WO2023216938A1

WO2023216938A1 - Random probe, preparation method therefor and use thereof

Info

Publication number: WO2023216938A1
Application number: PCT/CN2023/091732
Authority: WO
Inventors: 黄萌; 叶莘
Original assignee: 珠海圣美生物诊断技术有限公司
Priority date: 2022-05-09
Filing date: 2023-04-28
Publication date: 2023-11-16
Also published as: CN114891787B; CN114891787A

Abstract

The present disclosure relates to the technical field of molecular biology, and in particular to a random probe, a preparation method therefor and use thereof. The present disclosure provides a random probe, a preparation method therefor and use thereof. The preparation method comprises: using a transposase to perform random fragmentation on a target sequence; in the fragmentation process, adding transposase recognition sequences at both ends of a random target fragment obtained; then taking the obtained random target fragment as an amplification template and taking a sequence targeting the transposase recognition sequences as an amplification primer, and performing amplification in an amplification system with a quantity ratio of dUTP to dTTP+dUTP of 50%-100% to obtain the random probe targeting the target sequence. The random probe prepared by the method uniformly comprises bases U capable of serving as labeling sites.

Description

Random probes, preparation methods and applications

Cross-references to related applications

This disclosure requires that the application number submitted to the China Patent Office on May 9, 2022 is CN202210495738.4, titled "Random Probe, Preparation Method and Application" and the application number submitted to the China Patent Office on May 16, 2022 is CN202210531129.

Technical field

The present disclosure relates to the technical field of molecular biology, and in particular to random probes, preparation methods and applications.

Background technique

The common method for preparing fluorescent in situ hybridization probes is to obtain the target fragment through gene amplification or sequence synthesis, and then use the nick translation method to insert fluorescently labeled nucleotides, or use fluorescently labeled primers to amplify the target fragment. The nick translation method requires a large starting amount of DNA (μg level), has low efficiency of inserting fluorescently labeled nucleotides, and low probe yield, making it unsuitable for large-scale production. Moreover, the probe obtained by using fluorescently labeled primers for amplification is only labeled with a fluorescent signal molecule at the end, and the fluorescence intensity is low. It is necessary to design primers according to different templates and target fragment sizes.

Contents of the invention

The purpose of this disclosure is to provide a method for preparing random probes using transposase for target sequences. This method can obtain a large number of random probes of different sequences in one step, significantly improving the probe production efficiency. At the same time, the disclosure is random The introduction of dUTP into the entire sequence range of the probe introduces more labeling sites for subsequent probe detection, thereby reducing the detection limit and improving detection sensitivity and accuracy.

The second purpose of the present disclosure is to provide the application of random probes obtained based on the above preparation method in hybridization assays.

In order to solve the above technical problems and achieve the above objectives, the present disclosure provides the following technical solutions:

The present disclosure provides a method for preparing random probes, using transposase to randomly fragment the target sequence, and at the same time adding transposase recognition sequences at both ends of the obtained random target fragments, and then using the random target fragments as amplification templates to target change The sequence of the locus enzyme recognition sequence is an amplification primer, which is amplified in an amplification system with a ratio of dUTP to dTTP+dUTP of 50% to 100% to obtain a random probe targeting the target sequence.

Alternatively, the transposase is selected from Tn1, Tn2, Tn3, Tn4, Tn5, Tn6, Tn7, Tn9, Tn10, Tn551, Tn971, Tn916, Tn1545, Tn1681, Tgf2, Tol2, MuA, Himar1 or HARBI1, so The transposase recognition sequence includes the ME sequence of the transposase.

Alternatively, the transposase is Tn5, and the ME sequence of the transposase Tn5 is 5'-AGATGTGTATAAGAGACAG-3'.

Optionally, the DNA polymerase used for amplification is selected from Taq DNA polymerase, Tth DNA polymerase, Tfl DNA polymerase, TLI DNA polymerase, Tne DNA polymerase, Tma DNA polymerase, vent ^TM DNA polymerase, Phusion One or more of ^TM DNA polymerase, Pfu DNA polymerase and KOD DNA polymerase.

Optionally, the dUTP in the random probe is also labeled; the labeling method includes: labeling dUTP and then adding it to the amplification system, and labeling the dUTP in the random probe as the amplification reaction proceeds; or, amplifying During the amplification reaction or after the amplification is completed, the dUTP in the obtained random probe is labeled.

Optionally, the label is a fluorescent group label; the fluorescent group is selected from fluorescein dyes, rhodamine dyes or cyanine dyes.

