WO2023211073A1 - Biomarker composition for predicting cancer patient susceptibility to anti-igsf1 antibody, and method using same - Google Patents

Abstract

The present invention relates to: a biomarker composition for predicting cancer patient susceptibility to an anti-IGSF1 antibody; and a method for providing information required for predicting cancer patient susceptibility to an anti-IGSF1 antibody by using same. Therefore, individual cancer patient susceptibility to an anti-IGSF1 antibody can be accurately predicted before treatment through a method for measuring the expression level of PD-L1 protein or a gene encoding same, and thus an anticancer drug with a high therapeutic effect can be selected, and side effects caused by using unnecessary anticancer drugs can be prevented.

Description

Biomarker composition for predicting susceptibility of cancer patients to anti-IGSF1 antibodies and method of using the same

The present invention provides a biomarker composition for predicting the susceptibility of a cancer patient to an anti-IGSF1 antibody and a method for providing the information necessary to predict the susceptibility of a cancer patient to an anti-IGSF1 antibody using the same.

Cancer is a major disease that ranks first in mortality in modern society, and despite much research, there is no groundbreaking treatment to date. Worldwide, more than 100 million cancer patients occur every year, and the World Health Organization (WHO) considers cancer to be one of the main causes of death.

In general, the responsiveness of a living body when an anticancer drug is administered in anticancer therapy largely depends on the sensitivity of the targeted cancer cells to a specific drug. The sensitivity of these cancer cells to drugs is greatly different for each cancer cell, and this difference in sensitivity is due to quantitative or qualitative differences in the target molecules of the drug or factors related thereto, or the acquisition of drug resistance, etc. Based on this background, if genetic changes in cancer cells that specifically appear when target cancer cells are sensitive to drugs can be identified, the effectiveness of the drug can be determined at an early stage, the treatment regimen can be established, and new treatments can be selected. This is possible and is very beneficial. In addition, prior to treatment, cancer cells are isolated from cancer tissue obtained by biological tissue fragments, etc. according to a conventional method and then treated with a drug, and whether the cancer cells are sensitive to the drug is measured based on the above-mentioned changes. It is very useful clinically because it is possible to predict in advance whether treatment by .

Meanwhile, Republic of Korea Patent Publication No. 10-2021-0122185 discloses that an antibody against IGSF1 can be used as a pharmaceutical composition for cancer prevention or treatment. However, no method has been disclosed at all to predict the sensitivity of cancer patients to antibodies against IGSF1.

Accordingly, the present inventors studied to develop a method to predict the sensitivity of cancer patients to antibodies against IGSF1, and as a result, it was found that the expression patterns of IGSF1 and PD-L1 in cancer cells or tissues of cancer patients show an opposite correlation. By confirming this, the present invention was completed.

In order to achieve the above object, one aspect of the present invention is a biomarker composition for predicting the susceptibility of cancer patients to anti-IGSF1 antibodies, comprising an agent capable of measuring the expression level of PD-L1 protein or the gene encoding it. provides.

Another aspect of the present invention provides a kit for predicting susceptibility of cancer patients to anti-IGSF1 antibodies, comprising the biomarker composition.

Another aspect of the present invention provides information necessary for predicting the susceptibility of a cancer patient to an anti-IGSF1 antibody, comprising measuring the expression level of the PD-L1 protein or the gene encoding it in a biological sample obtained from the individual. Provides a method to provide.

Another aspect of the present invention provides a method of selecting cancer patients suitable for treatment with an anti-IGSF1 antibody, comprising selecting an individual with a low expression level of the PD-L1 protein or the gene encoding it.

Using the biomarker composition for predicting susceptibility to anti-IGSF1 antibody of the present invention, the susceptibility of individual cancer patients to anti-IGSF1 antibody can be determined by measuring the expression level of PD-L1 protein or the gene encoding it. Since accurate predictions can be made before treatment, it is possible to select an anticancer drug with high therapeutic effect and prevent side effects from unnecessary use of anticancer drugs.

Figure 1a shows the results of Western blot (top) and RT-PCR (bottom) to confirm changes in the expression pattern of PD-L1 due to IGSF1 overexpression in NCI-H292, a non-small cell lung cancer cell line. β-actin and GAPDH are controls for each experiment.

Figure 1b shows the results of Western blotting to confirm changes in the expression pattern of PD-L1 when IGSF1 was knocked down in a cell line with stable IGSF1 overexpression.

Figure 2a shows the results of Western blotting to confirm changes in the expression pattern of PD-L1 when IGSF1 was knocked down in three lung cancer cell lines (NCI-H520, NCI-H1435, NCI-H1944) expressing IGSF1.

