WO2023224390A1

WO2023224390A1 - Antibody for regulating ccr7 activity

Info

Publication number: WO2023224390A1
Application number: PCT/KR2023/006705
Authority: WO
Inventors: 유연규; 장문성
Original assignee: 국민대학교 산학협력단
Priority date: 2022-05-19
Filing date: 2023-05-17
Publication date: 2023-11-23
Also published as: KR20230161759A

Abstract

The present invention relates to an antibody having an inhibitory activity against the signal transduction function of human CCR7. More specifically, the antibody exhibits the function of inhibiting the signal transduction process of CCR7, and thus can be effectively used as a therapeutic agent for cancer or cancer metastasis involving CCR7.

Description

Antibodies that regulate the activity of CCR7

The present invention relates to an antibody having the activity of inhibiting the signaling function of human CCR7 and a specific antibody of CCR7. More specifically, the antibody of the present invention can be used for the treatment of cancer diseases by inhibiting the signaling function of CCR7. .

CCR7 (CC chemokine receptor 7) is one of the chemokine receptors belonging to the rhodopsin-type G protein-coupled receptor (GPCR), which regulates the chemotactic process of lymphocytes in lymph nodes and promotes immunity by antigen-presenting cells (APC). Contributes to inducing tolerance. CCR7 is overexpressed in various metastatic cancers, including non-small cell lung cancer (NSCLC), B-cell chronic lymphocytic leukemia (BLL), lung cancer, pancreatic cancer, breast cancer, and hepatocellular carcinoma.

Additionally, CCR7 plays a key role in metastasis through activation of intracellular signaling pathways, including PI3/Akt, MAPK/ERK, and JAK/STAT pathways in cancer cells, activation of NF-κB, upregulation of MMP9, and upregulation of MMP9 in tumor-related leukocytes. Since it is known to induce endothelial mesenchymal transition, it is attracting attention as a major drug target.

The endogenous ligands of CCR7, CCL19 (C-C Motif Chemokine Ligand 19) and CCL21 (C-C Motif Chemokine Ligand 21), regulate the expression of cytokines and chemokines and induce changes in cAMP concentration through Gi-signaling mechanism. It is known to regulate various intracellular phenomena such as cell proliferation, apoptosis, migration, and invasion.

Despite the advantages of antibody drugs compared to small molecule synthetic drugs, such as high specificity, low side effects, high blood half-life, and defective cell death mechanism (ADCC, ADCP, CDC) by the Fc region, antibody drugs targeting CCR7 have not been commercialized. Even when expanded to all GPCRs, the only antibody drug approved for sale is Poteligeo (Mogamulizumab) from Kyowa Hakko Kirin, which targets CCR4. Therefore, the need to discover new antibodies that specifically bind to CCR7 and regulate its activity has emerged. In addition, in order to develop a new antibody drug targeting CCR7, it must first bind specifically to the extracellular domain (ECD) of the antigen, but the proportion of the extracellular domain of the total surface area of CCR7 is very limited, approximately 10%. am. In addition, because structural changes occur in CCR7 when binding to the CCL19/CCL21 ligand, there are limitations to the previously used antibody discovery strategy.

The matters described as the above background art are only for the purpose of improving the understanding of the background of the present invention, and should not be taken as an acknowledgment that they correspond to prior art already known to those skilled in the art.

The present inventors made diligent efforts to discover a new antibody that specifically binds to CCR7 and inhibits the signal transduction process. As a result, we designed a specific antibody screening strategy utilizing competitive binding between CCR7 and CCL19/CCL21, and used this to demonstrate binding activity in cell lines stably expressing CCR7, CCR7-dependent cAMP accumulation inhibitory activity, and ligand-mediated CCL19/CCL21 activity. The present invention was completed by confirming the cancer cell-dependent migration or invasion blocking activity by interfering with signal transduction.

Therefore, the purpose of the present invention is to provide an antibody or fragment thereof that recognizes CCR7 (CC chemokine receptor 7) as an antigen and specifically binds to it.

Another object of the present invention is to provide a nucleic acid molecule encoding the antibody or antigen-binding fragment thereof.

Another object of the present invention is to provide a vector containing the above nucleic acid molecule.

Another object of the present invention is to provide a host cell containing the vector.

Another object of the present invention is to provide a composition containing the monoclonal antibody, nucleic acid molecule, or vector.

Other objects and advantages of the present invention will become clearer from the following detailed description, claims, and drawings.

According to one aspect of the present invention, the present invention provides an antibody comprising heavy chain CDR1, CDR2, CDR3 and light chain CDR1, CDR2, CDR3, which recognizes CCR7 (CC chemokine receptor 7) as an antigen and specifically binds to it, or an antigen thereof. A binding fragment is provided.

As a result of efforts to discover a new antibody that specifically binds to CCR7 and inhibits the signal transduction process, the present inventors prepared CCR7, which stabilized the natural folded structure using the P9 protein of Pseudomonas phi6, as an antigen, and performed biopanning using this as an antigen. Through a primary screening method, antibodies showing competitive binding to CCR7 with CCL19 or CCL21 ligand were selected, and it was confirmed that this effectively inhibits the signaling function of CCR7.

According to a preferred embodiment of the present invention, the antibody or antigen-binding fragment thereof of the present invention binds specifically to the extracellular region of CCR7, rather than the intracellular region, as an antigen (e.g., epitope).

The present invention provides an antibody or antigen-binding fragment thereof comprising heavy chain CDR1, CDR2, and CDR3 and light chain CDR1, CDR2, and CDR3, which recognizes CCR7 (CC chemokine receptor 7) as an antigen and specifically binds to it.

The CCR7 (CC chemokine receptor 7) is responsible for the intracellular signaling process by binding to the ligand CCL19 or CCL21, and is attracting attention as an anti-cancer target material. However, antibodies that still recognize the extracellular portion of CCR7 as an antigen No drugs have been reported. The CCR7 (CC chemokine receptor 7) may preferably include the sequence of NCBI: NM_001838.4.

In the present invention, the antibody or antigen-binding fragment thereof can be used as a blocking antibody or antagonist antibody for CCR7, which means an antibody that inhibits or reduces the biological activity of the antigen to which it binds. A preferred blocking antibody or antagonist antibody may be one that substantially or completely inhibits the biological activity of the antigen.

As used herein, the term “epitope” refers to a localized site on an antigen to which an antibody or fragment thereof can specifically bind. For example, a continuous amino acid in an antigenic polypeptide can become an epitope, and two or more non-contiguous regions of the polypeptide can together become an epitope due to folding in the tertiary structure. Epitopes are at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 consecutive or discontinuous amino acids in the unique three-dimensional structure of the antigen. It can include at least 9 or more, at least 10 or more, at least 11 or more, at least 12 or more, at least 13 or more, at least 14 or more, or at least 15 or more. The antibody or antigen-binding fragment thereof of the present invention recognizes the extracellular portion of CCR7 (e.g., CC chemokine receptor 7) as an antigen and specifically binds to it, and specifically binds to one or more extracellular portions as an epitope. The epitope may include one or more amino acids.

Methods for determining the epitope to which an antibody or antigen-binding fragment thereof according to the present invention binds (e.g., epitope mapping) include various methods such as immunoblotting and immunoprecipitation tests through reactivity tests for antibodies. There is. Determination of the three-dimensional spatial structure of an epitope can be performed using various methods such as x-ray crystallography, 2-dimensional nuclear magnetic resonance, and HDX-MS. (Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66, G. E. Morris, Ed. (1996)).

According to a preferred embodiment of the present invention, the epitope to which the antibody or antigen-binding fragment thereof of the present invention can bind is determined by NMR spectroscopy, X-ray diffraction crystallography, ELISA analysis, and HDX-MS (hydrogen/deuterium exchange coupled with mass spectrometry). , array-based oligo-peptide scanning assays, and/or mutagenesis mapping (Giege R et al. , (1994) Acta Crystallogr D Biol Crystallogr 50 ( Pt 4): 339-350; McPherson A (1990) Eur J Biochem 189: 1-23; Chayen NE (1997) Structure 5: 1269-1274; McPherson A (1976) J Biol Chem 251: 6300-6303).

As used herein, the term “antibody” may be any type of immunoglobulin molecule (e.g., IgG, IgE, IgM, IgD, IgA, or IgY), or any subtype of antibody (e.g., human In mice, it may be IgG1, IgG2, IgG3, and IgG4; and in mice, it may be IgG1, IgG2a, IgG2b, and IgG3). Immunoglobulins (eg, IgG1) may exist in various allotypes, and the term “antibody” herein includes generally known isotypes and allotypes. Additionally, the term “antibody” herein may be IgG1, IgG2, IgG3, or IgG4, or a hybrid type thereof (e.g., a hybrid of IgG2 and IgG4).

As used herein, the term “monoglon antibody” or “monoclonal antibody” refers to an antibody that exhibits single binding specificity and affinity for a specific epitope.

In this specification, the monoclonal antibody is used to include its fragment, and the fragment preferably refers to an antigen binding fragment. The fragment can be prepared using various methods known in the art. For example, through proteolytic cleavage of immunoglobulin molecules using enzymes such as papain (production of Fab fragments) or pepsin (F(ab')2), Fab and F(ab')2 fragments. can be manufactured.

As used herein, the term "fragment" may be Fab, Fab', F(ab')2, Fv, scFV (single chain Fv), or scFv containing the VH or VL domain of a monomer, and the fragment may be Well known in the industry.

