Classifications

• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
  • C12N15/111—General methods applicable to biologically active non-coding nucleic acids
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
  • C12N15/102—Mutagenizing nucleic acids
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
  • C12N15/09—Recombinant DNA-technology
  • C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
  • C12N15/90—Stable introduction of foreign DNA into chromosome
  • C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
  • C12N15/907—Stable introduction of foreign DNA into chromosome using homologous recombination in mammalian cells
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
  • C12N9/14—Hydrolases (3)
  • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
  • C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/11—Antisense
  • C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/10—Type of nucleic acid
  • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/31—Chemical structure of the backbone
  • C12N2310/315—Phosphorothioates
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/32—Chemical structure of the sugar
  • C12N2310/321—2'-O-R Modification
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/32—Chemical structure of the sugar
  • C12N2310/322—2'-R Modification
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/32—Chemical structure of the sugar
  • C12N2310/323—Chemical structure of the sugar modified ring structure
  • C12N2310/3231—Chemical structure of the sugar modified ring structure having an additional ring, e.g. LNA, ENA
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/35—Nature of the modification
  • C12N2310/351—Conjugate
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2310/00—Structure or type of the nucleic acid
  • C12N2310/30—Chemical structure
  • C12N2310/35—Nature of the modification
  • C12N2310/351—Conjugate
  • C12N2310/3515—Lipophilic moiety, e.g. cholesterol
• • C—CHEMISTRY; METALLURGY
  • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
  • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
  • C12N2320/00—Applications; Uses
  • C12N2320/50—Methods for regulating/modulating their activity
  • C12N2320/51—Methods for regulating/modulating their activity modulating the chemical stability, e.g. nuclease-resistance

