WO2023224352A1 - Gene manipulation based on nanoparticle-crispr complex and fabrication method therefor - Google Patents

Gene manipulation based on nanoparticle-crispr complex and fabrication method therefor Download PDF

Info

Publication number
WO2023224352A1
WO2023224352A1 PCT/KR2023/006602 KR2023006602W WO2023224352A1 WO 2023224352 A1 WO2023224352 A1 WO 2023224352A1 KR 2023006602 W KR2023006602 W KR 2023006602W WO 2023224352 A1 WO2023224352 A1 WO 2023224352A1
Authority
WO
WIPO (PCT)
Prior art keywords
guide rna
present
aptamer
nanoparticles
cas protein
Prior art date
Application number
PCT/KR2023/006602
Other languages
French (fr)
Korean (ko)
Inventor
이강석
배지현
염지현
주민주
유민경
현하나
심세훈
김차영
박성철
정재철
정유정
Original Assignee
주식회사 엔이에스바이오테크놀러지
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020220184348A external-priority patent/KR20230160699A/en
Application filed by 주식회사 엔이에스바이오테크놀러지, 한국생명공학연구원 filed Critical 주식회사 엔이에스바이오테크놀러지
Publication of WO2023224352A1 publication Critical patent/WO2023224352A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • B—PERFORMING OPERATIONS; TRANSPORTING
    • B82—NANOTECHNOLOGY
    • B82Y—SPECIFIC USES OR APPLICATIONS OF NANOSTRUCTURES; MEASUREMENT OR ANALYSIS OF NANOSTRUCTURES; MANUFACTURE OR TREATMENT OF NANOSTRUCTURES
    • B82Y5/00—Nanobiotechnology or nanomedicine, e.g. protein engineering or drug delivery

Definitions

  • the present invention is a nanocomplex for the CRISPR-Cas system comprising nanoparticles and Cas protein and guide RNA bound thereto, and a gene editing method using the same.
  • the nanocomplex is prepared and delivered into cells to edit the target gene. It's about technology.
  • Genes are organic substances possessed by all living organisms, and contain all the information necessary for the composition and maintenance of living organisms and the organic interrelationships between cells. Genes can be damaged by various factors, and genetic damage can develop into various diseases.
  • genes can freely correct genetic information through editing, and gene editing technology seeks to utilize this by changing the genetic information of animals, plants, and even microorganisms, including humans.
  • Gene editing technology called genetic scissors
  • Genetic scissors is being studied as an important technology for enabling gene editing and expanding the scope of use and utilization of genetic information.
  • Genetic scissors go through first generation gene scissors such as zinc finger, second generation gene scissors such as TALEN, and recently, a third generation gene scissors called CRISPR (Clustered regularly interspaced short palindromic repeat)-Cas (CRISPR-associated) 9 has been developed.
  • CRISPR/Cas9 is derived from a protein involved in the immune response of bacteria and has the function of protecting bacteria by cutting viral genes that invade from the outside.
  • CRISPR-Cas9 which has a gene cutting function, and sgRNA, which provides sequence selectivity, to operate simultaneously.
  • the Cas9 protein which can cleave genes, forms a complex with a single guide RNA (sgRNA) and forms an active endonuclease that decomposes the genetic elements of the phage or plasmid when it invades the host. Protects cells.
  • RNA-guided nuclease derived from the CRISPR-Cas9 system can be used for gene editing.
  • single guide RNA (sgRNA) and Cas proteins can be used to edit the genomes of cells and organs. In particular, it can be used to treat diseases caused by gene damage by removing or modifying damaged genes.
  • viral carriers such as lentivirus, adenovirus, AAV, liposomes, or nanoparticles to deliver Cas9 protein and sgRNA for the operation of the CRISPR-Cas9 system into the cell where the target gene is located.
  • non-viral carriers such as exosomes and microvesicles are known.
  • the viral carrier technology used in the CRISPR-Cas9 system is a gene carrier that uses the virus's unique proliferation mechanism, and representative examples include Adenovirus, Retrovirus, and Adeno-Associated Virus (AAV).
  • Viral carrier technology has high gene transfer efficiency, but because it is a pathogenic virus, there are safety issues such as inducing a strong immune response, and there is a limit to the size of the gene that can be inserted into the viral vector, so applicable genes are limited.
  • non-viral carrier technology has the advantage of being easy to produce without introducing viral genetic material into human cells, allowing unlimited size of inserted genes in the carrier, and having fewer side effects due to lower immune response to the host. there is.
  • it has the disadvantage of low intracellular delivery efficiency compared to viral carriers.
  • the present inventors have developed a nanoparticle carrier that can simultaneously deliver sgRNA and Cas protein for the operation of the CRISPR-Cas9 system, and a cargo DNA as a binding partner that can covalently bind sgRNA to the surface of the nanomaterial and can bind to Cas protein.
  • the present invention regarding a complex that includes an aptamer and can simultaneously transport it into a target cell has been completed.
  • the object of the present invention is a delivery vehicle comprising nanoparticles, a DNA binding partner and an aptamer linked to the surface of the nanoparticle; and a nanocomplex containing guide RNA and Cas protein as a transport object bound thereto.
  • Another object of the present invention is a delivery vehicle comprising nanoparticles, a DNA binding partner and an aptamer linked to the surface of the nanoparticles; and a method of manufacturing a nanocomposite containing guide RNA and Cas protein as a transport object bound thereto.
  • Another object of the present invention is to provide a composition and editing method for gene editing of cells using the nanocomposite.
  • the present invention provides a delivery vehicle including nanoparticles, a DNA binding partner and an aptamer linked to the surface of the nanoparticles; A complex comprising a guide RNA and a Cas protein bound thereto is provided.
  • the present invention includes: a nanoparticle, a delivery vehicle including a DNA binding partner and an aptamer linked to the surface of the nanoparticle; and a method of manufacturing a nanocomplex containing a guide RNA and a Cas protein as a transport object bound thereto.
  • the present invention provides a composition and editing method for gene editing of cells using the nanocomposite.
  • the present invention is a complex for delivering Cas (CRISPR associated protein) protein and guide RNA in the CRISPR-Cas system, which is complementary to nanoparticles, a DNA binding partner for delivering guide RNA by linking to the surface of the nanoparticle, and Cas protein. It includes a nanoparticle delivery vehicle containing an aptamer that binds to.
  • the nanoparticle delivery vehicle can deliver guide RNA and Cas protein together into target cells, and enables stable and effective delivery compared to conventional delivery vehicles, and is especially capable of gene editing using CRISPR-Cas gene scissors in both animal and plant cells. It's about nanocomposites.
  • the present invention includes a nanoparticle, a DNA binding partner linked to the surface of the nanoparticle to deliver guide RNA, and an aptamer that binds complementary to a Cas protein, and binds to the DNA binding partner.
  • a nanocomplex containing a guide RNA and a Cas protein bound to the aptamer.
  • Gene editing technology can be used to treat damaged genes or manipulate existing genes.
  • the CRISPR-Cas gene editing system is capable of editing genes at the level of the genome or single base of a gene.
  • intracellular movement of guide RNA and Cas protein for the gene to be edited is required, and the nanocomplex of the present invention is non-toxic and can efficiently deliver foreign genes and proteins into cells, It was developed to enable editing of target genes without causing any damage.
  • the 'nanoparticle (NP)' refers to a material preferably having a size of 1-100 nm.
  • the shape and shape of the nanoparticles used in the present invention are not particularly limited as long as they are nano-sized materials (for example, shapes such as particles, tubes, rods, or tetrahedrons).
  • the “nanoparticles” are various particles having a diameter in nanoscale, preferably 8-100 nm, more preferably 10-50 nm, and most preferably 12-14 nm. It refers to particles of matter.
  • the nanoparticles are not particularly limited as long as they are nano-sized particles.
  • the nanoparticles used in the present invention refer to gold nanoparticles.
  • Gold nanoparticles are not only easy to manufacture in the form of stable particles, but their size can be varied from 0.8 nm to 200 nm to suit various purposes.
  • gold can modify the structure by combining with various types of molecules, such as peptides, proteins, and nucleic acids, and reflects light at various wavelengths, making it easy to confirm its location within the cell.
  • gold nanoparticles are harmless to the human body and have high biocompatibility, unlike heavy metals such as manganese, aluminum, cadmium, lead, mercury, cobalt, nickel, and beryllium.
  • the diameter of the gold nanoparticles of the present invention is not limited thereto, but may preferably be 8-100 nm, more preferably 10-50 nm, and most preferably 12-14 nm.
  • Gold nanoparticles used in the present invention can be prepared, for example, as follows: gold nanoparticles are prepared by reducing HAuCl 4 using HAuCl 4 as a gold source and sodium citrate as a reducing agent. In this case, the size of the gold nanoparticles can be adjusted by varying the added citrate. In other words, as the amount of citrate added increases, nucleation increases and the size of gold nanoparticles decreases.
  • the DNA binding partner for delivering the guide RNA includes a sequence that binds complementary to the guide RNA, and the DNA binding partner is DNA that is the cargo of the nanocomplex of the present invention, and is used to edit the target gene. Includes a base sequence derived from the target sequence.
  • the DNA binding partner mediates the binding of the nanocomplex and the guide RNA, and allows the guide RNA bound to the nanocomplex to move into the cell and bind complementary to the target sequence within the cell.
  • the DNA binding partner may include an oligonucleotide as a universal binding partner described in Korean Patent No. 10-1230913, a prior patent of the present inventor, and when including the universal binding partner, it is not particularly limited to the derived sequence or organism. Nanocomplexes capable of transporting guide RNAs composed of various sequences can be produced. At this time, a binding counter partner sequence for binding to the universal binding partner may be additionally included in the guide RNA, which can be produced by referring to the information described in the prior patent.
  • the 'guide RNA' includes a sequence derived from the target gene to be edited, and refers to RNA specific to the target DNA (eg, RNA capable of hybridizing with the target site of DNA).
  • the guide RNA is not limited in type, for example, CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA), dual guide RNA including a combination thereof, or single guide RNA (sgRNA). It may be, and more preferably, it may be a single guide RNA (sgRNA), but is not limited thereto. In the present invention, the guide RNA may be sgRNA.
  • the nucleotide sequence capable of hybridizing with the gene target site is at least 50%, 60% or more of the nucleotide sequence of the gene target site (more specifically, the nucleotide sequence of the strand opposite to the strand on which the PAM is present among the DNA double strands of the gene target site). refers to a nucleotide sequence having sequence complementarity of % or more, 70% or more, 80% or more, 90% or more, 95% or more, 99% or more, or 100% (hereinafter, unless otherwise specified, it is used with the same meaning) .
  • the Cas protein forms a complex with guide RNA and serves to cleave the DNA sequence that is the target of editing.
  • the guide RNA recognizes the target sequence and binds to it, and the Cas protein that forms the complex acts to cleave the target DNA.
  • the Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3 , Csx1, Csx15, Csf1, Csf2, Csf3, and Csf4 are known, and in particular, Cas9, Cas12a (Cpf1),
  • the Cas protein used in one embodiment of the present invention is Cas9 protein, but is not limited thereto.
  • the Cas protein is bound to the gold nanoparticle by an aptamer, and the aptamer is not limited in sequence and structure as long as it has a structure for attaching the Cas protein.
  • a His-tag aptamer is used. used.
  • the nanocomposite may be applied to gene editing of cells and/or organisms, and the cells and/or organisms may be eukaryotic cells or eukaryotic organisms.
  • the eukaryotic cells and/or eukaryotic organisms include, for example, eukaryotic cells (e.g., fungi such as yeast, eukaryotic animal-derived and/or eukaryotic plant-derived cells (e.g., embryonic cells, stem cells, somatic cells, germ cells, etc.), eukaryotic animals, etc.
  • eukaryotic plants e.g., algae such as green algae, corn, soybeans, wheat, rice, etc. It may be selected.
  • the gene of the present invention is a plant cell contained in a plant body, and may include plant protoplasts.
  • Plant protoplast means a plant cell with the cell wall removed. Plant protoplasts can be produced by treating plant cells with enzymes such as cellulase, pectinase, and xylanase. The plant protoplasts may be derived from various plants and are not limited to the types.
  • the nanocomplex can be used as a composition for gene editing as a carrier of guide RNA and Cas protein in the CRISPR-Cas system for gene editing.
  • the present invention provides a delivery system comprising nanoparticles, a DNA binding partner linked to the surface of the nanoparticles, and an aptamer; and a method of manufacturing a nanocomposite containing guide RNA and Cas protein as a transport object bound thereto.
  • the nanocomposite manufacturing method of the present invention includes manufacturing nanoparticles; Fabricating a nano-delivery vehicle by covalently binding an aptamer that specifically binds to a Cas protein and a DNA binding partner containing a target gene sequence to be edited to the surface of the nanoparticle; And it includes the step of producing a nanocomposite by binding the guide RNA and Cas protein to be transported to the nanoparticle.
  • the present invention relates to a method of editing a target gene of a cell using the manufactured nanocomposite.
  • the present invention relates to a nanoparticle delivery vehicle designed to bind Cas protein and guide RNA, a nanocomplex containing Cas protein and guide RNA bound thereto, and a gene editing method using the same, which delivers guide RNA and Cas protein into a target cell. At the same time, it has the effect of being delivered stably and effectively.
  • Figure 1 is a schematic diagram showing the process of manufacturing the nanocomposite of the present invention.
  • Figure 2 shows the results of confirming the intracellular delivery ability of Cas9 protein and sgRNA according to the nano-delivery vehicle of the present invention through confocal microscopy.
  • Figure 3 shows the results of confirming the intracellular delivery ability of Cas9 protein and sgRNA according to the nano-delivery vehicle of the present invention through Western blot.
  • Figure 4 confirms the results of plant genetic manipulation using the CRISPR-Cas9 system coupled to the nano-delivery vehicle of the present invention.
  • Figure 5 shows the results of analyzing the insertion and deletion sequences by amplifying the target region of the target gene using the nano-delivery vehicle of the present invention and then sequencing it.
  • a nanocomposite was prepared by covalently binding sgRNA and Cas9 protein to gold nanoparticles, and a schematic diagram of the manufacturing process is shown in Figure 1.
  • the gold nanoparticles used in the present invention were prepared by reducing HAuCl 4 using HAuCl 4 as a gold source and sodium citrate as a reducing agent. More specifically, 545ml of 0.92mM HAuCl 4 solution and 5ml of 388mM sodium citrate solution were mixed and reacted at 100C for 15 minutes. The reactants were analyzed using a transmission electron microscope to confirm the synthesis and size of nanoparticles ( Figure 2).
  • the histidine-tag DNA aptamer is an aptamer whose 3' end is modified with a thiol group, and consists of the base sequence 5' - GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGCAAAAAAAA - 3'.
  • Example 1-2 The DNA aptamer pretreated and precipitated as in Example 1-2 was dissolved in water, then added to the gold nanoparticles synthesized in Example 1-1, and then combined with the salt aging method.
  • the final gold nanoparticle-DNA aptamer complex was dispersed in 10mM sodium phosphate buffer (pH 7.4) containing 0.1 M NaCl. As a result of analyzing the prepared gold nanoparticle-DNA aptamer complex by electrophoresis using a 10% acrylamide 8M Urea gel, it was confirmed that 130 to 150 DNA aptamers were bound to one gold nanoparticle.
  • a nanocomplex was prepared by combining Cas9 and sgRNA that specifically binds to the nano-delivery vehicle produced above. Its manufacturing process is shown in Figure 1.
  • the prepared AuNP His was added to the HeLa cell culture medium to a final concentration of 1 nM, and after 24 hours, the fluorescence emitted from the cells was measured using a fluorescence microscope.
  • HeLa cells without Cas9 stained with Alexa546 (red) and guide RNA stained with FITC (green) were used.
  • FITC green
  • the target region of the target gene was amplified using the nanocomposite of the present invention and then sequenced to analyze the Indel (insertion and deletion) sequence. As a result, a higher indel sequence was confirmed when delivered using gold nanoparticles rather than using the PEG technique used for transformation of protoplasts. ( Figure 5)
  • the present invention provides nanoparticles; An aptamer covalently bound to the surface of the nanoparticle; and a DNA binding partner covalently bound to the surface of the nanoparticle, wherein the aptamer specifically binds to a Cas protein, and the DNA binding partner includes a sequence that binds complementary to a guide RNA. It's about complexes.
  • the nanoparticles are nanoparticles with a size of 8-100 nm.
  • the nanoparticles may be gold nanoparticles (AuNP).
  • the nanocomplex includes guide RNA and Cas protein.
  • the Cas protein is Cas9 protein.
  • the guide RNA may be selected from sgRNA (single guide RNA), crRNA (crispr RNA), or tracrRNA (trans-activating RNA).
  • the DNA binding partner is a sequence derived from a target gene to be edited and includes a base sequence complementary to a guide RNA.
  • the present invention includes preparing an aptamer that specifically binds to a Cas protein; Creating a DNA binding partner containing a sequence derived from a gene to be edited; Covalently binding the aptamer and DNA binding partner to the surface of the nanoparticle; and forming a complex by binding Cas protein and guide RNA to the aptamer and DNA binding partner, respectively.
  • the present invention relates to a composition for gene editing containing the nanocomposite.
  • the gene editing composition is intended to be applied to eukaryotic cells or entities containing eukaryotic cells.
  • the present invention relates to a method of editing a target gene by injecting the nanocomplex into a cell or organism to be edited.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The present invention pertains to a nanoparticle delivery vehicle designed to bind Cas protein and guide RNA, a nano-complex containing the bound Cas protein and guide RNA, and a gene editing method using same. The use of the nano-complex of the present invention allows for stable and effective delivery of the guide RNA and the Cas protein at the same time into the target cells.

