JP2017175953A - SYT-SSX fusion gene detection probe, SYT-SSX fusion gene detection probe set, SYT-SSX fusion gene detection method and SYT-SSX fusion gene detection kit - Google Patents

Abstract

PROBLEM TO BE SOLVED: To provide a SYT-SSX fusion gene detection probe, a SYT-SSX fusion gene detection probe set, a SYT-SSX fusion gene detection method and a SYT-SSX fusion gene detection kit capable of easily and rapidly detecting a SYT-SSX fusion gene.SOLUTION: The SYT-SSX fusion gene detection probe is an oligonucleotide comprising a specific base sequence. The oligonucleotide is preferably labelled, more preferably fluorescently labelled, and the labelled oligonucleotide is a guanine quenching probe.SELECTED DRAWING: Figure 1

Description

  The present invention relates to a probe for detecting a SYT-SSX fusion gene, a probe set for detecting a SYT-SSX fusion gene, a method for detecting a SYT-SSX fusion gene, and a kit for detecting a SYT-SSX fusion gene.

SYT-SSX (synovial sarcoma translocation-synovial sarcoma X break point) fusion gene has been reported to be observed in almost all cases in synovial sarcoma and is thought to play a central role in tumor development. Yes. It has been revealed that the SYT gene located on chromosome 18q11.2 and the SSX gene located on the X chromosome are fused to express a SYT-SSX chimeric protein (Patent Document 1). Therefore, the presence or absence of the SYT-SSX fusion gene has important significance in the diagnosis of synovial sarcoma.
There are several types of subtypes in the SSX gene, but three types of subtypes, SSX1, SSX2 and SSX4, are observed in the synovial sarcoma as fusion genes with the SYT gene. The determination result of the subtype of the SYT-SSX fusion gene is used for determination of prognosis of synovial sarcoma and determination of a treatment policy.

  For the detection of the SYT-SSX fusion gene, RNA is extracted from the synovial sarcoma tissue, cDNA is obtained by reverse transcription, and further amplified by the PCR method to detect the SYT-SSX fusion gene. The way to do is taken. Determination of the subtype of the SYT-SSX fusion gene is performed by restriction enzyme fragment length polymorphism (RFLP) analysis, single-stranded conformation polymorphism (SSCP) analysis, sequencing, or the like. Alternatively, a plurality of primer sets that specifically amplify each subtype of the SYT-SSX fusion gene are prepared, and the subtype is determined based on the difference in the base length of the amplified product (Patent Document 2).

  In addition, as a sample used for detection of the SYT-SSX fusion gene, a fresh sample of a synovial sarcoma tissue or a fresh frozen sample is often used, but a synovial sarcoma tissue embedded in paraffin after formalin fixation was used as a sample. There are relatively few reports. This is probably because RNA is fragmented by formalin fixation and storage after embedding in paraffin, and nucleic acid amplification is difficult.

Japanese Patent Laid-Open No. 2003-252802 Japanese Patent No. 3572316

  None of the conventional methods for detecting a SYT-SSX fusion gene can be performed easily. In light of this current situation, there has been a long-awaited development of an effective technique for detecting the SYT-SSX fusion gene.

  The present invention provides a SYT-SSX fusion gene detection probe, a SYT-SSX fusion gene detection probe set, a SYT-SSX fusion gene detection method, and a SYT-SSX fusion capable of detecting a SYT-SSX fusion gene easily and quickly. It is an object of the present invention to provide a gene detection kit.

The above problem can be solved by the following means.
<1> A probe for detecting a SYT-SSX fusion gene, which is an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 1 or an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 2.
<2> The SYT according to <1>, wherein the oligonucleotide having the base sequence shown in SEQ ID NO: 1 or the oligonucleotide consisting of the base sequence shown in SEQ ID NO: 2 is labeled with a labeling substance -Probe for detecting SSX fusion gene.
<3> The probe for detecting a SYT-SSX fusion gene according to <2>, wherein the labeling substance is a fluorescent labeling substance.
<4> The probe for detecting a SYT-SSX fusion gene according to <2> or <3>, wherein the labeled oligo is a nucleotide guanine quenching probe.
<5> The labeling substance is bound to any one of the first to third positions counted from the 5 ′ end of the oligonucleotide having the base sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, <2> to <4> The probe for detecting a SYT-SSX fusion gene according to any one of 4>.
<6> The SYT-SSX fusion gene detection probe according to <5>, wherein the labeling substance is bound to the position of the 5 ′ end of the oligonucleotide having the base sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.
<7> A probe for detecting a SYT-SSX fusion gene that is an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 1 and a probe for detecting a SYT-SSX fusion gene that is an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 2 , Probe set.
<8> A SYT-SSX fusion gene detection kit comprising the SYT-SSX fusion gene detection probe according to any one of <1> to <6> or the probe set according to <7>.
<9> The forward primer, which is an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 3, and a reverse primer, which is an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 4 or SEQ ID NO: 5, according to <8> SYT-SSX fusion gene detection kit.
<10> The SYT-SSX fusion gene detection kit according to <9>, further comprising a reverse primer that is an oligonucleotide having the base sequence represented by SEQ ID NO: 6.
<11> A method for detecting a SYT-SSX fusion gene using the SYT-SSX fusion gene detection probe according to any one of <1> to <6> or the probe set according to <7>.
<12> The method for detecting a SYT-SSX fusion gene according to <11>, comprising the following (i) to (iii):
(I) a probe for detecting a SYT-SSX fusion gene that is an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 1 or a probe for detecting a SYT-SSX fusion gene that is an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 2; Dissociating the hybrid by changing the temperature of a sample containing a hybrid obtained by hybridizing with a single-stranded nucleic acid in the sample, and measuring a signal variation based on the dissociation of the hybrid;
(Ii) determining a Tm value which is a dissociation temperature of the hybrid based on the variation of the signal.
(Iii) Based on the Tm value determined in (ii) above, whether or not the SYT-SSX fusion gene is present in the single-stranded nucleic acid in the sample and / or the subtype of the SYT-SSX fusion gene To determine.
<13> The SYT-SSX fusion gene which is an oligonucleotide having the base sequence shown in SEQ ID NO: 1 as to whether or not the SYT-SSX fusion gene exists in the above (iii) using the probe set according to <7> Judgment is made based on the Tm value determined using the detection probe, and the subtype of the SYT-SSX fusion gene is determined using the SYT-SSX fusion gene detection probe, which is an oligonucleotide having the base sequence shown in SEQ ID NO: 2. The method for detecting a SYT-SSX fusion gene according to <12>, wherein the determination is based on the Tm value.
<14> The method for detecting a SYT-SSX fusion gene according to any one of <10> to <13>, wherein a fixed biological sample is used as a test sample.
<15> The method for detecting a SYT-SSX fusion gene according to <14>, wherein the fixation is formalin fixation.

  According to the present invention, a SYT-SSX fusion gene detection probe, a SYT-SSX fusion gene detection probe set, a SYT-SSX fusion gene detection method, and a SYT-, which can detect a SYT-SSX fusion gene easily and quickly. A kit for detecting an SSX fusion gene can be provided.

The binding of probes (SYTSSX-FUSION-F2 (SEQ ID NO: 1) and SYTSSX-1_2_4-F1 (SEQ ID NO: 2)) to various subtypes of wild-type SYT gene or SYT-SSX fusion gene is shown. (A) and (B) are the nucleotide sequences in the vicinity of the fusion point of the SYT gene and the SSX gene in the mRNAs of the wild type SYT gene and the SYT-SSX1 fusion gene, SYTSSX-1_2_4-F1 and / or SYTSSX-FUSION The binding region of F2 is shown. (C) and (D) are the nucleotide sequences in the vicinity of the fusion point of the SYT gene and the SSX gene in the mRNA of the SYT-SSX2 fusion gene and the SYT-SSX4 fusion gene, SYTSSX-1_2_4-F1 and SYTSSX-FUSION-F2, respectively. Shows the binding region. The sequence alignment of the SYT-SSX1 fusion gene, SYT-SSX2 fusion gene, and SYT-SSX4 fusion gene in the vicinity of the fusion point of the SYT gene and the SSX gene is shown. An example of the binding region of the probes (SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1) and the binding region of the primer in the SYT-SSX fusion gene and the wild-type SYT gene is shown. (A) and (B) are the melting curves and differential melting curves of Example 1 and Example 2, respectively. In each of (A) and (B), the melting curve is shown at the top and the differential melting curve is shown at the bottom. (A)-(C) are the melting curves and differential melting curves of Example 3 to Example 5, respectively. In each of (A) to (C), the melting curve is shown at the top and the differential melting curve is shown at the bottom. (A) and (B) are the melting curves and differential melting curves of Comparative Example 1 and Comparative Example 2, respectively. In each of (A) and (B), the melting curve is shown at the top and the differential melting curve is shown at the bottom. (A) and (B) are the melting curves and differential melting curves of Comparative Example 3 and Comparative Example 4, respectively. In each of (A) and (B), the melting curve is shown at the top and the differential melting curve is shown at the bottom. (A) and (B) are the melting curves and differential melting curves of Comparative Example 5 and Comparative Example 6, respectively. In each of (A) and (B), the melting curve is shown at the top and the differential melting curve is shown at the bottom. (A)-(F) are the melting curves and differential melting curves of Examples 6-11, respectively. In each of (A) to (F), the melting curve is shown at the top and the differential melting curve is shown at the bottom. FIG. 6 is a melting curve and a differential melting curve at a wavelength of 585 nm to 700 nm (Wave 2) and a wavelength of 520 nm to 555 nm (Wave 3) in Example 12. FIG. It is a melting curve and a differential melting curve in Example 13 in wavelength 585nm-700nmnm (Wave2) and wavelength 520nm-555nmnm (Wave3). It is a melting curve and a differential melting curve in Example 14 in wavelength 585nm-700nm (Wave2) and wavelength 520nm-555nm (Wave3). FIG. 6 is a melting curve and a differential melting curve at a wavelength of 585 nm to 700 nm (Wave 2) and a wavelength of 520 nm to 555 nm (Wave 3) in Example 15. FIG. The result of Example 16 is shown. The measurement result by a conventional method, the melting curve and differential melting curve in wavelength 585nm-700nm (Wave2) and wavelength 520nm-555nm (Wave3) measured by i-densy, and reagent reactivity are shown.