Definitions

• This disclosure relates to compositions and methods of protecting oligonucleotides for modified guide RNAs for CRISPR genome editing.
• CRISPR RNA-guided genome engineering has revolutionized research into human genetic disease and many other aspects of biology. Numerous CRISPR-based in vivo or ex vivo genome editing therapies are nearing clinical trials. At the heart of this revolution are the microbial effector proteins found in class II CRISPR-Cas systems such as Cas9 (type II) and Casl2a/Cpfl (type V) (Jinek et al. Science 337, 816-821 (2012); Gasiunas et al. PNAS 109, E2579-E2586 (2012); Zetsche et al. Cell 163, 759-771 (2015)).
• Cas9 type II
• Casl2a/Cpfl type V
• the most widely used genome editing tool is the type II- A Cas9 from Streptococcus pyogenes strain SF370 (SpCas9) (Jinek et al, supra).
• Cas9 forms a ribonucleoprotein (RNP) complex with a CRISPR RNA (crRNA) and a trans-activating crRNA (tracrRNA) for efficient DNA cleavage both in bacteria and eukaryotes ( Figure 1).
• the crRNA contains a guide sequence that directs the Cas9 RNP to a specific locus via base-pairing with the target DNA to form an R-loop. This process requires the prior recognition of a protospacer adjacent motif (PAM), which for SpCas9 is NGG.
• PAM protospacer adjacent motif
• R-loop formation activates the His-Asn-His (HNH) and RuvC-like endonuclease domains that cleave the target strand and the non-target strand of the DNA, respectively, resulting in a double-strand break (DSB).
• HNH His-Asn-His
• RuvC-like endonuclease domains that cleave the target strand and the non-target strand of the DNA, respectively, resulting in a double-strand break (DSB).
• Cas9 and its guide RNAs can be expressed from DNA (e.g. a viral vector), RNA (e.g. Cas9 mRNA plus guide RNAs in a lipid nanoparticle), or introduced as a ribonucleoprotein (RNP).
• DNA e.g. a viral vector
• RNA e.g. Cas9 mRNA plus guide RNAs in a lipid nanoparticle
• RNP ribonucleoprotein
• RNAs are extremely vulnerable to nuclease degradation and are rapidly degraded in cells and biological fluids such as serum.
• Delivering naked and unformulated crRNAs is similar to the scenario of delivering other therapeutic oligonucleotides such as antisense oligonucleotide (ASO) and short interfering RNA (siRNA), where chemical modifications are the key to in vivo efficacy.
• ASO antisense oligonucleotide
• siRNA short interfering RNA
• protecting oligos short, fully chemically stabilized oligos (hereafter referred to as “protecting oligos”) that are complementary to the under-modified regions of the crRNA significantly enhanced crRNA stability without compromising the activity. Furthermore, we show that the protecting oligos can enhance the potency of crRNAs and tolerate a wide range of conjugations, and may therefore improve delivery and biodistribution. We anticipate that the protecting oligos will enable in vivo delivery of naked crRNA with enhanced stability, activity, and cellular uptake.
• the present disclosure provides protecting oligonucleotides for CRISPR genome editing.
• the protecting oligonucleotides of the disclosure are heavily or fully chemically modified.
• the protecting oligonucleotides of the disclosure may confer several advantages in vivo or ex vivo, including crRNA stability, improved potency, and/or reduced off-target effects.
• the protecting oligonucleotides of the disclosure have reduced immunogenicity, e.g., a reduced ability to induce innate immune responses.
• the disclosure provides a protecting oligonucleotide comprising: (a) a sequence that is complementary to a crRNA; and (b) at least one chemically modified nucleotide, wherein the protecting oligonucleotide is capable of binding the crRNA, and wherein the protecting oligonucleotide confers nuclease resistance to the crRNA when bound.
• the modified nucleotides each independently comprise a modification of a ribose group, a phosphate group, a nucleobase, or a combination thereof.
• each modification of the ribose group is independently selected from the group consisting of 2'-O-methyl, 2’-fluoro, 2’-deoxy, 2’- ⁇ 9-(2-methoxyethyl) (MOE), 2’-NH2 (2’-amino), 4’-thio, a bicyclic nucleotide, a locked nucleic acid (LNA), a 2’-( )-constrained ethyl (S-cEt), a constrained MOE, and a 2'-O,4'-C-aminomethylene bridged nucleic acid (2',4'-BNA NC ).
• At least 80% of the ribose groups are chemically modified. In an embodiment, at least 90% of the ribose groups are chemically modified. In an embodiment, 100% of the ribose groups are chemically modified.
• crRNA comprises a guide sequence portion capable of hybridizing to a target polynucleotide sequence and a repeat sequence portion.
• the protecting oligonucleotide binds to the crRNA to form a duplex.
• the duplex has a melting temperature (Tm) of greater than 37 °C over the full length of the duplex.
• the duplex has a melting temperature (Tm) of less than 37 °C over the region of complementarity comprising the guide sequence portion.
• the binding of a tracrRNA to the guide sequence portion of the crRNA dissociates the protecting oligonucleotide from the crRNA.
• the protecting oligonucleotide further comprises at least one moiety conjugated to the protecting oligonucleotide. In an embodiment, the at least one moiety is conjugated to at least one of the 5’ end of the protecting oligonucleotide and/or the 3’ end of the protecting oligonucleotide.
• the at least one moiety increases cellular uptake of the guide RNA. In an embodiment, the at least one moiety promotes specific tissue distribution of the guide RNA.
• the at least one moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, gangliosides analogs, nucleoside analogs, endocannabinoids, vitamins, receptor ligands, peptides, aptamers, and alkyl chains.
• the at least one moiety is selected from the group consisting of cholesterol, docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymer (ABC), hydrophilic block copolymer (HBC), poloxamer, Cy5, and Cy3.
• the at least one moiety is conjugated to the guide RNA via a linker.
• the linker is selected from the group consisting of an ethylene glycol chain, an alkyl chain, a polypeptide, a polysaccharide, and a block copolymer.
• the at least one moiety is a modified lipid.
• the modified lipid is a branched lipid.
• the modified lipid is a headgroup-modified lipid.
• the disclosure provides a double stranded oligonucleotide comprising: (a) a crRNA comprising (i) a guide sequence portion capable of hybridizing to a target polynucleotide sequence, and (ii) a repeat sequence portion; and (b) a protecting oligonucleotide that is complementary to the crRNA, wherein the crRNA comprises at least 50% modified nucleotides, and wherein the protecting oligonucleotide comprises at least one modified nucleotide.
• the modified nucleotide comprises a modification of a ribose group, a phosphate group, a nucleobase, or a combination thereof.
• each modification of the ribose group is independently selected from the group consisting of 2'-6>-methyl, 2’-fluoro, 2’-deoxy, 2’-6>-(2-methoxyethyl) (MOE), 2’-NH2 (2’-amino), 4’-thio, a bicyclic nucleotide, a locked nucleic acid (LNA), a 2’-( )-constrained ethyl (S-cEt), a constrained MOE, or a 2'-6>,4'-C-aminomethylene bridged nucleic acid (2',4'-BNA NC ).
• At least 80% of the ribose groups are chemically modified. In an embodiment, at least 90% of the ribose groups are chemically modified. In an embodiment, 100% of the ribose groups are chemically modified.
• the double stranded oligonucleotide comprises a melting temperature (Tm) of greater than 37 °C over the full length of the double stranded oligonucleotide.
• the double stranded oligonucleotide comprises a melting temperature (Tm) of less than 37 °C for the region of the double stranded oligonucleotide comprising the crRNA guide sequence portion.
• the binding of a tracrRNA to the repeat sequence portion of the crRNA dissociates the protecting oligonucleotide from the crRNA.
• the protecting oligonucleotide binds to a region of the crRNA that is not fully chemically modified.
• the protecting oligonucleotide binds to a region of the crRNA that comprises less than 100% modified ribose groups.
• the double stranded oligonucleotide further comprises at least one moiety conjugated to the protecting oligonucleotide and/or crRNA.
• the at least one moiety is conjugated to at least one of the 5’ end and/or the 3’ end of the protecting oligonucleotide and/or crRNA.