Figure 2b shows the results of Western blotting to confirm changes in the expression pattern of PD-L1 when IGSF1 was overexpressed in two lung cancer cell lines (Calu-1, NCI-H2228) that do not express IGSF1.

Figure 3 shows a Western blot to confirm changes in the expression pattern of PD-L1 when co-transfected with increasing amounts of the IGSF1 expression vector while maintaining a fixed amount of the PD-L1 expression vector in 293T, a human embryonic kidney cell line. This is the result of the performance.

Figure 4 is a photograph (top) of a tissue showing an inverse correlation between the expression patterns of IGSF1 and PD-L1 by performing immunohistochemical staining, and the IGSF1 expression levels are categorized as 0(-), 1(+), and 2( ++), 3(+++), and PD-L1 is a graph created by calculating the TPS value (bottom).

Figure 5a shows the results of confirming the binding between ATF3, a downstream signal of IGSF1, and PD-L1 through chromatin immunoprecipitation when IGSF1 was knocked down in a cell line stably overexpressing IGSF1.

Figure 5b shows the results of RT-PCR (top) and Western blot (bottom) to confirm changes in the expression patterns of ATF3 and PD-L1 due to inhibition of IGSF1 expression in lung cancer cell lines NCI-H838 and NCI-H358. GAPDH and β-actin are controls for each experiment.

Figure 5c shows the results of RT-PCR (top) and Western blot (bottom) to confirm changes in the expression patterns of ATF3 and PD-L1 due to IGSF1 overexpression in NCI-H292 cells, a lung cancer cell line. GAPDH and β-actin are controls for each experiment.

Figure 6 is a diagram showing the results of identifying IGSF1 protein using TMT labeling LC/MS in lung cancer cell lines with different PD-L1 expression levels.

Biomarker composition for predicting susceptibility to anti-IGSF1 antibody

One aspect of the present invention provides a biomarker composition for predicting susceptibility of cancer patients to anti-IGSF1 antibodies, including an agent capable of measuring the expression level of PD-L1 protein or the gene encoding it.

As used herein, the term “Immunoglobulin superfamily member 1 (IGSF1)” is a plasma membrane glycoprotein encoded by the IGSF1 gene found on the X chromosome of humans and other mammalian species. Although the function of IGSF1 in normal cells is not well known, IGSF1 mutations are known to cause diseases such as IGSF1 deficiency syndrome or central hypothyroidism.

As used herein, the term "PD-L1" refers to a protein present on the surface of cancer cells or hematopoietic cells. PD-L1 and PD-L2 on the surface of cancer cells are PD-L1, a protein on the surface of T cells. When combined with 1, T cells cannot attack cancer cells.

As used herein, the term “susceptibility” refers to whether an anti-IGSF1 antibody exhibits a therapeutic effect for an individual cancer patient. It is known that even types of therapeutic agents recognized as effective for cancer treatment may or may not be effective depending on the individual patient. Whether or not a treatment is effective for an individual cancer patient can be referred to as sensitivity to the treatment.

As used herein, the term “biomarker” may also be used as a companion diagnosis marker and refers to a substance that can predict in advance a patient's responsiveness to a specific drug treatment in a biological sample. Polypeptides or nucleic acids (e.g., mRNA, etc.), lipids, glycolipids, glycoproteins, or sugars (e.g., monosaccharides, disaccharides, oligosaccharides, etc.) that are shown to be increased or decreased in biological samples taken from certain cancer patients. It may include organic biomolecules, etc.

As used herein, the term “cancer” refers to the aggressive nature of cells dividing and proliferating in defiance of normal growth limits, the invasive nature of infiltrating surrounding tissues, and the ability to spread to other parts of the body. It refers to a general term for diseases caused by cells with metastatic characteristics, and is used in the same sense as malignant tumor. In addition, “treatment of cancer” means inhibiting or preventing the growth of cancer cells or tissues, which reduces cancer growth and cancer metastasis compared to no treatment or treatment, and reduces resistance to anticancer drugs. This concept also includes making the treatment more effective. The cancer metastasis refers to the process by which tumor (cancer) cells spread to distant parts of the body, and "resistance to anticancer drugs" or "anticancer drug resistance" refers to the initial stage of treatment when treating cancer patients using anticancer drugs. This means that there is no treatment effect or that the cancer treatment effect is initially effective but the cancer treatment effect is lost during the continuous treatment process.

In one embodiment, the expression level of the PD-L1 protein or the gene encoding the same in the responding patient group showing a therapeutic effect against the anti-IGSF1 antibody compared to the non-responsive cancer patient group showing no therapeutic effect against the anti-IGSF1 antibody. This may decrease. In addition, the expression level of PD-L1 protein or the gene encoding it is increased in the non-responsive cancer patient group that does not show a therapeutic effect to the anti-IGSF1 antibody compared to the responsive cancer patient group that shows a therapeutic effect to the anti-IGSF1 antibody. can do.

