WO2023210233A1

WO2023210233A1 - Sugar-linked polynucleotide

Info

Publication number: WO2023210233A1
Application number: PCT/JP2023/012164
Authority: WO
Inventors: 哲也兒玉; 義大百相; 永士三森; 春彦鎌田; 泰亮中山
Original assignee: 国立大学法人東海国立大学機構; 国立研究開発法人医薬基盤・健康・栄養研究所
Priority date: 2022-04-27
Filing date: 2023-03-27
Publication date: 2023-11-02

Abstract

The present invention addresses the problem of providing a technique for effectively exerting the activity of a polynucleotide in the brain. The problem is solved by a compound represented by general formula (1) [In the formula, Ms represents a monovalent group obtained by removing one atom or group from a monosaccharide. Lk represents a divalent group that is a linker. Pn represents a monovalent group obtained by removing one atom or group from a polynucleotide.], or a salt thereof, or solvates thereof.

Description

sugar-linked polynucleotide

The present invention relates to compound-linked polynucleotides and the like.

In recent years, much attention has been focused on nucleic acid medicines that aim to control the expression of genes that cause diseases and achieve their treatment and prevention. Nucleic acid medicines are classified into various types based on their mechanisms of action and the structure of the nucleic acid that serves as their active ingredient. Most of them have the characteristic that they can control the expression of the target gene in a sequence-specific manner. Therefore, it is expected that this will lead to new treatments for many intractable diseases for which no effective treatments have been found.

Because there is a blood-brain barrier in the brain, nucleic acid drugs usually cannot pass through it. Therefore, there is a need for a technology that allows nucleic acid drugs to effectively exert their activity in the brain. Patent Document 1 reports a technique for transporting drugs such as nucleic acids into micelles modified with glucose and aspartic acid within brain cells. However, when used as a pharmaceutical, a great deal of effort is required to control quality such as particle size distribution, micelle morphology, surface charge, thermodynamic properties of the membrane, and encapsulation rate of active ingredients.

International Publication No. 2017/002979

An object of the present invention is to provide a technique for effectively exerting the activity of polynucleotides in the brain.

As a result of intensive research in view of the above problems, the present inventor discovered that by linking a monosaccharide to a polynucleotide via a linker, the activity of the polynucleotide can be effectively exerted in the brain. Ta. The present inventor conducted further research based on this knowledge and completed the present invention. That is, the present invention includes the following aspects.

Item 1. General formula (1):

[In the formula: Ms represents a monovalent group obtained by removing one atom or group from a monosaccharide. Lk represents a divalent group that is a linker. Pn represents a monovalent group obtained by removing one atom or group from a polynucleotide. ]
A compound represented by: or a salt thereof or a solvate thereof.

Section 2. Item 2. The compound, a salt thereof, or a solvate thereof according to item 1, wherein the monosaccharide is a ligand for glucose transporter 1.

Section 3. Item 3. The compound, salt thereof, or solvate thereof according to item 1 or 2, wherein the monosaccharide is a hexose.

Section 4. Item 3. The compound, a salt thereof, or a solvate thereof according to Item 3, wherein Ms is a monovalent group obtained by removing a hydrogen atom from the hydroxyl group at the 4th or 6th position of the monosaccharide.

Section 5. The compound or a salt thereof according to any one of Items 1 to 4, wherein the linker is a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a hetero atom and/or a linking structure, or a salt thereof. solvates of.

Section 6. Item 6. The compound or a salt thereof, or a solvate thereof according to Item 5, wherein the linked structure includes a linked structure containing a triazole ring and/or a linked structure containing an amide bond.

Section 7. The compound, salt thereof, or solvate thereof according to any one of Items 1 to 6, wherein the number of atoms constituting the main chain of Lk is 6 or more.

Section 8. Item 8. The compound, salt thereof, or solvate thereof according to any one of Items 1 to 7, wherein the Pn is a monovalent group obtained by removing one atom or group from the terminal nucleotide of the polynucleotide.

Section 9. Item 8. The compound, salt thereof, or solvate thereof according to any one of items 1 to 8, wherein the Pn is a monovalent group obtained by removing one hydrogen atom from the phosphate group of the terminal nucleotide of the polynucleotide. .

Section 10. Any one of Items 1 to 9, wherein the polynucleotide is an antisense polynucleotide, siRNA, miRNA, miRNA precursor, aptamer, guide RNA, mRNA, DNA (antigene nucleic acid), or a DNA/RNA heteroduplex. The described compounds or salts thereof or solvates thereof.

Section 11. A medicament containing the compound according to any one of Items 1 to 10, a salt thereof, or a solvate thereof.

Section 12. The medicament according to item 11, which is for brain delivery.

Section 13. A reagent containing the compound according to any one of Items 1 to 10, a salt thereof, or a solvate thereof.

According to the present invention, it is possible to provide a technique for effectively exerting the activity of polynucleotides in the brain. Specifically, sugar-linked polynucleotides having a specific structure can be provided.

2 shows the measurement results of Malat1 expression level in the brain in Example 6. The vertical axis shows the relative value of Malat1 expression level. The horizontal axis shows the administered samples. ** indicates that the p value for saline is less than 0.01 when Tukey's test is performed. ‡ indicates that the p-value for naked ASO is less than 0.01 when performing the Tukey test. 2 shows the measurement results of Malat1 expression level in the brain in Example 7. The vertical axis shows the relative value of Malat1 expression level. The horizontal axis shows the administered samples. The numbers on the horizontal axis indicate the amount of ASO administered (unit: μg). * indicates that the p-value for naketASO is less than 0.05 when performing the Tukey test. 2 shows the measurement results of Malat1 expression level in the brain in Example 8. The vertical axis shows the relative value of Malat1 expression level. The horizontal axis shows the administered samples. ** indicates that the p value for saline is less than 0.01 when Tukey's test is performed. 2 shows the measurement results of Malat1 expression level in the brain of Example 10. The vertical axis shows the relative value of Malat1 expression level. The horizontal axis shows the administered samples. * and ** indicate that the p value for saline is less than 0.05 and less than 0.01 when Tukey's test is performed. ‡ indicates that the p-value for naked ASO2 is less than 0.01 when performing the Tukey test. The measurement results of Malat1 expression level in each tissue (horizontal axis) of Example 11 are shown. The vertical axis shows the relative value of Malat1 expression level. Conjugate ASO administered is shown at the top of the graph. 2 shows the measurement results of Malat1 expression level in the brain of Example 12. The vertical axis shows the relative value of Malat1 expression level. The horizontal axis shows the administered samples. ** indicates that the p value for saline is less than 0.01 when Tukey's test is performed. # indicates that the p-value for Naked ASO is less than 0.05 when performing the Tukey test. 1 shows the measurement results of Malat1 expression level in the brain of Example X. The vertical axis shows the relative value of Malat1 expression level. The horizontal axis shows the administered samples.

In this specification, the expressions "contain" and "comprising" include the concepts of "containing", "containing", "consisting essentially" and "consisting only".

1. Sugar-linked polynucleotide In one embodiment of the present invention, the general formula (1):

The compound represented by (herein sometimes referred to as the "sugar-linked polynucleotide of the present invention") or a salt thereof or a solvate thereof (these are collectively referred to herein as the "sugar-linked polynucleotide of the present invention") (sometimes referred to as "active ingredients of"). This will be explained below.

In the general formula (1), Ms represents a monovalent group obtained by removing one atom or group from a monosaccharide.

Preferably, the monosaccharide is a glucose transporter 1 ligand. The gene for glucose transporter 1 is, for example, the gene with NCBI Gene ID: 6513 (SLC2A1 gene) in humans, and is known in other animals or has been analyzed for sequence identity with known animal genes. can be easily identified based on Therefore, the amino acid sequence and coding sequence of glucose transporter 1 can be easily obtained according to known information.

"A ligand for glucose transporter 1" refers to a molecule that binds to glucose transporter 1 expressed on the cell membrane and is transported into the cell via the glucose transporter 1, and is not particularly limited as long as it is a molecule. . Whether it is a ligand or not is determined based on known information or according to a known method (for example, Document 1: Life Sci Alliance. 2021 Feb 3;4(4):e202000858. doi: 10.26508/lsa.202000858. Print 2021 Apr., Reference 2: J Dairy Sci. 2012 Mar;95(3):1188-97. doi: 10.3168/jds.2011-4430., Reference 3: Biochemistry. 1992 Oct 27;31(42):10414-20 doi: 10.1021/bi00157a032.).