• the at least one moiety increases cellular uptake of the guide RNA. In an embodiment, the at least one moiety promotes specific tissue distribution of the guide RNA.
• the at least one moiety is selected from the group consisting of fatty acids, steroids, secosteroids, lipids, gangliosides analogs, nucleoside analogs, endocannabinoids, vitamins, receptor ligands, peptides, aptamers, and alkyl chains.
• the at least one moiety is selected from the group consisting of cholesterol, docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymer (ABC), hydrophilic block copolymer (HBC), poloxamer, Cy5, and Cy3.
• the at least one moiety is conjugated to the guide RNA via a linker.
• the linker is selected from the group consisting of an ethylene glycol chain, an alkyl chain, a polypeptide, a polysaccharide, and a block copolymer.
• the at least one moiety is a modified lipid.
• the modified lipid is a branched lipid.
• the modified lipid is a headgroup-modified lipid.
• the guide RNA binds to a Cas9 nuclease selected from the group consisting of 5. pyogenes Cas9 (SpCas9), -S', aureus Cas9 (SaCas9), N. meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9).
• pCas9 pyogenes Cas9
• -S' aureus Cas9
• NaCas9 N. meningitidis Cas9
• CjCas9 C. jejuni Cas9
• Geobacillus Cas9 Geobacillus Cas9
• the Cas9 is a variant Cas9 with altered activity.
• the variant Cas9 is selected from the group consisting of a Cas9 nickase (nCas9), a catalytically dead Cas9 (dCas9), a hyper accurate Cas9 (HypaCas9), a high fidelity Cas9 (Cas9-HF), an enhanced specificity Cas9 (eCas9), and an expanded PAM Cas9 (xCas9).
• nCas9 Cas9 nickase
• dCas9 catalytically dead Cas9
• HypaCas9 hyper accurate Cas9
• Cas9-HF high fidelity Cas9
• eCas9 enhanced specificity Cas9
• xCas9 expanded PAM Cas9
• the Cas9 off-target activity is reduced relative to an unmodified guide RNA.
• the Cas9 on-target activity is increased relative to an unmodified guide RNA.
• the disclosure provides a method of editing a target region of a genome in a cell altering expression of a target gene in a cell, comprising administering to said cell a genome editing system comprising: a protecting oligonucleotide of any of the embodiments recited above; one or more crRNAs of any of the embodiments recited above; one or more tracrRNAs; and an RNA-guided nuclease or a polynucleotide encoding an RNA-guided nuclease.
• the target gene is in a cell in an organism.
• expression of the target gene is knocked out or knocked down.
• the RNA-guided nuclease or a polynucleotide encoding an RNA-guided nuclease and the one or more tracrRNAs are administered to the cell before the one or more crRNAs or the protecting oligonucleotide.
• the crRNA comprises a crRNA portion of any of the preceding embodiments modification pattern consisting of: mN#mN#mN#mNmNmNmNmNmNmNfNfNfNrN#rN#fNfNrN#mNmGrU#rU#r
• the protecting oligonucleotide of any of the preceding embodiments comprises a modification pattern consisting of: mAmAmAmCmNmNmNmNmNmN (RC01); mAmAmAmCmNmNmNmNmN (RC02); mAmAmAmCmNmNmNmNmN (RC03); mAmAmAmAmCmNmNmNmNmN (RC04); mUmAmAmAmAmCmNmNmNmNmNmNmNmN (RC05); mAmAmAmAmCmNmNmNmNmNmNmN (RC06); mUmAmAmAmAmCmNmNmNmNmNmNmN (RC07); mCmUmAmAmAmAmCmNmNmNmNmNmNmNmN (RC 08); mUmAmAmAmAmCmNmNmNmNmNmNmN (RC09
• the protecting oligonucleotide of any one of the preceding embodiments is a protecting oligonucleotide modification pattern selected from any of RC01-10 of Table 1.
• the crRNA of any one of the preceding embodiments is a crRNA modification pattern selected from any of crRNA 1-134 of Table 2.
• protecting oligonucleotide and/or crRNA of any one of the preceding embodiments further comprises one or more additional modified nucleotides, each independently selected from a modification of a ribose group, a phosphate group, a nucleobase, or a combination thereof.
• each modification of the ribose group is independently selected from the group consisting of 2'-6>-methyl, 2’-fluoro, 2’-deoxy, 2’-6>-(2-methoxyethyl) (MOE), 4’-thio, a bicyclic nucleotide, a locked nucleic acid (LNA), a 2’-(5)-constrained ethyl (S-cEt), a constrained MOE, and a 2'-6>,4'-C- aminomethylene bridged nucleic acid (2',4'-BNA NC ).
• each modification of the phosphate group is independently selected from the group consisting of a phosphorothioate, phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, or phosphotriester modification.
• each modification of the nucleobase group is independently selected from the group consisting of 2-thiouridine, 4-thiouridine, N 6 -methyladenosine, pseudouridine, 2,6-diaminopurine, inosine, thymidine, 5- methylcytosine, 5-substituted pyrimidine, isoguanine, isocytosine, and halogenated aromatic groups.
• Fig. 1A - Fig. IE Schematic representation of stable cell lines, and activity and stability of chemically modified crRNAs.
• Fig. 1A is a schematic representation of the stable HEK293T cell line that expresses SpyCas9 nuclease, tracrRNA, and a fluorescent reporter gene that consists of a broken GFP and an out-offrame mCherry. Electroporation of crRNAs targeting the GFP sequence will generate frameshift mutations and place the mCherry coding sequence in- frame.
• Fig. 1A is a schematic representation of the stable HEK293T cell line that expresses SpyCas9 nuclease, tracrRNA, and a fluorescent reporter gene that consists of a broken GFP and an out-offrame mCherry. Electroporation of crRNAs targeting the GFP sequence will generate frameshift mutations and place the mCherry coding sequence in- frame.
• IB is a schematic representation of the stable HEK293T cell line that expresses SpyCas9 Adenine base editor (SpyCas9-ABE8e), tracrRNA, and a fluorescent reporter gene that consists of a G-to-A nonsense mutation within the GFP coding sequence. Electroporation of crRNA will restore GFP fluorescence by an A-to-G edit that reverses the mutation.
• Fig. 1C depicts the activities of different chemically modified crRNAs were measured by electroporating 50 pmole crRNA per 5 x 10 4 cells to the stable cell line shown in Fig. 1A. Cells were harvested 48 hours post-electroporation and the percentage of mCherry positive cells was quantified by FACS.
• Fig. ID depict activities of different chemically modified crRNAs measured by electroporating 50 pmole crRNA per 5 x 10 4 cells in a stable mouse Hepal-6 cell line that expresses SpyCas9-ABE8e and tracrRNA. Data measured by Sanger sequencing and EditR analysis.
• Fig. IE depicts the stability of partially and fully-modified crRNAs shown in Fig. 1 C.
• crRNAs were diluted to 1 pM concentration in 10% FBS and incubated at 37°C for the indicated numbers of hours before denaturing by formamide loading dye and fractionation by 10% urea-denaturing polyacrylamide gel electrophoresis (PAGE) followed by staining.
• PAGE polyacrylamide gel electrophoresis
• FIG. 2A- Fig. 2C depict protecting oligos enhancing the stability of crRNA without compromising activity.
• Fig. 2A depicts representative designs and chemical modifications of C20 (top) and protecting oligos (bottom, RC01 to RC10). Chemical modification patterns of C20 and protecting oligos are color-coded: green, 2’-O-Me; red 2’-F; black, 2’-OH; underlined, PS.
• Fig. 2B depicts the stability of C20- protecting oligo complex.
• C20 and the indicated protecting oligo were mixed at equal molar ratio and annealed by heating to 95°C for 5 minutes and slowly cooled down to 4°C (-0.1 °C per second).
• Annealed C20-protecting oligo complex was diluted to IpM in 10% FBS and incubated for the indicated number of hours at 37°C. The RNAs were then denatured by formamide and resolved by 10% denaturing urea PAGE.
• Fig. 2C depicts the activity of the C20-protecting oligo complex. C20 and the indicated protecting oligo were annealed as described in Fig. 2B. 50 pmole crRNA per 5 x 10 4 cells was then electroporated using the stable cell line shown in Fig. 1A. Cells were harvested at 48 hours post-electroporation and the percentage of mCherry was quantified by FACS.
• Fig. 3A- Fig. 3B depicts protecting oligos enhancing the potency of crRNA.
• Fig. 3 A depicts the activity of the C20-protecting oligo complex in the stable cell line shown in Fig. 1A at non-saturating dosages.
• Fig. 3B depicts the activity of C20-protecting oligo complex in the stable cell line shown in Fig. IB at non-saturating dosages.
• the molar amounts of C20-protecting oligo complex per 5 x 10 4 cells are given on the x axis. Cells were harvested at 48 hours post-electroporation and the percentage of mCherry or GFP positive cells was quantified by FACS.
• Fig. 4 A- Fig. 4D depicts the conjugation of protecting oligos enhanced cellular uptake without interfering with crRNA activity.