  The probe for detecting a SYT-SSX fusion gene according to one embodiment of the present invention is an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 1 or an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 2, Probe.

If a probe (SYTSSX-FUSION-F2) that is an oligonucleotide having the base sequence shown in SEQ ID NO: 1 is used, it can be determined whether or not the SYT-SSX fusion gene is present in the specimen.
If a probe (SYTSSX-1_2_4-F1) that is an oligonucleotide having the base sequence shown in SEQ ID NO: 2 is used, it can be determined whether or not the SYT-SSX fusion gene is present in the specimen. In addition, it can be determined whether the SYT-SSX fusion gene is a SYT-SSX1 fusion gene, a SYT-SSX2 fusion gene, or a SYT-SSX4 fusion gene.

The probe set for detecting a SYT-SSX fusion gene according to an embodiment of the present invention is a probe set including SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1.
The method for detecting a SYT-SSX fusion gene according to an embodiment of the present invention is a method comprising detecting a SYT-SSX fusion gene using at least one SYT-SSX fusion gene detection probe.
A kit for detecting a SYT-SSX fusion gene according to an embodiment of the present invention is a kit for detecting a SYT-SSX fusion gene containing at least one SYT-SSX fusion gene detection probe.

In the present specification, the “SYT-SSX fusion gene” means a generic name of genes in which the SYT gene and any of various types of SSX genes are fused. That is, the “SYT-SSX fusion gene” includes a SYT-SSX1 fusion gene, a SYT-SSX2 fusion gene, a SYT-SSX3 fusion gene, a SYT-SSX4 fusion gene, and a SYT-SSX5 fusion gene.
In the present specification, “detection of SYT-SSX fusion gene” means determination of whether or not a SYT-SSX fusion gene is present and / or a subtype of the SYT-SSX fusion gene.

The “SYT gene” and “SYT-SSX fusion gene” in the present specification are already known in biological species including humans, and their base sequences can be obtained from public databases such as Genbank. For example, the base sequence of the human wild-type SYT gene corresponds to the sequence of NCBI Reference Sequence: NC — 000018.10. SEQ ID NO: 7 shows the nucleotide sequence of NCBI Reference Sequence: NC — 000018.10.
An example of a full-length cDNA complementary to the transcription product of the human SYT-SSX1 fusion gene is published as NCBI Reference Sequence: NM_005635.3 (SEQ ID NO: 8). An example of a full-length cDNA complementary to the transcription product of the human SYT-SSX2 fusion gene is published as NCBI Reference Sequence: NM_0011644417.2 (SEQ ID NO: 9). An example of a full-length cDNA complementary to the transcription product of the human SYT-SSX4 fusion gene is published as NCBI Reference Sequence: NM_001034832.3 (SEQ ID NO: 10).

In the present specification, with respect to the individual sequences of sample nucleic acids, probes or primers in a sample, the matters described based on these complementary relationships with each other, unless otherwise specified, for each sequence and each sequence. This also applies to complementary sequences. When applying the subject matter of the present invention to the sequence complementary to each sequence, the sequence recognized by the complementary sequence is within the scope of technical common knowledge for those skilled in the art. The entire specification shall be read as a sequence complementary to the sequence described.
In addition, in this specification, “gene” may mean not only a gene present in the genome but also RNA that is a transcription product, cDNA obtained by reverse transcription of RNA, or an amplification product of the cDNA.

In this specification, when referring to the oligonucleotide sequence “1st to 3rd counting from the 5 ′ end”, the 5 ′ end of the oligonucleotide chain is counted as the first.
Further, in this specification, “specimen” means a tissue, cell, body fluid or the like collected from a human or an animal. The specimen may be treated with formalin fixation or paraffin embedding. The collected cells may be cultured after collection.
In the present specification, the “sample” includes a sample used for detection according to an embodiment of the present invention. Specifically, it refers to a sample that is of interest in that context. For example, depending on the context, a sample containing a nucleic acid extracted from a specimen, a sample containing an amplification product obtained by amplifying a nucleic acid extracted from a specimen, a sample containing a hybrid obtained by hybridizing a probe and a target sequence, etc. May point.

In this specification, the term “process” is not limited to an independent process, and is included in this term if the intended action of this process is achieved even when it cannot be clearly distinguished from other processes. .
Moreover, the numerical value range shown using "to" in this specification shows the range which includes the numerical value described before and behind "to" as a minimum value and a maximum value, respectively.
In the present invention, the amount of each component in the composition is such that when there are a plurality of substances corresponding to each component in the composition, the plurality of substances present in the composition unless otherwise specified. It means the total amount.
The present invention will be described below.

<SYT-SSX fusion gene detection probe>
The SYT-SSX fusion gene detection probe according to one embodiment of the present invention is a SYT-SSX fusion gene detection probe (SYTSSX-FUSION-F2) or SEQ ID NO: 2 which is an oligonucleotide having the base sequence shown in SEQ ID NO: 1. The SYT-SSX fusion gene detection probe (SYTSSX-1_2_4-F1) which is an oligonucleotide having the base sequence shown in FIG.

The base sequences of SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1 are shown below.
SYTSSX-FUSION-F2: cttattaggatagaccagacatcatg (SEQ ID NO: 1)
SYTSSX-1_2_4-F1: ccaggagaggagaagatg (SEQ ID NO: 2)

FIG. 1 shows the binding of SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1 to wild-type SYT gene or SYT-SSX fusion gene (SYT-SSX1 fusion gene, SYT-SSX2 fusion gene or SYT-SSX4 fusion gene). Show.
The base sequence of SYTSSX-FUSION-F2 is complementary to the base sequence of the region containing the fusion point of the SYT gene and the SSX gene in the SYT-SSX fusion gene, and has no mismatch. However, since the wild-type SYT gene does not have an SSX gene region, the nucleotide sequence of SYTSSX-FUSION-F2 is 5 out of 6 nucleotides on the 3 ′ side of SYTSSX-FUSION-F2 relative to the sequence of the wild-type SYT gene. Has a base mismatch. The base mismatch between the target sequence and the probe can be detected, for example, by analyzing the Tm value, as described later. The fact that no mismatch is detected between SYTSSX-FUSION-F2 and the target sequence indicates that a SYT-SSX fusion gene is present.
The base sequence of SYTSSX-1_2_4-F1 has a two-base mismatch with the base sequence of the SSX1 gene, has no mismatch with the base sequence of the SSX2 gene, and has a single base mismatch with the base sequence of the SSX4 gene.
When a region around the fusion point of the SYT gene and SSX gene of a nucleic acid contained in a specimen is hybridized with an amplified product, a two-base mismatch is detected between SYTSSX-1_2_F1 and the target sequence. SYT-SSX fusion gene is present and the subtype of the SYT-SSX fusion gene is a SYT-SSX1 fusion gene. The fact that no mismatch is detected between SYTSSX-1_2_F1 and the target sequence indicates that the SYT-SSX fusion gene exists and that the subtype of the SYT-SSX fusion gene is the SYT-SSX2 fusion gene. The detection of a single base mismatch between SYTSSX-1_2_4-F1 and the target sequence indicates that the SYT-SSX fusion gene exists and the genotype of the SYT-SSX fusion gene is a SYT-SSX4 fusion gene. Indicates.

  The binding regions of SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1 with the SYT-SSX1 fusion gene, SYT-SSX2 fusion gene and SYT-SSX4 fusion gene are shown in FIGS. 2-1 (A) and (B), FIG. -2 (C) and (D). In FIGS. 2-1 and 2-2, the nucleotide sequences of the mRNA sequences of the SYT-SSX1 fusion gene, SYT-SSX2 fusion gene, and SYT-SSX4 fusion gene are shown. However, uracil in RNA is shown by replacing it with thymine.

In the SYT-SSX1 fusion gene, the fusion point of the SYT gene and the SSX gene is the same position regardless of the subtype of the SSX gene. The fusion points in the SYT-SSX1 fusion gene, SYT-SSX2 fusion gene and SYT-SSX4 fusion gene are shown in FIG.
The probe SYTSSX-FUSION-F2 binds to a region including a fusion point between the SYT gene and each SSX gene in the SYT-SSX1 fusion gene. The sequence of the binding region of SYTSSX-FUSION-F2 is not different between the SYT-SSX1 fusion gene, the SYT-SSX2 fusion gene, and the SYT-SSX4 fusion gene.

The probe SYTSSX-1_2_4-F1 binds to a region including the SSX gene in the vicinity of the fusion point between the SYT gene and each SSX gene in the SYT-SSX1 fusion gene.
There is a mismatch between the SYTSSX-1_2_4-F1 and the target sequence of the SYT-SSX1 fusion gene at the 12th and 14th bases counted from the 5 ′ side of the SYTSSX-1_2_F1 (2-base mismatch). Specifically, in SYTSSX-1_2_4-F1, the 12th base counted from the 5 ′ side is A (adenine), and the 14th base is G (guanine). In the sense strand of the SYT-SSX1 fusion gene, the base corresponding to the 12th base is G (guanine), and the base corresponding to the 14th base is T (thymine).

  In the SYT-SSX2 fusion gene, there is no mismatch between the SYTSSX-1_2_4-F1 and the target sequence of the SYT-SSX1 fusion gene (perfect match).

  In the SYT-SSX4 fusion gene, there is a mismatch between the SYTSSX-1_2_4-F1 and the target sequence of the SYT-SSX1 fusion gene at the 14th base counted from the 5 'side of the binding region of SYTSSX-1_2_4-F1. (1 base mismatch). Specifically, in SYTSSX-1_2_4-F1, the 14th base counted from the 5 'side of the binding region is G (guanine). In contrast, in the sense strand of the SYT-SSX4 fusion gene, the base corresponding to the 14th base is T (thymine).

Oligonucleotides contained in SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1 include modified oligonucleotides in addition to oligonucleotides. The modified oligonucleotide includes, for example, an oligonucleotide labeled with a labeling substance, an oligonucleotide to which a phosphate group is added, and the like. Examples of the structural unit of the oligonucleotide include ribonucleotides, deoxyribonucleotides, artificial nucleic acids and the like, and deoxyribonucleotides are preferable. Examples of the artificial nucleic acid include DNA, RNA, RNA analog LNA (Locked Nucleic Acid); peptide nucleic acid PNA (Peptide Nucleic Acid); cross-linked nucleic acid BNA (Bridged Nucleic Acid).
The oligonucleotide may be composed of one or more types of the structural units.

In SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1, even if the probe has a base sequence in which 1 to 3 bases are extended, shortened, inserted, deleted, or substituted, the SYTSSX- Similarly to FUSION-F2 and SYTSSX-1_2_4-F1, there may be a probe capable of detecting the SYT-SSX fusion gene and / or determining the SYT-SSX fusion genotype. Such a probe having a base sequence in which 1 to 3 bases are extended, shortened, inserted, deleted or substituted from the base sequence of SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1 is also fused with SYT-SSX. If it is possible to detect a gene and / or determine a SYT-SSX fusion genotype, it is included in the present invention as an embodiment of the present invention.
That is, even if the probe has a base sequence in which 1 to 3 bases are extended, shortened, inserted, deleted, or substituted from the base sequence of SYTSSX-FUSION-F2, the target sequence of the wild-type SYT gene Any probe that has a difference in mismatch between the mismatch and the target sequence of the SYTSYT-SSX fusion gene and can detect the difference in mismatch by, for example, a difference in Tm value is included in the present invention as an embodiment of the present invention. Targets of SSX1 gene, SSX2 gene and SSX4 gene even if the probe has a base sequence in which 1 to 3 bases are extended, shortened, inserted, deleted or substituted from the base sequence of SYTSSX-1_2_F1 Any probe that has a difference in sequence mismatch and can detect the mismatch difference by, for example, a difference in Tm value is included in the present invention as an embodiment of the present invention.

  SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1 can be chemically synthesized by a known method known as an oligonucleotide synthesis method, such as the amidite method, the H-phosphonate method or the thiophosphite method. it can. Methods for producing SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1 using a genetically modified microorganism are also well known to those skilled in the art.

The mismatch between the probe (SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1) and the target sequence can be detected by, for example, analyzing the Tm value. The smaller the mismatch between the probe and the target sequence, the higher the Tm value, and the greater the mismatch, the lower the Tm value. For example, there is a difference between the Tm value when there is no mismatch, the Tm value when there is a one-base mismatch, and the Tm value when there is a two-base mismatch. The mismatch can be detected by hybridizing the probe and the target sequence and measuring the Tm value of the hybrid.
When mismatches are detected by analyzing the Tm value, for example, the Tm value of the hybrid of the probe and the target sequence in the wild-type SYT gene or the SYT-SSX fusion gene of each subtype is obtained in advance by measurement or calculation. May be. The Tm value can be calculated using Meltcalc 99 free (http://www.meltcalc.com/). For example, setting conditions: Oligoconc [μM] 0.2, Na eq. It can be calculated under any conditions such as [mM] 50. The Tm value analysis of the detection target sample is performed, and the detection target sample is compared with the hybrid Tm value of the probe obtained in advance and the target sequence in the SYT-SSX fusion gene of the wild type SYT gene or each subtype. The mismatch between the nucleic acid in the SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1 can be detected.

  In the present specification, the “Tm value” is a temperature at which a double-stranded nucleic acid is dissociated (dissociation temperature: Tm). Generally, the temperature at which the absorbance at 260 nm reaches 50% of the total increase in absorbance. Is defined. That is, when a solution containing a double-stranded nucleic acid, for example, a double-stranded DNA, is heated, the absorbance at 260 nm increases. This is because hydrogen bonds between both strands in double-stranded DNA are unwound by heating and dissociated into single-stranded DNA (DNA melting). When all the double-stranded DNAs are dissociated into single-stranded DNAs, the absorbance is about 1.5 times the absorbance at the start of heating (absorbance of only double-stranded DNA), thereby melting. It can be judged that it has been completed. The Tm value is set based on this phenomenon.

  In order to analyze the Tm value of each probe and the detection target gene, it is preferable that the oligonucleotide of SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1 is labeled with a labeling substance, and the labeling substance is a fluorescent substance It is particularly preferred that As the fluorescent labeling substance, a fluorescent labeling substance in which the fluorescence intensity when hybridized to the target sequence is decreased (quenched) or increased as compared to the fluorescence intensity when not hybridized to the target sequence is preferable. Among them, a fluorescent labeling substance that reduces the fluorescence intensity when hybridized to the target sequence is more preferable than the fluorescence intensity when not hybridized to the target sequence.

  One example of a probe using such a fluorescence quenching phenomenon (Quenching phenomenon) is a guanine quenching probe, which is known as a so-called Q Probe (registered trademark). Among them, it is particularly preferable that the 3 ′ end or the 5 ′ end is designed to be cytosine (C), and the labeling is performed with a fluorescent labeling substance so that light emission is weakened when C at the end approaches guanine (G). . If such a probe is used, a change in Tm value due to hybridization and dissociation can be easily detected due to signal fluctuation.

  In addition to the detection method using Q Probe, a known detection mode may be applied. Examples of such detection modes include Taq-man Probe method, Hybridization Probe method, Molecular Beacon method, and MGB Probe method.

Examples of the fluorescent labeling substance include fluorescein, phosphor, rhodamine, polymethine dye derivative and the like. Examples of commercially available products of these fluorescent dyes include Pacific Blue, BODIPY FL, FluorePrime, Fluoredite, FAM, Cy3 and Cy5, and TAMRA.
The detection conditions for the fluorescently labeled probe are not particularly limited, and can be appropriately determined depending on the fluorescent dye used. For example, Pacific Blue can be detected at a detection wavelength of 445 nm to 480 nm, TAMRA can be detected at a detection wavelength of 585 nm to 700 nm, and BODIPY FL can be detected at a detection wavelength of 520 nm to 555 nm.
If a probe having such a fluorescent labeling substance is used, hybridization and dissociation can be easily confirmed by fluctuations in the respective fluorescence signals.

The labeling of the probe with the fluorescent labeling substance may be performed by binding the fluorescent labeling substance to the oligonucleotide contained in the probe. The fluorescently labeled base is preferably present at any one of the first to third positions counted from the 5 ′ end from the viewpoint of the efficiency and detection sensitivity of the fluorescent label. The fluorescent labeling substance may be bound directly to the oligonucleotide or indirectly via a linker or the like.
The fluorescent labeling substance can be bound to the oligonucleotide according to a usual method. It can also be carried out using a commercially available labeling kit such as OliGro (registered trademark) manufactured by Marker Gene Technologies.

  As a probe for detecting a SYT-SSX fusion gene according to one embodiment of the present invention, a probe for detecting a SYT-SSX fusion gene, which is an oligonucleotide having a base sequence represented by SEQ ID NO: 1 or It is a probe for detecting a SYT-SSX fusion gene, which is an oligonucleotide having the base sequence shown in SEQ ID NO: 2. Particularly preferably, the label is a fluorescent label.

In addition, a phosphate group may be added to the 3 ′ end of SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1. By adding a phosphate group to the 3 ′ end of the fluorescently labeled probe, it is possible to sufficiently suppress the probe itself from being extended by the gene amplification reaction. As described later, the nucleic acid to be detected (target nucleic acid) can be prepared by a gene amplification method such as PCR. In this case, by using a fluorescently labeled probe with a phosphate group added to the 3 ′ end, it can be coexisted in the reaction solution of the amplification reaction.
The same effect can be obtained by adding a labeling substance (fluorescent dye) as described above to the 3 ′ end.

<SYT-SSX fusion gene detection probe set>
The probe set for detecting a SYT-SSX fusion gene according to an embodiment of the present invention is a probe set for detecting a SYT-SSX fusion gene including SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1.
By using a combination of SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1, it is possible to make a determination with higher accuracy than when using each independently.

Since SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1 have different binding regions in the target sequence, they can provide complementary information.
For example, although the probability is low, the SYTSSX-1_2_4-F1 probe does not bind due to an unknown mutation in the region of the SSX gene in the SYT-SSX fusion gene despite the presence of the SYT-SSX fusion gene Is assumed. In such a case, the presence or absence of the SYT-SSX fusion gene can be determined more accurately by combining with SYTSSX-FUSION-F2.

The above-mentioned description about the fluorescence labeling etc. about SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1 is applied to SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1 included in the probe set as they are.
Further, in the probe set, SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1 may be included in a mixed state or may be included separately.
When SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1 are in a mixed state or are included as separate reagents, for example, the Tm analysis of the probe and each detection target sequence is performed in the same reaction system at the time of use. When performing, it is preferable that SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1 are labeled with fluorescent dyes having different emission wavelengths.
Thus, by changing the kind of fluorescent substance, it is possible to detect each probe even in the same reaction system.

<Method for detecting SYT-SSX fusion gene>
The method for detecting a SYT-SSX fusion gene according to an embodiment of the present invention is a SYT-SSX fusion gene using SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1, or SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1. This is a detection method.
According to the method for detecting a SYT-SSX fusion gene, by including the probe SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1, whether the SYT-SSX fusion gene is present and / or the SYT-SSX fusion gene Is a subtype of the SYT-SSX1 fusion gene, the SYT-SSX2 fusion gene, or the SYT-SSX4 fusion gene, and can be easily and sensitively detected.

The method for detecting a SYT-SSX fusion gene according to an embodiment of the present invention is characterized by using SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1, and other configurations and conditions are described below. Not limited to.
In addition, about the probe used for the detection method of a SYT-SSX fusion gene, the matter mentioned above about a probe can be applied as it is.

Hybridization of SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1 with a target sequence may be performed by a known method or a method according thereto, for example, Molecular Cloning 3rd (J. Sambrook et al., Cold Spring Harbor Lab. Press, 200). Can be carried out according to the method described in the above. This document is hereby incorporated by reference.
Hybridization is preferably performed under stringent conditions. Stringent conditions refer to conditions in which specific hybrids are formed and non-specific hybrids are not formed. Here, the specific hybrid refers to a hybrid formed by binding SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1 to a target sequence. Typical stringent conditions include, for example, conditions under which hybridization is performed in a potassium concentration of about 25 mM to about 50 mM and a magnesium concentration of about 1.0 mM to about 5.0 mM. Examples of conditions according to an embodiment of the present invention include, but are not limited to, conditions for performing hybridization in Tris-HCl (pH 8.6), 25 mM KCl, and 1.5 mM MgCl _2. It is not a thing. Other stringent conditions are described in Molecular Cloning 3rd (J. Sambrook et al., Cold Spring Harbor Lab. Press, 2001). This document is hereby incorporated by reference. Those skilled in the art can easily select such conditions by changing the hybridization reaction, the salt concentration of the hybridization reaction solution, and the like.