Description

나노 입자-CRISPR 결합체를 기반으로 하는 유전자 조작 및 이의 제조 방법Genetic manipulation based on nanoparticle-CRISPR conjugate and method for producing the same
본 발명은 나노 입자 및 이에 결합된 Cas 단백질 및 가이드 RNA를 포함하는 CRISPR-Cas 시스템을 위한 나노 복합체 및 이를 이용한 유전자 편집 방법으로서, 상기 나노 복합체를 제조하고, 이를 세포 내로 전달하여 목적 유전자를 편집하는 기술에 대한 것이다.The present invention is a nanocomplex for the CRISPR-Cas system comprising nanoparticles and Cas protein and guide RNA bound thereto, and a gene editing method using the same. The nanocomplex is prepared and delivered into cells to edit the target gene. It's about technology.
유전자는 모든 생물체가 가지고 있는 유기 물질로, 생물체의 구성, 유지 및 세포의 유기적인 상호관계를 이루는데 필요한 모든 정보가 담겨있다. 유전자는 다양한 요인에 의해 손상을 입을 수 있으며, 유전자의 손상은 다양한 질병으로 발전할 수 있다.Genes are organic substances possessed by all living organisms, and contain all the information necessary for the composition and maintenance of living organisms and the organic interrelationships between cells. Genes can be damaged by various factors, and genetic damage can develop into various diseases.
또한 상기 유전자는 교정(editing)을 통해 유전 정보를 자유롭게 교정할 수 있으며, 유전자 교정(gene editing) 기술은 인간을 포함하는 동물, 식물, 나아가 미생물의 유전 정보를 변화시켜 이를 활용하고자 하는 것으로, 특히 유전자 가위라고 불리는 유전자 편집을 위한 기술은 유전자의 교정을 가능하게 하고, 유전정보의 활용 및 활용 영역을 확대하는 데 있어 중요한 기술로 연구되고 있다. 유전자 가위는 징크핑거와 같은 1세대, TALEN과 같은 2세대 유전자 가위를 거쳐, 최근에는 CRISPR(Clustered regularly interspaced short palindromic repeat)-Cas(CRISPR-associated) 9이라는 3세대 유전자 가위가 개발되어 있다. CRISPR/Cas9은 세균의 면역 반응에 관여하는 단백질에서 유래한 것으로 외부에서 침입한 바이러스 유전자를 절단함으로서 박테리아를 보호하는 기능을 가진다. 따라서 3세대 기술에서는 유전자 절단 기능을 가지는 CRISPR-Cas9 과 서열 선택성을 부여하는 sgRNA가 동시에 작동하는 것이 필요하다. 유전자를 절단할 수 있는 Cas9 단백질은single guide RNA(sgRNA)와 complex를 이루고 있는 형태로서, 활성 엔도뉴클레아제(endonuclease)를 형성하여 파지 또는 플라스미드가 침입한 경우, 이의 유전적 요소를 분해하여 숙주 세포를 보호한다. In addition, the above genes can freely correct genetic information through editing, and gene editing technology seeks to utilize this by changing the genetic information of animals, plants, and even microorganisms, including humans. Gene editing technology, called genetic scissors, is being studied as an important technology for enabling gene editing and expanding the scope of use and utilization of genetic information. Genetic scissors go through first generation gene scissors such as zinc finger, second generation gene scissors such as TALEN, and recently, a third generation gene scissors called CRISPR (Clustered regularly interspaced short palindromic repeat)-Cas (CRISPR-associated) 9 has been developed. CRISPR/Cas9 is derived from a protein involved in the immune response of bacteria and has the function of protecting bacteria by cutting viral genes that invade from the outside. Therefore, in the third generation technology, it is necessary for CRISPR-Cas9, which has a gene cutting function, and sgRNA, which provides sequence selectivity, to operate simultaneously. The Cas9 protein, which can cleave genes, forms a complex with a single guide RNA (sgRNA) and forms an active endonuclease that decomposes the genetic elements of the phage or plasmid when it invades the host. Protects cells.
이러한 CRISPR-Cas9 시스템 유래의 RNA-가이드 뉴클레아제(RNA-guided nuclease)는 유전자 편집에 활용될 수 있다. 특히 단일 가이드 RNA(sgRNA)와 Cas 단백질을 이용하여 세포 및 기관의 유전체를 편집할 수 있으며, 특히 손상된 유전자를 제거하거나, 수정하여 유전자 손상에 의한 질환을 치료하는데 활용될 수 있다. 이러한 방법을 활용하기 위하여 CRISPR-Cas9 시스템의 작동을 위한 Cas9 단백질과 sgRNA 등을 목적 유전자가 위치한 세포 내로 전달하기 위하여, 렌티바이러스, 아데노바이러스, AAV와 같은 바이러스성 운반체를 이용하거나, 리포솜, 나노입자, 엑소좀, 미세운반체(microvesicle) 등의 비 바이러스성 운반체를 이용하는 기술이 공지되어 있다.This RNA-guided nuclease derived from the CRISPR-Cas9 system can be used for gene editing. In particular, single guide RNA (sgRNA) and Cas proteins can be used to edit the genomes of cells and organs. In particular, it can be used to treat diseases caused by gene damage by removing or modifying damaged genes. To use this method, use viral carriers such as lentivirus, adenovirus, AAV, liposomes, or nanoparticles to deliver Cas9 protein and sgRNA for the operation of the CRISPR-Cas9 system into the cell where the target gene is located. , technologies using non-viral carriers such as exosomes and microvesicles are known.
CRISPR-Cas9 시스템에 사용되는 바이러스성 운반체 기술은 바이러스 고유의 증식 기전을 이용한 유전자 운반체로 아데노바이러스 (Adenovirus), 레트로바이러스(Retrovirus), 아데노부속바이러스 (Adeno-Associated Virus, AAV) 등이 대표적이다. 바이러스성 운반체 기술은 유전자의 전달 효율은 높으나, 병원성이 있는 바이러스이므로 강력한 면역반응을 유도하는 등의 안전성 문제가 있으며, 바이러스 벡터 내 삽입 가능한 유전자 크기에 한계가 있어 적용 가능한 유전자가 제한적이다.The viral carrier technology used in the CRISPR-Cas9 system is a gene carrier that uses the virus's unique proliferation mechanism, and representative examples include Adenovirus, Retrovirus, and Adeno-Associated Virus (AAV). Viral carrier technology has high gene transfer efficiency, but because it is a pathogenic virus, there are safety issues such as inducing a strong immune response, and there is a limit to the size of the gene that can be inserted into the viral vector, so applicable genes are limited.
이에 비해, 비바이러스성 운반체 기술은 인체 세포 내 바이러스 유전 물질의 유입이 되지 않고 생산이 용이하며, 운반체 내 삽입 유전자의 크기를 무제한으로 할 수 있고, 숙주에 대한 면역 반응이 낮아 부작용이 적은 장점이 있다. 하지만 바이러스성 운반체에 비해 세포 내 전달 효율이 낮은 단점을 가진다.In comparison, non-viral carrier technology has the advantage of being easy to produce without introducing viral genetic material into human cells, allowing unlimited size of inserted genes in the carrier, and having fewer side effects due to lower immune response to the host. there is. However, it has the disadvantage of low intracellular delivery efficiency compared to viral carriers.
본 발명자의 이전 연구에서 유전자를 목적 세포 내로 전달하기 위한 금나노 운반체(특허 제10-1230913호), 항체 전달을 위한 금 나노 입자 전달체(특허 제10-2236120호)를 개발한 바 있다. 유전자 운반체는 금 나노 입자에 유전자의 결합을 위한 결합 파트너를 도입하여 타겟 유전자의 결합을 가능하게 하였다. 항체 전달을 위한 운반체의 경우, 상기 항체의 결합에 적합한 앱타머를 적용한 것이다. 그러나, CRISPR-Cas9 시스템과 같이, 유전자와 단백질을 동시에 필요로 하는 시스템에서 이를 동시에 운반할 수 있는 운반체에 대한 연구가 필요한 실정이다. In our previous research, we have developed a gold nano-carrier for delivering genes into target cells (Patent No. 10-1230913) and a gold nanoparticle carrier for delivering antibodies (Patent No. 10-2236120). The gene carrier made it possible to bind the target gene by introducing a binding partner for gene binding to the gold nanoparticle. In the case of a carrier for antibody delivery, an aptamer suitable for binding the antibody is applied. However, in systems that require both genes and proteins, such as the CRISPR-Cas9 system, research is needed on carriers that can transport them simultaneously.
이에 본 발명자들은 CRISPR-Cas9 시스템의 작동을 위한 sgRNA 및 Cas 단백질을 동시에 전달할 수 있는 나노 입자 전달체로서, 나노 물질 표면에 공유 결합으로 sgRNA가 결합할 수 있는 결합 파트너로서의 cargo DNA 및 Cas 단백질과 결합 가능한 앱타머를 포함하여 이를 동시에 목적 세포 내로 운반할 수 있는 복합체에 대한 본 발명을 완성하게 되었다.Accordingly, the present inventors have developed a nanoparticle carrier that can simultaneously deliver sgRNA and Cas protein for the operation of the CRISPR-Cas9 system, and a cargo DNA as a binding partner that can covalently bind sgRNA to the surface of the nanomaterial and can bind to Cas protein. The present invention regarding a complex that includes an aptamer and can simultaneously transport it into a target cell has been completed.
따라서 본 발명의 목적은 나노 입자, 상기 나노 입자 표면에 연결된 DNA 결합 파트너 및 앱타머를 포함하는 전달체; 및 이에 결합된 운반 대상으로서 가이드 RNA 및 Cas 단백질을 포함하는 나노 복합체를 제공하는 것이다. Therefore, the object of the present invention is a delivery vehicle comprising nanoparticles, a DNA binding partner and an aptamer linked to the surface of the nanoparticle; and a nanocomplex containing guide RNA and Cas protein as a transport object bound thereto.
본 발명의 다른 목적은 나노 입자, 상기 나노 입자 표면에 연결된 DNA 결합 파트너 및 앱타머를 포함하는 전달체; 및 이에 결합된 운반 대상으로서 가이드 RNA 및 Cas 단백질을 포함하는 나노 복합체를 제조하는 방법에 대한 것이다. Another object of the present invention is a delivery vehicle comprising nanoparticles, a DNA binding partner and an aptamer linked to the surface of the nanoparticles; and a method of manufacturing a nanocomposite containing guide RNA and Cas protein as a transport object bound thereto.