The antibody or antigen-binding fragment thereof of the present invention preferably has a heavy chain variable region selected from the group consisting of CDR1 of SEQ ID NO: 1 or 7, CDR2 of SEQ ID NO: 2 or 8, and CDR3 of SEQ ID NO: 3 or 9. It may include. The antibody has the activity of inhibiting at least one of CCR7-dependent intracellular signaling and CCR7 receptor internalization by any one CCR7 ligand selected from CCL19 and CCL21.

The antibody or antigen-binding fragment thereof of the present invention is an antigen-binding protein that specifically binds to CCR7, and may bind to primate CCR7, preferably human CCR7. The reference amino acid sequence of human CCR7 may be that indicated by NCBI: NM_001838.4,

The antibody or antigen-binding fragment thereof of the present invention is an antibody that can bind to CCR7 with excellent affinity, making it sufficiently effective as a diagnostic or therapeutic agent targeting CCR7. Preferably, the antibody according to the present invention may have low binding to non-CCR7 proteins and high binding to CCR7 proteins. For example, when measured by radioimmunoassay (RIA) or ELISA, antibodies binding to CCR7 have a high dissociation constant (K _D ) of 20 to 100 nM, preferably a dissociation constant (K _D ) of 20 to 50 nM. have

The antibody or antigen-binding fragment thereof of the present invention may affect at least one of killing, inducing apoptosis, blocking migration, blocking activation, blocking proliferation, and blocking proliferation of CCR7-expressing cells at the receptor. there is.

The antibody or antigen-binding fragment thereof of the present invention preferably has a light chain variable region selected from the group consisting of CDR1 of SEQ ID NO: 4 or 10, CDR2 of SEQ ID NO: 5 or 11, and CDR3 of SEQ ID NO: 6 or 12. It may include

The VH domain, or one or more CDRs, can be linked to the constant domain to form a heavy chain. Additionally, the VL domain, or one or more CDRs, can be linked to the constant domain to form a light chain. The full-length heavy chain and full-length light chain combine to make up a full-length antibody.

According to a preferred embodiment of the present invention, the antibody or antigen-binding fragment thereof may include any one CDR combination selected from the following group:

(A) The heavy chain variable region includes CDR1 of SEQ ID NO: 1, CDR2 of SEQ ID NO: 2, and CDR3 of SEQ ID NO: 3, and the light chain variable region includes CDR1 of SEQ ID NO: 4, CDR2 of SEQ ID NO: 5, and CDR3 of SEQ ID NO: 6. include;

(B) The heavy chain variable region includes CDR1 of SEQ ID NO: 1, CDR2 of SEQ ID NO: 2, and CDR3 of SEQ ID NO: 3, and the light chain variable region includes CDR1 of SEQ ID NO: 10, CDR2 of SEQ ID NO: 11, and CDR3 of SEQ ID NO: 12. include;

(C) The heavy chain variable region includes CDR1 of SEQ ID NO: 7, CDR2 of SEQ ID NO: 8, and CDR3 of SEQ ID NO: 9, and the light chain variable region includes CDR1 of SEQ ID NO: 4, CDR2 of SEQ ID NO: 5, and CDR3 of SEQ ID NO: 6. include; and

(D) The heavy chain variable region includes CDR1 of SEQ ID NO: 7, CDR2 of SEQ ID NO: 8, and CDR3 of SEQ ID NO: 9, and the light chain variable region includes CDR1 of SEQ ID NO: 10, CDR2 of SEQ ID NO: 11, and CDR3 of SEQ ID NO: 12. Includes.

According to a preferred embodiment of the present invention, the antibody or antigen-binding fragment thereof includes a heavy chain variable region of SEQ ID NO: 13 or 15 and a light chain variable region of SEQ ID NO: 14 or 16, and more preferably the heavy chain of SEQ ID NO: 13. Variable region and light chain variable region of SEQ ID NO: 14; Or it may include a heavy chain variable region of SEQ ID NO: 15 and a light chain variable region of SEQ ID NO: 16.

According to the most preferred embodiment of the present invention, the antibody or antigen-binding fragment thereof may include the amino acid sequence of SEQ ID NO: 17 or SEQ ID NO: 19.

The antibody or antigen-binding fragment thereof according to the present invention blocks binding of CCR7 to its ligand, thereby inhibiting biological activity, for example, the activity of inhibiting at least one of CCR7-dependent intracellular signaling and CCR7 receptor internalization by the CCR7 ligand. It may be.

Unlike CAP-100, which uses CCR7 as an antigen, the antibody or antigen-binding fragment thereof according to the present invention was developed using phage display using a human scFv library, and has a clear difference in that it is designing a fully human IgG ₄ antibody. . In addition, the antibody or antigen-binding fragment thereof according to the present invention has a significantly superior affinity of about 10 to 50 times more than that of CAP-100 (about 0.8 nM), and its antagonistic effect on cAMP accumulation is also quite effective.

Furthermore, unlike CAP-100, the antibody or antigen-binding fragment thereof according to the present invention binds to the extracellular region of CCR7, blocking ligand binding, metastasis and invasion of cancer cells, and blocking β-arrestin-mediated ERK1/2 phosphorylation. Because it has a significant effect, it has the activity of effectively blocking the movement of cancer cells overexpressing CCR7, so it can be used as a treatment for a wider range of metastatic cancers than CAP-100.

According to another aspect of the present invention, the present invention provides a nucleic acid molecule encoding the polypeptide, a vector containing the nucleic acid molecule, or a host cell containing the vector.

Nucleic acid molecules of the present invention may be isolated or recombinant and include single- and double-stranded forms of DNA and RNA as well as corresponding complementary sequences. “Isolated nucleic acid” means, in the case of a nucleic acid isolated from a naturally occurring source, a nucleic acid that has been separated from the surrounding genetic sequence present in the genome of the individual from which the nucleic acid was isolated. In the case of nucleic acids synthesized enzymatically or chemically from a template, such as PCR products, cDNA molecules, or oligonucleotides, the nucleic acids resulting from these procedures may be understood as isolated nucleic acid molecules. Isolated nucleic acid molecules refer to nucleic acid molecules either in the form of separate fragments or as components of larger nucleic acid constructs. A nucleic acid is “operably linked” when placed into a functional relationship with another nucleic acid sequence. For example, the DNA of the presequence or secretion leader is operably linked to the DNA of the polypeptide when the polypeptide is expressed as a preprotein in a form before secretion, and the promoter or enhancer is a polypeptide sequence. is operably linked to the coding sequence when it affects transcription, or the ribosome binding site is operably linked to the coding sequence when configured to facilitate translation. Generally, “operably linked” means that the DNA sequences to be linked are located adjacent to each other, and in the case of a secretory leader, it means that they are adjacent and exist within the same reading frame. However, enhancers do not need to be located adjacently. Linking is accomplished by ligation at convenient restriction enzyme sites. If such sites do not exist, synthetic oligonucleotide adapters or linkers are used according to conventional methods.

As used herein, the term “vector” refers to a carrier capable of inserting a nucleic acid sequence for introduction into cells capable of replicating the nucleic acid sequence. Nucleic acid sequences may be exogenous or heterologous. Vectors include, but are not limited to, plasmids, cosmids, and viruses (eg, bacteriophages). Those skilled in the art can construct vectors by standard recombination techniques (Maniatis, et al., Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, Cold Spring Harbor, N.Y., 1988; and Ausubel et al., In: Current Protocols in Molecular Biology, John, Wiley & Sons, Inc, NY, 1994, etc.).

As used herein, the term “expression vector” refers to a vector containing a nucleic acid sequence encoding at least a portion of the gene product to be transcribed. In some cases, the RNA molecule is then translated into a protein, polypeptide, or peptide. Expression vectors may contain various control sequences. In addition to regulatory sequences that regulate transcription and translation, vectors and expression vectors may also contain nucleic acid sequences that also serve other functions.

As used herein, the term “host cell” includes eukaryotes and prokaryotes, and refers to any transformable organism capable of replicating the vector or expressing the gene encoded by the vector. The host cell may be transfected or transformed by the vector, which refers to a process in which an exogenous nucleic acid molecule is transferred or introduced into the host cell.

Host cells of the present invention preferably include bacterial cells, CHO cells, HeLa cells, HEK293 cells, BHK-21 cells, COS7 cells, COP5 cells, A549 cells, NIH3T3 cells, etc., but are not limited thereto. no.

According to a preferred embodiment of the present invention, the host cell is an isolated host cell.

According to another aspect of the present invention, the present invention provides a composition comprising the antibody or antigen-binding fragment thereof, the nucleic acid molecule, or the vector.

According to a preferred embodiment of the present invention, the composition of the present invention is a pharmaceutical composition for preventing or treating cancer, and a pharmaceutical composition for preventing or treating metastasis of cancer.

The pharmaceutical composition of the present invention includes (a) the antibody or fragment thereof, the nucleic acid molecule, or a vector containing the nucleic acid molecule; and (b) a pharmaceutically acceptable carrier.

According to another aspect of the present invention, the present invention provides a method for preventing or treating cancer, and a method for preventing or treating metastasis of cancer, including the step of administering the pharmaceutical composition to a subject in need thereof.