Alternatively, the labeling method of dUTP includes directly coupling dUTP with the active group of the fluorescent group, or connecting dUTP and the active group of the fluorescent group through a modifying group; the modified group includes a first modifying group. group or a second modifying group; the first modifying group is an amino group, and the first active group connected to the first modifying group includes isothiocyanate, active ester, active carboxylic acid or sulfonyl chloride; the The second modification group is biotin, and the fluorescent group connected to the second modification group includes a streptavidin-modified dye, or a horseradish peroxidase-streptavidin conjugate.

Optionally, after the target sequence is fragmented and before the amplification reaction, a gap sequence reaction step is further included; or, in the amplification reaction step after the target sequence is fragmented, a gap sequence completion step is first performed. Extend the program, and then adjust the parameters for amplification.

Optionally, the transposase recognition sequence includes the ME sequence of the transposase and a linker sequence connected to the 5' end of the ME sequence of the transposase; the number of bases A in the linker sequence is 1 to 20; Linker sequences include TCGTCGGCAGCGTC, ACGATGTCAGCGAC, or AAGAGACCACCAGAGTAGCAACGATGTCAGCGAC.

The present disclosure also provides random probes prepared by using the preparation method described in the aforementioned embodiments.

Optionally, the length of the random probe is 100-500 bps, and the number of labels per 100 nucleotides in the random probe is 3-10.

The present disclosure also provides the use of the random probes described in any of the aforementioned embodiments in nucleic acid hybridization assays.

The present disclosure provides a method for preparing random probes, which uses transposase to randomly fragment target sequences. During the fragmentation process, transposase recognition sequences are added to both ends of the obtained random target fragments, and then The obtained random target fragment is used as the amplification template, and the sequence targeting the transposase recognition sequence is used as the amplification primer, and amplification is carried out in an amplification system with a ratio of dUTP to (dTTP+dUTP) of 50% to 100%. Random probes targeting the target sequence are obtained. The probe sequences prepared by this method are random fragments derived from the target sequence, and can be used for the detection of the target sequence. Since the preparation process does not limit the specific sequence, the production efficiency is significantly improved. At the same time, the conventional T bases in the entire sequence of the obtained random probe will be partially replaced by U bases, and the sites substituted by U can Used as a labeling site, therefore, the random probe obtained by the preparation method provided by the present disclosure can achieve labeling within the entire sequence range, and can show more excellent sensitivity and accuracy when used for detection.

Description of the drawings

In order to more clearly explain the specific embodiments of the present disclosure or the technical solutions in the prior art, the drawings that need to be used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings in the following description The drawings illustrate some embodiments of the present disclosure. For those of ordinary skill in the art, other drawings can be obtained based on these drawings without exerting creative efforts.

Figure 1 shows the results of the impact of different polymerases on dUTP compatibility and amplification efficiency obtained in Experimental Example 4 of the disclosure.

Figure 2 shows the FISH hybridization signal results obtained in Experimental Example 4 under different ratios of dUTP.

Figure 3 shows the FISH hybridization signal results after labeling with different dUTP fluorescent labeling groups in Experimental Example 5.

Detailed ways

In order to make the purpose, technical solutions and advantages of the embodiments of the present disclosure clearer, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below in conjunction with the drawings in the embodiments of the present disclosure. Obviously, the described embodiments These are some embodiments of the present disclosure, but not all embodiments. The components of the embodiments of the present disclosure generally described and illustrated in the figures herein may be arranged and designed in a variety of different configurations.

Therefore, the following detailed description of the embodiments of the disclosure provided in the appended drawings is not intended to limit the scope of the claimed disclosure, but rather to represent selected embodiments of the disclosure. Based on the embodiments in this disclosure, it is common in the art to All other embodiments obtained by those skilled in the art without creative efforts fall within the scope of protection of this disclosure.

It should be noted that similar reference numerals and letters represent similar items in the following figures, therefore, once an item is defined in one figure, it does not need further definition and explanation in subsequent figures. Furthermore, terms such as “first” or “second” are only used to differentiate descriptions and are not to be construed as indicating or implying relative importance.

In an optional embodiment, the present disclosure provides a method for preparing random probes, using transposase to randomly fragment the target sequence, while adding transposase recognition sequences at both ends of the obtained random target fragments, and then using the random target fragments As an amplification template, use the sequence targeting the transposase recognition sequence as the amplification primer, and perform amplification in an amplification system with a ratio of dUTP to dTTP+dUTP of 50% to 100% to obtain a random sequence of the target sequence. probe.