The monosaccharide is particularly preferably a hexose from the viewpoint of its function as a ligand for glucose transporter 1. Examples of hexoses include glucose, mannose, galactose, N-acetylglucosamine, fructose, allose, talose, gulose, altrose, idose, psicose, sorbose, tagatose, and the like. Further, these may be either D-form or L-form, but D-form is particularly preferred. In addition, some of the hydroxy groups may be reduced and replaced with hydrogen atoms, or some of the hydroxy groups may be protected with known protecting groups (for example, alkyl groups), or even if some of the hydroxy groups are protected with known protecting groups (for example, alkyl groups), sulfate groups, etc. It may be substituted with a functional group or a halogen atom. Such derivatives include, for example, 2-deoxy-glucose, 3-O-alkyl-glucose (e.g. 3-O-methyl-glucose), 1-O-alkyl-glucose (e.g. 1-O-nonyl-glucose), Examples include 1-deoxy-1-fluoro-glucose. Among these, preferred are glucose, mannose, galactose, and glucosamine, and particularly preferred is glucose, from the viewpoint of the function as a ligand for glucose transporter 1.

In Ms, the atoms removed from the monosaccharide typically include the hydrogen atom within the hydroxy group. Furthermore, examples of groups removed from monosaccharides include hydroxy groups. Ms is preferably a monovalent group formed by removing a hydrogen atom from a hydroxyl group of a monosaccharide. When the monosaccharide is a hexose, Ms is preferably a monovalent group obtained by removing a hydrogen atom from the hydroxyl group at the 2nd, 3rd, 4th, or 6th position of the monosaccharide, and particularly preferably is a monovalent group formed by removing a hydrogen atom from the 4- or 6-position hydroxyl group of a monosaccharide.

In a more specific embodiment, Ms is preferably general formula (M1) or general formula (M2):

[In the formula: R ^m1 , R ^m2 and R ^m3 are the same or different and represent a hydroxy group, an optionally substituted alkoxy group, a halogen atom, or a hydrogen atom. ]
A monovalent group represented by formula (M1) is particularly preferred.

Alkoxy groups include both linear and branched groups. The alkoxy group is preferably linear. The number of carbon atoms in the alkoxy group is not particularly limited, and is, for example, from 1 to 15, preferably from 1 to 12, more preferably from 1 to 10, still more preferably from 1 to 6, particularly preferably from 1 to 4. Specific examples of the alkoxy group include methoxy group, ethoxy group, n-propoxy group, isopropoxy group, n-butoxy group, isobutoxy group, sec-butoxy group, tert-butoxy group, pentoxy group, hexoxy group, octoxy group, Examples include nonoxy group. The alkoxy group may be substituted with a halogen atom such as a fluorine atom, chlorine atom, bromine atom, or iodine atom.

The halogen atom is not particularly limited and includes, for example, a fluorine atom, a chlorine atom, a bromine atom, an iodine atom, and the like. Among these, fluorine atoms are particularly preferred.

At least one of R ^m1 , R ^m2 and R ^m3 is preferably a hydroxy group, and more preferably at least two are hydroxy groups. It is particularly preferred that R ^m1 , R ^m2 and R ^m3 are all hydroxy groups.

In a more specific embodiment, general formula (M1) or general formula (M2) is preferably general formula (M1a) or general formula (M2a):

[In general formula (M1) and general formula (M2): R ^m1 , R ^m2 and R ^m3 are the same as above. ].

In general formula (1), Lk represents a divalent group that is a linker.

The linker is not particularly limited as long as it is interposed between Ms and Pn and has a structure that allows flexible operation. The linker may consist of only a chain structure or may include a chain structure and a ring structure. Further, the chain structure may be linear or branched. When the chain structure is branched, monosaccharides may be linked in the branched chain, and in this case, two or more monosaccharides are linked to the sugar-linked polynucleotide of the present invention. In this case, general formula (1) is, for example, general formula (1A):

can be. Lk ^a and LK ^b each have the same definition as LK. p is, for example, 2-10, 2-5, 2-4, 2-3, or 3.

More specifically, the linker is preferably a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a heteroatom and/or a linking structure. When at least one carbon atom constituting the main chain is replaced by a heteroatom and/or a linked structure, the number of replaced carbon atoms is, for example, 1 to 5, preferably 1 to 3, more preferably 1 to 3. It is 2.

Preferably, the hydrocarbon chain is an alkylene group. The alkylene group can be either linear or branched, but is preferably linear. The number of carbon atoms constituting the main chain of the alkylene group (the chain connecting Ms and Pn) is preferably 6 or more from the viewpoint of the activity of the polynucleotide in the brain. The number of carbon atoms is more preferably 6 to 40, still more preferably 8 to 30, even more preferably 10 to 20.

Examples of the heteroatom include an oxygen atom, a sulfur atom, and a nitrogen atom. When at least one carbon atom constituting the main chain of the alkylene group is replaced with an oxygen atom, specifically, -CH ₂ - in the main chain of the alkylene group is replaced with, for example, -O-. When at least one carbon atom constituting the main chain of the alkylene group is replaced with a sulfur atom, specifically, -CH ₂ - in the main chain of the alkylene group is replaced with -S-, -S(=O) ₂ -, for example. , -S(=O)-, etc. When at least one carbon atom constituting the main chain of the alkylene group is replaced with a nitrogen atom, specifically, -CH ₂ - in the main chain of the alkylene group is replaced with -NR- (R is a hydrogen atom or a hydrocarbon group). (preferably an alkyl group, more preferably an alkyl group having 1 to 8 carbon atoms).

The connecting structure is not particularly limited as long as it is a divalent group that is a bonding structure formed by the reaction of two identical or different reactive groups. Examples of the reactive group include an amino group, a carboxy group, a hydroxy group, a ketone group, an ethynyl group, a vinyl group, an azide group, an epoxy group, an aldehyde group, an oxylamino group, a thiol group, an isocyanate group, an isothiocyanate group, etc. It will be done.

Examples of reactions between reactive groups are:
It is known that an amino group reacts with a carboxy group (or a group formed by esterifying a carboxy group with N-hydroxysuccinimide (NHS)) to form an amide bond. It is known that an ethynyl group forms a 1,2,3-triazole ring through a 1,3-dipolar cycloaddition reaction with an azide group. Cyclooctyne is known to form a 1,2,3-triazole ring through a 1,3-dipolar cycloaddition reaction with an azide group. Amino groups react with carboxy groups to form amide bonds. Carboxy groups are known to react with hydroxy groups to form ester bonds. Carboxy groups are known to react with thiol groups to form thioester bonds. Phosphate groups are known to react with hydroxy groups to form phosphodiester bonds. Vinyl groups react with thiol groups to form bonds. Epoxy groups react with amino groups and thiol groups to form bonds. Aldehyde groups react with amino groups to form Schiff bases, which upon reduction form bonds. Oxylamino groups react with ketone groups and aldehyde groups to form oximes.

In one aspect of the present invention, the linked structure includes a linked structure containing a triazole ring, a linked structure containing an amide bond, a linked structure containing (3-thio)succinimide, a disulfide bond, a phosphodiester bond, and an intracellularly cleaved peptide. It can contain at least one type of connecting structure selected from the group consisting of connecting bonds. In one embodiment of the present invention, the linked structure can include a linked structure containing a triazole ring and/or a linked structure containing an amide bond. More specifically, the connected structure containing a triazole ring is, for example, a 1,2,3-triazole ring, or a fused ring of a 1,2,3-triazole ring and another ring (for example, a 3- to 8-membered ring). (e.g. 2 or 3 rings). More specifically, the fused ring has, for example, the formula (Cy):

can be. Specifically, the linking structure containing an amide bond can be, for example, an amide bond (-CO-NR-) or -O-CO-NR- (R is the same as above).

In a more specific embodiment, Lk preferably represents the general formula (L1):

[In the formula: R ^l1 and R ^l2 are the same or different and represent a single bond or a connected structure. R ^l3 and R ^l5 are the same or different and represent a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a heteroatom. R ^l4 represents a single bond or a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a heteroatom. *1 is a site that connects with Ms, and *2 is a site that connects with Pn. ]
It is a divalent group represented by

The hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a heteroatom can include a biodegradable structure. Examples of the biodegradable structure include a peptide structure containing a peptidase recognition cleavage sequence (eg, Val-Ala, etc.), a disulfide bond, and the like.

In one embodiment of the present invention, R ^l1 is a linked structure containing a triazole ring, and R ^l2 is a linked structure containing an amide bond. In another embodiment of the present invention, R ^l1 and R ^l4 are single bonds, and R ^l2 is a linked structure containing an amide bond.