The type of cancer that the present invention aims to prevent or treat is not limited, and includes leukemias, acute lymphocytic leukemia, acute nonlymphocytic leukemias, chronic lymphocytic leukemia, chronic Lymphomas, such as chronic myelogenous leukemia, Hodgkin's disease, non-Hodgkin's lymphomas, and multiple myeloma, brain tumors, and glioblastoma , childhood solid tumors such as neuroblastoma, rhabdomyosarcoma, retinoblastoma, Wilms Tumor, bone tumors, and soft-tissue sarcomas. tumors, lung cancer, breast cancer, prostate cancer, urinary cancers, uterine cancers, oral cancers, pancreatic cancer, melanoma ( melanoma and other skin cancers, stomach cancer, ovarian cancer, brain tumors, liver cancer, laryngeal cancer, thyroid cancer, and esophageal cancer. It can be administered to treat a number of cancers, including common solid tumors in adults, such as cancer and testicular cancer.

In particular, the pharmaceutical composition of the present invention can provide a preventive or therapeutic effect on cancer metastasis by inhibiting the migration and invasion of cancer cells.

In the present invention, the term “cancer metastasis” refers to cancer cells leaving the primary organ, moving to another organ, and proliferating. The spread of cancer to other parts of the body is largely divided into two types: cancer tissue grows from the primary cancer and directly invades surrounding organs, and distant metastasis occurs along blood vessels or lymphatic vessels to other distant organs.

The metastatic cancer is formed by spreading through blood circulation or lymph circulation, and usually moves to other organs through blood circulation and then grows into a new tumor. Cancer cells attached to it can also be formed by moving directly to neighboring tissues. In the present invention, cancer metastasis includes both the spread of cancer cells by invasion where cancer cells directly move and penetrate neighboring tissues, and metastasis in which cancer cells move through the bloodstream and form a new tumor in an organ that is not physically adjacent to the primary cancer. do. Meanwhile, in cancer metastasis, cell movement is essential. Therefore, inhibiting the movement of these cancer cells is the primary way to prevent cancer metastasis.

In addition, in cancer metastasis, cell movement is involved in several stages, such as when cancer cells move from the initial primary cancer site through the extracellular matrix into blood vessels, when they move out of blood vessels from a second metastatic tissue, and into new blood vessels. The process is very complex and has various functions, including involvement in the movement of vascular endothelial cells. Therefore, considering that general anticancer drugs have the effect of simply killing cancer cells or inhibiting the proliferation of cancer cells, the use for inhibiting cancer metastasis can be distinguished separately from the simple anticancer use.

Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in preparation, and include lactose, dextrose, sucrose, sorbitol, mannitol, starch, gum acacia, calcium phosphate, alginate, gelatin, Includes, but is limited to, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. It doesn't work. In addition to the above ingredients, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

The pharmaceutical composition of the present invention can be administered orally or parenterally, preferably parenterally, for example, by intravenous injection, local injection, and intraperitoneal injection.

The appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as formulation method, administration method, patient's age, weight, sex, pathological condition, food, administration time, administration route, excretion rate, and reaction sensitivity. Usually, a skilled physician can easily determine and prescribe an effective dosage for the desired treatment or prevention. According to a preferred embodiment of the present invention, the daily dosage of the pharmaceutical composition of the present invention is 0.0001-100 mg/kg.

The pharmaceutical composition of the present invention is prepared in unit dosage form by formulating it using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by a person skilled in the art. Alternatively, it can be manufactured by placing it in a multi-capacity container. At this time, the formulation may be in the form of a solution, suspension, or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet, or capsule, and may additionally contain a dispersant or stabilizer.

In the present invention, the term "subject" refers to an individual who needs to administer the composition of the present invention, and may be a human, mammal, bird, reptile, or fish, and preferably may be a mammal including a human.

The pharmaceutical composition of the present invention can be used as a stand-alone therapy, but can also be used in combination with other conventional chemotherapy or radiotherapy, and when such a combination therapy is performed, cancer treatment can be performed more effectively. Chemotherapeutic agents that can be used with the composition of the present invention include cisplatin, carboplatin, procarbazine, mechlorethamine, cyclophosphamide, and ipo. ifosfamide, melphalan, chlorambucil, bisulfan, nitrosourea, dactinomycin, daunorubicin, doxorubicin , bleomycin, plicomycin, mitomycin, etoposide, tamoxifen, taxol, transplatinum, 5-fluoro Includes 5-fluorouracil, vincristin, vinblastin, and methotrexate. Radiation therapy that can be used with the composition of the present invention includes X-ray irradiation and γ-ray irradiation.

According to another aspect of the present invention, the present invention provides a method for quantifying CCR7 contained in a sample, comprising treating the sample with an antibody or antigen-binding fragment thereof.

Since the antibody or antigen-binding fragment thereof of the present invention specifically binds to CCR7, the amount of CCR7 contained in a sample can be accurately measured using it.

The sample is not limited, but is preferably a sample separated outside the body from a subject, and more preferably a sample of blood, plasma, saliva, hair, urine, stool, or tissue separated outside the body from a subject.

According to another aspect of the present invention, there is provided a method of providing information for diagnosis of a disease caused by overexpression of CCR7, comprising the following steps:

(a) obtaining a sample separated from the subject in vitro;

(b) treating the sample with the antibody or antigen-binding fragment thereof; and

(c) Confirming whether the expression level of CCR7 included in the subject's sample is higher than the expression level of CCR7 included in the normal group sample.

The CCR7 controls cell migration to chemokine expression sites such as lymph nodes and the central nervous system by binding to the ligands CCL19 and/or CCL21; It is overexpressed in various cancers such as bladder cancer, lung cancer, ovarian cancer, kidney cancer, colon cancer, prostate cancer, breast cancer, uterine cancer, rhabdomyosarcoma, and glioblastoma, and is directly involved in major cancer progression processes such as proliferation, migration, invasion, and metastasis of cancer cells. Because it is involved, by comparing the expression level of CCR7 with that of normal people, information can be provided for diagnosis of diseases caused by overexpression of CCR7.

According to a preferred embodiment of the present invention, the disease caused by overexpression of CCR7 may be cancer, preferably metastatic cancer.

According to another aspect of the present invention, the present invention provides a CCR7 quantitative kit comprising the antibody or antigen-binding fragment thereof.

The quantitative kit of the present invention can quantify the amount of CCR7 by analyzing the antigen for the antibody through an antigen-antibody binding reaction, and the antigen-antibody binding reaction can be performed using conventional ELISA (Enzyme-linked immunosorbent assay), RIA (Radioimmnoassay), It is preferably selected from the group consisting of Sandwich assay, Western Blot on polyacrylamide gel, Immunoblot assay, and Immunohistochemical staining, but is not limited thereto.

The fixture for the antigen-antibody binding reaction consists of a nitrocellulose membrane, a PVDF membrane, a well plate synthesized from polyvinyl resin or polystyrene resin, and a slide glass made of glass. Any selected from the group may be used, but are not limited thereto.

The secondary antibody is preferably labeled with a common coloring agent that produces a color reaction, such as HRP (Horseradish peroxidase), alkaline phosphatase, colloid gold, or FITC (Poly L-lysine-fluorescein isothiocyanate). ), RITC (Rhodamine-B-isothiocyanate), etc. Any label selected from the group consisting of a fluorescent substance (Fluorescein) and a dye (Dye) may be used. The substrate that induces color development is preferably used according to the label that produces the color reaction, such as TMB (3,3',5,5'-tetramethyl bezidine), ABTS [2,2'-azino-bis (3-ethylbenzothiazoline), -6-sulfonic acid)] and OPD (ophenylenediamine), but it is not limited thereto.

The features and advantages of the present invention are summarized as follows:

(i) The present invention provides an antibody or antigen-binding fragment thereof that recognizes the extracellular region of CCR7 as an antigen and specifically binds to it.

(ii) In addition, the present invention discovers an antibody that specifically binds to the extracellular region while maintaining the structural characteristics of CCR7, showing the function of inhibiting the signaling process of CCR7 even in practical applications, and using this function to suppress CCR7 It can be useful as a treatment for cancer or metastasis of cancer.

Figure 1a shows purified functional P9-CCR7, and shows the results of analyzing samples obtained at each purification step by SDS-PAGE using Coomassie staining. In Figure 1a, M is the size marker, Load is the solubilized membrane fraction treated with 1% sarkosyl, FT is the flow-through through Ni-NTA chromatography, and W1 and W2 are 0 and 5mM, respectively. This is the wash fraction obtained by treatment with a washing buffer containing dazole, and E is the elution fraction obtained from Ni-NTA chromatography each treated with an elution buffer containing 20mM imidazole.

Figure 1b is a graph showing P9-CCR7 purified using a Ni-NTA affinity column, stabilized by treatment with APG, and then further purified using size exclusion chromatography. In Figure 1b, ① is the monodisperse peak of P9-CCR7 stabilized with APG, and ② is the peak that appears when free APG is separated.

Figure 1c shows the results of ELISA analysis of the activity of P9-CCR7, plates treated with 5% skimmed milk blocking solution (brown diamond); Alternatively, prepare a plate immobilized with 10 μg/ml of CCL19-His-FLAG (blue circle) or 10 μg/ml of CCL21-His-FLAG (orange square), and then add P9-CCR7 at various concentrations (1 to 500 nM). was applied. The amount of P9-CCR7 binding to the ligand was measured using an anti-P9 antibody and an anti-mouse Fc antibody bound to HRP.