• Fig. 4A depicts the activities of C20-protecting oligo complex with conjugates were measured in the stable cell line shown in Fig. IB by electroporating 50 pmole complex per 5 x 10 4 cells.
• the chemical modification pattern of C20 (“crRNA 20”) is recited in Table 2 and the chemical modification pattern of the protecting oligo RClOis recited in Table 1.
• Cells were harvested at 48 hours post-electroporation and the percentage of mCherry or GFP positive cells was quantified by FACS.
• FIG. 4B depicts a schematic representation of the design and modifications the editing efficiency of protecting oligonucleotides with and without lipid conjugations (Cholesterol is Choi, docosahexaenoic acid is DHA, N- acetylgalactosamine is GalNac) by GFP quantification.
• Fig. 4D depicts cellular uptake of Cy3-labeled crRNA (right), Cy3- labeled crRNA with protecting oligo (middle), and with Cholesterol-conjugated protecting oligo (left).
• Oligonucleotides were diluted to 1.5pM in DMEM + 3% FBS then mixed with HEK293T cells. Cells were plated on an 8-well glass bottom cell culture chamber slide (SKU2301 18) and incubated overnight. Cell culture media was then replaced with PBS and one drop of NucBlue (Hoechst 33342) were added to cell culture before imaging. Images were taken under Leica fluorescent microscope at 40x magnification.
• Fig. 5 depicts editing efficiency by passive uptake of C20 with and without protecting oligo. GFP positive cells were quantified by FACS.
• Fig. 6 depicts optimal duplex stability between protecting oligo and crRNA may be required for efficient editing.
• C20 and the indicated protecting oligo were annealed as described in Fig. 1A.
• 50 pmole crRNA per 5 x 10 4 cells was then electroporated using the stable cell line shown in Fig. 1A.
• Cells were harvested at 48 hours post-electroporation and the percentage of mCherry was quantified by FACS.
• the chemical modification patterns of C20 and the protecting oligos were color-coded: green, 2’-O-Me; red, 2’-F; black: 2’-OH; underlined: PS, double underlined: locked nucleic acid (LNA).
• Fig. 7A - Fig. 7B depict the in vivo genome editing in adult mouse CNS by co-delivery of AAV and self-delivering crRNA.
• Fig. 7A depicts the process of genome editing in adult mouse using scAAV9 by injection up to immunohistochemistry (IHC) detection.
• IHC immunohistochemistry
• the editing efficiencies of these conjugates were tested by IHC staining using an anti-EGFP antibody and were quantified by percentage of EGFP positive cells within 1 mm2 around the site-of- injection. These results are shown in Fig. 7B.
• the chemical modification patterns are recited in Table 1.
• FIG. 8G depict the in vivo genome editing in adult mouse liver by co-delivery of AAV-expressed effector and tracrRNA and GalNac conjugated selfdelivering crRNA.
• the results of the expression of the injected AAV are shown in Fig. 8A for SpyCas9-ABE8e and tracrRNA expression and Fig. 8B for SpyCas9 nuclease and tracrRNA expression.
• Fig. 8C depicts the a/z PM/PM generating a point mutation resulting in exon 8 skipping and FAH deficiency.
• Fig. 8D shows the schematic representation of the AAV delivery to the a/z PM/PM mouse.
• FIG. 8E depicts base editing efficiency of the genomic DNA of the mouse liver treated by AAV-SpyCas9- ABE-tracrRNA co-delivery with indicated C20/protecting oligo compound.
• mice The body weight over time of the mice treated with AAV-expressed SpyCas9-ABE8e and tracrRNA, and C20 with protecting oligonucleotides was measured and the results are shown in Fig. 8F.
• the mice were then sacrificed after three months of NTBC cycles, and IHC staining was performed on liver sections using anti- FAH antibodies, the staining results are shown in Fig. 8G.
• FIG. 9A- Fig. 9B depict the effect of optimization of the dosing regimen on the in vivo editing efficiency.
• Fig. 9A shows the schematic representation of the experimental process to test repeat crRNA dosing regimen. RO, retro-orbital injection.
• Fig. 9B depicts the editing efficiency of AAV-SpyCas9-ABE-tracrRNA co-delivered with either a single 80 mg/kg dose, as compared to the editing efficiency of three consecutive daily injections 26 mg/kg dose of C20+RC07-GalNac targeting the mouse Pcsk9 gene.
• the single dose data was the same as what shown in Figure 8 A. Data present mean ⁇ SD, ****, P ⁇ 0.0001 (two-way ANOVA).
• Fig. 10A- Fig. 10B depict the effect of C20 targeting different sequences with and without protecting oligonucleotides.
• Fig 10A shows the dose-response curves of C20 targeting different sequences with and without protecting oligonucleotides in the HEK293T-SpyCas9-ABE-tracrRNA-dGFP reporter. The editing efficiency was quantified by FACS. Data represent mean ⁇ SD; ns, P > 0.05, ****, P ⁇ 0.0001 (two- way ANOVA, C20 was used as control in multiple comparisons).
• protecting oligonucleotides including heavily or fully chemically protecting oligonucleotides.
• protecting oligonucleotides and crRNAs with 5’ and/or 3’ conjugated moieties are provided.
• Methods of using the protecting oligonucleotides and crRNAs of the disclosure for genome editing with a CRISPR nuclease and kits for performing the same are also provided.
• protecting oligonucleotide refers to an oligonucleotide that comprises complementarity to a crRNA and confers increased nuclease resistance to the crRNA when bound relative to a crRNA that is not bound by a protecting oligonucleotide.
• guide RNA refers to any nucleic acid that promotes the specific association (or “targeting”) of an RNA-guided nuclease such as a Cas9 to a target sequence (e.g., a genomic or episomal sequence) in a cell.
• target sequence e.g., a genomic or episomal sequence
• a “modular” or “dual RNA” guide comprises more than one, and typically two, separate RNA molecules, such as a CRISPR RNA (crRNA) and a trans- activating crRNA (tracrRNA), which are usually associated with one another, for example by duplexing.
• crRNA CRISPR RNA
• tracrRNA trans- activating crRNA
• a “unimolecular gRNA,” “chimeric gRNA,” or “single guide RNA (sgRNA)” comprises a single RNA molecule.
• the sgRNA may be a crRNA and tracrRNA linked together.
• the 3’ end of the crRNA may be linked to the 5’ end of the tracrRNA.
• a crRNA and a tracrRNA may be joined into a single unimolecular or chimeric gRNA, for example, by means of a four nucleotide (e.g., GAAA) “tetraloop” or “linker” sequence bridging complementary regions of the crRNA (at its 3' end) and the tracrRNA (at its 5' end).
• a “repeat” sequence or region is a nucleotide sequence at or near the 3 ’ end of the crRNA which is complementary to an anti-repeat sequence of a tracrRNA.
• an “anti -repeat” sequence or region is a nucleotide sequence at or near the 5 ’ end of the tracrRNA which is complementary to the repeat sequence of a crRNA.
• a “guide sequence” or “targeting sequence” refers to the nucleotide sequence of a gRNA, whether unimolecular or modular, that is fully or partially complementary to a target domain or target polynucleotide within a DNA sequence in the genome of a cell where editing is desired.
• Guide sequences are typically 10-30 nucleotides in length, preferably 16-24 nucleotides in length (for example, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides in length), and are at or near the 5' terminus of a Cas9 gRNA.
• a “target domain” or “target polynucleotide sequence” is the DNA sequence in a genome of a cell that is complementary to the guide sequence of the gRNA.
• gRNAs typically include a plurality of domains that influence the formation or activity of gRNA/Cas9 complexes.
• the duplexed structure formed by first and secondary complementarity domains of a gRNA also referred to as a repeat: anti-repeat duplex
• REC recognition
• Cas9/gRNA complexes both incorporated by reference herein.
• first and/or second complementarity domains can contain one or more poly-A tracts, which can be recognized by RNA polymerases as a termination signal.
• the sequence of the first and second complementarity domains are, therefore, optionally modified to eliminate these tracts and promote the complete in vitro transcription of gRNAs, for example through the use of A-G swaps as described in Briner 2014, or A-U swaps.
• Cas9 gRNAs typically include two or more additional duplexed regions that are necessary for nuclease activity in vivo but not necessarily in vitro (Nishimasu 2015, supra).