The cancer may be one in which the IGSF1 protein or the gene encoding it is overexpressed.

The cancer consists of stomach cancer, liver cancer, lung cancer, colon cancer, breast cancer, prostate cancer, ovarian cancer, pancreas cancer, cervical cancer, thyroid cancer, laryngeal cancer, acute myeloid leukemia, brain tumor, neuroblastoma, retinoblastoma, head and neck cancer, salivary gland cancer, and lymphoma. It may be any one selected from the group, but is not limited thereto, and may be applicable to any tumor tissue in which the IGSF1 protein or the gene encoding it is present.

Measuring the expression level of the PD-L1 protein is a process of confirming the presence and expression level of the protein in a biological sample isolated from a cancer patient in order to predict the cancer patient's sensitivity to the anti-IGSF1 antibody, The amount of protein is confirmed using a molecule that specifically binds to the protein.

Agents that can measure the expression level of the protein include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, ligands, PNA (peptide nucleic acid), and aptamers ( It may be one or more selected from the group consisting of an aptamer and a nanoparticle, but is not limited thereto.

Analysis methods for this include western blotting, ELISA (enzyme linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, ouchterlony immunodiffusion, and rocket ( rocket) immunoelectrophoresis, immunoprecipitation assay, immunohistochemical analysis, complement fixation assay, FACS (fluorescence activated cell sorter), protein chip, two-dimensional electrophoresis Electrophoretic analysis, protein mass spectrometry, liquid chromatography-mass spectrometry (LC-MS), LC-MS/MS (liquid chromatography-mass spectrometry/mass spectrometry), MALDI-TOF (matrix desorption/ionization time) of flight mass spectrometry) analysis and SELDI-TOF (surface enhanced laser desorption/ionization time of flight mass spectrometry) analysis, etc., but are not limited thereto.

Measurement of the expression level of the gene encoding the protein determines the presence or absence of the gene encoding the protein in biological samples isolated from cancer patients and the expression level of the gene in order to predict the susceptibility of the cancer patient to the anti-IGSF1 antibody. In the process of confirming, the amount of the gene is confirmed using a molecule that specifically binds to the gene.

An agent capable of measuring the expression level of a gene encoding the protein may be at least one selected from the group consisting of a primer pair, a probe, and an antisense nucleotide that specifically binds to the gene. However, it is not limited to this.

Analysis methods for this include reverse transcriptase-polymerase chain reaction (RT-PCR), real time-polymerase chain reaction, RNase protection assay (RPA), and Northern These include, but are not limited to, northern blotting and DNA chips.

In one embodiment, it can be seen that the expression patterns of PD-L1 and IGSF1 show a reverse correlation.

Another aspect of the present invention provides a kit for predicting the sensitivity of cancer patients to anti-IGSF1 antibodies, including the biomarker composition.

The kit can predict sensitivity to the anti-IGSF1 antibody using biological samples isolated from cancer patients. Specifically, the kit can predict sensitivity to the anti-IGSF1 antibody using tumor tissue collected from a cancer patient.

The kit may include tools and reagents commonly used in immunological analysis, as well as agents for measuring the expression level of the protein or gene.

Examples of the tool or reagent may include, but is not limited to, a suitable carrier, a labeling substance capable of generating a detectable signal, a chromophore, a solubilizer, a detergent, a buffer, and a stabilizer. If the labeling substance is an enzyme, it may include a substrate that can measure enzyme activity and a reaction stopper. Carriers include soluble carriers and insoluble carriers. Examples of soluble carriers include physiologically acceptable buffers known in the art, such as PBS, and examples of insoluble carriers include polystyrene, polyethylene, polypropylene, polyester, It may be polyacrylonitrile, fluororesin, cross-linked dextran, polysaccharide, polymers such as magnetic fine particles plated with metal on latex, other paper, glass, metal, agarose, and combinations thereof.

The biomarker composition is as described above.

Methods that provide information needed to predict susceptibility to anti-IGSF1 antibodies

Another aspect of the present invention provides information necessary for predicting the susceptibility of a cancer patient to an anti-IGSF1 antibody, comprising measuring the expression level of the PD-L1 protein or the gene encoding it in a biological sample obtained from the individual. Provides a method to provide.

The method may additionally include the step of predicting sensitivity to an anticancer agent containing an anti-IGSF1 antibody when the expression level of the PD-L1 protein or the gene encoding it is lower than the reference value. Specifically, when the expression level of the PD-L1 protein or the gene encoding it is lower than the reference value, the expression level of the IGSF1 protein or the gene encoding it can be predicted to be high.

