WO2023206871A1 - Système crispr/spcas12f1 optimisé, arn guide modifié et son utilisation - Google Patents

Système crispr/spcas12f1 optimisé, arn guide modifié et son utilisation Download PDF

Info

Publication number
WO2023206871A1
WO2023206871A1 PCT/CN2022/113354 CN2022113354W WO2023206871A1 WO 2023206871 A1 WO2023206871 A1 WO 2023206871A1 CN 2022113354 W CN2022113354 W CN 2022113354W WO 2023206871 A1 WO2023206871 A1 WO 2023206871A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
seq
spcas12f1
guide rna
gene
Prior art date
Application number
PCT/CN2022/113354
Other languages
English (en)
Chinese (zh)
Inventor
季泉江
王玉珏
吴兆韡
Original Assignee
上海科技大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 上海科技大学 filed Critical 上海科技大学
Publication of WO2023206871A1 publication Critical patent/WO2023206871A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/43—Enzymes; Proenzymes; Derivatives thereof
    • A61K38/46—Hydrolases (3)
    • A61K38/465—Hydrolases (3) acting on ester bonds (3.1), e.g. lipases, ribonucleases
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/52—Genes encoding for enzymes or proenzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/65—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression using markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0684—Cells of the urinary tract or kidneys
    • C12N5/0686—Kidney cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/10—Cells modified by introduction of foreign genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22—Ribonucleases RNAses, DNAses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Definitions