• a first stem-loop near the 3' portion of the second complementarity domain is referred to variously as the “proximal domain,” “stem loop 1” (Nishimasu 2014, supra,- Nishimasu 2015, supra) and the “nexus” (Briner 2014, supra).
• One or more additional stem loop structures are generally present near the 3' end of the gRNA, with the number varying by species: S.
• pyogenes gRNAs typically include two 3' stem loops (for a total of four stem loop structures including the repeat: anti-repeat duplex), while s. aureus and other species have only one (for a total of three).
• stem loop structures and gRNA structures more generally) organized by species is provided in Briner 2014, which is incorporated herein by reference. Additional details regarding guide RNAs generally may be found in WO2018026976A1, which is incorporated herein by reference.
• the inventors have surprisingly discovered that the use of protecting oligonucleotides confers increased nuclease resistance to crRNAs.
• the protecting oligonucleotides described herein comprise complementarity to a crRNA.
• the protecting oligonucleotides confer nuclease resistance to the crRNAs when bound.
• the protecting oligonucleotides described herein bind to a region of the crRNA the contains at least one unmodified ribose group.
• the protecting oligonucleotide binds to a region of the crRNA the contains 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 unmodified ribose groups.
• the protecting oligonucleotide is about 5 to about 20 nucleotides in length (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides in length). In certain embodiments, the protecting oligonucleotide is 10, 11, 12, 13, 14, 15, or 16 nucleotides in length. The length of the protecting oligonucleotide is shorter than the crRNA to which the protecting oligonucleotide comprises complementarity to (i.e., the protecting oligonucleotide comprises complementarity to a region of the crRNA, wherein said region is not the full length of the crRNA).
• the protecting oligonucleotide binds to the crRNA to form a duplex, optionally wherein the protecting oligonucleotide binds to a region of the crRNA that is not fully chemically modified.
• the duplex has a melting temperature (Tm) of greater than 37 °C over the full length of the duplex.
• the duplex has a melting temperature (Tm) of less than 37 °C over the region of complementarity comprising the guide sequence portion.
• the binding of a tracrRNA to the guide sequence portion of the crRNA dissociates the protecting oligonucleotide from the crRNA.
• e sequences are recited below, [0101] CUAAAACNNNNNNN
• the protecting oligonucleotides and guide RNAs possess improved in vivo stability, improved genome editing efficacy, and/or reduced immunotoxicity relative to unmodified or minimally modified protecting oligonucleotides and guide RNAs.
• the protecting oligonucleotides and guide RNAs of the disclosure contain one or more modified nucleotides comprising a modification in a ribose group, a phosphate group, a nucleobase, or a combination thereof.
• Chemical modifications to the ribose group may include, but are not limited to, 2'-O-methyl, 2’-fluoro, 2’-deoxy, 2’-O-(2 -methoxyethyl) (MOE), 2’-NH2 (2’-amino), 4’-thio, 2’-O-Allyl, 2’-O-Ethylamine, 2’-O-Cyanoethyl, 2’-O-Acetalester, or a bicyclic nucleotide, such as locked nucleic acid (LNA), 2’-(.S')-constraincd ethyl (S-cEt), constrained MOE, or 2'-6>,4'-C-aminomethylene bridged nucleic acid (2', 4'- BNA NC ).
• LNA locked nucleic acid
• S-cEt constrained MOE
• 2'-6>,4'-C-aminomethylene bridged nucleic acid 2', 4'- B
• Chemical modifications to the phosphate group may include, but are not limited to, a phosphorothioate, phosphonoacetate (PACE), thiophosphonoacetate (thioPACE), amide, triazole, phosphonate, or phosphotriester modification.
• the crRNA portion of the chemically modified guide RNA comprises between 1 and 20 phosphorothioate modifications (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 phosphorothioate modifications).
• the crRNA portion of the chemically modified guide RNA comprises between 1 and 20 phosphorothioate modifications (i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 phosphorothioate modifications) and comprises at least about 50% activity relative to a guide RNA that does not comprise phosphorothioate modifications (e.g., 50% activity, 60% activity, 70% activity, 80% activity, 90% activity, 95% activity, or 100% activity, relative to a guide RNA that does not comprise phosphorothioate modifications).
• phosphorothioate modifications i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 phosphorothioate modifications
• 50% activity relative to a guide RNA that does not comprise phosphorothioate modifications e.g., 50% activity, 60% activity, 70% activity, 80% activity, 90% activity, 95% activity, or 100% activity, relative to a guide RNA that does not comprise phosphorothioate modifications
• nucleobase may include, but are not limited to, 2-thiouridine, 4 -thiouridine, N 6 -methyladenosine, pseudouridine, 2,6- diaminopurine, inosine, thymidine, 5 -methylcytosine, 5-substituted pyrimidine, isoguanine, isocytosine, or halogenated aromatic groups.
• the chemically modified guide RNAs may have one or more chemical modifications in the crRNA portion and/or the tracrRNA portion for a modular or dual RNA guide.
• the chemically modified guide RNAs may also have one or more chemical modifications in the single guide RNA for the unimolecular guide RNA.
• the protecting oligonucleotides and guide RNAs may comprise at least about 50% to at least about 100% chemically modified nucleotides, at least about 60% to at least about 100% chemically modified nucleotides, at least about 70% to at least about 100% chemically modified nucleotides, at least about 80% to at least about 100% chemically modified nucleotides, at least about 90% to at least about 100% chemically modified nucleotides, and at least about 95% to at least about 100% chemically modified nucleotides.
• the protecting oligonucleotides and guide RNAs may comprise at least about 50% chemically modified nucleotides, at least about 60% chemically modified nucleotides, at least about 70% chemically modified nucleotides, at least about 80% chemically modified nucleotides, at least about 90% chemically modified nucleotides, at least about 95% chemically modified nucleotides, at least about 99% chemically modified, or 100% (fully) chemically modified nucleotides.
• the protecting oligonucleotides and guide RNAs may comprise at least about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% chemically modified nucleotides.
• Protecting oligonucleotides and guide RNAs that comprise at least about 80% chemically modified nucleotides to at least about 99% chemically modified nucleotides are considered “heavily” modified, as used herein.
• the protecting oligonucleotides and guide RNAs may comprise a chemically modified ribose group at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides
• the protecting oligonucleotides and guide RNAs may comprise a chemically modified ribose group at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.
• the protecting oligonucleotides and guide RNAs may comprise a chemically modified ribose group at about 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides.
• the protecting oligonucleotides and guide RNAs may comprise a chemically modified phosphate group at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides
• the protecting oligonucleotides and guide RNAs may comprise a chemically modified phosphate group at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.
• the protecting oligonucleotides and guide RNAs may comprise a chemically modified phosphate group at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of nucleotides.
• the protecting oligonucleotides and guide RNAs may comprise a chemically modified nucleobase at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides.
• the protecting oligonucleotides and guide RNAs may comprise a chemically modified nucleobase at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.
• the protecting oligonucleotides and guide RNAs may comprise a chemically modified nucleobase at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides.
• the protecting oligonucleotides and guide RNAs may comprise any combination of chemically modified ribose groups, chemically modified phosphate groups, and chemically modified nucleobases at about 50% of the nucleotides to about 100% of the nucleotides, at about 60% of the nucleotides to about 100% of the nucleotides, at about 70% of the nucleotides to about 100% of the nucleotides, at about 80% of the nucleotides to about 100% of the nucleotides, at about 90% of the nucleotides to about 100% of the nucleotides, and at about 95% of the nucleotides to about 100% of the nucleotides.