As used herein, the term “reference value” refers to amplification/non-amplification of a gene; Alternatively, it refers to a value that serves as a standard for dividing over- or under-expression of mRNA or protein. The reference value may be, for example, the average mRNA/protein expression level of an individual before treatment with a specific drug, or the average mRNA/protein expression level of a normal individual, but is not limited thereto. In addition, the reference value may be determined according to the distribution of the average mRNA/protein expression level of a specific patient group, but is not limited thereto.

Specifically, the mRNA expression level or protein expression level is measured by measuring the average mRNA expression level or protein expression level from each individual sample using a method for measuring gene, mRNA, or protein levels commonly used in the technical field of the present invention. , top 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9% 10%, 11%, 12%, 13%, 14%, 15% of the distribution of measurements. , 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32 %, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65% , 66%, 67%, 68%, 69%,70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82 %, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or The measured value corresponding to 99% can be set as the standard value.

As used herein, the term “biological sample” refers to any sample obtained from an individual in which the expression level of the PD-L1 protein or the gene encoding it can be measured.

The biological sample may be, but is not limited to, blood, plasma, serum, urine, saliva, sputum, cerebrospinal fluid, cell culture fluid, tissue extract, or tumor tissue. Specifically, the biological sample may be tumor tissue collected from an individual for biopsy. The biological sample can be prepared by processing by methods commonly used in the art.

The cancer may be one in which the IGSF1 protein or the gene encoding it is overexpressed.

The cancer consists of stomach cancer, liver cancer, lung cancer, colon cancer, breast cancer, prostate cancer, ovarian cancer, pancreas cancer, cervical cancer, thyroid cancer, laryngeal cancer, acute myeloid leukemia, brain tumor, neuroblastoma, retinoblastoma, head and neck cancer, salivary gland cancer, and lymphoma. It may be any one selected from the group, but is not limited thereto, and may be applicable to any tumor tissue in which the IGSF1 protein or the gene encoding it is present.

PD-L1 and IGSF1 are as described above.

How to select patients suitable for anti-IGSF1 antibody treatment

Another aspect of the present invention provides a method of selecting cancer patients suitable for treatment with an anti-IGSF1 antibody, comprising selecting an individual with a low expression level of the PD-L1 protein or the gene encoding it.

The anti-IGSF1 antibody, PD-L1 protein expression level, cancer, etc. are as described above.

Redundant content is omitted in consideration of the complexity of the present specification, and terms not otherwise defined in this specification have meanings commonly used in the technical field to which the present invention pertains.

Hereinafter, the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and it will be apparent to those skilled in the art that the scope of the present invention is not to be construed as limited by these examples.

Example 1. Analysis of expression patterns of IGSF1 and PD-L1 in non-small cell lung cancer cell lines

Example 1.1. Analysis of PD-L1 expression pattern according to IGSF1 overexpression

The non-small cell lung cancer cell line NCI-H292 (Korean Cell Line Bank, KCLB) was genetically engineered to overexpress IGSF1 (NCI-H292 IGSF1 O/E), and as a negative control, an empty vector (pCMV6 entry) was added to NCI-H292. , Origene PS100001) was used (NCI-H292 MOCK). Specifically, the IGSF1 expression vector (pCMV6 entry IGSF1, Origene, RC209621) was transfected into NCI-H292 cells using jetPRIME reagent, and treated with 800 μg/ml of G418 starting 2 days later. After treatment with G418, the transfected cells were selected for 1 month to obtain a single clone (clone F) IGSF1 overexpressing stable cell line.

To confirm the expression pattern of PD-L1 according to IGSF1 overexpression in cancer cells, Western blot and RT-PCR were performed. Specifically, NCI-H292 MOCK and NCI-H292 IGSF1 O/E were lysed using RIPA buffer, reacted with Bradford solution, and quantified at a wavelength of 595 nm. 15 μg of cell lysis sample was loaded onto an 8% SDS-gel and subjected to SDS-PAGE, and then the sample present in the gel was transferred to a PVDF membrane at 100V for 120 minutes.

Next, the primary antibodies, anti-IGSF1 antibody, anti-PD-L1 antibody, and anti-β-actin antibody, were incubated at a ratio of 1:2000 at 4°C using 5% skim milk dissolved in TBST. The reaction was carried out overnight. Afterwards, the secondary antibody, HRP (horseradish peroxidase)-conjugated mouse antibody, was diluted in 5% skim milk powder at a ratio of 1:5000 and reacted at room temperature for 1 hour. The signal was amplified using an enhanced chemiluminescence (ECL) solution, sensitized to film, developed, and the change in protein expression level was measured. The results are shown in Figure 1a. Antibody information used in Western blot is as listed in Table 1 below.

target	category	cat.#	Manufacturer
IGSF1	Mouse IgG (primary antibody)	sc-393786	SantaCruz Biotechnology, Inc.
PD-L1	Rabbit IgG (primary antibody)	ab205921	Abcam
β-actin	Mouse IgG (primary antibody)	sc-47778	SantaCruz Biotechnology, Inc.