  • the invention belongs to the field of biotechnology and relates to an optimized CRISPR/SpCas12f1 system, engineered guide RNA and its application. Specifically, it relates to an engineered guide RNA and a gene editing method based on an extremely small CRISPR/SpCas12f1 system.
  • CRISPR Clustered regularly interspaced short palindromic repeats
  • Cas Clustered regularly interspaced short palindromic repeats
  • Cas Clustered regularly interspaced short palindromic repeats
  • Cas Clustered regularly interspaced short palindromic repeats
  • Cas Clustered regularly interspaced short palindromic repeats
  • Cas Clustered regularly interspaced short palindromic repeats
  • Cas its associated genes
  • the CRISPR-Cas system uses three steps to protect microorganisms from foreign invasion: (1) adaptation, in which Cas proteins capture foreign nucleic acid fragments (spacers) and insert them into the CRISPR array; (2) processing of transcripts from the CRISPR array to produce mature CRISPR RNA (crRNAs); (3) Interference, crRNAs guide the Cas protein to target and cut the homologous sequence of the new invader.
  • the use of genome editing technology can promote cell engineering, the generation of model animals, the development of new plant varieties and genetic screening, etc. It
  • CRISPR/Cas9 and CRISPR/Cas12a are the most widely used genome editing systems, but the large size of these two systems limits their use in fields such as gene therapy.
  • V-F subtype proteins - Cas12f which are composed of approximately 400–700 amino acid residues and contain a RuvC nuclease domain, have been discovered. These small-sized proteins can help solve the problem of adeno-associated virus vector packaging.
  • SyntrophomonaspalmitaticaCas12f1 SpCas12f1, 497 amino acids
  • SpCas12f1 can also target target genes in eukaryotic cells and trigger gene insertion and deletion, but its efficiency is only 0.1%-3.6%. Therefore, it is particularly urgent to optimize small molecular weight or small size gene editing systems to make them efficient and precise gene editing tools.
  • the purpose of the present invention is to solve the shortcomings of small nuclease gene editing within the framework of the existing technology and provide an optimized CRISPR/SpCas12f1 system and its efficient gene editing method.
  • the optimized gene editing system and method provided by the present invention can achieve efficient and precise editing of target genes or target genomes in vitro (including cells) or in vivo, greatly improving the gene editing efficiency of the small CRISPR/SpCas12f1 system.
  • a guide RNA which is characterized in that it includes a tracr RNA sequence and a crRNA sequence; the crRNA sequence includes a gene targeting segment capable of hybridizing with a target sequence and a tracr partner sequence; the The tracr RNA sequence and the tracr partner sequence constitute the backbone sequence of the guide RNA; the gene targeting segment that hybridizes to the target sequence can be determined based on the target gene for editing;
  • the tracrRNA includes the nucleotide sequence shown in SEQ ID NO. 111 or a variant sequence having at least 50% identity with it;
  • the tracr partner sequence includes the nucleotide sequence shown in SEQ ID NO. 112 or a variant sequence having at least 50% identity with it.
  • Another object of the present invention is to provide an isolated polynucleotide encoding the guide RNA as described above.
  • Another object of the present invention is to provide a construct containing an isolated polynucleotide as described above.
  • Another object of the present invention is to provide an expression system, which contains the construct as described above or an exogenous polynucleotide as described above integrated into the genome.
  • Another object of the present invention is to provide a gene editing system, which includes the guide RNA or its encoding polynucleotide as described above; the editing system further includes a nuclease or its encoding polynucleotide.
  • Another object of the present invention is to provide a gene editing method that contacts the target gene with the gene editing system as described above to achieve editing of the target gene.
  • Another object of the present invention is to provide the guide RNA, isolated polynucleotide, construct, expression system, gene editing system, pharmaceutical composition or method described above in vivo, ex vivo cell or cell-free environment. Applications in gene editing of target genes and/or their related polypeptides.
  • Another object of the present invention is to provide a genetically modified cell, which is obtained by gene editing using the gene editing system or method described above.
  • the present invention conducted in-depth exploration of the gRNA of SpCas12f1 through multiple rounds of gRNA transformation, thereby determining the gRNA with the highest editing efficiency and transforming the CRISPR/SpCas12f1 system into an efficient and accurate genome editing tool.
  • the optimal version of gRNA can increase the efficiency of gene insertion and gene deletion in all tested targets by approximately 2-9 times.
  • gRNA remodeling in the present invention significantly reduces the size of gRNA, and the engineered SpCas12f1 system is smaller, providing more possibilities for gene editing and gene therapy for AAV delivery.
  • This compact CRISPR system has broad application prospects in genome editing.
  • the present invention tested the editing efficiency of a total of 32 targeted sequences on 9 endogenous genes in a mammalian cell genome editing experiment, thereby improving the applicability of the small CRISPR system in cell gene editing.
  • Figure 1 is a schematic diagram of the initial version of gRNA_MS1 of SpCas12f1 nuclease in Example 1.
  • Figure 2 is a diagram showing the gene editing results in human cells mediated by SpCas12f1 nuclease and the corresponding initial version of gRNA_MS1 in Example 1. The results showed that SpCas12f1 nuclease successfully achieved gene editing of multiple genes on the mammalian cell genome.
  • Figure 3 is a schematic diagram of the specific modification sites and corresponding base lengths of SpCas12f1 nuclease gRNA engineering in Example 2.
  • Figure 4 is a diagram showing the gene editing results in mammalian cells mediated by SpCas12f1 nuclease and corresponding different versions of gRNA in Example 2. The results showed that the editing efficiency of the partially engineered gRNA was higher than that of the initial version gRNA_MS1, with the highest efficiency being gRNA_MS13.
  • Figure 5 is a diagram showing the comparison results of gene editing in mammalian cells mediated by SpCas12f1 nuclease and the corresponding initial version (MS1) and optimal version (MS13) of gRNA in Example 3. The results showed that gRNA_MS13 greatly improved the gene editing efficiency of nuclease in mammalian cells.
  • a single base editing system based on SpCas12f1 was developed by fusing inactivated SpCas12f1 and base deaminase;
  • a Prime editing system based on SpCas12f1 was developed by fusing inactivated SpCas12f1 and reverse transcriptase;
  • a SpCas12f1-based Prime editing system was developed by fusing inactivated SpCas12f1 and transcription activator to develop a transcription activation system based on SpCas12f1; by fusing inactivated SpCas12f1 and a nucleic acid epigenetic modification enzyme, an epigenetic modification system based on SpCas12f1 was developed; using inactivated SpCas12f1, a transcription repression system based on SpCas12f1 was developed.
  • the CRISPR system mainly used in the present invention is the V-F type CRISPR system, in which the effector protein is mainly Syntrophomonaspalmitatica Cas12f (SpCas12f1) nuclease.
  • SpCas12f1 nuclease can accurately locate the target gene under the guidance of the corresponding guide RNA, cut the genomic DNA, and achieve double-stranded breaks in the genomic DNA. Utilizing the host cell's own or exogenous repair mechanisms, this system can efficiently and accurately achieve gene editing in living cells.
  • the invention provides a guide RNA (gRNA), which includes a trans-activating CRISPR RNA (tracrRNA) sequence and a crRNA sequence; the crRNA sequence includes a gene targeting segment capable of hybridizing with a target sequence and a tracr partner sequence (gene The targeting segment and the tracr partner sequence are connected to obtain the RNA sequence (crRNA));
  • gRNA guide RNA
  • tracrRNA trans-activating CRISPR RNA
  • crRNA sequence includes a gene targeting segment capable of hybridizing with a target sequence and a tracr partner sequence (gene The targeting segment and the tracr partner sequence are connected to obtain the RNA sequence (crRNA));
  • the tracrRNA includes the nucleotide sequence shown in SEQ ID NO. 111 or a variant sequence having at least 50% identity with it;
  • the tracr partner sequence includes the nucleotide sequence shown in SEQ ID NO. 112 or a variant sequence having at least 50% identity with it.
  • the guide RNA of the present invention includes one or more of the complementary base pairs in the tracrRNA, and the tracrRNA is obtained by exchanging positions of the paired bases.
  • the base A at position 13 of tracrRNA is complementary to the base U at position 50.
  • the tracrRNA obtained after setting position 13 to U and position 50 to A can also achieve the technical effects of the present invention.
  • the guide RNA of the present invention includes one or more base pairs of complementary pairs between tracrRNA and tracr partner sequence, and the tracrRNA and tracr partner sequence are obtained by exchanging positions of the paired bases.
  • base A at position 70 of tracrRNA is complementary to base U at position 10 of the tracr partner.
  • the counterpart sequence can also achieve the technical effects of the present invention.
  • the gene targeting segment is a nucleotide sequence complementary to the target sequence in the target gene and is located at the 3' end of the crRNA sequence; the gene targeting segment identifies the target The PAM sequence on the sequence; the preferred PAM sequence is at least one of 5'-NTTC and 5'-GTTT, where N is A, T, C, G; further preferably the PAM sequence is 5'-GTTC, 5'-TTTC and 5'-ATTC at least either.
  • the gene targeting segment targets a nucleic acid fragment with a length of 12 to 40 bp after the PAM sequence; for example, it can be 13-20, 18-25, 22-32, 26-37, 30-38, 32-40 nucleotides
  • the length of the acid is preferably 20 bp.
  • the gene targeting segment is preferably an RNA sequence corresponding to a 20 bp length nucleic acid fragment following the PAM sequence.
  • the gene targeting segment is selected from SEQ ID NO. 168.
  • the complementarity percentage between the targeting segment of the guide RNA and the target sequence of the target gene can be at least 50% (for example, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 97%, at least 98%, at least 99% or 100%).
  • the gRNA further comprises a transcription terminator.
  • the guide RNA can be two strands, one strand includes a tracrRNA sequence, and the other strand includes a crRNA sequence, wherein the tracr partner sequence hybridizes with the tracrRNA sequence and forms a stem-loop structure.
  • the crRNA sequence and the tracrRNA sequence can be connected together to form a single guide RNA skeleton sequence, that is, the guide RNA is a strand, which sequentially contains from the 5' end to the 3' end.
  • the tracr RNA sequence and crRNA sequence can be connected together to form a single guide RNA skeleton sequence, that is, the guide RNA is a strand, which sequentially contains from the 5' end to the 3' end.
  • the 3' end of the tracr RNA sequence is directly connected to the 5' end of the crRNA sequence or connected through a connecting strand; preferably, the connecting strand is connected, and the connecting strand is selected from oligonucleotides ; Preferably, the number of oligonucleotides in the connecting chain is 3 to 18 nt; further preferably, the connecting chain is AAGG.
