WO2023205724A2 - Cells comprising a suppressor of gene expression and/or a synthetic pathway activator and/or an inducible payload - Google Patents

Cells comprising a suppressor of gene expression and/or a synthetic pathway activator and/or an inducible payload Download PDF

Info

Publication number
WO2023205724A2
WO2023205724A2 PCT/US2023/065998 US2023065998W WO2023205724A2 WO 2023205724 A2 WO2023205724 A2 WO 2023205724A2 US 2023065998 W US2023065998 W US 2023065998W WO 2023205724 A2 WO2023205724 A2 WO 2023205724A2
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
receptor
cell
seq
cytokine
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2023/065998
Other languages
English (en)
French (fr)
Other versions
WO2023205724A3 (en
Inventor
Aaron Cooper
Joseph CHOE
Sofia KYRIAZOPOULOU PANAGIOTOPO
Marian SANDOVAL
Gavin SHAVEY
Stephen Santoro
Luke CASSEREAU
Brian HSU
Jason Hall
Natalie BEZMAN
Thomas Gardner
Anzhi YAO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Arsenal Biosciences Inc
Original Assignee
Arsenal Biosciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Arsenal Biosciences Inc filed Critical Arsenal Biosciences Inc
Priority to AU2023256671A priority Critical patent/AU2023256671A1/en
Priority to CN202380038696.4A priority patent/CN119156398A/zh
Priority to CA3248111A priority patent/CA3248111A1/en
Priority to JP2024561779A priority patent/JP2025514751A/ja
Priority to EP23792773.6A priority patent/EP4496806A2/en
Publication of WO2023205724A2 publication Critical patent/WO2023205724A2/en
Publication of WO2023205724A3 publication Critical patent/WO2023205724A3/en
Priority to US18/919,328 priority patent/US20250049854A1/en
Anticipated expiration legal-status Critical
Priority to MX2024012971A priority patent/MX2024012971A/es
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/14Blood; Artificial blood
    • A61K35/17Lymphocytes; B-cells; T-cells; Natural killer cells; Interferon-activated or cytokine-activated lymphocytes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/10Cellular immunotherapy characterised by the cell type used
    • A61K40/11T-cells, e.g. tumour infiltrating lymphocytes [TIL] or regulatory T [Treg] cells; Lymphokine-activated killer [LAK] cells
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/30Cellular immunotherapy characterised by the recombinant expression of specific molecules in the cells of the immune system
    • A61K40/31Chimeric antigen receptors [CAR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4202Receptors, cell surface antigens or cell surface determinants
    • A61K40/4214Receptors for cytokines
    • A61K40/4217Receptors for interleukins [IL]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4231Cytokines
    • A61K40/4234Interleukins [IL]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4244Enzymes
    • A61K40/4252Phosphatases
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K40/00Cellular immunotherapy
    • A61K40/40Cellular immunotherapy characterised by antigens that are targeted or presented by cells of the immune system
    • A61K40/41Vertebrate antigens
    • A61K40/42Cancer antigens
    • A61K40/4254Adhesion molecules, e.g. NRCAM, EpCAM or cadherins
    • A61K40/4255Mesothelin [MSLN]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • C07K14/5443IL-15
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/7051T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/715Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons
    • C07K14/7155Receptors; Cell surface antigens; Cell surface determinants for cytokines; for lymphokines; for interferons for interleukins [IL]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/40Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515Animal cells
    • A61K2039/5156Animal cells expressing foreign proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/10Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the structure of the chimeric antigen receptor [CAR]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/10Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the structure of the chimeric antigen receptor [CAR]
    • A61K2239/11Antigen recognition domain
    • A61K2239/13Antibody-based
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/10Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the structure of the chimeric antigen receptor [CAR]
    • A61K2239/21Transmembrane domain
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00Indexing codes associated with cellular immunotherapy of group A61K40/00
    • A61K2239/10Indexing codes associated with cellular immunotherapy of group A61K40/00 characterized by the structure of the chimeric antigen receptor [CAR]
    • A61K2239/22Intracellular domain
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/01Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/03Fusion polypeptide containing a localisation/targetting motif containing a transmembrane segment
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed
    • C12N2310/531Stem-loop; Hairpin

Definitions

  • CAR-T cells that are taken from a patient and genetically engineered to produce chimeric antigen receptors, or CARs, receptor proteins that give the T cells a new ability to target a specific protein.
  • the receptors are chimeric because they combine antigen- binding and T-cell activating functions into a single receptor.
  • Immunotherapy using CAR-T cells is promising because the modified T cells have the potential to recognize cancer cells in order to more effectively target and destroy them.
  • the resulting CAR-T cells are introduced into patients to attack tumor cells.
  • CAR-T cells can be either derived from T cells in a patient's own blood (autologous) or derived from the T cells of another healthy donor (allogeneic).
  • CAR-T cells Once CAR-T cells are infused into a patient, they come in contact with their targeted antigen on a cell. The CAR-T cells bind to the antigen and become activated. Upon antigen engagement, CAR T cells can proliferate exponentially, initiate antitumor cytokine production, and target tumor cell killing. [0006] However, there remain some concerns and limitations to CAR T cell–based immunotherapy. Some CAR T cells may engage with normal cells expressing low levels of target antigens, leading to off target toxicity. Thus, additional therapies are required that reduce off-target toxicity.
  • This disclosure generally relates to systems and methods for enhancing the function of CAR-expressing immune cells (e.g., through use of a logic gate comprising a CAR and a priming receptor along with a synthetic pathway activator (SPA) that enhances immune cell stimulation by inducing constitutive cytokine signaling).
  • SPA synthetic pathway activator
  • the systems and methods disclosed herein provide improved efficacy and antigen-specific targeting of CAR-immune cells.
  • a system comprising system comprising: a first chimeric polypeptide comprises a priming receptor; a second chimeric polypeptide comprises a chimeric antigen receptor (CAR); and a cytokine.
  • a system comprising system comprising: a first chimeric polypeptide comprising a priming receptor; a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); and a third chimeric polypeptide comprising a synthetic pathway activator (SPA).
  • a first chimeric polypeptide comprising a priming receptor
  • a second chimeric polypeptide comprising a chimeric antigen receptor (CAR)
  • SPA synthetic pathway activator
  • a system comprising system comprising: a first chimeric polypeptide comprising a priming receptor; a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); a third chimeric polypeptide comprising a synthetic pathway activator (SPA); and a cytokine
  • a system comprising (a) a first chimeric polypeptide comprising a priming receptor, (b) a second chimeric polypeptide comprising a chimeric antigen receptor (CAR), (c) a suppressor of gene expression, and a (d) one or both of (i) third chimeric polypeptide comprising a synthetic pathway activator (SPA) and/or (ii) a cytokine.
  • the priming receptor comprises, from N-terminus to C- terminus, a first extracellular antigen-binding domain; a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and an intracellular domain comprising a human or humanized transcriptional effector.
  • the first extracellular antigen-binding domain specifically binds to Alkaline Phosphatase, Germ Cell (ALPG/P).
  • the first extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein: CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, 39, 40, 41, or 42, CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, 43, 44, 45, or 46, CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, 47, or 48, CDR-L1 comprises the sequence set forth in SEQ ID NO: 4, 49, or 50, CDR-L2 comprises the sequence set forth in SEQ ID NO: 5 or 51; and CDR-L3 comprises the sequence set forth in SEQ ID NO: 6 or 53.
  • VH1 comprises the sequence set forth in SEQ ID NO: 1
  • CDR-H2 comprises the sequence set forth in
  • the VH chain sequence comprises the sequence set forth in SEQ ID NO: 7.
  • the VL chain sequence comprises the sequence set forth in SEQ ID NO: 8.
  • the first extracellular antigen- binding domain comprises the sequence set forth in SEQ ID NO: 9.
  • binding of ALPG/P by the first extracellular antigen-binding domain results in cleavage at the one or more ligand-inducible proteolytic cleavage sites within the intracellular domain.
  • the priming receptor further comprises a first hinge domain positioned between the first extracellular antigen-binding domain and the first transmembrane domain.
  • the first hinge domain comprises a CD8 ⁇ or truncated CD8 ⁇ hinge domain. In some embodiments, the first hinge comprises the sequence as set forth in SEQ ID NO: 18. [0014] In some embodiments, the first transmembrane domain comprises a Notch1 transmembrane domain. In some embodiments, the first transmembrane domain comprises the sequence as set forth in SEQ ID NO: 19. [0015] In some embodiments, the intracellular domain comprises an HNF1a/p65 domain or a Gal4/VP64 domain. In some embodiments, the intracellular domain comprises the sequence as set forth in SEQ ID NO: 23.
  • the priming receptor further comprises a stop-transfer- sequence between the first transmembrane domain and the intracellular domain.
  • the stop-transfer-sequence comprises the sequence as set forth in SEQ ID NO: 20.
  • the priming receptor comprises a sequence as set forth in SEQ ID NO: 24.
  • the CAR comprises, from N-terminus to C-terminus, (a) a second extracellular antigen-binding domain; (b) a second transmembrane domain; (c) an intracellular co-stimulatory domain; and (d) an intracellular activation domain.
  • the second extracellular antigen-binding domain specifically binds to mesothelin (MSLN), and the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR- H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein: (a) CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, 54, 56, 57, or 71, (b) CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, 58, 59, 60, 61, or 308, (c) CDR-H3 comprises the sequence set forth in SEQ ID NO: 12, 62, or 63, (d) CDR-L1 comprises the sequence set forth in SEQ ID NO: 14, 64, 65, 66, or 67, (e) CDR-L2 comprises
  • the VH chain sequence comprises the sequence set forth in SEQ ID NO: 13. In some embodiments, the VL chain sequence comprises the sequence set forth in SEQ ID NO: 17. In some embodiments, the second extracellular antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO: 30. [0019] In some embodiments, the CAR comprises a second hinge domain. In some embodiments, the second hinge domain comprises a CD8 ⁇ or truncated CD8 ⁇ hinge domain. In some embodiments, the second transmembrane domain comprises a CD8 ⁇ transmembrane domain. In some embodiments, the intracellular co-stimulatory domain comprises a 4-1BB domain. In some embodiments, the intracellular activation domain comprises a CD3 ⁇ domain.
  • the CAR comprises a sequence as set forth in SEQ ID NO: 31 or 32.
  • the SPA is an activator of STAT phosphorylation, optionally STAT1, STAT3 and/or STAT5 phosphorylation.
  • the SPA comprises an extracellular domain linked to an intracellular signaling domain.
  • the intracellular signaling domain comprises an intracellular signaling region derived from a cytokine receptor.
  • the intracellular signaling domain comprises a polypeptide sequence derived from an interleukin receptor.
  • the cytokine receptor comprises interleukin-6 signal transducer (IL6ST).
  • the extracellular domain conveys constitutive activity to the intracellular signaling domain.
  • the extracellular domain comprises a dimerization region, optionally wherein the dimerization region comprises at least one of a cysteine residue and a leucine zipper.
  • the dimerization region forms a homodimer.
  • the SPA comprises a leucine zipper-gp130 (L-gp130).
  • the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 74.
  • the SPA comprises the amino acid sequence of SEQ ID NO: 74. In some embodiments, the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 75. In some embodiments, the SPA comprises the amino acid sequence of SEQ ID NO: 75. [0023] In some embodiments, the extracellular domain comprises a polypeptide derived from a cytokine and mimics receptor agonism. In some embodiments, the SPA comprises a membrane-bound interleukin-15 (mbIL-15).
  • mbIL-15 membrane-bound interleukin-15
  • the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% % identical to the sequence set forth in SEQ ID NO: 76.
  • the SPA comprises the amino acid sequence of SEQ ID NO: 76.
  • the SPA comprises a CD34-interleukin-7 receptor (C7R).
  • the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 77.
  • the SPA comprises an amino acid sequence of SEQ ID NO: 77.
  • the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 78.
  • the SPA comprises an amino acid sequence of SEQ ID NO: 78.
  • the cytokine is a secreted cytokine.
  • the cytokine is an interleukin.
  • the cytokine comprises at least one of interleukin (IL)-2, Super-2, IL-12, IL-12/23p40, IL-7, IL-15, IL-21, and IL-18.
  • the cytokine is IL-2.
  • the cytokine is Super-2.
  • the cytokine is IL-12.
  • the cytokine is IL-12/23p40.
  • the cytokine is IL-7. In some embodiments, the cytokine is IL-15. In some embodiments, the cytokine is IL-21. In some embodiments, the cytokine is IL-18. [0026] In some embodiments, the cytokine comprises a non-native signal peptide. In some embodiments, the non-native signal peptide comprises a signal peptide from at least one of CD44, CD3E, CD5, IGTAL, IL-2, GMCSF, chymotrypsinogen, trypsinogen, IgK, IgKVIII, IgE, OSM, IgG2H, BM40, secrecon, and tPA.
  • the non-native signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, or 130.
  • the cytokine comprises the amino acid sequence set forth in SEQ ID NO: 86, 88, 90, 92, 94, 96, 98 or 132.
  • the suppressor of gene expression is an sgRNA or an shRNA. In some embodiments, the suppressor of gene expression is an sgRNA.
  • the sgRNA suppresses the expression of a gene selected from PTPN2, RASA2, SOCS1, ZC3H12A, and CISH. In some embodiments, the sgRNA suppresses the expression of PTPN2. In some embodiments, the sgRNA suppresses the expression of RASA2. In some embodiments, the sgRNA suppresses the expression of SOCS1. In some embodiments, the sgRNA suppresses the expression of ZC3H12A. In some embodiments, the sgRNA suppresses the expression of CISH. In some embodiments, the sgRNA comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 160-164.
  • the suppressor of gene expression is an shRNA.
  • the shRNA suppresses the expression of a gene selected from RASA2, SOCS1, ZC3H12A, TGFBR1, and CISH.
  • the shRNA suppresses the expression of RASA2.
  • the shRNA suppresses the expression of SOCS1.
  • the shRNA suppresses the expression of ZC3H12A.
  • the shRNA suppresses the expression of TGFBR1.
  • the shRNA suppresses the expression of CISH.
  • the shRNA comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 165-172.
  • the system comprises two or more suppressors of gene expression.
  • the system comprises an shRNA that suppresses the expression of TNFRSF6 (Fas) and an additional suppressor of gene expression.
  • the system comprises an shRNA that suppresses the expression of TNFRSF6 (Fas), an shRNA that suppresses the expression of TGFBR2 and an additional suppressor of gene expression.
  • the system comprises an shRNA that suppresses the expression of TNFRSF6 (Fas), an shRNA that suppresses the expression of PTPN2 and an additional suppressor of gene expression.
  • the system comprises an sgRNA that suppresses CISH expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses PTPN2 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses RASA2 expression and a cytokine that is IL- 2. In some embodiments, the system comprises an sgRNA that suppresses SOCS1 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and a cytokine that is IL-2.
  • the system comprises an shRNA that suppresses RASA2 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses PTPN2 expression and a cytokine that is IL-21. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and a cytokine that is IL-21. In some embodiments, the system comprises an sgRNA that suppresses CISH expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses PTPN2 expression and an SPA that is C7R.
  • the system comprises an sgRNA that suppresses RASA2 expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses SOCS1 expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses CISH expression and an SPA that is L-gp130. In some embodiments, the system comprises an sgRNA that suppresses RASA2 expression and an SPA that is L-gp130.
  • the system comprises an sgRNA that suppresses ZC3H12A expression and an SPA that is L-gp130.
  • the system comprises an shRNA that suppresses RASA2 expression, a cytokine that is IL-2, and an SPA that is L-gp130.
  • the system comprises an sgRNA that suppresses RASA2 expression, a cytokine that is IL-2, and an SPA that is L-gp130.
  • the system comprises an shRNA that suppresses RASA2 expression, a cytokine that is IL-15, and an SPA that is L-gp130.
  • the system comprises an sgRNA that suppresses RASA2 expression, a cytokine that is IL-15, and an SPA that is L-gp130.
  • the priming receptor and the CAR are capable of binding to a same target cell.
  • the target cell is a human cell.
  • the target cell is a cancer cell.
  • the cancer cell is a solid cancer cell or a liquid cancer cell.
  • the cancer cell is ovarian cancer, fallopian cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer.
  • nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding the system disclosed herein.
  • one or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising: a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain; a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain; and a nucleotide sequence encoding a cytokine.
  • nucleic acids comprising at least one nucleic acid fragment comprising: a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain; a nucleotide sequence encoding a chimeric antigen receptor comprising an second extracellular antigen-binding domain; and a nucleotide sequence encoding a synthetic pathway activator.
  • nucleic acids comprising at least one nucleic acid fragment comprising: a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain; a nucleotide sequence encoding a chimeric antigen receptor comprising an second extracellular antigen-binding domain; a nucleotide sequence encoding a synthetic pathway activator; and a nucleotide sequence encoding a cytokine.
  • nucleic acids comprising at least one nucleic acid fragment comprising: a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain; a nucleotide sequence encoding a chimeric antigen receptor comprising an second extracellular antigen-binding domain; a nucleotide sequence of a suppressor of gene expression; and one or both of: a nucleotide sequence encoding a synthetic pathway activator and/or a nucleotide sequence encoding a cytokine.
  • the first extracellular antigen-binding domain specifically binds to ALPG/P.
  • the second extracellular antigen-binding domain specifically binds to MSLN.
  • the recombinant nucleic acid comprises two or more nucleic acid fragments. [0037] In some embodiments, the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the CAR. In some embodiments, the recombinant nucleic acid further comprises a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor. In some embodiments, the recombinant nucleic acid further comprises a constitutive promoter operably linked to the nucleotide sequence encoding the synthetic pathway activator.
  • the priming receptor and the synthetic pathway activator are under the control of the same constitutive promoter.
  • the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor and a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor and the nucleotide sequence encoding the synthetic pathway activator.
  • the nucleic acid comprises, in a 5’ to 3’ direction, the constitutive promoter; the nucleotide sequence encoding the synthetic pathway activator; the nucleotide sequence encoding priming receptor; the inducible promoter; and the nucleotide sequence encoding chimeric antigen receptor.
  • the nucleic acid comprises, in a 5’ to 3’ direction, the inducible promoter; the nucleotide sequence encoding chimeric antigen receptor; the constitutive promoter ;the nucleotide sequence encoding priming receptor; and the nucleotide sequence encoding the synthetic pathway activator.
  • the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the cytokine.
  • the recombinant nucleic acid further comprises: (a) an inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor and the nucleotide sequence encoding the cytokine; and (b) a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor.
  • the nucleic acid comprises, in a 5’ to 3’ direction, (a) the constitutive promoter; (b) the nucleotide sequence encoding the priming receptor; (c) the inducible promoter; d) the nucleotide sequence encoding the chimeric antigen receptor; and (e) the nucleic acid sequence encoding the cytokine.
  • the nucleic acid comprises, in a 5’ to 3’ direction, (a) the constitutive promoter; (b) the nucleotide sequence encoding the priming receptor; (c) the inducible promoter; (d) the nucleotide sequence encoding the cytokine; and (e) the nucleic acid sequence encoding the chimeric antigen receptor.
  • the nucleic acid comprises, in a 5’ to 3’ direction, (a) the inducible promoter; (b) the nucleotide sequence encoding the chimeric antigen receptor; (c) the nucleic acid sequence encoding the cytokine; (d) the constitutive promoter; and (e) the nucleotide sequence encoding the priming receptor.
  • the nucleic acid comprises, in a 5’ to 3’ direction, (a) the inducible promoter; (b) the nucleotide sequence encoding the cytokine; (c) the nucleic acid sequence encoding the chimeric antigen receptor; (d) the constitutive promoter; and (e) the nucleotide sequence encoding the priming receptor.
  • the recombinant nucleic acid further comprises: (a) a first inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor; (b) a second inducible promoter operably linked to the nucleotide sequence encoding the cytokine; and (c) a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor.
  • the nucleic acid comprises, in a 5’ to 3’ direction, (a) the constitutive promoter; (b) the nucleotide sequence encoding the priming receptor; (c) the first inducible promoter; (d) the nucleotide sequence encoding the chimeric antigen receptor; (e) the second inducible promoter; and (f) the nucleic acid sequence encoding the cytokine.
  • the nucleic acid comprises, in a 5’ to 3’ direction, (a) the constitutive promoter; (b) the nucleotide sequence encoding the priming receptor; (c) the second inducible promoter; (c) the nucleic acid sequence encoding the cytokine; (d) the first inducible promoter; and (e) the nucleotide sequence encoding the chimeric antigen receptor.
  • the nucleic acid comprises, in a 5’ to 3’ direction, (a) the first inducible promoter; (b) the nucleotide sequence encoding the chimeric antigen receptor; (c) the second inducible promoter; (d) the nucleic acid sequence encoding the cytokine; (e) the constitutive promoter; and (f) the nucleotide sequence encoding the priming receptor.
  • the nucleic acid comprises, in a 5’ to 3’ direction, (a) the first inducible promoter; (b) the nucleotide sequence encoding the chimeric antigen receptor; (c) the constitutive promoter; (d) the nucleotide sequence encoding the priming receptor; (e) the second inducible promoter; and (f) the nucleic acid sequence encoding the cytokine.
  • the nucleic acid comprises, in a 5’ to 3’ direction, (a) the second inducible promoter; (b) the nucleic acid sequence encoding the cytokine; (c) the first inducible promoter; (d) the nucleotide sequence encoding the chimeric antigen receptor; (e) the constitutive promoter; and (f) the nucleotide sequence encoding the priming receptor.
  • the nucleic acid comprises, in a 5’ to 3’ direction, (a) the second inducible promoter; (b) the nucleic acid sequence encoding the cytokine; (c) the constitutive promoter; (d) the nucleotide sequence encoding priming receptor; (e) the first inducible promoter; and (f) the nucleotide sequence encoding chimeric antigen receptor.
  • the first inducible promoter and the second inducible promoter are identical.
  • the nucleotide sequence encoding the priming receptor comprises the sequence set forth in SEQ ID NO: 35.
  • the nucleotide sequence encoding the chimeric antigen receptor comprises the sequence set forth in SEQ ID NO: 36.
  • the nucleotide sequence encoding the synthetic pathway activator comprises the sequence set forth in SEQ ID NO: 79, 80, 81, 82, or 83.
  • the nucleotide sequence encoding the cytokine comprises the sequence set forth in SEQ ID NO: 87, 89, 91, 93, 95, 97, or 99.
  • the suppressor of gene expression comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 160- 172.
  • the nucleic acid further comprises a 5’ homology directed repair arm and a 3’ homology directed repair arm complementary to an insertion site in a host cell chromosome.
  • the recombinant nucleic acid further comprises a nucleotide sequence encoding a self-excising 2A peptide (P2A).
  • P2A is at the 3’ end of the nucleotide sequence encoding chimeric antigen receptor.
  • the P2A is at the 3’ end of the nucleotide sequence encoding priming receptor.
  • the recombinant nucleic acid further comprises a woodchuck hepatitis virus post-translational regulatory element (WPRE).
  • WPRE woodchuck hepatitis virus post-translational regulatory element
  • the WPRE is at the 3’ end of the nucleotide sequence encoding chimeric antigen receptor and at the 5’ end of the nucleotide sequence encoding priming receptor or wherein the WPRE is at the 3’ end of the nucleotide sequence encoding priming receptor and at the 5’ end of the nucleotide sequence encoding chimeric antigen receptor.
  • the recombinant nucleic acid further comprises an SV40 polyA element.
  • the nucleic acid is incorporated into an expression cassette or an expression vector.
  • the expression vector is a non-viral vector.
  • an expression vector comprising the recombinant nucleic acid disclosed herein.
  • the 5’ and 3’ ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in a genome of a primary cell.
  • the insertion site is located at a T Cell Receptor Alpha Constant (TRAC) locus or a genomic safe harbor (GSH) locus.
  • T Cell Receptor Alpha Constant T Cell Receptor Alpha Constant
  • GSH genomic safe harbor
  • an immune cell comprising: the system disclosed herein; at least one recombinant nucleic acid disclosed herein; and/or the vector disclosed herein.
  • the immune cell is a primary human immune cell.
  • the immune cell is an allogeneic immune cell.
  • the immune cell is an autologous immune cell.
  • the primary immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor.
  • the primary immune cell is a primary T cell.
  • the primary immune cell is a primary human T cell.
  • the primary immune cell is virus-free.
  • a primary immune cell comprising at least one recombinant nucleic acid comprising: a nucleic acid sequence encoding a priming receptor comprising a first extracellular antigen-binding domain; a nucleic acid sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain; and a nucleic acid sequence encoding a cytokine and/or a synthetic pathway activator; wherein the recombinant nucleic acid is inserted into a target region of the genome of the primary immune cell, wherein the primary immune cell does not comprise a viral vector for introducing the recombinant nucleic acid into the primary immune cell.
  • the first extracellular antigen-binding domain specifically binds to ALPG/P.
  • the second extracellular antigen-binding domain specifically binds to MSLN.
  • a viable, virus-free, primary cell comprising a ribonucleoprotein complex (RNP)- recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein recombinant nucleic acid comprises: a nucleic acid sequence encoding a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to ALPG/P; a nucleic acid sequence encoding a chimeric antigen receptor comprising a second extracellular antigen- binding domain that specifically binds to MSL; and a nucleic acid sequence encoding a cytokine and/or a synthetic pathway activator that constitutively activates cytokine signaling; wherein
  • RNP ribonucleoprotein complex
  • the first extracellular antigen-binding domain specifically binds to ALPG/P. In some embodiments, the second extracellular antigen- binding domain specifically binds to MSLN.
  • a population of cells comprising a plurality of immune cells disclosed herein.
  • a pharmaceutical composition comprising the immune cell disclosed herein or the population of cells disclosed herein, and a pharmaceutically acceptable excipient.
  • a pharmaceutical composition comprising the recombinant nucleic acid disclosed herein or the vector disclosed herein, and a pharmaceutically acceptable excipient.
  • a method of editing an immune cell comprising: providing a ribonucleoprotein complex (RNP)-recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the recombinant nucleic acid comprises the recombinant nucleic acid disclosed herein, and wherein the 5’ and 3’ ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the genome of the immune cell; non-virally introducing the RNP-recombinant nucleic acid complex into the immune cell, wherein the guide RNA specifically hybridizes to a target region of the genome of the primary immune cell, and wherein the nuclease domain cleaves the target region to create the insertion site in the genome of the immune cell; and editing the immune cell via insertion of the recombinant nucleic acid disclosed herein into the insertion
  • RNP ribonucleoprotein complex
  • non-virally introducing comprises electroporation.
  • the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.
  • the target region of the genome of the cell is a T Cell Receptor Alpha Constant (TRAC) locus or a genomic safe harbor (GSH) locus.
  • the recombinant nucleic acid is a double-stranded recombinant nucleic acid or a single-stranded recombinant nucleic acid.
  • the recombinant nucleic acid is a linear recombinant nucleic acid or a circular recombinant nucleic acid, optionally wherein the circular recombinant nucleic acid is a plasmid.
  • the immune cell is a primary human immune cell. In some embodiments, the immune cell is an autologous immune cell. In some embodiments, the immune cell is an allogeneic immune cell. In some embodiments, the immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor. In some embodiments, the immune cell is a primary T cell.
  • NK natural killer
  • the immune cell is a primary human T cell. In some embodiments, the immune cell is virus- free. In some embodiments, the method further comprises obtaining the immune cell from a patient and introducing the recombinant nucleic acid in vitro. [0067] Also disclosed herein, in various embodiments, is a method of treating a disease in a subject comprising administering the immune cell disclosed herein or primary cells disclosed herein or the pharmaceutical composition disclosed herein to the subject. In some embodiments, the disease is cancer. In some embodiments, the cancer is a solid cancer or a liquid cancer.
  • the cancer is ovarian cancer, fallopian cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer.
  • the administration of the immune cell enhances an immune response in the subject.
  • the enhanced immune response is an adaptive immune response.
  • the enhanced immune response is an innate immune response.
  • the enhanced immune response is an increased expression of at least one cytokine or chemokine.
  • the at least one cytokine or chemokine is IL-2 or IFN ⁇ .
  • the enhanced immune response is an increased lysis of target cells.
  • the method further comprises administering an immunotherapy to the subject concurrently with the immune cell or subsequently to the immune cell.
  • a method of modulating the activity of an immune cell comprising: obtaining an immune cell comprising the system disclosed herein; the recombinant nucleic acid disclosed herein; and/or the vector disclosed herein; and contacting the immune cell with a target cell expressing ALPG/P and MSLN, wherein binding of the priming receptor to ALPG/P on the target cell induces activation of the priming receptor and expression of the chimeric antigen receptor, wherein binding of the chimeric antigen receptor to MSLN on the target cell modulates the activity of the immune cell, and wherein the cytokine and/or the synthetic pathway activator also modulates the activity of the immune cell.
  • the modulation of the immune cell activity comprises enhancing an immune response.
  • the enhanced immune response is an adaptive immune response.
  • the enhanced immune response is an innate immune response.
  • the immune cell activity is an increased expression of at least one cytokine or chemokine.
  • the at least one cytokine or chemokine is IL-2 or IFN ⁇ .
  • the immune cell activity is lysis of target cells.
  • a system comprising: (a) at least one of a CAR, an SPA, and a cytokine; and (b) a suppressor of RASA2 expression.
  • the SPA comprises a leucine zipper-gp130 (L-gp130).
  • the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 74.
  • the SPA comprises the amino acid sequence of SEQ ID NO: 74.
  • the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 75. In some embodiments, the SPA comprises the amino acid sequence of SEQ ID NO: 75. [0072] In some embodiments, the cytokine is IL-2. In some embodiments, the cytokine comprises the amino acid sequence set forth in SEQ ID NO: 86. In some embodiments, the cytokine is IL-15. In some embodiments, the cytokine comprises the amino acid sequence set forth in SEQ ID NO: 96.
  • the suppressor of RASA2 expression is an shRNA or an sgRNA. In some embodiments, the suppressor of RASA2 expression is an shRNA. In some embodiments, the shRNA comprises the nucleic acid sequence of SEQ ID NO: 165. In some embodiments, the suppressor of RASA2 expression is an sgRNA. In some embodiments, the sgRNA comprises the nucleic acid sequence of SEQ ID NO: 161. [0073] In some embodiments, the system further comprises an shRNA that suppresses the expression of TNFRSF6 (Fas). In some embodiments, the system further comprises an shRNA that suppresses the expression of TGFBR2. In some embodiments, the system further comprises an shRNA that suppresses the expression of PTPN2.
  • nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding the system disclosed herein.
  • an expression vector comprising the recombinant nucleic acid sequence provided herein.
  • an engineered immune cell comprising: the system disclosed herein; the recombinant nucleic acid sequence disclosed herein; or the expression vector disclosed herein.
  • an improvement comprising: (a) at least one of a CAR, an SPA, and a cytokine; and (b) a suppressor of RASA2 expression.
  • the SPA comprises a leucine zipper- gp130 (L-gp130).
  • the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 74.
  • the SPA comprises the amino acid sequence of SEQ ID NO: 74.
  • the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 75. In some embodiments, the SPA comprises the amino acid sequence of SEQ ID NO: 75. [0078] In some embodiments, the cytokine is IL-2. In some embodiments, the cytokine comprises the amino acid sequence set forth in SEQ ID NO: 86. In some embodiments, the suppressor of RASA2 expression is an shRNA or an sgRNA. In some embodiments, the suppressor of RASA2 expression is an shRNA.
  • the shRNA comprises the nucleic acid sequence of SEQ ID NO: 165.
  • the suppressor of RASA2 expression is an sgRNA.
  • the sgRNA comprises the nucleic acid sequence of SEQ ID NO: 161.
  • the engineered immune cell further comprises an shRNA that suppresses the expression of TNFRSF6 (Fas).
  • the engineered immune cell further comprises an shRNA that suppresses the expression of TGFBR2.
  • the engineered immune cell further comprises an shRNA that suppresses the expression of PTPN2.
  • the engineered immune cell is a primary human immune cell.