본 발명의 또 다른 목적은 상기 나노 복합체를 이용한 세포의 유전자 편집용 조성물 및 편집 방법을 제공하는 것이다.Another object of the present invention is to provide a composition and editing method for gene editing of cells using the nanocomposite.
상기와 같은 목적을 달성하기 위하여, 본 발명은 나노 입자, 상기 나노 입자 표면에 연결된 DNA 결합 파트너 및 앱타머를 포함하는 전달체; 및 이에 결합된 가이드 RNA 및 Cas 단백질을 포함하는 복합체를 제공한다.In order to achieve the above object, the present invention provides a delivery vehicle including nanoparticles, a DNA binding partner and an aptamer linked to the surface of the nanoparticles; A complex comprising a guide RNA and a Cas protein bound thereto is provided.
본 발명의 다른 목적을 달성하기 위하여 본 발명은, 나노 입자, 상기 나노 입자 표면에 연결된 DNA 결합 파트너 및 앱타머를 포함하는 전달체; 및 이에 결합된 운반 대상으로서 가이드 RNA 및 Cas 단백질을 포함하는 나노 복합체를 제조하는 방법을 제공한다. In order to achieve another object of the present invention, the present invention includes: a nanoparticle, a delivery vehicle including a DNA binding partner and an aptamer linked to the surface of the nanoparticle; and a method of manufacturing a nanocomplex containing a guide RNA and a Cas protein as a transport object bound thereto.
본 발명의 또 다른 목적을 달성하기 위하여 본 발명은 상기 나노 복합체를 이용한 세포의 유전자 편집용 조성물 및 편집 방법을 제공한다. In order to achieve another object of the present invention, the present invention provides a composition and editing method for gene editing of cells using the nanocomposite.
이하, 본 발명을 상세하게 설명한다. Hereinafter, the present invention will be described in detail.
본 발명은 CRISPR-Cas 시스템에서 Cas (CRISPR associated protein) 단백질, 가이드 RNA를 전달하기 위한 복합체로서, 나노 입자, 상기 나노 입자 표면에 연결되어 가이드 RNA를 전달하기 위한 DNA 결합 파트너 및 Cas 단백질에 상보적으로 결합하는 앱타머를 포함하는 나노 입자 전달체를 포함한다. 상기 나노 입자 전달체는 가이드 RNA와 Cas 단백질을 목적 세포 내로 함께 전달할 수 있으며, 종래의 전달체에 비해 안정적이고 효과적인 전달이 가능하며, 특히 동물, 식물 세포 모두에서 CRISPR-Cas 유전자 가위를 이용한 유전자 편집이 가능한 나노 복합체에 대한 것이다. The present invention is a complex for delivering Cas (CRISPR associated protein) protein and guide RNA in the CRISPR-Cas system, which is complementary to nanoparticles, a DNA binding partner for delivering guide RNA by linking to the surface of the nanoparticle, and Cas protein. It includes a nanoparticle delivery vehicle containing an aptamer that binds to. The nanoparticle delivery vehicle can deliver guide RNA and Cas protein together into target cells, and enables stable and effective delivery compared to conventional delivery vehicles, and is especially capable of gene editing using CRISPR-Cas gene scissors in both animal and plant cells. It's about nanocomposites.
본 발명의 일 양태로서, 본 발명은 나노 입자, 상기 나노 입자 표면에 연결되어 가이드 RNA를 전달하기 위한 DNA 결합 파트너 및 Cas 단백질에 상보적으로 결합하는 앱타머를 포함하며, 상기 DNA 결합 파트너에 결합된 가이드 RNA 및 상기 앱타머에 결합된 Cas 단백질을 포함하는 나노 복합체를 제공한다. In one aspect of the present invention, the present invention includes a nanoparticle, a DNA binding partner linked to the surface of the nanoparticle to deliver guide RNA, and an aptamer that binds complementary to a Cas protein, and binds to the DNA binding partner. Provided is a nanocomplex containing a guide RNA and a Cas protein bound to the aptamer.
손상된 유전자를 치료하거나, 기존의 유전자를 조작하기 위하여, 유전자 편집 기술을 활용할 수 있다. 최근 개발된 유전자 편집 기술 중, CRISPR-Cas 유전자 가위 시스템은 유전체, 또는 유전자의 단일 염기 수준에서 유전자의 편집이 가능하다. 이를 위하여, 편집 대상이 되는 유전자에 대한 가이드 RNA 및 Cas 단백질의 세포 내 이동이 필요하며, 본 발명의 나노 복합체는 독성이 없고, 외래 유전자 및 단백질을 세포 내로 효율적으로 전달할 수 있는 것으로서, 정상 세포에 영향을 주지 않고 타겟 유전자의 편집이 가능하도록 개발되었다. Gene editing technology can be used to treat damaged genes or manipulate existing genes. Among recently developed gene editing technologies, the CRISPR-Cas gene editing system is capable of editing genes at the level of the genome or single base of a gene. For this purpose, intracellular movement of guide RNA and Cas protein for the gene to be edited is required, and the nanocomplex of the present invention is non-toxic and can efficiently deliver foreign genes and proteins into cells, It was developed to enable editing of target genes without causing any damage.
본 발명에서 상기 '나노 입자(NP, nanoparticle)'는 크기가 바람직하게는 1-100 nm 크기를 가지는 물질을 의미한다. 본 발명에서 사용되는 나노 입자는 나노 크기를 갖는 물질이라면 형태 및 모양은 특별히 한정되지 않는다(예컨대, 입자, 튜브, 막대기 또는 정사면체와 같은 형태). 본 발명의 바람직한 구현예에 따르면, 상기 “나노 입자”는 나노 단위의 직경, 바람직하게는 8-100 nm, 보다 바람직하게는 10-50 nm, 가장 바람직하게는 12-14 nm의 직경을 가지는 다양한 물질의 입자를 의미한다. 상기 나노 입자는 나노 크기를 갖는 입자라면 특별히 제한되지 않는다.In the present invention, the 'nanoparticle (NP)' refers to a material preferably having a size of 1-100 nm. The shape and shape of the nanoparticles used in the present invention are not particularly limited as long as they are nano-sized materials (for example, shapes such as particles, tubes, rods, or tetrahedrons). According to a preferred embodiment of the present invention, the “nanoparticles” are various particles having a diameter in nanoscale, preferably 8-100 nm, more preferably 10-50 nm, and most preferably 12-14 nm. It refers to particles of matter. The nanoparticles are not particularly limited as long as they are nano-sized particles.
본 발명의 가장 바람직한 구현예에 따르면, 본 발명에서 이용되는 나노 입자는 금 나노 입자를 의미한다. 금 나노 입자는 안정한 입자의 형태로 제조가 쉬울 뿐만 아니라 0.8 nm에서 200 nm까지 다양하게 사용 목적에 맞추어 크기를 변화시킬 수 있다. 또한, 금은 다양한 종류의 분자들, 예컨대 펩타이드, 단백질, 핵산 등과 함께 결합하여 구조를 변형시킬 수 있고, 다양한 파장에서 빛에 반사하는 바, 이를 이용해 세포 내에서의 위치를 쉽게 확인할 수 있다. 또한, 금 나노 입자는 망간, 알루미늄, 카드늄, 납, 수은, 코 발트, 니켈, 베릴륨 등의 중금속과 달리 인체에 무해하여 높은 생체친화성을 가진다.According to the most preferred embodiment of the present invention, the nanoparticles used in the present invention refer to gold nanoparticles. Gold nanoparticles are not only easy to manufacture in the form of stable particles, but their size can be varied from 0.8 nm to 200 nm to suit various purposes. In addition, gold can modify the structure by combining with various types of molecules, such as peptides, proteins, and nucleic acids, and reflects light at various wavelengths, making it easy to confirm its location within the cell. In addition, gold nanoparticles are harmless to the human body and have high biocompatibility, unlike heavy metals such as manganese, aluminum, cadmium, lead, mercury, cobalt, nickel, and beryllium.
상기 금 나노 입자는 직경이 100 nm 이상으로 커질 경우 나노 입자로서의 특성이 소멸될 뿐 아니라, 나노 입자의 특성이 없는 금 표면과 티올기 등의 작용기와의 결합이 약해지기 때문에 금 입자를 매개로 하여 올리고T가 결합된 입자를 제조하기 어렵다. 따라서, 본 발명의 금 나노 입자의 직경은 이에 제한되는 것은 아니나, 바람직하게는 8-100 nm, 보다 바람직하게는 10-50 nm, 가장 바람직하게는 12-14 nm일 수 있다. When the diameter of the gold nanoparticles increases beyond 100 nm, not only do their characteristics as nanoparticles disappear, but the bond between the gold surface, which does not have the characteristics of nanoparticles, and functional groups such as thiol groups becomes weak, so the gold nanoparticles are used as a medium. It is difficult to manufacture particles with oligoT bound. Therefore, the diameter of the gold nanoparticles of the present invention is not limited thereto, but may preferably be 8-100 nm, more preferably 10-50 nm, and most preferably 12-14 nm.
본 발명에서 이용되는 금 나노 입자는 예컨대, 다음과 같이 제조될 수 있다: HAuCl4를 금 공급원으로 하고, 소듐 시트레이트를 환원제로 하여 HAuCl4를 환원시켜 금 나노 입자를 제조한다. 이 경우, 금 나노 입자의 크기는 첨가하는 시트레이트를 달리 해줌으로써 조절이 가능한다. 즉, 시트레이트의 첨가량을 증가시킬수록 핵형성(nucleation)이 많이 되기 때문에 금 나노 입자의 크기는 감소한다.Gold nanoparticles used in the present invention can be prepared, for example, as follows: gold nanoparticles are prepared by reducing HAuCl 4 using HAuCl 4 as a gold source and sodium citrate as a reducing agent. In this case, the size of the gold nanoparticles can be adjusted by varying the added citrate. In other words, as the amount of citrate added increases, nucleation increases and the size of gold nanoparticles decreases.
본 발명에서 가이드 RNA를 전달하기 위한 DNA 결합 파트너는 가이드 RNA와 상보적으로 결합하는 서열을 포함하며, 상기 DNA 결합 파트너는 본 발명의 나노 복합체의 운반 대상(Cargo)인 DNA 로서, 목적 유전자의 편집 대상이 되는 서열로부터 유래된 염기 서열을 포함한다. 상기 DNA 결합 파트너는 나노 복합체와 가이드 RNA의 결합을 매개하며, 상기 나노 복합체에 결합된 가이드 RNA가 세포 내로 이동하여, 세포 내에서 타겟 서열에 상보적으로 결합할 수 있도록 한다. In the present invention, the DNA binding partner for delivering the guide RNA includes a sequence that binds complementary to the guide RNA, and the DNA binding partner is DNA that is the cargo of the nanocomplex of the present invention, and is used to edit the target gene. Includes a base sequence derived from the target sequence. The DNA binding partner mediates the binding of the nanocomplex and the guide RNA, and allows the guide RNA bound to the nanocomplex to move into the cell and bind complementary to the target sequence within the cell.