Figure 1d shows the results of ELISA analysis of the specific binding activity of the ligand, showing plates treated with 3% BSA blocking solution (red triangle); Alternatively, plates immobilized with 5 μg/ml APG:P9 (purple square) or 5 μg/ml P9-CCR7 (blue or orange circle) were prepared, and various concentrations (15-1000 nM) of CCL19-His were added thereto. -FLAG or CCL21-His-FLAG was applied. The amount of ligand binding to P9-CCR7 was measured using an anti-FLAG antibody and an anti-mouse Fc antibody coupled to HRP.

Figure 2a shows the results of screening of scFv clones specific for CCR7. This is the result of analyzing the specificity of scFv for CCR7 for the 16 initially selected clones by ELISA.

Figure 2b is a graph showing the results of treating scFv at each concentration with 100 nM CCL19-His-FLAG and analyzing it by ELISA. Blue circles and green squares represent signals by scFv 6RG11 and scFv 72C7, respectively.

Figure 2c is a graph showing the results of treating P9-CCR7 with 0 to 500 nM scFv and analyzing it by ELISA. Blue circles and green squares represent signals by scFv 6RG11 and scFv 72C7, respectively.

Figure 3a shows the results of SDS-PAGE analysis of purified IgG ₄ (6RG11) and IgG ₄ (72C7). In Figure 3a, M is a size marker, NR is 6 μg of IgG ₄ loaded under non-reducing conditions, and R is 6 μg of IgG ₄ loaded under reducing conditions using 1mM DTT.

Figure 3b shows the results of ELISA analysis of the specific binding of human IgG ₄ (6RG11) and human IgG ₄ (72C7) to CCR7.

Figure 3c is a graph showing the results of flow cytometry analysis of the specific binding of human IgG ₄ (6RG11) to CCR7.

Figure 3d is a graph showing the results of flow cytometry analysis of the specific binding of human IgG ₄ (72C7) to CCR7.

Figures 4 and 5 are graphs showing the results of analyzing the antagonistic activity of IgG ₄ on the ligand effect through cAMP assay, Figure 4a is a graph measuring the effect of CCL19 ligand on HEK293 cells expressing CCR7, and Figure 4b is a graph This is a graph measuring the effect of CCL21 ligand on HEK293 cells expressing CCR7, Figure 4c is a graph measuring the effect of CCL19 ligand on MDA-MB-231 cells expressing CCR7, and Figure 4d is a graph measuring the effect of CCL19 ligand on MDA-MB-231 cells expressing CCR7. This is a graph measuring the effect of CCL21 ligand on MDA-MB-231 cells.

Figure 5a is a graph measuring the effect of IgG4 (6RG11) clone on CCL19 ligand in HEK293 cells expressing CCR7, and Figure 5b is a graph measuring the effect of IgG4 (6RG11) clone on CCL21 ligand in HEK293 cells expressing CCR7. It is a graph, and Figure 5c is a graph measuring the effect of IgG4 (6RG11) clone on CCL19 ligand in MDA-MB-231 cells expressing CCR7, and Figure 5d is a graph measuring the effect of CCL21 in MDA-MB-231 cells expressing CCR7. This is a graph measuring the effect of IgG4 (6RG11) clone on the ligand.

Figure 6 is a photograph showing the effect of IgG ₄ (6RG11, 72C7) on CCR7-dependent invasion induced by CCL19 ligand in MDA-MB-231 cells expressing CCR7.

Figure 7 is a photograph showing the effect of IgG ₄ (6RG11, 72C7) on CCR7-dependent invasion induced by CCL21 ligand in MDA-MB-231 cells expressing CCR7.

Figure 8 is a graph showing the number of migrated cells measured from Figures 6 and 7, suggesting migration inhibition by IgG4 (6RG11, 72C7). Figure 8a shows the number of migrated cells in MDA-MB-231 cells expressing CCR7 to CCL19 ligand. Figure 8b is a graph measuring the effect of the IgG4 (6RG11) clone on CCL19 ligand in MDA-MB-231 cells expressing CCR7, and Figure 8c is a graph measuring the effect of the IgG4 (72C7) clone on CCR7. This is a graph measuring the effect of the IgG4 (6RG11) clone on the CCL21 ligand in MDA-MB-231 cells expressing CCR7, and Figure 8d is a graph measuring the effect of the IgG4 (72C7) clone on the CCL21 ligand in MDA-MB-231 cells expressing CCR7. This is a graph measuring the impact.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention.

실시예Example

실험재료experiment material

The DNA sequence representing the CCR7 coding region is designated as NCBI: NM_001838.4, and was designed as the coding optimization sequence of E. coli . The coding sequence of CCL19 or CCL21 is indicated as NCBI: NM_006274.3 and NCBI: NM_002989.4, and is a sequence with FLAG and 6X His-tag, and was designed as a mammalian codon-optimized sequence. The designed DNA sequences were synthesized by LNC Bio (Korea). The mammalian expression vector of CCR7 was purchased from Sino Biological (China). Restriction enzymes, DNA polymerase, and T4 DNA ligase were purchased from New England Biolabs (NEB) (UK). Amphipathic polyglutamate (APG) was obtained from MPRAB (Korea). The synthetic scFv-displayed M13 library was provided by Dr. Ewha University. It was used as provided by Shim. CCL19 and CCL21 were purchased from Peprotech (USA). HRP-conjugated anti-mouse IgG was purchased from Sigma (USA), and Ni-NTA resin was purchased from Qiagen (Germany). The HiLoad superdex 200 16/600 PG column was obtained from GE Healthcare (USA). CNBr-activated sepharose 4B was purchased from GE Healthcare (USA). Isopropyl-β-D-thiogalactoside (IPTG), phenylmethylsulfonyl fluoride (PMSF), and sarkosyl were purchased from Sigma (USA). EDTA-free protease inhibitor cocktail was purchased from GenDEPOT (USA). In addition, all consumable reagents were of reagent grade, and GraphPad Prism 8 software was used for data analysis.

<실시예 1> P9-CCR7, CCL19, CCL12 및 IgG4 발현벡터 제조<Example 1> Preparation of P9-CCR7, CCL19, CCL12 and IgG4 expression vectors

1) P9-CCR7 발현벡터 제조1) Preparation of P9-CCR7 expression vector

The DNA sequence representing the coding region of CCR7 was amplified through PCR reaction using forward primer (5'TATTTTCAGTCGACGATGGAATTCATGGATCTGGGTAAACCAATGAAG ?? 3'; SEQ ID NO. 21) and reverse primer (5' - GTGATGGTGAGAAGCTTCGAATTCTGGAGAAAAGGTGGTAGTAGTTTC ?? 3'; SEQ ID NO. 22). did. The PCR amplification product was purified using the QIAquick® PCR Purification Kit (Qiagen, Germany) and digested using restriction enzymes Sal I and Hind III . This was purified using the QIAquick® PCR Purification Kit and then ligated to the Sal I and Hind III sites of the pP9 vector. At this time, the pP9 vector required for antibody discovery was referenced in the paper by Kwangkyu Lee, et al. (Purification and characterization of recombinant human endothelin receptor type A, Protein expression and purification 2012; 84(1): 14-18).

2) CCL19 및 CCL12 발현벡터 제조2) Preparation of CCL19 and CCL12 expression vectors

A DNA fragment representing the coding region of CCL19 or CCL21 with FLAG and 6 23) and reverse primer (5'-CCGGCCTTGCCGGCCTCGAGTCATTACTTGTCGTCATCGT - 3'; SEQ ID NO. 24), forward primer of CCL21 (5'-TCCAGCCTC CGGACTCTAGAGCCGCCACCATGGCTCAGTC-3'; SEQ ID NO. 25) and reverse primer (5'-ATCCGG CCTTGCCGGCCTCGAGTCATTACTTGTCGTCATC-3'; SEQ ID NO: 26)

The PCR amplification product was purified using the QIAquick® PCR Purification Kit and ligated into the Xba I and Xho I sites of pCDNA 3.4 vector (NEB, UK).

3) IgG4 발현벡터 제조3) Production of IgG4 expression vector

Sequences encoding the variable regions VL and VH were amplified through PCR reaction. The signal sequence for each light chain and heavy chain was the light chain signal sequence (5'-GCCGCCACCATGGCCGGCTTCCCTCTCCTCCTCACCCTCCTCACTCACTGTGCAGGATCCTGGGCCCAGTCTGTGCTGACTCAGCCACCC-3'; SEQ ID NO. 27) and heavy chain signal sequence (5'- GCCGCCACCATGGAGTTTGGGCTGAGCTGGCTTTTTCTTGTGGCTATTTTAAAAGGTGTCCAGTGTGAGGTGCAGCTGTTGGAGTCTGGG-3'; SEQ ID NO. 28) through an overlap extension PCR reaction. This was commissioned by Cosmogenetech (Korea) to produce a synthetic oligomer. Each product was purified using a gel extraction kit (Qiagen, Germany), and in the pTRIOZ-hIgG4(S228P) vector (Invivogen, USA), VL was linked to the Sgr AI and Kpn I sites, and VH was linked to Nhe I and Age I. connected to the area. At this time, NEBuilder® HiFi DNA Assembly (NEB, UK) was used.

<실시예 2> P9-CCR7 정제<Example 2> P9-CCR7 purification

E. coli BL21(DE3)-RIPL cells containing the pP9-CCR7 vector were cultured using a bioreactor (Marado-PDA, CNS, Korea). When the OD ₆₀₀ of the culture was 60, the expression of P9-CCR7 was induced by adding 1 mM IPTG for 21 hours at 18°C. The cells were recovered through centrifugation and stored at -80°C. 20 g of the cell paste was redispersed in 100 ml of buffer A (25 mM HEPES, pH 7.0) containing 1 mM PMSF and 1 tablet of EDTA-free protease inhibitor cocktail, and incubated with microfluidics (model and company) was used to dissolve it. Cell debris was removed by centrifugation at 12,000 xg for 30 minutes, and the supernatant was further centrifuged at 100,000 xg for 1 hour to precipitate as a membrane fraction.