  • the engineered immune cell is an allogeneic immune cell. In some embodiments, the engineered immune cell is an autologous immune cell. In some embodiments, the primary immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor. In some embodiments, the primary immune cell is a primary T cell. In some embodiments, wherein the primary immune cell is a primary human T cell. In some embodiments, the primary immune cell is virus-free. [0081] Also disclosed herein, in various embodiments, is a population of cells comprising a plurality of engineered immune cells disclosed herein.
  • a pharmaceutical composition comprising the engineered immune cell disclosed herein or the population of disclosed herein and a pharmaceutically acceptable excipient.
  • a method of treating a disease in a subject comprising administering the engineered immune cell disclosed herein or the pharmaceutical composition disclosed herein to the subject.
  • the disease is cancer.
  • the cancer is a solid cancer or a liquid cancer.
  • the cancer is ovarian cancer, fallopian cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer.
  • the administration of the engineered immune cell enhances an immune response in the subject.
  • the enhanced immune response is an adaptive immune response.
  • the enhanced immune response is an innate immune response.
  • the enhanced immune response is an increased expression of at least one cytokine or chemokine.
  • the at least one cytokine or chemokine is IL-2 or IFN ⁇ .
  • the enhanced immune response is an increased lysis of target cells.
  • the method further comprises administering an immunotherapy to the subject concurrently with the engineered immune cell or subsequently to the engineered immune cell.
  • FIG. 1 shows a schematic of an exemplary logic gate protein expression system employing a synthetic pathway activator (SPA).
  • FIG. 2A shows the fold change of T cells expressing various pro-survival receptors cultured in cytokine-free media over a 6-day period.
  • the percentage of logic gate-expressing T cells (LG T cells) in culture is defined by the number of cells expressing the Myc tag on the primeR.
  • FIG. 2B shows the absolute cell count of the cells from FIG. 2A expressed as fold change from the first day of culture.
  • FIG. 3 shows phosphorylation of STAT1, STAT3, and STAT5 proteins under non- stimulated conditions in T cells expressing two types of synthetic pathway activators, as compared to T cells expressing an inert truncated EGFR molecule on the surface (EGFRt).
  • FIG. 4A shows a comparison of baseline pSTAT1 levels across LG Ts expressing various types of synthetic pathway activators or constitutively secreted cytokine molecules.
  • FIG. 4B shows a comparison of baseline pSTAT3 levels across LG Ts expressing various types of synthetic pathway activators or constitutively secreted cytokine molecules.
  • FIG. 4C shows a comparison of baseline pSTAT5 levels across LG Ts expressing various types of synthetic pathway activators or constitutively secreted cytokine molecules.
  • FIG. 5A shows primeR surface expression in T cells expressing the indicated proteins cultured alone or with antigen-negative tumor cells.
  • FIG. 5B shows catalytic CAR surface expression in T cells expressing the indicated proteins cultured alone or with antigen- negative tumor cells.
  • FIG. 6A shows cytotoxic activity of LG Ts expressing pro-survival modules or an inert EGFRt molecule when cocultured with antigen-positive cells.
  • FIG. 6B shows cytotoxic activity of LG Ts expressing pro-survival modules or an inert EGFRt molecule when cocultured with antigen-negative cells.
  • FIG. 7A shows continual analysis over a 72hr period of tumor cell killing by LG Ts expressing pro-survival molecules at 4 different Effector:Target ratios.
  • FIG. 7B shows continual analysis over a 72hr period of T cell expansion during coculture with antigen- positive tumor cells at 4 different Effector:Target ratios.
  • FIG. 7A shows continual analysis over a 72hr period of tumor cell killing by LG Ts expressing pro-survival molecules at 4 different Effector:Target ratios.
  • FIG. 7B shows continual analysis over a 72hr period of T cell expansion during coculture with antigen- positive tumor cells at 4
  • FIG. 8A shows cell counts of logic gate T cells expressing indicated pro-survival receptors cultured with ALPG/MSLN-expressing RPMI cells over a 10 day period.
  • FIG. 8B shows a representative well image of logic gate T cells expressing truncated EGFR at day 10.
  • FIG. 8C shows a representative well image of logic gate T cells expressing a gp130-based SPA at day 10.
  • FIG. 9 shows quantification of flow cytometry staining of various T cell phenotype markers on pre-challenge LG Ts expressing various pro-survival molecules.
  • FIG. 10 shows cytotoxicity and T cell expansion throughout a 15-day repetitive stimulation assay wherein LG Ts were challenged every 2-3 days with K562 tumor cells.
  • FIG. 11A shows summary metrics depicting total tumor cell expansion throughout a 31-day repetitive stimulation assay (in presence or absence of IL-2-supplemented media) with data from two donors shown (left and right panels).
  • FIG. 11B shows summary metrics depicting total T cell expansion throughout a 31-day repetitive stimulation assay (in presence or absence of IL-2-supplemented media) with data from two donors shown (left and right panels).
  • FIG. 12 shows cell viability of T cells expressing indicated pro-survival receptors cultured in cytokine-free media over a 6-day period following 6 consecutive rounds of tumor challenge.
  • FIG. 11A shows summary metrics depicting total tumor cell expansion throughout a 31-day repetitive stimulation assay (in presence or absence of IL-2-supplemented media) with data from two donors shown (left and right panels).
  • FIG. 12 shows cell viability of T cells expressing indicated pro-survival receptors cultured in cytokine-free media over a 6-day period following 6 consecutive rounds of tumor challenge.
  • FIG. 13A shows quantification of flow cytometry staining of various T cell phenotype markers on ICTs after 6 rounds of tumor challenge in the absence of IL-2- supplemented media.
  • FIG. 13B shows quantification of flow cytometry staining of various T cell phenotype markers on ICTs after 6 rounds of tumor challenge in the presence of IL-2- supplemented media.
  • FIG. 14A shows comparison of cell phenotype in ICTs stimulated with tumor cells in the absence of IL-2.
  • FIG. 14B shows comparison of cell phenotype in ICTs stimulated with tumor cells in the presence of IL-2.
  • FIG. 15A shows comparison of cell phenotype change over time in T cells expressing truncated EGFR stimulated with tumor cells in the absence of IL-2.
  • FIG. 15B shows comparison of cell phenotype change over time in T cells expressing truncated EGFR stimulated with tumor cells in the presence of IL-2.
  • FIG. 15C shows comparison of cell phenotype change over time in T cells expressing a gp130-based SPA stimulated with tumor cells in the absence of IL-2.
  • FIG. 15D shows comparison of cell phenotype change over time in T cells expressing a gp130-based SPA stimulated with tumor cells in the presence of IL-2.
  • FIGs. 16A-16B shows phosphorylation of STAT3 (FIG.
  • FIG. 16A shows relative expansion of target cells following incubation with LG T cells expressing EGFRt or L-gp130 with or without knockdown of FAS/PTPN2.
  • FIG. 17B shows relative counts of SPA-expressing LG T cells expressing the indicated surface markers, as measured by flow cytometry.
  • FIG. 18A is a heatmap of differential gene expression in LG T cells expressing an SPA before and after challenge with a repetitive stimulation assay.
  • FIG. 18B is a heatmap of differential expression of selected markers of T cell exhaustion in LG T cells before and after challenge with a repetitive stimulation assay.
  • FIG. 19 depicts the accessibility of genetic loci of selected markers (TIGIT and TOX) of T cell exhaustion in LG T cells as measured by ATAC-seq before and after challenge with a repetitive stimulation assay.
  • FIG. 20 diagrams the SPA interrogation assay design in mice using CAR/primeR logic gate T cells expressing the indicated SPAs.
  • FIG. 21 diagrams the SPA interrogation assay design in mice using CAR/primeR logic gate T cells expressing the indicated SPAs.
  • FIG. 20 diagrams the SPA interrogation assay design in mice using CAR/primeR logic gate T cells expressing the indicated SPAs.
  • FIG. 22A shows tumor burden in mice treated with CAR/primeR LG T cells expressing the indicated SPAs.
  • FIG. 22B shows levels of LG T cells in mice treated with CAR/primeR logic gate T cells expressing the indicated SPAs.
  • FIG. 22C shows the cell counts of LG T cells expressing the indicated SPAs at the experimental endpoint. Cell counts are normalized to EGFRt control.
  • FIG. 23A shows tumor burden in mice treated with CAR/primeR logic gate T cells expressing the indicated SPAs.
  • FIG. 23B shows levels of logic gate T cells in mice treated with CAR/primeR logic gate T cells expressing the indicated SPAs.
  • FIG. 24A-24C depict the effects of SPA-expressing LG T cells in a murine xenograft model of renal cell carcinoma.
  • FIG. 24A diagrams the experimental design.
  • FIG. 24B depicts tumor burden in mice engrafted with LG T cells expressing the indicated SPAs.
  • FIG. 24C depicts the total counts of LG T cells expressing the SPAs in whole blood at indicated time points following LG T cell engraftment.
  • FIG. 25A diagrams an assay testing inducible cytokine secretion in response to logic gate activation.
  • FIG. 25B shows activation of inducible IL-2 secretion in response to logic gate activation.
  • FIG. 25A diagrams an assay testing inducible cytokine secretion in response to logic gate activation.
  • FIG. 25B shows activation of inducible IL-2 secretion in response to logic gate activation.
  • FIG. 26A diagrams an assay testing CAR-T cell mediated cytotoxicity in response to logic gate activation with or without inducible cytokine expression.
  • FIG. 26B shows CAR- T cell mediated cytotoxicity at indicated effector:target (E:T) ratios in the absence of antigen stimulation.
  • FIG. 26C shows CAR-T cell mediated cytotoxicity at E:T ratios in the presence of priming and cytolytic antigen stimulation.
  • FIG. 27A diagrams a flow cytometry analysis of leakiness of the Logic Gate in un- stimulated LG T cells.
  • FIG. 27B shows expression of the primeR and CAR in the absence of antigen stimulation in LG T cells with the nucleic acid encoding the cytokine “payload” situated upstream of the nucleic acid encoding the CAR.
  • FIG. 27C shows expression of the primeR and CAR in the absence of antigen stimulation in LG T cells with the nucleic acid encoding the cytokine “payload” situated downstream of the nucleic acid encoding the CAR.
  • FIG. 28 shows expansion of T cells expressing Logic Gates in the presence of indicated cytokines.
  • FIG. 29 shows expansion of T cells expressing Logic Gates in the presence of indicated cytokines.
  • FIG. 30 shows secretion of indicated inducible cytokines compared to control in Logic Gate T cells stimulated with PrimeR and CAR antigens.
  • FIG. 31 shows expansion of T cells expressing Logic Gates plus indicated inducible cytokines.
  • FIG. 32A details the construction of inducible cytokines with non-native signal peptides to allow tunable secretion.
  • FIG. 32B shows the levels of IL-7 secretion in Logic Gate T cells with indicated signal peptides.
  • FIG. 33A shows tumor volume over time in mice treated with Logic Gate T cells expressing indicated accessory molecules.
  • FIG. 33B shows titers of Logic Gate T cells expressing indicated accessory molecules at indicated time points following tumor injection.
  • FIG. 33A shows tumor volume over time in mice treated with Logic Gate T cells expressing indicated accessory molecules.
  • FIG. 33B shows titers of Logic Gate T cells expressing indicated accessory molecules at indicated time points following tumor injection.
  • FIGs. 34A-34C are schematics detailing the workflow of the high-throughput screen of combinations of synthetic pathway activators (SPAs) and cytokines.
  • FIG. 34A details the cell editing process for the production of LG T cells expressing the SPA and cytokine combinations.
  • FIG. 34B details the process of normalizing the edited cells for the screen.
  • FIG. 34C details the continuous stimulation assay used to screen edited T cells for effects on target cell killing and T cell proliferation.
  • FIGs. 35A-35C show the results of the screen of LG T cells expressing the indicated SPA and cytokine combinations based on decreased counts of target cells (lower number indicates increased target cell killing).
  • FIG. 35A-35C show the results of the screen of LG T cells expressing the indicated SPA and cytokine combinations based on decreased counts of target cells (lower number indicates increased target cell killing).
  • FIG. 35A-35C show the results of the screen of LG T cells expressing the indicated SPA and cytokine combinations based on decreased counts of target cells
  • FIG. 35A shows results of combinations with boxes colored based on the expressed SPA.
  • FIG. 35B shows results of combinations with boxes colored based on the expressed cytokine.
  • FIG. 35C shows results of the top 20 tested combinations compared to indicated positive controls.
  • FIGs. 36A and 36B show graphs detailing combinations that perform better that single-module LG T cells.
  • FIG. 36A shows combinations that perform better that single- module LG T cells based on decreased target cell count.
  • FIG. 36B shows combinations that perform better that single-module LG T cells based on increased T cell expansion.
  • FIGs. 37A and 37B show graphs detailing combinations that showed no additive effects relative to single-module LG T cells.
  • FIG. 37A and 37B show graphs detailing combinations that showed no additive effects relative to single-module LG T cells.
  • FIG. 37A shows a graph detailing the effects of the combination of L-gp130 with an sgRNA targeting PTPN2 on T cell expansion compared to the effects of L-gp130 or the sgRNA alone.
  • FIG. 37B shows a graph detailing the effects of the combination of C7R with an sgRNA targeting CISH on target cell count compared to the effects of C7R or the sgRNA alone.
  • FIG. 37C shows an ANOVA analysis of the combination of L-gp130 and IL-2 in LG T cells across various backgrounds.
  • FIG. 37D shows an ANOVA analysis of the combination of L-gp130 and IL-12 in LG T cells across various backgrounds. [00123] FIG.
  • FIG. 38 is a graph showing results of a continuous stimulation assay screen of LG T cells expressing indicated cytokine and sgRNA/ribonucleoproteins and cultured in the presence of indicated cytokines.
  • FIGs. 39A-39C detail a continuous stimulation assay screen of LG T cells expressing various shRNAs, inducible cytokine payloads, sgRNAs, and SPAs cultured in the presence or absence of TGF- ⁇ .
  • FIG. 39A details the tested combinations.
  • FIG. 39B shows results of indicated combinations including inducible IL-2 expression.
  • FIG. 39C shows results of indicated combinations including inducible IL-12 expression.
  • FIG. 40A-40C detail a continuous stimulation assay screen of LG-T cells expressing various shRNAs, inducible cytokine payloads, sgRNAs, and SPAs.
  • FIG. 40A shows results of a screen of LG T cells in the absence of TGF- ⁇ (left panel) with selected results of indicated combinations (right panel).
  • FIG. 40B shows results of a screen of LG T cells in the presence of TGF- ⁇ (left panel) with selected results of indicated combinations (right panel).
  • FIG. 40C shows the top performing cytokine, SPA, and sgRNA combinations (left panel) or SPA and sgRNA combinations with a control inducible payload (right panel).
  • FIG. 41A shows the mean tumor volume in mice after treatment with the indicated ICT cells.
  • FIG. 41A shows the mean tumor volume in mice after treatment with the indicated ICT cells.
  • FIG. 41B shows the total T cells at 7, 14, 21, and 42 days post T cell injection.
  • FIG. 42 shows serum levels of IL2 and IFN ⁇ on days 14, 21, and 42 after in vivo injection with the indicated ICT cells.
  • FIG. 43A shows TCR expansion and percent tumor lysis after incubation of T cells with exogenous IL-2 or IL-15 or delayed addition of exogenous IL-2 or IL-15.
  • FIG. 43B shows percent TCR target cell growth after incubation with the indicated cytokine.
  • FIG. 44 shows that addition of IL-15 expression to the ICT cells expressing L- gp130 (SPA.I) resulted in increased killing by the T cells.
  • SPA.I L- gp130
  • an antibody that “selectively binds” or “specifically binds” an antigen is an antigen-binding moiety that binds the antigen with high affinity and does not significantly bind other unrelated antigens.
  • Specific binding can be measured, for example, by measuring binding to a target molecule and comparing it to binding to a non-target molecule.
  • Specific binding can also be determined by competition with a control molecule that mimics the epitope recognized on the target molecule. In that case, specific binding is indicated if the binding of the antibody to the target molecule is competitively inhibited by the control molecule.
  • the extracellular antigen-binding domain specifically binds to Alkaline phosphatase, Germ Cell type (ALPG).
  • the extracellular domain includes an antigen-binding moiety that binds to Alkaline phosphatase, Placenta (ALPP).
  • Affinity refers to the strength of the sum total of non-covalent interactions between a single binding site of a molecule (e.g., an antibody) and its binding partner (e.g., an antigen or epitope).
  • affinity refers to intrinsic binding affinity, which reflects a 1:1 interaction between members of a binding pair (e.g., antibody and antigen or epitope).
  • KD dissociation equilibrium constant
  • HVR hypervariable region
  • HVRs generally comprise amino acid residues from the hypervariable loops and/or from the complementarity determining regions (CDRs), the latter being of highest sequence variability and/or involved in antigen recognition. With the exception of CDR1 in VH, CDRs generally comprise the amino acid residues that form the hypervariable loops.
  • CDRs complementarity determining regions
  • Hypervariable regions (HVRs) are also referred to as “complementarity determining regions” (CDRs), and these terms are used herein interchangeably in reference to portions of the variable region that form the antigen-binding regions. This particular region has been described by Kabat et al., U.S. Dept.
  • amino acid sequence boundaries of a CDR can be determined by one of skill in the art using any of a number of known numbering schemes, including those described by Kabat et al., supra (“Kabat” numbering scheme); Al-Lazikani et al., 1997, J. Mol. Biol., 273:927-948 (“Chothia” numbering scheme); MacCallum et al., 1996, J. Mol. Biol. 262:732- 745 (“Contact” numbering scheme); Lefranc et al., Dev. Comp. Immunol., 2003, 27:55-77 (“IMGT” numbering scheme); and Honegge and Plückthun, J. Mol.
  • Table A provides the positions of CDR-L1, CDR-L2, CDR-L3, CDR-H1, CDR-H2, and CDR-H3 as identified by the Kabat and Chothia schemes.
  • residue numbering is provided using both the Kabat and Chothia numbering schemes.
  • CDRs may be assigned, for example, using antibody numbering software, such as Abnum, available at bioinf.org.uk/abs/abnum/, and described in Abhinandan and Martin, Immunology, 2008, 45:3832-3839, incorporated by reference in its entirety. Table A.
  • an scFv has a variable domain of light chain (VL) connected from its C-terminus to the N-terminal end of a variable domain of heavy chain (VH) by a polypeptide chain.
  • VL variable domain of light chain
  • VH variable domain of heavy chain
  • the scFv comprises of polypeptide chain where in the C-terminal end of the VH is connected to the N-terminal end of VL by a polypeptide chain.
  • the “Fab fragment” (also referred to as fragment antigen-binding) contains the constant domain (CL) of the light chain and the first constant domain (CH1) of the heavy chain along with the variable domains VL and VH on the light and heavy chains respectively.
  • the variable domains comprise the complementarity determining loops (CDR, also referred to as hypervariable region) that are involved in antigen-binding.
  • CDR complementarity determining loops
  • Fab′ fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH1 domain including one or more cysteines from the antibody hinge region.
  • “F(ab’)2” fragments contain two Fab’ fragments joined, near the hinge region, by disulfide bonds.
  • F(ab’) 2 fragments may be generated, for example, by recombinant methods or by pepsin digestion of an intact antibody.
  • the F(ab’) fragments can be dissociated, for example, by treatment with ß-mercaptoethanol.
  • “Fv” fragments comprise a non-covalently-linked dimer of one heavy chain variable domain and one light chain variable domain.
  • the “Single-chain Fv” or “scFv” includes the VH and VL domains of an antibody, wherein these domains are present in a single polypeptide chain.
  • the Fv polypeptide further comprises a polypeptide linker between the VH and VL domains which enables the scFv to form the desired structure for antigen-binding.
  • a polypeptide linker between the VH and VL domains which enables the scFv to form the desired structure for antigen-binding.
  • single domain antibody refers to a molecule in which one variable domain of an antibody specifically binds to an antigen without the presence of the other variable domain.
  • Single domain antibodies, and fragments thereof, are described in Arabi Ghahroudi et al., FEBS Letters, 1998, 414:521-526 and Muyldermans et al., Trends in Biochem. Sci., 2001, 26:230-245, each of which is incorporated by reference in its entirety.
  • Single domain antibodies are also known as sdAbs or nanobodies. Sdabs are fairly stable and easy to express as fusion partner with the Fc chain of an antibody (Harmsen MM, De Haard HJ (2007).
  • the term “gene” refers to the basic unit of heredity, consisting of a segment of DNA arranged along a chromosome, which codes for a specific protein or segment of protein.
  • a gene typically includes a promoter, a 5' untranslated region, one or more coding sequences (exons), optionally introns, and a 3' untranslated region.
  • the gene may further comprise a terminator, enhancers and/or silencers.
  • locus refers to a specific, fixed physical location on a chromosome where a gene or genetic marker is located.
  • safe harbor locus refers to a locus at which genes or genetic elements can be incorporated without disruption to expression or regulation of adjacent genes. These safe harbor loci are also referred to as safe harbor sites (SHS).
  • SHS safe harbor sites
  • a safe harbor locus refers to an “integration site” or “knock-in site” at which a sequence encoding a transgene, as defined herein, can be inserted. In some embodiments the insertion occurs with replacement of a sequence that is located at the integration site.
  • the insertion occurs without replacement of a sequence at the integration site.
  • Examples of integration sites contemplated are provided in Table D.
  • the term “insert” refers to a nucleotide sequence that is integrated (inserted) at a target locus or safe harbor site.
  • the insert can be used to refer to the genes or genetic elements that are incorporated at the target locus or safe harbor site using, for example, homology-directed repair (HDR) CRISPR/Cas9 genome-editing or other methods for inserting nucleotide sequences into a genomic region known to those of ordinary skill in the art.
  • HDR homology-directed repair
  • the term “inserting” refers to a manipulation of a nucleotide sequence to introduce a non-native sequence. This is done, for example, via the use of restriction enzymes and ligases whereby the DNA sequence of interest, usually encoding the gene of interest, can be incorporated into another nucleic acid molecule by digesting both molecules with appropriate restriction enzymes in order to create compatible overlaps and then using a ligase to join the molecules together.
  • restriction enzymes and ligases whereby the DNA sequence of interest, usually encoding the gene of interest, can be incorporated into another nucleic acid molecule by digesting both molecules with appropriate restriction enzymes in order to create compatible overlaps and then using a ligase to join the molecules together.
  • CRISPR/Cas refers to a widespread class of bacterial systems for defense against foreign nucleic acid.
  • CRISPR/Cas systems are found in a wide range of eubacterial and archaeal organisms.
  • CRISPR/Cas systems include type I, II, and III sub- types. Wild-type type II CRISPR/Cas systems utilize an RNA-mediated nuclease, Cas9 in complex with guide and activating RNA to recognize and cleave foreign nucleic acid.
  • RNAs having the activity of both a guide RNA and an activating RNA are also known in the art. In some cases, such dual activity guide RNAs are referred to as a small guide RNA (sgRNA).
  • sgRNA small guide RNA
  • Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes- Chlorobi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae.
  • An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and homologs thereof are described in, e.g., Chylinksi, et al., RNA Biol. 2013 May 1; 10(5): 726–737 ; Nat. Rev. Microbiol. 2011 June; 9(6): 467-477; Hou, et al., Proc Natl Acad Sci U S A. 2013 Sep 24;110(39):15644-9; Sampson et al., Nature. 2013 May 9;497(7448):254-7; and Jinek, et al., Science. 2012 Aug 17;337(6096):816-21.
  • the Cas9 nuclease domain can be optimized for efficient activity or enhanced stability in the host cell.
  • the term “Cas9” refers to an RNA-mediated nuclease (e.g., of bacterial or archeal orgin, or derived therefrom).
  • Exemplary RNA-mediated nuclases include the foregoing Cas9 proteins and homologs thereof, and include but are not limited to, CPF1 (See, e.g., Zetsche et al., Cell, Volume 163, Issue 3, p759–771, 22 October 2015).
  • Cas9 ribonucleoprotein complex and the like refers to a complex between the Cas9 protein, and a crRNA (e.g., guide RNA or small guide RNA), the Cas9 protein and a trans-activating crRNA (tracrRNA), the Cas9 protein and a small guide RNA, or a combination thereof (e.g., a complex containing the Cas9 protein, a tracrRNA, and a crRNA guide RNA).
  • a crRNA e.g., guide RNA or small guide RNA
  • tracrRNA trans-activating crRNA
  • Cas9 protein and a small guide RNA e.g., a complex containing the Cas9 protein, a tracrRNA, and a crRNA guide RNA
  • the phrase “immune cell” is inclusive of all cell types that can give rise to immune cells, including hematopoietic cells such hematopoietic stem cells, pluripotent stem cells, and induced pluripotent stem cells (iPSCs).
  • the immune cell is a B cell, macrophage, a natural killer (NK) cell, an induced pluripotent stem cell (iPSC), a human pluripotent stem cell (HSPC), a T cell or a T cell progenitor or dendritic cell.
  • the cell is an innate immune cell.
  • primary in the context of a primary cell or primary stem cell refers to a cell that has not been transformed or immortalized.
  • Such primary cells can be cultured, sub-cultured, or passaged a limited number of times (e.g., cultured 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times).
  • the primary cells are adapted to in vitro culture conditions.
  • the primary cells are isolated from an organism, system, organ, or tissue, optionally sorted, and utilized, e.g., directly without culturing or sub-culturing.
  • the primary cells are stimulated, activated, or differentiated.
  • primary T cells can be activated by contact with (e.g., culturing in the presence of) CD3, CD28 agonists, IL-2, IFN- ⁇ , or a combination thereof.
  • T lymphocyte and “T cell” are used interchangeably and refer to cells that have completed maturation in the thymus, and identify certain foreign antigens in the body. The terms also refer to the major leukocyte types that have various roles in the immune system, including activation and deactivation of other immune cells.
  • the T cell can be any T cell such as a cultured T cell, e.g., a primary T cell, or a T cell derived from a cultured T cell line, e.g., a Jurkat, SupT1, etc., or a T cell obtained from a mammal.
  • T cells include, but are not limited to, na ⁇ ve T cells, stimulated T cells, primary T cells (e.g., uncultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or sub-populations thereof.
  • the T cell can be a CD3 + cell.
  • T cells can be CD4 + , CD8 + , or CD4 + and CD8 + .
  • the T cell can be any type of T cell, CD4 + / CD8 + double positive T cells, CD4 + helper T cells (e.g., Th1 and Th2 cells), CD8 + T cells (e.g., cytotoxic T cells), peripheral Including but not limited to blood mononuclear cells (PBMC), peripheral blood leukocytes (PBL), tumor infiltrating lymphocytes (TIL), memory T cells, naive T cells, regulatory T cells, ⁇ T cells, etc. It can be any T cell at any stage of development. Additional types of helper T cells include Th3 (Treg) cells, Th17 cells, Th9 cells, or Tfh cells.
  • T cells such as central memory T cells (Tcm cells), effector memory T cells (Tem cells and TEMRA cells).
  • a T cell can also refer to a genetically modified T cell, such as a T cell that has been modified to express a T cell receptor (TCR) or a chimeric antigen receptor (CAR).
  • T cells can also be differentiated from stem cells or progenitor cells.
  • CD4 + T cells refers to a subset of T cells that express CD4 on their surface and are associated with a cellular immune response.
  • CD4 + T cells are characterized by a post- stimulation secretion profile that can include secretion of cytokines such as IFN- ⁇ , TNF- ⁇ , IL-2, IL-4 and IL-10.
  • cytokines such as IFN- ⁇ , TNF- ⁇ , IL-2, IL-4 and IL-10.
  • CD4 is a 55 kD glycoprotein originally defined as a differentiation antigen on T lymphocytes, but was also found on other cells including monocytes / macrophages.
  • the CD4 antigen is a member of the immunoglobulin superfamily and has been implicated as an associative recognition element in MHC (major histocompatibility complex) class II restricted immune responses.
  • MHC major histocompatibility complex
  • CD8 + T cells refers to a subset of T cells that express CD8 on their surface, are MHC class I restricted, and function as cytotoxic T cells.
  • the “CD8” molecule is a differentiation antigen present on thymocytes, as well as on cytotoxic and suppressor T lymphocytes.
  • the CD8 antigen is a member of the immunoglobulin superfamily and is an associative recognition element in major histocompatibility complex class I restriction interactions.
  • hematopoietic stem cell refers to a type of stem cell that can give rise to a blood cell.
  • Hematopoietic stem cells can give rise to cells of the myeloid or lymphoid lineages, or a combination thereof. Hematopoietic stem cells are predominantly found in the bone marrow, although they can be isolated from peripheral blood, or a fraction thereof. Various cell surface markers can be used to identify, sort, or purify hematopoietic stem cells. In some cases, hematopoietic stem cells are identified as c- kit + and lin-. In some cases, human hematopoietic stem cells are identified as CD34 + , CD59 + , Thy1/CD90 + , CD38 lo/- , C-kit/CD117 + , lin-.
  • human hematopoietic stem cells are identified as CD34-, CD59 + , Thy1/CD90 + , CD38 lo/- , C-kit/CD117 + , lin-.
  • human hematopoietic stem cells are identified as CD133 + , CD59 + , Thy1/CD90 + , CD38 lo/- , C- kit/CD117 + , lin-.
  • mouse hematopoietic stem cells are identified as CD34 lo/- , SCA-1 + , Thy1 +/lo , CD38 + , C-kit + , lin-.
  • the hematopoietic stem cells are CD150 + CD48-CD244-.
  • hematopoietic cell refers to a cell derived from a hematopoietic stem cell.
  • the hematopoietic cell may be obtained or provided by isolation from an organism, system, organ, or tissue (e.g., blood, or a fraction thereof).
  • an hematopoietic stem cell can be isolated and the hematopoietic cell obtained or provided by differentiating the stem cell.
  • Hematopoietic cells include cells with limited potential to differentiate into further cell types.
  • hematopoietic cells include, but are not limited to, multipotent progenitor cells, lineage-restricted progenitor cells, common myeloid progenitor cells, granulocyte-macrophage progenitor cells, or megakaryocyte-erythroid progenitor cells.
  • Hematopoietic cells include cells of the lymphoid and myeloid lineages, such as lymphocytes, erythrocytes, granulocytes, monocytes, and thrombocytes.
  • the term “construct” refers to a complex of molecules, including macromolecules or polynucleotides.
  • the term “integration” refers to the process of stably inserting one or more nucleotides of a construct into the cell genome, e.g., covalently linking to a nucleic acid sequence in the chromosomal DNA of the cell. It may also refer to nucleotide deletions at a site of integration. Where there is a deletion at the insertion site, “integration” may further include substitution of the endogenous sequence or nucleotide deleted with one or more inserted nucleotides.
  • the term “exogenous” refers to a molecule or activity that has been introduced into a host cell and is not native to that cell.
  • the molecule can be introduced, for example, by introduction of the encoding nucleic acid into host genetic material, such as by integration into a host chromosome, or as non-chromosomal genetic material, such as a plasmid.
  • host genetic material such as by integration into a host chromosome, or as non-chromosomal genetic material, such as a plasmid.
  • the term, when used in connection with expression of an encoding nucleic acid refers to the introduction of the encoding nucleic acid into a cell in an expressible form.
  • endogenous refers to a molecule or activity that is present in a host cell under natural, unedited conditions.
  • the term, when used in connection with expression of the encoding nucleic acid refers to expression of the encoding nucleic acid that is contained within the cell and not introduced exogenously.
  • heterologous refers to a nucleic acid or polypeptide sequence or domain which is not native to a flanking sequence, e.g., wherein the heterologous sequence is not found in nature coupled to the nucleic acid or polypeptide sequences occurring at one or both ends.
  • homologous refers to a nucleic acid or polypeptide sequence or domain which is native to a flanking sequence, e.g., wherein the homologous sequence is found in nature coupled to the nucleic acid or polypeptide sequences occurring at one or both ends.
  • a “polynucleotide donor construct” refers to a nucleotide sequence (e.g., DNA sequence) that is genetically inserted into a polynucleotide and is exogenous to that polynucleotide.