• the protecting oligonucleotides and guide RNAs may comprise any combination of chemically modified ribose groups, chemically modified phosphate groups, and chemically modified nucleobases at about 50% of the nucleotides, at about 60% of the nucleotides, at about 70% of the nucleotides, at about 80% of the nucleotides, at about 90% of the nucleotides, at about 95% of the nucleotides, at about 99% of the nucleotides, or at 100% of the nucleotides.
• the protecting oligonucleotides and guide RNAs may comprise any combination of chemically modified ribose groups, chemically modified phosphate groups, and chemically modified nucleobases at about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of the nucleotides.
• oligonucleotides and guide RNAs that have at least about 80% of any combination of the ribose groups, the phosphate groups, and the nucleobases chemically modified to at least about 99% of the nucleobases chemically modified are considered “heavily” modified, as used herein.
• the heavily and fully chemically modified protecting oligonucleotides and guide RNAs of the disclosure possess several advantages over the minimally modified protecting oligonucleotides and guide RNAs in the art.
• Heavily and fully chemically modified protecting oligonucleotides and guide RNAs are expected to ease chemical synthesis, further enhance in vivo stability, and provide a scaffold for terminally appended chemical functionalities that facilitate delivery and efficacy during clinical applications to genome editing.
• the chemical modification pattern used in the guide RNA is such that activity of the guide RNA is maintained when paired with an RNA-guided DNA endonuclease, e.g., Cas9.
• the chemically modified guide RNAs of the disclosure comprise at least about 50% activity relative to an unmodified guide RNA (e.g., 50% activity, 60% activity, 70% activity, 80% activity, 90% activity, 95% activity, or 100% activity, relative to an unmodified guide RNA).
• the activity of a guide RNA can be readily determined by any means known in the art.
• % activity is measured with the traffic light reporter (TLR) Multi-Cas Variant 1 system (TLR-MCV1), described below.
• TLR- MCV 1 system will provide a % fluorescent cells which is a measure of % activity.
• Table 1 Exemplary chemical modification patterns for protecting oligonucleotides.
• An exemplary unmodified tracrRNA sequence is AGCAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGU GGCACCGAGUCGGUGCUUU (SEQ ID NO: 2).
• the guide sequence may be 10-30 nucleotides in length, preferably 16-24 nucleotides in length (for example, 16, 17, 18, 19, 20, 21, 22, 23 or 24 nucleotides in length), and is at or near the 5' terminus of a Cas9 gRNA.
• Chemically modified guide RNAs including chemically modified crRNAs and tracrRNAs, are described in more detail in US20210363518 and US20210388348, each of which is incorporated herein by reference.
• the protecting oligonucleotides described herein may be designed to bind to any region of the crRNA modification patterns that contain at least one unmodified ribose group, thereby conferring nuclease resistance to the crRNA.
• a crRNA and a tracrRNA hybridize together by forming a duplex between the repeat region of the crRNA and the anti-repeat region of the tracrRNA.
• modular, or dual RNA, guide RNAs are provided with modifications in the repeat region and the anti-repeat region to enhance the affinity between the two regions and form a stronger duplex.
• the high-affinity interaction may be enhanced by increasing the GC nucleotide content in the duplex formed by the repeat regions and the anti-repeat region.
• Nucleotide modifications such as 2’-Fluoro and 2’-O-Methyl modifications, may also be introduced, which increase the melting temperature (Tm) of the duplex. Further modifications include the use of orthogonal and non-naturally occurring nucleotides.
• the various repeat region / anti-repeat region modifications described herein enhance the stability of the duplex, helping to prevent the crRNA and tracrRNA from folding into sub- optimal structures and therefore promoting higher genome editing efficacy.
• the protecting oligonucleotides and/or crRNAs of the disclosure may be modified with terminally conjugated moieties.
• a “terminally conjugated moiety” or “moiety” refers to a compound which may be linked or attached to the 5’ and/or 3’ end of the crRNA and/ protecting oligonucleotide. Terminally conjugated moieties can provide increased stability, increased ability to penetrate cell membranes, increase cellular uptake, increase circulation time in vivo, act as a cellspecific directing reagent, and/or provide a means to monitor cellular or tissue-specific uptake.
• the terminally conjugated moiety is conjugated to the 5’ end of the crRNA. In certain embodiments, the terminally conjugated moiety is conjugated to the 3 ’ end of the crRNA. In certain embodiments, the terminally conjugated moiety is conjugated to the 5’ end of the protecting oligonucleotide. In certain embodiments, the terminally conjugated moiety is conjugated to the 3’ end of the protecting oligonucleotide.
• a terminally conjugated moiety includes, but is not limited to, fatty acid, steroid, secosteroid, lipid, ganglioside analog, nucleoside analogs, endocannabinoid, vitamin, receptor ligand, peptide, aptamer, alkyl chain, fluorophore, antibody, nuclear localization signal, and the like.
• a terminally conjugated moiety includes, but is not limited to, cholesterol, cholesterol-triethylene glycol (TEGChol), docosahexaenoic acid (DHA), docosanoic acid (DCA), lithocholic acid (LA), GalNAc, amphiphilic block copolymer (ABC), hydrophilic block copolymer (HBC), poloxamer, Cy5, Cy3, and the like.
• the at least one terminally conjugated moiety is a modified lipid, including a branched lipid (such as the structure shown in Formula I) or a headgroup -modified lipid (such as the structure shown in Formula II).
• X is a moiety that links the lipid to the guide RNA
• each Y is independently oxygen or sulfur
• each M is independently CH2
• Z is a branching group which allows two or three (“n”) chains to be joined to the rest of the structure
• L is an optional linker moiety
• each R is independently a saturated, monounsaturated or polyunsaturated linear or branched moiety from 2 to 30 atoms in length, a sterol, or other hydrophobic group.
• X is a moiety that links the lipid to the guide RNA
• each Y is independently oxygen or sulfur
• each M is independently CH2
• Z is a branching group which allows two or three (“n”) chains to be joined to the rest of the structure
• each L is independently an optional linker moiety
• R is a saturated, monounsaturated or polyunsaturated linear or branched moiety from 2 to 30 atoms in length, a sterol, or other hydrophobic group
• K is a phosphate, sulfate, or amide
• J is an aminoalkane or quaternary aminoalkane group.
• the moieties may be attached to the terminal nucleotides of the guide RNA via a linker.
• linkers include, but are not limited to, an ethylene glycol chain, an alkyl chain, a polypeptide, a polysaccharide, a block copolymer, and the like.
• the moiety is conjugated to the 5’ end and/or 3’ end of any one of RC01 to RC10 (i.e., RC01, RC02, RC03, RC04, RC05, RC06, RC07, RC08, RC09, or RC10).
• the chemically modified guide RNAs of the disclosure may be constructed as single guide RNAs (sgRNAs) by linking the 3’ end of a crRNA to the 5’ end of a tracrRNA.
• the linker may be an oligonucleotide loop, including a chemically modified oligonucleotide loop.
• the oligonucleotide loop comprises a GAAA tetraloop.
• the linker may be a non-nucleotide chemical linker, including, but not limited to, ethylene glycol oligomers (see, e.g., Pils et al. Nucleic Acids Res. 28(9): 1859-1863 (2000)).
• RNA-guided nucleases include, without limitation, naturally-occurring Type II CRISPR nucleases such as Cas9, as well as other nucleases derived or obtained therefrom.
• Exemplary Cas9 nucleases that may be used in the present disclosure include, but are not limited to, 5. pyogenes Cas9 (SpCas9), S. aureus Cas9 (SaCas9), N. meningitidis Cas9 (NmCas9), C. jejuni Cas9 (CjCas9), and Geobacillus Cas9 (GeoCas9).