The membrane fraction was placed in buffer B (25mM HEPES pH 7.0, 1% sarkosyl), dissolved by gentle stirring for 2 hours at 4°C, and then centrifuged at 15,000 x g for 30 minutes to remove precipitates. . The membrane fraction solution was loaded onto a Ni-NTA column equilibrated with buffer A, and bound P9-CCR7 was eluted with 20mM imidazole. 1% APG was added to the elution fraction and mixed for 16 hours at 4°C. P9-CCR7 was stabilized with APG, further purified by size exclusion chromatography (HiLoad superdex 200 16/600 PG) equilibrated with buffer A, and stored at -80°C.

<실시예 3> CCL19 및 CCL21 정제<Example 3> CCL19 and CCL21 purification

Expi 293 ^cells ( ³ × ¹⁰ ⁶ cells/mL) (ATCC, USA) were transfected in 50 ml. The transfected cells were cultured until cell viability reached at least 60% and harvested by centrifugation at 2000 xg at 4°C for 20 minutes.

The supernatant was filtered using a syringe filter (PES, Pore 0.22 μm) (Sartorius, USA), and filtered using DPBS (137 mM NaCl, 2.7 mM KCl, Na ₂ HPO ₄ 10 mM, KH ₂ PO ₄ 1.8 mM, pH 7.4) was loaded onto a Ni-NTA column equilibrated.

After washing the column using an imidazole concentration gradient, the target protein was eluted using 100 and 200 mM imidazole in equilibration buffer. The purified protein was desalted with DPBS and 10% glycerol using a Pd-10 column (GE Healthcare, USA), and the eluted protein was stored at -80°C.

<실시예 4> APG에 의하여 능동적으로 접힌 구조를 갖는 P9-CCR7의 제조<Example 4> Preparation of P9-CCR7 with an actively folded structure by APG

The P9 expression system in E. coli was successfully applied for the expression of human CCR7. The P9 sequence is in a transversal form and helps CCR7 expression in the plasma membrane of E. coli . In the membrane fraction of 1 g of wet E. coli cells, 0.8 mg of P9-CCR7 was expressed (Western blot data as supplementary data). In the membrane fraction obtained from 20 g of wet cells, P9-CCR7 was efficiently solubilized with sarkosyl, and 8 mg of P9-CCR7 was purified using a Ni-NTA affinity column (Figure 1a). As a result, it was confirmed that it was successfully purified.

Next, APG-stabilized P9-CCR7 stabilized by treatment with APG was measured by gel filtration chromatography, and a monodisperse peak (Molecular Weight: 347 kDa) and separated free APG (Molecular Weight: 30 kDa) were confirmed ( Figure 1b). It was confirmed that 5 mg of P9-CCR7 stabilized by binding to the final APG was purified from the membrane fraction of E. coli . This means that P9-CCR7 expressed in 20 g of wet cells was 31%.

In other words, it was confirmed that full-length hCCR7 could be purified from E. coli and successfully produce APG:P9-CCR7 using P9 and APG polymer.

<실시예 5> P9-CCR7에 대한 CCL19 및 CCL21의 친화도 측정(Affinity determination)<Example 5> Affinity determination of CCL19 and CCL21 for P9-CCR7

In order to confirm whether the purified P9-CCR7 was in an appropriately folded form, the binding affinity between the purified P9-CCR7 and the ligand was measured using ELISA.

Specifically, the purified CCL19-His-FLAG and CCL21-His-FLAG were immobilized on a Maxi-binding 96-well plate (SPL, USA). Each well was blocked with DPBS containing 5% skimmed milk, and then purified P9-CCR7 was added to the plate at various concentrations. The plate was then sequentially treated with anti-P9 antibody, HRP-conjugated anti-mouse IgG, ultra TMB (Thermo fisher scientific), and 1 N HCl. The amount of P9-CCR7 bound to the ligand was measured using a Synergy H1 (BioTek, USA) microplate reader (Figure 1c).

The interaction between the purified P9-CCR9 and CCL19 or CCL21 was measured using a modified ELISA method. 500 ng of purified P9-CCR7 was immobilized in a Maxi-bound 96-well plate. The plates were then washed, blocked, and treated with various concentrations of CCL19-His-FLAG or CCL21-His-FLAG. The plate was sequentially treated with anti-FLAG M2 antibody (Sigma-Aldrich, USA), HRP-conjugated anti-mouse IgG, ultra TMB (Thermo Fisher Scientific), and 1 N HCl. The amount of P9-CCR7 bound to the ligand was measured using a microplate reader (Figure 1d).

Figure 1c shows the results of ELISA analysis of the activity of P9-CCR7, plates treated with 5% skimmed milk blocking solution (brown diamond); Alternatively, plates immobilized with 10 μg/ml of CCL19-His-FLAG (blue circle) or 10 μg/ml of CCL21-His-FLAG (orange square) were prepared, and various concentrations (1 to 500 nM) of P9- CCR7 was applied. The amount of APG:P9-CCR7 binding to the ligand was measured using an anti-P9 antibody and an anti-mouse Fc antibody conjugated to HRP.

Figure 1d shows the results of ELISA analysis of the specific binding activity of the ligand, showing plates treated with 3% BSA blocking solution (red triangle); Alternatively, prepare plates immobilized with 5 μg/ml APG:P9 (purple squares) or 5 μg/ml P9-CCR7 (blue or orange circles), and then add CCL19-His- at various concentrations (15 to 1000 nM). FLAG or CCL21-His-FLAG was applied. The amount of ligand binding to P9-CCR7 was measured using an anti-FLAG antibody and an anti-mouse Fc antibody coupled to HRP.

As shown in Figures 1c and 1d, the dissociation constants (K _D s) of CCL19 or CCL21 with respect to purified P9-CCR7 were measured to be 19 nM and 11 nM, respectively. This confirmed that it was similar to the EC ₅₀ value measured by BRET (bioluminescence resonance energy transfer) analysis using CCR7+ cells. Therefore, this indicates that the CCR7 region of the P9-CCR7 fusion protein has a native form and is highly suitable for ligand binding. The purified protein was used as an antigen for the biopanning process.

<실시예 6> CCR7에 특이적 항체 발굴<Example 6> Discovery of antibodies specific to CCR7

1) 바이오패닝을 통한 항체 발굴(1차 선별)1) Antibody discovery through biopanning (primary screening)

We attempted to discover CCR7-specific antibodies using the biopanning technique of the synthetic scFv phage library using the immobilized P9-CCR7. For this purpose, first, the purified P9-CCR7 was immobilized on the bead surface using CNBr-activated Sepharose resin (Cytiva, USA) according to the manufacturer's instructions. Briefly, the resin powder (40 μl) was rinsed with 1 mM HCl (pH 3.0), washed with binding buffer (100 mM sodium bicarbonate pH 8.2), and incubated with purified P9-CCR7 (0.2 mg) at 4 °C. was cultured overnight. The resin on which P9-CCR7 was immobilized was treated with termination buffer (100 mM Tris-Cl pH 8.0) at room temperature for 1 hour, and washed with DPBS (Dulbecco's phosphate buffered saline) using a centrifuge tube filter (Corning, USA). did. The first step of biopanning begins with incubating 20 μl of P9-CCR7 immobilized beads with 0.20 ml of scFv-displaying M13 phage library (~1 × 10 ¹² CFU/ml) for 14 hours at 4°C. Next, the unbound phage was washed three times with DPBS, and the bound phage was eluted by incubating with 200 μl of elution buffer (100mM glycine pH 2.2, 1% BSA) at room temperature for 10 minutes, and neutralization buffer (1 M Tris-Cl). , pH 8.0) was treated with 40 μl. Infection of eluted phage into ER2738 cells and rescue process of eluted phage using M13K07 helper phage were performed as described in Yang, HY, et al. [Yang, HY, et al., Construction of a large synthetic human scFv library with six diversified CDRs. and high functional diversity. Mol Cells, 2009. 27(2): p. 225-35.]. The biopanning process using the eluted phage was repeated while increasing the number of washes. In the 4th to 7th panning steps, P9-GLP1R (0.1 mg/ml) along with the phage solution was added to the P9-CCR7-immobilized beads to prevent enrichment of P9-specific phage. A total of 384 clones were initially selected through the above-described process (Table 1).

2) CCR7에 특이적 scFv 클론 스크리닝(2차 선별)2) CCR7-specific scFv clone screening (secondary screening)

After biopanning, the eluted phage was infected with mid-log phase ER2738, and the infected cells were spread on LB/Agar plates containing carbenicillin. A single colony was inoculated in 750 ㎕ of SB medium containing carbenicillin in a deep 96-well plate, and then cultured at 37°C for about 4 hours until it became turbid. IPTG at a final concentration of 1 mM was added and cultured with shaking at 180 rpm and 30°C overnight. The deep well plate was centrifuged at 3,500 x g for 20 minutes, the supernatant was removed, and cooled on ice. To recover the periplasmic fraction containing scFv, the cell pellet was resuspended in 160 μl of 1X TES (50 mM Tris-Cl pH 8.0, 1 mM EDTA, 20% sucrose) buffer and 0.2 240 μl was added. After incubation on ice for 30 minutes, the plate was centrifuged to obtain a periplasmic fraction. 100 ㎕ of the periplasmic extract was applied to each target GPCR-immobilized 96 well Maxi binding plate and incubated at room temperature for 1 hour. Next, antigen-binding clones were selected by sequentially treating HRP-conjugated anti-HA antibody (1:3000 dilution), TMB solution, and 1N HCl solution. Among the 384 clones obtained from step 1), 50 hit clones binding to the antigen were isolated, and among these, 16 unique clones were confirmed through sequence analysis (Table 1).