또한 상기 DNA 결합 파트너는 본 발명자의 선행 특허인 한국 특허 제10-1230913호에 기재된 유니버셜 결합 파트너로서의 올리고뉴클레오타이드를 포함할 수 있으며, 상기 유니버셜 결합 파트너를 포함하는 경우 특별히 유래 서열 또는 생물에 제한되지 않는 다양한 서열로 이루어진 가이드 RNA를 운반할 수 있는 나노 복합체를 제작할 수 있다. 이 때, 상기 유니버셜 결합 파트너에 결합하기 위한 결합 카운터 파트너 서열이 상기 가이드 RNA에 추가로 포함될 수 있으며, 이는 상기 선행 특허에 기재된 내용을 참고하여 제작할 수 있다. In addition, the DNA binding partner may include an oligonucleotide as a universal binding partner described in Korean Patent No. 10-1230913, a prior patent of the present inventor, and when including the universal binding partner, it is not particularly limited to the derived sequence or organism. Nanocomplexes capable of transporting guide RNAs composed of various sequences can be produced. At this time, a binding counter partner sequence for binding to the universal binding partner may be additionally included in the guide RNA, which can be produced by referring to the information described in the prior patent.
상기 '가이드 RNA'는 편집 대상이 된 목적 유전자로부터 유래한 서열을 포함하는 것으로서, 표적 DNA에 특이적인 RNA (예컨대, DNA의 표적 부위와 혼성화 가능한 RNA)를 의미한다. 상기 가이드 RNA는 종류에 제한이 없으며, 예를 들어 CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA), 또는 이들의 조합을 포함하는 이중 가이드 RNA (dual guide RNA), 또는 단일 가이드 RNA (sgRNA)일 수 있으며, 보다 바람직하게는 단일 가이드 RNA(sgRNA)일 수 있으나 이에 제한되는 것은 아니다. 본 발명에서 상기 가이드 RNA는 sgRNA일 수 있다. The 'guide RNA' includes a sequence derived from the target gene to be edited, and refers to RNA specific to the target DNA (eg, RNA capable of hybridizing with the target site of DNA). The guide RNA is not limited in type, for example, CRISPR RNA (crRNA), trans-activating crRNA (tracrRNA), dual guide RNA including a combination thereof, or single guide RNA (sgRNA). It may be, and more preferably, it may be a single guide RNA (sgRNA), but is not limited thereto. In the present invention, the guide RNA may be sgRNA.
본 명세서에서, 유전자 표적 부위와 혼성화 가능한 뉴클레오타이드 서열은 유전자 표적 부위의 뉴클레오타이드 서열 (보다 구체적으로, 유전자 표적 부위의 DNA 이중 가닥 중 PAM이 존재하는 가닥의 반대 가닥의 뉴클레오타이드 서열)과 50% 이상, 60% 이상, 70% 이상, 80% 이상, 90% 이상, 95% 이상, 99% 이상, 또는 100%의 서열 상보성을 갖는 뉴클레오타이드 서열을 의미한다 (이하, 특별한 언급이 없는 한 동일한 의미로 사용된다).In the present specification, the nucleotide sequence capable of hybridizing with the gene target site is at least 50%, 60% or more of the nucleotide sequence of the gene target site (more specifically, the nucleotide sequence of the strand opposite to the strand on which the PAM is present among the DNA double strands of the gene target site). refers to a nucleotide sequence having sequence complementarity of % or more, 70% or more, 80% or more, 90% or more, 95% or more, 99% or more, or 100% (hereinafter, unless otherwise specified, it is used with the same meaning) .
본 발명에서 상기 Cas 단백질은 가이드 RNA와 복합체를 형성하여, 편집의 타겟이 되는 DNA 서열을 절단하는 역할을 한다. 가이드 RNA가 타겟 서열을 인지하여 결합되며, 복합체를 형성한 Cas 단백질이 작용하여 타겟 DNA를 절단한다. 상기 Cas 단백질은 Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3 및 Csf4 등이 알려져 있고, 특히 Cas9, Cas12a(Cpf1) 및 Cas3 등이 사용될 수 있으나, 그 종류에 제한되는 것은 아니다. 본 발명의 일 실시예에서 사용된 Cas 단백질은 Cas9 단백질이나, 이에 제한되는 것은 아니다. 상기 Cas 단백질은 앱타머에 의해 금 나노 입자에 결합되며, 상기 앱타머는 그 Cas 단백질을 부착하기 위한 구조를 가지는 것이면 서열 및 구조에 제한되는 것은 아니며, 본 발명의 실시예에서는 His-tag 앱타머를 사용하였다. In the present invention, the Cas protein forms a complex with guide RNA and serves to cleave the DNA sequence that is the target of editing. The guide RNA recognizes the target sequence and binds to it, and the Cas protein that forms the complex acts to cleave the target DNA. The Cas proteins include Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9, Cas10, Cas12a, Cas12b, Cas12c, Cas12d, Cas12e, Cas13a, Cas13b, Cas13c, Cas13d, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3 , Csx1, Csx15, Csf1, Csf2, Csf3, and Csf4 are known, and in particular, Cas9, Cas12a (Cpf1), and Cas3 may be used, but the types are not limited. The Cas protein used in one embodiment of the present invention is Cas9 protein, but is not limited thereto. The Cas protein is bound to the gold nanoparticle by an aptamer, and the aptamer is not limited in sequence and structure as long as it has a structure for attaching the Cas protein. In an embodiment of the present invention, a His-tag aptamer is used. used.
본 발명에서 상기 나노 복합체는 세포 및/또는 유기체의 유전자 교정에 적용될 수 있으며, 상기 세포 및/또는 유기체는 진핵 세포 또는 진핵 유기체일 수 있다. 상기 진핵 세포 및/또는 진핵 유기체는, 예컨대, 진핵 세포 (예컨대, 효모 등의 균류, 진핵 동물 유래 및/또는 진핵 식물 유래 세포 (예컨대, 배아세포, 줄기세포, 체세포, 생식 세포 등), 진핵 동물 (예컨대, 인간, 원숭이 등의 영장류, 개, 돼지, 소, 양, 염소, 마우스, 래트 등), 및 진핵 식물(예컨대, 녹조류 등의 조류, 옥수수, 콩, 밀, 벼 등)로 이루어진 군에서 선택된 것일 수 있다. In the present invention, the nanocomposite may be applied to gene editing of cells and/or organisms, and the cells and/or organisms may be eukaryotic cells or eukaryotic organisms. The eukaryotic cells and/or eukaryotic organisms include, for example, eukaryotic cells (e.g., fungi such as yeast, eukaryotic animal-derived and/or eukaryotic plant-derived cells (e.g., embryonic cells, stem cells, somatic cells, germ cells, etc.), eukaryotic animals, etc. (e.g., primates such as humans and monkeys, dogs, pigs, cattle, sheep, goats, mice, rats, etc.), and eukaryotic plants (e.g., algae such as green algae, corn, soybeans, wheat, rice, etc.) It may be selected.
본 발명의 상기 유전자는 식물체에 포함된 식물 세포로서, 식물 원형질체를 포함할 수 있다. "식물 원형질체"란, 식물 세포에서 세포벽이 제거된 것을 의미한다. 식물 원형질체는 식물 세포에 셀룰라아제(cellulase), 펙티나아제(pectinase), 자일라나아제(xylanase) 등의 효소를 처리하여 제조할 수 있다. 상기 식물 원형질체는 다양한 식물로부터 유래될 수 있으며, 그 종류에 제한되는 것은 아니다. The gene of the present invention is a plant cell contained in a plant body, and may include plant protoplasts. “Plant protoplast” means a plant cell with the cell wall removed. Plant protoplasts can be produced by treating plant cells with enzymes such as cellulase, pectinase, and xylanase. The plant protoplasts may be derived from various plants and are not limited to the types.
본 발명에서 상기 나노 복합체는 유전자 편집을 위한 CRISPR-Cas 시스템에서 가이드 RNA 및 Cas 단백질의 운반체로서 유전자 편집을 위한 조성물로 활용될 수 있다. In the present invention, the nanocomplex can be used as a composition for gene editing as a carrier of guide RNA and Cas protein in the CRISPR-Cas system for gene editing.
본 발명의 다른 양태로서, 본 발명은 나노 입자, 상기 나노 입자 표면에 연결된 DNA 결합 파트너 및 앱타머를 포함하는 전달체; 및 이에 결합된 운반 대상으로서 가이드 RNA 및 Cas 단백질을 포함하는 나노 복합체를 제조하는 방법에 대한 것이다. In another aspect of the present invention, the present invention provides a delivery system comprising nanoparticles, a DNA binding partner linked to the surface of the nanoparticles, and an aptamer; and a method of manufacturing a nanocomposite containing guide RNA and Cas protein as a transport object bound thereto.
본 발명의 상기 나노 복합체 제조 방법은 나노 입자를 제조하는 단계; Cas 단백질과 특이적으로 결합하는 앱타머 및 편집 대상인 타겟 유전자 서열을 포함하는 DNA 결합 파트너를 상기 나노 입자 표면에 공유결합으로 결합시켜 나노 전달체를 제작하는 단계; 및 운반 대상이 되는 가이드 RNA 및 Cas 단백질을 상기 나노 입자에 결합하여 나노 복합체를 제작하는 단계를 포함한다. The nanocomposite manufacturing method of the present invention includes manufacturing nanoparticles; Fabricating a nano-delivery vehicle by covalently binding an aptamer that specifically binds to a Cas protein and a DNA binding partner containing a target gene sequence to be edited to the surface of the nanoparticle; And it includes the step of producing a nanocomposite by binding the guide RNA and Cas protein to be transported to the nanoparticle.
또한 본 발명의 또 다른 양태로서 본 발명은 상기 제작된 나노 복합체를 이용하여 세포의 목적 유전자를 교정(editing) 하는 방법에 대한 것이다.In addition, as another aspect of the present invention, the present invention relates to a method of editing a target gene of a cell using the manufactured nanocomposite.