• RNA-guided nucleases are defined as those nucleases that: (a) interact with (e.g., complex with) a gRNA; and (b) together with the gRNA, associate with, and optionally cleave or modify, a target region of a DNA that includes (i) a sequence complementary to the targeting domain of the gRNA and, optionally, (ii) an additional sequence referred to as a “protospacer adjacent motif,” or “PAM,” which is described in greater detail below.
• PAM protospacer adjacent motif
• RNA-guided nucleases can be defined, in broad terms, by their PAM specificity and cleavage activity, even though variations may exist between individual RNA-guided nucleases that share the same PAM specificity or cleavage activity.
• Skilled artisans will appreciate that some aspects of the present disclosure relate to systems, methods and compositions that can be implemented using any suitable RNA-guided nuclease having a certain PAM specificity and/or cleavage activity.
• the term RNA-guided nuclease should be understood as a generic term, and not limited to any particular type (e.g., Cas9 vs. Cpfl), species (e.g., 5. pyogenes vs. 5. aureus) or variation (e.g., full-length vs. truncated or split; naturally-occurring PAM specificity vs. engineered PAM specificity).
• RNA-guided nucleases may require different sequential relationships between PAMs and protospacers.
• Cas9s recognize PAM sequences that are 5' of the protospacer as visualized relative to the top or complementary strand.
• RNA-guided nucleases In addition to recognizing specific sequential orientations of PAMs and protospacers, RNA-guided nucleases generally recognize specific PAM sequences. 5. aureus Cas9, for example, recognizes a PAM sequence of NNGRRT, wherein the N sequences are immediately 3' of the region recognized by the gRNA targeting domain. 5. pyogenes Cas9 recognizes NGG PAM sequences.
• engineered RNA-guided nucleases can have PAM specificities that differ from the PAM specificities of similar nucleases (such as the naturally occurring variant from which an RNA-guided nuclease is derived, or the naturally occurring variant having the greatest amino acid sequence homology to an engineered RNA-guided nuclease).
• PAM specificities that differ from the PAM specificities of similar nucleases (such as the naturally occurring variant from which an RNA-guided nuclease is derived, or the naturally occurring variant having the greatest amino acid sequence homology to an engineered RNA-guided nuclease).
• Modified Cas9s that recognize alternate PAM sequences are described below.
• RNA-guided nucleases are also characterized by their DNA cleavage activity: naturally-occurring RNA-guided nucleases typically form DSBs in target nucleic acids, but engineered variants have been produced that generate only SSBs (discussed above; see also Ran 2013, incorporated by reference herein), or that do not cut at all.
• the RNA-guided nuclease Cas9 may be a variant of Cas9 with altered activity.
• Exemplary variant Cas9 nucleases include, but are not limited to, a Cas9 nickase (nCas9), a catalytically dead Cas9 (dCas9), a hyper accurate Cas9 (HypaCas9) (Chen et al. Nature, 550(7676), 407-410 (2017)), a high fidelity Cas9 (Cas9-HF) (Kleinstiver et al. Nature 529(7587), 490-495 (2016)), an enhanced specificity Cas9 (eCas9) (Slaymaker et al. Science 351(6268), 84-88 (2016)), and an expanded PAM Cas9 (xCas9) (Hu et al. Nature doi: 10.1038/nature26155 (2016)).
• nCas9 Cas9 nickase
• dCas9 cata
• the RNA-guided nucleases may be combined with the chemically modified guide RNAs of the present disclosure to form a genome-editing system.
• the RNA-guided nucleases may be combined with the chemically modified guide RNAs to form an RNP complex that may be delivered to a cell where genome-editing is desired.
• the RNA-guided nucleases may be expressed in a cell where genome-editing is desired with the chemically modified guide RNAs delivered separately.
• the RNA-guided nucleases may be expressed from a polynucleotide such as a vector or a synthetic mRNA.
• the vector may be a viral vector, including, be not limited to, an adeno-associated virus (AAV) vector or a lentivirus (LV) vector.
• AAV adeno-associated virus
• LV lentivirus
• Example 1 Genome editing efficiency of chemically modified crRNA and tracrRNA
• Example 2 Protecting oligos enhance the stability of crRNA without compromising activity and enhance the potency of crRNA
• Example 3 Conjugation to protecting oligos enhanced cellular uptake without interfering with crRNA activity
• Addition of conjugations such as N-acetylgalactosamine (GalNac) and Cholesterol (TegChol) to therapeutic oligonucleotide is critical for achieving potent and targeted in vivo delivery.
• conjugations interfere with the crRNA activity
• Fig. 4A While directly conjugating of Cholesterol to C20 significantly compromised the activity, C20 with Cholesterol-conjugated protecting oligos did not show reduced activity (Fig. 4A). While C20 with cholesterol conjugation showed significantly reduced editing efficiency, conjugating cholesterol onto the protecting oligonucleotides did not interfere with the activity (Fig. 4B).
• Example 4 Chemically modified crRNAs with varied phosphorothioate content
• the mTmG+/+ reporter consists of loxP sites on either side of a membrane-targeted tdTomato (mT) cassette, which constitutively expresses red fluorescent, and a downstream membrane- targeted EGFP (mG) that cannot be expressed until the mT cassette was deleted (Fig. 7A).
• mT membrane-targeted tdTomato
• Example 6 Chemically modified crRNAs with varied phosphorothioate content
• the HT 1 mouse model used in this study is the Fah PM/PM mouse, which possesses a G-to-A point mutation in the last nucleotide of exon 8 of the Fah gene, which encodes fiimarylacetoacetate hydrolase. This point mutation generates exon 8 skipping and causes FAH deficiency (Fig. 8C). Because FAH catalyzes one step of the tyrosine catabolic pathway, FAH deficiency leads to accumulations of toxic fiimarylacetoacetate and succinyl acetoacetate, causing damage in multiple organs.
• the Fah PM/PM mouse can be treated with 2-(2-nitro-4-trifluoromethylbenzoyl)-l,3-cyclohexanedione (NTBC), an inhibitor of an enzyme upstream within the tyrosine degradation pathway to prevent toxin accumulation. Without such treatment, the mice will rapidly lose weight and die.
• NTBC 2-(2-nitro-4-trifluoromethylbenzoyl)-l,3-cyclohexanedione
• mice were kept on NTBC the whole time to maintain their body weight and allow time for the genome editing to occur.
• Fig. 8E Before NTBC withdrawal, we observed low yet significant on-target editing in the codelivery-treated groups (Fig. 8E). After NTBC withdrawal, the PBS-injected mouse rapidly lost body weight and was humanely sacrificed after the body weight dropped below 80% and moribund. The mice treated with AAV-expressed SpyCas9-ABE8e and tracrRNA, and C20 with protecting oligos gradually gained body weight over time (Fig. 8F). The mice were then sacrificed after three months of NTBC cycles, and IHC staining was performed on liver sections using anti-FAH antibodies. We observed the expansion of FAH-positive hepatocytes in the liver tissue treated with AAV co-delivery (Fig. 8G). These data suggested that systemic delivery of C20 and GalNac-conjugated protecting oligos, with AAV-expressed effector protein and tracrRNA, can achieve in vivo genome editing in the liver and offer therapeutic benefits.
• the asialoglycoprotein receptor (ASGPR) which is expressed on the surface of the hepatocytes and responsible for the uptake of GalNac-conjugated oligos, has a recycle time of around 10 - 15 minutes. Data from previous studies also showed that due to ASGPR saturation, the hepatocytes can only uptake limited amount of the GalNac- conjugated molecules after bolus intravenous injection.77
• Our initial study injected a single dose of C20 with GalNac-conjugated protecting oligo at 80 mg/kg, far beyond the capacity of available ASGPR.
• Example 7 Improving the in vivo editing efficiency through optimization of the dosing regimen
• a 16 nt protecting oligo (B10 with a sequence of 5’- ACCAUAGCUCUAAAAC-3’) that leaves no toe-hold for initial tracrRNA annealing also leads to reduced activity, consistent with our hypothesis that the protecting oligo need to be displaced by tracrRNA before C20 can become active (Fig. 10A).
• the protecting oligo neither inhibited nor enhanced the potency of a fully modified and stabilized crRNA (C40), implying that the potency increase conferred by the protecting oligo resulted from C20 stabilization (Fig. 10B).