  • the crRNA and tracrRNA sequences are two separate RNA sequences and can mediate the activity of nuclease such as SpCas12f1 endonuclease when they exist simultaneously.
  • nuclease such as SpCas12f1 endonuclease
  • the complete guide RNA expression construct for the target sequence obtained by connecting the guide RNA backbone sequence and the DNA-targeting segment that hybridizes to the target sequence can also mediate the activity of nucleases such as SpCas12f1 endonuclease.
  • the gene targeting segment includes a nucleotide sequence complementary to a sequence in the target gene, and the gene targeting sequence interacts with the target gene in a sequence-specific manner through hybridization (i.e., base pairing). interaction.
  • the gene targeting sequence of the gRNA can be modified, for example, by genetic engineering, so that the gRNA hybridizes to any desired sequence within the target gene.
  • gRNA guides the bound polypeptide to a specific nucleotide sequence within the target gene through the above-mentioned gene targeting sequence.
  • the guide RNA of the present invention also contains a stem-loop structure, which forms a protein-binding structure that interacts with nucleases such as SpCas12f1.
  • the protein binding structure of the gRNA includes 4 stem-loop structures, including stem-loop 1, 2, 3, and 4.
  • the target gene is a DNA sequence. In some embodiments, the target gene is an RNA sequence.
  • the invention also provides methods for modifying the guide RNA, including but not limited to individual modifications and combined modifications of trans-activating CRISPR RNA (tracrRNA) and CRISPR RNA (crRNA).
  • the transformation methods include but are not limited to truncation or extension of tracrRNA or crRNA, and the connection between tracrRNA and crRNA.
  • tracrRNA and crRNA are connected with AAGG.
  • the variant sequence of tracrRNA refers to adding, reducing or replacing part of the nucleosides at the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 111 Sequence obtained after acid.
  • the variant sequence of tracrRNA refers to a sequence obtained by reducing nucleotides at the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO.
  • the variant sequence of tracrRNA refers to a sequence obtained by reducing 1 to 30 nt nucleotides from the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 111.
  • the variant sequence of tracrRNA refers to a reduction of 4 to 16 nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 111, and/or, in the SEQ ID NO.
  • the 3' end of the nucleotide sequence shown in NO. 111 is reduced by 3 to 28 nt nucleotides.
  • the variant sequence of the tracr partner sequence refers to a sequence obtained by adding, reducing or replacing part of the nucleotides at the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 112 ;
  • the variant sequence of the tracr partner sequence refers to a sequence obtained by reducing nucleotides at the 5' end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 112.
  • the variant sequence of the tracr partner sequence refers to a sequence obtained by reducing 3 to 28 nt nucleotides from the 5' end of the nucleotide sequence shown in SEQ ID NO. 112. More preferably, the variant sequence of the tracr partner sequence refers to a reduction of 8 to 21 nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 112.
  • the variant sequence of tracrRNA refers to a sequence obtained by reducing 7nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 111; preferably, the tracrRNA The variant sequence is shown in SEQ ID NO.114;
  • the variant sequence of tracrRNA refers to a sequence obtained by reducing 6nt nucleotides at the 3' end of the nucleotide sequence shown in SEQ ID NO. 111; preferably, the The variant sequence of tracrRNA is shown in SEQ ID NO.120;
  • the variant sequence of the tracr partner sequence refers to a sequence obtained by reducing 8 nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 112; preferably , the variant sequence of the tracr partner sequence is shown in SEQ ID NO.130;
  • the variant sequence of tracrRNA refers to reducing 7nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 111 and reducing 6nt nucleotides at the 3' end.
  • the variant sequence of tracrRNA is as shown in SEQ ID NO. 138;
  • the variant sequence of tracrRNA refers to reducing 7nt nucleotides at the 5' end of the nucleotide sequence shown in SEQ ID NO. 111 and reducing 6nt nucleotides at the 3' end.
  • the variant sequence of tracrRNA is as shown in SEQ ID NO. 144;
  • the variant sequence of the tracr partner sequence refers to a sequence obtained by reducing 21nt nucleotides at the 3' end of the nucleotide sequence shown in SEQ ID NO. 112; preferably , the variant sequence of the tracr partner sequence is shown in SEQ ID NO. 148.
  • nucleotide sequence of the backbone sequence of the guide RNA is shown in SEQ ID NO. 116. In other preferred embodiments, the nucleotide sequence of the backbone sequence of the guide RNA is shown in SEQ ID NO. 122. In other preferred embodiments, the nucleotide sequence of the backbone sequence of the guide RNA is shown in SEQ ID NO. 131. In other preferred embodiments, the nucleotide sequence of the backbone sequence of the guide RNA is shown in SEQ ID NO. 140.
  • the variant sequence of the tracrRNA is shown in SEQ ID NO.144, and the variant sequence of the tracr partner sequence is shown in SEQ ID NO.145; preferably, the tracrRNA and The tracr partner sequences are connected through connecting strands; further preferably, the nucleotide sequence of the backbone sequence of the guide RNA is as shown in SEQ ID NO. 146.
  • the variant sequence of the tracrRNA is shown in SEQ ID NO. 147, and the variant sequence of the tracr partner sequence is shown in SEQ ID NO.
  • the tracrRNA and The tracr partner sequences are connected through connecting strands; further preferably, the nucleotide sequence of the backbone sequence of the guide RNA is as shown in SEQ ID NO. 149.
  • the preferred guide RNA targets the same target sequence in mammalian cell genome editing. Show higher gene deletion and/or gene cleavage efficiency.
  • the present invention also provides modified gRNA, which can be used to achieve hybridization with any desired sequence within the target gene through modification; or, by modifying the gRNA to change the characteristics of the gRNA itself, such as enhancing the stability of the gRNA through modification, including But it is not limited to increasing its resistance to ribonuclease (RNase) degradation present in the cell, thereby extending its half-life in the cell; alternatively, it can be modified to enhance the content of gRNA and endonuclease (such as SpCas12f1 The formation of the CRISPR-SpCas12f1 genome editing complex or its stability; alternatively, it can be used to enhance the specificity of the genome editing complex through modification; alternatively, it can be used to enhance the interaction between the genome editing complex and the genome The initiation site, stability or kinetics of the interaction between the target sequences; alternatively, it can be modified to reduce the likelihood or extent of the RNA introduced into the cell to trigger an innate immune response, etc.
  • RNase
  • RNA can be modified using modification methods known in the art, including but not limited to 2'-fluoro and 2'-amino modifications on the ribose and base residues of the pyrimidine or the reverse base at the 3' end of the RNA. .
  • any modification or combination of modifications can be used to modify gRNA.
  • the sgRNA introduced into the cell is modified to edit any one or more genomic loci.
  • the invention also provides an isolated polynucleotide encoding the guide RNA as described in any one of the above.
  • the invention also provides a construct comprising an isolated polynucleotide as described above.
  • the construct can usually be constructed by inserting the isolated polynucleotide into a suitable expression vector, and those skilled in the art can select a suitable expression vector.
  • the construct may, for example, be a recombinant expression vector, and any suitable expression vector may be used as long as it is compatible with the host cell, including, but not limited to, viral vectors (e.g., vaccinia virus-based viral vectors; poliovirus; Adenovirus; adeno-associated virus; SV40; herpes simplex virus; human immunodeficiency virus; retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey Sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma
  • multiple gRNAs are used simultaneously in the same cell to simultaneously regulate transcription of different locations on the same target gene or different target genes.
  • they can exist on the same expression vector or on different vectors, or they can be expressed simultaneously; when they exist on the same vector, they can be expressed under the same control element.
  • a nucleotide sequence encoding a gRNA is operably linked to a control element, such as a transcription control element, such as a promoter.
  • a nucleotide sequence encoding a gRNA is operably linked to an inducible promoter.
  • a nucleotide sequence encoding a gRNA is operably linked to a constitutive promoter.
  • Transcriptional control elements may function in eukaryotic cells, such as mammalian cells (HEK293T cells); or in prokaryotic cells, such as bacterial or archaeal cells.
  • a nucleotide sequence encoding a gRNA is operably linked to a plurality of control elements that permit expression of the nucleotide sequence encoding the gRNA in both prokaryotic and eukaryotic cells.
  • the gRNA can be synthesized by artificial synthesis, for example, by chemical methods, so that it can be easily modified in various ways.
  • the modification can adopt any modification method known in the art, for example, using a polyA tail, adding a 5' cap analog, a 5' or 3' untranslated region (UTR), and the 5' or 3' end including phosphorothioate 2 '-O-methyl nucleotide or treated with phosphatase to remove the 5' terminal phosphate, etc.
  • the nucleotide sequence encoding a gRNA contains one or more modifications that may be used, for example, to enhance activity, stability or specificity, alter delivery, reduce the innate immune response in the host cell, or for Other enhancements.
  • one or more targeting moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the nucleotide sequence encoding the gRNA are chemically linked to the gRNA.
  • the targeting moiety or conjugate may include a conjugate group covalently bonded to a functional group; the conjugate group includes reporter molecules, polyamines, polyethylene glycol.
  • a group that enhances pharmacodynamic properties is attached to the gRNA, including groups that improve uptake, enhance resistance to degradation, and/or enhance sequence-specific hybridization to the target nucleic acid. group.
  • the nucleic acid containing the polynucleotide encoding gRNA may be a nucleic acid mimetic.
  • polynucleotide mimetic peptide nucleic acids with excellent hybridization properties may be used.
  • the gRNA, or polynucleotide encoding gRNA is applicable to any biological or in vitro environment, including but not limited to bacteria, archaea, fungi, protists, plants or animals.
  • suitable target cells include, but are not limited to, bacterial cells, archaeal cells, fungal cells, protist cells, plant cells or animal cells.
  • Applicable target cells can be any type of cells, including stem cells, somatic cells, etc.
  • the present invention also provides an expression system, which contains the construct as described above or an exogenous polynucleotide as described above integrated into the genome.
  • the host cell of the expression system is selected from eukaryotic cells or prokaryotic cells; preferably, the host cell is selected from mouse cells and human cells.
  • the present invention also provides a gene editing system, which includes the guide RNA or its encoding polynucleotide as described in any one of the above; further, it may also include a nuclease or its encoding polynucleotide.