The "number ratio of dUTP to dTTP+dUTP" refers to the ratio of the amount of guanosine triphosphate to the sum of the amounts of "guanosine triphosphate and thymidine triphosphate".

In alternative embodiments, the transposase is selected from Tn1, Tn2, Tn3, Tn4, Tn5, Tn6, Tn7, Tn9, Tn10, Tn551, Tn971, Tn916, Tn1545, Tn1681, Tgf2, Tol2, MuA, Himar1 Or HARBI1, the transposase recognition sequence includes the ME sequence of the transposase.

In an optional embodiment, the transposase is Tn5, and the ME sequence of the transposase Tn5 is 5'-AGATGTGTATAAGAGACAG-3' (SEQ ID No. 1).

Examples of the ME sequence portions of other transposases mentioned above are shown in the table below.

In an alternative embodiment, the DNA polymerase used for amplification is selected from the group consisting of dUTP-compatible DNA polymerase, Taq DNA polymerase, Tth DNA polymerase, Tfl DNA polymerase, TLI DNA polymerase, and Tne DNA polymerase. , one or more of Tma DNA polymerase, vent ^TM DNA polymerase, Phusion ^TM DNA polymerase, Pfu DNA polymerase and KOD DNA polymerase; preferably, selected from Taq DNA polymerase, PfuTurboCxHotstart DNA polymerase, One or more Robustart Taq DNA polymerases, the PfuTurboCxHotstart DNA polymerase and Robustart Taq DNA polymerase are the above-mentioned mixed polymerases.

Among them, "dUTP-compatible DNA polymerase" can use amplification efficiency as an evaluation index, which refers to a DNA polymerase that maintains an amplification efficiency of more than 50% when 50% of dTTP is replaced by dUTP.

In an optional embodiment, the dUTP in the random probe is also labeled; the labeling method includes: labeling dUTP and then adding it to the amplification system, and labeling the dUTP in the random probe as the amplification reaction proceeds. ; Alternatively, during the amplification reaction or after the amplification is completed, the dUTP in the obtained random probe is labeled.

In an optional embodiment, the label is a fluorescent group label; the fluorescent group is selected from fluorescein dyes, rhodamine dyes, cyanine dyes or other fluorescent dyes with similar fluorescence intensity and anti-quenching ability. .

The fluorescein dyes include standard fluorescein and its derivatives, such as fluorescein isothiocyanate (FITC), hydroxyfluorescein (FAM), tetrachlorofluorescein (TET), etc.

The rhodamine dye materials include R101, tetraethyl rhodamine (RB200), carboxytetramethyl rhodamine (TAMRA), etc.

The cyanine dyes include Class I cyanine dyes: thiazole orange (TO), oxazole orange (YO) series and their dimer dyes, and Class II cyanine dyes: polymethine series cyanine dyes.

It should be understood that the present disclosure uses fluorescent dyes as labeling groups, which mainly relies on the fluorescence intensity and anti-fade ability of the fluorescent dye to meet actual detection needs. Therefore, any two indicators of fluorescence intensity and anti-fade ability are consistent with the above-mentioned Compared with the three series of dyes, no less than 50% of fluorescent dyes can be used in this disclosure as a labeling group, and should not be understood to be limited to the above three types of dyes.

In an optional embodiment, the labeling method of dUTP includes directly coupling dUTP with the active group of the fluorescent group, or connecting dUTP and the active group of the fluorescent group through a modifying group; the modified group includes The first modifying group or the second modifying group; the first modifying group is an amino group, and the first active group connected to the first modifying group includes isothiocyanate, active ester, active carboxylic acid or sulfonate acid chloride; the second modification group is biotin, and the fluorescent group connected to the second modification group includes a streptavidin-modified dye, or horseradish peroxidase-streptavidin coupling Connected things.

It should be noted that if HRP-streptavidin conjugate or HRP direct labeling is used, the Power Styramide ^TM signal amplification (PSA) or tyramide signal amplification (TSA) system based on the peroxidase principle can also be used downstream. , if the label is phosphatase, a signal amplification system based on the principle of phosphatase can be used. For example, those skilled in the art make routine choices based on the present disclosure, which should be regarded as the labeling method using HRP-streptavidin conjugate or HRP direct labeling as described in the present disclosure.

In an optional embodiment, after the target sequence is fragmented and before the amplification reaction, a gap sequence reaction step is further included; or, in the amplification reaction step after the target sequence is fragmented, a gap sequence completion step is first performed. The sequence is the extension procedure for the purpose, and then the parameters are adjusted for amplification.