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Genetics & Genomics (AREA)
• Engineering & Computer Science (AREA)
• Chemical & Material Sciences (AREA)
• Biomedical Technology (AREA)
• Zoology (AREA)
• Organic Chemistry (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Wood Science & Technology (AREA)
• Molecular Biology (AREA)
• Biotechnology (AREA)
• General Engineering & Computer Science (AREA)
• General Health & Medical Sciences (AREA)
• Biochemistry (AREA)
• Microbiology (AREA)
• Physics & Mathematics (AREA)
• Plant Pathology (AREA)
• Biophysics (AREA)
• Medicinal Chemistry (AREA)
• Mycology (AREA)
• Cell Biology (AREA)
• Crystallography & Structural Chemistry (AREA)
• Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Priority Applications (5)

Applications Claiming Priority (4)

Publications (1)

Family

ID=88519734

Family Applications (1)

Country Status (7)

Citations (3)

Family Cites Families (4)

• 2023
  • 2023-04-28 WO PCT/US2023/020418 patent/WO2023212327A1/en not_active Ceased
  • 2023-04-28 US US18/141,166 patent/US20230407295A1/en active Pending
  • 2023-04-28 CA CA3250967A patent/CA3250967A1/en active Pending
  • 2023-04-28 EP EP23797358.1A patent/EP4514972A1/en active Pending
  • 2023-04-28 JP JP2024563634A patent/JP2025514327A/ja active Pending
  • 2023-04-28 AU AU2023262033A patent/AU2023262033A1/en active Pending
  • 2023-04-28 CN CN202380043499.1A patent/CN119563023A/zh active Pending

Patent Citations (3)

Also Published As

Similar Documents

Legal Events