  • the polynucleotide encoding the nuclease includes: a coding sequence encoding only a nuclease; a nuclease coding sequence and various additional coding sequences; a nuclease coding sequence (and optional additional coding sequences) and non-coding sequences.
  • the polynucleotide encoding the guide RNA includes: a coding sequence encoding only the guide RNA; a coding sequence of the guide RNA and various additional coding sequences; a coding sequence of the guide RNA (and optional additional coding sequences) and non-coding sequences.
  • the base editing system includes one or more vectors; the one or more vectors include (i) a first regulatory element operably linked to the nuclease The coding polynucleotide; and (ii) a second regulatory element operably linked to the coding polynucleotide of the guide RNA nucleotide sequence; the (i) and (ii) are located on the same or different carriers.
  • the base editing system comprises (i) a nuclease or a variant thereof, and (ii) a vector comprising the coding sequence of the guide RNA.
  • the system includes a gRNA and nuclease complex.
  • the first regulatory element may regulate the transcription of a polynucleotide encoding the nuclease or a variant thereof.
  • the polynucleotide encoding the nuclease or its variant may be one or more, and the first regulatory element may be one or more.
  • the second regulatory element can regulate the transcription of the polynucleotide encoding the guide RNA.
  • the guide RNA encoding polynucleotide may be one or more, and the second regulatory element may be one or more.
  • the system of the present invention may contain one gRNA or multiple gRNAs simultaneously.
  • the system includes multiple gRNAs simultaneously to simultaneously modify different positions on the same target DNA or different target DNAs.
  • two or more guide RNAs target the same gene or transcript or locus.
  • two or more guide RNAs target different unrelated loci.
  • two or more guide RNAs target different but related loci.
  • the nuclease is a CRISPR nuclease; preferably, the nuclease is selected from Cas9, Cas12, Cas13 protein family or variants thereof; further preferably, the Cas nuclease is selected from nSpCas9 and its mutants, SaCas9 and its mutants, Cas12a and its mutants, or Cas12f and its mutants; more preferably, it is SpCas12f1 nuclease or its mutants.
  • SpCas12f1 nuclease is provided directly as a protein; for example, spheroplast transformation can be used to transform fungi with exogenous proteins and/or nucleic acids.
  • SpCas12f1 nuclease can be introduced into cells by any suitable method, such as injection.
  • the gene editing system of the present invention recognizes the PAM sequence on the target sequence; preferably the PAM sequence is at least one of 5'-NTTC and 5'-GTTT, where N is A, T, C, G; further preferably the PAM sequence Be at least any one of 5'-GTTC, 5'-TTTC and 5'-ATTC.
  • the gene editing system targets nucleic acid fragments with a length of 12 to 40 bp after the PAM sequence, and the preferred length is 20 bp.
  • the gene editing system targets at least one target sequence in the genome of the cell.
  • the nucleic acid encoding SpCas12f1 nuclease is DNA. In certain embodiments, the nucleic acid encoding SpCas12f1 nuclease is RNA. In certain embodiments, the nucleic acid encoding SpCas12f1 nuclease is an expression vector, such as a recombinant expression vector.
  • Any suitable expression vector may be used so long as it is compatible with the host cell, including, but not limited to, viral vectors (e.g., vaccinia virus-based viral vectors; poliovirus; adenovirus; adeno-associated virus; SV40; herpes simplex Viruses; human immunodeficiency virus; retroviral vectors (e.g., murine leukemia virus, spleen necrosis virus, and vectors derived from retroviruses, such as Rous sarcoma virus, Harvey sarcoma virus, avian leukemia virus, lentivirus, human immunodeficiency virus, myeloproliferative sarcoma virus and breast tumor virus), etc.
  • viral vectors e.g., vaccinia virus-based viral vectors; poliovirus; adenovirus; adeno-associated virus; SV40; herpes simplex Viruses; human immunodeficiency virus; retroviral vectors (e
  • the nucleic acid encoding the SpCas12f1 nuclease is shown in SEQ ID NO. 40.
  • the invention provides a SpCas12f1 nuclease codon-optimized polynucleotide sequence that is at least 90%, 92%, 93%, 94%, 95%, 96%, 97% identical to SEQ ID NO: 42 , 98%, 99%, 99.2%, 99.5%, 99.8%, 99.9% or 100% sequence homology.
  • the better coding sequence of the SpCas12f1 nuclease optimized for human codons is shown in SEQ ID NO. 42 in the sequence listing, which encodes one or more functional SpCas12f1 domains, or encodes A polypeptide that has the same function as the polypeptide encoded by the original native nucleotide sequence.
  • a nucleotide sequence encoding a SpCas12f1 nuclease is operably linked to a control element, such as a transcription control element, such as a promoter.
  • a control element such as a transcription control element, such as a promoter.
  • the nucleotide sequence encoding SpCas12f1 nuclease is operably linked to an inducible promoter.
  • the nucleotide sequence encoding SpCas12f1 nuclease is operably linked to a constitutive promoter.
  • Transcriptional control elements may function in eukaryotic cells, such as mammalian cells (HEK293T cells); or in prokaryotic cells, such as bacterial or archaeal cells.
  • the nucleotide sequence encoding the SpCas12f1 nuclease is operably linked to a plurality of control elements that allow expression of the nucleotide sequence encoding the SpCas12f1 nuclease in both prokaryotic and eukaryotic cells.
  • the polynucleotide sequence encoding SpCas12fl nuclease is operably linked to a suitable nuclear localization signal for expression in a cellular or in vitro environment.
  • the polynucleotide encoding SpCas12f1 nuclease can be synthesized artificially, for example, chemically, so that it can be easily modified in various ways.
  • the modification may adopt any modification method known in the art.
  • the polynucleotide encoding SpCas12f1 nuclease contains one or more modifications, thereby enabling easy incorporation of a number of modifications, such as enhancing transcriptional activity, altering enzymatic activity, improving its translation or stability ( For example, increasing its resistance to proteolysis, degradation) or specificity, changing solubility, changing delivery, and reducing the innate immune response in host cells.
  • the modification may adopt any modification method known in the art.
  • any one or more genomic loci are edited by modifying the DNA or RNA encoding the SpCas12f1 nuclease introduced into the cell.
  • the nucleic acid sequence encoding SpCas12f1 nuclease is a modified nucleic acid, eg, codon optimized.
  • the modification may be a single modification or a combination of modifications.
  • the nucleic acid comprising the polynucleotide encoding SpCas12f1 nuclease may be a nucleic acid mimetic.
  • polynucleotide mimetic peptide nucleic acids with excellent hybridization properties may be used.
  • the SpCas12f1 nuclease or the polynucleotide encoding SpCas12f1 nuclease is suitable for use in any biological or in vitro environment, including but not limited to bacteria, archaea, fungi, protists, plants or animals.
  • suitable target cells include but are not limited to eukaryotic cells and prokaryotic cells, such as bacterial cells, archaeal cells, fungal cells, protist cells, plant cells or animal cells; the eukaryotic cells include mammalian cells and Plant cells, the prokaryotic cells include Escherichia coli and Klebsiella pneumoniae.
  • Applicable target cells can be any type of cells, including stem cells, somatic cells, etc.
  • the present invention is preferably used for mammalian cells HEK293T cells.
  • the cells may be in vivo or ex vivo.
  • the SpCas12f1 nuclease or nucleic acid encoding the SpCas12f1 nuclease is formulated in liposomes or lipid nanoparticles.
  • SpCas12f1 nuclease and gRNA can form a complex in the host cell to identify the PAM sequence on the target gene (such as target DNA) sequence;
  • the target sequence of the CRISPR/SpCas12f1 gene editing system is A nucleic acid fragment (such as a DNA fragment) of 20 bp in length following the PAM sequence.
  • the complex can selectively modulate the transcription of target DNA in a host cell.
  • the CRISPR/SpCas12f1 gene editing system can cut the double strands of targeted DNA, causing DNA breaks.
  • the system includes a recombinant expression vector.
  • the system comprises a recombinant expression vector comprising (i) a nucleotide sequence encoding a gRNA, wherein the gRNA comprises: (a) a core comprising a sequence complementary to a sequence in the target DNA and (b) a second segment that interacts with SpCas12f1 nuclease; and (ii) a nucleotide sequence encoding SpCas12f1 nuclease, wherein said SpCas12f1 nuclease comprises: (a) an RNA-binding moiety that interacts with the gRNA; and (b) an active moiety that modulates transcription within the target DNA, wherein the site of regulated transcription within the target DNA is determined by the gRNA.
  • SpCas12f1 nuclease variants can also be formed through modification, mutation, DNA shuffling, etc., so that the SpCas12f1 nuclease variants have improved desired characteristics, such as function, activity, kinetics, half-life, etc.
  • the modification may be, for example, the deletion, insertion or substitution of amino acids, or may be, for example, the replacement of the "" of the SpCas12f1 nuclease with a homologous or heterologous cleavage domain from a different nuclease (for example, the HNH domain of a CRISPR-related nuclease).
  • the DNA target of SpCas12f1 nuclease can be changed by any modification method of DNA binding and/or DNA modifying proteins known in the art, such as methylation, demethylation, acetylation, etc. tropism.
  • the DNA shuffling refers to the exchange of sequence fragments between DNA sequences of SpCas12f1 nucleases from different sources to generate chimeric DNA sequences encoding synthetic proteins with RNA-guided endonuclease activity.
  • the modification, mutation, DNA shuffling, etc. may be used singly or in combination.
  • the SpCas12f1 nuclease of the present invention can be:
  • (II) A variant having at least 50% sequence homology with the amino acid sequence of (I) and having RNA-guided nucleic acid binding activity;
  • the SpCas12f1 nuclease has endonuclease activity.
  • the SpCas12f1 can be used in combination with other enzyme components or other components to further develop various potential applications of the SpCas12f1 nuclease.
  • SpCas12f1 nuclease variants under (IV) for example, a single base editing system based on SpCas12f1 nuclease is developed by fusing inactivated SpCas12f1 and a base deaminase; by fusing inactivated SpCas12f1 and Reverse transcriptase develops a Prime editing system based on SpCas12f1 nuclease; by fusing inactivated SpCas12f1 and a transcription activator, a transcription activation system based on SpCas12f1 nuclease is developed; by fusing inactivated SpCas12f1 and a nucleic acid epigenetic modification enzyme, a SpCas12f1-based transcription activation system is developed Nu
  • SpCas12f1 nuclease variants may have the following specific properties, including but not limited to:
  • deaminase activity which can act on cytosine, guanine or adenine bases and then replicate and repair them within the cell through the deamination site to produce guanine, thymine and guanine respectively;
  • the enzymatic activity can be methyltransferase activity, demethylase activity, acetyltransferase activity, deacetylase activity, kinase activity, phosphatase activity, ubiquitin activity, etc.
  • peptide ligase activity deubiquitinating activity, ribosylation activity, etc.
  • the covalent modification of proteins is catalyzed by these enzyme activities; for example, SpCas12f1 nuclease variants catalyze covalent modification of proteins through methylation, acetylation function, ubiquitination, phosphorylation, etc., to modify histones to cause structural changes in histone-related DNA, thereby controlling the structure and properties of DNA).