Additionally, to confirm the mRNA expression level, RNA was extracted and quantified with Trizol, and then 2,000 ng of RNA was prepared. Subsequently, cDNA was synthesized using the AccuPower ^® CycleScript RT PreMix kit using 100 pmole 1 μl of oligo dt primer. PCR was performed on 2 μl of the synthesized cDNA in an AB Veriti 96-Well Thermal Cycler using the AccuPower ^® PCR PreMix kit for 28 cycles. After completing PCR, 5 μl of each sample was loaded onto a 1% agarose gel, electrophoresed at 150 V for 35 minutes, and changes in mRNA expression levels were confirmed through UV irradiation in Gel-Doc. The results are shown in Figure 1a. Primer information used in PCR is as listed in Table 2 below.

gene	Primer sequence (5` → 3`)		sequence number
IGSF1	forward	CTGGAGATCTGGTGACTGATA	One
	reverse		AGCAAGAGAGAGGAGAGGAAAG	2
PD-L1	forward		TTACTGTCACGGTTCCCAAG	3
	reverse	TCATGTTCAGAGTGACTGG	4
GAPDH	forward	GAAGGTGAAGGTCGGAGTC	5
	reverse		GAAGATGGTGATGGGATTTC	6

As shown in Figure 1a, it was confirmed that the expression level of PD-L1 was decreased in protein and mRNA in the NCI-H292 IGSF1 overexpression stabilized cell line.

Example 1.2. Analysis of PD-L1 expression pattern according to decreased IGSF1 expression

In order to confirm the expression pattern of PD-L1 according to the decrease in IGSF1 expression in the IGSF1 overexpression stabilized cell line of Example 1.1, Western blot was performed. Specifically, NCI-H292 IGSF1 O/E was seeded at 5x10 ⁵ cells/dish in a 60 mm ² culture dish, cultured for 24 hours, and Scrambled shRNA (Short hairpin RNA) and IGSF1 shRNA (Sequence) Number 7) were transfected at 200 pmol each using JetPrime reagent. Scrambled (sc) shRNA is a negative control for IGSF1 shRNA, and IGSF1 shRNA is for knockdown of IGSF1. After culturing the transfected cells for 48 hours and collecting them, the cells were lysed using RIPA buffer. Western blot was performed using the cell lysed sample in the same manner as described in Example 1.1, and the results are shown in Figure 1b.

As shown in Figure 1b, it was confirmed that the expression of PD-L1, which had decreased in the NCI-H292 IGSF1 overexpression stabilization cell line, increased again when IGSF1 was knocked down.

Example 2. Analysis of expression patterns of IGSF1 and PD-L1 in various lung cancer cell lines

Example 2.1. Analysis of PD-L1 expression pattern according to inhibition of IGSF1 expression

Lung cancer cell lines NCI-H520 (ATCC), NCI-H1435 (KCLB), and NCI-H1944 (ATCC) cells were inoculated at 5x10 ⁵ cells/dish in a 60 mm ² culture dish and cultured for 24 hours, followed by Scrambled shRNA and IGSF1. 200 pmol of each shRNA was transfected using JetPrime reagent. Scrambled (sc) shRNA is a negative control for IGSF1 shRNA, and IGSF1 shRNA is for knocking down IGSF1. After culturing the transfected cells for 48 hours and collecting them, the cells were lysed using RIPA buffer. Western blot was performed using the cell lysed sample in the same manner as described in Example 1.1, and the results are shown in Figure 2a.

As shown in Figure 2a, when IGSF1 was knocked down in a lung cancer cell line expressing IGSF1, the expression of PD-L1 was confirmed to increase.

Example 2.2. Analysis of PD-L1 expression pattern according to induction of IGSF1 expression

Lung cancer cell lines Calu-1 (KCLB) and NCI-H2228 (ATCC) cells were inoculated into a 60 mm ² culture dish at 5x10 ⁵ cells/dish and cultured for 24 hours, followed by empty vector and HA-tagged IGSF1 expression. 2 μg of each vector was transfected using JetPrime reagent. After culturing the transfected cells for 48 hours and collecting them, the cells were lysed using RIPA buffer and Western blot was performed. Specifically, cell lysis samples were reacted with Bradford solution and quantified at a wavelength of 595 nm. 15 μg of cell lysis sample was loaded onto an 8% SDS-gel and subjected to SDS-PAGE, and then the sample present in the gel was transferred to a PVDF membrane at 100V for 120 minutes.