It should be noted that the above-mentioned "gap sequence" refers to the naturally formed nucleotide gap in the double-stranded DNA fragment obtained during the fragmentation process of the target sequence by transposase. It is difficult to achieve subsequent processing while retaining this gap. Amplification step, therefore, the present disclosure also provides a step of completing the gap sequence, and this step can be performed separately or integrated into the amplification step, and is achieved by adding a pre-extension step. The "reaction step of completing the gap sequence" and the "extension procedure for the purpose of completing the gap sequence" are both aimed at completing the sequence gap. Specific extension parameters can be selected routinely by those skilled in the art, for example, performing amplification in an amplification system. Before the reaction, first extend at 72°C for 3 to 5 minutes to complete the gap.

The above-mentioned amplification reaction system has been verified through experiments. After filling the gap, the present disclosure can amplify target sequence fragments with a content of less than 50 ng to obtain a target sequence fragment content of 2 to 3 μg/50 μL. When amplifying in an amplification system with a ratio of dUTP to dTTP+dUTP of 50% to 100%, target sequence fragments with a content of 0.01 to 0.1 μg can be used to obtain a target sequence fragment content of 4 to 6 μg/50 μL, which is significantly better than Amplification effect of probes in the prior art.

In an optional embodiment, the transposase recognition sequence includes the ME sequence of the transposase and a linker sequence connected to the 5' end of the ME sequence of the transposase; the number of bases A in the linker sequence is 1 to 20; The linker sequence includes TCGTCGGCAGCGTC (SEQ ID No. 5), ACGATGTCAGCGAC (SEQ ID No. 6), or AAGAGACCACCAGAGTAGCAACGATGTCAGCGAC (SEQ ID No. 7).

The present disclosure provides random probes prepared using the preparation method described in the aforementioned embodiments.

In an optional embodiment, the length of the random probe is 100-500 nts, and the number of labels per 100 nucleotides in the random probe is 3-10.

The present disclosure provides the use of the random probes described in any of the aforementioned embodiments in nucleic acid hybridization assays.

It should be noted that "nucleic acid hybridization assay" means that the corresponding assay method relies on the principle of complementary base pairing of nucleic acids. Since the transposase provided by the present disclosure does not specifically select the target sequence, it can use the fragmentation method provided by the present disclosure to fragment a large number of target sequences and prepare corresponding probes. Therefore, the transposase provided by the present disclosure does not specifically select the target sequence. Nucleic acid hybridization assays include but are not limited to "fluorescence in situ hybridization, nucleic acid capture, immunocytochemistry, flow cytometry or nanoflow cytometry and signal amplification" and many other assay methods based on nucleic acid hybridization.

Similarly, target sequences applicable to this disclosure also include all nucleotide sequences obtained through amplification, extraction or synthesis, including but not limited to BAC libraries and PAC libraries. Based on the fragmentation principle of transposase, the form of the target sequence is also suitable for a variety of forms including DNA sequences, RNA sequences and DNA-RNA mixed sequences.

For example, in an optional embodiment, the present disclosure selects target sequences derived from the BAC library (Bacterial Artificial Chromosome, bacterial artificial chromosome library), and obtains a large number of target sequences as templates through the steps of bacterial culture and plasmid extraction, so The size of the plasmid is about 150kb~200kb.

The target sequence obtained above is then randomly fragmented by Tn5 transposase, and transposase recognition sequences are added to both ends of the sequence. This transposase recognition sequence can be used as a universal primer for subsequent amplification, and the target sequence fragmentation product has the main peak. At 300~500bps, the BAC DNA fragmentation effect of different sequences and lengths is good and uniform. The use of universal primers for amplification has no preference for sequences, and can be used to amplify 2 to 3 μg DNA/50 μL from a starting amount of DNA containing less than 50 ng.

In addition, in addition to retaining the ME sequence that affects the recognition and activity of Tn5 transposase, the transposase recognition sequence can also include a linker sequence. In the linker sequence, the content of base A is adjusted to adjust the insertion of dUTP bases in the amplification step. The quantity does not affect the efficiency of Tn5 transposase and amplification efficiency.

During amplification, part of the dTTP in the PCR reaction system is replaced with dUTP, and a DNA polymerase compatible with dUTP is used to randomly insert dUTP into the probe sequence. The amplification reaction can amplify the 10ng template to 4-6μg/ 50μL.