본 발명은 본 발명은 Cas 단백질 및 가이드 RNA가 결합하도록 제작된 나노 입자 전달체 및 이에 결합된 Cas 단백질 및 가이드 RNA를 포함하는 나노 복합체 및 이를 이용한 유전자 편집 방법으로서, 목적 세포 내로 가이드 RNA 및 Cas 단백질을 동시에 안정적이고 효과적으로 전달할 수 있는 효과를 가진다. The present invention relates to a nanoparticle delivery vehicle designed to bind Cas protein and guide RNA, a nanocomplex containing Cas protein and guide RNA bound thereto, and a gene editing method using the same, which delivers guide RNA and Cas protein into a target cell. At the same time, it has the effect of being delivered stably and effectively.
도 1은 본 발명의 나노 복합체를 제조하는 과정을 나타낸 모식도이다. Figure 1 is a schematic diagram showing the process of manufacturing the nanocomposite of the present invention.
도 2는 본 발명의 나노 전달체에 따른 Cas9 단백질 및 sgRNA의 세포 내 전달력을 공초점 현미경을 통해 확인한 결과이다. Figure 2 shows the results of confirming the intracellular delivery ability of Cas9 protein and sgRNA according to the nano-delivery vehicle of the present invention through confocal microscopy.
도 3은 본 발명의 나노 전달체에 따른 Cas9 단백질 및 sgRNA의 세포 내 전달능을 웨스턴 블랏을 통해 확인한 결과이다. Figure 3 shows the results of confirming the intracellular delivery ability of Cas9 protein and sgRNA according to the nano-delivery vehicle of the present invention through Western blot.
도 4는 본 발명의 나노 전달체에 결합된 CRISPR-Cas9 시스템을 이용한 식물 유전자 조작 결과를 확인한 것이다. Figure 4 confirms the results of plant genetic manipulation using the CRISPR-Cas9 system coupled to the nano-delivery vehicle of the present invention.
도 5는 본 발명의 나노 전달체를 이용하여 목적 유전자의 타겟 부위를 증폭한 후 시퀀싱하여 삽입 및 결실 서열을 분석한 결과이다.Figure 5 shows the results of analyzing the insertion and deletion sequences by amplifying the target region of the target gene using the nano-delivery vehicle of the present invention and then sequencing it.
이하, 본 명세서를 구체적으로 설명하기 위해 실시예를 들어 상세히 설명한다. 그러나, 본 명세서에 따른 실시예들은 여러 가지 다른 형태로 변형될 수 있으며, 본 명세서의 범위가 아래에서 상술하는 실시예들에 한정되는 것으로 해석되지는 않는다. 본 명세서의 실시예들은 당업계에서 평균적인 지식을 가진 자에게 본 명세서를 보다 완전하게 설명하기 위해 제공되는 것이다.Hereinafter, examples will be given in detail to explain the present specification in detail. However, the embodiments according to the present specification may be modified into various other forms, and the scope of the present specification is not to be construed as being limited to the embodiments described in detail below. The embodiments of this specification are provided to more completely explain the present specification to those with average knowledge in the art.
실시예 1. 기능화된 금 나노 입자 (AuNPHis -Cas9RNP 컨쥬게이트)의 제조 Example 1. Preparation of functionalized gold nanoparticles ( AuNP His -Cas9RNP conjugate)
sgRNA 및 Cas9 단백질을 금 나노 입자에 공유 결합시켜 나노 복합체를 제조하였으며, 상기 제조 과정의 모식도는 도 1과 같다. A nanocomposite was prepared by covalently binding sgRNA and Cas9 protein to gold nanoparticles, and a schematic diagram of the manufacturing process is shown in Figure 1.
1-1.13nm 금 나노 입자 제조 Fabrication of 1-1.13nm gold nanoparticles
본 발명에서 이용되는 금 나노 입자는 HAuCl4를 금 공급원으로 하고, 소듐 시트레이트를 환원제로 하여 HAuCl4를 환원시켜 금 나노 입자를 제조하였다. 보다 구체적으로, 0.92 mM의 HAuCl4 용액 545ml과 388 mM의 소듐 시트레이드 용액 5 ml을 섞은 후, 100C에서 15분간 반응하였다. 반응물을 투과 전자현미경으로 분석하여 나노 입자의 합성 여부 및 크기를 확인하였다 (도2).The gold nanoparticles used in the present invention were prepared by reducing HAuCl 4 using HAuCl 4 as a gold source and sodium citrate as a reducing agent. More specifically, 545ml of 0.92mM HAuCl 4 solution and 5ml of 388mM sodium citrate solution were mixed and reacted at 100C for 15 minutes. The reactants were analyzed using a transmission electron microscope to confirm the synthesis and size of nanoparticles (Figure 2).
1-2. His- Aptamer의 전처리1-2. Pretreatment of His-Aptamer
본 발명에 따른 유전자 운반체를 제조하기 위해, Histidine 탐지하여 이에 특이적으로 결합하는 DNA-앱타머를 사용하였다(특허10-1596552). 보다 구체적으로, 상기 히스티딘-tag DNA 앱타머는 3’말단이 티올기로 변형된 앱타머로서, 5' - GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGCAAAAAAAAAA - 3'의 염기 서열로 이루어졌다. 건조된 상기 앱타머를 최종 농도가 100 μM이 되도록 물에 녹인 후, 150 μl의 올리고에 20μl의 3M sodium acetate와 30 μl의 1N DTT(dithiothreitol)를 넣고, 실온에서 60분간 반응시켰다. 원하지 않은 티올기 분자를 포함한 DTT를 제거하기 위해, 에틸아세테이트(Ethyl acetate) 200 μl를 넣고 섞은 후, 원심 분리하여 상층액을 제거하였으며, 이 과정을 3회 반복하였다. 이후 에탄올 침전법(EtOH precipitating method)을 이용하여 DNA 앱타머를 침전시켰다.To manufacture the gene carrier according to the present invention, a DNA-aptamer that detects and specifically binds to histidine was used (Patent 10-1596552). More specifically, the histidine-tag DNA aptamer is an aptamer whose 3' end is modified with a thiol group, and consists of the base sequence 5' - GCTATGGGTGGTCTGGTTGGGATTGGCCCCGGGAGCTGGCAAAAAAAAAA - 3'. After dissolving the dried aptamer in water to a final concentration of 100 μM, 20 μl of 3M sodium acetate and 30 μl of 1N DTT (dithiothreitol) were added to 150 μl of oligo, and reacted at room temperature for 60 minutes. To remove DTT containing unwanted thiol molecules, 200 μl of ethyl acetate was added and mixed, then centrifuged to remove the supernatant, and this process was repeated three times. Afterwards, the DNA aptamer was precipitated using the ethanol precipitation method (EtOH precipitating method).
1-3. 금 나노 입자와 DNA 앱타머(AuNP-Apthis ) 결합 1-3. Combination of gold nanoparticles and DNA aptamer ( AuNP-Apt his )
상기 실시예 1-2와 같이 전처리하여 침전시킨 DNA 앱타머를 물에 녹인 후, 상기 실시예 1-1에서 합성된 금 나노 입자에 첨가한 후, Salt aging 방법으로 결합시켰다. The DNA aptamer pretreated and precipitated as in Example 1-2 was dissolved in water, then added to the gold nanoparticles synthesized in Example 1-1, and then combined with the salt aging method.
구체적으로, 6 nM의 금 나노 입자에 DNA 앱타머를 넣고(AuNP : His 앱타머 비율 = 1:300) 충분히 섞은 후, 농도가 0.1M 이 되도록 NaCl을 첨가하여 4시간 동안 혼합하였다. 4시간 후 농도가 0.2M 이 되도록 NaCl을 첨가하여 4시간 혼합하였다. 4시간 후 농도가 0.3M 이 되도록 NaCl을 첨가하여 12시간 혼합하였다. 12시간 후 DNA 앱타머와 금 혼합물은 ~10,000*g에서 20 분간 원심 분리하여 모은 뒤 상층액에 있는 반응하지 않은 DNA 앱타머를 제거하였고, 이 과정을 3회 반복하였다. 최종 금 나노 입자-DNA 앱타머 결합물은 0.1 M NaCl를 포함하는 10mM sodium phosphate buffer (pH 7.4)에 넣고 분산시켰다. 제조된 금 나노 입자-DNA 앱타머 결합물을 10% acrylamide 8M Urea gel을 이용하여 전기 영동으로 분석한 결과, 한 개의 금 나노 입자에 130~150개의DNA 앱타머가 결합됨을 확인하였다.Specifically, DNA aptamer was added to 6 nM gold nanoparticles (AuNP: His aptamer ratio = 1:300) and thoroughly mixed, then NaCl was added to make the concentration 0.1M and mixed for 4 hours. After 4 hours, NaCl was added to the concentration to 0.2M and mixed for 4 hours. After 4 hours, NaCl was added to bring the concentration to 0.3M and mixed for 12 hours. After 12 hours, the DNA aptamer and gold mixture was collected by centrifugation at ~10,000*g for 20 minutes, and unreacted DNA aptamer in the supernatant was removed, and this process was repeated three times. The final gold nanoparticle-DNA aptamer complex was dispersed in 10mM sodium phosphate buffer (pH 7.4) containing 0.1 M NaCl. As a result of analyzing the prepared gold nanoparticle-DNA aptamer complex by electrophoresis using a 10% acrylamide 8M Urea gel, it was confirmed that 130 to 150 DNA aptamers were bound to one gold nanoparticle.
1-4. 나노 복합체(AuNP-Apt-Cas9/Cargo DNA-sgRNA)의 제조 1-4. Preparation of nanocomposite (AuNP-Apt-Cas9/Cargo DNA-sgRNA)
상기 제작된 나노 전달체에 특이적으로 결합하는 Cas9 및 sgRNA를 결합시킨 나노 복합체를 제조하였다. 이의 제조 과정은 도 1에 도시되어 있다. A nanocomplex was prepared by combining Cas9 and sgRNA that specifically binds to the nano-delivery vehicle produced above. Its manufacturing process is shown in Figure 1.
실시예 2. 기능화된 AuNPExample 2. Functionalized AuNPs HisHis 를 이용한 Cas9 protein 전달능 확인Confirmation of Cas9 protein delivery ability using
2-1. 공초점 현미경을 이용한 세포 내 전달능 확인 2-1. Confirmation of intracellular delivery ability using confocal microscopy
5 X 104 개의 HeLa (Human cervical carcinoma) 세포를 10% FBS를 포함하는 배지 하에서 24-웰 플레이트에 플레이팅 하였다. Cas9 단백질 및 sgRNA를 염색한 후 제조된 AuNPHis를 최종 농도 1 nM이 되도록 HeLa 세포 배양 배지에 첨가하고, 24시간 후 형광 현미경을 이용하여 세포로부터 방출되는 형광을 측정하였다. 본 발명의 AuNPHis과 비교하기 위하여 Alexa546(빨강)으로 염색한 Cas9과 FITC(녹색)로 염색한 guide RNA를 넣지 않은 HeLa cell을 사용하였다. 그 결과, 도 2에서 보듯이, 대조군(control)과 비교하여, AuNPHis -Cas9RNP의 경우, 세포 내 전달능이 증가되어 있는 것을 확인할 수 있었다. 5 After staining the Cas9 protein and sgRNA, the prepared AuNP His was added to the HeLa cell culture medium to a final concentration of 1 nM, and after 24 hours, the fluorescence emitted from the cells was measured using a fluorescence microscope. To compare with the AuNP His of the present invention, HeLa cells without Cas9 stained with Alexa546 (red) and guide RNA stained with FITC (green) were used. As a result, as shown in Figure 2, it was confirmed that the intracellular delivery ability of AuNP His -Cas9RNP was increased compared to the control.