  • the SpCas12f1 nuclease variant has no cleavage activity. In some embodiments, SpCas12f1 nuclease variants have single-strand cleavage activity. In some embodiments, the SpCas12f1 nuclease variant has double-stranded cleavage activity.
  • Having enhanced activity or ability means having an activity or ability that is increased by at least 1%, 5%, 10%, 20%, 30%, 40%, or 50% compared to wild-type SpCas12f1 nuclease.
  • Having reduced activity and ability refers to having an activity or ability of less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, less than 5%, or less than 1% relative to wild-type SpCas12f1 nuclease.
  • SpCas12f1 and SpCas12f1 nuclease include wild-type SpCas12f1 nuclease and all variants thereof. Those skilled in the art can determine the type of SpCas12f1 nuclease variant by routine means without limitation. Those cited above.
  • Each component in the system of the present invention can be transported by means of carriers.
  • methods that can be used include, but are not limited to, nanoparticles, liposomes, ribonucleoproteins, small molecule RNA-conjugates, chimeras, and RNA-fusion protein complexes, etc.
  • the system of the present invention may further include one or more donor templates.
  • the donor template includes donor sequences for insertion of a target gene.
  • the system of the present invention may further comprise a dimeric FOK1 nuclease, a complete or partially or completely defective SpCas12f1 nuclease or a gRNA connected to the dimeric FOK1 nuclease to guide the process through one or more gRNA molecules. Directs endonuclease cleavage when reaching one or more specific DNA target sites.
  • the system of the present invention can edit or modify DNA at multiple locations in cells for gene therapy, including but not limited to gene therapy for diseases, biological research, and improvement or enhancement of crop resistance. Yield etc.
  • the present invention also provides a composition comprising one or more of the SpCas12f1 nuclease or the polynucleotide encoding the same, gRNA or the polynucleotide encoding the same, a recombinant expression vector, and a system as described above, and also Acceptable carriers, media, etc. may be included.
  • the acceptable carriers and media such as sterile water or physiological saline, stabilizers, excipients, antioxidants (ascorbic acid, etc.), buffers (phosphoric acid, citric acid, other organic acids, etc.), preservatives, surface Active agents (PEG, Tween, etc.), chelating agents (EDTA, etc.), adhesives, etc.
  • polypeptides such as serum albumin, gelatin or immunoglobulin; amino acids such as glycine, glutamine, asparagine, arginine and lysine; sugars such as polysaccharides and monosaccharides or Carbohydrates; sugar alcohols such as mannitol or sorbitol.
  • aqueous solutions for injection such as physiological saline, isotonic solutions containing glucose or other auxiliary drugs, such as D-sorbitol, D-mannose, D-mannitol, and sodium chloride
  • appropriate Solubilizers include alcohols (ethanol, etc.), polyols (propylene glycol, PEG, etc.), nonionic surfactants (Tween 80, HCO-50), etc.
  • the composition includes gRNA and a buffer for stabilizing the nucleic acid.
  • the present invention also provides a kit comprising the system or composition as described above.
  • the kit may further include one or more additional reagents, for example selected from: dilution buffer; wash buffer; control reagents, etc.
  • the kit includes (a) a SpCas12f1 nuclease or a nucleic acid encoding a SpCas12f1 nuclease as described above; and (b) a gRNA or a nucleic acid encoding the gRNA, wherein the gRNA is capable of converting The SpCas12f1 nuclease or variant thereof is directed to a target polynucleotide sequence.
  • the kit further contains a donor template comprising a heterologous polynucleotide sequence capable of being inserted into the target polynucleotide sequence.
  • the present invention also provides a gene editing method, which involves contacting the target gene with the gene editing system as described above to achieve editing of the target gene.
  • the methods of the present invention can be used to target, edit, modify or manipulate target genes (such as target DNA) in cells or in vivo, ex vivo cells or cell-free systems, and the methods include: adding the SpCas12f1 nuclease as described above Or the polynucleotide encoding it, gRNA or the polynucleotide encoding it, recombinant expression vector, system, composition, etc. are introduced into the kit in vivo, in vitro cells or cell-free systems to target, edit and modify the target gene. or manipulation.
  • the method includes the following:
  • sgRNA gRNA
  • a nucleic acid e.g., DNA
  • the gene editing method of the present invention includes the following steps:
  • each parameter condition in the gene editing method of the present invention can be adjusted according to common knowledge in the field.
  • the concentration of the expression vector including nuclease and guide RNA is preferably 1 ⁇ g; the cells are transfected and then The time for editing is preferably 72 hours.
  • the SpCas12f1 nuclease is guided to the target gene through a processed or unprocessed form of guide RNA.
  • the SpCas12f1 nuclease and guide RNA form a complex to recognize the PAM sequence on the target gene.
  • the method further includes the step of introducing a donor template comprising a heterologous polynucleotide sequence into the cell.
  • the present invention also provides the above-mentioned guide RNA, isolated polynucleotide, construct, expression system, gene editing system, pharmaceutical composition or said method for targeting genes and genes in vivo, ex vivo cells or cell-free environment. /or its related peptides for use in gene editing.
  • the in vitro cells are selected from at least one of bacterial cells, archaeal cells, fungal cells, protist cells, viral cells, plant cells and animal cells.
  • the gene editing is selected from the group consisting of: gene cutting, gene deletion, gene insertion, point mutation, transcription inhibition, transcription activation, base editing and guided editing, including but not limited to:
  • SpCas12f1 nuclease has an enzymatic activity that modifies the target gene in a manner other than introducing a double-strand break; the enzymatic activity may be possessed by SpCas12f1 itself, or by, for example, adding an enzyme with The active heterologous polypeptide is fused to SpCas12f1 nuclease to form a chimeric SpCas12f1 nuclease.
  • the enzyme activities include but are not limited to methyltransferase activity, deamination activity, dismutase activity, alkylation activity, and demethylation. Enzyme activity, DNA repair activity, transposase activity, recombinase activity, DNA damage activity, depurination activity, oxidation activity, pyrimidine dimer formation activity, etc.).
  • the gene editing is gene deletion or gene cutting; the gene editing can be used to achieve one or more of the following including but not limited to the correction of pathogenic sites, gene function research, enhancement of cell function, cell therapy, etc. .
  • the SpCas12f1 nuclease of the present invention or the polynucleotide encoding the same, gRNA or the polynucleotide encoding the same, recombinant expression vector, system, composition and kit can be applied in the research field, diagnostic field, industrial field (such as microbial engineering), Drug discovery (such as high-throughput screening), target identification, imaging fields, and therapeutic areas, etc.
  • the target gene is target DNA.
  • the target DNA can be in vitro naked DNA that is not bound to DNA-associated proteins.
  • the target DNA is chromosomal DNA in cells in vitro.
  • the target gene is target RNA.
  • the target DNA is contacted with a targeting complex comprising the SpCas12f1 nuclease and a gRNA, the gRNA providing target specificity to the targeting complex by comprising a nucleotide sequence complementary to the target DNA; SpCas12f1 nucleic acid Enzymes provide site-specific activity.
  • the targeting complex modifies the target DNA, resulting in, for example, DNA cleavage, DNA methylation, DNA damage, DNA repair, and the like.
  • the targeting complex modifies a polypeptide associated with the target DNA (e.g., histones, DNA-binding proteins, etc.), resulting in, for example, methylation of the target DNA-associated polypeptide-histone, histone acetylation, histone acetylation, etc. Protein ubiquitination, etc.
  • SpCas12f1 nuclease or a nucleic acid containing a nucleotide sequence encoding a polypeptide of SpCas12f1 nuclease can be introduced into cells by known methods.
  • gRNA or a nucleic acid comprising a nucleotide sequence encoding gRNA can be introduced into a cell by well-known methods.
  • Well-known methods include DEAE-dextran-mediated transfection, liposome-mediated transfection, virus or phage infection, lipofection, transfection, conjugation, protoplast fusion, polyethylenimine-mediated guided transfection, electroporation, calcium phosphate precipitation, gene gun, calcium phosphate precipitation, microinjection, nanoparticle-mediated nucleic acid delivery, etc. Plasmids are delivered, for example, by electroporation, calcium chloride transfection, microinjection, and lipofection.
  • cells are contacted with viral particles comprising nucleic acid encoding gRNA and/or SpCas12f1 nuclease and/or chimeric SpCas12f1 nuclease and/or donor polynucleotide.
  • a nuclease cleaves target DNA in a cell to create a double-stranded break, which is then repaired by the cell, typically through non-homologous end joining (NHEJ) and homology-directed of repair.
  • NHEJ non-homologous end joining
  • the present invention also provides a cell, including a host cell that has been genetically modified with the above-mentioned SpCas12f1 nuclease or polynucleotide encoding the same, gRNA or polynucleotide encoding the same, recombinant expression vector, system, and composition.
  • the effective dosage of gRNA and/or SpCas12f1 nuclease and/or recombinant expression vector and/or donor polynucleotide is routine for those skilled in the art. This may vary depending on the route of administration and the nature of the condition being treated.
  • the bacteria or prokaryotic bacteria may be Escherichia coli, Klebsiella pneumoniae, Bacteroides ovatus, Campylobacter jejuni, Staphylococcus saprophyticus, Enterococcus faecalis, Bacteroides thetaiotaomicron, Bacteroides vulgaris, Bacteroides monomorpha, Bacteroides, Lactobacillus casei, Bacteroides fragilis, Acinetobacter reuteri, Fusobacterium nucleatum, Bacteroides johnsonii, Bacteroides arabidopsis, Lactobacillus rhamnosus, Bacteroides marseillei, Parabacteroides faecalis, Clostridium death Bacillus and Bifidobacterium breve, etc.
  • the eukaryotic cells include but are not limited to mammalian cells, fungi and other eukaryotic cells.
  • the fungi include yeast and Aspergillus, such as Saccharomyces cerevisiae, Hansenula polymorpha, Pichia pastoris, Kluyveromyces fragilis, Kluyveromyces lactis, Schizosaccharomyces pombe and Candida albicans.
  • a novel genome editing method based on extremely small CRISPR/SpCas12f1 nuclease is disclosed.
  • the invention shows that through the guidance and positioning functions of guide RNA, SpCas12f1 can accurately cut genomic DNA and achieve double-stranded breaks in genomic DNA. Utilizing the host cell's own or exogenous repair mechanisms, this system can efficiently and accurately achieve gene editing in living cells.
  • the present invention also provides a method for preparing guide RNA as described above, which method includes individually transforming tracrRNA and crRNA of the basic guide RNA and transforming them in combination, and the transformation is selected from truncation or extension of tracrRNA or crRNA, or TracrRNA and crRNA are connected through connecting strands to prepare engineered guide RNA.
  • the complete sequence of the wild-type guide RNA containing the targeting sequence contains the following sequence:
  • the underlined part is the targeting sequence: 5'- acacagaggaccccuaguaa -3' (SEQ ID NO. 168); which is the 20 bp fragment after the preferred PAM sequence.
  • SpCas12f1 nuclease described in the present invention is Syntrophomonas palmmitatica Cas12f (SpCas12f1), and its amino acid sequence preferably includes the sequence shown below:
  • the codon-optimized nucleotide sequence encoding the SpCas12f1 nuclease E. coli includes the following sequence:
  • the guide RNA sequences of different versions corresponding to the SpCas12f1 nuclease described in the present invention are as follows, where light gray is the tracrRNA sequence; dark gray is the tracr partner sequence; when there is no connecting chain, the tracrRNA sequence + tracr partner sequence is Backbone; when there is a connecting strand, the tracrRNA sequence + connecting strand + tracr partner sequence is the backbone.
  • FIG. 1 Its schematic diagram is shown in Figure 1; its tracrRNA sequence is shown in SEQ ID NO.111, and its tracr partner sequence is shown in SEQ ID NO.112; the guide RNA backbone sequence is SEQ ID NO.1 except for the gene targeting segment.
  • the sequence is shown in SEQ ID NO.113; the gene targeting segment that hybridizes to the target sequence is shown in SEQ ID NO.168 ( acacagaggaccccuaguaa );
  • the tracrRNA sequence is shown in SEQ ID NO.114, the tracr partner sequence is shown in SEQ ID NO.115; the guide RNA backbone sequence is the sequence of SEQ ID NO.2 except for the gene targeting segment, such as SEQ ID NO.116 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.117, the tracr partner sequence is shown in SEQ ID NO.118; the guide RNA backbone sequence is the sequence of SEQ ID NO.3 except the gene targeting segment, such as SEQ ID NO.119 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.120, the tracr partner sequence is shown in SEQ ID NO.121; the guide RNA backbone sequence is the sequence of SEQ ID NO.4 except the gene targeting segment, such as SEQ ID NO.122 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.123, the tracr partner sequence is shown in SEQ ID NO.124; the guide RNA backbone sequence is the sequence of SEQ ID NO.5 except the gene targeting segment, such as SEQ ID NO.125 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.126, the tracr partner sequence is shown in SEQ ID NO.127; the guide RNA backbone sequence is the sequence of SEQ ID NO.6 except for the gene targeting segment, such as SEQ ID NO.128 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.129, the tracr partner sequence is shown in SEQ ID NO.130; the guide RNA backbone sequence is the sequence of SEQ ID NO.7 except the gene targeting segment, such as SEQ ID NO.131 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.132, the tracr partner sequence is shown in SEQ ID NO.133; the guide RNA backbone sequence is the sequence of SEQ ID NO.8 except the gene targeting segment, such as SEQ ID NO.134 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.135, the tracr partner sequence is shown in SEQ ID NO.136; the guide RNA backbone sequence is the sequence of SEQ ID NO.9 except the gene targeting segment, such as SEQ ID NO.137 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.138, the tracr partner sequence is shown in SEQ ID NO.139; the guide RNA backbone sequence is the sequence of SEQ ID NO.10 except for the gene targeting segment, such as SEQ ID NO.140 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.141, the tracr partner sequence is shown in SEQ ID NO.142; the guide RNA backbone sequence is the sequence of SEQ ID NO.11 except the gene targeting segment, such as SEQ ID NO.143 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.144, the tracr partner sequence is shown in SEQ ID NO.145; the guide RNA backbone sequence is the sequence of SEQ ID NO.12 except for the gene targeting segment, such as SEQ ID NO.146 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.147, the tracr partner sequence is shown in SEQ ID NO.148; the guide RNA backbone sequence is the sequence of SEQ ID NO.13 except the gene targeting segment, such as SEQ ID NO.149 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.150, the tracr partner sequence is shown in SEQ ID NO.151; the guide RNA backbone sequence is the sequence of SEQ ID NO.14 except for the gene targeting segment, such as SEQ ID NO.152 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.153, the tracr partner sequence is shown in SEQ ID NO.154; the guide RNA backbone sequence is the sequence of SEQ ID NO.15 except the gene targeting segment, such as SEQ ID NO.155 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.156, the tracr partner sequence is shown in SEQ ID NO.157; the guide RNA backbone sequence is the sequence of SEQ ID NO.16 except the gene targeting segment, such as SEQ ID NO.158 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.159, the tracr partner sequence is shown in SEQ ID NO.160; the guide RNA backbone sequence is the sequence of SEQ ID NO.17 except for the gene targeting segment, such as SEQ ID NO.161 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.162, the tracr partner sequence is shown in SEQ ID NO.163; the guide RNA backbone sequence is the sequence of SEQ ID NO.18 except for the gene targeting segment, such as SEQ ID NO.164 shown;
  • the tracrRNA sequence is shown in SEQ ID NO.165, the tracr partner sequence is shown in SEQ ID NO.166; the guide RNA backbone sequence is the sequence of SEQ ID NO.19 except for the gene targeting segment, such as SEQ ID NO.167 shown.
  • the underlined part is the targeting sequence, which is preferably the 20 bp fragment after the PAM sequence, which can be replaced by other qualifying targeting sequences.
  • SpCas12f1 The terms “SpCas12f1”, “SpCas12f1 nuclease”, “SpCas12f1 polypeptide”, “SpCas12f1 protein” and “SpCas12f1 protein” are used interchangeably.
  • guide RNA guide RNA
  • gRNA single gRNA
  • chimeric gRNA chimeric gRNA
  • homology refers to the sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing corresponding positions in different polypeptides or nucleic acid molecules. When the same position in the sequence of the molecule being compared is occupied by the same base or amino acid in different sequences, then the molecule is at that position. Homogenous. The degree of homology between sequences is determined as a function of the number of matches or homologous positions shared by the sequences. An "unrelated" or “non-homologous" sequence should have less than 20% homology to one of the sequences disclosed herein.
  • a polynucleotide or polynucleotide region has a certain percentage of sequence homology (e.g., 20%, 30%) with another polynucleotide or polynucleotide region (or polypeptide or polypeptide region). , 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 99%) refers to the percentage of bases (or amino acids) are the same.
  • sequence homology e.g. 20%, 30%
  • polynucleotide and “oligonucleotide” are used interchangeably and they refer to a polymeric form of nucleotides of any length, whether deoxyribonucleotides or ribonucleotides or its analogues. Polynucleotides can have any three-dimensional structure and can perform any function, known or unknown.
  • polynucleotides include, but are not limited to, the following: genes or gene fragments (including probes, primers, EST or SAGE tags), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, Ribozymes, cDNA, dsRNA, siRNA, miRNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes and primers.
  • Polynucleotides also include modified nucleotides, such as methylated nucleotides and nucleotide analogs.
  • any embodiment of a polynucleotide disclosed herein includes its double-stranded form and any of the two complementary single-stranded forms known or predicted to constitute the double-stranded form.
  • the term “encoding” means that the polynucleotide "encodes" a polypeptide, meaning that in its native state or when manipulated by methods well known to those skilled in the art, it can be transcribed and/or Or translated to produce a polypeptide of interest and/or a fragment thereof, or to produce an mRNA capable of encoding the polypeptide of interest and/or a fragment thereof.
  • the antisense strand refers to the sequence that is complementary to the polynucleotide and from which the coding sequence can be deduced.
  • genomic DNA refers to the DNA of the genome of an organism, including the DNA of the genome of bacteria, archaea, fungi, protists, viruses, plants or animals.
  • Manipulating DNA includes binding, nicking one strand, or cleaving both strands of DNA, or includes modifying or editing DNA or polypeptides that bind to DNA.
  • Manipulating DNA can silence, activate or regulate the expression of RNA or polypeptide encoded by the DNA (so that it is not transcribed, or reduces the transcription activity, or makes it not translated, or reduces the level of translation), or prevents or enhances the interaction of the polypeptide with the DNA. combine.
  • Cleavage can be performed by a variety of methods, such as enzymatic or chemical hydrolysis of phosphodiester bonds; cleavage can be single-stranded or double-stranded; DNA cleavage can result in blunt or staggered ends.
  • hybridizable or “complementary” or “substantially complementary” means that a nucleic acid (e.g., RNA) contains a nucleotide sequence that enables it to react at appropriate in vitro and/or in vivo temperatures and solution ionic strengths. Non-covalently bind to another nucleic acid under conditions in a sequence-specific, antiparallel manner, i.e., form Watson-Crick base pairs and/or G/U base pairs, “anneal” or “hybridize” ".
  • sequence of a polynucleotide need not be 100% complementary to the sequence of a target nucleic acid to which it specifically hybridizes.
  • Polynucleotides can hybridize on one or more segments.
  • the polynucleotide may comprise at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or 100% sequence complementarity to a target region within the target nucleic acid sequence to which it is targeted.
  • peptide refers to polymeric forms of amino acids of any length, which may include both coded and non-coded amino acids, chemically or biochemically modified or derivatized Amino acids, and polypeptides with modified peptide backbones.
  • RNA RNA that is translated into a protein
  • RNA RNA that is not translated into a protein
  • a "protein coding sequence” or a sequence encoding a specific protein or polypeptide is a nucleic acid sequence that is transcribed into mRNA (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vivo or in vitro under the control of appropriate regulatory sequences .
  • vector or "expression vector” is a replicon, such as a plasmid, phage, virus or cosmid, to which another DNA segment, i.e., an "insert” can be attached so that the attached segment can be expressed in a cell copy in.
  • expression cassette encompasses a DNA coding sequence operably linked to a promoter.
  • "Operably connected” means connected in parallel, with the components in a relationship that allows them to function in their intended manner.
  • recombinant expression vector or "DNA construct” are used interchangeably in the present invention to refer to a DNA molecule comprising a vector and at least one insert. Recombinant expression vectors are typically produced for the purpose of expressing and/or amplifying inserts or for the construction of other recombinant nucleotide sequences.
  • the cell When foreign DNA, such as a recombinant expression vector, has been introduced into a cell, the cell has been "genetically modified” or “transformed” or “transfected” by the DNA. The presence of foreign DNA results in permanent or transient genetic changes.
  • the transforming DNA may or may not be integrated into the cell's genome.
  • target DNA is a DNA polynucleotide comprising a "target site” or “target sequence”.
  • target site a DNA polynucleotide comprising a "target site” or "target sequence”.
  • target site a DNA polynucleotide comprising a "target site” or "target sequence”.
  • target site a DNA polynucleotide comprising a "target site” or "target sequence”.