3) scFv 정제 및 CCR7에 대한 특이적 scFv 발굴(3차 선별)3) Purification of scFv and discovery of scFv specific for CCR7 (3rd screening)

Among the 16 clones selected secondarily, we attempted to discover a specific scFv for CCR7. For this purpose, scFv was purified from 16 secondary selected clones. Plasmid DNA extracted from individual cultured cells was transformed into TOP10F competent cells. 10 ml of seed culture was incubated overnight at 37°C in SB medium containing 0.05 mg/ml carbenicillin. The culture was transferred to 500 mL of SB medium containing carbenicillin and incubated at 37°C until the OD ₆₀₀ reached 0.6-0.8. After adding a final 1mM of IPTG to the culture, it was further incubated at 30°C overnight. Cells were harvested by centrifugation at 3,500 xg for 20 minutes and the supernatant was discarded. 35 ml of cold 1X TES buffer was added to the cell pellet and resuspended. Then, 0.25 ml of lysozyme (40 mg/ml) was added to the cells and the mixture was placed on ice for 30 min. EDTA in the mixture was inactivated by adding 0.25 ml of 1M MgCl ₂ and incubated on ice for 10 minutes. The solution was centrifuged at 10,000 xg for 20 min, the supernatant was loaded into 1 ml of Ni-NTA resin pre-equilibrated with DPBS, and the mixture was incubated at 4°C for 1 h. The reacted resin was packed in a 5ml disposable column (Thermo Scientific, USA) and washed with 10ml of DPBST (0.05% Tween-20) containing 5mM imidazole. ScFv was eluted with 5 ml of DPBS containing 200mM imidazole, and the eluate was analyzed by SDS-PAGE.

16 types of scFv (500 nM) purified through the above-described process were treated with APG:P9-CCR7 or APG:P9-GLP1R, respectively, and the bound scFv was detected using an HRP-conjugated anti-HA antibody. More specifically, the specificity between CCR7 and 16 scFvs was analyzed through ELISA. Purified P9-CCR7 (500 ng) or P9-GLP1R (500 ng) was immobilized on a 96-well Maxi binding plate and treated with 3% BSA. Next, each of the 16 types of scFv (500 nM) was treated and incubated at room temperature for 1 hour. To measure the amount of scFv bound to CCR7 or GPCR, HRP-conjugated anti-HA antibody (1:3000 diluted) was used.

Figure 2a shows the results of screening of scFv clones specific for CCR7, and is the result of analyzing the specificity of scFv for CCR7 for 16 types of clones by ELISA. The bar graph in Figure 2A represents the signal of APG:P9-CCR7 divided by the signal of APG:P9-GLP1R.

As shown in Figure 2a, the 16 types of scFv specifically bound to P9-CCR7 and P9-GLP1R, but the absorption values of scFv for APG:P9-CCR7 were compared to those for APG:P9-GLP1R. When divided by the absorption values of scFv, it was confirmed that only 7 clones had a total of 2 or more (6RG8, 6RG11, 7RB11, 7RD10, 72C1, 72C7, 72G8). Only 7 clones were selected as they were found to form superior specific binding to P9-CCR7 compared to P9-GLP1R.

4) 최종 선별4) Final selection

In order to analyze the competitor characteristics of the seven scFvs selected for the third time with the CCL19 ligand, an epitope overlapping with the extracellular region of CCR7, which plays an important role in the binding of CCL19, was selected. Antibodies were identified. Competitive ELISA was performed using P9-CCR7 and purified scFv in the presence of CCL19-His-FLAG.

Specifically, purified P9-CCR7 was immobilized on a 96-well Maxi binding plate and then treated with 3% BSA. After washing three times with DPBS, scFv at various concentrations (4~3000 nM) was treated and incubated at room temperature for 30 minutes. DPBS mixed with CCL19-His-FLAG was treated to a final concentration of 100 nM, and further incubated at room temperature for 30 minutes. After washing with DPBS, the cells were treated with monoclonal ANTI-FLAG® M2 antibody (Thermo Fisher Scientific, USA) (1:1000 diluted in DPBS) and incubated for 1 hour at room temperature. Washed with DPBST (0.05% Tween-20), sequentially treated with HRP-conjugated anti-Mouse Fc antibody (1:5000 dilution in DPBST), TMB solution, 1N HCl, and CCL19-His conjugated to P9-CCR7. -FLAG was detected.

Figure 2b is a graph showing the results of treating scFv (6RG11, 72C7) at different concentrations with 100 nM CCL19-His-FLAG and analyzing it by ELISA. As shown in Figure 2b, among the seven types of scFvs, only two types of scFvs (6RG11, 72C7) formed CCL19-competitive binding to CCR7. Accordingly, two types of clones (6RG11, 72C7) were finally selected according to the ELISA graph for scFv (6RG11, 72C7).

Through the above-described process, a total of 384 clones were first screened, 50 hit clones were secondarily screened by analyzing their binding characteristics to antigens, and then 16 unique clones were selected through sequence analysis. Afterwards, two types of clones were finally selected through additional characterization of CCR7-specific clones and ligand binding ability, and each selection process and the number of selected clones are summarized in Table 1.

	Number of clonesNumber of clones
Screened clonesScreened clones	384384
Primary hitsPrimary hits	5050
Unique clonesUnique clones	1616
CCR7-specific clonesCCR7-specific clones	77
Ligand competitors Ligand competitors	22

As a result of sequence analysis of the two types of scFv finally selected through the above-described process, 6RG11 scfv of SEQ ID NO: 17 and 72C7 scFv containing SEQ ID NO: 19 were confirmed (CDR1 of SEQ ID NO: 1 in the heavy chain variable region, respectively, sequence CDR2 of SEQ ID NO: 2 and CDR3 of SEQ ID NO: 3, and the light chain variable region includes CDR1 of SEQ ID NO: 4, CDR2 of SEQ ID NO: 5, and CDR3 of SEQ ID NO: 6; CDR1 of SEQ ID NO: 7 and CDR2 of SEQ ID NO: 8 in the heavy chain variable region and CDR3 of SEQ ID NO: 9 and CDR1 of SEQ ID NO: 10, CDR2 of SEQ ID NO: 11, and CDR3 of SEQ ID NO: 12 in the light chain variable region.

<실시예 7> CCR7에 대한 최종 선별된 2종 클론의 결합력<Example 7> Binding affinity of the two final selected clones to CCR7

We sought to confirm through ELISA whether the two types of scFv (6RG11, 72C7) bind to CCR7 in a concentration-dependent manner. Specifically, various concentrations (0 ~ 500 nM) of scFv (6RG11, 72C7) were treated with APG-O:P9-CCR7, incubated at room temperature for 1 hour, and then bound scFv (6RG11, 72C7) was measured. HRP-conjugated anti-HA antibody (1:3000 diluted) was used.

Figure 2c is a graph showing the results of treating APG-O:P9-CCR7 with 0 to 500 nM scFv (6RG11, 72C7) and analyzing it by ELISA. Blue circles and green squares represent signals by scFv 6RG11 and scFv 72C7, respectively.

As shown in Figure 2c, the two types of scFv (6RG11, 72C7) were confirmed to bind to CCR7 in a concentration-dependent manner, and were confirmed to have K _D values of 90 nM (6RG11) and 230 nM (72C7), respectively. . That is, scFvs with CCR7-specific activity were successfully screened through the scFv-display M13 library using P9-CCR7 purified as an antigen. Approximately 56% of the identified clones were non-specific for CCR7. Non-specific clones are believed to bind to the P9 sequence and not to the CCR7 domain. Non-specific clones are expected to inhibit the inclusion of P9 protein during the biopanning process.

Among the 7 types of antibodies, 5 types of CCR7-specific scFvs excluding 2 types of scFvs (6RG11, 72C7) were confirmed to be unable to compete with CCL19. The five scFvs that were not finally selected are believed to interact with intracellular or extracellular regions far from the CCL19 binding site of CCR7. The above two types of scFv (6RG11, 72C7) form competitive bonds with CCL19 and CCR7 and have excellent inhibitory activity against CCR7 ligand binding, so they were finally selected as therapeutic antibodies targeting CCR7.