In a preferred embodiment of the present invention, the number of atoms constituting the main chain of R ^l3 and R ^l5 is 3 to 10, more preferably 4 to 8, particularly preferably 5 to 7. In a preferred embodiment of the invention, R ^l3 and R ^l5 are hydrocarbon chains, more preferably alkylene groups, particularly preferably linear alkylene groups. In these preferred embodiments, the activity of the polynucleotide in the brain can be significantly exhibited.

In general formula (1), Pn represents a monovalent group obtained by removing one atom or group from a polynucleotide.

The polynucleotide is not particularly limited, and in addition to DNA, RNA, etc., it may also be subjected to known chemical modifications, as exemplified below. To prevent degradation by hydrolytic enzymes such as nucleases, the phosphate residues of each nucleotide are replaced with chemically modified phosphate residues such as phosphorothioate (PS), methylphosphonate, phosphorodithionate, etc. I can do it. In addition, the hydroxyl group at the 2-position of the sugar (ribose) of each ribonucleotide is replaced by -OR (R is, for example, CH3 (2´-O-Me), CH2CH2OCH3 (2´-O-MOE), CH2CH2NHC(NH)NH2, CH2CONHCH3, CH2CH2CN, etc.) may be substituted. Furthermore, the base moiety (pyrimidine, purine) may be chemically modified, such as introducing a methyl group or cationic functional group to the 5-position of the pyrimidine base, or replacing the carbonyl group at the 2-position with thiocarbonyl. can be mentioned. Further examples include, but are not limited to, those in which the phosphoric acid moiety or hydroxyl moiety is modified with biotin, an amino group, a lower alkylamine group, an acetyl group, or the like. In addition, BNA (LNA), etc., in which the conformation of the sugar moiety of the nucleotide is fixed to N-type by cross-linking the 2' oxygen and 4' carbon of the sugar moiety, can also be preferably used.

The nucleobases that make up polynucleotides include typical bases found in natural nucleic acids such as RNA and DNA (adenine (A), thymine (T), uracil (U), guanine (G), cytosine (C), etc.) In addition, bases other than these, such as hypoxanthine (I) and modified bases, are also included. Examples of the modified base include pseudouracil, 3-methyluracil, dihydrouracil, 5-alkylcytosine (e.g., 5-methylcytosine), 5-alkyluracil (e.g., 5-ethyluracil), 5-halouracil (5- Bromouracil), 6-azapyrimidine, 6-alkylpyrimidine (6-methyluracil), 4-acetylcytosine, 5-(carboxyhydroxymethyl)uracil, 5'-carboxymethylaminomethyl-2-thiouracil, 5-carboxymethyl Aminomethyluracil, 1-methyladenine, 1-methylhypoxanthine, 2,2-dimethylguanine, 3-methylcytosine, 2-methyladenine, 2-methylguanine, N6-methyladenine, 7-methylguanine, 5-methoxy Aminomethyl-2-thiouracil, 5-methylaminomethyluracil, 5-methylcarbonylmethyluracil, 5-methyloxyuracil, 5-methyl-2-thiouracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxy Examples include acetic acid, 2-thiocytosine, purine, 2-aminopurine, isoguanine, indole, imidazole, xanthine, and the like.

The polynucleotide may be linked with other molecules or modified with a radioactive isotope. Other molecules include, for example, fluorescent labels. Examples of fluorescent labels include fluorescein, rhodamine, Texas red, tetramethylrhodamine, carboxyrhodamine, phycoerythrin, 6-FAM (trademark), Cy (registered trademark) 3, Cy (registered trademark) 5, Alexa Fluor (registered trademark) ) series, etc. The position of linkage/modification is not particularly limited, and can be, for example, at the end of the polynucleotide.

A polynucleotide can be a single-stranded polynucleotide or a double-stranded polynucleotide.

The polynucleotide is, for example, a polynucleotide of 8 to 50 bases consisting of a sequence capable of binding to a target sequence in a target gene. The length of the polynucleotide is, for example, 8 bases or more, 9 bases or more, 10 bases or more, 11 bases or more, 12 bases or more, 13 bases or more, 14 bases or more, or 15 bases or more, and 500 bases or less, 200 bases or more The length is 100 bases or less, 50 bases or less, 40 bases or less, 30 bases or less, 25 bases or less, or 20 bases or less.

In the present invention, when the polynucleotide is a double-stranded polynucleotide, the second strand consists of a sequence capable of binding to the polynucleotide, which is the first strand, which consists of a sequence capable of binding to a target sequence in a target gene. It is a polynucleotide. This second strand may be, for example, between 8 and 500 bases, at least 8 bases, at least 9 bases, at least 10 bases, at least 11 bases, at least 12 bases, at least 13 bases, at least 14 bases, or at least 15 bases; The length is less than or equal to a base, 200 bases or less, 100 bases or less, 60 bases or less, 50 bases or less, 40 bases or less, 30 bases or less, 25 bases or less, or 20 bases or less. The length of the second strand may be the same length as the first strand, or one or more bases shorter than the first strand, so long as it binds to the first strand, or The length of the second strand may be longer than the first strand by adding one or several bases to one or both sides of the site that binds to the first strand. In this specification, "one or several bases" means 1 to 10 bases, 1 to 5 bases, 1 to 3 bases, and 1 or 2 bases. The preferred length of the second strand depends on the length of the first strand. For example, the length of the first strand is 50% or more, 60% or more, 70% or more, 50 to 100%, 60 to 100%, 70 ~100% length.

A polynucleotide "binding" to a target sequence means that a plurality of different single-stranded polynucleotides or nucleic acids can form a double-stranded or more stranded nucleic acid due to nucleobase complementarity. Preferably, it means that a double-stranded nucleic acid can be formed. The melting temperature (Tm) of a double-stranded or more stranded nucleic acid, which is an indicator of the thermal stability of the bond, is not particularly limited.

The melting temperature (Tm) of double-stranded nucleic acids can be determined, for example, as follows:
Polynucleotide and target RNA were mixed equimolarly in buffer (8.1mM Na ₂ HPO ₄ , 2.68mM KCl, 1.47mM KH ₂ PO ₄ , and pH 7.2) and incubated at 95°C for 5 minutes. After heating, the mixture is slowly cooled to room temperature and annealed to form double-stranded nucleic acids. When the temperature of double-stranded nucleic acid is heated from 20℃ to 95℃ at a heating rate of 0.5℃/min, the change in absorbance (A) at 260nm due to temperature (T) is measured, and from this measurement result, dA/ A graph of dTvsT is created, and the temperature at which the value of dA/dT is the largest in this graph, that is, the temperature at which the change in A due to T is the largest, is set as the Tm of the double-stranded nucleic acid.

The melting temperature (Tm) is, for example, 40°C or higher, preferably 50°C or higher.

As used herein, "complementary" refers to a pairing relationship in which two different single-stranded polynucleotides or nucleic acids can form a double-stranded nucleic acid. Preferably, the base sequences of the double-stranded regions have complete complementarity, but as long as the double-stranded nucleic acid can be formed and the desired function (for example, expression suppression or regulation) can be exerted, one Or it may have several mismatches. One or several mismatches may depend on the length of the polynucleotide, but means 1 to 4, preferably 1 to 3, more preferably 1 or 2 mismatches. The polynucleotide preferably has a complementarity of 80% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, or 99% or more to the base sequence of the region forming a double strand. or may be completely (100%) complementary.

The polynucleotide is preferably one whose main purpose is to be introduced into cells and used. Examples of polynucleotides for such purposes include antisense polynucleotides, siRNAs, miRNAs, miRNA precursors, aptamers, guide RNAs, mRNAs, DNA (antigene nucleic acids), or DNA/RNA heteroduplexes. etc.

In Pn, the atom removed from the polynucleotide typically includes a hydrogen atom within a phosphate group or a hydroxyl group. Furthermore, in Pn, examples of the group removed from the polynucleotide include a phosphate group, a hydroxy group, and the like.

Pn is preferably a monovalent group obtained by removing one atom or group from the terminal nucleotide of the polynucleotide, particularly preferably one hydrogen atom removed from the phosphate group of the terminal nucleotide of the polynucleotide. It is a monovalent group. Although the terminus can be either the 5' terminus or the 3' terminus, the 5' terminus is preferred from the viewpoint of the activity of the polynucleotide in the brain.

In a more specific embodiment, Pn preferably has the general formula (P1):

[In the formula: R ^p1 represents a monovalent group obtained by removing the phosphate group from the terminal nucleotide of the polynucleotide. ]
R ^p1 is preferably a monovalent group obtained by removing the phosphate group from the 5' terminal nucleotide of the polynucleotide.