2-2. 웨스턴 블랏을 이용한 타겟 전달능 확인2-2. Confirmation of target delivery ability using Western blot
상기2-1과 같이, AuNPHis -Cas9RNP의 타겟 전달능을 확인하기 위하여, 5 X 104 개의 HeLa (Human cervical carcinoma) 세포를 10% FBS를 포함하는 배지에서 배양하고, 배양한 세포에 전달체인 AuNP-AptHis만 처리 또는 AuNP-AptHis전달체에 Cas9단백질과 guide RNA 복합체(Cas9His-sgRNABRAF-V600E)를 결합시켜 처리하였다. 아무것도 처리하지 않은 샘플은 Control 역할을 한다. 샘플 처리 후, 각각 4시간과 24시간 후에 Cell을 모아 세포질 및 핵을 분획하여 total 단백질을 추출하고 Western blot을 진행하였다. 각 항체는 Cas9 antibody, 세포질에서만 관찰되는 베타 튜블린으로 세포질 단백질의 마커로서 사용하였고 핵에서 더 많이 관찰되는 XRCC5를 핵 단백질의 마커로서 사용하였다. 결과적으로 세포에 금 나노입자-Cas RNP 복합체를 처리하고 4시간뒤의 핵 분획에서 많은 양의 Cas9이 확인(밴드가 가장 두꺼움)하였으며, 이는 핵으로 금 나노 전달체가 Cas9 RNP를 잘 전달하였음을 보여주는 것이다. (도 3) As in 2-1 above, in order to confirm the target delivery ability of AuNP His -Cas9RNP, 5 AuNP-Apt His was treated alone or the Cas9 protein and guide RNA complex (Cas9 His -sgRNA BRAF-V600E ) were combined with the AuNP-Apt His carrier. Samples that have not been processed at all serve as controls. After sample processing, cells were collected 4 and 24 hours later, cytoplasm and nucleus were fractionated, total protein was extracted, and Western blot was performed. Each antibody was Cas9 antibody, beta tubulin observed only in the cytoplasm was used as a marker for cytoplasmic protein, and XRCC5, which is more commonly observed in the nucleus, was used as a marker for nuclear protein. As a result, a large amount of Cas9 was confirmed in the nuclear fraction 4 hours after treating the cells with the gold nanoparticle-Cas RNP complex (the band was the thickest), showing that the gold nanocarrier successfully delivered the Cas9 RNP to the nucleus. will be. (Figure 3)
실시예 3. 기능화 된 금나노 입자에 결합한 CRISPR-cas9 시스템을 이용한 식물 유전자 조작Example 3. Plant genetic manipulation using the CRISPR-cas9 system coupled to functionalized gold nanoparticles
담배 속 식물인 Nicotiana benthamiana에서 유래된 원형질체(Protoplast) 를 분리하여, 본 발명의 나노 복합체에 포함된 AuNP-Cas9, AuNP, Cas9 및 sgRNA를 포함하는 혼합물을 하기의 도 4과 같이 처리한 후, 48시간 동안 반응시키고, DNA를 추출하였다. 추출된 각 DNA에 T7E1 효소 처리를 통하여 Cas9 전달 여부를 관찰하였다. T7E1 은 게놈 편집 효율성 분석에 이용되며, heteroduplex DNA의 일치하지 않는 부분을 잘라서 확인할 수 있다Protoplasts derived from Nicotiana benthamiana, a plant in the tobacco genus, were isolated, and a mixture containing AuNP-Cas9, AuNP, Cas9, and sgRNA included in the nanocomposite of the present invention was treated as shown in Figure 4 below, 48 After reacting for some time, DNA was extracted. Each extracted DNA was treated with T7E1 enzyme to observe whether Cas9 was delivered. T7E1 is used to analyze genome editing efficiency and can be confirmed by cutting out non-matching parts of heteroduplex DNA.
그 결과 도 4에서 보듯이, 기존의 PEG 기법과 비교하여, 본 발명의 나노 복합체를 이용한 Cas9 RNP 전달체가 원형질체 내부로 전달됨을 확인할 수 있었다. As a result, as shown in Figure 4, compared to the existing PEG technique, it was confirmed that the Cas9 RNP carrier using the nanocomplex of the present invention was delivered into the protoplast.
실시예 4. 시퀀싱을 통한 금 나노 복합체의 CRISPR-cas9 시스템 전달능 확인Example 4. Confirmation of CRISPR-cas9 system delivery ability of gold nanocomposite through sequencing
상기 본 발명의 나노 복합체를 이용하여 목적 유전자의 타겟 부위를 증폭한 후 시퀀싱하여 Indel (삽입 및 결실) 서열을 분석하였다. 그 결과 원형질체에 형질 전환을 위해 사용하던 PEG 기법보다는 금나노 입자를 이용한 전달 시 보다 높은 indel 서열을 확인할 수 있었다. (도 5)The target region of the target gene was amplified using the nanocomposite of the present invention and then sequenced to analyze the Indel (insertion and deletion) sequence. As a result, a higher indel sequence was confirmed when delivered using gold nanoparticles rather than using the PEG technique used for transformation of protoplasts. (Figure 5)
이제까지 본 발명에 대하여 그 바람직한 실시예들을 중심으로 살펴보았다. 본 발명이 속하는 기술 분야에서 통상의 지식을 가진 자는 본 발명이 본 발명의 본질적인 특성에서 벗어나지 않는 범위에서 변형된 형태로 구현될 수 있음을 이해할 수 있을 것이다. 그러므로 개시된 실시예들은 한정적인 관점이 아니라 설명적인 관점에서 고려되어야 한다. 본 발명의 범위는 전술한 설명이 아니라 청구범위에 나타나 있으며, 그와 동등한 범위 내에 있는 모든 차이점은 본 발명에 포함된 것으로 해석되어야 할 것이다.So far, the present invention has been examined focusing on its preferred embodiments. A person skilled in the art to which the present invention pertains will understand that the present invention may be implemented in a modified form without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative rather than a restrictive perspective. The scope of the present invention is indicated in the claims, not the foregoing description, and all differences within the equivalent scope should be construed as being included in the present invention.
본 발명의 일 양태로서, 본 발명은 나노 입자; 상기 나노 입자 표면에 공유결합으로 결합된 앱타머; 및 상기 나노 입자 표면에 공유결합으로 결합된 DNA 결합 파트너를 포함하고, 상기 앱타머는 Cas 단백질에 특이적으로 결합하고, 상기 DNA 결합 파트너는 가이드 RNA에 상보적으로 결합하는 서열을 포함하는 것인 나노 복합체에 대한 것이다. In one aspect of the present invention, the present invention provides nanoparticles; An aptamer covalently bound to the surface of the nanoparticle; and a DNA binding partner covalently bound to the surface of the nanoparticle, wherein the aptamer specifically binds to a Cas protein, and the DNA binding partner includes a sequence that binds complementary to a guide RNA. It's about complexes.
본 발명의 일 실시예에서 상기 나노 입자는 8-100nm의 크기를 가지는 나노 입자이다. In one embodiment of the present invention, the nanoparticles are nanoparticles with a size of 8-100 nm.
본 발명의 일 실시예에서 상기 나노 입자는 금 나노 입자(AuNP)일 수 있다. In one embodiment of the present invention, the nanoparticles may be gold nanoparticles (AuNP).
본 발명의 일 실시예에서 상기 나노 복합체는 가이드 RNA 및 Cas 단백질을 포함한다. In one embodiment of the present invention, the nanocomplex includes guide RNA and Cas protein.
본 발명의 일 실시예에서, 상기 Cas 단백질은 Cas9 단백질이다. In one embodiment of the present invention, the Cas protein is Cas9 protein.
본 발명의 일 실시예에서 상기 가이드 RNA는 sgRNA(single guide RNA), crRNA(crispr RNA) 또는 tracrRNA(trans-activating RNA) 중 선택될 수 있다. In one embodiment of the present invention, the guide RNA may be selected from sgRNA (single guide RNA), crRNA (crispr RNA), or tracrRNA (trans-activating RNA).
본 발명의 일 실시예에서 상기 DNA 결합 파트너는 편집 대상이 되는 목적 유전자로부터 유래된 서열로서, 가이드 RNA에 상보적인 염기 서열을 포함하는 것이다. In one embodiment of the present invention, the DNA binding partner is a sequence derived from a target gene to be edited and includes a base sequence complementary to a guide RNA.
본 발명의 다른 양태로서, 본 발명은 Cas 단백질에 특이적으로 결합하는 앱타머를 제조하는 단계; 편집(editing) 대상이 되는 유전자로부터 유래된 서열을 포함하는 DNA 결합 파트너를 제작하는 단계; 나노 입자 표면에, 상기 앱타머 및 DNA 결합 파트너를 공유결합으로 결합시키는 단계; 및 상기 앱타머 및 DNA 결합 파트너에 각각 Cas 단백질 및 가이드 RNA를 결합시켜 복합체를 형성하는 단계를 포함하는 나노 복합체를 제조하는 방법에 대한 것이다. In another aspect of the present invention, the present invention includes preparing an aptamer that specifically binds to a Cas protein; Creating a DNA binding partner containing a sequence derived from a gene to be edited; Covalently binding the aptamer and DNA binding partner to the surface of the nanoparticle; and forming a complex by binding Cas protein and guide RNA to the aptamer and DNA binding partner, respectively.
본 발명의 또 다른 양태로서, 본 발명은 상기 나노 복합체를 포함하는 유전자 편집용 조성물에 대한 것이다. In another aspect of the present invention, the present invention relates to a composition for gene editing containing the nanocomposite.
본 발명의 일 실시예에서 상기 유전자 편집용 조성물은 진핵 세포 또는 진핵 세포를 포함하는 개체에 적용하기 위한 것이다. In one embodiment of the present invention, the gene editing composition is intended to be applied to eukaryotic cells or entities containing eukaryotic cells.
본 발명의 또 다른 양태로서, 본 발명은 상기 나노 복합체를 편집 대상인 세포 또는 개체에 주입하여 목젹 유전자를 편집하는 방법에 대한 것이다.In another aspect of the present invention, the present invention relates to a method of editing a target gene by injecting the nanocomplex into a cell or organism to be edited.