  • the polynucleotide donor construct is transcribed into RNA and optionally translated into a polypeptide.
  • the polynucleotide donor construct can include prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences.
  • the polynucleotide donor construct can be a miRNA, shRNA, natural polypeptide (e.g., a naturally occurring polypeptide) or fragment thereof or a variant polypeptide (e.g., a natural polypeptide having less than 100% sequence identity with the natural polypeptide) or fragments thereof.
  • the term “complementary” or “complementarity” refers to specific base pairing between nucleotides or nucleic acids. Complementary nucleotides are, generally, A and T (or A and U), and G and C.
  • the guide RNAs described herein can comprise sequences, for example, DNA targeting sequence that are perfectly complementary or substantially complementary (e.g., having 1-4 mismatches) to a genomic sequence in a cell.
  • the term “transgene” refers to a polynucleotide that has been transferred naturally, or by any of a number of genetic engineering techniques from one organism to another. It is optionally translated into a polypeptide. It is optionally translated into a recombinant protein.
  • a “recombinant protein” is a protein encoded by a gene — recombinant DNA — that has been cloned in a system that supports expression of the gene and translation of messenger RNA (see expression system).
  • the recombinant protein can be a therapeutic agent, e.g. a protein that treats a disease or disorder disclosed herein.
  • transgene can refer to a polynucleotide that encodes a polypeptide.
  • protein polypeptide
  • peptide amino acid sequence
  • operably linked refers to the binding of a nucleic acid sequence to a single nucleic acid fragment such that one function is affected by the other.
  • a promoter is capable of affecting the expression of a coding sequence or functional RNA (e.g., the coding sequence or functional RNA is under transcriptional control by the promoter), the promoter is operably linked thereto. Coding sequences can be operably linked to control sequences in both sense and antisense orientation.
  • the term “developmental cell states” refers to, for example, states when the cell is inactive, actively expressing, differentiating, senescent, etc. developmental cell state may also refer to a cell in a precursor state (e.g., a T cell precursor).
  • the term “encoding” refers to a sequence of nucleic acids which codes for a protein or polypeptide of interest.
  • the nucleic acid sequence may be either a molecule of DNA or RNA.
  • the molecule is a DNA molecule.
  • the molecule is a RNA molecule.
  • When present as a RNA molecule it will comprise sequences which direct the ribosomes of the host cell to start translation (e.g., a start codon, ATG) and direct the ribosomes to end translation (e.g., a stop codon). Between the start codon and stop codon is an open reading frame (ORF).
  • ORF open reading frame
  • the term “subject” refers to a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats, rabbits, pigs and sheep. In certain embodiments, the subject is a human. In some embodiments the subject has a disease or condition that can be treated with an engineered cell provided herein or population thereof. In some aspects, the disease or condition is a cancer.
  • the term “promoter” refers to a nucleotide sequence (e.g., DNA sequence) capable of controlling the expression of a coding sequence or functional RNA.
  • the promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
  • a promoter can be derived from natural genes in its entirety, can be composed of different elements from different promoters found in nature, and/or may comprise synthetic DNA segments.
  • a promoter, as contemplated herein, can be endogenous to the cell of interest or exogenous to the cell of interest. It is appreciated by those skilled in the art that different promoters can induce gene expression in different tissue or cell types, or at different developmental stages, or in response to different environmental conditions.
  • a promoter can be selected according to the strength of the promoter and/or the conditions under which the promoter is active, e.g., constitutive promoter, strong promoter, weak promoter, inducible/repressible promoter, tissue specific Or developmentally regulated promoters, cell cycle-dependent promoters, and the like.
  • a promoter can be an inducible promoter (e.g., a heat shock promoter, tetracycline- regulated promoter, steroid-regulated promoter, metal-regulated promoter, estrogen receptor- regulated promoter, etc.).
  • the promoter can be a constitutive promoter (e.g., CMV promoter, UBC promoter).
  • the promoter can be a spatially restricted and/or temporally restricted promoter (e.g., a tissue specific promoter, a cell type specific promoter, etc.). See for example US Publication 20180127786, the disclosure of which is herein incorporated by reference in its entirety.
  • Gene editing may involve a gene (or nucleotide sequence) knock-in or knock-out.
  • knock-in refers to an addition of a DNA sequence, or fragment thereof into a genome.
  • Such DNA sequences to be knocked-in may include an entire gene or genes, may include regulatory sequences associated with a gene or any portion or fragment of the foregoing.
  • a polynucleotide donor construct encoding a recombinant protein may be inserted into the genome of a cell carrying a mutant gene.
  • a knock-in strategy involves substitution of an existing sequence with the provided sequence, e.g., substitution of a mutant allele with a wild-type copy.
  • the term “knock-out” refers to the elimination of a gene or the expression of a gene.
  • a gene can be knocked out by either a deletion or an addition of a nucleotide sequence that leads to a disruption of the reading frame.
  • a gene may be knocked out by replacing a part of the gene with an irrelevant (e.g., non-coding) sequence.
  • non-homologous end joining refers to a cellular process in which cut or nicked ends of a DNA strand are directly ligated without the need for a homologous template nucleic acid. NHEJ can lead to the addition, the deletion, substitution, or a combination thereof, of one or more nucleotides at the repair site.
  • homology directed repair or HDR refers to a cellular process in which cut or nicked ends of a DNA strand are repaired by polymerization from a homologous template nucleic acid. Thus, the original sequence is replaced with the sequence of the template.
  • the homologous template nucleic acid can be provided by homologous sequences elsewhere in the genome (sister chromatids, homologous chromosomes, or repeated regions on the same or different chromosomes).
  • an exogenous template nucleic acid can be introduced to obtain a specific HDR-induced change of the sequence at the target site. In this way, specific mutations can be introduced at the cut site.
  • a single-stranded DNA template or a double-stranded DNA template refers to a DNA oligonucleotide that can be used by a cell as a template for HDR.
  • the single-stranded DNA template or a double-stranded DNA template has at least one region of homology to a target site.
  • the single-stranded DNA template or double- stranded DNA template has two homologous regions flanking a region that contains a heterologous sequence to be inserted at a target cut site.
  • vectors can be linear or circular. Vectors can integrate into a target genome of a host cell or replicate independently in a host cell. Vectors can comprise, for example, an origin of replication, a multicloning site, and/or a selectable marker.
  • An expression vector typically comprises an expression cassette.
  • Vectors and plasmids include, but are not limited to, integrating vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, cosmids, and artificial chromosomes.
  • the phrase “introducing” in the context of introducing a nucleic acid or a complex comprising a nucleic acid, for example, an RNP-DNA template complex refers to the translocation of the nucleic acid sequence or the RNP-DNA template complex from outside a cell to inside the cell. In some cases, introducing refers to translocation of the nucleic acid or the complex from outside the cell to inside the nucleus of the cell.
  • expression cassette is a polynucleotide construct, generated recombinantly or synthetically, comprising regulatory sequences operably linked to a selected polynucleotide to facilitate expression of the selected polynucleotide in a host cell.
  • the regulatory sequences can facilitate transcription of the selected polynucleotide in a host cell, or transcription and translation of the selected polynucleotide in a host cell.
  • An expression cassette can, for example, be integrated in the genome of a host cell or be present in an expression vector.
  • the phrase “subject in need thereof” refers to a subject that exhibits and/or is diagnosed with one or more symptoms or signs of a disease or disorder as described herein.
  • a “chemotherapeutic agent” refers to a chemical compound useful in the treatment of cancer. Chemotherapeutic agents include “anti-hormonal agents” or “endocrine therapeutics” which act to regulate, reduce, block, or inhibit the effects of hormones that can promote the growth of cancer.
  • composition refers to a mixture that contains, e.g., an engineered cell or protein contemplated herein.
  • the composition may contain additional components, such as adjuvants, stabilizers, excipients, and the like.
  • composition or “pharmaceutical composition” refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective in treating a subject, and which contains no additional components which are unacceptably toxic to the subject in the amounts provided in the pharmaceutical composition.
  • in situ refers to processes that occur in a living cell growing separate from a living organism, e.g., growing in tissue culture.
  • in vivo refers to processes that occur in a living organism.
  • ex vivo generally includes experiments or measurements made in or on living tissue, preferably in an artificial environment outside the organism, preferably with minimal differences from natural conditions.
  • mamal as used herein includes both humans and non-humans and include but is not limited to humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.
  • percent "identity,” in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison algorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection.
  • sequence comparison algorithms e.g., BLASTP and BLASTN or other algorithms available to persons of skill
  • the percent “identity” can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.
  • sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
  • test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated.
  • sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
  • Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol.
  • the term “sufficient amount” means an amount sufficient to produce a desired effect, e.g., an amount sufficient to modulate protein aggregation in a cell.
  • the term “therapeutically effective amount” is an amount that is effective to ameliorate a symptom of a disease.
  • the term “ameliorating” refers to any therapeutically beneficial result in the treatment of a disease state, e.g., a cancer disease state, lessening in the severity or progression, remission, or cure thereof.
  • the term “effective amount” refers to the amount of a compound (e.g., a compositions described herein, cells described herein) sufficient to effect beneficial or desired results.
  • An effective amount can be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or administration route.
  • the term “treating” includes any effect, e.g., lessening, reducing, modulating, ameliorating or eliminating, that results in the improvement of the condition, disease, disorder, and the like, or ameliorating a symptom thereof.
  • the terms “modulate” and “modulation” refer to reducing or inhibiting or, alternatively, activating or increasing, a recited variable.
  • the terms “increase” and “activate” refer to an increase of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater in a recited variable.
  • the terms “reduce” and “inhibit” refer to a decrease of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50- fold, 100-fold, or greater in a recited variable.
  • a “logic gate,” “circuit,” “circuit receptor,” “system” or “system receptor” refers to a two part protein expression system comprising a priming receptor and a chimeric antigen receptor.
  • the system can be encoded on at least one nucleic acid inserted into a cell, where the priming receptor is expressed in the cell.
  • the intracellular domain of the priming receptor is cleaved from the transmembrane domain upon binding of the priming receptor to its target antigen.
  • the intracellular domain is then capable of translocating into a cell nucleus where it induces expression of the chimeric antigen receptor.
  • a synthetic pathway activator can also be employed to enhance expansion and activity of logic gate- expressing T cells (LG T cells).
  • FIG. 1 An overview of an exemplary logic gate system employing a synthetic pathway activator is shown in FIG. 1.
  • the system comprises 4 steps leading to T cell activation: (1) the synthetic pathway activator (SPA) and priming receptor (primeR) are constitutively expressed; (2) the primeR is triggered, resulting in cleavage of the intracellular domain; (3) the cleaved primeR intracellular domain induces expression of the CAR; and (4) the CAR is activated, resulting in T cell activation.
  • SPA synthetic pathway activator
  • priming receptor priming receptor
  • systems comprising a priming receptor that binds to ALPG/P, a chimeric antigen receptor that binds to MSLN, and a cytokine and/or a synthetic pathway activator that activates cytokine signaling, wherein the transcription factor of the intracellular domain of the priming receptor is capable of inducing expression of the CAR.
  • Such systems are alternatively termed “logic gates” or “circuits.”
  • the system is encoded by nucleic acid transgenes inserted into an immune cell.
  • the system can be encoded on a single nucleic acid insert or fragment that comprises both transgenes, or can be encoded on two nucleic acids that encode the system transgenes individually.
  • the priming receptor, SPA, and CAR, of the system can be placed in any order on the single nucleic acid.
  • the priming receptor can be at the 5’ end, the SPA can be immediately after the SPA of the priming receptor, and the CAR can be at the 3’ end; or the SPA can be at the 5’ end, the priming receptor can be immediately after the SPA, and the CAR can be at the 3’ end; or the CAR can be at the 5’ end, and the SPA can be after the CAR and the priming receptor can be at the 3’ end; or the CAR can be at the 5’ end, and the priming receptor can be after the CAR and the SPA can be at the 3’ end.
  • a constitutive promoter can be operably linked to the nucleotide sequence encoding the priming receptor and/or the SPA.
  • the nucleic acids encoding the SPA and priming receptor can be under the control of a single promoter.
  • An inducible promoter can also be operably linked to the nucleotide sequence encoding the CAR.
  • the nucleic acids encoding the CAR and SPA can be under the control of a separate inducible promoters (e.g., a first inducible promoter and a second inducible promoter).
  • the first and second inducible promoters can be identical or different.
  • the nucleic acid when the system is encoded on a single nucleic acid insert or fragment that comprises both transgenes, can comprise, in a 5’ to 3’ direction, the constitutive promoter; the nucleotide sequence encoding priming receptor; the inducible promoter; and the nucleotide sequence encoding chimeric antigen receptor.
  • the nucleic acid can comprise, in a 5’ to 3’ direction, the inducible promoter; the nucleotide sequence encoding chimeric antigen receptor; the constitutive promoter; and the nucleotide sequence encoding priming receptor.
  • the SPA can be present upstream or downstream of the priming receptor and/or CAR.
  • priming receptors comprising an extracellular antigen-binding domain that specifically binds Alkaline Phosphatase, Placental/Germ Cell (ALPG/P); ALPP: NCBI Entrez Gene: 250, UniProtKB/Swiss-Prot: P05187, SEQ ID NO: 176; ALPG: NCBI Entrez Gene: 251, UniProtKB/Swiss-Prot: P10696, SEQ ID NO: 177).
  • the priming receptor comprises an extracellular antigen-binding domain that specifically binds Alkaline Phosphatase, Placental (ALPP).
  • the priming receptor comprises an extracellular antigen-binding domain that specifically binds Alkaline Phosphatase, Germ Cell (ALPG).
  • ALPG Alkaline Phosphatase, Placental/Germ Cell
  • An antigen binding domain that specifically binds ALPG/P is capable of specifically binding ALPG and/or ALPP.
  • the priming receptor comprises a sequence as set forth in SEQ ID NO: 24.
  • the priming receptor comprises a sequence as set forth in SEQ ID NO: 25.
  • the priming receptor is a synthetic receptor based on the Notch protein. Binding of a natural Notch receptor to a cognate ligand, such as those from the Delta family of proteins, causes intramembrane proteolysis that cleaves an intracellular fragment of the Notch protein. This intracellular fragment is a transcriptional regulator that only functions when cleaved from Notch. Cleavage may occur by sequential proteolysis by ADAM metalloprotease and the gamma-secretase complex. This intracellular fragment enters the nucleus of a cell and activates cell-cell signaling genes.
  • Notch receptors have a modular domain organization.
  • the ectodomains of Notch receptors consist of a series of N-terminal epidermal growth factor (EGF)-like repeats that are responsible for ligand binding.
  • EGF epidermal growth factor
  • the Notch ligand-binding domain is replaced with a ligand binding domain that binds a selected target ligand or antigen.
  • the EGF repeats are followed by three LIN -12/Notch repeat (LNR) modules, which are unique to Notch receptors, and are widely reported to participate in preventing premature receptor activation.
  • LNR LIN -12/Notch repeat
  • the heterodimerization (HD) domain of Notchl is divided by furin cleavage, so that its N-terminal part terminates the extracellular subunit, and its C -terminal half constitutes the beginning of the transmembrane subunit.
  • the receptor has a transmembrane segment and an intracellular domain (ICD), which includes a transcriptional regulator.
  • ICD intracellular domain
  • Multiple forms of priming receptors can be used in the methods, cells, and nucleic acids as described herein.
  • priming receptor contemplated for use in the methods and cells herein comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor including the NRR, a TMD, and an ICD.
  • “Fn Notch” receptors comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with a Robo receptor (such as a mammalian Robol, Robo2, Robo3, or Robo4), followed by 1, 2, or 3 fibronectin repeats (“Fn”), a TMD, and an ICD.
  • Mini Notch receptors comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor (lacking the NRR), a TMD, and an ICD.
  • “Minimal Linker Notch” receptors comprise a heterologous extracellular ligand binding domain, a linking polypeptide lacking substantial sequence identity with a Notch receptor (e.g., a synthetic (GGS)n polypeptide sequence), a TMD, and an ICD.
  • “Hinge Notch” receptors comprise a heterologous extracellular ligand binding domain, a hinge sequence comprising an oligomerization domain (e.g., a domain that promotes dimerization, trimerization, or higher order multimerization with a synthetic receptor and/or an existing host receptor), a TMD, and an ICD. All of these receptor classes are synthetic, recombinant, and do not occur in nature.
  • the non-naturally occurring receptors disclosed herein bind a target cell-surface displayed ligand, which triggers proteolytic cleavage of the receptors and release of a transcriptional regulator that modulates a custom transcriptional program in the cell.
  • the priming receptor does not include a LIN-12-Notch repeat (LNR) and/or a heterodimerization domain (HD) of a Notch receptor.
  • LNR LIN-12-Notch repeat
  • HD heterodimerization domain
  • the priming receptor disclosed herein comprises an extracellular domain that specifically binds Alkaline Phosphatase, Placental/Germ Cell (ALPG/P).
  • the extracellular domain includes the ligand-binding portion of a receptor.
  • the extracellular domain includes an antigen-binding moiety that binds to one or more target antigens.
  • the antigen-binding moiety includes one or more antigen-binding determinants of an antibody or a functional antigen-binding fragment thereof.
  • the antigen-binding moiety is selected from the group consisting of an antibody, a nanobody, a diabody, a triabody, or a minibody, a F(ab') 2 fragment, a Fab fragment, a single chain variable fragment (scFv), and a single domain antibody (sdAb), or a functional fragment thereof.
  • the antigen-binding moiety comprises an scFv.
  • the antigen-binding moiety can include naturally-occurring amino acid sequences or can be engineered, designed, or modified so as to provide desired and/or improved properties, e.g., increased binding affinity.
  • Priming Receptor CDRs, VH, VL Domains [00211]
  • the priming receptor extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein: CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, 39, 40, 41, or 42, CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, 43, 44, 45, or 46, CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, 47, or 48, CDR-L1 comprises the sequence set forth in SEQ ID NO: 4,
  • the VH chain sequence comprises the sequence set forth in SEQ ID NO: 7.
  • the VL comprises the sequence set forth in SEQ ID NO: 8.
  • the extracellular domain comprises the sequence set forth in SEQ ID NO: 9 [00212]
  • the priming receptor extracellular antigen-binding domain CDR-H3 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-H3 of SEQ ID NO: 3, 47, or 48
  • the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-H2 of SEQ ID NO: 2, 43, 44, 45, or 46
  • the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-H1 of SEQ ID NO: 1, 39, 40, 41, or 42
  • the CDR-L3 has at least about 50%, 75%, 80%, 85%, 90%,
  • the CDR-H3 is a CDR-H3 of SEQ ID NO: 3, 47, or 48, with up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions
  • the CDR-H2 is a CDR-H2 of SEQ ID NO: 2, 43, 44, 45, or 46, with up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions
  • the CDR-H1 is a CDR-H1 of SEQ ID NO: 1, 39, 40, 41, or 42, with up to 1, 2, 3, 4, or 5 amino acid substitutions
  • the CDR-L3 is a CDR-L3 of SEQ ID NO: 6 or 53, with up to 1, 2, 3, 4, or 5 amino acid substitutions
  • the CDR-L2 is a CDR-L2 of SEQ ID NO: 5 or 51, with up to 1, 2, 3, or 4 amino acid substitutions
  • the CDR-L1 is a CDR-L1 of SEQ ID NO: 4 with up to 1, 2, 3, 4, 5, or 6 amino acid substitutions.
  • a priming receptor extracellular antigen-binding domain provided herein comprises one to three CDRs of a VH domain as set forth in SEQ ID NO: 7. In some embodiments, an antigen-binding domain provided herein comprises two to three CDRs of a VH domain as set forth in SEQ ID NO: 7. In some embodiments, an antigen- binding domain provided herein comprises three CDRs of a VH domain as set forth in SEQ ID NO: 7. In some aspects, the CDRs are Kabat CDRs. In some aspects, the CDRs are Chothia CDRs. In some aspects, the CDRs are AbM CDRs. In some aspects, the CDRs are Contact CDRs.
  • a priming receptor extracellular antigen-binding domain provided herein comprises a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to an VH sequence set forth in SEQ ID NO: 7.
  • an antigen-binding domain provided herein comprises a VH sequence provided in SEQ ID NO: 7, with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions.
  • the amino acid substitutions are conservative amino acid substitutions.
  • the antigen-binding domains described in this paragraph are referred to herein as “variants.”
  • such variants are derived from a sequence provided herein, for example, by affinity maturation, site directed mutagenesis, random mutagenesis, or any other method known in the art or described herein.
  • such variants are not derived from a sequence provided herein and may, for example, be isolated de novo according to the methods provided herein for obtaining antibodies or antigen-binding domains.
  • a priming receptor extracellular antigen-binding domain provided herein comprises one to three CDRs of a VL domain as set forth in SEQ ID NO: 8.
  • an antigen-binding domain provided herein comprises two to three CDRs of a VL domain as set forth in SEQ ID NO: 8. In some embodiments, an antigen- binding domain provided herein comprises three CDRs of a VL domain as set forth in SEQ ID NO: 8. In some aspects, the CDRs are Kabat CDRs. In some aspects, the Kabat VH CDRs are provided in the sequences set forth as SEQ ID NOs: 40, 44, and 3, and the Kabat VL CDRs are provided in the sequences set forth as SEQ ID NOs: 4, 5, and 6. In some aspects, the CDRs are Chothia CDRs.
  • the Chothia VH CDRs are provided in the sequences set forth as SEQ ID NOs: 1, 2, and the Chothia VL CDRs are provided in the sequences set forth as SEQ ID NOs: 4, 5, and 6.
  • the CDRs are AbM CDRs.
  • the AbM VH CDRs are provided in the sequences set forth as SEQ ID NOs: 39, 43, and 3, and the AbM VL CDRs are provided in the sequences set forth as SEQ ID NOs: 4, 5, and 6.
  • the CDRs are Contact CDRs.
  • the Contact VH CDRs are provided in the sequences set forth as SEQ ID NOs: 41, 45, and 47, and the Contact VL CDRs are provided in the sequences set forth as SEQ ID NOs: 49, 51, and 53.
  • the CDRs are IMGT CDRs.
  • the IMGT VH CDRs are provided in the sequences set forth as SEQ ID NOs: 42, 46, and 48, and the IMGT VL CDRs are provided in the sequences set forth as SEQ ID NOs: 50, 52, and 6.
  • a priming receptor extracellular antigen-binding domain provided herein comprises a VL sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to an VL sequence set forth in SEQ ID NO: 8.
  • an antigen-binding domain provided herein comprises a VL sequence provided in SEQ ID NO: 8, with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions.
  • the amino acid substitutions are conservative amino acid substitutions.
  • the antibodies described in this paragraph are referred to herein as “variants.”
  • such variants are derived from a sequence provided herein, for example, by affinity maturation, site directed mutagenesis, random mutagenesis, or any other method known in the art or described herein.
  • such variants are not derived from a sequence provided herein and may, for example, be isolated de novo according to the methods provided herein for obtaining antibodies or antigen-binding domains.
  • Table B provides the CDR sequences of the VH and VL of an illustrative ALPG/P antigen binding domain according to the indicated numbering schemes.
  • the priming receptor comprises a transmembrane domain (TMD) comprising one or more ligand-inducible proteolytic cleavage sites.
  • TMD transmembrane domain
  • the TMD comprises a Notch1 transmemebrane domain.
  • the transmembrane domain comprises the sequence as set forth in SEQ ID NO: 19.
  • the TMD suitable for the chimeric receptors disclosed herein can be any transmembrane domain of a Type 1 transmembrane receptor including at least one gamma- secretase cleavage site.
  • gamma- secretase complex as well as its substrate proteins, including amyloid precursor protein (APP) and Notch, can, for example, be found in a recent review by Zhang et al, Frontiers Cell Neurosci (2014).
  • APP amyloid precursor protein
  • Non limiting suitable TMDs from Type 1 transmembrane receptors include those from CLSTN1, CLSTN2, APLP1, APLP2, LRP8, APP, BTC, TGBR3, SPN, CD44, CSF1R, CXCL16, CX3CL1, DCC, DLL1, DSG2, DAG1, CDH1, EPCAM, EPHA4, EPHB2, EFNB1, EFNB2, ErbB4, GHR, HLA- A, and IFNAR2, wherein the TMD includes at least one gamma secretase cleavage site.
  • TMDs suitable for the compositions and methods described herein include, but are not limited to, transmembrane domains from Type 1 transmembrane receptors IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE2, KCNE3, KCNE4, KL, CHL1, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBOl, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, YASN, FLT1, CDH5, PKHD1, NECTINl, PCDHGC3, NRG1, LRP1B, CDH2, NRG2, PTPRK, SCN2B, Nradd, and PTPRM.
  • Type 1 transmembrane receptors IL1R1, IL1R2, IL6R, INSR, ERN1, ERN2, JAG2, KCNE1, KCNE
  • the TMD of the chimeric polypeptides or Notch receptors of the disclosure is a TMD derived from the TMD of a member of the calsyntenin family, such as, alcadein alpha and alcadein gamma.
  • the TMD of the chimeric polypeptides or Notch receptors of the disclosure is a TMD known for Notch receptors.
  • the TMD of the chimeric polypeptides or Notch receptors of the disclosure is a TMD derived from a different Notch receptor.
  • the Notchl TMD can be substituted with a Notch2 TMD, Notch3 TMD, Notch4 TMD, or a Notch TMD from a non- human animal such as Danio rerio, Drosophila melanogaster, Xenopus laevis, or Gallus gallus.
  • the priming receptor comprises a Notch cleavage site, such as S2 or S3.
  • Additional proteolytic cleavage sites suitable for the compositions and methods disclosed herein include, but are not limited to, ADAM10, a metalloproteinase cleavage site for a MMP selected from collagenase-1, -2, and -3 (MMP-1, -8, and -13), gelatinase A and B (MMP-2 and -9), stromelysin 1, 2, and 3 (MMP-3, -10, and -11), matrilysin (MMP-7), and membrane metalloproteinases (MT1-MMP and MT2-MMP).
  • MMP-1, -8, and -13 gelatinase A and B
  • MMP-3, -10, and -11 stromelysin 1, 2, and 3
  • MMP-7 matrilysin
  • MT1-MMP and MT2-MMP membrane metalloproteinases
  • a suitable protease cleavage site is a plasminogen activator cleavage site, e.g., a urokinase plasminogen activator (uPA) or a tissue plasminogen activator (tPA) cleavage site.
  • a suitable protease cleavage site is a prolactin cleavage site.
  • Specific examples of cleavage sequences of uPA and tPA include sequences comprising Yal-Gly-Arg.
  • protease cleavage site that can be included in a proteolytically cleavable linker is a tobacco etch vims (TEV) protease cleavage site, e.g., Glu-Asn-Leu-Tyr-Thr-Gln-Ser (SEQ ID NO:182), where the protease cleaves between the glutamine and the serine.
  • TSV tobacco etch vims
  • protease cleavage site that can be included in a proteolytically cleavable linker is an enterokinase cleavage site, e.g., Asp-Asp-Asp-Asp- Lys (SEQ ID NO:183), where cleavage occurs after the lysine residue.
  • enterokinase cleavage site e.g., Asp-Asp-Asp-Asp- Lys
  • a protease cleavage site that can be included in a proteolytically cleavable linker is a thrombin cleavage site, e.g., Leu-Val-Pro- Arg (SEQ ID NO:184).
  • protease cleavage sites include sequences cleavable by the following proteases: a PreScissionTM protease (a fusion protein comprising human rhinovirus 3C protease and glutathione-S-transferase), a thrombin, cathepsin B, Epstein-Barr vims proteas, MMP-3 (stromelysin), MMP-7 (matrilysin), MMP-9; thermolysin-like MMP, matrix metalloproteinase 2 (MMP-2), cathepsin L; cathepsin D, matrix metalloproteinase 1 (MMP-1), urokinase-type plasminogen activator, membrane type 1 matrixmetalloprotemase (MT- MMP), stromelysin 3 (or MMP-11), thermo lysin, fibroblast collagenase and stromelysin- 1, matrix metalloproteinase 13 (collagena
  • Proteases that are not native to the host cell in which the receptor is expressed can be used as a further regulatory mechanism, in which activation of the receptor is reduced until the protease is expressed or otherwise provided.
  • a protease may be tumor-associated or disease-associated (expressed to a significantly higher degree than in normal tissue), and serve as an independent regulatory mechanism.
  • some matrix metalloproteases are highly expressed in certain cancer types.
  • the amino acid substitution(s) within the TMD includes one or more substitutions within a “GV” motif of the TMD. In some embodiments, at least one of such substitution(s) comprises a substitution to alanine.
  • the priming receptor comprises one or more intracellular domains from or derived from a transcriptional regulator and/or a DNA-binding domain.
  • the intracellular domain comprises a Gal4/VP64 domain.
  • the intracellular domain comprises the sequence as set forth in SEQ ID NO: 23.
  • Transcriptional regulators either activate or repress transcription from cognate promoters. Transcriptional activators typically bind nearby to transcriptional promoters and recruit RNA polymerase to directly initiate transcription.
  • Transcriptional repressors bind to transcriptional promoters and sterically hinder transcriptional initiation by RNA polymerase.
  • Other transcriptional regulators serve as either an activator or a repressor depending on where it binds and cellular conditions.
  • a “transcriptional activation domain” refers to the domain of a transcription factor that interacts with transcriptional control elements and/or transcriptional regulatory proteins (e.g., transcription factors, RNA polymerases, etc.) to increase and/or activate transcription of one or more genes.
  • Non- limiting examples of transcriptional activation domains include: a herpes simplex virus VP16 activation domain, VP64 (which is a tetrameric derivative of VP16), HIV TAT, a NFkB p65 activation domain, p53 activation domains 1 and 2, a CREB (cAMP response element binding protein) activation domain, an E2A activation domain, NFAT (nuclear factor of activated T-cells) activation domain, yeast Gal4, yeast GCN4, yeast HAP1, MLL, RTG3, GLN3, OAF1, PIP2, PDR1, PDR3, PHO4, LEU3 glucocorticoid receptor transcription activation domain, B-cell POU homeodomain protein Oct2, plant Ap2, or any others known to one or ordinary skill in the art.
  • VP16 activation domain VP64 (which is a tetrameric derivative of VP16), HIV TAT, a NFkB p65 activation domain, p53 activation domains 1 and
  • the transcriptional regulator is selected from Gal4-VP16, Gal4-VP64, tetR-VP64, ZFHD1-YP64, Gal4-KRAB, and HAP1- VP16.
  • the transcriptional regulator is Gal4-VP64.
  • a transcriptional activation domain can comprise a wild-type or naturally occurring sequence, or it can be a modified, mutant, or derivative version of the original transcriptional activation domain that has the desired ability to increase and/or activate transcription of one or more genes.
  • the transcriptional regulator can further include a nuclear localization signal.
  • the priming receptor comprises one or more intracellular “DNA-binding domains” (or “DB domains”).
  • DNA-binding domains refer to sequence-specific DNA binding domains that bind a particular DNA sequence element. Accordingly, as used herein, a “sequence-specific DNA-binding domain” refers to a protein domain portion that has the ability to selectively bind DNA having a specific, predetermined sequence.
  • a sequence-specific DNA binding domain can comprise a wild-type or naturally occurring sequence, or it can be a modified, mutant, or derivative version of the original domain that has the desired ability to bind to a desired sequence. In some embodiments, the sequence-specific DNA binding domain is engineered to bind a desired sequence.
  • Non- limiting examples of proteins having sequence-specific DNA binding domains that can be used in synthetic proteins described herein include HNF1a, Gal4, GCN4, reverse tetracycline receptor, THY1, SYN1, NSE/RU5′, AGRP, CALB2, CAMK2A, CCK, CHAT, DLX6A, EMX1, zinc finger proteins or domains thereof, CRISPR/Cas proteins, such as Cas9, Cas3, Cas4, Cas5, Cas5e (or CasD), Cash, Cas6e, Cas6f, Cas7, Cas8a1, Cas8a2, Cas8b, Cas8c, Cas10, Cas10d, CasF, CasG, CasH, Csy1, Csy2, Csy3, Cse1 (or CasA), Cse2 (or CasB), Cse3 (or CasE), Cse4 (or CasC), Csc1, Csc2, Csa5, Csn2,
  • the CRISPR/Cas-like protein can be a wild type CRISPR/Cas protein, a modified CRISPR/Cas protein, or a fragment of a wild type or modified CRISPR/Cas protein.