Salts of the sugar-linked polynucleotide of the present invention are not particularly limited, and include, for example, alkali metal salts such as sodium salts, potassium salts, and lithium salts, alkaline earth metal salts such as calcium salts and magnesium salts, and aluminum salts. , metal salts such as iron salts, zinc salts, copper salts, nickel salts, cobalt salts; inorganic salts such as ammonium salts, t-octylamine salts, dibenzylamine salts, morpholine salts, glucosamine salts, phenylglycine alkyl ester salts , ethylenediamine salt, N-methylglucamine salt, guanidine salt, diethylamine salt, triethylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, chloroprocaine salt, procaine salt, diethanolamine salt, N-benzyl-phenethylamine salt Amine salts such as organic salts such as , piperazine salts, tetramethylammonium salts, tris(hydroxymethyl)aminomethane salts; such as hydrofluorides, hydrochlorides, hydrobromides, hydroiodides Inorganic acid salts such as hydrohalides, nitrates, perchlorates, sulfates, and phosphates; lower alkanesulfonates such as methanesulfonates, trifluoromethanesulfonates, and ethanesulfonates; Aryl sulfonates such as benzenesulfonate, p-toluenesulfonate, acetate, malate, fumarate, succinate, citrate, tartrate, oxalate, maleate, etc. Organic acid salts; and glycine salts, lysine salts, arginine salts, ornithine salts, glutamic acid salts,
Amino acid salts such as aspartate may be mentioned.

Solvates of the sugar-linked polynucleotides of the present invention or salts thereof are not particularly limited, and include, for example, solvates with solvents such as water, ethanol, glycerol, and acetic acid.

The sugar-linked polynucleotide of the present invention can be synthesized by various methods. The sugar-linked polynucleotide of the present invention can be synthesized, for example, according to the scheme below.

[In the formula: Ms, Lk, and Pn are the same as above. Lk ¹ and Lk ² are the same or different and represent a divalent group that is a linker. Y ¹ and Y ² are the same or different and represent a reactive group. ]

As for the explanation of the linker represented by Lk ¹ or Lk ² , the above-mentioned explanation of the linker is used. As for the description of the reactive group represented by Y ¹ or Y ² , the above-mentioned description of the reactive group is used.

The compound represented by the general formula (a) and the compound represented by the general formula (b) can be commercially available, or can be synthesized according to a known method.

The reaction conditions can be set according to known information depending on the type of reactive group. As an example, the reaction conditions of Example 1 and Example 4 described below can be referred to.

Progress of the reaction can be followed by conventional methods such as chromatography. After the reaction is completed, the solvent is distilled off, and the product can be isolated and purified by a conventional method such as chromatography or recrystallization. Furthermore, the structure of the product can be identified by MALDI-TOF-MS, elemental analysis, MS (ESI-MS) analysis, IR analysis, ¹ H-NMR, ¹³ C-NMR, etc.

2. Uses The sugar-linked polynucleotide of the present invention, its salt, or a solvate thereof (the active ingredient of the present invention) increases the activity of the polynucleotide in the brain even when used alone without forming a complex with other substances. can be demonstrated effectively. The activity of a polynucleotide refers to the physiological activity possessed by the polynucleotide, specifically, for example, the activity of suppressing the expression of a target gene, the function of a target nucleic acid (e.g. miRNA, mRNA, or their precursor, etc.) (the expression of a target gene) and function-suppressing activity of a target molecule (for example, aptamer target molecule).

The active ingredient of the present invention can be used for various purposes, such as for brain delivery (preferably for delivery into brain cells), pharmaceuticals, reagents, etc. (hereinafter collectively referred to as these). (Sometimes referred to as "the agent of the present invention").

The agent of the present invention is not particularly limited as long as it contains the active ingredient of the present invention, and may further contain other ingredients as necessary. Other ingredients are not particularly limited as long as they are pharmaceutically acceptable ingredients, such as excipients, binders, disintegrants, lubricants, colorants, flavorings, and if necessary. Stabilizers, emulsifiers, absorption enhancers, surfactants, pH adjusters, preservatives, antioxidants, bulking agents, wetting agents, surface activators, dispersants, buffers, preservatives, solubilizing agents, Examples include pain-relieving agents.

The mode of use of the agent of the present invention is not particularly limited, and an appropriate mode of use can be adopted depending on the type thereof. The agent of the present invention can be used, for example, in vitro (eg, added to the culture medium of cultured cells) or in vivo (eg, administered to animals).

The subject to which the agent of the present invention can be applied is not particularly limited, and includes, for example, various mammals such as humans, monkeys, mice, rats, dogs, cats, and rabbits; animal cells, etc. The type of cells is not particularly limited, and examples include nerve cells such as cone cells, astrocytes, granule cells, retinal ganglion cells, and Purkinje cells; microglia, astrocytes, oligodendrocytes, ependymal cells, Schwann cells, and satellite cells. glial cells such as;

When administering the agent of the present invention to animals, the mode of administration is not particularly limited as long as the desired effect is obtained, and oral administration, parenteral administration (e.g., intravenous injection, intramuscular injection, subcutaneous administration, rectal administration, They can be administered to mammals, including humans, by any route of administration (dermal administration, topical administration). The preferred mode of administration is parenteral administration. Dosage forms for oral and parenteral administration and their manufacturing methods are well known to those skilled in the art, and can be manufactured in accordance with conventional methods by mixing the active ingredient with a pharmaceutically acceptable carrier, etc. can.

Dosage forms for parenteral administration include injectable preparations (e.g., drip injections, intravenous injections, intramuscular injections, subcutaneous injections, intradermal injections), external preparations (e.g., ointments, poultices, lotions). agents, creams, gels), suppositories, inhalants, eye drops, eye ointments, nasal drops, ear drops, and liposomes. For example, an injectable preparation is prepared by dissolving the oligopeptide of the present invention in distilled water for injection, and adding solubilizing agents, buffering agents, pH adjusting agents, isotonic agents, soothing agents, and preservatives as necessary. , a stabilizer, etc. can be added. The medicament of the present invention can also be made into a lyophilized preparation for ex-post preparation.

The agent of the present invention may further contain other drugs effective for treating or preventing diseases. The agent of the present invention may also contain components such as bactericides, anti-inflammatory agents, cell activators, vitamins, and amino acids, as required.

The content of the active ingredient of the present invention in the agent of the present invention depends on the mode of use, the subject to which it is applied, the condition of the subject, etc., and is not limited to, for example, 0.0001 to 95% by weight, preferably 0.001% by weight. ~50% by weight.

The dosage when administering the agent of the present invention to animals is not particularly limited as long as it is an effective amount that exhibits the medicinal effect, and it is generally expressed as the weight of the active ingredient of the present invention, which is the active ingredient, when administered orally. 0.1 to 1000 mg/kg body weight per day, preferably 0.5 to 50 mg/kg body weight per day, and 0.01 to 100 mg/kg body weight per day, preferably 0.1 to 50 mg/kg body weight per day for parenteral administration. 10 mg/kg body weight. The above dosage is preferably administered once a day or divided into 2 to 3 times a day, and can be increased or decreased as appropriate depending on age, pathological condition, and symptoms.

The present invention will be described in detail below based on Examples, but the present invention is not limited to these Examples.

Reference example 1. Synthesis of compound 2

To a solution of glycine ethyl ester hydrochloride (14.0 g, 100 mmol) in water (20 mL) was added dichloromethane (40 mL) and the mixture was stirred at -15 °C. To this stirred mixture was added an ice-cold solution of sodium nitrite (8.28 g, 120 mmol, 1.2 eq.) in water (40 mL), followed by H ₂ SO ₄ (270 μL, 5 mmol, 0.05 eq.). ) in water (9.32 mL) was added over 10 minutes. After further stirring for 1 hour, saturated sodium bicarbonate solution was added at the same temperature to stop the reaction. The mixture was partitioned between dichloromethane and water and the contents were extracted from the aqueous layer twice with dichloromethane. The organic layers were combined, washed with saturated brine, dried over sodium sulfate, and evaporated to give the ethylglycine diazo derivative. 1,5-Cyclooctadiene (86.5 g, 800 mmol, 8eq.) was dissolved in dichloromethane (100 mL) in a separate flask and rhodium(II) acetate dimer (508 mg, 1.15 mmol, 0.0115eq.) was added to the solution at room temperature. To this stirring solution was slowly added a solution of ethylglycine diazo derivative (total volume) in dichloromethane (30 mL) over a period of 2 hours. The volatiles were evaporated and the residue was purified by column chromatography (SiO ₂ , hexane:EtOAc=50:1) to obtain compound 2 (16.09 g, 82.8 mmol, 83%) as a colorless oil. The diastereomers did not separate from each other and were used as such in the next step.
¹ H NMR (400 MHz, CDCl ₃ ) δ 5.57-5.66 (m, 2H), 4.07-4.14 (m, 2H), 2.50 (tt, J = 11.6, 3.9 Hz, 1H), 2.25-2.34 (m, 1H) ), 2.16-2.24 (m, 2H), 2.01-2.12 (m, 2H), 1.78-1.87 (m, 1H), 1.36-1.59 (m, 3H), 1.26 (tt, J = 7.1, 2.6 Hz, 3H ), 1.18 (t, J = 4.6 Hz, 1H). The NMR spectrum of the compound was consistent with the reported one.