Claims (11)

  1. 나노 입자; nanoparticles;
    상기 나노 입자 표면에 공유결합으로 결합된 앱타머; 및An aptamer covalently bound to the surface of the nanoparticle; and
    상기 나노 입자 표면에 공유결합으로 결합된 DNA 결합 파트너를 포함하고, Containing a DNA binding partner covalently bound to the surface of the nanoparticle,
    상기 앱타머는 Cas 단백질에 특이적으로 결합하고, 상기 DNA 결합 파트너는 가이드 RNA에 상보적으로 결합하는 서열을 포함하는 것인 나노 복합체. The aptamer specifically binds to the Cas protein, and the DNA binding partner includes a sequence that binds complementary to the guide RNA.
  2. 제 1항에 있어서, According to clause 1,
    상기 나노 입자는 8-100nm의 크기를 가지는 나노 입자인 것을 특징으로 하는 나노 복합체. A nanocomposite, characterized in that the nanoparticles are nanoparticles with a size of 8-100 nm.
  3. 제1항에 있어서, According to paragraph 1,
    상기 나노 입자는 금 나노 입자(AuNP) 인 것을 특징으로 하는 나노 복합체.A nanocomposite, wherein the nanoparticles are gold nanoparticles (AuNP).
  4. 제1항에 있어서, According to paragraph 1,
    상기 나노 복합체는 가이드 RNA 및 Cas 단백질을 포함하는 것을 특징으로 하는 나노 복합체. The nanocomplex is characterized in that it contains guide RNA and Cas protein.
  5. 제4항에 있어서, According to paragraph 4,
    상기 Cas 단백질은 Cas9 단백질인 것을 특징으로 하는 나노 복합체.Nanocomplex, characterized in that the Cas protein is Cas9 protein.
  6. 제4항에 있어서, According to paragraph 4,
    상기 가이드 RNA는 sgRNA(single guide RNA), crRNA(crispr RNA) 또는 tracrRNA(trans-activating RNA) 중 어느 하나 이상인 것을 특징으로 하는 나노 복합체. The guide RNA is a nanocomplex characterized in that it is one or more of sgRNA (single guide RNA), crRNA (crispr RNA), or tracrRNA (trans-activating RNA).
  7. 제1항에 있어서, According to paragraph 1,
    상기 DNA 결합 파트너는 편집 대상이 되는 목적 유전자로부터 유래된 서열로서, 가이드 RNA에 상보적인 염기 서열을 포함하는 것을 특징으로 하는 나노 복합체. The DNA binding partner is a sequence derived from the target gene to be edited, and is a nanocomposite characterized in that it includes a base sequence complementary to the guide RNA.
  8. Cas 단백질에 특이적으로 결합하는 앱타머를 제조하는 단계; Preparing an aptamer that specifically binds to the Cas protein;
    편집(editing) 대상이 되는 유전자로부터 유래된 서열을 포함하는 DNA 결합 파트너를 제작하는 단계;Creating a DNA binding partner containing a sequence derived from a gene to be edited;
    나노 입자 표면에, 상기 앱타머 및 DNA 결합 파트너를 공유결합으로 결합시키는 단계; 및 Covalently binding the aptamer and DNA binding partner to the surface of the nanoparticle; and
    상기 앱타머 및 DNA 결합 파트너에 각각 Cas 단백질 및 가이드 RNA를 결합시켜 복합체를 형성하는 단계를 포함하는 나노 복합체를 제조하는 방법. A method of producing a nanocomplex comprising the step of forming a complex by binding Cas protein and guide RNA to the aptamer and DNA binding partner, respectively.
  9. 제1항의 상기 나노 복합체를 포함하는 유전자 편집용 조성물. A composition for gene editing comprising the nanocomposite of claim 1.
  10. 제9항에 있어서, According to clause 9,
    상기 유전자 편집용 조성물은 진핵 세포 또는 진핵 세포를 포함하는 개체에 적용하기 위한 것인 유전자 편집용 조성물. The gene editing composition is for application to eukaryotic cells or entities containing eukaryotic cells.
  11. 제1항의 상기 나노 복합체를 편집 대상인 세포 또는 개체에 주입하여 목젹 유전자를 편집하는 방법.A method of editing a target gene by injecting the nanocomplex of claim 1 into a cell or object to be edited.
PCT/KR2023/006602 2022-05-16 2023-05-16 Gene manipulation based on nanoparticle-crispr complex and fabrication method therefor WO2023224352A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2022-0059778 2022-05-16
KR20220059778 2022-05-16
KR10-2022-0184348 2022-12-26
KR1020220184348A KR20230160699A (en) 2022-05-16 2022-12-26 Genetic manipulation and manufacturing method based on gold nanoparticle-CRISPR conjugate