  • the CRISPR/Cas-like protein can be modified to increase nucleic acid binding affinity and/or specificity, alter an enzymatic activity, and/or change another property of the protein.
  • nuclease e.g., DNase, RNase
  • nuclease domains of the CRISPR/Cas-like protein can be modified, deleted, or inactivated.
  • the CRISPR/Cas-like protein can be truncated to remove domains that are not essential for the functions of the systems described herein.
  • a CRISPR enzyme that is used as a DNA binding protein or domain thereof can be mutated with respect to a corresponding wild-type enzyme such that the mutated CRISPR or domain thereof lacks the ability to cleave a nucleic acid sequence containing a DNA binding domain target site.
  • a D10A mutation can be combined with one or more of H840A, N854A, or N863A mutations to produce a Cas9 enzyme substantially lacking all DNA cleavage activity.
  • the ECD and the TMD, or the TMD and the ICD can be linked to each other with a linking polypeptide, such as a juxtamembrane domain.
  • a linking polypeptide such as a juxtamembrane domain.
  • “SynNotch” or synthetic notch receptors comprise a heterologous extracellular ligand-binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor JMD (including the NRR), a TMD, and an ICD.
  • “Fn Notch” receptors comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with a Robo receptor (such as a mammalian Robol, Robo2, Robo3, or Robo4), followed by 1, 2, or 3 fibronectin repeats (“Fn”), a TMD, and an ICD.
  • “Mini Notch” receptors comprise a heterologous extracellular ligand binding domain, a linking polypeptide having substantial sequence identity with a Notch receptor JMD but lacking the NRR (the LIN-12-Notch repeat (LNR) modules, and the heterodimerization domain), a TMD, and an ICD.
  • “Minimal Linker Notch” receptors comprise a heterologous extracellular ligand-binding domain, a linking polypeptide lacking substantial sequence identity with a Notch receptor (for example, without limitation, having a synthetic (GGS) n polypeptide sequence), a TMD, and an ICD.
  • “Hinge Notch” receptors comprise a heterologous extracellular ligand-binding domain, a hinge sequence comprising an oligomerization domain (e.g., a domain that promotes dimerization, trimerization, or higher order multimerization with a synthetic receptor and/or an existing host receptor), a TMD, and an ICD.
  • the priming receptor comprises a juxtamembrane domain (JMD) peptide in between the extracellular domain and the transmembrane domain.
  • the priming receptor comprises a juxtamembrane domain (JMD) peptide in between the transmembrane domain and the intracellular domain.
  • the JMD peptide comprises an LWF motif. The use of LWF motifs in receptor constructs is described in US Patent N. 10,858,443, hereby incorporated by reference in its entirety.
  • the JMD peptide has substantial sequence identity to the JMD of Notchl, Notch2, Notch3, and/or Notch4.
  • the JMD peptide has substantial sequence identity to the Notchl, Notch2, Notch3, and/or Notch4 JMD, but does not include a LIN-12-Notch repeat (LNR) and/or a heterodimerization domain (HD) of a Notch receptor. In some embodiments, the JMD peptide does not have substantial sequence identity to the Notchl, Notch2, Notch3, and/or Notch4 JMD. In some embodiments, the JMD peptide includes an oligimerization domain which promotes formation of dimers, trimers, or higher order assemblages of the receptor. Such JMD peptides are described in WO2021061872, hereby incorporated by reference in its entirety.
  • the linking polypeptide is derived from a Notch JMD sequence after deletion of the NRR and HD domain.
  • the Notch JMD sequence may be the sequence from Notchl, Notch2, Notch3, or Notch4, and can be derived from a non-human homolog, such as those from Drosophila, Gallus, Danio, and the like. Four to 50 amino acid residues of the remaining Notch sequence can be used as a polypeptide linker.
  • the length and amino acid composition of the linker polypeptide sequence are varied to alter the orientation and/or proximity of the ECD and the TMD relative to one another to achieve a desired activity of the chimeric polypeptide, such as the signal transduction level when ligand induced or in the absence of ligand.
  • the linking polypeptide does not have substantial sequence identity to a Notch JMD sequence, including the Notch JMD sequence from Notchl, Notch2, Notch3, or Notch4, or a non-human homolog thereof. Four to 50 amino acid residues can be used as a polypeptide linker.
  • the length and amino acid composition of the linker polypeptide sequence are varied to alter the orientation and/or proximity of the ECD and the TMD relative to one another to achieve a desired activity of the chimeric polypeptide of the disclosure.
  • the Minimal Linker sequence can be designed to include or omit a protease cleavage site, and can include or omit a glycosylation site or sites for other types of post-translational modification. In some embodiments, the Minimal Linker does not comprise a protease cleavage site or a glysosylation site.
  • the priming receptor further comprises a hinge.
  • Hinge linkers that can be used in the priming receptor can include an oligomerization domain (e.g., a hinge domain) containing one or more polypeptide motifs that promote oligomer formation of the chimeric polypeptides via intermolecular disulfide bonding.
  • the hinge domain generally includes a flexible polypeptide connector region disposed between the ECD and the TMD.
  • the hinge domain provides flexibility between the ECD and TMD and also provides sites for intermolecular disulfide bonding between two or more chimeric polypeptide monomers to form an oligomeric complex.
  • the hinge domain includes motifs that promote dimer formation of the chimeric polypeptides disclosed herein.
  • the hinge domain includes motifs that promote trimer formation of the chimeric polypeptides disclosed herein (e.g., a hinge domain derived from OX40).
  • Hinge polypeptide sequences suitable for the compositions and methods of the disclosure can be naturally-occurring hinge polypeptide sequences (e.g., those from naturally-occurring immunoglobulins) or can be engineered, designed, or modified so as to provide desired and/or improved properties, e.g., modulating transcription.
  • Suitable hinge polypeptide sequences include, but are not limited to, those derived from IgA, IgD, and IgG subclasses, such as IgGl hinge domain, IgG2 hinge domain, IgG3 hinge domain, and IgG4 hinge domain, or a functional variant thereof.
  • the hinge polypeptide sequence contains one or more CXXC motifs.
  • the hinge polypeptide sequence contains one or more CPPC motifs (SEQ ID NO:185).
  • Hinge polypeptide sequences can also be derived from a CD8 ⁇ hinge domain, a CD28 hinge domain, a CD152 hinge domain, a PD-1 hinge domain, a CTLA4 hinge domain, an OX40 hinge domain, and functional variants thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from a CD8 ⁇ hinge domain or a functional variant thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from a CD28 hinge domain or a functional variant thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from an OX40 hinge domain or a functional variant thereof.
  • the hinge domain includes a hinge polypeptide sequence derived from an IgG4 hinge domain or a functional variant thereof.
  • the Fn Notch linking polypeptide is derived from the Robol JMD, which contains a fibronectin repeat (Fn) domain, with a short polypeptide sequence between the Fn repeats and the TMD.
  • the Fn Notch linking polypeptide does not contain a Notch negative regulatory region (NRR), or the Notch HD domain.
  • the Fn linking polypeptide can contain 1, 2, 3, 4, or 5 Fn repeats.
  • the chimeric receptor comprises a Fn linking polypeptide having about 1 to about 5 Fn repeats, about 1 to about 3 Fn repeats, or about 2 to about 3 Fn repeats.
  • the short polypeptide sequence between the Fn repeats and the TMD can be from about 2 to about 30 amino acid residues. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 amino acids, of any sequence. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 naturally- occurring amino acids, of any sequence. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 amino acids, of any sequence but having no more than one proline. In some embodiments, the short polypeptide sequence can be between about 5 and about 20 amino acids, and about 50% or more of the amino acids are glycine.
  • the short polypeptide sequence can be between about 5 and about 20 amino acids, where the amino acids are selected from glycine, serine, threonine, and alanine.
  • the length and amino acid composition of the Fn linking polypeptide sequence can be varied to alter the orientation and/or proximity of the ECD and the TMD relative to one another to achieve a desired activity of the chimeric polypeptide of the disclosure.
  • Stop-Transfer Sequence [00234]
  • the priming receptor further comprises a stop-transfer sequence (STS) in between the transmembrane domain and the intracellular domains.
  • the STS comprises a charged, lipophobic sequence.
  • the STS serves as a membrane anchor, and is believed to prevent passage of the intracellular domain into the plasma membrane.
  • the use of STS domains in priming receptors is described in WO2021061872, hereby incorporated by reference in its entirety.
  • Non-limiting exemplary STS sequences include APLP1, APLP2, APP, TGBR3, CSF1R, CXCL16, CX3CL1, DAG1, DCC, DNER, DSG2, CDH1, GHR, HLA-A, IFNAR2, IGF1R, IL1R1, ERN2, KCNE1, KCNE2, CHL1, LRPl, LRP2, LRP18, PTPRF, SCN1B, SCN3B, NPR3, NGFR, PLXDC2, PAM, AGER, ROBOl, SORCS3, SORCS1, SORL1, SDC1, SDC2, SPN, TYR, TYRP1, DCT, VASN, FLT1, CDH5, PKTFD1, NECTINl, KL, IL6R, EFNB1, CD44, CLSTN1, LRP8, PCDHGC3, NRG1, LRP1B, JAG2, EFNB2, DLL1, CLSTN2, EPCAM, ErbB4, KCNE3, CDH2, NRG2, PT
  • the STS is heterologous to the transmembrane domain. In some embodiments, the STS is homologous to the transmembrane domain. STS sequences are described in WO2021061872, hereby incorporated by reference in its entirety. [00235] In some embodiments, the stop-transfer-sequence comprises the sequence as set forth in SEQ ID NO: 20.
  • Chimeric Antigen Receptors [00236] In another aspect, provided herein are chimeric antigen receptors comprising an extracellular antigen-binding domain that specifically binds to mesothelin (MSLN; NCBI Entrez Gene: 10232; UniProtKB/Swiss-Prot: Q13421, SEQ ID NO: 178).
  • the CAR may be a human CAR, comprising fully human sequences, e.g., natural human sequences.
  • the chimeric antigen receptor includes an extracellular portion comprising an antigen binding domain.
  • the antigen recognition domain of a receptor such as a CAR can be linked to one or more intracellular signaling components, such as signaling components that mimic activation through an antigen receptor complex, such as a TCR complex, in the case of a CAR, and/or signal via another cell surface receptor.
  • the extracellular binding component e.g., ligand-binding or antigen- binding domain
  • the transmembrane domain is fused to the extracellular domain.
  • a transmembrane domain that naturally is associated with one of the domains in the receptor e.g., CAR
  • the transmembrane domain is selected or modified by amino acid substitution to avoid binding of such domains to the transmembrane domains of the same or different surface membrane proteins to minimize interactions with other members of the receptor complex.
  • the chimeric antigen receptor includes an extracellular portion comprising an antigen binding domain described herein and an intracellular signaling domain.
  • an antibody or fragment includes an scFv, a VH, or a single- domain VH antibody and the intracellular domain contains an ITAM.
  • the intracellular signaling domain includes a signaling domain of a zeta chain of a CD3-zeta (CD3) chain.
  • the chimeric antigen receptor includes a transmembrane domain linking the extracellular domain and the intracellular signaling domain. [00239] In some aspects, the transmembrane domain contains a transmembrane portion of CD8a or CD28. The extracellular domain and transmembrane can be linked directly or indirectly.
  • the extracellular domain and transmembrane are linked by a spacer, such as any described herein.
  • the chimeric antigen receptor contains an intracellular domain of a T cell costimulatory molecule, such as between the transmembrane domain and intracellular signaling domain.
  • the T cell costimulatory molecule is CD28 or 41BB.
  • the priming receptor extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein: CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, 54, 56, 57, or 71, CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, 58, 59, 60, 61, or 308, CDR-H3 comprises the sequence set forth in SEQ ID NO: 12, 62, or 63, CDR-L1 comprises the sequence set forth in SEQ ID NO: 14, 64, 65, 66, or 67, CDR-L2 comprises the sequence set forth in SEQ ID NO: 15; and CDR-L3 comprises the sequence set forth
  • the VH chain sequence comprises the sequence set forth in SEQ ID NO: 13.
  • the VL comprises the sequence set forth in SEQ ID NO: 17.
  • the antigen-binding domain comprises the sequence set forth in SEQ ID NO: 30.
  • the priming receptor extracellular antigen-binding domain CDR-H3 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-H3 of SEQ ID NO: 12, 62, or 63
  • the CDR-H2 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-H2 of SEQ ID NO: 11, 58, 59, 60, 61, or 308
  • the CDR-H1 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-H1 of SEQ ID NO: 10, 54, 56, 57, or 71
  • the CDR-L3 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-L3 of SEQ ID NO: 16 or 72
  • the CDR-L2 has at least about 50%, 75%, 80%, 85%, 90%, or 95% identity with a CDR-H3
  • the CDR-H3 is a CDR-H3 of SEQ ID NO: 12, 62, or 63, with up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions
  • the CDR-H2 is a CDR- H2 of SEQ ID NO: 11, 58, 59, 60, 61, or 308, with up to 1, 2, 3, 4, 5, 6, 7, or 8 amino acid substitutions
  • the CDR-H1 is a CDR-H1 of SEQ ID NO: 10, 54, 56, 57, or 71, with up to 1, 2, 3, 4, or 5 amino acid substitutions
  • the CDR-L3 is a CDR-L3 of SEQ ID NO: 16 or 72, with up to 1, 2, 3, 4, or 5 amino acid substitutions
  • the CDR-L2 is a CDR-L2 of SEQ ID NO: 15, 68, 69, or 70, with up to 1, 2, 3, or 4 amino acid substitutions
  • the CDR-L1 is a CDR-L1 of SEQ ID NO: 14, 65, 66
  • a priming receptor extracellular antigen-binding domain provided herein comprises one to three CDRs of a VH domain as set forth in SEQ ID NO: 13. In some embodiments, an antigen-binding domain provided herein comprises two to three CDRs of a VH domain as set forth in SEQ ID NO: 13. In some embodiments, an antigen- binding domain provided herein comprises three CDRs of a VH domain as set forth in SEQ ID NO: 13. In some aspects, the CDRs are Kabat CDRs. In some aspects, the CDRs are Chothia CDRs. In some aspects, the CDRs are AbM CDRs. In some aspects, the CDRs are Contact CDRs.
  • a priming receptor extracellular antigen-binding domain provided herein comprises a VH sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to an VH sequence set forth in SEQ ID NO: 13.
  • an antigen-binding domain provided herein comprises a VH sequence provided in SEQ ID NO: 13, with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions.
  • the amino acid substitutions are conservative amino acid substitutions.
  • the antigen-binding domains described in this paragraph are referred to herein as “variants.”
  • such variants are derived from a sequence provided herein, for example, by affinity maturation, site directed mutagenesis, random mutagenesis, or any other method known in the art or described herein.
  • such variants are not derived from a sequence provided herein and may, for example, be isolated de novo according to the methods provided herein for obtaining antibodies or antigen-binding domains.
  • a priming receptor extracellular antigen-binding domain provided herein comprises one to three CDRs of a VL domain as set forth in SEQ ID NO: 17.
  • an antigen-binding domain provided herein comprises two to three CDRs of a VL domain as set forth in SEQ ID NO: 17. In some embodiments, an antigen- binding domain provided herein comprises three CDRs of a VL domain as set forth in SEQ ID NO: 17. In some aspects, the CDRs are Kabat CDRs. In some aspects, the Kabat VH CDRs are provided in the sequences set forth as SEQ ID NOs: 10, 11, and 12, and the Kabat VL CDRs are provided in the sequences set forth as SEQ ID NOs: 14, 69, and 16. In some aspects, the CDRs are Chothia CDRs.
  • the Chothia VH CDRs are provided in the sequences set forth as SEQ ID NOs: 71, 308, and 12, and the Chothia VL CDRs are provided in the sequences set forth as SEQ ID NOs: 14, 15, and 16.
  • the CDRs are AbM CDRs.
  • the AbM VH CDRs are provided in the sequences set forth as SEQ ID NOs: 54, 58, and 12, and the AbM VL CDRs are provided in the sequences set forth as SEQ ID NOs: 14, 68, and 16.
  • the CDRs are Contact CDRs.
  • the Contact VH CDRs are provided in the sequences set forth as SEQ ID NOs: 56, 60, and 62, and the Contact VL CDRs are provided in the sequences set forth as SEQ ID NOs: 66, 70, and 72.
  • the CDRs are IMGT CDRs.
  • the IMGT VH CDRs are provided in the sequences set forth as SEQ ID NOs: 57, 61, and 63, and the IMGT VL CDRs are provided in the sequences set forth as SEQ ID NOs: 67, DT, and 16.
  • a priming receptor extracellular antigen-binding domain provided herein comprises a VL sequence having at least about 50%, 60%, 70%, 80%, 90%, 95%, or 99% identity to an VL sequence set forth in SEQ ID NO: 17.
  • an antigen-binding domain provided herein comprises a VL sequence provided in SEQ ID NO: 17, with up to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 amino acid substitutions.
  • the amino acid substitutions are conservative amino acid substitutions.
  • the antibodies described in this paragraph are referred to herein as “variants.”
  • such variants are derived from a sequence provided herein, for example, by affinity maturation, site directed mutagenesis, random mutagenesis, or any other method known in the art or described herein.
  • such variants are not derived from a sequence provided herein and may, for example, be isolated de novo according to the methods provided herein for obtaining antibodies or antigen-binding domains.
  • Table C provides illustrative MSLN antigen binding domain CDR sequences of the VH of SEQ ID NO: 13 and the VL of SEQ ID NO: 17, according to the indicated numbering schemes.
  • the transmembrane domain in some embodiments is derived either from a natural or from a synthetic source. Where the source is natural, the domain in some aspects is derived from any membrane-bound or transmembrane protein. Transmembrane regions include those derived from (e.g., comprise at least the transmembrane region(s) of) the alpha, beta or zeta chain of the T-cell receptor, CD28, CD3 epsilon, CD45, CD4, CD5, CDS, CD9, CD 16, CD22, CD33, CD37, CD64, CD80, CD86, CD 134, CD137, and/or CD 154. Alternatively the transmembrane domain in some embodiments is synthetic.
  • the synthetic transmembrane domain comprises predominantly hydrophobic residues such as leucine and valine. In some aspects, a triplet of phenylalanine, tryptophan and valine will be found at each end of a synthetic transmembrane domain.
  • the linkage is by linkers, spacers, and/or transmembrane domain(s).
  • the transmembrane domain of the receptor e.g., the CAR
  • the transmembrane domain of the receptor is a transmembrane domain of human CD28 or variant thereof, e.g., a 27-amino acid transmembrane domain of a human CD28 (Accession No.: P10747.1).
  • the CAR comprises a CD8a TMD.
  • the CD8a TMD comprises the sequence set forth in SEQ ID NO: 27.
  • CAR Hinge [00250]
  • the CAR further includes a spacer, which may be or include at least a portion of an immunoglobulin constant region or variant or modified version thereof, such as a hinge region, e.g., a CD8a hinge, an IgG4 hinge region, and/or a CH1/CL and/or Fc region.
  • the constant region or portion is of a human IgG, such as IgG4 or IgG1.
  • the portion of the constant region serves as a spacer region between the antigen- recognition component, e.g., scFv, and transmembrane domain.
  • the spacer can be of a length that provides for increased responsiveness of the cell following antigen binding, as compared to in the absence of the spacer. In some examples, the spacer is at or about 12 amino acids in length or is no more than 12 amino acids in length.
  • Exemplary spacers include those having at least about 10 to 229 amino acids, about 10 to 200 amino acids, about 10 to 175 amino acids, about 10 to 150 amino acids, about 10 to 125 amino acids, about 10 to 100 amino acids, about 10 to 75 amino acids, about 10 to 50 amino acids, about 10 to 40 amino acids, about 10 to 30 amino acids, about 10 to 20 amino acids, or about 10 to 15 amino acids, and including any integer between the endpoints of any of the listed ranges.
  • a spacer region has about 12 amino acids or less, about 119 amino acids or less, or about 229 amino acids or less.
  • Exemplary spacers include CD8a hinge, IgG4 hinge alone, IgG4 hinge linked to CH2 and CH3 domains, or IgG4 hinge linked to the CH3 domain.
  • Exemplary spacers include, but are not limited to, those described in Hudecek et al. (2013) Clin. Cancer Res., 19:3153 or international patent application publication number WO2014031687.
  • the CAR hinge comprises a CD8a hinge.
  • the CD8a hinge comprises the sequence set forth in SEQ ID NO: 26.
  • intracellular signaling domains are those that mimic or approximate a signal through a natural antigen receptor, a signal through such a receptor in combination with a costimulatory receptor, and/or a signal through a costimulatory receptor alone.
  • a short oligo- or polypeptide linker for example, a linker of between 2 and 10 amino acids in length, such as one containing glycines and serines, e.g., glycine-serine doublet, is present and forms a linkage between the transmembrane domain and the cytoplasmic signaling domain of the receptor.
  • the cytoplasmic domain or intracellular signaling domain of the receptor activates at least one of the normal effector functions or responses of the immune cell, e.g., T cell engineered to express the receptor.
  • the receptor induces a function of a T cell such as cytolytic activity or T-helper activity, such as secretion of cytokines or other factors.
  • a truncated portion of an intracellular signaling domain of an antigen receptor component or costimulatory molecule is used in place of an intact immunostimulatory chain, for example, if it transduces the effector function signal.
  • the intracellular signaling domain or domains include the cytoplasmic sequences of the T cell receptor (TCR), and in some aspects also those of co-receptors that in the natural context act in concert with such receptor to initiate signal transduction following antigen receptor engagement, and/or any derivative or variant of such molecules, and/or any synthetic sequence that has the same functional capability.
  • the receptor includes a primary cytoplasmic signaling sequence that regulates primary activation of the TCR complex.
  • Primary cytoplasmic signaling sequences that act in a stimulatory manner may contain signaling motifs which are known as immunoreceptor tyrosine-based activation motifs or ITAMs.
  • ITAM containing primary cytoplasmic signaling sequences include those derived from TCR or CD3 zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CDS, CD22, CD79a, CD79b, and CD66d.
  • cytoplasmic signaling molecule(s) in the CAR contain(s) a cytoplasmic signaling domain, portion thereof, or sequence derived from CD3 zeta.
  • the intracellular signaling domain comprises a human CD3 zeta stimulatory signaling domain or functional variant thereof, such as a 112 AA cytoplasmic domain of isoform 3 of human CD3.zeta. (Accession No.: P20963.2) or a CD3 zeta signaling domain as described in U.S. Pat. No. 7,446,190 or U.S. Pat. No. 8,911,993.
  • the receptor e.g., the CAR, can include at least one intracellular signaling component or components.
  • the receptor includes an intracellular component of a TCR complex, such as a TCR CD3 chain that mediates T-cell activation and cytotoxicity, e.g., CD3 zeta chain.
  • the extracellular domain is linked to one or more cell signaling modules.
  • cell signaling modules include CD3 transmembrane domain, CD3 intracellular signaling domains, and/or other CD transmembrane domains.
  • the receptor e.g., CAR, further includes a portion of one or more additional molecules such as Fc receptor-gamma, CD8, CD4, CD25, or CD16.
  • the CAR includes a chimeric molecule between CD3-zeta or Fc receptor-gamma and CD8, CD4, CD25 or CD16.
  • the CAR comprises a CD3-zeta activation domain comprising the sequence set forth in SEQ ID NO: 29.
  • the intracellular domain comprises an intracellular costimulatory signaling domain of 41BB or functional variant or portion thereof, such as a 42-amino acid cytoplasmic domain of a human 4-1BB (Accession No. Q07011.1) or functional variant or portion thereof.
  • the receptor encompasses one or more, e.g., two or more, costimulatory domains and an activation domain, e.g., primary activation domain, in the cytoplasmic portion.
  • exemplary receptors include intracellular components of CD3-zeta, CD28, and 4-1BB.
  • the chimeric antigen receptor contains an intracellular domain of a T cell costimulatory molecule.
  • the T cell costimulatory molecule is 4-1BB.
  • the receptor includes a signaling domain and/or transmembrane portion of a costimulatory receptor, such as CD28, 4-1BB, OX40, DAP10, and ICOS.
  • the same receptor includes both the activating and costimulatory components.
  • the intracellular signaling domain comprises a CD8a transmembrane and signaling domain linked to a CD3 (e.g., CD3-zeta) intracellular domain.
  • the intracellular signaling domain comprises a 4-1BB (CD137, TNFRSF9) co-stimulatory domains, linked to a CD3 zeta intracellular domain.
  • the CAR comprises a 4-1BB co-stimulatory domain.
  • the 4-1BB co- stimulatory domain comprises the sequence as set forth in SEQ ID NO: 28.
  • the CAR comprises a sequence as set forth in SEQ ID NO: 30, 31, or 32. In some embodiments, the CAR comprises a sequence as set forth in SEQ ID NO: 31.
  • the CAR or other antigen receptor further includes a marker, such as a cell surface marker, which may be used to confirm transduction or engineering of the cell to express the receptor, such as a truncated version of a cell surface receptor, such as truncated EGFR (tEGFR).
  • the marker includes all or part (e.g., truncated form) of CD34, a nerve growth factor receptor (NGFR), or epidermal growth factor receptor (e.g., tEGFR).
  • the nucleic acid encoding the marker is operably linked to a polynucleotide encoding for a linker sequence, such as a cleavable linker sequence or a ribosomal skip sequence, e.g., T2A.
  • a linker sequence such as a cleavable linker sequence or a ribosomal skip sequence, e.g., T2A.
  • introduction of a construct encoding the CAR and EGFRt separated by a T2A ribosome switch can express two proteins from the same construct, such that the EGFRt can be used as a marker to detect cells expressing such construct.
  • a marker, and optionally a linker sequence can be any as disclosed in published patent application No. WO2014031687.
  • the marker can be a truncated EGFR (tEGFR) that is, optionally, linked to a linker sequence, such as a T2A ribosomal skip sequence.
  • tEGFR truncated EGFR
  • the marker is a molecule, e.g., cell surface protein, not naturally found on T cells or not naturally found on the surface of T cells, or a portion thereof.
  • the molecule is a non-self molecule, e.g., non-self protein, e.g., one that is not recognized as "self" by the immune system of the host into which the cells will be adoptively transferred.
  • the marker serves no therapeutic function and/or produces no effect other than to be used as a marker for genetic engineering, e.g., for selecting cells successfully engineered.
  • the marker may be a therapeutic molecule or molecule otherwise exerting some desired effect, such as a ligand for a cell to be encountered in vivo, such as a costimulatory or immune checkpoint molecule to enhance and/or dampen responses of the cells upon adoptive transfer and encounter with ligand.
  • the CAR may comprise one or modified synthetic amino acids in place of one or more naturally-occurring amino acids.
  • modified amino acids include, but are not limited to, aminocyclohexane carboxylic acid, norleucine, ⁇ -amino n-decanoic acid, homoserine, S- acetylaminomethylcysteine, trans-3- and trans-4-hydroxyproline, 4-aminophenylalanine, 4- nitrophenylalanine, 4-chlorophenylalanine, 4-carboxyphenylalanine, (3-phenylserine (3- hydroxyphenylalanine, phenylglycine, ⁇ -naphthylalanine, cyclohexylalanine, cyclohexylglycine, indoline-2-carboxylic acid, 1,2,3,4-tetrahydroisoquinoline-3-carboxylic acid, aminomalonic acid, aminomalonic acid monoamide, N' -benzyl-N'-methyl-lysine, N',N' -dibenzyl-lysine,
  • the CAR includes an antibody or fragment thereof, including single chain antibodies (sdAbs, e.g., containing only the VH region), VH domains, and scFvs, described herein, a spacer such as a CD8a hinge, a CD8a transmembrane domain, a 4- 1BB intracellular signaling domain, and a CD3 zeta signaling domain.
  • sdAbs single chain antibodies
  • VH domains e.g., containing only the VH region
  • scFvs e.g., containing only the VH region
  • a spacer such as a CD8a hinge, a CD8a transmembrane domain, a 4- 1BB intracellular signaling domain, and a CD3 zeta signaling domain.
  • the CAR includes an antibody or fragment, including sdAbs and scFvs described herein, a spacer such as a CD8a hinge, a CD8a transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3 zeta signaling domain.
  • a spacer such as a CD8a hinge, a CD8a transmembrane domain, a 4-1BB intracellular signaling domain, and a CD3 zeta signaling domain.
  • Transgenes expressing the priming receptor and CAR system may be introduced into cells, such as a T cell, using, for example, a site-specific technique. With site specific integration of the transgenes (e.g., priming receptor and CAR), the transgenes may be targeted to a safe harbor locus or TRAC.
  • Examples of site-specific techniques for integration into the safe harbor loci include, without limitation, homology-dependent engineering using nucleases and homology independent targeted insertion using Cas9.
  • the engineered cells have applications to immune-oncology.
  • the priming receptor and CAR for example, can be selected to target different specific tumor antigens. Examples of cancers that can be effectively targeted using such cells are blood cancers or solid cancers.
  • immune cell therapy can be used to treat solid tumors.
  • Synthetic pathway activators [00269]
  • systems disclosed herein employ one or more “synthetic pathway activators” (SPAs).
  • SPAs synthetic pathway activators
  • CAR-expressing immune cells can be limited by the necessity for in vivo expansion following infusion.
  • SPAs can thus be used to stimulate robust in vivo expansion and enhance desirable properties (e.g., increased survival, persistence, and potency) of T cells expressing priming receptors and/or CARs as described herein.
  • SPA Structure [00270] In various embodiments, SPAs mimic activation of interleukin signaling.
  • Interleukin receptors are cytokine receptors that signal through Signal Transducer and Activator of Transcription (STAT) transcription factors (e.g., STAT3 and STAT5). Interleukin receptors typically function by dimerization in response to ligand binding. Once dimerized, receptors can bind janus-associated kinases (JAKs) to induce JAK cross-phosphorylation and downstream “JAK/STAT” signaling. Accordingly, induced receptor agonism or ligand- independent dimerization of receptors can be utilized to induce constitutive receptor activity and thus, constitutive cytokine signaling.
  • STAT Signal Transducer and Activator of Transcription
  • Interleukin receptors typically function by dimerization in response to ligand binding. Once dimerized, receptors can bind janus-associated kinases (JAKs) to induce JAK cross-phosphorylation and downstream “JAK/STAT” signaling. Accordingly, induced receptor agonism or ligand- independent dimerization
  • SPAs comprise or are derived from interleukin receptor intracellular signaling domains or functional fragments thereof. In some embodiments, SPAs comprise or are derived from interleukin-6 signal transducer (IL6ST) polypeptides or functional fragments thereof. In some embodiments, SPAs comprise or are derived from interleukin-7 receptor (IL-7R) polypeptides or functional fragments thereof. In some embodiments SPAs comprise or are derived from interleukin-15 (IL-15) polypeptides or functional fragments thereof. [00272] In various embodiments, one or more structural alterations can be made to confer constitutive activity to a SPA or functional fragment thereof. In some embodiments, structures or mutations can be added to induce SPA multimerization.
  • one or more amino acids can be mutated to a cysteine to allow formation of one or more disulfide bond(s), e.g., between two receptor monomers.
  • one or more amino acids can be inserted into a wild-type receptor polypeptide to promote dimerization, e.g., through formation of one or more disulfide bond(s).
  • an exogenous polypeptide is operatively linked to a cytokine receptor or functional fragment thereof to cause their multimerization.
  • a leucine zipper polypeptide is operatively linked to a cytokine receptor or functional fragment thereof.
  • the leucine zipper polypeptide is a c-Jun leucine zipper.