The method for detecting a SYT-SSX fusion gene according to an embodiment of the present invention may include the following steps (I) to (III). In addition, the method for detecting a SYT-SSX fusion gene of the present invention is characterized by using the probe (SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1) itself, and other processes and conditions are not limited at all. .
(I) Extracting RNA from the specimen.
(II) Preparing DNA (cDNA) complementary to RNA that is a transcript of the SYT gene or SYT-SSX1 fusion gene contained in the specimen.
(III) Amplifying the nucleic acid in the region containing the target sequence of the probe (SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1) using the cDNA as a template.

  In the above (I), RNA is extracted by a method known to those skilled in the art, for example, Acid Guanidinium Thiocyanate-phenol-chloroform extraction (AGPC method) (Chomczynski & Sacchi (1987) Analytical Biochemistry, 162: 156-159). Can do.

In (II) above, DNA complementary to RNA can be prepared using reverse transcriptase. Examples of the reverse transcriptase include, but are not limited to, reverse transcriptases derived from retroviruses such as Moloney Murine Leukemia Virus (M-MVL) and Avian Myeloblastosis Virus (AMV).
cDNA can be prepared by a known method, for example, the method described in Cleveland, DL and Ihle, JH (1995) Cell 81, 479. or Tartaglia, LA and Goeddel, DV (1992) Immunol. Today 13,151. .

In one embodiment of the present invention, the nucleic acid may be a nucleic acid originally contained in a biological sample. However, since the detection accuracy can be improved, the step (III) is preferably performed. The length of the amplification product obtained in (III) is not particularly limited, but can be, for example, 50 mer to 1000 mer, or 80 mer to 200 mer.
In the above (III), the nucleic acid can be amplified by, for example, a method using a polymerase. Examples thereof include PCR method, ICAN method, LAMP method, NASBA method and the like. When amplification is performed by a method using a polymerase, amplification is preferably performed in the presence of the probe of the present invention. Those skilled in the art can easily adjust the amplification reaction conditions and the like according to the probe and polymerase used. Thereby, since it can be determined only by analyzing the Tm value of the probe after nucleic acid amplification, it is not necessary to handle the amplified product after the reaction is completed. Therefore, there is no worry of contamination by amplification products. In addition, since it can be detected by the same equipment as that required for amplification, there is no need to move the container and automation is easy.

As the DNA polymerase used in the PCR method, a commonly used DNA polymerase can be used without particular limitation. For example, GeneTaq (manufactured by Nippon Gene), PrimeSTAR Max DNA Polymerase (manufactured by Takara Bio Inc.), Taq polymerase and the like can be mentioned.
The amount of polymerase used is not particularly limited as long as it is a commonly used concentration. For example, when Taq polymerase is used, for example, the concentration can be 0.01 U to 100 U with respect to the reaction solution amount of 50 μL. This tends to increase the detection sensitivity.

The PCR method can be performed by appropriately selecting commonly used conditions.
During amplification, it is also possible to monitor amplification by real-time PCR and examine the copy number of the target sequence contained in the sample. That is, since the ratio of probes that form hybrids increases as the nucleic acid is amplified by PCR, the fluorescence intensity varies. By monitoring this, the copy number and abundance of the target sequence contained in the sample can be evaluated.

  Said (II) and (III) may be performed by reverse transcription PCR method as one reaction. The reverse transcription PCR method can be performed by a known method. For example, a commercial kit manufactured by Promega (Evans, H., and Sillibourne, J. Promega Notes 57, p21.), A commercial kit manufactured by Clontech (J. Biol. Chem., 2008; 283: 17175-17183.) Etc. can be used for reverse transcription PCR.

<Primer>
In the case of (III), when nucleic acid is amplified by PCR, the nucleic acid is amplified using appropriate primers. The primer that can be used is not particularly limited as long as it can amplify the nucleic acid in the region containing the base corresponding to the probe (SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1) of the SYT-SSX fusion gene or SYT wild-type gene. .

  The primer applied to the PCR method is not particularly limited as long as it can amplify a region where the probe for detecting a SYT-SSX fusion gene according to an embodiment of the present invention can be hybridized, and the bases represented by SEQ ID NOs: 7 to 10 are used. Those skilled in the art can appropriately design the arrangement. The length and Tm value of the primer may be 12 mer to 40 mer and 40 ° C. to 70 ° C., or 16 mer to 30 mer and 55 ° C. to 60 ° C.

In order to amplify the target sequence by the PCR method, a primer set including a forward primer and a reverse primer may be used.
Using the primer set for amplifying the SYT-SSX fusion gene and the primer set for amplifying the wild-type SYT gene, amplification reaction for amplification of the SYT-SSX fusion gene and amplification of the wild-type SYT gene The amplification reaction may be performed in a single amplification reaction system in parallel, or the amplification of the SYT-SSX fusion gene and the amplification of the wild-type SYT gene may be performed in separate amplification reaction systems. In addition, when only SYTSSX-1_2_4-F1 is used, amplification of a wild type SYT gene is not required.
In addition, subtypes exist in the SYT-SSX fusion gene, but amplification by PCR may be performed using a primer set corresponding to a sequence common among the subtypes, or a specific subtype sequence may be specified. Alternatively, amplification by the PCR method may be performed for each subtype using a primer set that amplifies automatically. When performing amplification by PCR method for each subtype, the amplification reaction for amplification of each subtype may be performed in parallel in one reaction system, or may be performed in another amplification reaction system for each subtype. Good.
In one embodiment, the primer set for amplifying the SYT-SSX fusion gene and the primer set for amplifying the wild-type SYT gene share a forward primer or a reverse primer, and the SYT-SSX fusion gene is amplified by three primers. An amplification reaction for amplification of the wild-type SYT gene can also be performed in parallel in one amplification reaction system.

As primers particularly suitable as primers applied to the PCR method, forward primers and reverse primers described below are exemplified.
-Forward primer-
-Oligonucleotide consisting of the base sequence shown in SEQ ID NO: 3 (SYT-WT-F2)
-Reverse primer-
-Oligonucleotide consisting of the base sequence shown in SEQ ID NO: 4 (SYT-SSX-R1)
-Oligonucleotide consisting of the base sequence shown in SEQ ID NO: 5 (SYT-SSX-R2)
-Oligonucleotide consisting of the base sequence shown in SEQ ID NO: 6 (SYT-WT-R2)

FIG. 4 shows the binding positions of SYT-WT-F2, SYT-WT-R2, SYT-SSX-R1, and SYT-SSX-R2, which are examples of suitable primers, to the target sequence.
SYT-WT-F2 binds to a region in exon 10 of the SYT gene that is present in both the SYT-SSX fusion gene and the wild-type SYT gene. SYT-WT-R2 binds to a region of the SYT gene downstream from the fusion point that is present in the wild-type SYT gene but not in the SYT-SSX fusion gene. SYT-SSX-R1 and SYT-SSX-R2 are present in the SYT-SSX fusion gene and bind to a region of the SSX gene that is not present in the wild-type SYT gene. SYT-SSX-R1 and SYT-SSX-R2 are sequences common to SYT-SSX1 fusion gene, SYT-SSX2 fusion gene, and SYT-SSX4 fusion gene, which are subtypes of SYT-SSX fusion gene. Amplification can be performed regardless of the subtype of the SYT-SSX fusion gene.
Therefore, if SYT-WT-F2, SYT-WT-R2, and SYT-SSX-R1 or SYT-SSX-R2 are used, the amplification reaction of the wild-type SYT gene with three primers and the three subtypes The amplification reaction of the SYT-SSX fusion gene can be performed in parallel in one amplification reaction system.
The sequence of SYT-SSX-R2 includes a base that is adenine or guanine represented by R in the sequence represented by SEQ ID NO: 5. When SYT-SSX-R2 is used as a reverse primer, a primer whose base indicated by R is adenine and a primer whose guanine is preferably mixed in equal amounts are preferably used, so that the SYT-SSX1 fusion gene, SYT- Both the SSX2 fusion gene and the SYT-SSX4 fusion gene can be efficiently amplified.

  In the SYT-SSX fusion gene, the sequence derived from the SSX side has a different base sequence depending on the subtype of the SSX gene, and there are also many differences in gene sequences such as single nucleotide polymorphism (FIG. 3). Therefore, it is difficult even for those skilled in the art to obtain a primer set that can perform the amplification reaction of the wild-type SYT gene and the amplification reaction of the three subtypes of the SYT-SSX fusion gene in the same amplification reaction system. It is. However, by using SYT-WT-F2 as the forward primer, SYT-WT-R2 and SYT-SSX-R1 or SYT-SSX-R2 as the reverse primer, the amplification reaction of the wild-type SYT gene and three sub- It is possible to carry out the amplification reaction of the type SYT-SSX fusion gene in parallel in the same amplification reaction system.

Furthermore, by using SYT-WT-F2 as the forward primer and SYT-WT-R2, SYT-SSX-R1 or SYT-SSX-R2 as the reverse primer, formalin fixation or paraffin embedding, which is usually difficult, is performed. Nucleic acid amplification of the target region of the nucleic acid contained in the sample is possible.
Even when a probe other than the probe according to one embodiment of the present invention is used, the primer corresponds to a region including a fusion point of the SYT gene of the SYT-SSX fusion gene and the SSX gene or a wild type SYT gene. It can be used to amplify nucleic acids in a region.

The method for detecting a SYT-SSX fusion gene according to an embodiment of the present invention may include the following steps (i) to (iii).
(I) The hybrid is dissociated by changing the temperature of the sample including the hybrid obtained by hybridizing the probe (SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1) and the single-stranded nucleic acid in the sample. Measure signal fluctuations based on dissociation of the hybrid.
(Ii) determining a Tm value which is a dissociation temperature of the hybrid based on the variation of the signal.
(Iii) Based on the Tm value determined in (ii) above, whether or not the SYT-SSX fusion gene is present in the single-stranded nucleic acid in the sample and / or the SYT-SSX fusion gene is SYT- To determine which subtype of the SSX1 fusion gene, the SYT-SSX2 fusion gene, or the SYT-SSX4 fusion gene.