Publications (1)

Publication Number Publication Date
WO2023224352A1 true WO2023224352A1 (en) 2023-11-23

Family

ID=88835595

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/006602 WO2023224352A1 (en) 2022-05-16 2023-05-16 Gene manipulation based on nanoparticle-crispr complex and fabrication method therefor

Country Status (1)

Country Link
WO (1) WO2023224352A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140102596A (en) * 2013-02-13 2014-08-22 중앙대학교 산학협력단 Gold nanoparticle-aptamer conjugates-based protein delivery system and preparation method thereof
KR20200017485A (en) * 2017-06-14 2020-02-18 위스콘신 얼럼나이 리서어치 화운데이션 Modified Guide RNAs, CRISPR-ribonucleoprotein Complexes and Methods of Use
KR20210053898A (en) * 2018-07-31 2021-05-12 더 브로드 인스티튜트, 인코퍼레이티드 New CRISPR enzyme and system

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20140102596A (en) * 2013-02-13 2014-08-22 중앙대학교 산학협력단 Gold nanoparticle-aptamer conjugates-based protein delivery system and preparation method thereof
KR20200017485A (en) * 2017-06-14 2020-02-18 위스콘신 얼럼나이 리서어치 화운데이션 Modified Guide RNAs, CRISPR-ribonucleoprotein Complexes and Methods of Use
KR20210053898A (en) * 2018-07-31 2021-05-12 더 브로드 인스티튜트, 인코퍼레이티드 New CRISPR enzyme and system

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DUAN LI, OUYANG KAN, XU XIAO, XU LIMEI, WEN CAINING, ZHOU XIAOYING, QIN ZHUAN, XU ZHIYI, SUN WEI, LIANG YUJIE: "Nanoparticle Delivery of CRISPR/Cas9 for Genome Editing", FRONTIERS IN GENETICS, FRONTIERS RESEARCH FOUNDATION, SWITZERLAND, vol. 12, Switzerland , XP093109460, ISSN: 1664-8021, DOI: 10.3389/fgene.2021.673286 *
LE SAUX SARAH, AUBERT‐POUËSSEL ANNE, OUCHAIT LYRIA, MOHAMED KHALED ELHADY, MARTINEAU PIERRE, GUGLIELMI LAURENCE, DEVOISSELLE JEAN‐: "Nanotechnologies for Intracellular Protein Delivery: Recent Progress in Inorganic and Organic Nanocarriers", ADVANCED THERAPEUTICS, WILEY, vol. 4, no. 6, 1 June 2021 (2021-06-01), XP093109467, ISSN: 2366-3987, DOI: 10.1002/adtp.202100009 *

Similar Documents

Publication Publication Date Title
Lv et al. Nanoparticle‐mediated gene transformation strategies for plant genetic engineering
Ding et al. A non-cationic nucleic acid nanogel for the delivery of the CRISPR/Cas9 gene editing tool
DE69637156T2 (en) DNA MOLECULE, MANUFACTURE AND USE IN GENE THERAPY
CN105793425B (en) Delivery, use and therapeutic applications of CRISPR-CAS systems and compositions for targeting disorders and diseases using viral components
CN105164264B (en) Delivery, engineering and optimization of systems, methods and compositions for sequence manipulation and therapeutic applications
Prow et al. Construction, gene delivery, and expression of DNA tethered nanoparticles
WO2017074788A1 (en) Compositions and methods for targeting cancer-specific sequence variations
CA2932475A1 (en) Delivery, use and therapeutic applications of the crispr-cas systems and compositions for targeting disorders and diseases using particle delivery components
CA2915845A1 (en) Delivery, engineering and optimization of systems, methods and compositions for targeting and modeling diseases and disorders of post mitotic cells
CN102131927A (en) Regulated genetic suicide mechanism compositions and methods
CN113840925A (en) Modifying the specificity of non-coding RNA molecules for silencing genes in eukaryotic cells
JP2013507934A (en) Supercoiled minicircle DNA for gene therapy applications
Zhu et al. DNAzyme activated protein-scaffolded CRISPR–Cas9 nanoassembly for genome editing
WO2017039074A1 (en) Method for effectively delivering gene into cells by using photothermal effect of gold nanoparticles
Vats et al. Opportunity and challenges for nanotechnology application for genome editing in plants
WO2023224352A1 (en) Gene manipulation based on nanoparticle-crispr complex and fabrication method therefor
Zillies et al. Evaluating gelatin based nanoparticles as a carrier system for double stranded oligonucleotides
WO2023229344A1 (en) Messenger rna carrier based on nanoparticle-oligo t conjugate
Munk et al. Using carbon nanotubes to deliver genes to hard-to-transfect mammalian primary fibroblast cells
WO2016053033A1 (en) Messenger rna nanoparticles and preparation method therefor
CN113226336B (en) Method for delivering genes in cells
KR20230160699A (en) Genetic manipulation and manufacturing method based on gold nanoparticle-CRISPR conjugate
CN115992131A (en) Nanocrystallized chitosan/dsGRK complex and preparation method and application thereof
EP1294919B1 (en) In vitro method for introducing a nucleic acid into a cell (transfection) by means of calcium phosphate
JPH08504321A (en) Particle Transfection: Method of Transferring Polynucleotide Molecules to Cells

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23807871

Country of ref document: EP

Kind code of ref document: A1