Reference example 2. Synthesis of compound 3

To a stirred suspension of lithium aluminum hydride (3.14 g, 82.8 mmol, 1.0 eq.) in diethyl ether (200 mL) on an ice bath was added compound 2 (16.1 g, 82.8 mmol) in diethyl ether (300 mL). ) solution was added slowly over 1 hour. After adding water at the same temperature, the resulting mixture was passed through a Celite Pad. The filtrate was evaporated to alcohol. To a stirred solution of the resulting alcohol in dichloromethane (70 mL) was slowly added a solution of bromine (14.5 g, 91.08 mmol, 1.1 eq.) in dichloromethane (70 mL) over 1 hour. After adding saturated sodium bisulfite water, the mixture was separated into dichloromethane and water at the same temperature, and the contents were extracted twice with dichloromethane. The organic layers were combined and washed with saturated sodium hydroxide. Washing with NaCl, drying over sodium sulfate and evaporation gave the dibromo derivative. To a stirred solution of the dibromo derivative in THF (500 mL) on an ice bath was added t-BuOK (1M solution in THF, 248 mL, 248 mmol, 3 eq) over 1 minute and stirred under reflux conditions for 2 hours. After the mixture was cooled to room temperature, saturated aqueous ammonium chloride was added. The resulting mixture was partitioned between dichloromethane and water and the contents were extracted twice with dichloromethane. The organic layers were combined and washed with saturated aqueous solution. Washed with NaCl, dried over sodium sulphate and evaporated. The obtained residue was purified by column chromatography (SiO ₂ , hexane:EtOAc=3:1) to obtain compound 3 (4.73 g, 31.46 mmol, 38% (3 steps)) as a yellow oil. Compound 3 was used in the next step without separation of diastereomers.
¹ H NMR (400 MHz, CDCl ₃ ) δ 4.12 (q, J = 7.2 Hz, 1H), 3.73 (d, J = 7.8 Hz, 1H), 3.55 (t, J = 3.2 Hz, 2H), 2.13-2.44 (m, 10H), 2.05 (s, 1H), 1.30-1.66 (m, 6H), 1.24-1.28 (m, 1H), 0.88-0.99 (m, 1H), 0.64-0.74 (m, 3H). Compound The NMR spectrum of was consistent with the reported one.

Reference example 3. Synthesis of compound 4

4-nitrophenyl chloroformate (7.93 g, 39.3 mmol, 1.25 eq.) was added. After stirring the mixture for 30 minutes, saturated aqueous ammonium chloride was added. The mixture was partitioned between dichloromethane and water, and the organic layer was washed with 1M hydrochloric acid, saturated aqueous sodium bicarbonate, and saturated brine, dried over sodium sulfate, and evaporated. The obtained residue was purified by column chromatography (SiO ₂ , hexane:EtOAc=15:1) to obtain Compound 4 (7.14 g, 22.7 mmol, 72%) as a yellow oil. Compound 4 was used in the next step without separation of diastereomers.
¹ H NMR (400 MHz, CDCl ₃ ) δ 8.29 (d, J = 9.2 Hz, 3H), 7.38-7.41 (m, 3H), 4.41 (d, J = 8.2 Hz, 1H), 4.22 (d, J = 6.4 Hz, 2H), 2.17-2.47 (m, 11H), 1.24-1.62 (m, 6H), 1.02-1.11 (m, 1H), 0.80-0.90 (m, 3H). It matched what was there.

Reference example 4. Synthesis of compound 6

1,6-dibromohexane (7.32 g, 30 mmol, 3eq.) was dissolved in DMSO (60 mL) and stirred at room temperature. To this, sodium azide DMSO solution (0.65 g, 10 mmol, 1 eq., 20 mL) was added dropwise over 10 minutes. 10 minutes after the dropwise addition was completed, the disappearance of the raw material was confirmed by TLC, and the mixture was concentrated under reduced pressure and purified by column chromatography (SiO ₂ , hexane → tetrahydrofuran) to obtain compound 6 (2.01 g, 9.74 mmol, 97%). Obtained as a yellow oil. ¹ H-NMR (400 MHz, CDCl ₃ ) δ 3.42 (t, J = 6.6 Hz, 2H), 3.28 (t, J = 6.9 Hz, 2H), 1.91-1.84 (m, 2H), 1.66-1.57 (m , 3H), 1.52-1.37 (m, 4H). The NMR spectrum of the compound was consistent with the reported one.

Reference example 5. Synthesis of compound 8

After dissolving D-(+)-glucose (1.8 g, 10 mmol, 1eq.) and zinc chloride (2.04 g, 15 mmol, 1.5eq.) in acetone (40 mL), concentrated sulfuric acid (108 μL, 13 mmol, 1.3eq.) was slowly added and stirred at room temperature. After 20 hours, the disappearance of the raw material was confirmed by TLC, and the mixture was neutralized with saturated sodium bicarbonate solution and filtered through Celite. The filtrate was separated using diethyl ether and water, and the organic layer was extracted three times and mixed. The mixed organic layer was dehydrated with saturated brine and sodium sulfate, concentrated under reduced pressure, and purified by column chromatography (SiO ₂ , hexane:ethyl acetate = 2:1) to obtain compound 8 (2.14 g, 8.23 mmol, 82%). was obtained as a white solid. The obtained white solid was recrystallized from a heated hexane-ethyl acetate mixed solvent (4:1) to give colorless fibrous crystals. ¹ H-NMR (400 MHz, CDCl ₃ ) δ 5.95 (d, J = 3.7 Hz, 1H), 4.54-4.52 (m, 1H), 4.39-4.30 (m, 2H), 4.20-4.15 (m, 1H) , 4.07 (dd, J = 7.8, 2.7 Hz, 1H), 3.99 (q, J = 4.6 Hz, 1H), 2.59 (d, J = 3.7 Hz, 1H), 1.65 (s, 1H), 1.50 (s, ^13C -NMR (101 MHz, CDCl ₃ ) δ 111.9, 109.8, 105.4, 85.2, 81.3, 75.2, 73.5, 67.7, 27.0, 26.9, 26.3, 25.3, LRMS (ESI): m/z283 [M+Na] ⁺ . HRMS (ESI-TOF): Calcd for C ₁₂ H ₂₀ O ₆ Na [M+Na] ⁺ : 283.1152, Found: 283.1176.

Reference example 6. Synthesis of compound 9

Compound 8 (520 mg, 2 mmol, 1 eq.) was dissolved in DMF (20 mL) under an argon atmosphere, 60% sodium hydride/mineral oil (160 mg, 4 mmol, 2 eq.) was added, and the mixture was stirred at room temperature. After 10 minutes, tetrabutylammonium iodide (887 mg, 2.4 mmol, 1.2eq.) and compound 6 (495 mg, 2.4 mmol, 1.2eq.) were added. After 16 hours, disappearance of the raw material was confirmed by TLC, and water was added to quench the sodium hydride. Thereafter, separation between ethyl acetate and water was performed, and the organic layer was extracted twice and mixed. The mixed organic layer was dehydrated with saturated saline and sodium sulfate, concentrated under reduced pressure, and purified by column chromatography (SiO ₂ , hexane: ethyl acetate = 10: 1) to obtain compound 9 (503 mg, 1.31 mmol, 65%). was obtained as a white solid. ¹ H-NMR (400 MHz, CDCl ₃ ) δ 5.87 (d, J = 3.7 Hz, 1H), 4.53-4.49 (m, 1H), 4.35-4.27 (m, 1H), 4.13-4.06 (m, 2H) , 3.99 (dd, J = 8.7, 6.0 Hz, 1H), 3.85 (d, J = 3.2 Hz, 1H), 3.64-3.58 (m, 1H), 3.55-3.47 (m, 1H), 3.27 (t, J = 6.9 Hz, 2H), 1.61 (s, 2H), 1.60-1.55 (m, 3H), 1.50 (s, 3H), 1.43 (s, 3H), 1.41-1.37 (m, 4H), 1.35 (s, 3h), 1.32 (D, J = 4.6 Hz, 3h). ¹³ C-NMR (101 MHz, CDCL ₃ ) δ 111.9, 109.0, 105.4, 82.2, 82.3, 72.3, 70.5, 70.5, 67.4, 28.7, 28.9, 28.9 , 27.0, 26.9, 26.6, 26.4, 25.8, 25.6., LRMS (ESI): m/z 408 [M+Na] ⁺ . HRMS (ESI-TOF): Calcd for C ₁₈ H ₃₁ N ₃ O ₆ Na [M +Na] ⁺ : 408.2105, Found: 408.2102.