In an optional embodiment, the present disclosure labels random probes by fluorescein reacting with a dUTP modification group. The reaction may be a reaction between an amino group and an active group, or a reaction between biotin and streptavidin. , or signal amplification through TSA, etc. This reaction can also adjust the insertion efficiency by adjusting the ratio of dUTP, thereby affecting the efficiency of probe labeling. Generally, 3 to 10 dye molecules/100 bases can be inserted through this method, depending on the dyes may vary.

It should be noted that increasing the base U content in the random probe sequence can improve the labeling degree of the random probe and the detection rate of the target sequence, but the increase in the base U content will reduce the binding strength of the random probe to the target sequence. Decrease, thus affecting the sensitivity and accuracy of detection. Therefore, the content of base U in the full sequence of the random probe needs to be adjusted. The purpose of adding the linker sequence in this disclosure is to adjust the base A content of the target sequence according to the difference. , the content of base A in the linker sequence is designed to adjust the content of base U in the random probe, thereby improving the comprehensive detection effect including labeling degree, detection sensitivity and accuracy.

Example

Some embodiments of the present disclosure will be described in detail below with reference to the accompanying drawings. The following embodiments and features in the embodiments may be combined with each other without conflict.

Example 1

This embodiment provides a method for preparing a random probe targeting BAC strains, including the following steps:

(1) Sequence acquisition

Use LB medium containing chloramphenicol to cultivate BAC strains, and extract BAC DNA according to the BAC DNA purification kit or plasmid purification kit (NucleoBondXtra BAC, manufacturer: MACHEREY-NAGEL).

(2) Preparation of transposome (TTE Mix)

Design a 19bps ME complementary sequence based on transposase Tn5. The sequence is as follows:

ME-A：5’-AGATGTGTATAAGAGACAG-3’(SEQ ID No.1)

ME-B: 5'-phos-CTGTCTCTTATACACATCT-NH ₂ -3' (SEQ ID No. 8)

Mix ME-A and ME-B at equimolar concentrations and renature into double strands, and prepare the transposome according to the instructions for transposase (TruePrepTagment Enzyme, Novizan).

(3)DNA fragmentation and adapter addition

Dilute BAC DNA to 50ng/μL, prepare the reaction system according to the following table according to the number of reaction tubes, and react at 55°C for 10 minutes:

After the reaction, magnetic beads or columns are used to purify the fragmented products.

(4)PCR amplification

Using the fragmented DNA as a template, a sequence that can be complementary to the ME sequence is used as a universal primer (the universal primer can be complementary to the entire sequence of the ME sequence or partially complementary to it) to perform PCR amplification. During the amplification reaction, Part or all of dTTP was replaced with modified dUTP for multiple sets of experiments. During amplification, dUTP was randomly inserted into the nucleic acid sequence. The number ratios of dUTP to dTTP+dUTP were 50%, 67%, 75%, 80% and 100%.

Prepare the reaction system according to the following table according to the number of reaction tubes:

Run the following program:

The PCR product is purified and the nucleic acid concentration is measured using an ultramicrovolume spectrophotometer. Take 10ng of the product as a template for the next round of amplification and modification. The reaction system is as follows:

Run the following program:

Purify the PCR product to obtain random probes.

Examples 2 to 4

The only difference between this set of examples and Example 1 is that the complementary sequence used in the transposome constructed in this set of examples also contains a linker sequence, and the corresponding amplification primer is different from that of Example 1, and the sequence is as follows:

In this set of embodiments, a nucleotide fragment is also connected to the 5' end of the ME sequence. You can add a nucleotide fragment to the 5' end of the A chain sequence as needed, and randomly insert base A into the nucleotide fragment to avoid repeated sequences and internal complementary sequences. Formation, adding sequences does not affect the transposase recognition and adapter insertion effects.

Examples 5 to 8

In this set of examples, the dUTP added to the amplification system in Examples 1 to 4 was fluorescently labeled based on amino modification. The method is as follows:

The nucleic acid molecules inserted into the amino-labeled dUTP react with iFlour 488-NHS dye in a sodium bicarbonate solution with a pH of 8.3 to 8.5 at room temperature (20 to 25°C) for 2 hours, where the nucleic acid molecule concentration is 0.1 to 0.5 μg/μL. , iFlour 488-NHS dye concentration is 4μg/μL.

Examples 9 to 12

In this set of examples, the dUTP added to the amplification system in Examples 1 to 4 was fluorescently labeled based on biotin modification. The method is as follows:

The nucleic acid molecule inserted into the biotin-labeled dUTP is coupled with streptavidin-iFluor488 in 1×PBS with a neutral pH, and the reaction is carried out at room temperature or 4°C for more than 0.5 hours, and the dye concentration is 20 μg/mL.