  • an exogenous scaffold is operatively linked to a cytokine receptor or functional fragment thereof.
  • the exogenous scaffold is a CD34 ectodomain.
  • SPAs can comprise a ligand agonist (e.g., a cytokine, e.g., an interleukin) that allows constitutive activation of the SPA.
  • the cytokine receptor and a soluble agonist are expressed simultaneously.
  • the cytokine receptor and a membrane-bound agonist are expressed simultaneously.
  • SPAs are anchored to the cellular membrane.
  • SPAs comprise an extracellular domain, a transmembrane domain, and an intracellular signaling domain.
  • SPAs comprise a transmembrane domain of an interleukin receptor.
  • the SPA comprises a leucine zipper-gp130 (referred to interchangeably herein as “L-gp130” or “gp130”) or an L-gp130 intracellular signaling domain.
  • L-gp130 comprises a homodimer, with each monomer comprising (a) an extracellular domain comprising an inserted cysteine residue that forms a disulfide linkage with another monomer and a c-Jun leucine zipper; and (b) an IL6ST transmembrane domain and intracellular signaling domain.
  • the cysteine residue and the leucine zipper on each polypeptide can induce the formation of stable homodimers that mimic constitutive IL-6R activation. Additional details on the construction of L-gp130 are described in Schememann- Laeisz et al. Mol Biol Cell. 2006 Jul;17(7):2986-95 and in WO2020200325, which are hereby incorporated by reference in their entirety.
  • the L-gp130 intracellular signaling domain comprises an amino acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 74.
  • the L-gp130 intracellular signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 74.
  • L-gp130 comprises an amino acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 75.
  • L-gp130 comprises the amino acid sequence set forth in SEQ ID NO: 75.
  • the L-gp130 intracellular signaling domain is encoded by a nucleic acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 79.
  • the L-gp130 intracellular signaling domain is encoded by the nucleic acid sequence set forth in SEQ ID NO: 79.
  • L-gp130 is encoded by a nucleic acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 80.
  • L-gp130 is encoded by the nucleic acid sequence set forth in SEQ ID NO: 80.
  • the leucine zipper domain comprises the sequence as set forth in Seq ID NO: 179.
  • the leucine zipper domain comprises an amino acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 179.
  • the L-gp130 transmembrane domain comprises the gp130 transmembrane domain. In some embodiments, the L-gp130 transmembrane domain comprises the sequence as set forth in Seq ID NO: 180.
  • the L-gp130 transmembrane domain comprises an amino acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 180.
  • the SPA comprises a membrane-bound interleukin-15 (mbIL- 15).
  • mbIL-15 comprises an IL-15 polypeptide linked to a linked to the IL15-receptor ⁇ (IL15R ⁇ ), thus allowing constitutive receptor activation.
  • IL15R ⁇ IL15-receptor ⁇
  • mbIL-15 comprises an amino acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 76.
  • mbIL-15 comprises the amino acid sequence set forth in SEQ ID NO: 76.
  • mbIL-15 is encoded by a nucleic acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 81. In some embodiments, mbIL-15 is encoded by the nucleic acid sequence set forth in SEQ ID NO: 81. [00283] In some embodiments, the SPA comprises a CD34-interleukin-7 receptor (C7R).
  • C7R CD34-interleukin-7 receptor
  • C7R comprises a homodimer, with each monomer comprising (a) an extracellular domain comprising a CD34 ectodomain, (b) a transmembrane domain comprising an inserted cysteine residue that forms a disulfide linkage with another monomer, and (c) an IL-7R intracellular signaling domain.
  • the CD34 ectodomain and the inserted cysteine residue on each polypeptide allow the formation of a stable homodimer that mimics constitutive IL-7R activation. Additional details on the construction of C7R are described in Shum et al. Cancer Discov. 2017 Nov; 7(11): 1238–1247 and in US Publication No.
  • the C7R intracellular signaling domain comprises an amino acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 77.
  • the C7R intracellular signaling domain comprises the amino acid sequence set forth in SEQ ID NO: 77.
  • C7R comprises an amino acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 78.
  • C7R comprises the amino acid sequence set forth in SEQ ID NO: 78.
  • the C7R extracellular domain and transmembrane domain comprises an amino acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 181.
  • the C7R extracellular domain and transmembrane domain comprises the amino acid sequence set forth in SEQ ID NO: 181.
  • the C7R intracellular signaling domain is encoded by a nucleic acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 82.
  • the C7R intracellular signaling domain is encoded by the nucleic acid sequence set forth in SEQ ID NO: 82.
  • C7R is encoded by a nucleic acid sequence at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 83.
  • C7R is encoded by a nucleic acid sequence set forth in SEQ ID NO: 83.
  • Cytokines [00286]
  • the systems disclosed herein employ one or more cytokines.
  • CAR-expressing immune cells can be limited by the necessity for in vivo expansion following infusion.
  • T cells require three signals: antigen-stimulation, co-stimulation, and cytokine-induced stimulation. Activation of CARs is sufficient to induce the first two signals, but cannot recapitulate cytokine signaling.
  • the tumor microenvironment is often immunosuppressive and devoid of pro- inflammatory cytokines. Cytokines can thus be used to stimulate robust in vivo expansion and enhance desirable properties (e.g., increased survival, persistence, and potency) of T cells expressing priming receptors and/or CARs as described herein.
  • cytokines used in the systems disclosed herein can be members of the interleukin (IL) family of cytokines. Interleukins activate receptors that signal through Signal Transducer and Activator of Transcription (STAT) transcription factors (e.g., STAT1, STAT3 and STAT5). Once activated, interleukin receptors can dimerize and bind janus-associated kinases (JAKs) to induce JAK cross-phosphorylation and downstream “JAK/STAT” signaling. Accordingly, induced cytokine expression can be utilized to induce receptor activity and thus cytokine signaling.
  • STAT Signal Transducer and Activator of Transcription
  • cytokines used in the system disclosed herein are secreted into the extracellular milieu upon expression.
  • cytokines used in the system disclosed herein are membrane-bound.
  • Membrane-bound (“mb”) cytokines can comprise a non-native polypeptide that tethers the cytokine to the cellular membrane upon expression.
  • Membrane-bound cytokines can improve activation of cytokine signaling, e.g., by increasing the proximity of the cytokine to its receptor.
  • Exemplary Cytokines [00289] Any cytokine that confers advantageous effects to CAR-expressing immune cells can be employed in the system disclosed herein.
  • cytokines employed in the system disclosed herein can promote memory T cell persistence and/or proliferation (e.g., IL-7, IL-15, and IL-23). In various embodiments, cytokines employed in the system disclosed herein can promote effector cell function (e.g., IL-2 and IL-12). In various embodiments, cytokines employed in the system disclosed herein can reduce immune cell exhaustion (e.g., IL-21 and IL-23). In various embodiments, cytokines employed in the system disclosed herein can promote activation of endogenous immunity (e.g., IL-18). In various embodiments, cytokines employed in the system disclosed herein can reduce an inflammatory response (e.g., IL-10 and TGF- ⁇ ).
  • IL-7 memory T cell persistence and/or proliferation
  • cytokines employed in the system disclosed herein can promote effector cell function (e.g., IL-2 and IL-12).
  • cytokines employed in the system disclosed herein can reduce immune cell exhaustion (
  • cytokines used in the system disclosed herein are selected from IL-2, Super-2, IL-7, IL-21, IL-12, IL-12/23p40, IL-15, IL-18, IL-10, and TGF- ⁇ .
  • the cytokine used in the system disclosed herein is IL-2.
  • the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 86.
  • the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 87.
  • the cytokine used in the system disclosed herein is IL-7.
  • the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 88.
  • the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 89.
  • the cytokine used in the system disclosed herein is IL-21.
  • the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 90.
  • the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 91.
  • the cytokine used in the system disclosed herein is IL-12.
  • the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 92.
  • the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 93.
  • the cytokine used in the system disclosed herein is IL- 12/23p40.
  • the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 94.
  • the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 95.
  • the cytokine used in the system disclosed herein is IL-15.
  • the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 96.
  • the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 97.
  • the cytokine used in the system disclosed herein is IL-18.
  • the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 98.
  • the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 99.
  • the cytokine used in the system disclosed herein is Super-2. Further details on Super-2 are given in U.S. Patent No. 10,150,802, which is hereby incorporated by reference in its entirety.
  • the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 132.
  • the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 133.
  • the cytokine used in the system disclosed herein is IL-10.
  • the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 134.
  • the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 135.
  • the cytokine used in the system disclosed herein is TGF- ⁇ .
  • the cytokine used in the system disclosed herein comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 136.
  • the nucleic acid encoding the cytokine used in the system disclosed herein comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 137.
  • one or more than one cytokine is expressed in the system disclosed herein.
  • two or more cytokines are expressed in the system disclosed herein.
  • three or more cytokines are expressed in the system disclosed herein.
  • cytokines are expressed in the system disclosed herein. In some embodiments, five or more cytokines are expressed in the system disclosed herein. In some embodiments, six or more cytokines are expressed in the system disclosed herein. In some embodiments, seven or more cytokines are expressed in the system disclosed herein.
  • Signal Peptides [00301] In various embodiments, cytokines used in the system disclosed herein are operably linked to a non-native signal peptide. Different signal peptides can yield variant levels of secretion of expressed proteins (e.g., cytokines). Further details on signal peptides and their influence on protein secretion can be found in Lumangtad LA, Bell TW.
  • the signal peptide as a new target for drug design. Bioorg Med Chem Lett. 2020 May 15;30(10):127115, which is hereby incorporated by reference in its entirety. Selection of specific signal peptides can therefore allow rheostat tuning of cytokine secretion based on desired levels of downstream signaling. For example, for cytokines that are expressed with low efficiency, a signal peptide yielding highly efficient secretion can be selected to improve overall activation of cytokine signaling. In another example, for cytokines that are toxic at high levels, a signal peptide yielding reduced efficiency of secretion can be selected to reduce the toxic effects of the cytokine.
  • the non-native signal peptide comprises a signal peptide from at least one of CD44, CD3E, CD5, IGTAL, IL-2, GMCSF, chymotrypsinogen, trypsinogen, IgK, IgKVIII, IgE, OSM, IgG2H, BM40, secrecon, and tPA.
  • the cytokine used in the system disclosed herein is linked to a CD44 signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 100.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 101.
  • the cytokine used in the system disclosed herein is linked to a CD3E signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 102.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 103.
  • the cytokine used in the system disclosed herein is linked to a CD5 signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 104.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 105.
  • the cytokine used in the system disclosed herein is linked to a IGTAL signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 106.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 107.
  • the cytokine used in the system disclosed herein is linked to a IL-2 signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 108.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 109.
  • the cytokine used in the system disclosed herein is linked to a GMCSF signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 110.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 111.
  • the cytokine used in the system disclosed herein is linked to a chymotrypsinogen signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 112.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 113.
  • the cytokine used in the system disclosed herein is linked to a trypsinogen signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 114.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 115.
  • the cytokine used in the system disclosed herein is linked to a IgK signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 116.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 117.
  • the cytokine used in the system disclosed herein is linked to a IgKVIII signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 118.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 119.
  • the cytokine used in the system disclosed herein is linked to a IgE signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 120.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 121.
  • the cytokine used in the system disclosed herein is linked to a OSM signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 122.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 123.
  • the cytokine used in the system disclosed herein is linked to a IgG2H signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 124.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 125.
  • the cytokine used in the system disclosed herein is linked to a BM40 signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 126.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 127.
  • the cytokine used in the system disclosed herein is linked to a Secrecon signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 128.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 129.
  • the cytokine used in the system disclosed herein is linked to a tPA signal peptide.
  • the non-native signal peptide comprises an amino acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the amino acid sequence set forth in SEQ ID NO: 130.
  • the nucleic acid encoding the non-native signal peptide comprises a nucleic acid sequence having at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, or 100% identity to the nucleic acid sequence set forth in SEQ ID NO: 131.
  • Suppressors of Gene Expression [00319]
  • one or more suppressors of gene expression can be used in a system described herein to yield desirable effects on the logic-gate expressing T cells.
  • a suppressor of gene expression can be used, for example, to suppress activity of genes that have inhibitory effects on T cell properties, such as expansion or target cell killing.
  • Suppressors of gene expression can function via any mechanism known in the art. Suppressors of gene expression can function, for example, by knock-out of the genomic sequence, suppression of gene transcription, or suppression of protein translation (“knock- down”). Examples of suppressors of gene expression include, but are not limited to, sgRNAs, shRNAs, siRNAs, TALENs, and zinc-finger nucleases (ZFNs).
  • a suppressor of gene expression used in a system disclosed herein is an sgRNA or an shRNA.
  • the suppressor of gene expression is an sgRNA.
  • the sgRNA suppresses the expression of a gene selected from PTPN2, RASA2, SOCS1, ZC3H12A, and CISH.
  • the sgRNA suppresses the expression of PTPN2.
  • the sgRNA suppresses the expression of RASA2.
  • the sgRNA suppresses the expression of SOCS1.
  • the sgRNA suppresses the expression of ZC3H12A.
  • the sgRNA suppresses the expression of CISH.
  • the sgRNA comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 160-164. In some embodiments, the sgRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 160. In some embodiments, the sgRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 161. In some embodiments, the sgRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 162. In some embodiments, the sgRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 163. In some embodiments, the sgRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 164.
  • the suppressor of gene expression is an shRNA.
  • the shRNA suppresses the expression of a gene selected from RASA2, PTPN2, SOCS1, ZC3H12A, CISH, TNFRSF6 (Fas), TGFBR1, and TGFBR2.
  • the shRNA suppresses the expression of RASA2.
  • the shRNA suppresses the expression of PTPN2.
  • the shRNA suppresses the expression of SOCS1.
  • the shRNA suppresses the expression of ZC3H12A.
  • the shRNA suppresses the expression of CISH.
  • the shRNA suppresses the expression of TNFRSF6 (Fas). In some embodiments, the shRNA suppresses the expression of TGFBR1. In some embodiments, the shRNA suppresses the expression of TGFBR1. In some embodiments, the shRNA comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 165-172. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 165. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 166. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 167.
  • the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 168. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 169. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 170. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 171. In some embodiments, the shRNA comprises the nucleic acid sequence set forth in SEQ ID NO: 172.
  • Exemplary Combinations [00323] Combinations of suppressors of gene expression with an SPA and/or a cytokine can be used in a system described herein to support activation of logic gate-expressing T cells..
  • the SPA is L-gp130 and the cytokine is IL-2. In some embodiments, the SPA is L-gp130 and the cytokine is mbIL-15. In some embodiments, the SPA is C7R and the cytokine is IL-2. In some embodiments, the SPA is C7R and the cytokine is mbIL-15. In some embodiments, the system comprises an sgRNA that suppresses CISH expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses PTPN2 expression and a cytokine that is IL-2.
  • the system comprises an sgRNA that suppresses RASA2 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses SOCS1 expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and a cytokine that is IL-2. In some embodiments, the system comprises an sgRNA that suppresses PTPN2 expression and a cytokine that is IL-21. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and a cytokine that is IL-21.
  • the system comprises an sgRNA that suppresses RASA2 expression and a cytokine that is IL-15. In some embodiments, the system comprises an shRNA that suppresses RASA2 expression and a cytokine that is IL-2. In some embodiments, the system comprises an shRNA that suppresses RASA2 expression and a cytokine that is IL-15. In some embodiments, the system comprises an sgRNA that suppresses CISH expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses PTPN2 expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses RASA2 expression and an SPA that is C7R.
  • the system comprises an sgRNA that suppresses SOCS1 expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and an SPA that is C7R. In some embodiments, the system comprises an sgRNA that suppresses CISH expression and an SPA that is L- gp130. In some embodiments, the system comprises an sgRNA that suppresses RASA2 expression and an SPA that is L-gp130. In some embodiments, the system comprises an sgRNA that suppresses ZC3H12A expression and an SPA that is L-gp130.
  • the system comprises an shRNA that suppresses the expression of TNFRSF6 (Fas) and an additional suppressor of gene expression.
  • the system comprises an shRNA that suppresses the expression of TNFRSF6 (Fas), an shRNA that suppresses the expression of TGFBR2 and an additional suppressor of gene expression.
  • the system comprises an shRNA that suppresses the expression of TNFRSF6 (Fas), an shRNA that suppresses the expression of PTPN2 and an additional suppressor of gene expression.
  • the present disclosure contemplates recombinant nucleic acid inserts that comprise one or more transgenes encoding the priming receptors, CARs, cytokines, or SPAs as described herein.
  • the nucleic acids are recombinant nucleic acids.
  • the insert encodes a priming receptor transgene.
  • the insert encodes a chimeric antigen receptor transgene.
  • the insert comprises a priming receptor transgene and a chimeric antigen receptor transgene.
  • the insert comprises a priming receptor transgene and a cytokine transgene.
  • the insert comprises a cytokine transgene and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a priming receptor transgene, a cytokine transgene, and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a priming receptor transgene and a SPA transgene. In some embodiments, the insert comprises a SPA transgene and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a priming receptor transgene, a SPA transgene, and a chimeric antigen receptor transgene.
  • the insert comprises a SPA, a cytokine transgene, and a chimeric antigen receptor transgene. In some embodiments, the insert comprises a SPA, a priming receptor transgene, a cytokine transgene, and a chimeric antigen receptor transgene. [00326] The insert can also comprise a self-cleaving peptide.
  • self-cleaving peptides include, but are not limited to, self-cleaving viral 2A peptides, for example, a porcine teschovirus-1 (P2A) peptide, a Thosea asigna virus (T2A) peptide, an equine rhinitis A virus (E2A) peptide, or a foot-and-mouth disease virus (F2A) peptide.
  • Self-cleaving 2A peptides allow expression of multiple gene products from a single construct. (See, for example, Chang et al. “Cleavage efficient 2A peptides for high level monoclonal antibody expression in CHO cells,” MAbs 7(2): 403-412 (2015)).
  • the insert can also comprise a WPRE element.
  • WPRE elements are generally described in Higashimoto, T., et al. Gene Ther 14, 1298–1304 (2007); and Zufferey, R., et al. J Virol. 1999 Apr;73(4):2886-92., both of which are hereby incorporated by reference.
  • Recombinant Cells [00328] Also provided herein are recombinant immune cells comprising at least one DNA template non-virally inserted into a target region of the genome of the cell, wherein DNA template encodes the priming receptor and CAR system as described herein, optionally also the cytokine, optionally also the SPA, optionally also the gene expression suppressor molecule.
  • recombinant immune cells comprising the priming receptor that specifically binds Alkaline Phosphatase, Placental/Germ Cell (ALPG/P), the chimeric antigen receptor that specifically binds MSLN, and the cytokine and/or the synthetic pathway activator that activates cytokine signaling.
  • engineered immune cells comprising the priming receptor that specifically binds Alkaline Phosphatase, Placental/Germ Cell (ALPG/P), the chimeric antigen receptor that specifically binds MSLN, and the cytokine.
  • the cell can further comprise a gene expression suppressor such as an RNAi molecule (e.g., shRNA) or an sgRNA for CRISPR-based knockout of a target gene.
  • a gene expression suppressor such as an RNAi molecule (e.g., shRNA) or an sgRNA for CRISPR-based knockout of a target gene.
  • the immune cell comprises primary hematopoietic cells or primary hematopoietic stem cells.
  • that engineered cell is a stem cell, a human cell, a primary cell, an hematopoietic cell, an adaptive immune cell, an innate immune cell, a natural killer (NK) cell, a T cell, a CD8+ cell, a CD4+ cell, or a T cell progenitor.
  • the immune cells are T cells.
  • the T cells are regulatory T cells, effector T cells, or na ⁇ ve T cells.
  • the T cells are CD8 + T cells.
  • the T cells are CD4 + T cells.
  • the T cells are CD4 + CD8 + T cells.
  • the engineered cell is a stem cell, a human cell, a primary cell, an hematopoietic cell, an hematopoietic stem cell, an adaptive immune cell, an innate immune cell, a T cell or a T cell progenitor.
  • immune cells include T cell, B cell, natural killer (NK) cell, NKT/iNKT cell, macrophage, myeloid cell, and dendritic cells.
  • Non-limiting examples of stem cells include pluripotent stem cells (PSCs), embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), embryo- derived embryonic stem cells obtained by nuclear transfer (ntES; nuclear transfer ES), male germline stem cells (GS cells), embryonic germ cells (EG cells), hematopoietic stem/progenitor stem cells (HSPCs), somatic stem cells (adult stem cells), hemangioblasts, neural stem cells, mesenchymal stem cells and stem cells of other cells (including osteocyte, chondrocyte, myocyte, cardiac myocyte, neuron, tendon cell, adipocyte, pancreocyte, hepatocyte, nephrocyte and follicle cells and so on).
  • PSCs pluripotent stem cells
  • ESCs embryonic stem cells
  • iPSCs induced pluripotent stem cells
  • embryo- derived embryonic stem cells obtained by nuclear transfer (ntES; nuclear transfer ES), male germline stem
  • the engineered cells is a T cell, NK cells, iPSC, and HSPC.
  • the engineered cells used in the present disclosure are human cell lines grown in vitro (e.g., deliberately immortalized cell lines, cancer cell lines, etc.).
  • populations of cells comprising a plurality of the immune cell.
  • the genome of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or greater of the cells comprises the priming receptor and CAR system with the optional cytokine, SPA, and/or gene suppressor as described herein.
  • the invention provides methods of treating an immune-related condition (e.g., cancer) in an individual comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor that specifically binds to ALPG/P, a chimeric antigen receptor that specifically binds to MSLN, and optionally, a cytokine and/or a synthetic pathway activator that activates cytokine signaling.
  • a composition comprising a system comprising a priming receptor that specifically binds to ALPG/P, a chimeric antigen receptor that specifically binds to MSLN, and optionally, a cytokine and/or a synthetic pathway activator that activates cytokine signaling.
  • the system can further comprise a gene expression suppressor such as an RNAi molecule (e.g., shRNA) or an sgRNA for CRISPR based knockout of a target gene.
  • the invention provides methods of enhancing an immune response in an individual comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor that specifically binds to ALPG/P, a chimeric antigen receptor that specifically binds to MSLN, and a cytokine and/or a synthetic pathway activator that activates cytokine signaling.
  • a composition comprising a system comprising a priming receptor that specifically binds to ALPG/P, a chimeric antigen receptor that specifically binds to MSLN, and a cytokine and/or a synthetic pathway activator that activates cytokine signaling.
  • the methods provided herein are useful for the treatment of an immune-related condition in an individual.
  • the individual is a human.
  • the methods provided herein (such as methods of enhancing an immune response) are useful for the treatment of cancer and as such an individual receiving the system described herein has cancer.
  • the cancer is a solid cancer. In some embodiments, the cancer is a liquid cancer. In some embodiments, the cancer is immunoevasive. In some embodiments, the cancer is immunoresponsive. In particular embodiments, the cancer is ovarian cancer, fallopian cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancers. In particular embodiments, the cancer is ovarian cancer. [00335] In some embodiments, the treatment results in a decrease in the cancer volume or size. In some embodiments, the treatment is effective at reducing a cancer volume as compared to the cancer volume prior to administration of the antibody. In some embodiments, the treatment results in a decrease in the cancer growth rate.
  • the treatment is effective at reducing a cancer growth rate as compared to the cancer growth rate prior to administration of the antibody. In some embodiments, the treatment is effective at eliminating the cancer. [00336] In some embodiments, MSLN and ALPG or ALPP is expressed at a higher level in the cancer as compared to a non-cancer cell.
  • Levels of MSLN, ALPG, and ALPP can be assessed by any technique known in the field, including, but not limited to, protein assays or nucleic assays such as FACS, Western blot, ELISA, immunoprecipitation, immunohistochemistry, immunofluorescence, radioimmunoassay, dot blotting, immunodetection methods, HPLC, surface plasmon resonance, optical spectroscopy, mass spectrometery, HPLC, qPCR, RT-qPCR, multiplex qPCR or RT-qPCR, RNA-seq, microarray analysis, SAGE, MassARRAY technique, and FISH, and combinations thereof.
  • protein assays or nucleic assays such as FACS, Western blot, ELISA, immunoprecipitation, immunohistochemistry, immunofluorescence, radioimmunoassay, dot blotting, immunodetection methods, HPLC, surface plasmon resonance, optical spectroscopy, mass spectr
  • an immune-related condition e.g., graft-versus-host
  • methods of treating an immune-related condition comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor, a chimeric antigen receptor, and a cytokine.
  • methods of suppressing an immune response in an individual comprising administering to the individual an effective amount of a composition comprising a system comprising a priming receptor, a chimeric antigen receptor, and a cytokine.
  • the cytokine can be a suppressive cytokine such as IL-10.
  • the methods provided herein are useful for the treatment of an immune-related condition in an individual.
  • the individual is a human.
  • the methods provided herein (such as methods of suppressing an immune response) are useful for the treatment of autoimmune disease.
  • the autoimmune disease is graft-versus-host disease.
  • the autoimmune disease is transplant rejection.
  • the autoimmune disease is rheumatoid arthritis.
  • the autoimmune disease is inflammatory bowel disease.
  • the autoimmune disease is type-I diabetes.
  • Methods of administration of a cell comprising a system comprising a priming receptor that specifically binds to ALPG/P, a chimeric antigen receptor that specifically binds to MSLN, and a cytokine and/or a synthetic pathway activator that activates cytokine signaling as described herein can result in modulation of an immune response.
  • Modulation can be an increase or decrease in an immune response. In some embodiments, modulation is an increase in an immune response.
  • a cell comprising a system comprising a priming receptor that specifically binds to ALPG/P, a chimeric antigen receptor that specifically binds to MSLN, and a cytokine and/or a synthetic pathway activator that activates cytokine signaling as described herein can result in induction of pro-inflammatory molecules, such as cytokines or chemokines.
  • pro-inflammatory molecules such as cytokines or chemokines.
  • induced pro-inflammatory molecules are present at levels greater than that achieved with isotype control.
  • pro-inflammatory molecules in turn result in activation of anti-tumor immunity, including, but not limited to, T cell activation, T cell proliferation, T cell differentiation, M1-like macrophage activation, and NK cell activation.
  • a system comprising a priming receptor that specifically binds to ALPG/P, a chimeric antigen receptor that specifically binds to MSLN can induce multiple anti-tumor immune mechanisms that lead to tumor destruction, and a cytokine and/or a synthetic pathway activator that activates cytokine signaling.
  • methods of increasing an immune response in an individual comprising administering to the individual an effective amount of a cell comprising a system comprising a priming receptor that specifically binds to ALPG/P, a chimeric antigen receptor that specifically binds to MSLN, and a cytokine and/or a synthetic pathway activator that activates cytokine signaling.
  • the method of increasing an immune response in a subject comprises administering to the subject a cell comprising a system comprising a priming receptor that specifically binds to ALPG/P, a chimeric antigen receptor that specifically binds to MSLN, and a cytokine and/or a synthetic pathway activator that activates cytokine signaling.
  • the cell is present in a pharmaceutical composition further comprising a pharmaceutically acceptable excipient.
  • any increase or decrease or alteration of an aspect of characteristic(s) or function(s) is as compared to a cell not comprising a composition comprising a system comprising a priming receptor that specifically binds to ALPG/P, a chimeric antigen receptor that specifically binds to MSLN, and a cytokine and/or a synthetic pathway activator that activates cytokine signaling.
  • Increasing an immune response can be both enhancing an immune response or inducing an immune response. For instance, increasing an immune response encompasses both the start or initiation of an immune response, or ramping up or amplifying an on-going or existing immune response.
  • the treatment induces an immune response.
  • the induced immune response is an adaptive immune response.
  • the induced immune response is an innate immune response.
  • the treatment enhances an immune response.
  • the enhanced immune response is an adaptive immune response.
  • the enhanced immune response is an innate immune response.
  • the treatment increases an immune response.
  • the increased immune response is an adaptive immune response.
  • the increased immune response is an innate immune response.
  • the immune response is started or initiated by administration of a cell comprising a system comprising a priming receptor that specifically binds to ALPG/P, a chimeric antigen receptor that specifically binds to MSLN, and a cytokine and/or a synthetic pathway activator that activates cytokine signaling.
  • the immune response is enhanced by administration of cell comprising a system comprising a priming receptor that specifically binds to ALPG/P, a chimeric antigen receptor that specifically binds to MSLN, and a cytokine and/or a synthetic pathway activator that activates cytokine signaling.
  • the present application provides methods of genetically editing a cell with a system comprising a priming receptor that specifically binds to ALPG/P, a chimeric antigen receptor that specifically binds to MSLN, and a cytokine and/or a synthetic pathway activator that activates cytokine signaling, which results in the modulation of the immune function of the cell.
  • the modulation can be increasing an immune response.
  • the modulation is an increase in immune function.
  • the modulation of function leads to the expression of an MSLN CAR.
  • the modulation of function leads to the activation of a cell comprising the system.
  • the cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor.
  • NK natural killer
  • the modulation of function of the cells comprising the priming receptor and CAR system as described herein leads to an increase in the cells’ abilities to stimulate both native and activated T-cells, for example, by increasing cytokine or chemokine secretion by the cells expressing the priming receptor and CAR system.
  • the modulation of function enhances or increases the cells’ ability to produce cytokines, chemokines, CARs, or costimulatory or activating receptors.
  • the modulation increases the T-cell stimulatory function of the cells expressing the priming receptor and CAR system, including, for example, the cells’ abilities to trigger T- cell receptor (TCR) signaling, T-cell proliferation, or T-cell cytokine production.
  • TCR T- cell receptor
  • the increased immune response is secretion of cytokines and chemokines.
  • the priming receptor and CAR system induces increased expression of at least one cytokine or chemokine in a cell as compared to an isotype control cell.
  • the at least one cytokine or chemokine is selected from the group consisting of: IL-2 and IFNg.
  • the cytokine or chemokine is IL-2. In some embodiments, the cytokine or chemokine is IFNg. In some embodiments, the cytokine or chemokine secretion is increased a between bout 1-100-fold 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 1-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, or 90-100 fold as compared to an untreated cell or a cell treated with an isotype control antibody.
  • the chemokine is IL-2 and the secretion is increased between about 1-100-fold, 1-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50-fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 1-10-fold, 10-20-fold, 20-30-fold, 30-40-fold, 40-50-fold, 50-60-fold, 60-70-fold, 70-80-fold, 80-90-fold, or 90-100-fold as compared to an untreated cell or a cell treated with an isotype control antibody.
  • the cytokine is IFNg and the secretion is increased between about 1-100-fold, 1-fold, 5-fold, 10-fold, 20-fold, 30-fold, 40-fold, 50- fold, 60-fold, 70-fold, 80-fold, 90-fold, 100-fold, 1-10-fold, 10-20-fold, 20-30-fold, 30-40- fold, 40-50-fold, 50-60-fold, 60-70-fold, 70-80-fold, 80-90-fold, or 90-100-fold as compared to an untreated cell or a cell treated with an isotype control antibody.
  • the enhanced immune response is anti-tumor immune cell recruitment and activation.
  • the cell expressing the priming receptor and CAR system induces a memory immune response as compared to an isotype control cell.
  • a memory immune response is a protective immune response upon a subsequent exposure to pathogens or antigens that the immune system encountered previously.
  • Exemplary memory immune responses include the immune response after infection or vaccination with an antigen.
  • memory immune responses are mediated by lymphocytes such as T cells or B cells.
  • the memory immune response is a protective immune response to cancer, including cancer cell growth, proliferation, or metastasis.
  • the memory immune response inhibits, prevents, or reduces cancer cell growth, proliferation, or metastasis.
  • Genome editing refers to a type of genetic manipulation in which DNA is inserted, replaced, or removed from the genome using artificially manipulated nucleases or “molecular scissors”. It is a useful tool for elucidating the function and effect of sequence-specific genes or proteins or altering cell behavior (e.g., for therapeutic purposes).