Reference example 7. Synthesis of compound 10

80% trifluoroacetic acid/water (8 mL) was added to Compound 9 (308 mg, 0.8 mmol, 1 eq.), and the mixture was stirred at room temperature. After 10 minutes, disappearance of the raw material was confirmed by TLC, and the mixture was concentrated under reduced pressure. Thereafter, it was purified by column chromatography (SiO ₂ , ethyl acetate → chloroform:methanol = 10:1) to obtain compound 10 (154 mg, 0.50 mmol, 63%) as a white solid. ¹ H-NMR (400 MHz, DMSO-D6) δ 6.63-6.58 (m, 1H), 6.28 (dd, J = 22.7, 4.8 Hz, 0H), 4.92-4.80 (m, 2H), 4.54-4.45 (m , 1H), 4.38-4.25 (m, 1H), 3.70-3.54 (m, 3H), 3.50-3.35 (m, 1H), 3.24 (q, J = 9.6 Hz, 2H), 3.17-3.05 (m, 2H) ), 2.99-2.91 (m, 1H), 1.54-1.48 (m, 4H), 1.37-1.31 (m, 4H). ¹³ C-NMR (101 MHz, DMSO-D6) δ 96.9, 85.2, 76.7, 74.6, 72.1, 71.8, 69.7, 61.1, 50.6, 29.8, 28.3, 26.1, 25.2, LRMS (ESI): m/z328 [M+Na] ⁺ . HRMS (ESI-TOF): Calcd for C ₁₂ H ₂₃ N ₃ O ₆ Na [M+Na] ⁺ : 328.1479, Found: 328.1479.

Reference example 8. Synthesis of compound 13

Dissolve 6-bromohexanoic acid (1.95 g, 10 mmol, 1eq.) in tetrahydrofuran (20 mL), add t-butyl alcohol (2.85 mL, 30 mmol, 3eq.), trifluoroacetic anhydride (4.16 mL, 30 mmol) , 1eq.) and stirred at room temperature. After 20 hours, disappearance of the weight loss was confirmed by TLC, and liquid separation between ethyl acetate and water was performed. The organic layer was dehydrated with saturated brine and sodium sulfate, and concentrated under reduced pressure to obtain Compound 13 (2.48 g, 9.88 mmol, 99%) as a transparent oil. ¹ H-NMR (400 MHz, CDCl ₃ ) δ 3.40 (q, J = 7.0 Hz, 2H), 2.21 (t, J = 7.3 Hz, 2H), 1.89-1.81 (m, 2H), 1.63-1.55 (m , 2H), 1.48-1.44 (m, 2H), 1.41 (d, J = 7.3 Hz, 8H). The NMR spectrum of the compound was consistent with the reported one.

Reference example 9. Synthesis of compound 14

Compound 8 (260 mg, 1 mmol, 1eq.) was dissolved in DMF (10 mL) under an argon atmosphere, and 60% sodium hydride/mineral oil (60 mg, 80 mmol, 2eq.) was added and stirred at room temperature. . After 10 minutes, tetrabutylammonium iodide (369 mg, 1 mmol, 1 eq.) and compound 13 (251 mg, 1 mmol, 1 eq.) were added. After 24 hours, disappearance of the raw material was confirmed by TLC, and water was added to quench the sodium hydride. Thereafter, separation between ethyl acetate and water was performed. The organic layer was dehydrated with saturated brine and sodium sulfate, concentrated under reduced pressure, and then purified by column chromatography (SiO ₂ , hexane: ethyl acetate = 20: 1) to obtain compound 14 (242 mg, 0.56 mmol, 56%). Obtained as a white solid.
¹ H-NMR (400 MHz, CDCl ₃ ) δ 5.87 (d, J = 3.7 Hz, 1H), 4.57-4.52 (m, 1H), 4.34-4.29 (m, 1H), 4.15-4.06 (m, 2H) , 3.98 (td, J = 7.1, 1.1 Hz, 1H), 3.89-3.84 (m, 1H), 3.63-3.47 (m, 2H), 2.21 (t, J = 7.1 Hz, 2H), 1.59 (td, J 1.51 (d, J = 7.3 Hz, 3H), 1.44 (d, J = 0.9 Hz, 9H), 1.42 (s, 3H), 1.39-1.25 (m, 8H). ¹³ C-NMR (101 MHz, CDCl ₃ ) δ 173.2, 111.8, 109.0, 105.4, 82.7, 82.2, 81.3, 80.1, 72.6, 70.5, 67.4, 35.6, 29.5, 28.2, 27.0, 26.9, 26. 4, 25.7, 25.5, 24.9 , LRMS (ESI): m/z 453 [M+Na] ⁺ . HRMS (ESI-TOF): Calcd for C ₂₂ H ₃₈ O ₈ Na[M+Na] ⁺ : 453.2459, Found: 453.2455.

Reference example 10. Synthesis of compound 15

80% trifluoroacetic acid/water (5 mL) was added to Compound 14 (242 mg, 0.56 mmol, 1 eq.), and the mixture was stirred at room temperature. After 10 minutes, disappearance of the raw material was confirmed by TLC, and the mixture was concentrated under reduced pressure. Thereafter, it was purified by column chromatography (SiO ₂ , ethyl acetate → chloroform:methanol = 10:1) to obtain compound 15 (139 mg, 0.47 mmol, 85%) as a pale pink oil. ¹ H-NMR (400 MHz, CD ₃ OD) δ 5.07 (s, 1H), 4.45 (d, J = 5.5 Hz, 1H), 3.85-3.75 (m, 3H), 3.69-3.61 (m, 1H), 3.51-3.39 (m, 2H), 3.18-3.11 (m, 1H), 2.35-2.28 (m, 2H), 1.63 (t, J = 7.1 Hz, 4H), 1.43 (q, J = 7.3 Hz, 2H) .13C-NMR (101 MHz, CD ₃ OD) δ 177.8, 98.2, 94.1, 83.4, 78.0, 74.0, 73.0, 62.8, 34.9, 31.0, 26.7, 25.9, LRMS (ESI): m/z 317 [M+Na ] ⁺ . HRMS (ESI-TOF): Calcd for C ₁₂ H ₂₂ O ₈ Na[M+Na] ⁺ : 317.1207, Found: 317.1204.

Reference example 11. Synthesis of compound 16

Compound 15 (139 mg, 0.47 mmol, 1eq.) was dissolved in dimethylformamide (5 mL), and NHS (218 mg, 1.89 mmol, 4eq.) and EDC・HCl (109 mg, 0.57 mmol, 1.2eq.) were added. The mixture was added and stirred at room temperature. After 3 hours, the disappearance of the raw material was confirmed by TLC, and after concentration under reduced pressure, it was purified by column chromatography (SiO ₂ , ethyl acetate → chloroform:methanol = 20:1) to obtain compound 16 (101 mg, 0.26 mmol, 54 %) was obtained as a pale pink oil.
¹ H-NMR (400 MHz, DMSO-D6) δ 6.62 (d, J = 6.9 Hz, 1H), 6.31 (d, J = 4.6 Hz, 1H), 4.89-4.81 (m, 2H), 4.53-4.48 ( m, 1H), 4.39-4.26 (m, 1H), 4.10 (q, J = 5.3 Hz, 1H), 3.67-3.50 (m, 4H), 3.47-3.38 (m, 1H), 3.25 (t, J = 9.2 Hz, 1H), 3.17 (q, J = 2.6 Hz, 1H), 3.13-3.09 (m, 1H), 2.99-2.91 (m, 1H), 2.67-2.64 (m, 2H), 1.57 (dq, J = 41.6, 7.1 Hz, 4H), 1.41-1.36 (m, 2H). ¹³ C-NMR (101 MHz, CD ₃ OD) δ 171.9, 170.3, 98.2, 94.1, 86.4, 83.5, 78.0, 76.2, 73.9, 73.8 , 71.5, 62.8, 62.7, 31.5, 30.8, 26.5, 26.3, 25.5, LRMS (ESI): m/z 414 [M+Na] ⁺ ,HRMS (ESI-TOF): Calcd for C ₁₆ H ₂₅ NO ₁₀ Na[M+Na] ⁺ : 414.1371, Found: 414.1355.