Next, the primary antibodies, anti-IGSF1 antibody, anti-HA antibody, anti-PD-L1 antibody, and anti-β-actin antibody, were mixed at 1:2000 using 5% skim milk dissolved in TBST. After reacting overnight at 4°C, the secondary antibody, HRP (horseradish peroxidase)-conjugated mouse antibody, was diluted in 5% skim milk powder at a ratio of 1:5000 and reacted at room temperature for 1 hour. The signal was amplified using an enhanced chemiluminescence (ECL) solution, sensitized to film, developed, and the change in protein expression level was measured. The results are shown in Figure 2b. Antibody information used in Western blot is as listed in Table 3 below.

target	category	cat.#	Manufacturer
IGSF1	Mouse IgG (primary)	sc-393786	SantaCruz Biotechnology, Inc.
HA	Rabbit IgG (primary)	3724S	Cell Signaling Technology
PD-L1	Rabbit IgG (primary)	ab205921	Abcam
β-actin	Mouse IgG (primary)	sc-47778	SantaCruz Biotechnology, Inc.

As shown in Figure 2b, it was confirmed that PD-L1 expression was decreased when IGSF1 was overexpressed in a lung cancer cell line that does not express IGSF1.

Example 3. Analysis of PD-L1 expression changes according to increase in IGSF1 expression level

293T (ATCC) cells, a human embryonic kidney cell line, were inoculated at 5x10 ⁵ cells/dish in a 60 mm ² culture dish and cultured for 24 hours. The amount of PD-L1 expression vector was fixed at 0.5 μg, and the amount of IGSF1 expression vector was increased to 0 μg, 0.5 μg, 1.0 μg, 1.5 μg, and 2.0 μg and co-transfected using JetPrime reagent. After culturing the transfected cells for 48 hours and collecting them, the cells were lysed using RIPA buffer. Western blot was performed using the cell lysed sample in the same manner as described in Example 1.1, and the results are shown in Figure 3.

As shown in Figure 3, it was confirmed that the expression level of PD-L1 decreased depending on the increase in the amount of IGSF1 expression vector.

Example 4. In non-small cell lung cancer patient tissue Expression pattern analysis of IGSF1 and PD-L1

To confirm the expression patterns of IGSF1 and PD-L1 on 84 tissue slides from non-small cell lung cancer patients, immunohistochemistry (IHC) was performed. Specifically, tissue sections from 84 human non-small cell lung cancer patients were deparaffinized and rehydrated. For heat-induced epitope recovery, the cells were soaked in target recovery buffer, heated in a microwave oven for 15 minutes, and left in target recovery buffer for an additional 30 minutes.

After washing three times with Tris-buffered saline-0.05% Tween 20 (TBS-T), it was blocked with a blocking solution for 60 minutes. Afterwards, the primary antibodies, anti-IGSF1 antibody (Santacruz, sc-393786) and anti-PD-L1 antibody (abcam, ab205921), were mixed at 1:100 and incubated overnight at 4°C. The next day, after washing three times with TBS-T, it was reacted with endogenous peroxidase blocking reagent (Cell Marque, 925B) at room temperature for 5 minutes, and secondary antibodies, rabbit and mouse antibodies (Vector, PK-6101, PK- 6102) were combined for 60 minutes at room temperature. After washing three times with TBS-T, it was reacted with avidin-biotin for 60 minutes. Finally, tissue staining was completed through DAB staining (Vector, SK-4100) and then another dehydration process. The dyed slide was photographed with a slide scanner (cat: M8, precipoint), and the results are shown in Figure 4 (top).

In addition, immunohistochemical staining was performed to confirm the expression of IGSF1 and PD-L1 and then scoring. For the scoring method, refer to the method described in [Yi Xin Li et al., PLOS ONE, 10(2), e0118391]. Specifically, IGSF1 is subdivided into 0(-), 1(+)(negative/low), 2(++), and 3(+++)(positive/high), and PD-L1 is classified into tumor proportion score (TPS). ) values were calculated and subdivided into <1, 1~4.9, 5~49 (negative/low), and ≥50 (positive/high). By comparing the scores of IGSF1 and PD-L1, tissues in which the scores of IGSF1 and PD-L1 were reverse correlated were identified, and a graph was created and shown in Figure 4 (bottom).

As shown in Figure 4, the expression patterns of IGSF1 and PD-L1 in the tissues of non-small cell lung cancer patients show an inverse correlation (bottom), and the tissues with IGSF1 (positive/high) and PD-L1 (negative/low) It was confirmed that 34.5%, IGSF1 (negative/low), and PD-L1 (positive/high) were 3.6%.