  • Currently available genome editing tools include zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALENs) to incorporate genes at safe harbor loci (e.g., the adeno-associated virus integration site 1 (AAVS1) safe harbor locus).
  • ZFN zinc finger nucleases
  • TALENs transcription activator-like effector nucleases
  • the DICE (dual integrase cassette exchange) system utilizing phiC31 integrase and Bxb1 integrase is a tool for target integration. Additionally, clustered regularly interspaced short palindromic repeat/Cas9 (CRISPR/Cas9) techniques can be used for targeted gene insertion. [00354] Site specific gene editing approaches can include homology dependent mechanisms or homology independent mechanisms. [00355] All methods known in the art for targeted insertion of gene sequences are contemplated in the methods described herein to insert constructs at gene targets or safe harbor loci.
  • nucleotide sequences greater than about 5 kilobases in length into the genome of a cell in the absence of a viral vector.
  • the nucleotide sequence greater than about 5 kilobase in length can be inserted into the genome of a primary immune cell, in the absence of a viral vector.
  • Integration of large nucleic acids, for example nucleic acids greater than 5 kilobase in size, into cells can be limited by low efficiency of integration, off-target effects and/or loss of cell viability.
  • the plasmid can be introduced into an immune cell with a nuclease, such as a CRISPR-associated system (Cas).
  • the nuclease can be introduced in a ribonucleoprotein format with a guide RNA (gRNA) that targets a specific site on the genome of the immune cell.
  • gRNA guide RNA
  • the specific site may be a portion of the genome that encodes an endogenous immune cell receptor. Thus, cutting the genome at this site will cause the immune cell to no longer express an endogenous immune cell receptor.
  • the plasmid may include 5’ and 3’ homology-directed repair arms complementary to sequences at a specific site on the genome of the immune cell. The complementary sequences are on either side of the site cut by the nuclease, which allows the plasmid to be incorporated at a specified insertion site on the immune cell’s genome. Once the plasmid is incorporated, the cell will express the priming receptor.
  • a T cell is activated.
  • the T cell may be obtained from a patient.
  • immune cells such as T cells
  • the plasmid that encodes the CAR and priming receptor are introduced into a T cell.
  • the plasmids of the present disclosure can be introduced using electroporation. When introducing the plasmid via electroporation, the nuclease may also be introduced.
  • methods of the present disclosure avoid the use of viral vectors for introducing transgenes, which is a known bottleneck in immune cell engineering.
  • the T cells are then expanded and co-cultured to create a sufficient quantity of engineered immune cells to be used as a therapeutic treatment.
  • Methods for editing the genome of a cell can include a) providing a Cas9 ribonucleoprotein complex (RNP)-DNA template complex comprising: (i) the RNP, wherein the RNP comprises a Cas9 nuclease domain and a guide RNA, wherein the guide RNA specifically hybridizes to a target region of the genome of the cell, and wherein the Cas9 nuclease domain cleaves the target region to create an insertion site in the genome of the cell; and (ii) a double-stranded or single-stranded DNA template, wherein the size of the DNA template is greater than about 200 nucleotides, wherein the 5’ and 3’ ends of the DNA template comprise nucleotide sequences that are homologous to genomic sequences flanking the insertion site, and wherein the molar ratio of RNP to DNA template in the complex is from about 3:1 to about 100:1; and b) introducing the RNP-DNA template complex into the cell.
  • RNP Cas9
  • the methods described herein provide an efficiency of delivery of the RNP-DNA template complex of at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or higher.
  • the efficiency is determined with respect to cells that are viable after introducing the RNP-DNA template into the cell.
  • the efficiency is determined with respect to the total number of cells (viable or non-viable) in which the RNP-DNA template is introduced into the cell.
  • the efficiency of delivery can be determined by quantifying the number of genome edited cells in a population of cells (as compared to total cells or total viable cells obtained after the introducing step).
  • Various methods for quantifying genome editing can be utilized. These methods include, but are not limited to, the use of a mismatch- specific nuclease, such as T7 endonuclease I; sequencing of one or more target loci (e.g., by sanger sequencing of cloned target locus amplification fragments); and high-throughput deep sequencing.
  • loss of cell viability is reduced as compared to loss of cell viability after introduction of naked DNA into a cell or introduction of DNA into a cell using a viral vector.
  • the reduction can be a reduction of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%,100% or any percentage in between these percentages.
  • off-target effects of integration are reduced as compared to off-target integration after introduction of naked DNA into a cell or introduction of DNA into a cell using a viral vector.
  • the reduction can be a reduction of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or any percentage in between these percentages.
  • the methods described herein provide for high cell viability of cells to which the RNP-DNA template has been introduced.
  • the viability of the cells to which the RNP-DNA template has been introduced is at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or higher.
  • the viability of the cells to which the RNP-DNA template has been introduced is from about 20% to about 99%, from about 30% to about 90%, from about 35% to about 85% or 90% or higher, from about 40% to about 85% or 90% or higher, from about 50% to about 85% or 90% or higher, from about 50% to about 85% or 90% or higher, from about 60% to about 85% or 90% or higher, or from about 70% to about 85% or 90% or higher.
  • the molar ratio of RNP to DNA template can be from about 3:1 to about 100:1.
  • the molar ratio can be from about 5:1 to 10:1, from about 5:1 to about 15:1, 5:1 to about 20:1; 5:1 to about 25:1; from about 8:1 to about 12:1; from about 8:1 to about 15:1, from about 8:1 to about 20:1, or from about 8:1 to about 25:1.
  • the DNA template is at a concentration of about 2.5 pM to about 25 pM.
  • the concentration of DNA template can be about 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25 pM or any concentration in between these concentrations.
  • the size or length of the DNA template is greater than about 4.5 kb, 5.0 kb, 5.1 kb, 5.2 kb, 5.3 kb, 5.4 kb, 5.5 kb, 5.6 kb, 5.7 kb, 5.8 kb, 5.9 kb, 6.0 kb, 6.1 kb, 6.2 kb, 6.3 kb, 6.4 kb, 6.5 kb, 6.6 kb, 6.7 kb, 6.8 kb, 6.9 kb, 7.0 kb, 7.1 kb, 7.2 kb, 7.3 kb, 7.4 kb, 7.5 kb, 7.6 kb, 7.7 kb, 7.8 kb, 7.9 kb, 8.0 kb, 8.1 kb, 8.2 kb, 8.3 kb, 8.4 kb, 8.5 kb, 8.6 kb, 8.7 kb, 8.7 kb, 8.7
  • the size of the DNA template can be about 4.5 kb to about 10 kb, about 5 kb to about 10 kb, about 5 kb to about 9 kb, about 5 kb to about 8 kb, about 5 kb to about 7 kb, about 5 kb to about 6 kb, about kb 6 to about 10 kb, about 6 kb to about 9 kb, about 6 kb to about 8 kb, about 6 kb to about 7 kb, about 7 kb to about 10 kb, about 7 kb to about 9 kb, about 7 kb to about 8 kb, about 8 kb to about 10 kb, about 8 kb to about 9 kb, or about 9 kb to about 10 kb.
  • the amount of DNA template is about 1 ⁇ g to about 10 ⁇ g.
  • the amount of DNA template can be about 1 ⁇ g to about 2 ⁇ g, about 1 ⁇ g to about 3 ⁇ g, about 1 ⁇ g to about 4 ⁇ g, about 1 ⁇ g to about 5 ⁇ g, about 1 ⁇ g to about 6 ⁇ g, about 1 ⁇ g to about 7 ⁇ g, about 1 ⁇ g to about 8 ⁇ g, about 1 ⁇ g to about 9 ⁇ g, about 1 ⁇ g to about 10 ⁇ g.
  • the amount of DNA template is about 2 ⁇ g to about 3 ⁇ g, about 2 ⁇ g to about 4 ⁇ g, about 2 ⁇ g to about 5 ⁇ g, about 2 ⁇ g to about 6 ⁇ g, about 2 ⁇ g to about 7 ⁇ g, about 2 ⁇ g to about 8 ⁇ g, about 2 ⁇ g to about 9 ⁇ g, or 2 ⁇ g to about 10 ⁇ g.
  • the amount of DNA template is about 3 ⁇ g to about 4 ⁇ g, about 3 ⁇ g to about 5 ⁇ g, about 3 ⁇ g to about 6 ⁇ g, about 3 ⁇ g to about 7 ⁇ g, about 3 ⁇ g to about 8 ⁇ g, about 3 ⁇ g to about 9 ⁇ g, or about 3 ⁇ g to about 10 ⁇ g.
  • the amount of DNA template is about 4 ⁇ g to about 5 ⁇ g, about 4 ⁇ g to about 6 ⁇ g, about 4 ⁇ g to about 7 ⁇ g, about 4 ⁇ g to about 8 ⁇ g, about 4 ⁇ g to about 9 ⁇ g, or about 4 ⁇ g to about 10 ⁇ g.
  • the amount of DNA template is about 5 ⁇ g to about 6 ⁇ g, about 5 ⁇ g to about 7 ⁇ g, about 5 ⁇ g to about 8 ⁇ g, about 5 ⁇ g to about 9 ⁇ g, or about 5 ⁇ g to about 10 ⁇ g. In some embodiments, the amount of DNA template is about 6 ⁇ g to about 7 ⁇ g, about 6 ⁇ g to about 8 ⁇ g, about 6 ⁇ g to about 9 ⁇ g, or about 6 ⁇ g to about 10 ⁇ g. In some embodiments, the amount of DNA template is about 7 ⁇ g to about 8 ⁇ g, about 7 ⁇ g to about 9 ⁇ g, or about 7 ⁇ g to about 10 ⁇ g.
  • the amount of DNA template is about 8 ⁇ g to about 9 ⁇ g, or about 8 ⁇ g to about 10 ⁇ g. In some embodiments, the amount of DNA template is about 9 ⁇ g to about 10 ⁇ g. [00370] In some cases, the size of the DNA template is large enough and in sufficient quantity to be lethal as naked DNA. In some embodiments, the DNA template encodes a heterologous protein or a fragment thereof. In some embodiments, the DNA template encodes at least one gene. In some embodiments, the DNA template encodes at least two genes. In some embodiments, the DNA template encodes one, two, three, four, five, six, seven, eight, nine, ten, or more genes.
  • the DNA template includes regulatory sequences, for example, a promoter sequence and/or an enhancer sequence to regulate expression of the heterologous protein or fragment thereof after insertion into the genome of a cell.
  • the DNA template is a linear DNA template.
  • the DNA template is a single-stranded DNA template.
  • the single-stranded DNA template is a pure single-stranded DNA template.
  • pure single-stranded DNA is meant single-stranded DNA that substantially lacks the other or opposite strand of DNA.
  • substantially lacks is meant that the pure single-stranded DNA lacks at least 100- fold more of one strand than another strand of DNA.
  • the RNP-DNA template complex is formed by incubating the RNP with the DNA template for less than about one minute to about thirty minutes, at a temperature of about 20o C to about 25o C.
  • the RNP can be incubated with the DNA template for about 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes or 30 minutes or any amount of time in between these times, at a temperature of about 20o C, 21o C, 22o C, 23o C, 24o C o ⁇ r 25o C.
  • the RNP can be incubated with the DNA template for less than about one minute to about one minute, for less than about one minute to about 5 minutes, for less than about 1 minute to about 10 minutes, for about 5 minutes to 10 minutes, for about 5 minutes to 15 minutes, for about 10 to about 15 minutes, for about 10 minutes to about 20 minutes, or for about 10 minutes to about 30 minutes, at a temperature of about 20o C to about 25o C.
  • the RNP-DNA template complex and the cell are mixed prior to introducing the RNP-DNA template complex into the cell.
  • introducing the RNP-DNA template complex comprises electroporation.
  • Methods, compositions, and devices for electroporating cells to introduce a RNP-DNA template complex can include those described in the examples herein. Additional or alternative methods, compositions, and devices for electroporating cells to introduce a RNP-DNA template complex can include those described in WO/2006/001614 or Kim, J.A. et al. Biosens. Bioelectron. 23, 1353–1360 (2008). Additional or alternative methods, compositions, and devices for electroporating cells to introduce a RNP-DNA template complex can include those described in U.S. Patent Appl. Pub. Nos. 2006/0094095; 2005/0064596; or 2006/0087522.
  • Additional or alternative methods, compositions, and devices for electroporating cells to introduce a RNP-DNA template complex can include those described in Li, L.H. et al. Cancer Res. Treat. 1, 341–350 (2002); U.S. Patent Nos.: 6,773,669; 7,186,559; 7,771,984; 7,991,559; 6485961; 7029916; and U.S. Patent Appl. Pub. Nos: 2014/0017213; and 2012/0088842, all of which are hereby incorporated by reference.
  • Additional or alternative methods, compositions, and devices for electroporating cells to introduce a RNP-DNA template complex can include those described in Geng, T. et al.. J.
  • the Cas9 protein can be in an active endonuclease form, such that when bound to target nucleic acid as part of a complex with a guide RNA or part of a complex with a DNA template, a double strand break is introduced into the target nucleic acid.
  • the double strand break can be repaired by NHEJ to introduce random mutations, or HDR to introduce specific mutations.
  • Various Cas9 nucleases can be utilized in the methods described herein.
  • a Cas9 nuclease that requires an NGG protospacer adjacent motif (PAM) immediately 3’ of the region targeted by the guide RNA can be utilized.
  • Such Cas9 nucleases can be targeted to any region of a genome that contains an NGG sequence.
  • Cas9 proteins with orthogonal PAM motif requirements can be utilized to target sequences that do not have an adjacent NGG PAM sequence.
  • Exemplary Cas9 proteins with orthogonal PAM sequence specificities include, but are not limited to, CFP1, those described in Nature Methods 10, 1116–1121 (2013), and those described in Zetsche et al., Cell, Volume 163, Issue 3, p759–771, 22 October 2015, both of which are hereby incorporated by reference.
  • the Cas9 protein is a nickase, such that when bound to target nucleic acid as part of a complex with a guide RNA, a single strand break or nick is introduced into the target nucleic acid.
  • a pair of Cas9 nickases, each bound to a structurally different guide RNA, can be targeted to two proximal sites of a target genomic region and thus introduce a pair of proximal single stranded breaks into the target genomic region.
  • nickase pairs can provide enhanced specificity because off-target effects are likely to result in single nicks, which are generally repaired without lesion by base-excision repair mechanisms.
  • Exemplary Cas9 nickases include Cas9 nucleases having a D10A or H840A mutation.
  • the RNP comprises a Cas9 nuclease.
  • the RNP comprises a Cas9 nickase.
  • the RNP-DNA template complex comprises at least two structurally different RNP complexes.
  • the at least two structurally different RNP complexes contain structurally different Cas9 nuclease domains
  • the at least two structurally different RNP complexes contain structurally different guide RNAs.
  • each of the structurally different RNP complexes comprises a Cas9 nickase, and the structurally different guide RNAs hybridize to opposite strands of the target region.
  • a plurality of RNP-DNA templates comprising structurally different ribonucleoprotein complexes is introduced into the cell.
  • a Cas9 protein can be complexed with a plurality (e.g., 2, 3, 4, 5, or more, e.g., 2-10, 5-100, 20-100) of structurally different guide RNAs to target insertion of a DNA template at a plurality of structurally different target genomic regions.
  • cells include, but are not limited to, eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells and the like.
  • the cell is a mammalian cell, for example, a human cell.
  • the cell can be in vitro, ex vivo or in vivo.
  • the cell can also be a primary cell, a germ cell, a stem cell or a precursor cell.
  • the precursor cell can be, for example, a pluripotent stem cell, or a hematopoietic stem cell.
  • the cell is a primary hematopoietic cell or a primary hematopoietic stem cell.
  • the primary hematopoietic cell is an immune cell.
  • the immune cell is a T cell.
  • the T cell is a regulatory T cell, an effector T cell, or a na ⁇ ve T cell.
  • the T cell is a CD4+ T cell.
  • the T cell is a CD8+ T cell.
  • the T cell is a CD4+CD8+ T cell.
  • the T cell is a CD4-CD8- T cell.
  • the cells are removed from a subject, modified using any of the methods described herein and administered to the patient.
  • any of the constructs described herein is delivered to the patient in vivo. See, for example, U.S. Patent No. 9737604 and Zhang et al. “Lipid nanoparticle-mediated efficient delivery of CRISPR/Cas9 for tumor therapy,” NPG Asia Materials Volume 9, page e441 (2017), both of which are hereby incorporated by reference.
  • the RNP- DNA template complex is introduced into about 1 x 10 5 to about 2 x 10 6 cells.
  • the RNP- DNA template complex can be introduced into about 1 x 10 5 to about 5 x 10 5 cells, about 1 x 10 5 to about 1 x 10 6 , 1 x 10 5 to about 1.5 x 10 6 , 1 x 10 5 to about 2 x 10 6 , about 1 x 10 6 to about 1.5 x 10 6 cells or about 1 x 10 6 to about 2 x 10 6 .
  • the methods and compositions described herein can be used for generation, modification, use, or control of recombinant T cells, such as chimeric antigen receptor T cells (CAR T cells).
  • CAR T cells can be used to treat or prevent cancer, an infectious disease, or autoimmune disease in a subject.
  • one or more gene products are inserted or knocked-in to a T cell to express a heterologous protein (e.g., a chimeric antigen receptor (CAR) or a priming receptor).
  • a heterologous protein e.g., a chimeric antigen receptor (CAR) or a priming receptor.
  • Insertion sites [00383]
  • Methods for editing the genome of a T cell include a method of editing the genome of a human T cell comprise inserting a nucleic acid sequence or construct into a target region in exon 1 of the TCR- ⁇ subunit (TRAC) gene in the human T cell.
  • the target region is in exon 1 of the constant domain of TRAC gene.
  • Methods for editing the genome of a T cell also include a method of editing the genome of a human T cell comprise inserting a nucleic acid sequence or construct into a target region in exon 1 of a TCR- ⁇ subunit (TRBC) gene in the human T cell.
  • TRBC TCR- ⁇ subunit
  • the target region is in exon 1 of the TRBC1 or TRBC2 gene.
  • Methods for editing the genome of a T cell include a method of editing the genome of a human T cell comprise inserting a nucleic acid sequence or construct into a target region of a genomic safe harbor (GSH).
  • GSH genomic safe harbor
  • Gene editing therapies include, for example, vector integration and site specific integration. Site-specific integration is a promising alternative to random integration of viral vectors, as it mitigates the risks of insertional mutagenesis or insertional oncogenesis (Kolb et al. Trends Biotechnol. 200523:399-406; Porteus et al. Nat Biotechnol. 200523:967-973; Paques et al. Curr Gen Ther. 20077:49-66).
  • SHS safe harbor loci or safe harbor sites
  • SHS SHS
  • Other potential SHS have been identified on the basis of homology, with sites first identified in other species (e.g., the human homolog of the permissive murine Rosa26 locus) or among the growing number of human genes that appear non-essential under some circumstances.
  • One putative SHS of this type is the CCR5 chemokine receptor gene, which, when disrupted, confers resistance to human immunodeficiency virus infection.
  • Additional potential genomic SHS have been identified in human and other cell types on the basis of viral integration site mapping or gene-trap analyses, as was the original murine Rosa26 locus.
  • the three top SHS, AAVS1, CCR5, and Rosa26, are in close proximity to many protein coding genes and regulatory elements. (See Sadelain, M., et al. (2012).
  • the AAVS1 (also known as the PPP1R12C locus) on human chromosome 19 is a known SHS for hosting transgenes (e.g., DNA transgenes) with expected function. It is at position 19q13.42. It has an open chromatin structure and is transcription-competent.
  • the canonical SHS locus for AAVS1 is chr19: 55,625,241–55,629,351. See Pellenz et al.
  • AAVS1 target gRNA and target sequence are provided below: ⁇ AAVS1-gRNA sequence: ggggccactagggacaggatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO:186) ⁇ AAVS1 target sequence: ggggccactagggacaggat (SEQ ID NO:187) [00389] CCR5, which is located on chromosome 3 at position 3p21.31, encodes the major co-receptor for HIV-1.
  • the canonical SHS locus for CCR5 is chr3: 46,414,443–46,414,942. See Pellenz et al. “New Human Chromosomal Sites with "Safe Harbor” Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7 (2019): 814-828, the relevant disclosures of which are herein incorporated by reference. [00390]
  • the mouse Rosa26 locus is particularly useful for genetic modification as it can be targeted with high efficiency and is expressed in most cell types tested. Irion et al.
  • safe harbor sites are provided in Pellenz et al. “New Human Chromosomal Sites with "Safe Harbor” Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7 (2019): 814-828, the relevant disclosures of which are herein incorporated by reference. Examples of additional integration sites are provided in Table D. [00392]
  • the safe harbor sites allow for high transgene expression (sufficient to allow for transgene functionality or treatment of a disease of interest) and stable expression of the transgene over several days, weeks or months.
  • knockout of the gene at the safe harbor locus confers benefit to the function of the cell, or the gene at the safe harbor locus has no known function within the cell.
  • the safe harbor locus results in stable transgene expression in vitro with or without CD3/CD28 stimulation, negligible off-target cleavage as detected by iGuide-Seq or CRISPR-Seq, less off-target cleavage relative to other loci as detected by iGuide-Seq or CRISPR-Seq, negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible transgene-independent chimeric antigen receptor expression, negligible deregulation or silencing of nearby genes, and positioned outside of a cancer-related gene.
  • a “nearby gene” can refer to a gene that is within about 100kB, about 125kB, about 150kB, about 175kB, about 200kB, about 225kB, about 250kB, about 275kB, about 300kB, about 325kB, about 350kB, about 375kB, about 400kB, about 425kB, about 450kB, about 475kB, about 500kB, about 525kB, about 550kB away from the safe harbor locus (integration site).
  • the present disclosure contemplates inserts that comprise one or more transgenes.
  • the transgene can encode a therapeutic protein, an antibody, a peptide, or any other gene of interest.
  • the transgene integration can result in, for example, enhanced therapeutic properties.
  • enhanced therapeutic properties refer to an enhanced therapeutic property of a cell when compared to a typical immune cell of the same normal cell type.
  • a T cell having “enhanced therapeutic properties” has an enhanced, improved, and/or increased treatment outcome when compared to a typical, unmodified and/or naturally occurring T cell.
  • the therapeutic properties of immune cells can include, but are not limited to, cell transplantation, transport, homing, viability, self-renewal, persistence, immune response control and regulation, survival, and cytotoxicity.
  • the term “insert size” refers to the length of the nucleotide sequence being integrated (inserted) at the target locus or safe harbor site.
  • the insert size comprises at least about 4.5 kilobasepairs (kb) to about 10 kilobasepairs (kb). In some embodiments, the insert size comprises about 5000 nucleotides or more basepairs.
  • the insert size comprises up to 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 kbp (kilo basepairs) or the sizes in between. In some embodiments, the insert size is greater than 4.5, 4.8, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 kbp or the sizes in between. In some embodiments, the insert size is within the range of 4.5-15 kbp or is any number in that range. In some embodiments, the insert size is within the range of 4.8-8.3 kbp or is any number in that range. In some embodiments, the insert size is within the range of 5-8.3 kbp or is any number in that range.
  • the insert size is within the range of 5-15 kbp or is any number in that range. In some embodiments, the insert size is within the range of 4.5-20 kbp or is any number in that range. In some embodiments, the insert size is 5-10 kbp. In some embodiments, the insert size is 4.5-10, 5-10, 6-10, 7-10, 8-10, 9-10 kbp. In some embodiments, the insert size is 4.5-11, 6-11, 7-11, 8-11, 9-11, or 10- 11 kbp. In some embodiments, the insert size is 4.5-12, 6-12, 7-12, 8-12, 9-12, 10-12, or 11- 12 kbp.
  • the insert size is 4.5-13, 6-13, 7-13, 8-13, 9-13, 10-13, 11-13, or 12-13 kbp. In some embodiments, the insert size is 4.5-14, 6-14, 7-14, 8-14, 9-14, 10-14, 11-14, 12-14 or 13-14 kbp. In some embodiments, the insert size is 4.5-15, 6-15, 7-15, 8-15, 9-15, 10-15, 11-15, 12-15, 13-15, or 14-15 kbp. In some embodiments, the insert size is 4.5- 16, 6-16, 7-16, 8-16, 9-16, 10-16, 11-16, 12-16, 13-16, 14-16 or 15-16 kbp.
  • the insert size is 4.5-17, 6-17, 7-17, 8-17, 9-17, 10-17, 11-17, 12-17, 13-17, or 14-17, 15-17 or 16-17 kbp. In some embodiments, the insert size is 4.5-18, 6-18, 7-18, 8-18, 9-18, 10-18, 11-18, 12-18, 13-18, 14-18, 15-18, 16-18 or 17-18 kbp. In some embodiments, the insert size is 4.5-19, 6-19, 7-19, 8-19, 9-19, 10-19, 11-19, 12-19, 13-19, 14-19, 15-19, 16- 19, 17-19, or 18-19 kbp.
  • the insert size is 4.5-20, 6-20, 7-20, 8-20, 9- 20, 10-20, 11-20, 12-20, 13-20, 14-20, 15-20, 16-20, 17-20, 18-20, or 19-20 kbp.
  • the inserts of the present disclosure refer to nucleic acid molecules or polynucleotide inserted at a target locus or safe harbor site.
  • the nucleotide sequence is a DNA molecule, e.g., genomic DNA, or comprises deoxy- ribonucleotides.
  • the insert comprises a smaller fragment of DNA, such as a plastid DNA, mitochondrial DNA, or DNA isolated in the form of a plasmid, a fosmid, a cosmid, a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC), and/or any other sub-genome segment of DNA.
  • the insert is an RNA molecule or comprises ribonucleotides. The nucleotides in the insert are contemplated as naturally occuring nucleotides, non-naturally occuring, and modified nucleotides.
  • Nucleotides may be modified chemically or biochemically, or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications.
  • the polynucleotides can be in any topological conformation, including single-stranded, double- stranded, partially duplexed, triplexed, hairpinned, circular conformations, and other three- dimension conformations contemplated in the art. [00397]
  • the inserts can have coding and/or non-coding regions.
  • the insert can comprises a non-coding sequence (e.g., control elements, e.g., a promoter sequence).
  • the insert encodes transcription factors.
  • the insert encodes an antigen binding receptors such as single receptors, T-cell receptors (TCRs), priming receptors, CARs, mAbs, etc.
  • the the insert is a human sequence.
  • the insert is chimeric.
  • the insert is a multi-gene/multi-module therapeutic cassette.
  • a multi-gene/multi-module therapeutic cassette referst to an insert or cassette having one or more than one receptor (e.g., synthetic receptors), other exogenous protein coding sequences, non-coding RNAs, transcriptional regulatory elements, and/or insulator sequences, etc.
  • the nucleic acid sequence is inserted into the genome of the T cell via non-viral delivery.
  • the nucleic acid can be naked DNA, or in a non-viral plasmid or vector.
  • Non-viral delivery techniques can be site-specific integration techniques, as described herein or known to those of ordinary skill in the art.
  • the insert is integrated at a safe harbor site by introducing into the engineered cell, (a) a targeted nuclease that cleaves a target region in the safe harbor site to create the insertion site; and (b) the nucleic acid sequence (insert), wherein the insert is incorporated at the insertion site by, e.g., HDR.
  • a targeted nuclease that cleaves a target region in the safe harbor site to create the insertion site
  • the nucleic acid sequence (insert) wherein the insert is incorporated at the insertion site by, e.g., HDR.
  • Examples of non-viral delivery techniques that can be used in the methods of the present disclosure are provided in US Application Nos. 16/568,116 and 16/622,843, the relevant disclosures of which are herein incorporated by reference in their entirety.
  • Examples of integration sites contemplated are provided in Table D. Table D: sgRNA sequences
  • CRISPR-Cas Editing [00401]
  • CRISPR-Cas approach e.g., CRISPR- Cas9.
  • This approach incorporates the use of a guide polynucleotide (e.g., guide ribonucleic acid or gRNA) and a Cas endonuclease (e.g., Cas9 endonuclease).
  • a guide polynucleotide e.g., guide ribonucleic acid or gRNA
  • Cas endonuclease e.g., Cas9 endonuclease
  • a polypeptide referred to as a “Cas endonuclease” or having “Cas endonuclease activity” refers to a CRISPR-related (Cas) polypeptide encoded by a Cas gene, wherein a Cas polypeptide is a target DNA sequence that can be cleaved when operably linked to one or more guide polynucleotides (see, e.g., US Pat. No. 8,697,359). Also included in this definition are variants of Cas endonuclease that retain guide polynucleotide-dependent endonuclease activity.
  • the Cas endonuclease used in the donor DNA insertion method detailed herein is an endonuclease that introduces double-strand breaks into DNA at the target site (e.g., within the target locus or at the safe harbor site).
  • the term “guide polynucleotide” relates to a polynucleotide sequence capable of complexing with a Cas endonuclease and allowing the Cas endonuclease to recognize and cleave a DNA target site.
  • the guide polynucleotide can be a single molecule or a double molecule.
  • the guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (RNA-DNA combination sequence).
  • a guide polynucleotide comprising only ribonucleic acid is also referred to as “guide RNA”.
  • a polynucleotide donor construct is inserted at a safe harbor locus using a guide RNA (gRNA) in combination with a cas endonuclease (e.g., Cas9 endonuclease).
  • the guide polynucleotide includes a first nucleotide sequence domain (also referred to as a variable targeting domain or VT domain) that is complementary to a nucleotide sequence in the target DNA, and a second nucleotide that interacts with a Cas endonuclease polypeptide.
  • It can be a double molecule (also referred to as a double-stranded guide polynucleotide) comprising a sequence domain (referred to as a Cas endonuclease recognition domain or CER domain).
  • the CER domain of this double molecule guide polynucleotide comprises two separate molecules that hybridize along the complementary region.
  • the two separate molecules can be RNA sequences, DNA sequences and/or RNA- DNA combination sequences.
  • Genome editing using CRISPR-Cas approaches relies on the repair of site-specific DNA double-strand breaks (DSBs) induced by the RNA-guided Cas endonuclease (e.g., Cas 9 endonuclease). Homology-directed repair (HDR) of these DSBs enables precise editing of the genome by introducing defined genomic changes, including base substitutions, sequence insertions, and deletions.
  • Conventional HDR-based CRISPR/Cas9 genome-editing involves transfecting cells with Cas9, gRNA and donor DNA containing homologous arms matching the genomic locus of interest.
  • HITI hypertension independent targeted insertion
  • NHEJ non-homologous end joining
  • gRNAs Guide RNAs
  • donor plasmids lack homology arms and DSB repair does not occur through the HDR pathway.
  • the donor polynucleotide construct can be engineered to include Cas9 cleavage site(s) flanking the gene or sequence to be inserted. This results in Cas9 cleavage at both the donor plasmid and the genomic target sequence.
  • RNAs and/or mRNA (or DNA) encoding an endonuclease can be chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide.
  • Non-limiting examples of such moieties include lipid moieties such as a cholesterol moiety, cholic acid, a thioether, a thiocholesterol, an aliphatic chain (e.g., dodecandiol or undecyl residues), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl- rac-glycero-3-H- phosphonate, a polyamine or a polyethylene glycol chain, adamantane acetic acid, a palmityl moiety and an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety.
  • lipid moieties such as a cholesterol moiety, cholic acid, a thioether, a thiocholesterol, an aliphatic chain (e.g.,
  • the engineered cells, populations thereof, or compositions thereof are administered to a subject, generally a mammal, generally a human, in an effective amount.
  • the engineered cells may be administered to a subject by infusion (e.g., continuous infusion over a period of time) or other modes of administration known to those of ordinary skill in the art.
  • the engineered cells provided herein not only find use in gene therapy but also in non-pharmaceutical uses such as, e.g., production of animal models and production of recombinant cell lines expressing a protein of interest.
  • the engineered cells of the present disclosure can be any cell, generally a mammalian cell, generally a human cell that has been modified by integrating a transgene at a safe harbor locus described herein. Exemplary cells are provided in the Recombinant Cells section.