  • target site RNA molecules contain sequences that bind, hybridize, or are complementary to target sequences within target DNA, thereby targeting the bound polypeptide to a specific location within the target DNA (target sequence).
  • “Cleaving” refers to the break of the covalent backbone of the DNA molecule.
  • nuclease and “endonuclease” are used interchangeably to refer to enzymes having endonucleic acid degrading catalytic activity for polynucleotide cleavage.
  • the "cleavage domain” or “active domain” or “nuclease domain” of a nuclease refers to a polypeptide sequence or domain within a nuclease that has catalytic activity for DNA cleavage.
  • the cleavage domain may be contained in a single polypeptide chain, or the cleavage activity may result from the association of two or more polypeptides.
  • targeting polypeptide or "RNA-binding site directed polypeptide” refers to a polypeptide that binds RNA and is targeted to a specific DNA sequence.
  • leader sequence or DNA-targeting segment (or “DNA-targeting sequence”) encompasses a nucleotide sequence complementary to a specific sequence within the target DNA, referred to in the present invention as a “protospacer-like” sequence (Complementary strand of target DNA).
  • HDR Homology-directed repair
  • homology-directed repair may result in changes to the target molecule sequence (e.g., insertions, deletions, mutation).
  • nonhomologous end joining refers to the repair of double-stranded breaks in DNA by directly joining the broken ends to each other without the need for homologous templates. NHEJ often results in deletions of nucleotide sequences near the double-strand break site.
  • treatment includes preventing the occurrence of a disease or symptom; inhibiting a disease or symptom or alleviating a disease.
  • the terms "individual”, “subject”, “host” and “patient” are used interchangeably in the present invention and refer to any mammalian subject, particularly a human, for whom diagnosis, treatment or therapy is desired. .
  • the primers used in the examples were all synthesized by Shanghai Sangon Bioengineering Co., Ltd. and Suzhou Jinweizhi Biotechnology Co., Ltd. If the manufacturer of the reagents or instruments used is not indicated, they are regarded as conventional products that can be purchased through regular channels.
  • human embryonic kidney cell HEK293T was used as the cell used in the experiment.
  • Phosphorylation and annealing of target sequence DNA Prepare the annealing system according to Table 1.
  • the phosphorylation procedure is: react at 37°C for 30 minutes. Then add a final concentration of 50mM NaCl to the 10 ⁇ l reaction system and anneal slowly to obtain the annealed target sequence DNA.
  • the target sequence DNA was inserted into the pCMV-SpCas12f1-gRNA_MS1 plasmid through the Golden gate assembly to construct the pCMV-SpCas12f1-gRNA_MS1-G series plasmids (including pCMV-SpCas12f1-gRNA_MS1-G1 to pCMV-SpCas12f1-gRNA_MS1-G32 plasmids). A total of 32 plasmids).
  • the Golden gate assembly system is shown in Table 2 below.
  • Connection procedure 37°C for 2min, 16°C for 3min, repeat this step for a total of 25 cycles, finally 50°C for 10min, 80°C for 10min.
  • the ligation product was transformed into E. coli DH5 ⁇ cells, and single clones were selected for sequencing to obtain pCMV-SpCas12f1-gRNA_MS1-G series plasmids (transient expression plasmids) containing the targeting sequence.
  • HEK293T cells Culture the activated HEK293T cells in DMEM medium containing 10% FBS by volume. When the cell growth density reaches about 90%, they are passaged into a 24-well plate. The number of cells in each well is about 1.0 ⁇ 10 5 . 16-18 hours later, 1000ng of pCMV-SpCas12f1-gRNA_MS1-G plasmid editing different genes was transfected into the cells using 1.5 ⁇ L lipofectamine3000 (Invitrogen) in each well. After 24 hours, fresh medium containing puromycin at a final concentration of 2 ⁇ g/ml was added for selection. After continuing to culture for 48 hours, the adherent cells were digested and genomic DNA was extracted.
  • PCR amplifies the target gene fragment of the target sequence, and the PCR product after gel recovery is annealed with NEBuffer2 (NEB). Then add T7 endonuclease 1 (NEB) to the PCR reaction system, digest at 37°C for 15 minutes, and then add 6 ⁇ Gel Loading Dye (NEB) to terminate the reaction.
  • the reaction products were separated by 6% TBE-PAGE and stained and imaged by 4S Red dye (Sangon Bioengineering (Shanghai) Co., Ltd.).
  • Results Figure 2 shows the gene editing results of mammalian cells mediated by the CRISPR/SpCas12f1 editing system (pCMV-SpCas12f1-gRNA_MS1 series plasmids). As shown in the figure, the CRISPR/SpCas12f1 editing system successfully achieved gene editing of multiple genes on the mammalian cell genome.
  • the tracrRNA and crRNA of the guide RNA corresponding to the SpCas12f1 nuclease were individually transformed and combined.
  • the specific transformation sites and corresponding base lengths are shown in Figure 3.
  • the specific engineering methods and The modified base length is as shown in the following sequence:
  • Coding nucleotides of gRNA_MS1 5'-ttatctctgtttcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaggctaacgcttctctaacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgaaactgagtagaaccgctgtcgcatcttgc gtaagcgcgtggattgaac acacagaggacccctagtaa -3' (SEQ ID NO. 20);
  • the coding nucleotide of gRNA_MS9 truncates 4nt bases at the 5' end of tracrRNA and truncates 3nt bases at the 3' end of tracrRNA: 5'-tctgtttcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaggctaacgcttctctaacggcgaccttggcgaaatgccatcaataccacgcggcccgaa agggttcgcgcgaaactgagaaccgctgtcgcatcttgcgtaagcgcgtggattgaaac acacagaggacccctagtaa –3’ (SEQ ID NO. 28);
  • the coding nucleotide of gRNA_MS10 truncates 7nt bases at the 5' end of tracrRNA and truncates 6nt bases at the 3' end of tracrRNA: 5'- gtttcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaggctaacgcttctctaacggcgaccttggcgaaatgccatcaataccacgcggcccgaaag ggttcgcgcgaaacgaaccgctgtcgcatcttgcgtaagcgcgtggattgaaac acacagaggacccctagtaa –3’ (SEQ ID NO. 29);
  • the coding nucleotide of gRNA_MS11 truncates 10nt bases at the 5' end of tracrRNA and truncates 9nt bases at the 3' end of tracrRNA: 5'-tcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaggctaacgcttctctaacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggt tcgcgcgcgagaaccgctgtcgcatcttgcgtaagcgcgtggattgaaac acacagaggacccctagtaa –3’ (SEQ ID NO. 30);
  • the coding nucleotide of gRNA_MS12 truncates 7nt bases at the 5' end of tracrRNA, truncates 6nt bases at the 3' end of tracrRNA, and truncates 8nt bases at the 5' end of crRNA, and adds AAGG four bases between tracrRNA and crRNA Base for ligation: 5'-gtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaggctaacgcttctctaacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgcgaaacAAGGgtcgcatcttgcgtaagcgcgtggattgaaac a cacagaggacccctagtaaa
  • the coding nucleotide of gRNA_MS13 truncates 7nt bases at the 5' end of tracrRNA, truncates 6nt bases at the 3' end of tracrRNA, and truncates 21nt bases at the 5' end of crRNA, and adds AAGG four bases between tracrRNA and crRNA Base for ligation: 5'-gtttcgcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaggctaacgcttctctaacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgcgaaacAAGGtaagcgcgtggattgaaac acacagaggacccctagtaa -3'(SEQ ID NO.32);
  • Coding nucleotide of gRNA_MS15 cut off the upper half of stem loop 2, 16nt base: 5'-ttactctgtttcgcgccagggcagttaggtgccctaaaagagcgaagtaacgcttctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgaaactgagtagaaccgctgtc gcatcttgcgtaagcgcgtggattgaac acacagaggacccctagtaa –3’ (SEQ ID NO.34);
  • the coding nucleotide of gRNA_MS16 cut off the entire stem loop 2, 32nt bases: 5'-ttactctgtttcgcgccagggcagttaggtgccctaaaagtctctaacgctacggcgaccttggcgaaatgccatcaataccacgcggcccgaaagggttcgcgcgcgaaactgagtagaaccgctgtcgcatcttgcgtaagcg cgtggattgaaac aca cagaggacccctagtaa –3’ (SEQ ID NO. 35);
  • the coding nucleotide of gRNA_MS19 add UUUUAUUUUUUU (SEQ ID NO.169) 11nt base at the 3' end of crRNA: 5'-ttactctgtttcgcgccagggcagttaggtgccctaaaagagcgaagtggccgaaaggaaggctaacgcttctctaacggcgaccttggcgaaatgccatcaataccacg cggccgaaagggttcgcgcgaaactgagtagaaccgctgtcgcatcttgcgtaagcgcgtggattgaac acacagaggacccctagtaa tttttttt–3′ (SEQ ID NO. 38).
  • nucleotide sequence of the guide RNA is shown in SEQ ID NO.1 to SEQ ID NO.19.
  • human embryonic kidney cell HEK293T was used as the cell used in the experiment.
  • the underlined part is the targeting sequence, which is preferably the 20 bp fragment after the PAM sequence.
  • the plasmid construction steps are the same as the first point in Example 1, except that the guide gRNA_MS1 expression cassette corresponding to SpCas12f1 in human cells is replaced with the guide gRNA_MS2-gRNA_MS19 expression cassette, which is pCMV-SpCas12f1-gRNA_MS2, pCMV-SpCas12f1-gRNA_MS3, pCMV- SpCas12f1-gRNA_MS4, pCMV-SpCas12f1-gRNA_MS5, pCMV-SpCas12f1-gRNA_MS6, pCMV-SpCas12f1-gRNA_MS7, pCMV-SpCas12f1-gRNA_MS8, pCMV-SpCas12f1-gRNA_MS9, pCMV-SpCas12f1-gRNA_MS10, pCMV-SpCas 12f1-gRNA_MS
  • the gene editing results of engineered SpCas12f1 gRNA_MS1 to gRNA_MS19 in mammalian cells are shown in Figure 4.
  • the engineered gRNA_MS2, gRNA_MS4, gRNA_MS7, gRNA_MS10, gRNA_MS12, and gRNA_MS13 of SpCas12f1 can improve the gene editing efficiency of SpCas12f1 in mammalian cells, among which gRNA_MS13 is the most efficient; gRNA_MS19 has little effect on cell editing; Removing any one of the four stem-loops on the gRNA will have a great impact on the activity, so all four stem-loops cannot be removed.
  • the preferred SpCas12f1 engineered guide RNA gene sequence described in this example is gRNA_MS13: 5'-guuucgcgcgccagggcaguuaggugcccuaaaagagcgaaguggccgaaaggaaggcuaacgcuucucuaacgcuacggcgaccuuggcgaaaugccaucaauaccacgcggcccgaaaggguucgcgcgaaaggguucgcgcgaaacAAGGuaagcg cguggauugaaac acacagaggaccccuaguaa –3'
  • human embryonic kidney cell HEK293T was used as the cell used in the experiment.
  • the plasmid construction steps are the same as the first point in Example 1, except that the guide gRNA_MS1 expression cassette corresponding to SpCas12f1 in human cells is replaced with the guide gRNA_MS13 expression cassette.
  • point 2 of Example 1 different targeting sequences were inserted into the above plasmids to obtain pCMV-SpCas12f1-gRNA_MS13-G series plasmids containing targeting sequences.
  • FIG. 5 Comparison of the editing efficiency of gRNA_MS1 and gRNA_MS13 in HEK293T cells is shown in Figure 5. It can be seen from the figure that the engineered gRNA_MS13 can be used to achieve efficient editing in mammalian cells.
  • the editing efficiency of the same site can be increased by up to about 9 times compared with gRNA_MS1.
  • the editing efficiency of the Guide3 site can be increased from 2.58% to 21.95%. , greatly improving the activity and versatility of SpCas12f1 in mammalian cell gene editing.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Cell Biology (AREA)
  • Urology & Nephrology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne un système CRISPR/SpCas12f1 optimisé, un ARN guide modifié et son utilisation. Le système d'édition du génome CRISPR/SpCas12f1 comprend : une construction d'expression comprenant une nucléase SpCas12f1 ; et une construction d'expression comprenant une séquence d'ADN exprimée pour un ARN guide correspondant à la nucléase SpCas12f1 et une séquence de ciblage d'une séquence cible. La présente invention concerne également un procédé d'optimisation d'un ARN guide correspondant à une nucléase SpCas12f1, comprenant : la modification de l'ARNtracr et de l'ARNcr individuellement ou en combinaison. En utilisant le système d'édition génique de la présente invention, un gène cible dans une cellule peut être édité avec précision ; en utilisant l'ARN guide optimisé de la présente invention, l'efficacité d'édition et l'applicabilité du système d'édition peuvent être grandement améliorées.
PCT/CN2022/113354 2022-04-25 2022-08-18 Système crispr/spcas12f1 optimisé, arn guide modifié et son utilisation WO2023206871A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CN202210444211.9A CN116987693A (zh) 2022-04-25 2022-04-25 一种优化的CRISPR/SpCas12f1系统、工程化向导RNA及其应用
CN202210444211.9 2022-04-25