<Hybridization>
In (i) above, the probe (SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1) is brought into contact with the single-stranded nucleic acid in the sample, and both are hybridized. A single-stranded nucleic acid in a sample can be prepared, for example, by dissociating the PCR amplification product obtained as described above.

  The heating temperature in the dissociation (dissociation step) of the PCR amplification product is not particularly limited as long as it is a temperature at which the amplification product can be dissociated. For example, it is 85 to 95 ° C. The heating time is not particularly limited. The heating time can be, for example, 1 second to 10 minutes, or 1 second to 5 minutes.

  In addition, hybridization between the dissociated single-stranded nucleic acid and the probe can be performed, for example, by lowering the heating temperature in the dissociation step after the dissociation step. As temperature conditions, it is 40 to 50 degreeC, for example.

  The volume and concentration of each composition in the hybridization reaction solution are not particularly limited. As a specific example, the concentration of the nucleic acid in the reaction solution can be, for example, 0.01 μM to 1 μM, or 0.1 μM to 0.5 μM. The concentration of the probe is, for example, a range that satisfies the addition ratio with respect to the nucleic acid, and can be, for example, 0.001 μM to 10 μM, or 0.001 μM to 1 μM.

  In one embodiment of the present invention, the nucleic acid in the sample may be a single-stranded nucleic acid or a double-stranded nucleic acid. When the nucleic acid is a double-stranded nucleic acid, for example, prior to hybridization with the fluorescently labeled probe, the double-stranded nucleic acid in the sample is melted (dissociated) by heating to form a single-stranded nucleic acid. It is preferable to contain. By dissociating the double-stranded nucleic acid into a single-stranded nucleic acid, hybridization with the probe becomes possible.

The addition ratio (molar ratio) of the probe (SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1) to the nucleic acid in the sample is not particularly limited. For example, 1 times or less of the nucleic acid in the sample can be mentioned. Further, from the viewpoint of securing a sufficient detection signal, the addition ratio (molar ratio) of the probe to the nucleic acid in the sample can be 0.1 times or less.
Here, the nucleic acid in the sample may be, for example, the total of the detection target nucleic acid in which the SYT-SSX fusion gene is present and the detection target nucleic acid in which the wild type SYT gene is present, or the detection in which the SYT-SSX fusion gene is present. The total of the amplification product containing the target sequence and the amplification product containing the detection target sequence in which the wild-type SYT gene is present may be used. In addition, although the ratio of the detection target nucleic acid in the nucleic acid in the sample is usually unknown, as a result, the addition ratio (molar ratio) of the probe depends on the detection target nucleic acid (amplification product including the detection target sequence). On the other hand, it may be 10 times or less. Moreover, the addition ratio (molar ratio) of the probe can be 5 times or less, or 3 times or less of the detection target nucleic acid (amplification product containing the detection target sequence). Moreover, the lower limit is not particularly limited, but may be, for example, 0.001 times or more, 0.01 times or more, or 0.1 times or more.
The ratio of the probe to the nucleic acid may be, for example, a molar ratio with respect to a double-stranded nucleic acid or a molar ratio with respect to a single-stranded nucleic acid.

The SYT-SSX fusion gene detection probe may be added to a liquid sample containing nucleic acid, or may be mixed with a sample containing nucleic acid in an appropriate solvent. The solvent is not particularly limited, and examples thereof include conventionally known solvents such as a buffer solution such as Tris-HCl, a solvent containing KCl, MgCl ₂ , MgSO ₄ , glycerol and the like, and a PCR reaction solution.
The timing of addition of the probe is not particularly limited. For example, when an amplification reaction such as PCR is performed, the probe may be added to the PCR amplification product after the amplification reaction or may be added before the amplification reaction. Good.
As described above, it is preferable to add the detection probe to perform fluorescence labeling or add a phosphate group to the 3 ′ end before the amplification reaction by PCR or the like.

<Measurement of signal fluctuation based on dissociation of hybrid>
In (i) above, the obtained hybrid of the single-stranded nucleic acid and the probe is gradually heated, and the fluctuation of the signal accompanying the temperature rise is measured.
Next, in (i), a method for detecting a change in signal based on the dissociation of the hybrid will be described with a specific example.

  For example, when QProbe is used, the fluorescence intensity is reduced (or quenched) in the hybridized state with a single-stranded nucleic acid compared to the dissociated state. Therefore, for example, a hybrid in which fluorescence is decreased (or quenched) may be gradually heated to measure an increase in fluorescence intensity as the temperature rises.

  Although the temperature range in measuring the fluctuation | variation of fluorescence intensity is not restrict | limited in particular, For example, starting temperature can be room temperature-85 degreeC, or 25 degreeC-70 degreeC. The end temperature may be 40 ° C. to 105 ° C., for example. Further, the rate of temperature rise is not particularly limited, and may be, for example, 0.1 ° C./second to 20 ° C./second, or 0.3 ° C./second to 5 ° C./second.

  Moreover, instead of the method of measuring the signal fluctuation (preferably increase in signal intensity) accompanying the temperature rise by heating the hybrid, measurement of the signal fluctuation at the time of hybrid formation may be performed. That is, the signal fluctuation accompanying the temperature drop when the hybrid is formed by lowering the temperature of the sample to which the probe is added may be measured.

As a specific example, when QProbe is used, when the probe is added to a sample, the fluorescence intensity is high because the probe is in a dissociated state. However, when a hybrid is formed due to a decrease in temperature, the fluorescence decreases (or Extinguish). Therefore, for example, the temperature of the heated sample may be gradually lowered to measure the decrease in fluorescence intensity accompanying the temperature drop.
On the other hand, when a labeled probe whose signal increases due to hybridization is used, when the probe is added to the sample, the probe is in a dissociated state, so that the fluorescence intensity is low (or quenching). When a hybrid is formed, the fluorescence intensity increases. Therefore, for example, the temperature of the sample may be gradually lowered and the increase in fluorescence intensity accompanying the temperature drop may be measured.

<Determination of Tm value>
In (ii), the Tm value is determined by analyzing the fluctuation of the signal. Specifically, a differential value (−d fluorescence intensity / dt) at each temperature is calculated from the obtained signal intensity, and the temperature showing the lowest value can be determined as the Tm value. In addition, the point with the highest signal intensity increase (fluorescence intensity increase / t) per unit time can be determined as the Tm value. If a probe whose signal intensity is increased by hybridization instead of a quenching probe is used as the labeled probe, on the contrary, the amount of decrease in fluorescence intensity may be measured.

In one embodiment of the present invention, the measurement of the signal fluctuation accompanying the temperature change for determining the Tm value can be performed by measuring the absorbance at 260 nm based on the principle as described above, but for detecting the SYT-SSX fusion gene. It is preferable to measure a signal based on the signal of the label added to the probe, which varies depending on the state of hybridization between the single-stranded nucleic acid and the SYT-SSX fusion gene detection probe. The probe is labeled and hybridized to a labeled probe or a complementary sequence whose signal intensity is reduced (quenched) when hybridized to the complementary sequence compared to the signal intensity when not hybridized to the complementary sequence. Compared with the signal intensity when not soyed, the fluorescence-labeled probe can be increased in signal intensity when hybridized to the target sequence.
If the probe is like the former, no signal is shown when a hybrid (double-stranded nucleic acid) is formed with the detection target sequence, or the signal is weak, but when the probe is dissociated by heating, the signal is shown. Or the signal increases.
In the case of the latter probe, a signal is shown by forming a hybrid (double-stranded nucleic acid) with the sequence to be detected, and the signal decreases (disappears) when the probe is dissociated by heating. Therefore, by detecting a change in signal based on this label under conditions specific to the label (fluorescence wavelength or the like), it is possible to determine the progress of melting and the Tm value as in the case of the absorbance measurement at 260 nm.
Note that it is not necessary to calculate or measure an absolute numerical value for the Tm value of each hybrid. It is sufficient to be able to grasp the difference in Tm values for detecting base mismatches in the hybrid.

<Detection of SYT-SSX fusion gene>
In the above (iii), when SYTSSX-FUSION-F2 is used, it is determined by SYTSSX-FUSION-F2 whether or not the SYT-SSX fusion gene is present in the sample.
In the hybrid of the probe SYTSSX-FUSION-F2 and the target sequence, it is determined that the SYT-SSX fusion gene is present when the Tm value at the perfect match is shown.
In the hybrid of the probe SYTSSX-FUSION-F2 and the target sequence, when the Tm value is 6 base mismatch, it is determined that the SYT-SSX fusion gene does not exist.

In (iii) above, when SYTSSX-1_2_4-F1 is used, whether SYT-SSX fusion gene is present in the sample and / or SYT-SSX fusion gene is SYT- The subtype of the SSX1 fusion gene, SYT-SSX2 fusion gene, or SYT-SSX4 fusion gene is determined.
When a nucleic acid amplification product including a region around the fusion point of the SYT gene and the SSX gene is used as a sample, the determination can be made as follows.
-In the hybrid of the probe SYTSSX-1_2_4-F1 and the target sequence, when the Tm value is shown when it is a perfect match, it is determined that the SYT-SSX fusion gene exists, and the subtype is the SYT-SSX2 fusion gene. judge.
-In the hybrid of the probe SYTSSX-1_2_4-F1 and the target sequence, when the Tm value is shown when there is a two-base mismatch, it is determined that the SYT-SSX fusion gene exists, and the subtype is the SYT-SSX1 fusion gene Is determined.
-In the hybrid of the probe SYTSSX-1_2_4-F1 and the target sequence, if the Tm value is 1 base mismatch, it is determined that the SYT-SSX fusion gene exists, and the subtype is the SYT-SSX4 fusion gene Is determined.