<Example 8> Preparation of CCR7-specific IgG ₄

The variable region sequences of the two final selected clones (6RG11, 72C7) are pTRIOZ-hIgG4 (pTRIOZ-hIgG4), which contains a human lambda Fc region sequence expressing IgG ₄ type immunoglobulin. S228P) vector (Invitrogen, USA). The IgG ₄ expression vector was transfected into 50 ml of Expi293 cells (3 × 10 ⁶ cells/ml) (ATCC, USA) maintained in Expi293™ medium using the ExpiFectamine™ 293 transfection kit (Thermo Fisher Scientific, USA). Transfected cells were cultured until cell viability reached less than 60% and harvested at 2,000 xg for 20 min at 4°C. The supernatant was filtered using a syringe filter (PES, Pore 0.22 μm) (Sartorius, USA) and loaded into CaptivA® (Repligen) equilibrated with DPBS. After washing the column with DPBS, the target protein was eluted with 100 mM Glycine-HCl pH 2.7 and immediately neutralized with 1M Tris-HCl pH 8.0. Purified proteins were diluted with DPBS to prevent precipitation, and proteins eluted with 10% glycerol were stored at -80°C until needed. The binding activity of purified IgG ₄ to P9-CCR7 was confirmed using ELISA, and bound IgG ₄ was analyzed using Goat anti-Human IgG (H+L) HRP (Thermo Fisher Scientific, USA).

As described above, an expression vector for human IgG ₄ containing the heavy and light chain variable regions of 6RG11 and 72C7 was constructed, and the two IgG ₄ proteins were purified and analyzed by SDS-PAGE. Specifically, human IgG ₄ was purified from the culture medium of Expi 293 cells containing an IgG ₄ expression vector using CaptivA protein A resin, and IgG ₄ purified through the above process was analyzed by SDS-PAGE using Coomassie staining. .

As shown in Figure 3a, it was confirmed that human IgG ₄ (6RG11) and human IgG ₄ (72C7) were successfully produced and purified through the above-described process.

<Example 9> Binding characteristics of human IgG ₄ (6RG11) and human IgG ₄ (72C7) to CCR7

To analyze the binding kinetics of human IgG ₄ (6RG11) and human IgG ₄ (72C7) according to the present invention, ELISA and flow cytometry were performed using P9-CCR7.

1) Affinity analysis of IgG ₄ for P9-CCR7

The binding affinity between CCR7 and IgG ₄ (6RG11, 72C7) was analyzed through ELISA. Purified P9-CCR7 (500 ng) or P9 (500 ng) was immobilized on a 96-well Maxi binding plate and treated with 3% BSA. Next, various concentrations (1 to 1000 nM) of IgG ₄ (6RG11, 72C7) were treated and incubated at room temperature for 1 hour. To measure the amount of bound IgG ₄ (6RG11, 72C7), it was analyzed using HRP-conjugated anti-HA antibody (1:3000 diluted).

2) Cell culture, transfection and flow cytometry

HEK293 CCR7+ cells were prepared using Lipofectamine® 3000 (Thermo Fisher Scientific, USA) with pCDNA3.1-FLAG-CCR7 DNA plasmid (1 ug/μL). HEK293 CCR7- cells were maintained in culture medium (DMEM, 10% FBS, 1% penicillin/streptomycin). The cells were treated with 1 ml of TrypLE™ Express Enzyme (Thermo Fisher Scientific, USA) to obtain a single cell suspension, which was centrifuged at 300 xg for 3 minutes, the supernatant was removed, and the cell pellet was obtained. Washed twice with DPBS. The washed cell pellet was resuspended in 5 ml of DPBS containing 3% BSA. At this time, the final density of cells in the solution was set to 1 × 10 ⁶ cells/ml. The resuspension was incubated at 4°C for 1 hour, 1 ml of cell solution (1 × 10 ⁶ cells) was added to each tube, and rinsed using 1 ml DPBS. DPBS or 20 nM of 6RG11 or 72C7 or Isotype control (Opdivo) was added thereto, incubated with rotation at 4°C for 1 hour, and then centrifuged. The supernatant was discarded, the pellet was washed twice with 1 ml of DPBS, and then all cells were treated with 400 ㎕ of Alexa 488 conjugated anti-Human Fc antibody (1:1000 dilution) (Invitrogen, USA) and incubated at 4°C for 1 hour. cultured for a while. Cells were washed three times and resuspended in 500 μl of DPBS. The fluorescence signal of bound IgG ₄ was measured using a Guava® easyCyte™ Flow Cytometer (Luminex, USA) (FIG. 3c, d). In the figure, DPBS is shown in red, 20 nM of Opdivo IgG ₄ (isotype control) is shown in blue, and 20 nM of purified human IgG ₄ (6RG11) or human IgG ₄ (72C7) is shown in orange.

Figure 3b shows the results of ELISA analysis of the specific binding of human IgG ₄ (6RG11) and human IgG ₄ (72C7) to CCR7, and Figure 3c shows the results of flow cytometry analysis of the specific binding of human IgG ₄ (6RG11) to CCR7. This is a graph showing the results of the analysis, and Figure 3d is a graph showing the results of analyzing the specific binding of human IgG ₄ (72C7) to CCR7 using flow cytometry.

As shown in Figure 3b, neither human IgG ₄ (6RG11) nor human IgG ₄ (72C7) binds to P9, but has high binding affinity to P9-CCR7 (K _D : 40 nM, K _D : 37 nM, respectively). ) was confirmed to have. It can be seen that the affinities of purified human IgG ₄ (6RG11) and human IgG ₄ (72C7) are 2.2 times (6RG11) and 6.5 times (72C7) higher than those in scFv form. It was confirmed that affinity was further improved in the form of human IgG ₄ (6RG11) and human IgG ₄ (72C7) compared to the scFv form.

We sought to confirm the specific binding ability of human IgG ₄ (6RG11) and human IgG ₄ (72C7) according to the present invention to CCR7 in mammalian cells. As shown in Figures 3c and 3d, when HEK293 cells were treated with human IgG ₄ (6RG11), human IgG ₄ (72C7), or isotype control antibody, human IgG ₄ (6RG11), human IgG Although no significant binding of ₄ (72C7) was observed (left view in Figure 3c, d), HEK293 cells expressing CCR7 showed strong binding signals with human IgG ₄ (6RG11) and human IgG ₄ (72C7). (right view in Fig. 3c,d). These results show that human IgG ₄ (6RG11) and human IgG ₄ (72C7) can bind to the extracellular region of CCR7 in mammalian cells.

<Example 10> Blocking the activity of human IgG ₄ (6RG11) and human IgG ₄ (72C7) on the CCR7 signaling axis

1) Cyclic AMP assay1) Cyclic AMP assay

HEK293 CCR7 + cells or MDA-MB-231 CCR7 + cells were maintained in DMEM medium containing 10% FBS and 1% penicillin/streptomycin. One day before the experiment, each was inoculated into a 96-well culture plate at a concentration of 1 × 10 ⁴ cells/well and cultured overnight at 37°C in 5% carbon dioxide. After replacing the medium with cAMP stimulation buffer (DMEM, 0.5mM 3-isobutyl-1-methylxanthine (IBMX)), cultured for 20 minutes at 5% carbon dioxide at 37°C, treated with CCL19 or CCL21. It was incubated for 20 minutes at 5% carbon dioxide and 37°C. At this time, CCL19 or CCL21 was used in the form of a mixture prepared by mixing various concentrations of CCL19 (Peprotech, USA) or CCL21 (Peprotech, USA) in 2 × forskolin buffer (cAMP stimulation buffer containing 40 μM forskolin). . The effect of CCL19 ligand or CCL21 ligand was analyzed using cAMP-GloTM assay kit (Promega, USA) and detected with Synergy H1 (BioTek, USA) microplate reader.

HEK293 CCR7 + cells or MDA-MB-231 CCR7 + cells were distributed in a 96-well culture plate at a concentration of 1 × 10 ⁴ cells/well and cultured overnight at 5% carbon dioxide and 37°C. Replace the medium with cAMP stimulation buffer (DMEM, 0.5mM 3-isobutyl-1-methylxanthine (IBMX)) or cAMP stimulation buffer containing various concentrations of IgG ₄ , and incubate for 20 minutes at 5% carbon dioxide at 37°C. cultured for a while. Here, the cells were treated with 2×forskolin buffer (cAMP stimulation buffer containing 40 μM forskolin) or only 2×forskolin buffer containing 20 nM of CCL19 (Peprotech, USA) or CCL21 (Peprotech, USA) and treated for 5 days. % carbon dioxide, and incubated for 20 minutes at 37°C. The effect of IgG ₄ on CCL19 or CCL21 ligand binding was also analyzed using the cAMP-GloTM assay kit (Promega, USA) and detected with a Synergy H1 (BioTek, USA) microplate reader.

Through ligand-competition of scFv for binding to CCR7 and specific binding of IgG ₄ (6RG11, 72C7) to CCR7 in mammalian cells, two types of human IgG ₄ (6RG11, 72C7) screened in the present invention were obtained. 72C7), and it was confirmed through previous experiments that they each prevent cell metastasis induced by CCR7 and have antagonistic activity against CCR7. Furthermore, we sought to confirm whether human IgG ₄ (6RG11, 72C7) of the present invention has antagonistic activity against CCR7, and CCR7-dependent Gi signaling induced by CCL19 or CCL21 was tested using a cAMP-GloTM assay kit (Promega, USA). analyzed.

As shown in Figure 4, cAMP accumulation was confirmed when MDA-MB-231 or HEK293 cells expressing CCR7 were treated with various concentrations of CCL19 and CCL21 ligands. At this time, the minimum concentration of CCL19 and CCL21 ligands was 0.1 nM in HEK293 cells, and 1 nM in MDA-MB-231 cells. The concentration of CCL19 and CCL21 at which maximum cAMP accumulation occurred was 10 nM in HEK293 cells and 50-100 nM in MDA-MB-231 cells.