Example 5. Analysis of PD-L1 gene expression regulation by IGSF1 in various lung cancer cell lines

Example 5.1. Analysis of the interaction between ATF3, a downstream signal of IGSF1, and PD-L1

To determine whether it affects the interaction between ATF3, a downstream signal of IGSF1, and PD-L1 in lung cancer cell lines, the ATF3 binding site (binding site) was identified on the PD-L1 promoter through PD-L1 promoter chip assay depending on whether IGSF1 was expressed or not. ) and conducted an experiment. The results were confirmed through chromatin immunoprecipitation.

Specifically, lung cancer cell lines NCI-H292 mock and NCI-H292 IGSF1 O/E cells were cultured by adding 37% formaldehyde to a concentration of 1% for 15 minutes at room temperature. During the culture, 740 mL glycine (1 M) was added and incubated at room temperature for 5 minutes, and then the cells were harvested. Cross-linked cells were then melted in SDS lysis buffer and sonicated to obtain DNA fragments. Chromatin was immunoprecipitated with ATF3 antibody or IgG antibody and agarose at 4°C. Chromatin, antibody, and agarose complex were eluted by adding sodium chloride during the washing process, and reverse histone-DNA crosslinks were performed at 65°C. Polymerase chain reaction was performed using 1 μL of immunoprecipitated DNA using primers specific to the PD-L1 promoter. Information on the antibodies used in immunoprecipitation is as shown in Table 4 below, and information on primers used in the polymerase chain reaction is as shown in Table 5 below.

target	category	cat.#	Manufacturer
ATF3	Rabbit IgG (primary)	33593	Cell Signaling Technology

gene	Primer sequence (5` → 3`)		sequence number
PD-L1 promoter region	forward	CACACACACACACACCTACT	8
	reverse	ACATCTGAACGCACCTTGAT	9

As a result, it was confirmed that ATF3 bound to the PD-L1 promoter in the NCI-H292 cell line without IGSF1 expression, and that ATF3 did not bind to the PD-L1 promoter in the NCI-H292 IGSF1 overexpressing stable cell line (Figure 5a) .

Example 5.2. Analysis of expression patterns of ATF3 and PD-L1 according to inhibition of IGSF1 expression

Reverse transcription-polymerase chain reaction (RT-PCR) and Western blot were used to analyze changes in the expression patterns of ATF3 and PD-L1 according to IGSF1 K/D (knock down) in lung cancer cell lines NCI-838 and NCI-H358 cells. blot) was performed.

Specifically, NCI-838 and NCI-H358 cells were treated with Trizol, RNA was extracted and quantified. Afterwards, cDNA was synthesized using the AccuPower® CycleScript RT PreMix kit using 1 μL of 100 pmole of oligo dt primer for 2000 ng of RNA. PCR was performed on 2 μL of the synthesized cDNA in an AB Veriti 96-Well Thermal Cycler using the AccuPower® PCR PreMix kit for 28 cycles. After completing PCR, 5 μL of each sample was loaded onto a 1% agarose gel and electrophoresed at 150 V for 35 minutes. Afterwards, changes in mRNA expression levels were confirmed through UV irradiation in Gel-Doc. To confirm protein expression, cells were digested using RIPA buffer, reacted with Bradford solution, and quantified at a wavelength of 595 nm. SDS-PAGE was performed by loading 15 μg of cell lysis sample on an 8% SDS-gel. Afterwards, transfer was performed on the PVDF membrane at 100V for 120 minutes, and IGSF1 antibody, ATF antibody, PD-L1 antibody, and β-actin antibody were incubated at 4°C at a ratio of 1:2000 using 5% skim milk powder dissolved in TBST. The reaction was carried out overnight. After reaction, the secondary mouse HRP antibody was diluted in 5% skim milk powder at a ratio of 1:5000 and reacted at room temperature for 1 hour. The signal was amplified using an ECL solution, sensitized to film, and developed to confirm changes in protein expression levels.

As a result of confirming changes in the expression patterns of ATF3 and PD-L1 due to inhibition of IGSF1 expression in lung cancer cell lines NCI-H838 and NCI-H358, it was confirmed at the mRNA and protein levels that the expression of ATF3 and PD-L1 increased when IGSF1 expression was inhibited. (Figure 5b).

Example 5.3. Analysis of expression patterns of ATF3 and PD-L1 according to IGSF1 overexpression

To analyze changes in the expression patterns of ATF3 and PD-L1 due to IGSF1 O/E (over expression) in NCI-H292 cells, a lung cancer cell line, reverse transcription-polymerase chain reaction (RT-PCR) and Western blot was performed.