When the probes SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1 were used, when the determination result by the probe SYTSSX-FUSION-F2 showed that the SYT-SSX fusion gene was present in the sample, It can be determined as follows.
-In the hybrid of the probe SYTSSX-1_2_4-F1 and the target sequence, if the Tm value is a perfect match, it is determined that the SYT-SSX2 fusion gene is present.
-In the hybrid of the probe SYTSSX-1_2_4-F1 and the target sequence, if the Tm value is a two-base mismatch, it is determined that the SYT-SSX1 fusion gene is present.
In the hybrid of the probe SYTSSX-1_2_4-F1 and the target sequence, if the Tm value is a single base mismatch, it is determined that the SYT-SSX4 fusion gene exists.

<Sample>
In the method for detecting a SYT-SSX fusion gene according to an embodiment of the present invention, whether or not a SYT-SSX fusion gene exists and / or the SYT-SSX fusion gene is a SYT-SSX1 fusion gene or a SYT-SSX2 fusion gene. A sample to be determined as to which subtype of the gene or SYT-SSX4 fusion gene may be used. Suitable test specimens are biological samples, including human synovial sarcoma tissue. Other tissues, blood cells such as white blood cells, whole blood, plasma, sputum, oral mucosal suspension, somatic cells such as nails and hair, germ cells, milk, ascites fluid, paraffin-embedded tissue, gastric juice, gastric lavage fluid Any biological sample such as urine, peritoneal fluid, amniotic fluid, and cell culture may be used.
The type of nucleic acid contained in the specimen is not particularly limited, but is preferably ribonucleic acid (RNA). In the method for detecting a SYT-SSX fusion gene according to one embodiment of the present invention, it is preferable to use a nucleic acid, particularly RNA, extracted from a specimen as a test subject.
The method for collecting the specimen, the method for preparing the sample containing nucleic acid from the specimen, etc. are not limited, and any conventionally known method can be adopted. Moreover, the nucleic acid used as a template can be used directly as obtained from the source, or after pretreatment to modify the properties of the nucleic acid.

A fixed tissue can be used as the specimen. When RNA is extracted from a specimen, it is generally preferable to extract RNA from a fresh specimen or a fresh frozen specimen because RNA is fragmented by fixation or storage. However, in one embodiment of the present invention, by using SYT-WT-F2 as a forward primer and SYT-WT-R2, SYT-SSX-R1 or SYT-SSX-R2 as a reverse primer, For example, a fixed biological sample considered to be fragmented can be used as a specimen.
The fixed biological sample may be a section of a biological sample embedded in paraffin or resin after fixing, or may be a stained biological sample. The method for fixing the biological sample is not particularly limited, and examples include formalin fixation, paraformaldehyde fixation, glutaraldehyde fixation, alcohol fixation, and the like. The staining method is not particularly limited, and examples include hematoxylin and eosin staining.

<SYT-SSX fusion gene detection kit>
The kit for detecting a SYT-SSX fusion gene according to an embodiment of the present invention includes a probe of either SYTSSX-FUSION-F2 or SYTSSX-1_2_4-F1, or includes SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1 SYT-SSX fusion gene detection kit comprising a probe set comprising
By including at least one of the probe or the probe set, whether or not a SYT-SSX fusion gene is present and / or the SYT-SSX fusion gene is a SYT-SSX1 fusion gene, a SYT-SSX2 fusion gene, or a SYT- Which subtype of the SSX4 fusion gene can be more easily and accurately determined.

  The kit for detecting a SYT-SSX fusion gene according to an embodiment of the present invention may further include a primer that can be amplified using a region containing a sequence to which the probe hybridizes as a template. As a result, the kit for detecting a SYT-SSX fusion gene according to an embodiment of the present invention determines whether the SYT-SSX fusion gene is present and / or the SYT-SSX fusion gene is a SYT-SSX1 fusion gene, SYT- Which subtype of the SSX2 fusion gene or the SYT-SSX4 fusion gene can be detected with higher sensitivity.

The kit for detecting a SYT-SSX fusion gene according to one embodiment of the present invention includes SYT-WT-F2 as a forward primer and either SYT-SSX-R1 or SYT-SSX-R2 as a reverse primer. May be. By using either the forward primer or the reverse primer, for example, whether a SYT-SSX fusion gene is present and / or the SYT-SSX fusion gene is a SYT-SSX1 fusion gene, SYT-SSX2 fusion. It is possible to accurately detect which subtype of the gene or SYT-SSX4 fusion gene. Furthermore, a sample in which RNA is fragmented, such as a fixed tissue, can also be used. SYT-WT-R2 may further be included as a reverse primer. By further using SYT-WT-R2, for example, it can be accurately detected whether or not a SYT-SSX fusion gene is present.
In addition, about the probe and primer contained in the kit for SYT-SSX fusion gene detection, the matter mentioned above about a probe and a primer is applicable as it is.

Moreover, the SYT-SSX fusion gene detection kit according to one embodiment of the present invention may further include reagents necessary for performing nucleic acid amplification in the detection method of the present invention, in addition to the probe. . Moreover, the probe, primer, and other reagents may be accommodated separately, or a part of them may be a mixture.
Note that “separately accommodated” is not limited as long as each reagent is separated so that a non-contact state can be maintained, and is not necessarily accommodated in an individual container that can be handled independently.
By including a primer set for amplifying a region containing a target sequence (region to which the probe hybridizes), for example, the SYT-SSX gene can be detected with higher sensitivity.

  For example, the reagents may be contained in a dissolved state in a buffer solution, or may be contained as a lyophilized product. As a container for storing the reagents, for example, a glass or plastic vial can be used.

  Furthermore, the kit for detecting a SYT-SSX fusion gene according to an embodiment of the present invention uses the probe to create a differential melting curve for a sample containing a nucleic acid to be detected by the SYT-SSX fusion gene. By performing value analysis, whether or not the SYT-SSX fusion gene is present and / or the SYT-SSX fusion gene is any subtype of the SYT-SSX1 fusion gene, the SYT-SSX2 fusion gene, or the SYT-SSX4 fusion gene There may be included an instruction manual for detecting whether or not, or an instruction manual for various reagents included in or additionally included in the reagent kit for detection.

In one embodiment of the present invention, when including both SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1 probes, they may be included in a mixed state or separately.
Further, when included in the SYT-SSX gene detection kit according to one embodiment of the present invention in a state where SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1 are mixed, it is included as a separate reagent. For example, when Tm analysis of the probe and each detection target sequence is performed in the same reaction system at the time of use, SYTSSX-FUSION-F2 and SYTSSX-1_2_4-F1 must be labeled with fluorescent dyes having different emission wavelengths. Is preferred.
Thus, by changing the kind of fluorescent substance, it is possible to detect each probe even in the same reaction system.

  Hereinafter, the present invention will be described in detail with reference to examples. However, the present invention is not limited to them.

<Evaluation of probe>
[Examples 1-5 and Comparative Examples 1-6]
The reaction liquid shown in Table 1 was prepared, and each probe described in Table 2 below was evaluated. Evaluation of the probe was performed by measuring the Tm value for binding with the complementary strand described in Table 3 below with a fully automatic SNPs inspection device (trade name i-densy (registered trademark), manufactured by ARKRAY). . “Taq Universal Buffer” shown in Table 1 was a commercial product of Nippon Gene Co., Ltd.
“5T” in the names of the probes in Table 2 indicates that the base at the 5 ′ end of the probe is labeled with a fluorescent dye TAMRA (registered trademark, manufactured by Molecular Probes), and “5FL” indicates 5 of the probe. 'Indicates that the terminal base is labeled with the fluorescent dye BODIPY FL (registered trademark, manufactured by Molecular Probes).

  The excitation wavelength of the fluorescent dye TAMRA is 520 nm to 555 nm, and the detection wavelength is 585 nm to 700 nm. The excitation wavelength of the fluorescent dye BODIPY FL is 420 nm to 485 nm, and the detection wavelength is 520 nm to 555 nm. The change in fluorescence intensity derived from the fluorescently labeled probe was measured for each wavelength.

  Details of the complementary strands used in Table 1 above are shown in Table 3 below. The complementary strand shown in Table 3 is an oligonucleotide corresponding to a part of the wild-type SYT gene or SYT-SSX1 fusion gene. “5T” in the name of the complementary strand in Table 3 indicates that the base at the 5 ′ end of the complementary strand is labeled with the fluorescent dye TAMRA.

  In the Tm analysis, the reaction solution was treated at 95 ° C. for 1 second and at 40 ° C. for 60 seconds, followed by increasing the temperature from 40 ° C. to 75 ° C. at a temperature increase rate of 1 ° C./3 seconds. The change in fluorescence intensity was measured at a wavelength of 585 nm to 700 nm for the probe labeled with TAMRA and at a wavelength of 520 nm to 555 nm for the probe labeled with BODIPY FL to obtain a melting curve and a differential melting curve. .

Example 1
5T-SYTSSX-FUSION-F2 (SEQ ID NO: 1) is used as the probe, and 5T-SYT-WT-R1 (SEQ ID NO: 14) corresponding to a part of the wild-type SYT gene not containing the SSX gene sequence is used as the complementary strand. did. 5T-SYTSSX-FUSION-F2 is a probe for determining whether or not a SYT-SSX fusion gene is present.
The result of Tm analysis is shown in FIG. Fluorescence having a peak at 53 ° C. was detected in the differential melting curve. This result indicates that 5T-SYTSSX-FUSION-F2 binds to a part of the wild type SYT gene.

-Example 2-
5T-SYTSSX-FUSION-F2 (SEQ ID NO: 1) used in Example 1 as a probe, and 5T-SYTSSX-FUSION-R1 (SEQ ID NO: 1) corresponding to a region containing the fusion point of the SYT-SSX fusion gene as a complementary strand 15) was used.
The result of Tm analysis is shown in FIG. Fluorescence having a peak at 65 ° C. was detected in the differential melting curve. This result indicates that 5T-SYTSSX-FUSION-F2 binds to the region containing the fusion point of the SYT-SSX fusion gene.
-Example 3-
5T-SYTSSX-1_2_4-F1 (SEQ ID NO: 2) was used as the probe, and 5T-SYTSSX1-1_2_4-R1 (SEQ ID NO: 17) corresponding to the region of the SSX1 gene present in the SYT-SSX1 fusion gene was used as the complementary strand. 5T-SYTSSX-1_2_4-F1 is a probe for determining the genotype of the SYT-SSX fusion gene.
The result of Tm analysis is shown in FIG. Fluorescence with a peak at 47 ° C. was detected in the differential melting curve. Fluorescence was detected. This result indicates that 5T-SYTSSX-1_2_4-F1 binds to a region of the SSX1 gene present in the SYT-SSX1 fusion gene.