Reference example 12. Synthesis of compound 17

Compound 17 (14.7 mg, 0.039 mmol, 82%) was obtained as a colorless oil by synthesizing according to Reference Examples 4 to 7 using an appropriate compound in place of Compound 5.

Reference example 13. Synthesis of compound 18

Compound 18 (18.9 mg, 0.048 mmol, quant.) was obtained as a colorless oil by synthesizing according to Reference Examples 4 to 7 using an appropriate compound in place of Compound 5 and Compound 7.

Reference example 14. Synthesis of compound 19

Antisense oligonucleotide (ASO (naked ASO)) against mouse Malat1 gene (NR_002847.3) was synthesized by Yamasa Soy Sauce Co., Ltd. The ASO arrangement is as follows.
5(L)^T(L)^A(L)^g^t^t^c^a^c^t^g^a^a^T(L)^G(L)^5(L) ( Sequence number 1) [Lower Case=DNA / N(L)=LNA / 5(L)=LNA_5mC / ^=Phosphorothioated / N(6)=amino C6 linker/]

Compound 19 is a compound in which an amino-C6 linker is added to the 5′-terminal phosphate group of ASO. Compound 19 was synthesized by Yamasa Soy Sauce Co., Ltd.

Reference example 15. Synthesis of compound 20

Compound 20 is a compound in which an amino-C6 linker is added to the phosphate group at the 3' end of ASO. Compound 20 was synthesized by Yamasa Soy Sauce Co., Ltd.

Example 1. Synthesis of compound A

Compound A was synthesized as follows. Mix 10 mM compound 19 aqueous solution (100 μL, 1 mmol), 100 mM compound 4 (short-BCN-PNP) in DMSO solution (100 μL, 10 eq.), and DIPEA (10 μL, 57 eq.). Shake at 40°C for 3 hours. After confirming the disappearance of Compound 19 by reverse phase HPLC, crude purification was performed by twice ethanol precipitation. The pellet was dissolved in distilled water (250 μL) to obtain 4 mM BCN-modified oligonucleic acid (N-ASO). Concentrations were determined by measuring UV absorption (260 nm). Subsequently, this 4 mM BCNated oligonucleic acid (N-ASO) (75 μL, 300 nmol) and a 50 mM DMSO solution of compound 10 (100 μL) were mixed. If it was dissolved quickly at 40°C, it was left as is; if it remained suspended, DMSO (75 μL) was added and the mixture was shaken at 40°C for 3 hours. After confirming the disappearance of N-ASO by reverse phase HPLC, crude purification was performed by ethanol precipitation, followed by purification by HPLC. The target elution solution was concentrated using a centrifugal concentrator and then dissolved in distilled water. After confirming that this solution was the target compound A by MALDI-TOF-MS, it was converted into a sodium salt suitable for use in in vivo experiments. The results of MALDI-TOF-MS for Compound A were calculated value [MH] ^- :5953.89 and actual value [MH] ^- :5953.40.

Example 2. Synthesis of compound B

Compound B was synthesized according to Example 1 using Compound 17 in place of Compound 10 and was made into a sodium salt suitable for use in in vivo experiments. The results of MALDI-TOF-MS for Compound B were calculated value [MH] ^- :6029.94 and actual value [MH] ^- :6028.36.

Example 3. Synthesis of compound C

Compound C was synthesized according to Example 1 using Compound 18 in place of Compound 10 and made into a sodium salt suitable for use in in vivo experiments. The results of MALDI-TOF-MS for Compound C were calculated value [MH] ^- :6029.94 and actual value [MH] ^- :6028.95.

Example 4. Synthesis of compound D

An aqueous solution of 6 mM compound 19 (50 μL, 300 pmol), 60 mM compound 16 in DMSO (50 μL, 10 eq.), and DMSO (50 μL) were combined, and the reaction mixture was shaken at 40 °C for 3 h (1200 rpm). ),did. After confirming the disappearance of the starting oligonucleotide by reverse phase HPLC, the reaction mixture was diluted with 0.1M TEAA and purified by reverse phase HPLC. After confirming by MALDI-TOF-MS that the obtained compound was the desired compound D, it was converted into a sodium salt suitable for use in in vivo experiments. The results of MALDI-TOF-MS for Compound D were calculated value [MH] ^- :5748.63 and actual value [MH] - :5748.00.

Example 5. Synthesis of compound E

Compound E was synthesized according to Example 1 using Compound 20 in place of Compound 19 and made into a sodium salt suitable for use in in vivo experiments. The results of MALDI-TOF-MS for Compound E were a calculated value [MH] ^- :5953.89 and an actual value [MH] ^- :5953.92.

Example 6. Administration test to mice 1
(ASO administration and organ collection)
Mice (Balb/c, female, 5 weeks old, 7 mice) were purchased from Japan SLC Co., Ltd. and transported to the animal experiment facility. After a mouse acclimatization period of at least 5-7 days, a single dose of conjugated ASO (Compound A) in saline solution prepared at 100 μg per individual mouse was administered into the tail vein. For comparison, a physiological saline solution prepared at 100 μg per mouse of unconjugated ASO (ASO with no ligand or linker bound: “naked ASO”) was administered once into the tail vein. Physiological saline was used as a negative control.

72 hours after ASO administration, mice were anesthetized by intraperitoneal administration of a triple anesthetic mixture (medetomidine, midazolam, and butorphanol), and after laparotomy, the abdominal aorta was incised to death by exsanguination, and 25 to 50 mg of tissue was removed. Place the sample into each 2 mL tube of 96-well Collection Microtubes (Qiagen) into which 500 μL/tube of RNAprotect Tissue Reagent (Thermo) was preliminarily dispensed, and store the tissue piece immersed in the reagent (-30°C). did. Tissue pieces were collected from the following 12 organs: liver, kidney, spleen, pancreas, heart, lungs, stomach, large intestine, brain, skeletal muscle, mammary gland (fat), and skin.

(total RNA preparation, reverse transcription and real-time PCR)
MagMAX mirVana Total RNA Isolation Kit (Thermo; hereinafter referred to as mirVana kit) was used to extract total RNA from the collected tissue pieces. Centrifuge the 96-well Collection Microtubes storing the tissue pieces (1000 x g, 3 minutes, 4°C) to remove the RNAprotect Tissue Reagent, and then add the lysis buffer (0.7% 2-mercaptoethanol) provided with the mirVana kit. Tissue homogenate was prepared by adding one stainless steel bead (5 mm diameter, QIAGEN) to each tube of Collection Microtubes, and repeating homogenization for 2 minutes at 30 Hz at room temperature five or more times using TissueLyser II (QIAGEN). .

Extraction and purification of total RNA from tissue homogenates was performed according to the protocol of the mirVana kit, and the process was automated by KingFisher Flex (Thermo). The concentration of each RNA sample was determined by Quant-iT RiboGreen RNA Assay Kit (Thermo). Reverse transcription products were prepared from approximately 10 ng of total RNA using the High-Capacity cDNA Reverse Transcription Kit (Thermo). The kit protocol was followed for the reaction. Real-time PCR was performed on each reverse transcription product using PowerUp SYBR Green Master Mix (Thermo). Gapdh was used as an internal control for PCR. However, the internal control for lung samples was 18S rRNA. The PCR reaction was performed using a StepOnePlus real-time PCR system (Thermo), and 45 cycles of heat treatment at 95°C for 20 seconds, followed by heat denaturation at 95°C for 3 seconds and extension reaction at 60°C for 30 seconds were performed. Malat1 expression level was analyzed by comparing Ct values obtained from amplification curves of Malat1 and internal control (ΔΔCt method).

The PCR primer sequences used in the above test are shown below:
mmalat1_F4: 5'-d(ACATTCCTTGAGGTCGGCAA)-3' (SEQ ID NO: 2) mmalat1_R4: 5'-d(CACCCGCAAAGGCCTACATA)-3' (SEQ ID NO: 3) mGapdh_F3: 5'-d(TCACCACCATGGAGAAGGC)-3' (SEQ ID NO: 4 ) mGapdh_R3: 5'-d(GCTAAGCAGTTGGTGGTGCA)-3' (SEQ ID NO: 5) m18SrRNA_F1: 5'-d(GTAACCCGTTGAACCCCATT)-3' (SEQ ID NO: 6) m18SrRNA_R1: 5'-d(CCATCCAATCGGTAGTAGCG)-3' (SEQ ID NO: 7).