Publications (1)

Publication Number Publication Date
WO2023206871A1 true WO2023206871A1 (fr) 2023-11-02

Family

ID=88517099

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/113354 WO2023206871A1 (fr) 2022-04-25 2022-08-18 Système crispr/spcas12f1 optimisé, arn guide modifié et son utilisation

Country Status (2)

Country Link
CN (1) CN116987693A (fr)
WO (1) WO2023206871A1 (fr)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019126762A2 (fr) * 2017-12-22 2019-06-27 The Broad Institute, Inc. Systèmes cas12a, procédés et compositions d'édition ciblée de bases d'arn
WO2020088450A1 (fr) * 2018-10-29 2020-05-07 中国农业大学 Nouvelle enzyme crispr/cas12f et système
WO2020098772A1 (fr) * 2018-11-15 2020-05-22 中国农业大学 Enzyme crispr-cas12j et système
CN113166744A (zh) * 2018-12-14 2021-07-23 先锋国际良种公司 用于基因组编辑的新颖crispr-cas系统
WO2021238128A1 (fr) * 2020-05-28 2021-12-02 上海科技大学 Système et procédé d'édition de génome

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2019126762A2 (fr) * 2017-12-22 2019-06-27 The Broad Institute, Inc. Systèmes cas12a, procédés et compositions d'édition ciblée de bases d'arn
WO2020088450A1 (fr) * 2018-10-29 2020-05-07 中国农业大学 Nouvelle enzyme crispr/cas12f et système
WO2020098772A1 (fr) * 2018-11-15 2020-05-22 中国农业大学 Enzyme crispr-cas12j et système
CN113166744A (zh) * 2018-12-14 2021-07-23 先锋国际良种公司 用于基因组编辑的新颖crispr-cas系统
WO2021238128A1 (fr) * 2020-05-28 2021-12-02 上海科技大学 Système et procédé d'édition de génome

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
GRETA BIGELYTE ET AL.: "Miniature Type V-F CRISPR-Cas Nucleases Enable Targeted DNA Modification in Cells", NATURE COMMUNICATIONS, vol. 12, no. 1, 26 October 2021 (2021-10-26), XP093104321, ISSN: 2041-1723, DOI: 10.1038/s41467-021-26469-4 *

Also Published As

Publication number Publication date
CN116987693A (zh) 2023-11-03

Similar Documents

Publication Publication Date Title
US20230383290A1 (en) High-throughput precision genome editing
US11713471B2 (en) Class II, type V CRISPR systems
CN105441440B (zh) 包含特异于靶dna的向导rna和cas蛋白质编码核酸或cas蛋白质的用于切割靶dna的组合物及其用途
CN116218836A (zh) 编辑rna的方法和组合物
EP3464587B1 (fr) Compositions et méthodes pour améliorer la recombinaison homologue
RU2707542C1 (ru) Способ получения препарата рекомбинантной нуклеазы CAS, по существу, свободного от бактериальных эндотоксинов, полученный данным способом препарат и содержащий его набор для использования в системе CRISPR/Cas
US20230212612A1 (en) Genome editing system and method
US20230416710A1 (en) Engineered and chimeric nucleases
WO2022066335A1 (fr) Systèmes et procédés de transposition de séquences nucléotidiques cargo
WO2023098485A1 (fr) Nouveau système d'édition génomique fondé sur la nucléase c2c9 et son application
US20220298494A1 (en) Enzymes with ruvc domains
WO2023206871A1 (fr) Système crispr/spcas12f1 optimisé, arn guide modifié et son utilisation
TW202330918A (zh) 環形rna及其製備方法
CA3225082A1 (fr) Enzymes ayant des domaines ruvc
WO2024055664A1 (fr) Arn guide optimisé, système d'édition génique crispr/acc2c9 et procédé d'édition génique
WO2023206872A1 (fr) Nucléase optimisée par génie génétique, arn guide, système d'édition et utilisation
WO2022159742A1 (fr) Nouvelles nucléases modifiées et chimériques
CN110241135B (zh) 促进基因编辑的化合物筛选和鉴定及其应用
US20190218533A1 (en) Genome-Scale Engineering of Cells with Single Nucleotide Precision
CN114891786B (zh) 犬Rosa26基因及其应用
US20230348877A1 (en) Base editing enzymes
CN118048343A (zh) Cas9核酸酶及其制备方法和用途
CA3189020A1 (fr) Modification d'acides nucleiques mediee par des nucleases
CN118048344A (zh) 核酸酶及其制备方法和用途
WO2024059811A2 (fr) Édition de gènes dirigée par un rétron

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22939697

Country of ref document: EP

Kind code of ref document: A1