Example 4
5T-SYTSSX-1_2_4-F1 (SEQ ID NO: 2) used in Example 3 as a probe, and 5T-SYTSSX2-1_2_4-R1 (sequence) corresponding to the region of the SSX2 gene present in the SYT-SSX2 fusion gene as a complementary strand Number 18) was used.
The result of Tm analysis is shown in FIG. In the differential melting curve, fluorescence having a peak at 62 ° C. was detected. This result shows that 5T-SYTSSX-1_2_4-F1 binds to a region of the SSX2 gene present in the SYT-SSX2 fusion gene.

-Example 5
5T-SYTSSX-1_2_4-F1 (SEQ ID NO: 2) used in Example 3 as a probe, and 5T-SYTSSX4-1_2_4-R1 (sequence) corresponding to a region of the SSX4 gene present in the SYT-SSX4 fusion gene as a complementary strand Number 19) was used.
The result of Tm analysis is shown in FIG. In the differential melting curve, fluorescence having a peak at 55 ° C. was detected. This result shows that 5T-SYTSSX-1_2_4-F1 binds to a region of the SSX4 gene present in the SYT-SSX4 fusion gene.

-Comparative Example 1-
5T-SYT-WT-F1 (SEQ ID NO: 3) as a probe and 5T-SYT-WT-R1 (SEQ ID NO: 14) corresponding to a part of a wild-type SYT gene that does not contain the SSX gene sequence as a complementary strand An oligonucleotide consisting of a base sequence was used. 5T-SYT-WT-F1 is a probe for determining whether or not a SYT-SSX fusion gene is present.
The result of Tm analysis is shown in FIG. In the differential melting curve, no fluorescence peak was detected even in the presence of wild-type SYT. This result indicates that 5T-SYT-WT-F1 does not bind to a part of the wild-type SYT gene corresponding to the complementary strand, which does not contain the SSX gene sequence.

-Comparative Example 2-
5T-SYTSSX-FUSION-R1 (SEQ ID NO: 15) corresponding to the region containing the fusion point of the SYT-SSX fusion gene as a complementary strand used in Comparative Example 1 as a probe The oligonucleotide having the base sequence shown in FIG.
The result of Tm analysis is shown in FIG. In the differential melting curve, no fluorescence peak was detected even in the presence of the SYT-SSX fusion gene. This result indicates that 5T-SYT-WT-F1 does not bind to the region containing the fusion point of the SYT-SSX fusion gene corresponding to the complementary strand.

-Comparative Example 3-
5T-SYTSSX-2_3_5-F1 (SEQ ID NO: 4) was used as the probe, and 5T-SYTSSX3-2_3_5-R1 (SEQ ID NO: 16) corresponding to the region of the SSX3 gene present in the SYT-SSX3 fusion gene was used as the complementary strand. . 5T-SYTSSX-2_3_5-F1 is a probe for determining the genotype of the SSX gene.
The result of Tm analysis is shown in FIG. In the differential melting curve, no fluorescence peak was detected even in the presence of the SYT-SSX3 fusion gene. This result indicates that 5T-SYTSSX-2_3_5-F1 does not bind to the SSX gene region of the SYT-SSX3 fusion gene corresponding to the complementary strand.

-Comparative Example 4-
5T-SYTSSX-2_3_5-F1 (SEQ ID NO: 4) used in Comparative Example 3 as a probe, and 5T-SYTSSX5-2_3_5-F1 (sequence) corresponding to a region of the SSX5 gene present in the SYT-SSX5 fusion gene as a complementary strand Number 20) was used.
The result of Tm analysis is shown in FIG. In the differential melting curve, no fluorescence peak was detected even in the presence of the SYT-SSX5 fusion gene. This result indicates that 5T-SYTSSX-2_3_5-F1 does not bind to the SSX gene region of the SYT-SSX5 fusion gene corresponding to the complementary strand.

-Comparative Example 5-
5T-SYTSSX-2_3_5-F2 (SEQ ID NO: 5) was used as a probe, and 5T-SYTSSX5-2_3_5-F1 (SEQ ID NO: 20) was used as a complementary strand. The oligonucleotide 5T-SYTSSX-2_3_5-F2 having the base sequence shown in FIG. 2 is a probe for determining the genotype of the SSX gene.
The result of Tm analysis is shown in FIG. In the differential melting curve, no fluorescence peak was detected even in the presence of the SYT-SSX fusion gene. This result indicates that 5T-SYTSSX-2_3_5-F2 does not bind to XX.

-Comparative Example 6
5T-SYTSSX-2_3_5-F2 (SEQ ID NO: 5) used in Comparative Example 5 as a probe and 5T-SYTSSX5-2_3_5-F1 (SEQ ID NO: 20) corresponding to a region present in the SYT-SSX5 fusion gene as a complementary strand An oligonucleotide consisting of a base sequence was used.
The result of Tm analysis is shown in FIG. In the differential melting curve, no fluorescence peak was detected even in the presence of the SYT-SSX5 fusion gene. This result indicates that 5T-SYTSSX-2_3_5-F2 does not bind to the SSX gene region of the SYT-SSX5 fusion gene corresponding to the complementary strand.

<Evaluation of primer>
[Examples 6 to 11]
Synthetic RNA (SEQ ID NO: 9) corresponding to the sequence of human SYT-SSX2 mRNA as a template for nucleic acid amplification using a fully automatic SNPs inspection apparatus (trade name i-densy (registered trademark), ARKRAY, Inc.) Reverse transcription PCR and Tm analysis were performed using the reverse transcription PCR reaction solution described in Table 4 below. Furthermore, the reagent reactivity was calculated by the following formula.
Reagent reactivity = (maximum differential value of melting curve) / (maximum value of melting curve) × 100

Details of the forward primer and reverse primer used in Table 4 are shown in Table 5 and Table 6 below, respectively. In the base sequence of Table 6, the base represented by “R” represents adenine or guanine. When a reverse primer containing a base represented by R in the formulation shown in Table 4 is used, 50% by volume of the reverse primer solution in which the base represented by R is adenine, and the reverse represented by R is guanine. A reverse primer containing 50% by volume of the primer solution was used.
The concentration of the probe in Table 4 above is 10 μM, and the concentrations of the forward primer and the reverse primer are both 100 μM. Each solvent is TE Buffer (pH 8.0, Nacalai Tesque).
* Added probe and primer solution composition.

  Table 7 shows combinations of forward primer and reverse primer used in Examples 6-11. SYT-WT-F1 (SEQ ID NO: 21) and SYT-WT-F2 (SEQ ID NO: 3) are forward primers that anneal to the upstream side of the target sequence of the probe SYTSSX-FUSION-F2 in the SYT gene region. SYT-WT-R2 (SEQ ID NO: 6) is a reverse primer that anneals to the sequence of only the SYT wild-type gene downstream of the fusion point in wild-type SYT. SYT-SSX-R1 (SEQ ID NO: 4), SYT-SSX-R2 (SEQ ID NO: 5), SYT-SSX-R3 (SEQ ID NO: 22) and SYT-SSX-R4 (SEQ ID NO: 23) are SYT-SSX fusion genes. 5 is a reverse primer that anneals downstream of the target sequence of the probe 5T-SYTSSX-2_3_5-F2.

In reverse transcription PCR, a complementary strand was synthesized at 55 ° C. for 900 seconds, followed by treatment at 95 ° C. for 120 seconds to inactivate the reverse transcriptase, followed by 1 minute at 95 ° C. and 30 seconds at 60 ° C. As a cycle, 60 cycles were repeated.
The Tm analysis was performed after reverse transcription PCR for 1 second at 95 ° C and 60 seconds at 40 ° C, and then the temperature was increased from 40 ° C to 75 ° C at a temperature increase rate of 1 ° C / 3 seconds. The change in fluorescence intensity over time was measured at a wavelength of 585 nm to 700 nm.

The results (melting curves and differential melting curves) of Tm analyzes of Examples 6 to 11 are shown as (A) to (F) in FIG.
10 and 11, the vertical axis represents the amount of change in fluorescence intensity per unit time or (d fluorescence intensity increase / t), and the horizontal axis represents temperature (° C.).

In Examples 6 to 8, specific peaks were observed in the hybrid of the target sequence and the amplification product, and the reagent reactivity was sufficient at 2.38, 2.76, and 2.89, respectively. In Examples 9 to 11, specific peaks were observed in the hybrid of the target sequence and the amplification product, but the reagent reactivity was 1.79, 2.27, and 1.15 and Examples 6 to 8, respectively. It was good.
From the above results, for amplification of the SYT-SSX fusion gene, SYT-WT-F2 (SEQ ID NO: 3) as a forward primer and SYT-SSX-R1 (SEQ ID NO: 4) or SYT-SSX-R2 (as a reverse primer) It was found that when SEQ ID NO: 5) was used, the target region was specifically amplified and the reagent reactivity was particularly good. For amplification of the wild type SYT gene, the target region is specifically amplified when SYT-WT-F2 (SEQ ID NO: 3) is used as a forward primer and SYT-WT-R2 (SEQ ID NO: 6) is used as a reverse primer. And the reagent reactivity was found to be particularly good.

<Evaluation of multi-detection system>
[Examples 12 to 15]
Probes 5T-SYTSSX-FUSION-F2 and 5T-SYTSSX-1_2_4-F1 and a primer set are prepared in a single reaction, and reverse transcription, target sequence amplification and target sequence detection are performed in one reaction system. A multi-detection system that can be performed by a single operation was constructed and evaluated by a fully automatic SNPs inspection device (trade name i-densy (registered trademark), ARKRAY, Inc.).
The composition of the reaction solution of the multi-detection system is as shown in Table 8 below. Tables 9, 10, 11 and 12 show the compositions of E-mix, U-mix, P-mix and RT-mix shown in Table 8, respectively. The primer sets used are shown in Table 11.