As shown in Figure 5, the concentration of CCL19 or CCL21 was fixed at 20 nM and the human 6RG11 antibody was treated with HEK293 CCR7+ cells at various concentrations (1-200 nM), resulting in a significant EC ₅₀ of 3-12 nM. A significant decrease in cAMP accumulation was confirmed.

Through the above-described experiment, it can be seen that IgG ₄ (6RG11) according to the present invention has excellent antagonistic activity against the CCR7 signaling pathway, especially Gi-dependent cAMP accumulation.

<실시예 11> 암 전이 및 침습에 대한 인간 항체 효능 분석<Example 11> Analysis of human antibody efficacy against cancer metastasis and invasion

CCR7 (CC-chemokine receptor 7) is a chemotactic receptor and is known to induce cell migration. Prior to this, human antibodies against CCR7 (IgG ₄ (6RG11) and IgG ₄ (72C7)) obtained through experiments were shown to inhibit the migration and invasion of MDA-MB-231 cancer cells expressing CCR7 induced by CCL19 or CCL21. We wanted to check whether it was effective.

1) Migration and invasion assay 1) Migration and invasion assay

MDA-MB-231 cells were transfected with pCDNA3.1-FLAG-CCR7 DNA plasmid (1 ug/μL) using Lipofectamine® 3000 (Thermo Fisher Scientific, USA), and the medium was changed after 20 h, followed by 5 % carbon dioxide, and cultured overnight at 37°C. The medium was exchanged for starvation medium (DMEM, 0.5% FBS, 1% (α) penicillin/streptomycin), and further cultured for 6 hours. Matrigel matrix (growth factor reduction, Corning, USA) was diluted to a concentration of 200 μg/ml using cold DMEM medium, and then placed on a permeable support (8.0 μm PET Membrane, Falcon) in a 24 well clear TC-treated well plate (Costar, USA). , USA) were each treated with 200 μL of the diluted Matrigel. Matrigel was cultured on the treated plate for more than 2 hours until it solidified. Remove DMEM medium from the upper chamber and treat with 200 μL of starved 2 × 10 ⁵ cells alone or 200 μL of starved 2 × 10 ⁵ cells mixed with human IgG ₄ (6RG11, 72C7). was dispensed into the upper chamber. The lower chamber was filled with 800 μL of starvation medium alone or 800 μL of starvation medium containing 30 nM of CCL19 or CCL21. The 24-well plate was cultured for 40 hours, the upper chamber was wiped with a cotton swab, and the migrated cells were stained using the Diff Quick staining kit and detected with an inverted microscope. did. The number of migrated cells was counted using Image J software and analyzed using GraphPad Prism 8 software.

All samples were tested in DMEM, 0.5% FBS, and the number of migrated cells was calculated using Image J software, and a p value of 0.05 or less was considered significant (P > 0.05 is not significant, * P ≤ 0.05, * *P ≤ 0.01, ***P ≤ 0.001).

Figure 6 is a photograph showing the effect of IgG ₄ (6RG11, 72C7) on CCR7-dependent invasion induced by CCL19 ligand in MDA-MB-231 cells expressing CCR7. 7 is a photograph showing the effect of IgG ₄ (6RG11, 72C7) on CCR7-dependent invasion induced by CCL21 ligand in MDA-MB-231 cells expressing CCR7.

As shown in Figures 6 and 7, it can be seen that both IgG ₄ (6RG11) or IgG ₄ (72C7) prevent the migration of CCR7 ⁺ cells induced by CCL19 or CCL21. It was confirmed that IgG ₄ (6RG11) had better efficacy than IgG ₄ (72C7) under low concentration conditions of less than 50 nM.

As shown in Figure 8, it was confirmed that IgG ₄ (6RG11) and IgG ₄ (72C7) exhibited inhibitory activity against CCR7-dependent invasion.

Taken together, the binding of CCR7 to CCL19/CCL21 ligands was found to induce several molecular events, such as structural changes in CCR7, displacement of G proteins, β-arrestin recruitment, and homodimerization or heterodimerization. CCR7 and CCL19/CCL21 ligands are known to play different roles in G protein activation, β-arrestin recruitment, internalization, migration, and signaling pathways, respectively. In the present invention, we attempted to screen human antibodies (IgG ₄ ) with the activity of blocking the binding of the above-described CCR7 and CCL19/CCL21 ligands, and as a result, two types of antibodies (IgG ₄ (6RG11) and IgG ₄ (72C7)) were discovered. It came down to this. Both IgG ₄ (6RG11) and IgG ₄ (72C7) according to the present invention bind to the extracellular region of CCR7 close to the ligand binding region, blocking ligand binding, metastasis and invasion of cancer cells, and β-arrestin-mediated ERK1/2 phosphorylation. It has a blocking effect. Through the above results, it was confirmed that the antibody of the present invention has the activity of effectively inhibiting the signaling process of CCR7 in cancer cells and is therefore effective as a therapeutic agent.

As the specific parts of the present invention have been described in detail above, it is clear to those skilled in the art that these specific techniques are merely preferred implementation examples and do not limit the scope of the present invention. Accordingly, the substantial scope of the present invention will be defined by the appended claims and their equivalents.

Claims

An antibody or antigen-binding fragment thereof comprising heavy chain CDR1, CDR2, and CDR3 and light chain CDR1, CDR2, and CDR3 that recognizes CCR7 (CC chemokine receptor 7) as an antigen and specifically binds to it,

The antibody or antigen-binding fragment thereof is characterized in that it comprises any one CDR combination selected from the following group:

(A) The heavy chain variable region includes CDR1 of SEQ ID NO: 1, CDR2 of SEQ ID NO: 2, and CDR3 of SEQ ID NO: 3, and the light chain variable region includes CDR1 of SEQ ID NO: 4, CDR2 of SEQ ID NO: 5, and CDR3 of SEQ ID NO: 6. include;

(B) The heavy chain variable region includes CDR1 of SEQ ID NO: 1, CDR2 of SEQ ID NO: 2, and CDR3 of SEQ ID NO: 3, and the light chain variable region includes CDR1 of SEQ ID NO: 10, CDR2 of SEQ ID NO: 11, and CDR3 of SEQ ID NO: 12. include;

(C) The heavy chain variable region includes CDR1 of SEQ ID NO: 7, CDR2 of SEQ ID NO: 8, and CDR3 of SEQ ID NO: 9, and the light chain variable region includes CDR1 of SEQ ID NO: 4, CDR2 of SEQ ID NO: 5, and CDR3 of SEQ ID NO: 6. include; and

(D) The heavy chain variable region includes CDR1 of SEQ ID NO: 7, CDR2 of SEQ ID NO: 8, and CDR3 of SEQ ID NO: 9, and the light chain variable region includes CDR1 of SEQ ID NO: 10, CDR2 of SEQ ID NO: 11, and CDR3 of SEQ ID NO: 12. include.
The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region of SEQ ID NO: 13 or 15 and a light chain variable region of SEQ ID NO: 14 or 16.
The method of claim 1, wherein the antibody or antigen-binding fragment thereof comprises a heavy chain variable region of SEQ ID NO: 13 and a light chain variable region of SEQ ID NO: 14; Or an antibody or antigen-binding fragment thereof comprising a heavy chain variable region of SEQ ID NO: 15 and a light chain variable region of SEQ ID NO: 16.
The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment thereof comprises the amino acid sequence of SEQ ID NO: 17 or SEQ ID NO: 19.
The method of claim 1, wherein the antibody is selected from the group consisting of IgG, IgA, IgM, IgE and IgD, and the antigen-binding fragment is diabody, Fab, F(ab'), F(ab')2, Fv, An antibody or antigen-binding fragment thereof, characterized in that it is selected from the group consisting of dsFv and scFv.
The method of claim 1, wherein the antibody or antigen-binding fragment thereof is capable of inhibiting the activity of inhibiting at least one of CCR7-dependent intracellular signaling and CCR7 receptor internalization by any one CCR7 ligand selected from CCL19 and CCL21. Characterized antibody or antigen-binding fragment thereof.
The antibody or antigen-binding fragment thereof according to claim 1, wherein the antibody or antigen-binding fragment thereof has a dissociation constant (K D ) of 20 nM to 100 nM for CCR7.
A nucleic acid molecule encoding the antibody of claim 1 or an antigen-binding fragment thereof.
A vector containing the nucleic acid molecule of claim 8.
A host cell containing the vector of claim 9.
A pharmaceutical composition comprising the antibody or antigen-binding fragment thereof of claim 1, the nucleic acid molecule of claim 8 or the vector of claim 9, and a pharmaceutically acceptable carrier.
The pharmaceutical composition according to claim 11, wherein the pharmaceutical composition is a pharmaceutical composition for preventing or treating cancer or cancer metastasis.
A method for quantifying CCR7 contained in a sample, comprising treating the sample with the antibody or antigen-binding fragment thereof of claim 1.
A method of providing information for diagnosis of a disease caused by overexpression of CCR7 comprising the following steps:

(a) obtaining a sample separated from the subject in vitro;

(b) treating the sample with the antibody or antigen-binding fragment thereof of claim 1; and

(c) Confirming whether the expression level of CCR7 included in the subject's sample is higher than the expression level of CCR7 included in the normal group sample.
The method of claim 14, wherein the disease caused by overexpression of CCR7 is cancer or metastatic cancer.
A CCR7 quantitative kit comprising the antibody or antigen-binding fragment thereof of claim 1.
A method for preventing or treating cancer or cancer metastasis, comprising administering the pharmaceutical composition of claim 11 to a subject in need thereof.