The results are shown in Figure 1. Administration of naked ASO did not reduce the expression level of the target gene (Malat1) in brain tissue. On the other hand, although data are omitted, the expression levels of target genes in other tissues were reduced by administration of naked ASO. In contrast, when Compound A was administered, the expression level of the target gene in brain tissue was significantly reduced. From this, it was found that by linking a monosaccharide to a polynucleotide via a linker, the activity of the polynucleotide can be effectively exerted in the brain.

Additionally, we conducted additional tests and found that the effect of suppressing the expression of the target gene in the brain was dose-dependent with Compound A. It was confirmed that it has an expression suppressing effect in the brain, and that even if the target sequence within the target gene is changed, the expression suppressing effect in the brain is exerted.

Example 7. Administration test to mice 2
The dose of conjugated ASO (compound A) and unconjugated ASO (naked ASO) was changed and the test was conducted in the same manner as in Example 6, and the expression level of the target gene (Malat1) in brain tissue was measured. .

The results are shown in Figure 2. When naked ASO was administered, the expression level of the target gene (Malat1) in brain tissue did not change at any concentration. In contrast, when Compound A was administered, the expression level of the target gene in brain tissue decreased in a concentration-dependent manner. Furthermore, even in the high-dose administration group (1000 μg group), no toxicity such as mouse death or liver enlargement was observed.

Example 8. Administration test on mice 3
Using conjugated ASO (compounds B and C) and unconjugated ASO (naked ASO), the dose was 100 μg, and the test was conducted in the same manner as in Example 6. Expression of target gene (Malat1) in brain tissue The amount was measured.

The results are shown in Figure 3. When Compounds B and C were administered, there was a tendency for the expression levels of target genes in brain tissue to further decrease. From this, the sugar structure connected to the polynucleotide via a linker is a substrate for Glut1, and the difference in the spacer that directly binds to the sugar does not have a large effect, allowing the polynucleotide to effectively exert its activity in the brain. I found out that it can be done.

Example 9. Synthesis of Compound X Compound The results of MALDI-TOF-MS for Compound X were calculated value [MH] ^- :5988.90 and actual value [MH] ^- :5989.44.

Example 10. Administration test on mice 4
Using conjugated ASO (compound It was measured.

The results are shown in Figure 4. When naked ASO 2 (second sequence) was administered, the expression level of the target gene (Malat1) in brain tissue was slightly reduced. On the other hand, when compound X was administered, the expression level of the target gene in brain tissue was significantly reduced. From this, it was found that by linking a monosaccharide to a polynucleotide with a different target sequence via a linker, the activity of the polynucleotide can be effectively exerted in the brain.

Example 11. Administration test on mice 5
Using conjugated ASO (Compound A, Compound The expression level of Malat1) was measured.

The results are shown in Figure 5. In both cases of Compound A and Compound X, the expression level of the target gene was significantly reduced only in the brain.

Example 12. Administration test on mice 6
Using conjugated ASO (Compound D, Compound E) and unconjugated ASO (naked ASO), the dose was 100 μg, and the test was conducted in the same manner as in Example 6. The expression level was measured.

The results are shown in Figure 6. Administration of naked ASO did not change the expression level of the target gene (Malat1) in brain tissue. In contrast, when compounds D and E were administered, the expression level of the target gene in brain tissue was further reduced. From this, it was found that the sugar linked to a polynucleotide via a linker can effectively exert the activity of the polynucleotide in the brain without being significantly affected by the linker structure or bonding position.

Example 13. Synthesis of compound F

Compound F was synthesized as follows. Mix an aqueous solution of 6 mM compound 19 (50 μL, 0.3 μmol), a DMSO solution of 72 mM trivalent linker PNP (42 μL, 10 eq.), and DIPEA (3 μL, 57 eq.) at 40 °C for 3 hours. Shake. After confirming the disappearance of Compound 19 by reverse phase HPLC, crude purification was performed by twice ethanol precipitation. The pellet was dissolved in distilled water (50 μL) and mixed with a 100 mM DMSO solution of compound 10 (30 μL, 10 eq.). It was shaken at 40°C for 3 hours. The reaction solution was purified by HPLC. The target elution solution was concentrated using a centrifugal concentrator and then dissolved in distilled water. After confirming that this solution was the target compound F by MALDI-TOF-MS, it was converted into a sodium salt suitable for use in in vivo experiments. The results of MALDI-TOF-MS for Compound F were calculated value [MH] ^- :7476.62 and actual value [MH] ^- :7475.28.

Example 14. Synthesis of compound G

Compound G was synthesized as follows. 6 mM aqueous solution of compound 19 (50 μL, 0.3 μmol), 24 mM Fmoc-Val-Ala-PAB-PNP in DMSO solution (35 μL, 2.8 eq.), and 100 mM sodium borate buffer (80 μL, pH 9.3) ) and shaken at 50°C for 1 hour. Furthermore, a DMSO solution (35 μL, 2.8 eq.) of 24 mM Fmoc-Val-Ala-PAB-PNP was added, and the mixture was shaken at 50°C for 1 hour, and then purified by ethanol precipitation. The pellet was dissolved in distilled water (80 μL), piperidine (20 μL) was added, and the mixture was shaken at 50°C for 1 hour. After ethanol precipitation, the main product was fractionated by HPLC, lyophilized, and dissolved again in distilled water (80 μL). From this point on, it was synthesized in the same manner as Compound A, and after confirming that it was the desired Compound G using MALDI-TOF-MS, it was converted into a sodium salt suitable for use in in vivo experiments. . The results of MALDI-TOF-MS for Compound G were a calculated value [MH] ^- :6273.2 and an actual value [MH] ^- :6276.1.

Example 15. Administration test on mice 7
Using conjugated ASO (compound F, compound G) and unconjugated ASO (naked ASO), the dose was 100 μg, and the test was conducted in the same manner as in Example 6. The expression level was measured.

The results are shown in Figure 7. Administration of naked ASO did not change the expression level of the target gene (Malat1) in brain tissue. On the other hand, when the aforementioned compounds D and E were administered, the expression level of the target gene in brain tissue decreased. When compounds F and G were administered, the expression level of the target gene in brain tissue was further reduced. From this, the effect of the linker structure that connects the linker and sugar to the polynucleotide is small, but changes in the valence of the sugar and biodegradable linkers may make the activity of the polynucleotide more effective in the brain. Shown.

Claims

General formula (1):

[In the formula: Ms represents a monovalent group obtained by removing one atom or group from a monosaccharide. Lk represents a divalent group that is a linker. Pn represents a monovalent group obtained by removing one atom or group from a polynucleotide. ]
A compound represented by: or a salt thereof or a solvate thereof.
2. The compound according to claim 1, a salt thereof, or a solvate thereof, wherein the monosaccharide is a ligand for glucose transporter 1.
The compound according to claim 1, a salt thereof, or a solvate thereof, wherein the monosaccharide is a hexose.
4. The compound, a salt thereof, or a solvate thereof according to claim 3, wherein the Ms is a monovalent group obtained by removing a hydrogen atom from a hydroxyl group at the 4th or 6th position of the monosaccharide.
The compound, a salt thereof, or a solvate thereof according to claim 1, wherein the linker is a hydrocarbon chain in which at least one carbon atom constituting the main chain may be replaced with a heteroatom and/or a linking structure. .
6. The compound, a salt thereof, or a solvate thereof according to claim 5, wherein the linked structure includes a linked structure containing a triazole ring and/or a linked structure containing an amide bond.
2. The compound, a salt thereof, or a solvate thereof according to claim 1, wherein the number of atoms constituting the main chain of the Lk is 6 or more.
2. The compound, a salt thereof, or a solvate thereof according to claim 1, wherein the Pn is a monovalent group obtained by removing one atom or group from the terminal nucleotide of the polynucleotide.
2. The compound, a salt thereof, or a solvate thereof according to claim 1, wherein the Pn is a monovalent group obtained by removing one hydrogen atom from the phosphate group of the terminal nucleotide of the polynucleotide.
The compound or compound according to claim 1, wherein the polynucleotide is an antisense polynucleotide, siRNA, miRNA, miRNA precursor, aptamer, guide RNA, mRNA, DNA (antigene nucleic acid), or DNA/RNA heteroduplex. its salts or their solvates.
A medicament containing the compound according to any one of claims 1 to 10, a salt thereof, or a solvate thereof.
The medicament according to claim 11, which is for brain delivery.
A reagent containing the compound according to any one of claims 1 to 10, a salt thereof, or a solvate thereof.