In Table 11, SYT-WT-F2 is a forward primer that anneals upstream of the target sequence of the probe SYTSSX-FUSION-F2 in the SYT gene region. SYT-WT-R2 is a reverse primer that anneals to the sequence of only the SYT wild type gene downstream of the fusion point in wild type SYT. SYT-SSX-R2 is a reverse primer that anneals to the downstream side of the target sequence of the probe 5T-SYTSSX-2_3_5-F2 in the SYT-SSX fusion gene.
5T-SYTSSX-FUSION-F2 is a probe for determining whether or not a SYT-SSX fusion gene in which the base at the 5 ′ end is labeled with the fluorescent dye TAMRA is present. 5FL-SYTSSX-1_2_4-F1 determines whether or not a SYT-SSX fusion gene in which the base at the 5 ′ end is labeled with the fluorescent dye BODIPY FL and / or the genotype of the SYT-SSX fusion gene It is a probe for.

    In Table 12, RNase Inhibitor used 40 U / μL RNase Inhibitor (Toyobo Co., Ltd.) and Reverse Transscriptase used Invitrogen 40 U / μL SuperScript III (registered trademark) (Thermo Fisher Scientific Co., Ltd.).

  Table 13 shows templates used as templates for nucleic acid amplification in the evaluation of the multi-detection system. Synthetic RNA was synthesized according to a standard method.

In reverse transcription PCR, a complementary strand was synthesized at 55 ° C. for 900 seconds, followed by treatment at 95 ° C. for 120 seconds to inactivate the reverse transcriptase, followed by 1 minute at 95 ° C. and 30 seconds at 60 ° C. As a cycle, 60 cycles were repeated.
In addition, the Tm analysis was performed by reverse transcription PCR, followed by treatment at 95 ° C for 1 second and 40 ° C for 60 seconds, followed by increasing the temperature from 40 ° C to 75 ° C at a temperature increase rate of 1 ° C / 3 seconds. The change in fluorescence intensity over time was measured. The fluorescence intensity of the fluorescent dye BODIPY FL was measured at a wavelength of 520 nm to 555 nm (wave 2), and the fluorescence intensity of the fluorescent dye TAMRA was measured at 585 nm to 700 nm (wave 3).

-Example 12-
Nucleic acid amplification and detection were performed using a mixture of a synthetic RNA SYT-SSX 1500 copy and a synthetic RNA SYT WT 500 copy as a template.
The result of Tm analysis is shown in FIG. As a result of measuring the change in fluorescence intensity of 5T-SYTSSX-FUSION-F2 (SEQ ID NO: 1) at a wavelength of 585 nm to 700 nm (wave 3), peaks were observed at 53 ° C. and 62 ° C. This means that both the SYT wild type gene and the SYT-SSX fusion gene were detected.
As a result of measuring the change in the fluorescence intensity of 5FL-SYTSSX-1_2_4-F1 (SEQ ID NO: 2) at a wavelength of 520 nm to 555 nm (wave 2), a peak was observed at 50 ° C. This result means that the SYT-SSX1 fusion gene was detected.
-Example 13-
As a template, nucleic acid amplification and detection were performed using a mixture of 600 copies of synthetic RNA SYT-SSX2 and 600 copies of synthetic RNA SYT WT.
The result of Tm analysis is shown in FIG. As a result of measuring the change in fluorescence intensity of 5T-SYTSSX-FUSION-F2 (SEQ ID NO: 1) at a wavelength of 585 nm to 700 nm (wave 3), peaks were observed at 53 ° C. and 62 ° C. This means that both the SYT wild type gene and the SYT-SSX fusion gene were detected.
As a result of measuring a change in fluorescence intensity of 5FL-SYTSSX-1_2_4-F1 (SEQ ID NO: 2) at a wavelength of 520 nm to 555 nm (wave 2), a peak was observed at 60 ° C. This result means that the SYT-SSX2 fusion gene was detected.
-Example 14-
As a template, nucleic acid amplification and detection were performed using a mixture of 500 copies of synthetic RNA SYT-SSX4 and 500 copies of synthetic RNA SYT WT.
The result of Tm analysis is shown in FIG. As a result of measuring the change in fluorescence intensity of 5T-SYTSSX-FUSION-F2 (SEQ ID NO: 1) at a wavelength of 585 nm to 700 nm (wave 3), peaks were observed at 53 ° C. and 62 ° C. This means that both the SYT wild type gene and the SYT-SSX fusion gene were detected.
As a result of measuring the change in fluorescence intensity of 5FL-SYTSSX-1_2_4-F1 (SEQ ID NO: 2) at a wavelength of 520 nm to 555 nm (wave 2), a peak was observed at 55 ° C. This result means that the SYT-SSX4 fusion gene was detected.
-Example 15-
Nucleic acid amplification and detection were performed using 10,000 copies of synthetic RNA SYT WT as a template.
The result of Tm analysis is shown in FIG. As a result of measuring a change in fluorescence intensity of 5T-SYTSSX-FUSION-F2 (SEQ ID NO: 1) at a wavelength of 585 nm to 700 nm (wave 3), a peak was observed at 53 ° C. This means that the SYT wild type gene was detected.
As a result of measuring the change in fluorescence intensity of 5FL-SYTSSX-1_2_4-F1 (SEQ ID NO: 2) at a wavelength of 520 nm to 555 nm (wave 2), no peak was observed. This result means that no subtype of SYT-SSX fusion gene was detected.

  As shown in Examples 12 to 15, the subtypes of the SYT-SSX fusion gene of the prepared template were all correctly determined by the multi-detection system.

<Measurement of actual sample>
[Example 16]
Human synovial sarcoma tissues collected from three patients were fixed in formalin and embedded in paraffin, and tissue sections were prepared and numbered as Sample 1 to Sample 3. For sample 1, RNA was extracted from the tissue section using an RNeasy FFPE extraction kit (Qiagen). Samples 2 and 3 were extracted from tissue sections using Maxwell 16 RNA FFPE Tissue (Promega Corporation).
Using the extracted RNA, reverse transcription PCR and Tm analysis were performed using i-densy by the same multi-detection system as in Examples 12-15. In addition, for comparison with the results obtained by the conventional method, RNA extracted from the specimen is subjected to nucleic acid amplification using a conventionally known method, the amplification product is confirmed by electrophoresis, and the genotype of the SYT-SSX gene is determined. Went.

  The determination results of Sample 1 to Sample 3 are shown in FIG. The measurement results by the conventional method indicate that SYT-SSX2 fusion gene is present in specimen 1, SYT-SSX1 fusion gene is present in specimen 2, and SYT-SSX1 fusion gene is absent in specimen 3. It was done. In the determination result by the same multi-detection system as in Examples 12 to 15, the same result as the result by the conventional method was obtained. The determination results obtained by the conventional detection method and the multi-detection systems used in Examples 12 to 15 coincided with each other, indicating that a correct determination result was obtained according to an embodiment of the present invention.

Claims (15)

  A probe for detecting a SYT-SSX fusion gene, which is an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 1 or an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 2.   The SYT-SSX fusion according to claim 1, wherein the oligonucleotide consisting of the base sequence shown in SEQ ID NO: 1 or the oligonucleotide consisting of the base sequence shown in SEQ ID NO: 2 is labeled with a labeling substance. Probe for gene detection.   The probe for detecting a SYT-SSX fusion gene according to claim 2, wherein the labeling substance is a fluorescent labeling substance. The SYT-SSX fusion gene detection probe according to claim 2 or 3, wherein the labeled oligonucleotide is a guanine quenching probe.   5. The labeling substance according to claim 2, wherein the labeling substance is bound to any one of the first to third positions counted from the 5 ′ end of the oligonucleotide having the base sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2. The probe for SYT-SSX fusion gene detection as described in any one.   The SYT-SSX fusion gene detection probe according to claim 5, wherein the labeling substance is bound to the position of the 5 'end of the oligonucleotide having the base sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2.   A probe set comprising a probe for detecting a SYT-SSX fusion gene that is an oligonucleotide having the base sequence shown in SEQ ID NO: 1 and a probe for detecting the SYT-SSX fusion gene that is an oligonucleotide having the base sequence shown in SEQ ID NO: 2 .   A SYT-SSX fusion gene detection kit comprising the SYT-SSX fusion gene detection probe according to any one of claims 1 to 6 or the probe set according to claim 7.   The SYT-SSX according to claim 8, further comprising a forward primer that is an oligonucleotide having the base sequence shown in SEQ ID NO: 3 and a reverse primer that is an oligonucleotide having the base sequence shown in SEQ ID NO: 4 or SEQ ID NO: 5. A fusion gene detection kit.   The kit for detecting a SYT-SSX fusion gene according to claim 9, further comprising a reverse primer which is an oligonucleotide having the base sequence shown in SEQ ID NO: 6.   A method for detecting a SYT-SSX fusion gene using the SYT-SSX fusion gene detection probe according to any one of claims 1 to 6 or the probe set according to claim 7. The method for detecting a SYT-SSX fusion gene according to claim 11, comprising the following (i) to (iii):
(I) a probe for detecting a SYT-SSX fusion gene that is an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 1 or a probe for detecting a SYT-SSX fusion gene that is an oligonucleotide consisting of the base sequence shown in SEQ ID NO: 2; Dissociating the hybrid by changing the temperature of a sample containing a hybrid obtained by hybridizing with a single-stranded nucleic acid in the sample, and measuring a signal variation based on the dissociation of the hybrid;
(Ii) determining a Tm value which is a dissociation temperature of the hybrid based on the variation of the signal.
(Iii) Based on the Tm value determined in (ii) above, whether or not the SYT-SSX fusion gene is present in the single-stranded nucleic acid in the sample and / or the subtype of the SYT-SSX fusion gene To determine.   A probe for detecting a SYT-SSX fusion gene, wherein the probe set according to claim 7 is an oligonucleotide having the base sequence shown in SEQ ID NO: 1 as to whether or not the SYT-SSX fusion gene is present in (iii). Tm value determined using a probe for detecting a SYT-SSX fusion gene, which is an oligonucleotide comprising the nucleotide sequence shown in SEQ ID NO: 2 as a subtype of the SYT-SSX fusion gene The method for detecting a SYT-SSX fusion gene according to claim 12, wherein the determination is based on   The method for detecting a SYT-SSX fusion gene according to any one of claims 10 to 13, wherein a fixed biological sample is used as a test sample.   The method for detecting a SYT-SSX fusion gene according to claim 14, wherein the fixation is formalin fixation.