  • the engineered cells, compositions and methods of the present disclosure are useful for therapeutic applications such as CAR T cell therapy and TCR T cell therapy.
  • the insertion of a sequence encoding a transgene within a safe harbor locus maintains the TCR expression relative to instances when there is no insertion and enables transgene expression while maintaining TCR function.
  • the present disclosure provides methods of treating a subject in need of treatment by administering to the subject a composition comprising any of the engineered cells described herein.
  • administration of the engineered cell composition results in a desired pharmacological and/or physiological effect. That effect can be partial or complete cure of the disease and/or adverse effects resulting from the disease.
  • treatment encompasses any treatment of a disease in a subject (e.g., mammal, e.g., human). Further, treatment may stabilize or reduce undesirable clinical symptoms in subjects (e.g., patients).
  • the cells provided herein populations thereof, or compositions thereof may be administered during or after the occurrence of the disease.
  • the subject has a disease, condition, and/or injury that can be treated and/or ameliorated by cell therapy.
  • the subject in need of cell therapy is a subject having an injury, disease, or condition, thereby causing cell therapy (e.g., therapy in which cellular material is administered to the subject).
  • cell therapy e.g., therapy in which cellular material is administered to the subject.
  • Method of Administration [00415] An effective amount of the immune cell comprising the system may be administered for the treatment of cancer.
  • the appropriate dosage of the immune cell comprising the system may be determined based on the type of cancer to be treated, the type of the immune cell comprising the system, the severity and course of the cancer, the clinical condition of the individual, the individual’s clinical history and response to the treatment, and the discretion of the attending physician.
  • Pharmaceutical compositions [00416]
  • the engineered recombinant cells provided herein can be administered as part of a pharmaceutical compositions. These compositions can comprise, in addition to one or more of the recombinant cells, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient.
  • the precise nature of the carrier or other material can depend on the route of administration, e.g., oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.
  • the pharmaceutical composition may comprise one or more pharmaceutical excipients. Any suitable pharmaceutical excipient may be used, and one of ordinary skill in the art is capable of selecting suitable pharmaceutical excipients. Accordingly, the pharmaceutical excipients provided below are intended to be illustrative, and not limiting. Additional pharmaceutical excipients include, for example, those described in the Handbook of Pharmaceutical Excipients, Rowe et al. (Eds.) 6th Ed. (2009), incorporated by reference in its entirety. [00417] Various modes of administering the additional therapeutic agents are contemplated herein.
  • kits comprising any one or more of the system or cell compositions described herein along with instructions for use.
  • the instructions for use can be present in the kits as a package insert, in the labeling of the container of the kit or components thereof, or can be in digital form (e.g., on a CD-ROM, via a link on the internet).
  • kits can include one or more of a genome-targeting nucleic acid, a polynucleotide encoding a genome-targeting nucleic acid, a site-directed polypeptide, and/or a polynucleotide encoding a site-directed polypeptide. Additional components within the kits are also contemplated, for example, buffer (such as reconstituting buffer, stabilizing buffer, diluting buffer), and/or one or more control vectors. [00420] In some embodiments, the kits further contain a component selected from any of secondary antibodies, reagents for immunohistochemistry analysis, pharmaceutically acceptable excipient and instruction manual and any combination thereof.
  • the kit comprises a pharmaceutical composition comprising any one or more of the antibody compositions described herein, with one or more pharmaceutically acceptable excipients.
  • the present application also provides articles of manufacture comprising any one of the antibody compositions or kits described herein. Examples of an article of manufacture include vials (including sealed vials). Additional Embodiments [00422]
  • Embodiment 1 A system comprising: a. a first chimeric polypeptide comprises a priming receptor; b. a second chimeric polypeptide comprises a chimeric antigen receptor (CAR); and c. a cytokine.
  • Embodiment 2 A system comprising: a. a first chimeric polypeptide comprising a priming receptor; b.
  • Embodiment 3 A system comprising: a. a first chimeric polypeptide comprising a priming receptor; b. a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); c. a third chimeric polypeptide comprising a synthetic pathway activator (SPA); and d. a cytokine
  • Embodiment 4 A system comprising: a. a first chimeric polypeptide comprising a priming receptor; b.
  • a second chimeric polypeptide comprising a chimeric antigen receptor (CAR); c. a suppressor of gene expression, and d. one or both of: i. a third chimeric polypeptide comprising a synthetic pathway activator (SPA); and/or ii. a cytokine.
  • the priming receptor comprises, from N-terminus to C-terminus, a. a first extracellular antigen-binding domain; b. a first transmembrane domain comprising one or more ligand-inducible proteolytic cleavage sites; and c. an intracellular domain comprising a human or humanized transcriptional effector.
  • Embodiment 6 The system of embodiment 5, wherein the first extracellular antigen-binding domain specifically binds to Alkaline Phosphatase, Germ Cell (ALPG/P).
  • Embodiment 7 The system of embodiment 5 or 6, wherein the first extracellular antigen- binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein: a.
  • VH1 variable heavy chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3,
  • VL variable light chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR-L3, wherein: a.
  • CDR-H1 comprises the sequence set forth in SEQ ID NO: 1, 39, 40, 41, or 42
  • CDR-H2 comprises the sequence set forth in SEQ ID NO: 2, 43, 44, 45, or 46, c.
  • CDR-H3 comprises the sequence set forth in SEQ ID NO: 3, 47, or 48, d.
  • CDR-L1 comprises the sequence set forth in SEQ ID NO: 4, 49, or 50, e.
  • CDR-L2 comprises the sequence set forth in SEQ ID NO: 5 or 51; and f.
  • CDR-L3 comprises the sequence set forth in SEQ ID NO: 6 or 53.
  • Embodiment 8 The system of embodiment 7, wherein the VH chain sequence comprises the sequence set forth in SEQ ID NO: 7.
  • Embodiment 9 The system of embodiment 7 or 8, wherein the VL chain sequence comprises the sequence set forth in SEQ ID NO: 8.
  • Embodiment 10 The system of any one of embodiments 5-9, wherein the first extracellular antigen-binding domain comprises the sequence set forth in SEQ ID NO: 9.
  • Embodiment 11 The system of any one of embodiments 5-10, wherein binding of ALPG/P by the first extracellular antigen-binding domain results in cleavage at the one or more ligand-inducible proteolytic cleavage sites within the intracellular domain.
  • Embodiment 12 The system of any one of embodiments 5-11, wherein the priming receptor further comprises a first hinge domain positioned between the first extracellular antigen- binding domain and the first transmembrane domain.
  • Embodiment 13 The system of embodiment 12, wherein the first hinge domain comprises a CD8 ⁇ or truncated CD8 ⁇ hinge domain.
  • Embodiment 14 The system of embodiment 13, wherein the first hinge comprises the sequence as set forth in SEQ ID NO: 18.
  • Embodiment 15 The system of any one of embodiments 5-14, wherein the first transmembrane domain comprises a Notch1 transmembrane domain.
  • Embodiment 16 The system of embodiment 15, wherein the first transmembrane domain comprises the sequence as set forth in SEQ ID NO: 19.
  • Embodiment 17 The system of any one of embodiments 5-16, wherein the intracellular domain comprises an HNF1a/p65 domain or a Gal4/VP64 domain.
  • Embodiment 18 The system of embodiment 17, wherein the intracellular domain comprises the sequence as set forth in SEQ ID NO: 23.
  • Embodiment 19 The system of any one of embodiments 5-18, wherein the priming receptor further comprises a stop-transfer-sequence between the first transmembrane domain and the intracellular domain.
  • Embodiment 20 The system of embodiment 19, wherein the stop-transfer-sequence comprises the sequence as set forth in SEQ ID NO: 20.
  • Embodiment 21 The system of any one of embodiments 1-20, wherein the priming receptor comprises a sequence as set forth in SEQ ID NO: 24.
  • Embodiment 22 The system of any one of embodiments 1-21, wherein the CAR comprises, from N-terminus to C-terminus, a. a second extracellular antigen-binding domain; b. a second transmembrane domain; c.
  • Embodiment 23 The system of embodiment 22, wherein the second extracellular antigen- binding domain specifically binds to mesothelin (MSLN), wherein the second extracellular antigen-binding domain comprises a variable heavy (VH) chain sequence comprising three heavy chain CDR sequences, CDR-H1, CDR-H2, and CDR-H3, and a variable light (VL) chain sequence comprising three light chain CDR sequences, CDR-L1, CDR-L2, and CDR- L3, wherein: a. CDR-H1 comprises the sequence set forth in SEQ ID NO: 10, 54, 56, 57, or 71, b.
  • CDR-H2 comprises the sequence set forth in SEQ ID NO: 11, 58, 59, 60, or 61, c.
  • CDR-H3 comprises the sequence set forth in SEQ ID NO: 12, 62, or 63, d.
  • CDR-L1 comprises the sequence set forth in SEQ ID NO: 14, 64, 65, 66, or 67, e.
  • CDR-L2 comprises the sequence set forth in SEQ ID NO: 15, 68, 69, or 70, and f.
  • CDR-L3 comprises the sequence set forth in SEQ ID NO: 16, 72, or 73.
  • Embodiment 24 The system of embodiment 23, wherein the VH chain sequence comprises the sequence set forth in SEQ ID NO: 13.
  • Embodiment 25 The system of embodiment 23 or 24, wherein the VL chain sequence comprises the sequence set forth in SEQ ID NO: 17.
  • Embodiment 26 The system of any one of embodiments 23-25, wherein the second extracellular antigen-binding domain comprises the amino acid sequence set forth in SEQ ID NO: 30.
  • Embodiment 27 The system of any one of embodiments 1-26, wherein the CAR comprises a second hinge domain.
  • Embodiment 28 The system of embodiment 27, wherein the second hinge domain comprises a CD8 ⁇ or truncated CD8 ⁇ hinge domain.
  • Embodiment 29 The system of any one of embodiments 22-28, wherein the second transmembrane domain comprises a CD8 ⁇ transmembrane domain.
  • Embodiment 30 The system of any one of embodiments 22-29, wherein the intracellular co- stimulatory domain comprises a 4-1BB domain.
  • Embodiment 31 The system of any one of embodiments 22-30, wherein the intracellular activation domain comprises a CD3 ⁇ domain.
  • Embodiment 32 The system of any one of embodiments 1-31, wherein the CAR comprises a sequence as set forth in SEQ ID NO: 31 or 32.
  • Embodiment 33 The system of any one of embodiments 2-32, wherein the SPA is an activator of STAT phosphorylation, optionally STAT1, STAT3, and/or STAT5 phosphorylation.
  • Embodiment 34 The system of any one of embodiments 2-33, wherein the SPA comprises an extracellular domain linked to an intracellular signaling domain.
  • Embodiment 35 The system of embodiment 34, wherein the intracellular signaling domain comprises an intracellular signaling region derived from a cytokine receptor.
  • Embodiment 36 The system of embodiment 34 or 35, wherein the intracellular signaling domain comprises a polypeptide sequence derived from an interleukin receptor.
  • Embodiment 37 The system of embodiment 34 or 35, wherein the cytokine receptor comprises interleukin-6 signal transducer (IL6ST).
  • IL6ST interleukin-6 signal transducer
  • Embodiment 38 The system of any one of embodiments 34-37, wherein the extracellular domain conveys constitutive activity to the intracellular signaling domain.
  • Embodiment 39 The system of any one of embodiment 34-38, wherein the extracellular domain comprises a dimerization region, optionally wherein the dimerization region comprises at least one of a cysteine residue and a leucine zipper.
  • Embodiment 40 The system of embodiment 39, wherein the dimerization region forms a homodimer.
  • Embodiment 41 The system of any one of embodiments 2-40, wherein the SPA comprises a leucine zipper-gp130 (L-gp130).
  • Embodiment 42 The system of any one of embodiments 2-41, wherein the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 74.
  • Embodiment 43 The system of any one of embodiments 2-42, wherein the SPA comprises the amino acid sequence of SEQ ID NO: 74.
  • Embodiment 44 The system of any one of embodiments 2-43, wherein the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 75.
  • Embodiment 45 The system of any one of embodiments 2-44, wherein the SPA comprises the amino acid sequence of SEQ ID NO: 75.
  • Embodiment 46 The system of embodiment 38, wherein the extracellular domain comprises a polypeptide derived from a cytokine and mimics receptor agonism.
  • Embodiment 47 The system of any one of embodiments 2-36, 38, or 46, wherein the SPA comprises a membrane-bound interleukin-15 (mbIL-15).
  • Embodiment 48 The system of any one of embodiments 2-38, 46, or 47, wherein the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% % identical to the sequence set forth in SEQ ID NO: 76.
  • Embodiment 49 The system of embodiment 2-36, 38 or 46-48, wherein the SPA comprises the amino acid sequence of SEQ ID NO: 76.
  • Embodiment 50 The system of any one of embodiments 2-36 or 38, wherein the SPA comprises a CD34-interleukin-7 receptor (C7R).
  • Embodiment 51 The system of embodiment 2-36, 38, or 50, wherein the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 77.
  • Embodiment 52 The system of embodiment 2-36, 38, 50, or 51, wherein the SPA comprises an amino acid sequence of SEQ ID NO: 77.
  • Embodiment 53 The system of embodiment 2-36, 38, or 50-52, wherein the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 78.
  • Embodiment 54 The system of embodiment 2-36, 38, or 50-53, wherein the SPA comprises an amino acid sequence of SEQ ID NO: 78.
  • Embodiment 55 The system of any one of embodiments 1-32, wherein the cytokine is a secreted cytokine.
  • Embodiment 56 The system of any one of embodiments 1-32, wherein the cytokine is a membrane-bound cytokine.
  • Embodiment 57 The system of any one of embodiments 1-32, 55, and 56, wherein the cytokine is an interleukin.
  • Embodiment 58 The system of any one of embodiments 1-32, and 55-57, wherein the cytokine comprises at least one of interleukin (IL)-2, Super-2, IL-12, IL-12/23p40, IL-7, IL- 15, IL-21, and IL-18.
  • Embodiment 59 The system of any one of embodiments 1-32, and 55-58, wherein the cytokine is IL-2.
  • Embodiment 60 The system of any one of embodiments 1-32, and 55-58, wherein the cytokine is Super-2.
  • Embodiment 61 The system of any one of embodiments 1-32, and 55-58, wherein the cytokine is IL-12.
  • Embodiment 62 The system of any one of embodiments 1-32, and 55-58, wherein the cytokine is IL-12/23p40.
  • Embodiment 63 The system of any one of embodiments 1-32, and 55-58, wherein the cytokine is IL-7.
  • Embodiment 64 The system of any one of embodiments 1-32, and 55-58, wherein the cytokine is IL-15.
  • Embodiment 65 The system of any one of embodiments 1-32, and 55-58, wherein the cytokine is IL-21.
  • Embodiment 66 The system of any one of embodiments 1-32, and 55-58, wherein the cytokine is IL-18.
  • Embodiment 67 The system of any one of embodiments 1-32, and 55-66, wherein the cytokine comprises a non-native signal peptide.
  • Embodiment 68 The system of embodiment 67, wherein the non-native signal peptide comprises a signal peptide from at least one of CD44, CD3E, CD5, IGTAL, IL-2, GMCSF, chymotrypsinogen, trypsinogen, IgK, IgKVIII, IgE, OSM, IgG2H, BM40, secrecon, and tPA.
  • the non-native signal peptide comprises a signal peptide from at least one of CD44, CD3E, CD5, IGTAL, IL-2, GMCSF, chymotrypsinogen, trypsinogen, IgK, IgKVIII, IgE, OSM, IgG2H, BM40, secrecon, and tPA.
  • Embodiment 69 The system of embodiment 67 or 68, wherein the non-native signal peptide comprises or consists of the amino acid sequence set forth in SEQ ID NO: 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, or 130.
  • Embodiment 70 The system of any one of embodiments 1-32, and 55-69, wherein the cytokine comprises the amino acid sequence set forth in SEQ ID NO: 86, 88, 90, 92, 94, 96, 98, or 132.
  • Embodiment 71 The system of any one of embodiments 3-32, wherein the suppressor of gene expression is an sgRNA or an shRNA.
  • Embodiment 72 The system of any one of embodiments 3-32 and 71, wherein the suppressor of gene expression is an sgRNA.
  • Embodiment 73 The system of embodiment 72, wherein the sgRNA suppresses the expression of a gene selected from PTPN2, RASA2, SOCS1, ZC3H12A, and CISH.
  • Embodiment 74 The system of embodiment 72 or 73, wherein the sgRNA suppresses the expression of PTPN2.
  • Embodiment 75 The system of embodiment 72 or 73, wherein the sgRNA suppresses the expression of RASA2.
  • Embodiment 76 The system of embodiment 72 or 73, wherein the sgRNA suppresses the expression of SOCS1.
  • Embodiment 77 The system of embodiment 72 or 73, wherein the sgRNA suppresses the expression of ZC3H12A.
  • Embodiment 78 The system of embodiment 72 or 73, wherein the sgRNA suppresses the expression of CISH.
  • Embodiment 79 The system of embodiment 72 or 73, wherein the sgRNA comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 160-164.
  • Embodiment 80 The system of any one of embodiments 3-32 and 71, wherein the suppressor of gene expression is an shRNA.
  • Embodiment 81 The system of embodiment 80, wherein the shRNA suppresses the expression of a gene selected from RASA2, SOCS1, ZC3H12A, TGFBR1, and CISH.
  • Embodiment 82 The system of embodiment 80 or 81, wherein the shRNA suppresses the expression of RASA2.
  • Embodiment 83 The system of embodiment 80 or 81, wherein the shRNA suppresses the expression of SOCS1.
  • Embodiment 84 The system of embodiment 80 or 81, wherein the shRNA suppresses the expression of ZC3H12A.
  • Embodiment 85 The system of embodiment 80 or 81, wherein the shRNA suppresses the expression of TGFBR1.
  • Embodiment 86 The system of embodiment 80 or 81, wherein the shRNA suppresses the expression of CISH.
  • Embodiment 87 The system of embodiment 80 or 81, wherein the shRNA comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 165-172.
  • Embodiment 88 The system of any one of embodiments 3-32, wherein the system comprises two or more suppressors of gene expression.
  • Embodiment 89 The system of embodiment 88, wherein the system comprises an shRNA that suppresses the expression of TNFRSF6 (Fas) and an additional suppressor of gene expression.
  • Embodiment 90 The system of embodiment 88, wherein the system comprises an shRNA that suppresses the expression of TNFRSF6 (Fas), an shRNA that suppresses the expression of TGFBR2 and an additional suppressor of gene expression.
  • Embodiment 91 The system of embodiment 88, wherein the system comprises an shRNA that suppresses the expression of TNFRSF6 (Fas), an shRNA that suppresses the expression of PTPN2 and an additional suppressor of gene expression.
  • Embodiment 92 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses CISH expression and a cytokine that is IL-2.
  • Embodiment 93 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses PTPN2 expression and a cytokine that is IL-2.
  • Embodiment 94 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses RASA2 expression and a cytokine that is IL-2.
  • Embodiment 95 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses SOCS1 expression and a cytokine that is IL-2.
  • Embodiment 96 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses ZC3H12A expression and a cytokine that is IL-2.
  • Embodiment 97 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses PTPN2 expression and a cytokine that is IL-21.
  • Embodiment 98 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses ZC3H12A expression and a cytokine that is IL-21.
  • Embodiment 99 The system of any one of embodiments 3-32, wherein the system comprises an shRNA that suppresses RASA2 expression and a cytokine that is IL-2.
  • Embodiment 100 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses CISH expression and an SPA that is C7R.
  • Embodiment 101 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses PTPN2 expression and an SPA that is C7R.
  • Embodiment 102 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses RASA2 expression and an SPA that is C7R.
  • Embodiment 103 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses SOCS1 expression and an SPA that is C7R.
  • Embodiment 104 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses ZC3H12A expression and an SPA that is C7R.
  • Embodiment 105 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses CISH expression and an SPA that is L-gp130.
  • Embodiment 106 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses RASA2 expression and an SPA that is L-gp130.
  • Embodiment 107 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses ZC3H12A expression and an SPA that is L-gp130.
  • Embodiment 108 The system of any one of embodiments 3-32, wherein the system comprises an shRNA that suppresses RASA2 expression, a cytokine that is IL-2, and an SPA that is L-gp130.
  • Embodiment 109 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses RASA2 expression, a cytokine that is IL-2, and an SPA that is L-gp130.
  • Embodiment 110 The system of any one of embodiments 3-32, wherein the system comprises an shRNA that suppresses RASA2 expression, a cytokine that is IL-15, and an SPA that is L-gp130.
  • Embodiment 111 The system of any one of embodiments 3-32, wherein the system comprises an sgRNA that suppresses RASA2 expression, a cytokine that is IL-15, and an SPA that is L-gp130.
  • Embodiment 112 The system of any one of embodiments 3-112, wherein the priming receptor and the CAR are capable of binding to a same target cell.
  • Embodiment 113 The system of embodiment 112, wherein the target cell is a human cell.
  • Embodiment 114 The system of embodiment 112 or 113, wherein the target cell is a cancer cell.
  • Embodiment 115 The system of embodiment 114, wherein the cancer cell is a solid cancer cell or a liquid cancer cell.
  • Embodiment 116 The system of embodiment 114 or 115, wherein the cancer cell is ovarian cancer, fallopian cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer.
  • Embodiment 117 One or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding the system of one of embodiments 1-116.
  • Embodiment 118 One or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising: a. a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain; b. a nucleotide sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain; and c. a nucleotide sequence encoding a cytokine.
  • Embodiment 119 One or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising: a. a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain; b.
  • nucleotide sequence encoding a chimeric antigen receptor comprising an second extracellular antigen-binding domain comprising an second extracellular antigen-binding domain
  • nucleotide sequence encoding a synthetic pathway activator One or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising: a. a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain; b. a nucleotide sequence encoding a chimeric antigen receptor comprising an second extracellular antigen-binding domain; c. a nucleotide sequence encoding a synthetic pathway activator; and d.
  • nucleotide sequence encoding a cytokine a nucleotide sequence encoding a cytokine.
  • nucleotide sequence encoding a cytokine a nucleotide sequence encoding a cytokine.
  • nucleotide sequence encoding a cytokine a nucleotide sequence encoding a cytokine.
  • nucleotide sequence encoding a cytokine a nucleotide sequence encoding a cytokine.
  • nucleotide sequence encoding a cytokine a nucleotide sequence encoding a cytokine.
  • nucleotide sequence encoding a cytokine a nucleotide sequence encoding a cytokine.
  • nucleotide sequence encoding a cytokine a nucleotide sequence encoding a cytokine.
  • Embodiment 122 The recombinant nucleic acid of any one of embodiments 118-121, wherein the first extracellular antigen-binding domain specifically binds to ALPG/P.
  • Embodiment 123 The recombinant nucleic acid of any one of embodiments 118-122, wherein the second extracellular antigen-binding domain specifically binds to MSLN.
  • Embodiment 124 The recombinant nucleic acid of embodiment 117-123, wherein the recombinant nucleic acid comprises two or more nucleic acid fragments.
  • Embodiment 125 The recombinant nucleic acid of any one of embodiments 117-124, wherein the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the CAR.
  • Embodiment 126 The recombinant nucleic acid of any one of embodiments 117-125, wherein the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the priming receptor.
  • Embodiment 127 The recombinant nucleic acid of any one of embodiments 117-125, wherein the recombinant nucleic acid further comprises a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor.
  • Embodiment 128 The recombinant nucleic acid of any one of embodiments 117-125, wherein the recombinant nucleic acid further comprises a constitutive promoter operably linked to the nucleotide sequence encoding the synthetic pathway activator.
  • Embodiment 129 The recombinant nucleic acid of any one of embodiments 117-127, wherein the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the synthetic pathway activator.
  • Embodiment 130 The recombinant nucleic acid of embodiment 127 or 128, wherein the priming receptor and the synthetic pathway activator are under the control of the same constitutive promoter.
  • Embodiment 131 The recombinant nucleic acid of any one of embodiments 117-124, wherein the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor and a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor and the nucleotide sequence encoding the synthetic pathway activator.
  • Embodiment 132 The recombinant nucleic acid of embodiments 131, wherein the nucleic acid comprises, in a 5’ to 3’ direction, a. the constitutive promoter; b. the nucleotide sequence encoding the synthetic pathway activator; c.
  • Embodiment 133 The recombinant nucleic acid of any one of embodiments 131, wherein the nucleic acid comprises, in a 5’ to 3’ direction, a. the inducible promoter; b. the nucleotide sequence encoding chimeric antigen receptor; c. the constitutive promoter; d. the nucleotide sequence encoding priming receptor; and e. the nucleotide sequence encoding the synthetic pathway activator.
  • Embodiment 134 The recombinant nucleic acid of any one of embodiments 117-127, wherein the recombinant nucleic acid further comprises an inducible promoter operably linked to the nucleotide sequence encoding the cytokine.
  • Embodiment 135 The recombinant nucleic acid of any one of embodiments 117-127, and 134, wherein the recombinant nucleic acid further comprises: a. an inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor and the nucleotide sequence encoding the cytokine; and b. a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor.
  • Embodiment 136 The recombinant nucleic acid of embodiment 135, wherein the nucleic acid comprises, in a 5’ to 3’ direction, a. the constitutive promoter; b. the nucleotide sequence encoding the priming receptor; c. the inducible promoter; d. the nucleotide sequence encoding the chimeric antigen receptor; and e. the nucleic acid sequence encoding the cytokine and/or the nucleic acid sequence encoding synthetic pathway activator.
  • Embodiment 137 The recombinant nucleic acid of embodiment 135, wherein the nucleic acid comprises, in a 5’ to 3’ direction, a. the constitutive promoter; b.
  • Embodiment 138 The recombinant nucleic acid of embodiment 135, wherein the nucleic acid comprises, in a 5’ to 3’ direction, a. the inducible promoter; b. the nucleotide sequence encoding the chimeric antigen receptor; c. the nucleic acid sequence encoding the cytokine and/or the nucleic acid sequence encoding synthetic pathway activator; d.
  • Embodiment 139 The recombinant nucleic acid of embodiment 135, wherein the nucleic acid comprises, in a 5’ to 3’ direction, a. the inducible promoter; b. the nucleotide sequence encoding the cytokine and/or the nucleic acid sequence encoding synthetic pathway activator; c. the nucleic acid sequence encoding the chimeric antigen receptor; d. the constitutive promoter; and e. the nucleotide sequence encoding the priming receptor.
  • Embodiment 140 The recombinant nucleic acid of any one of embodiments 117-127, wherein the recombinant nucleic acid further comprises: a. a first inducible promoter operably linked to the nucleotide sequence encoding the chimeric antigen receptor; b. a second inducible promoter operably linked to the nucleotide sequence encoding the cytokine or synthetic pathway activator; and c. a constitutive promoter operably linked to the nucleotide sequence encoding the priming receptor.
  • Embodiment 141 The recombinant nucleic acid of embodiment 140, wherein the nucleic acid comprises, in a 5’ to 3’ direction, a. the constitutive promoter; b.
  • Embodiment 142 The recombinant nucleic acid of embodiment 140, wherein the nucleic acid comprises, in a 5’ to 3’ direction, a. the constitutive promoter; b. the nucleotide sequence encoding the priming receptor; c. the second inducible promoter; d.
  • Embodiment 143 The recombinant nucleic acid of embodiment 140, wherein the nucleic acid comprises, in a 5’ to 3’ direction, a. the first inducible promoter; b. the nucleotide sequence encoding the chimeric antigen receptor; c. the second inducible promoter; d. the nucleic acid sequence encoding the cytokine and/or the nucleic acid sequence encoding synthetic pathway activator; e.
  • Embodiment 144 The recombinant nucleic acid of embodiment 140, wherein the nucleic acid comprises, in a 5’ to 3’ direction, a. the first inducible promoter; b. the nucleotide sequence encoding the chimeric antigen receptor; c. the constitutive promoter; d. the nucleotide sequence encoding the priming receptor; e. the second inducible promoter; and f. the nucleic acid sequence encoding the cytokine and/or the nucleic acid sequence encoding synthetic pathway activator.
  • Embodiment 145 The recombinant nucleic acid of embodiment 140, wherein the nucleic acid comprises, in a 5’ to 3’ direction, a. the second inducible promoter; b. the nucleic acid sequence encoding the cytokine and/or synthetic pathway activator; c. the first inducible promoter; d. the nucleotide sequence encoding the chimeric antigen receptor; e. the constitutive promoter; and f. the nucleotide sequence encoding the priming receptor.
  • Embodiment 146 The recombinant nucleic acid of embodiment 140, wherein the nucleic acid comprises, in a 5’ to 3’ direction, a. the second inducible promoter; b.
  • nucleic acid sequence encoding the cytokine and/or the nucleic acid sequence encoding synthetic pathway activator comprises the sequence set forth in SEQ ID NO: 35.
  • Embodiment 148 The recombinant nucleic acid of any one of embodiments 117-147, wherein the nucleotide sequence encoding the chimeric antigen receptor comprises the sequence set forth in SEQ ID NO: 36.
  • Embodiment 149 The recombinant nucleic acid of any one of embodiments 117-133, 147, and 148, wherein the nucleotide sequence encoding the synthetic pathway activator comprises the sequence set forth in SEQ ID NO: 79, 80, 81, 82, or 83.
  • Embodiment 150 The recombinant nucleic acid of any one of embodiments 117-127 and 134-148, wherein nucleotide sequence encoding the cytokine comprises the sequence set forth in SEQ ID NO: 87, 89, 91, 93, 95, 97, 99, or 133.
  • Embodiment 151 The recombinant nucleic acid of any one of embodiments 117-150, wherein the suppressor of gene expression comprises a nucleic acid sequence set forth in any one of SEQ ID NOs: 160-172.
  • Embodiment 152 The recombinant nucleic acid of embodiment of any one of embodiment 117-151, wherein the nucleic acid further comprises a 5’ homology directed repair arm and a 3’ homology directed repair arm complementary to an insertion site in a host cell chromosome.
  • Embodiment 153 The recombinant nucleic acid of any one of embodiments 117-152, wherein the recombinant nucleic acid further comprises a nucleotide sequence encoding a self-excising 2A peptide (P2A).
  • Embodiment 154 The recombinant nucleic acid of embodiment 153, wherein the P2A is at the 3’ end of the nucleotide sequence encoding chimeric antigen receptor.
  • Embodiment 155 The recombinant nucleic acid of embodiment 153, wherein the P2A is at the 3’ end of the nucleotide sequence encoding priming receptor.
  • Embodiment 156 The recombinant nucleic acid of any one of embodiments 117-155, wherein the recombinant nucleic acid further comprises a woodchuck hepatitis virus post- translational regulatory element (WPRE).
  • WPRE woodchuck hepatitis virus post- translational regulatory element
  • Embodiment 157 The recombinant nucleic acid of embodiment 156, wherein the WPRE is at the 3’ end of the nucleotide sequence encoding chimeric antigen receptor and at the 5’ end of the nucleotide sequence encoding priming receptor or wherein the WPRE is at the 3’ end of the nucleotide sequence encoding priming receptor and at the 5’ end of the nucleotide sequence encoding chimeric antigen receptor.
  • Embodiment 158 The recombinant nucleic acid of any one of embodiments 117-157, wherein the recombinant nucleic acid further comprises an SV40 polyA element.
  • Embodiment 159 The recombinant nucleic acid of any one of embodiments 117 to 158, wherein the nucleic acid is incorporated into an expression cassette or an expression vector.
  • Embodiment 160 The recombinant nucleic acid of embodiment 159, wherein the expression vector is a non-viral vector.
  • Embodiment 161 An expression vector comprising the recombinant nucleic acid of any one of embodiments 117-160.
  • Embodiment 162 The vector of embodiment 161, wherein the 5’ and 3’ ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in a genome of a primary cell.
  • Embodiment 163 The vector of embodiment 162, wherein the insertion site is located at a T Cell Receptor Alpha Constant (TRAC) locus or a genomic safe harbor (GSH) locus.