In order to characterize the technical effects achieved by the random probes obtained in different embodiments, the present disclosure provides the calculation method of labeling degree and probe concentration as follows:

After labeling, the random probe is purified, and the absorbance of the DNA fragment labeled by the random probe is measured at 260 nm and the maximum excitation wavelength of the dye. The labeling degree can be calculated by calculating the ratio of the fluorescent group to the bases in the fragment (dye/base) To estimate, calculate the probe concentration.

Optical density measurement: Measure the absorbance (Adye) of DNA fragments labeled with random probes at 260nm (A260) and maximum excitation wavelength (λexc); to obtain accurate absorbance measurements of nucleic acids, the absorbance value of the dye at 260nm must be corrected . Use the following formula to correct the A260 reading:
Abase=A260-(Adye×CF260).

The parameters of different dyes can be found on the manufacturer’s official website:

CF260 is Correction Factor at 260nm (A260 correction coefficient);

εdye is Extinction coefficients of dye (dye extinction coefficient).

To calculate labeling efficiency, the dye/base calculation method is as follows:
dye/base=(Adye×εbase)/(Abase×εdye);
dsDNA:εbase=6600cm ^-1 M ^-1 ;
ssDNA:εbase=8900cm ^-1 M ^-1 ;
oligonucleotide:εbase=10000cm ^-1 M ^-1 .

Example: dye/base=0.05 is equivalent to inserting 5 dyes dUTP into a DNA fragment containing 100 nucleotides, or into a 50bp PCR fragment. Assuming that the distribution of dATP, dCTP, dGTP and dTTP in the DNA fragment is equal, it is equivalent to 5 out of 25 dTTP being replaced by dye-dUTP.

The labeling degree can reflect the labeling efficiency of the dye molecules. Due to chemical properties and molecular size differences of different fluorescent dyes, the labeling degree may be different and cannot be compared with each other.

Calculate the probe concentration. The concentration calculation method is as follows:
Probe concentration (mg/mL)=(Abase×MWbase)/(εbase×path length);
dsDNA:MWbase=330g/mol;
dsDNA: εbase=6600cm ^-1 M ^-1 .

Use ethanol precipitation to precipitate the labeled probe, and resuspend the probe in hybridization buffer to a concentration of 2.5ng/μL.

Fluorescence in situ hybridization: Fix cells with Carnoy's fixative at room temperature for 30 minutes, soak in 2×SSC at 73°C for 2 minutes, then digest with pepsin solution containing 0.5 mg/mL at 37°C for 10 minutes, wash with PBS and fix with 1% paraformaldehyde. , repeat again, gradient ethanol dehydration and drying. Drop 3 microliters of the probe solution (2.5ng/μL) on the cell area, cover it with a coverslip, seal around the coverslip with mounting glue, and set up a hybridizer for hybridization (denaturation at 77°C for 3 minutes, hybridization at 37°C overnight) . Wash with 0.3% NP-40 in 0.4×SSC at 70°C for 2 min, and with 0.1% NP-40 in 2×SSC at room temperature for 2 min. Then, the nuclei are stained with DAPI, and scanned and image analyzed using a fluorescence microscope.

Example 13

This example provides three sets of random probe preparation methods. Compared with Example 1, the difference is only that the transposase used is different, the corresponding ME sequence is different and the primers are different, as shown in the following table:

The transposase can also be Tn1, Tn2, Tn3, Tn4, Tn6, Tn9, Tn551, Tn971, Tn916, Tn1545, Tn1681, Tgf2, Tol2, Himar1 or HARBI1. The applicable ME sequences are all easily accessible to those skilled in the art. The obtained sequences are not exhaustive here.

Example 14

Compared with Example 2, the only difference between this example and Example 2 is that transposase Tn5 is replaced with transposase Tn7, the corresponding ME sequence is replaced with the ME sequence of transposase Tn7 shown in Example 13, and the amplification primer is replaced with Amplification primers corresponding to transposase Tn7.

Example 15

Compared with Example 2, the only difference between this example and Example 2 is that transposase Tn5 is replaced with transposase Tn10, the corresponding ME sequence is replaced with the ME sequence of transposase Tn10 shown in Example 13, and the amplification primer is replaced with Amplification primers corresponding to transposase Tn10.