As a result of confirming changes in the expression patterns of ATF3 and PD-L1 according to IGSF1 overexpression in the H292 lung cancer cell line, it was confirmed that the expression of ATF3 and PD-L1 was decreased at the mRNA and protein levels when IGSF1 was overexpressed (Figure 5c).

Example 6. IGSF1 protein identification according to PD-L1 expression amount

IGSF1 protein was identified using TMT labeling LC/MS in lung cancer cell lines with different levels of PD-L1 expression.

Specifically, membrane proteins from human non-small cell lung cancer cell lines, NCI-H358 cell line with high PD-L1 expression and NCI-H838 cell line with low PD-L1 expression, were extracted using the Subcellular Protein Fractionation Kit (Thermo Scientific, 78840). Quantity of extracted protein was measured using Bradford assay (Bio-Rad, 5000001). 50 μg of each protein was reacted with 10 mM Tris(2-carboxyethyl)phosphine (TCEP) at 55°C for 1 hour, 18.75 mM iodoacetamide for 30 minutes at room temperature, and then precipitated with acetone overnight at -20°C. . The protein pellet precipitated with acetone was dissolved in 50 mM triethylammonium bicarbonate (TEAB), 2.5 μg of trypsin (1:40) per 100 μg of protein was added, and the protein was cleaved overnight at 37°C to peptide. TMT-labeling was performed using the TMTsixplex ^TM labeling reagent set (Thermo Scientific, 90066), and the protocol was performed according to the manufacturer's specifications. Mass spectrometry and protein identification Mass spectrometry was performed using an LTQ-Orbitrap Hybrid FT-ETD mass spectrometer (Thermo Scientific). Raw data was analyzed using IP2 software (Integrated Proteomics Pipeline), and protein ID and quantification were confirmed as peptides in the UniProt human database using the search engine provided by IP2. Afterwards, the membrane proteins expressed in NCI-H358 were quantitatively compared with those expressed in NCI-H838, and membrane proteins expressed more in NCI-H838 than in NCI-H358 were classified using a volcano plot.

As a result of classifying the identified quantified proteins using a volcano plot as shown in Figure 6, 27 types of membrane proteins (indicated by circles in the upper right corner) that were significantly more expressed in NCI-H838 were classified, and among these proteins, IGSF1 was identified.

Claims (11)

1. A biomarker composition for predicting susceptibility to anti-IGSF1 antibodies in cancer patients, comprising an agent capable of measuring the expression level of PD-L1 protein or the gene encoding it.
2. According to paragraph 1,

   Agents that can measure the expression level of the protein include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, ligands, and PNA ( A biomarker composition selected from the group consisting of peptide nucleic acid, aptamer, and nanoparticle.
3. According to paragraph 1,

   The agent capable of measuring the expression level of the gene encoding the protein is selected from the group consisting of a primer pair, a probe, and an antisense nucleotide that specifically binds to the gene, Biomarker composition.
4. According to paragraph 1,

   A biomarker composition in which the cancer overexpresses the IGSF1 protein or the gene encoding it.
5. According to paragraph 1,

   The cancer consists of stomach cancer, liver cancer, lung cancer, colon cancer, breast cancer, prostate cancer, ovarian cancer, pancreas cancer, cervical cancer, thyroid cancer, laryngeal cancer, acute myeloid leukemia, brain tumor, neuroblastoma, retinoblastoma, head and neck cancer, salivary gland cancer, and lymphoma. A biomarker composition selected from the group.
6. A kit for predicting susceptibility of a cancer patient to an anti-IGSF1 antibody, comprising the biomarker composition according to any one of claims 1 to 5.
7. Comprising the step of measuring the expression level of PD-L1 protein or the gene encoding it in a biological sample obtained from the individual,

   A method that provides the information needed to predict susceptibility to anti-IGSF1 antibodies in cancer patients.
8. In clause 7,

   When the expression level of the PD-L1 protein or the gene encoding it is lower than the reference value, it additionally includes the step of predicting sensitivity to an anticancer agent containing an anti-IGSF1 antibody, providing information method.
9. In clause 7,

   A method of providing information, wherein the cancer is one in which the IGSF1 protein or the gene encoding it is overexpressed.
10. In clause 7,

    The cancer consists of stomach cancer, liver cancer, lung cancer, colon cancer, breast cancer, prostate cancer, ovarian cancer, pancreas cancer, cervical cancer, thyroid cancer, laryngeal cancer, acute myeloid leukemia, brain tumor, neuroblastoma, retinoblastoma, head and neck cancer, salivary gland cancer, and lymphoma. A biomarker composition selected from the group.
11. Including the step of selecting individuals with low expression levels of the PD-L1 protein or the gene encoding it,

    Method for selecting cancer patients suitable for treatment with anti-IGSF1 antibodies.

Images