Example 16

Compared with Example 2, the only difference between this example and Example 2 is that transposase Tn5 is replaced by transposase Tn10, the corresponding ME sequence is replaced by the ME sequence of transposase MuA shown in Example 13, and the amplification primer is replaced with Amplification primers corresponding to transposase MuA.

Example 17

This embodiment provides multiple sets of examples. Compared with Example 8, the only difference is that the selected fluorescent groups are as follows.

Example 18

This example provides multiple sets of examples. Compared with Example 8, the only difference is that the DNA polymerase selected is as follows.

Experimental example 1

Prepare the probe targeting BAC DNA by the nick translation method according to the following reaction system. Refer to the table below for the reaction system:

The downstream fluorescent labeling steps are consistent with Example 5.

Assuming that the probe concentration is 2.5ng/μL and each probe is 4μL, calculate the number of reaction tubes required to produce 5,000 probes.

Conclusion: The probe yield of the random probe technical solution provided by this disclosure is significantly better than that of the gap translation method.

Experimental example 2

Comparison of fluorescently labeled primers and dUTP labeling effects.

Method: Compare the direct labeling effect using fluorescently labeled primers and the indirect labeling effect of fluorescein after inserting dUTP. The labeled fluorophore is FAM.

Primers:

Grouping:

The reaction system and reaction procedure are as follows:

Comparison results of yield and labeling degree:

The 3'-labeled primer cannot amplify effectively because it is modified by -OH. Although the 5'-FAM-labeled primer has a higher amplification efficiency, the labeling degree is significantly lower than that after random insertion of dUTP.

Hybridization effect diagram: (microscope scanning uses the same light source intensity, Set&Run scanning mode can set fixed exposure parameters, and Auto mode automatically adjusts exposure parameters according to the sample).

Under the same light source and exposure parameters, the fluorescence signal intensity of the 5’-FAM-labeled probe was significantly lower than that of the probe labeled after random insertion of dUTP. The signal is still weak after enhanced exposure, and some cell signals are invisible to the naked eye.

Experimental example 3

The above-mentioned detection method of labeling degree was used to detect the labeling degree of the four random probes provided in Examples 5 to 8. The results are as follows:

It can be seen that increasing the number of A bases at the linker can improve the labeling degree of the probe.

Experimental example 4

This experimental example examines the impact of different polymerases on dUTP compatibility and amplification efficiency. Using dUTP to partially or completely replace dTTP in the reaction system of Example 8 will reduce the polymerase amplification efficiency. Different polymerases have different compatibility with dUTP. This leads to differences in amplification yields, so the amplification efficiency of different DNA polymerases at different dUTP contents was examined. The ratios of dUTP: (dUTP+dTTP) were 0%, 50%, 80% and 100% respectively.

The polymerase information used is as follows:

The amplification results are shown in Figure 1. It can be seen that all three polymerases are compatible with the dUTP reaction system. The output of a single tube is 5 to 7 μg under 50% to 80% dUTP. The amplification efficiency is significant after all are replaced with dUTP. Compared with the other two polymerases, under all substitution conditions, the amplification efficiency of Robustart Taq dropped lower, showing better compatibility.

According to the above method of detecting labeling, the DNA polymerase is Robustart Taq, and the dUTP replacement ratio is 50%, 67%, 80%, and 100%, respectively. The results are as follows:

As can be seen from the table above, the labeling degree is positively related to the proportion of dUTP. An increase in the dUTP proportion can improve the insertion efficiency and increase the labeling degree.

When the dUTP replacement ratios are 50%, 67%, 80%, and 100% respectively, the FISH hybridization signal results are shown in Figure 2. It can be seen that under the same microscope light source intensity and scanning exposure parameters, the hybridization signal intensity is the same as dUTP The ratio is positively correlated. Increasing the proportion of dUTP can improve the labeling degree of the probe. Increasing the labeling degree can increase the fluorescence intensity of the probe and enhance the hybridization signal. The signal intensity of the dUTP substitution ratio is significantly higher than that of 67% and 80%, and the substitution ratio of 100% and 100% is significantly higher than that of 50%. The difference is not significant compared with 80%, which may be due to the fact that the efficiency of downstream dye labeling has reached saturation.

Experimental example 5

This group of experiments examined the impact of different dUTP fluorescent labeling groups on the labeling degree and FISH hybridization results based on Example 8. The fluorescent labeling group information is as follows:

According to the above labeling detection method, the detection results are as follows:

As can be seen from the table above, the probe directly labeled with iFluor 488-dUTP has a higher degree of labeling and the strongest hybridization signal. Due to the large molecular weight of streptavidin, steric hindrance affects the labeling efficiency of the dye, making the use of biotin Fluorescent labels linked to streptavidin have a lower degree of labeling.

After labeling with different dUTP fluorescent labeling groups, the FISH hybridization signal results are shown in Figure 3. The signal directly labeled with iFluor-488-dUTP is the strongest. The biotin molecule is too large, which prevents the probe from effectively entering the nucleus and binding to the target sequence, making it difficult to use The probe labeled with biotin and streptavidin cannot hybridize effectively with the target (the signal point is outside the nucleus, as shown by the arrow in Figure 3), indicating that biotin is not suitable for FISH hybridization of cells, but it does not rule out that it can be used for non-cells. of in situ hybridization.

Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present disclosure, but not to limit it; although the present disclosure has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: The technical solutions described in the foregoing embodiments can still be modified, or some or all of the technical features can be equivalently replaced; and these modifications or substitutions do not deviate from the essence of the corresponding technical solutions from the technical solutions of the embodiments of the present disclosure. scope.

Claims

The method for preparing random probes is characterized by using transposase to randomly fragment the target sequence, adding transposase recognition sequences to both ends of the obtained random target fragments, and then using the random target fragments as amplification templates to target The sequence toward the transposase recognition sequence is an amplification primer, which is amplified in an amplification system with a ratio of dUTP to dTTP+dUTP of 50% to 100% to obtain a random probe targeting the target sequence.
The preparation method according to claim 1, characterized in that the transposase is selected from Tn1, Tn2, Tn3, Tn4, Tn5, Tn6, Tn7, Tn9, Tn10, Tn551, Tn971, Tn916, Tn1545, Tn1681, Tgf2 , Tol2, MuA, Himar1 or HARBI1, the transposase recognition sequence includes the ME sequence of the transposase.
The preparation method according to claim 2, characterized in that the transposase is Tn5, and the ME sequence of the transposase Tn5 is 5’-AGATGTGTATAAGAGACAG-3’.
The preparation method according to claim 1, characterized in that the DNA polymerase used for amplification is selected from Taq DNA polymerase, Tth DNA polymerase, Tfl DNA polymerase, TLI DNA polymerase, Tne DNA polymerase, Tma DNA polymerase, vent ™ DNA polymerase, Phusion ™ DNA polymerase, Pfu DNA polymerase or KOD DNA polymerase.
The preparation method according to any one of claims 1 to 4, wherein the dUTP in the random probe is also labeled;

Marking methods include:

Label dUTP and then add it to the amplification system, and label the dUTP in the random probe as the amplification reaction proceeds; or,

During the amplification reaction or after the amplification is completed, the dUTP in the obtained random probe is labeled.
The preparation method according to claim 5, characterized in that the label is a fluorescent group label;

The fluorescent group is selected from fluorescein dyes, rhodamine dyes or cyanine dyes.
The preparation method according to claim 6, characterized in that the labeling method of dUTP includes directly coupling dUTP with the active group of the fluorescent group, or connecting dUTP and the active group of the fluorescent group through a modification group;

The modifying group includes a first modifying group or a second modifying group;

The first modifying group is an amino group, and the first active group connected to the first modifying group includes isothiocyanate, active ester, active carboxylic acid or sulfonyl chloride;

The second modification group is biotin, and the fluorescent group connected to the second modification group includes a streptavidin-modified dye, or a horseradish peroxidase-streptavidin conjugate.
The preparation method according to any one of claims 1 to 4, characterized in that, after the target sequence is fragmented and before the amplification reaction, a gap sequence completion reaction step is further included; or,

In the amplification reaction step after fragmentation of the target sequence, an extension procedure with the purpose of completing the gap sequence is first performed, and then the parameters are adjusted for amplification.
The preparation method according to any one of claims 1 to 4, wherein the transposase recognition sequence includes the ME sequence of the transposase and a linker sequence connected to the 5' end of the ME sequence of the transposase;

The number of base A in the linker sequence is 1 to 20;

The linker sequences include TCGTCGGCAGCGTC, ACGATGTCAGCGAC, or AAGAGACCACCAGAGTAGCAACGATGTCAGCGAC.
A random probe prepared using the preparation method described in any one of claims 1 to 9.
The random probe according to claim 10, wherein the length of the random probe is 100-500 bps, and the number of labels contained in every 100 nucleotides in the random probe is 3-10.
The application of the random probe according to claim 10 or 11 in nucleic acid hybridization assay.