  • Embodiment 164 An immune cell comprising: a. the system of any one of embodiments 1-116; b. at least one recombinant nucleic acid of any one of embodiments 117-160; and/or c. the vector of any one of embodiments 161-163.
  • Embodiment 165 The immune cell of embodiment 164, wherein the immune cell is a primary human immune cell.
  • Embodiment 166 The immune cell of any one of embodiments 164 or 165, wherein the immune cell is an allogeneic immune cell.
  • Embodiment 167 The immune cell of any one of embodiments 164 or 165, wherein the immune cell is an autologous immune cell.
  • Embodiment 168 The immune cell of any one of embodiments 165-167, wherein the primary immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor.
  • Embodiment 169 The immune cell of any one of embodiments 165-168, wherein the primary immune cell is a primary T cell.
  • Embodiment 170 The immune cell of any one of embodiments 165-169, wherein the primary immune cell is a primary human T cell.
  • Embodiment 171 The immune cell of any one of embodiments 165-170, wherein the primary immune cell is virus-free.
  • Embodiment 172 A primary immune cell comprising at least one recombinant nucleic acid comprising: a. a nucleic acid sequence encoding a priming receptor comprising a first extracellular antigen-binding domain; b. a nucleic acid sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain; and c.
  • Embodiment 173 The primary immune cell of embodiment 172, wherein the first extracellular antigen-binding domain specifically binds to ALPG/P.
  • Embodiment 174 The primary immune cell of embodiment 172 or 173, wherein the second extracellular antigen-binding domain specifically binds to MSLN.
  • Embodiment 175 A viable, virus-free, primary cell comprising a ribonucleoprotein complex (RNP)- recombinant nucleic acid complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein recombinant nucleic acid comprises: a. a nucleic acid sequence encoding a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to ALPG/P; b. a nucleic acid sequence encoding a chimeric antigen receptor comprising a second extracellular antigen-binding domain that specifically binds to MSLN; and c.
  • RNP ribonucleoprotein complex
  • nucleic acid sequence encoding a synthetic pathway activator that constitutively activates cytokine signaling and/or a nucleic acid sequence encoding a cytokine; wherein the 5’ and 3’ ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the genome of the primary cell.
  • Embodiment 176 The primary cell of embodiment 175, wherein the first extracellular antigen-binding domain specifically binds to ALPG/P.
  • Embodiment 177 The primary cell of embodiment 175 or 176, wherein the second extracellular antigen-binding domain specifically binds to MSLN.
  • Embodiment 178 A population of cells comprising a plurality of immune cells of any one of embodiments 164-171 or primary cells of any one of embodiments 172-177.
  • Embodiment 179 A pharmaceutical composition comprising the immune cell of any one of embodiments 164 to 177 or the population of cells of embodiment 178, and a pharmaceutically acceptable excipient.
  • Embodiment 180 A pharmaceutical composition comprising the recombinant nucleic acid of any one of embodiments 117-160 or the vector of any one of embodiments 161-163, and a pharmaceutically acceptable excipient.
  • Embodiment 181 A method of editing an immune cell, comprising: a.
  • RNP ribonucleoprotein complex
  • the RNP comprises a nuclease domain and a guide RNA
  • the recombinant nucleic acid comprises the recombinant nucleic acid of any one of embodiments 117-160, and wherein the 5’ and 3’ ends of the recombinant nucleic acid comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the genome of the immune cell; b.
  • Non-virally introducing the RNP-recombinant nucleic acid complex into the immune cell wherein the guide RNA specifically hybridizes to a target region of the genome of the primary immune cell, and wherein the nuclease domain cleaves the target region to create the insertion site in the genome of the immune cell; and c. editing the immune cell via insertion of the recombinant nucleic acid of any one of embodiments 117-160 into the insertion site in the genome of the immune cell.
  • Embodiment 182 The method of embodiment 181, wherein non-virally introducing comprises electroporation.
  • Embodiment 183 The method of embodiment 181 or 182, wherein the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.
  • Embodiment 184 The method of any one of embodiments 181-183, wherein the target region of the genome of the cell is a T Cell Receptor Alpha Constant (TRAC) locus or a genomic safe harbor (GSH) locus.
  • TRAC T Cell Receptor Alpha Constant
  • GSH genomic safe harbor
  • Embodiment 185 The method of any one of embodiments 181-184, wherein the recombinant nucleic acid is a double-stranded recombinant nucleic acid or a single-stranded recombinant nucleic acid.
  • Embodiment 186 The method of any one of embodiments 181-185, wherein the recombinant nucleic acid is a linear recombinant nucleic acid or a circular recombinant nucleic acid, optionally wherein the circular recombinant nucleic acid is a plasmid.
  • Embodiment 187 The method of any one of embodiments 181-186, wherein the immune cell is a primary human immune cell.
  • Embodiment 188 The method of any one of embodiments 181-187, wherein the immune cell is an autologous immune cell.
  • Embodiment 189 The method of any one of embodiments 181-187, wherein the immune cell is an allogeneic immune cell.
  • Embodiment 190 The method of any one of embodiments 181-189, wherein the immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor.
  • Embodiment 191 The method of any one of embodiments 181-190, wherein the immune cell is a primary T cell.
  • Embodiment 192 The method of any one of embodiments 181-191, wherein the immune cell is a primary human T cell.
  • Embodiment 193 The method of any one of embodiments 181-192, wherein the immune cell is virus-free.
  • Embodiment 194 The method of any one of embodiments 181-193, further comprising obtaining the immune cell from a patient and introducing the recombinant nucleic acid in vitro.
  • Embodiment 195 A method of treating a disease in a subject comprising administering the immune cell of any one of embodiments 164-171 or primary cells of any one of embodiments 172-177 or the pharmaceutical composition of embodiments 179 or 180 to the subject.
  • Embodiment 196 The method of embodiment 195, wherein the disease is cancer.
  • Embodiment 197 The method of embodiment 196, wherein the cancer is a solid cancer or a liquid cancer.
  • Embodiment 198 The method of embodiment 196 or 197, wherein the cancer is ovarian cancer, fallopian cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer.
  • Embodiment 199 The method of any one of embodiments 196-198, wherein the administration of the immune cell enhances an immune response in the subject.
  • Embodiment 200 The method of embodiment 199, wherein the enhanced immune response is an adaptive immune response.
  • Embodiment 201 The method of embodiment 199, wherein the enhanced immune response is an innate immune response.
  • Embodiment 202 The method of any one of embodiments 196-201, wherein the enhanced immune response is an increased expression of at least one cytokine or chemokine.
  • Embodiment 203 The method of embodiment 202, wherein the at least one cytokine or chemokine is IL-2 or IFN ⁇ .
  • Embodiment 204 The method of any one of embodiments 196-201, wherein the enhanced immune response is an increased lysis of target cells as compared to administration of a control cell.
  • Embodiment 205 The method of any one of embodiments 195-198, further comprising administering an immunotherapy to the subject concurrently with the immune cell or subsequently to the immune cell.
  • Embodiment 206 A method of inhibiting a target cell in a subject comprising administering the immune cell of any one of embodiments 164-171 or primary cells of any one of embodiments 172-177 to the subject, wherein the immune cell inhibits the target cell.
  • Embodiment 207 The method of embodiment 206, wherein the target cell expresses ALPG/P and MSLN.
  • Embodiment 208 The method of embodiment 206 or 207, wherein the target cell is a cancer cell.
  • Embodiment 209 A method of modulating the activity of an immune cell comprising: a. obtaining an immune cell comprising i. the system of any one of embodiments 2-116; ii. the recombinant nucleic acid of any one of embodiments 117-160; and/or iii. the vector of any one of embodiments 161-163; and b.
  • Embodiment 210 A method of modulating the activity of an immune cell comprising: a. obtaining an immune cell comprising i. the system of any one of embodiments 2-116; ii.
  • the modulation of the immune cell activity comprises enhancing an immune response.
  • Embodiment 212 The method of embodiment 211, wherein the enhanced immune response is an adaptive immune response.
  • Embodiment 213 The method of embodiment 211, wherein the enhanced immune response is an innate immune response.
  • Embodiment 214 The method of any one of embodiments 210-213, wherein the immune cell activity is an increased expression of at least one cytokine or chemokine.
  • Embodiment 215 The method of embodiment 214, wherein the at least one cytokine or chemokine is IL-2 or IFN ⁇ .
  • Embodiment 216 The method of any one of embodiments 210-213, wherein the immune cell activity is lysis of target cells.
  • Embodiment 217 A system comprising: a.
  • Embodiment 218 The system of embodiment 217, wherein the SPA comprises a leucine zipper-gp130 (L-gp130).
  • Embodiment 219 The system of embodiment 217 or 218, wherein the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 74.
  • Embodiment 220 The system of any one of embodiments 217-219, wherein the SPA comprises the amino acid sequence of SEQ ID NO: 74.
  • Embodiment 221 The system of any one of embodiments 217-219, wherein the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 75.
  • Embodiment 222 The system of any one of embodiments 217-221, wherein the SPA comprises the amino acid sequence of SEQ ID NO: 75.
  • Embodiment 223 The system of any one of embodiments 217-222, wherein the cytokine is IL-2.
  • Embodiment 224 The system of any one of embodiments 217-223, wherein the cytokine comprises the amino acid sequence set forth in SEQ ID NO: 86.
  • Embodiment 225 The system of any one of embodiments 217-222, wherein the cytokine is IL-15.
  • Embodiment 226 The system of any one of embodiments 217-223, wherein the cytokine comprises the amino acid sequence set forth in SEQ ID NO: 96.
  • Embodiment 227 The system of any one of embodiments 217-224, wherein the suppressor of RASA2 expression is an shRNA or an sgRNA.
  • Embodiment 228 The system of any one of embodiments 217-227, wherein the suppressor of RASA2 expression is an shRNA.
  • Embodiment 229 The system of embodiment 228, wherein the shRNA comprises the nucleic acid sequence of SEQ ID NO: 165.
  • Embodiment 230 The system of any one of embodiments 217-227, wherein the suppressor of RASA2 expression is an sgRNA.
  • Embodiment 231 The system of embodiment 230, wherein the sgRNA comprises the nucleic acid sequence of SEQ ID NO: 161.
  • Embodiment 232 The system of any one of embodiments 217-231, further comprising an shRNA that suppresses the expression of TNFRSF6 (Fas).
  • Embodiment 233 The system of embodiment 232, further comprising an shRNA that suppresses the expression of TGFBR2.
  • Embodiment 234 The system of embodiment 232, further comprising an shRNA that suppresses the expression of PTPN2.
  • Embodiment 235 One or more recombinant nucleic acids comprising at least one nucleic acid fragment comprising a nucleotide sequence encoding the system of one of embodiments 217-234.
  • Embodiment 236 An expression vector comprising the recombinant nucleic acid sequence of embodiment 235.
  • Embodiment 237 An engineered immune cell comprising: a. the system of any one of embodiments 217-234; b.
  • Embodiment 238 In an engineered immune cell, the improvement comprising: a. at least one of a a priming receptor, a CAR, an SPA, and a cytokine; and b. a suppressor of RASA2 expression.
  • Embodiment 239 The engineered immune cell of embodiment 238, wherein the SPA comprises a leucine zipper-gp130 (L-gp130).
  • Embodiment 240 The engineered immune cell of embodiment 238 or 239, wherein the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 74.
  • Embodiment 241 The engineered immune cell of any one of embodiments 238-240, wherein the SPA comprises the amino acid sequence of SEQ ID NO: 74.
  • Embodiment 242 The engineered immune cell of any one of embodiments 238-240, wherein the SPA comprises an amino acid sequence at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to the sequence set forth in SEQ ID NO: 75.
  • Embodiment 243 The engineered immune cell of any one of embodiments 238-242, wherein the SPA comprises the amino acid sequence of SEQ ID NO: 75.
  • Embodiment 244 The engineered immune cell of any one of embodiments 238-243, wherein the cytokine is IL-2.
  • Embodiment 245 The engineered immune cell of any one of embodiments 238-244, wherein the cytokine comprises the amino acid sequence set forth in SEQ ID NO: 86.
  • Embodiment 246 The engineered immune cell of any one of embodiments 238-245, wherein the suppressor of RASA2 expression is an shRNA or an sgRNA.
  • Embodiment 247 The engineered immune cell of any one of embodiments 238-246, wherein the suppressor of RASA2 expression is an shRNA.
  • Embodiment 248 The engineered immune cell of embodiment 247, wherein the shRNA comprises the nucleic acid sequence of SEQ ID NO: 165.
  • Embodiment 249 The engineered immune cell of any one of embodiments 238-246, wherein the suppressor of RASA2 expression is an sgRNA.
  • Embodiment 250 The engineered immune cell of embodiment 249, wherein the sgRNA comprises the nucleic acid sequence of SEQ ID NO: 161.
  • Embodiment 251 The engineered immune cell of any one of embodiments 238-250, further comprising an shRNA that suppresses the expression of TNFRSF6 (Fas).
  • Embodiment 252 The engineered immune cell of embodiment 251, further comprising an shRNA that suppresses the expression of TGFBR2.
  • Embodiment 253 The engineered immune cell of embodiment 251, further comprising an shRNA that suppresses the expression of PTPN2.
  • Embodiment 254 The engineered immune cell of any one of embodiments 237-253, wherein the engineered immune cell is a primary human immune cell.
  • Embodiment 255 The engineered immune cell of any one of any one of embodiments 237- 254, wherein the engineered immune cell is an allogeneic immune cell.
  • Embodiment 256 The engineered immune cell of any one of any one of embodiments 237- 254, wherein the engineered immune cell is an autologous immune cell.
  • Embodiment 257 The engineered immune cell of any one of embodiments 254-256, wherein the primary immune cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor.
  • NK natural killer
  • Embodiment 258 The engineered immune cell of any one of embodiments 254-257, wherein the primary immune cell is a primary T cell.
  • Embodiment 259 The engineered immune cell of any one of embodiments 254-258, wherein the primary immune cell is a primary human T cell.
  • Embodiment 260 The engineered immune cell of any one of embodiments 254-259, wherein the primary immune cell is virus-free.
  • Embodiment 261 A population of cells comprising a plurality of engineered immune cells of any one of embodiments 237-260.
  • Embodiment 262 A pharmaceutical composition comprising the engineered immune cell of any one of embodiments 237-260 or the population of cells of embodiment 261 and a pharmaceutically acceptable excipient.
  • Embodiment 263 A method of treating a disease in a subject comprising administering the engineered immune cell of any one of embodiments 237-260 or the pharmaceutical composition of embodiment 262 to the subject.
  • Embodiment 264 The method of embodiment 263, wherein the disease is cancer.
  • Embodiment 265 The method of embodiment 264, wherein the cancer is a solid cancer or a liquid cancer.
  • Embodiment 266 The method of embodiment 264 or 265, wherein the cancer is ovarian cancer, fallopian cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, or pancreatic cancer.
  • Embodiment 267 The method of any one of embodiments 264-266, wherein the administration of the engineered immune cell enhances an immune response in the subject.
  • Embodiment 268 The method of embodiment 267, wherein the enhanced immune response is an adaptive immune response.
  • Embodiment 269 The method of embodiment 267, wherein the enhanced immune response is an innate immune response.
  • Embodiment 270 The method of any one of embodiments 264-269, wherein the enhanced immune response is an increased expression of at least one cytokine or chemokine.
  • Embodiment 271 The method of embodiment 270, wherein the at least one cytokine or chemokine is IL-2 or IFN ⁇ .
  • Embodiment 272 The method of any one of embodiments 264-271, wherein the enhanced immune response is an increased lysis of target cells as compared to administration of a control cell.
  • Embodiment 273 The method of any one of embodiments 263-272, further comprising administering an immunotherapy to the subject concurrently with the engineered immune cell or subsequently to the engineered immune cell.
  • Embodiment 274 A method of inhibiting a target cell in a subject comprising administering the engineered immune cell of any one of embodiments 237-260 or the pharmaceutical composition of embodiment 262 to the subject, wherein the engineered immune cell inhibits the target cell.
  • Embodiment 275 The method of embodiment 274, wherein the target cell is a cancer cell.
  • T cells were engineered to express the ALPG/MSLN logic gate including the APLG PrimeR and the MSLN CAR (LG T cells).
  • LG T cells were further engineered to express one of three synthetic pathway activators (SPAs): leucine zipper-gp130 (L-gp130) (SEQ ID NO: 75), membrane-bound IL-15 (mbIL-15) (SEQ ID NO: 76), CD34-IL-7 receptor (C7R) (SEQ ID NO: 78) or a control: truncated EGFR (EGFRt, SEQ ID NO: 84) or c-Jun (SEQ ID NO: 85).
  • SPAs synthetic pathway activators
  • T cells from a single donor were engineered to express ALPG/MSLN circuits containing genes encoding SPA accessory proteins using the CiTE manufacturing process and were frozen and cryobanked at Day 9 after initial activation.
  • engineered T cells Prior to the assay, engineered T cells were thawed and rested overnight in media including 12.5 ng/mL human IL-7 and IL-15.
  • T cells On the day of the assay, T cells were counted, spun down, washed 1X in cytokine-free media, and then resuspended in cytokine-free media.
  • x total T cells were then plated per well of a 96-well v-bottom plate in 100 ⁇ L media without IL-7 and IL-15.
  • Duplicate plates were prepared. One of the plates was immediately analyzed for cell counts and %total edited cells. The second plate was placed in a cell incubator for 6 days, at which time cell count and %editing data were collected. [00427] Cell count and % editing were determined by pelleting cells at 300 ⁇ g for 5 min, and resuspending in FACS buffer containing anti-Myc PE antibodies at 1:50 dilution (for detection of surface PrimeR expression) and anti-FLAG BV421 (for surface CAR expression). Following a 20min staining period at room temperature, cells were spun down and washed 1 ⁇ with FACS Buffer.
  • T cells from one donor CITE-edited with ALPG/MSLN circuits containing genes encoding SPA accessory proteins were profiled for their STAT phosphorylation status by intracellular antibody staining.
  • Cryopreserved CITE-edited T cells were thawed and rested for 20 hours in media containing IL-7 and IL-15 at 12.5ng/mL, respectively.
  • T cells were washed with cytokine-free, serum-free media and then spun down and resuspended in cytokine-free, serum-free media.
  • BD Cytofix was added to the cells and the plate was incubated at 37°C for 15min. After fixation, cells were spun down at 400 ⁇ g for 5 min and resuspended in 200 ⁇ L of BD Perm Buffer III, and incubated on ice for 30min.
  • LG T cells were cocultured with K562 tumor cells expressing no cognate antigens (GFP), PrimeR antigen at high concentrations (ALPG-hi), or low concentrations (ALPG-lo). Following a 72hr incubation, activation of the logic gate was measured by PrimeR (Myc tag) and CAR (FLAG tag) surface expression. L-gp130 LG T cells cocultured with tumor cells demonstrated intact cytolytic CAR logic gate. LG T cells cultured alone or with antigen- negative tumor cells (ALPG-GFP) expressed primeR on the surface (FIG. 5A), but did not express a cytolytic CAR (FIG. 5B).
  • GFP no cognate antigens
  • APG-hi PrimeR antigen at high concentrations
  • APG-lo low concentrations
  • Example 2 In vitro Assessment of LG T Cells Expressing SPAs Materials and Methods Endpoint Luciferase Assay
  • T cells from two donors were engineered to express ALPG/MSLN logic gates (LG) containing genes encoding SPA accessory proteins using the CiTE manufacturing process and were frozen and cryobanked at Day 9 after initial activation.
  • LG ALPG/MSLN logic gates
  • engineered T cells and RNP Prior to the assay, engineered T cells and RNP only control T cells from the same donors were thawed and rested overnight in media including 12.5 ng/mL human IL-7 and IL-15.
  • engineered T cells were counted and stained for PrimeR and CAR expression using anti-Myc PE and anti-FLAG BV421, respectively, and analyzed by flow cytometry.
  • T cells were normalized to the lowest KI% within that donor by adding RNP only cells to dilute engineered populations that were above the lowest KI%.
  • T cells were resuspended in medium without IL-7 and IL-15 and serially diluted prior to being added to 96-well flat-bottom, white-walled assay plates. The serial dilution of T cells resulted in the following co-culture KI+ effector:target (E:T) ratios once 1e4 target cells are added/well: 1:1, 1:3, and 1:9, in technical duplicates.
  • E:T effector:target
  • Each T cell population was co-cultured with Luciferase+ K562 tumor cell lines that either express only CAR antigen (K562-MSLN), or both PrimeR and CAR antigens (ALPG/MSLN). Cytotoxicity at the end of the 72 hour co-culture was measured using an end-point luciferase assay. Following addition of the luciferase substrate directly to the wells data was collected in a PHERAstar plate reader.
  • T cells from two donors were engineered to express ALPG/MSLN circuits containing genes encoding SPA accessory proteins using the CiTE manufacturing process and were frozen and cryobanked at Day 9 after initial activation. Prior to the assay, engineered T cells and RNP only control T cells from the same donors were thawed and rested overnight in media including 12.5 ng/mL human IL-7 and IL-15.
  • engineered T cells were counted and stained for PrimeR and CAR expression using anti-Myc PE and anti-FLAG BV421, respectively, and analyzed by flow cytometry.
  • all engineered T cell populations were normalized to the lowest KI% within that donor by adding RNP only cells to dilute engineered populations that were above the lowest KI%.
  • T cells were resuspended in medium without IL-7 and IL-15 and serially diluted prior to being added to 96-well flat-bottom, white-walled assay plates.
  • T cells The serial dilution of T cells resulted in the following co-culture KI+ effector:target (E:T) ratios once 1e4 target cells are added/well: 1:1, 1:3, 1:9, and 1:27 in technical duplicates.
  • E:T effector:target
  • Each T cell population was co-cultured with GFP+ K562 tumor cell lines that express both PrimeR and CAR antigens (ALPG/MSLN). Imaging of GFP and AnnexinV co-culture was conducted throughout a 72hr. period to derive live target cell and live T cell numbers.
  • Continuous Stimulation Assay [00434] T cells from two donors were engineered to express ALPG/MSLN logic gate (LG) in addition to genes encoding SPA accessory proteins using the CiTE manufacturing process.
  • LG logic gate
  • edited cells were isolated by pretreatment with ADAM10 and Gamma-Secretase inhibitors for 30 minutes followed by incubation with Fc- conjugated recombinant ALPG protein for 30min on ice. Cells were then spun down, and resuspended in PBS + BSA containing ProteinG Dynabeads. The Cell/Bead mixture was incubated at room temperature for 15 minutes, and then spun down at 400 ⁇ g for 5min. The cell/bead fraction was washed 1 ⁇ in PBS/BSA and resuspended in media including 12.5 ng/mL human IL-7 and IL-15 and seeded in a 24-well GREX plate.
  • T cells were debeaded and resuspended in T cell media with IL-7/15. 24 hours later, T cells were counted and stained for PrimeR using anti-Myc PE antibodies and analyzed by flow cytometry to acquire the final percentage of edited cells. LG T cells were then cocultured with RPMI cells expressing both PrimeR and CAR antigens (ALPG/MSLN) at a 1:100 E:T ratio. Cells were cocultured either with or without IL-2 supplementation at 100 IU/mL. Every 2-3 days after the initial coculture setup, media was changed and cells were stained with anti-Myc PE antibodies and measured by flow cytometry with CountBright beads to attain the total number of T cells and RPMI cells/well.
  • APG/MSLN PrimeR and CAR antigens
  • LG T cells expressing a SPA or control were cocultured at three different E:T ratios with K562 tumor cells expressing both PrimeR and CAR cognate antigens (ALPG/MSLN), or CAR antigen only (MSLN). Following a 72hr incubation, tumor cytotoxicity was measured by luciferase activity of the target K562 cells.
  • LG T cells expressing SPA accessory molecules were able to specifically kill tumor cells expressing both PrimeR and CAR cognate antigens (FIGs. 6A and 6B).
  • LG T cells expressing a SPA or control protein were cocultured at four different E:T ratios with K562 tumor cells expressing both PrimeR and CAR cognate antigens (ALPG/MSLN). Cocultures were continually imaged throughout a 72-hour period via Incucyte, and T cell and K562 cell counts were derived.
  • LG T cells expressing SPA accessory molecules killed tumor cells at similar levels to an EGFRt control circuit throughout a 72hr period.
  • FIG. 7A LG T cells expressing SPA accessory molecules exhibited similar T cell expansion to an EGFRt control circuit throughout a 72hr period (FIG. 7B).
  • L-gp130-enhanced LG T cells were cocultured with RPMI cells expressing both ALPG and MSLN at a 1:100 E:T. Cocultures were continually imaged throughout a 10-day period via Incucyte, and tumor cell counts were derived.
  • L- gp130 LG T cells demonstrated vastly improved tumor control compared to EGFRt LG T cells, leading to complete tumor clearance (FIG. 8A). Representative well images from the Day 10 are shown (FIGs. 8B and 8C).
  • LG T cells were subjected to repetitive stimulation with IL-2. Edited LG T cells expressing a SPA or control protein in the absence of antigen stimulation were stained with a panel of antibodies to characterize their cell differentiation state and analyzed by flow cytometry. At baseline levels (in absence of stimulatory antigens), LG T cells expressing SPAs did not exhibit a modified cell differentiation state compared to LG T cells expressing an inert EGFRt molecule (FIG. 9). [00438] Subsequently, LG T cells and RPMI target cells were cocultured throughout a 15- day continuous stimulation assay with or without IL-2.
  • L-gp130-expressing LG T cells controlled tumor cell growth throughout the assay period while the EGFRt control LG T cells lost control (FIG. 10). These data indicate L-gp130 LG T cells do not require IL-2 support compared to control tumor cells. Cumulative LG T cell outgrowth throughout a 31- day period of repetitive stimulation shows that L-gp130 LG T cell’s ability to control tumor cell growth was vastly superior to a control EGFRt LG T cells. (FIG. 11A).
  • LG T cells expanded at similar levels as control EGFRt LG T cells in the presence of IL-2. In absence of IL-2, LG T cell expansion was superior in L-gp130-expressing LG T cells compared to all other LG T cells tested (FIG. 11B). [00439] Following 15 days of repetitive stimulation, LG T cells were removed from culture and incubated in cytokine-free media over a nine day period. LG T cell count was measured throughout the incubation period. In absence of supportive cytokines, LG T cells expressing SPAs that have previously been stimulated by tumor antigen did not grow out independently of supportive cytokines or additional antigen stimulation (FIG. 12).
  • L-gp130 LG T cells exhibited a more na ⁇ ve phenotype compared to EGFRt-expressing LG T cells (FIGs. 13A and 13B).
  • the differentiation state of L-gp130- expressing LG T cells was more sensitive to IL-2 supplementation than control LG T cells. (FIGs. 14A and 14B).
  • IL-2 drove differentiation of an effector phenotype in control EGFRt LG T cells while L-gp130 LG T cells developed a less differentiated stem-memory T cell (Tscm) phenotype.
  • Example 3 Modulation of SPA Activity with FAS/PTPN2 Knockdown Materials and Methods pSTAT Signaling
  • BD Cytofix was added to the cells and the plate was incubated at 37°C for 15min. After fixation, cells were spun down at 400 ⁇ g for 5 min and resuspended in 200 ⁇ L of BD Perm Buffer III, and incubated on ice for 30min.
  • T cells from two donors were engineered to express ALPG/MSLN logic gate in addition to genes encoding SPA accessory proteins using the CiTE manufacturing process.
  • edited cells were isolated by pretreatment with ADAM10 and Gamma-Secretase inhibitors for 30 minutes followed by incubation with Fc-conjugated recombinant ALPG protein for 30min on ice. Cells were then spun down, and resuspended in PBS + BSA containing ProteinG Dynabeads. The Cell/Bead mixture was incubated at room temperature for 15 minutes, and then spun down at 400 ⁇ g for 5min.
  • the cell/bead fraction was washed 1 ⁇ in PBS/BSA and resuspended in media including 12.5 ng/mL human IL-7 and IL-15 and seeded in a 24-well GREX plate. Following a 24-hour incubation period cells were debeaded and resuspended in T cell media with IL-7/15. 24 hours later, T cells were counted and stained for PrimeR using anti-Myc PE antibodies and analyzed by flow cytometry to acquire the final percentage of edited cells. T cells were then cocultured with K562 cells expressing both PrimeR and CAR antigens (ALPG/MSLN) at a 1:1 E:T ratio.
  • APG/MSLN K562 cells expressing both PrimeR and CAR antigens
  • L-gp130- expressing T cells controlled tumor cell growth throughout the assay period while the EGFRt control T cells lost control (FIG. 17A).
  • Edited T cells expressing the Fas/PTPN2 module exhibited increased antitumor activity with and without a SPA.
  • T cells expressing both an L- gp130 SPA and a Fas/PTPN2 shRNA module demonstrated the most potent killing.
  • T cell differentiation phenotype was assessed by flow cytometry.
  • L-gp130 T cells exhibited a more na ⁇ ve phenotype compared to EGFRt- expressing cells, and this trend was preserved in the presence of the Fas/PTPN2 shRNA module (FIG. 17B).
  • Example 4 Gene Expression Profiling of LG T cells Expressing SPAs Materials and Methods Repetitive Stimulation Assay [00444] ICTs (Integrated circuit T cells) expressing SPAs with or without FAS/PTPN2 modules were challenged in a repetitive stimulation assay as described above. Following 14- days of the RSA, ICTs were separated from target K562 cells by flow cytometry, using PrimeR(Myc) and CAR(Flag) surface expression to distinguish from the target cells. ATAC-Seq [00445] ATAC-Seq (Assay for Transposase-Accessible Chromatin with high-throughput sequencing) was carried out according to a previously published report (Corces et al. Nature Methods 2017).
  • 50,000 viable cells were centrifuged at 500 RCF at 4°C for 5 min.
  • the cell pellet was resuspended in 50 ⁇ L cold ATAC-Resuspension Buffer (RSB) containing 0.1% NP40, 0.1% Tween 20, and 0.01% Digitonin and incubated on ice for 3 minutes.
  • RSB cold ATAC-Resuspension Buffer
  • 1 mL of cold ATAC-RSB containing 0.1% Tween-20 only was added.
  • the isolated nuclei were centrifuged at 500 RCF for 10 min at 4°C and the supernatant was removed carefully.
  • the nuclei pellet was resuspended in 25 ⁇ L 2x TD buffer, 100nM final Tn5 transposase, 16.5 ⁇ L PBS, 0.5 ⁇ L 1% digitonin, 0.5 ⁇ L 10% Tween-20 and incubated at 37°C for 30 minutes with 1000 RPM shaking.
  • the transposition reaction was cleaned up using a Zymo DNA Clean and Concentrator-5 Kit and the eluted transposed DNA was amplified using Illumina barcoded Nextera primers for 5 cycles.
  • Quantitative PCR quantitative PCR (qPCR) was performed on 10% of the first PCR reaction to determine additional PCR cycles to amplify the barcoded libraries without saturation.
  • ATAC-Seq libraries were then quantified and qualified on the Agilent Tapestation D5000 assay focusing on the size range of 200bp-1000bp.
  • ATAC-Seq libraries were pooled and sequenced on the Illumina NovaSeq 6000 SP flowcell (v1.5) at paired-end 150bp, index 1 and 2 at 8bp for dual-indexed samples. Each ATAC-Seq libraries were targeted to be sequenced for 20-30M reads.
  • the fastq files were generated and demultiplexed using bcl2fastq script (v2.20.0.422).
  • ATAC-seq reads were first trimmed of adapter sequences using cutadapt (v3.5) and then aligned to GRCh38 with BWA (0.7.17). PCR duplicates were identified using Picard's (v2.26.10) MarkDuplicates procedure and removed prior to downstream analysis. ArchR (v1.0.1) was used to count pileup of ATAC-seq reads across the genome and produce plots of ATAC peaks.
  • RNAseq [00446] For bulk RNA isolation, RNA was isolated using RNEasy Plus Micro kit following manufacturer’s protocol. RNA was quantified using Qubit RNA HS Assay Kit, and RNA quality was assessed using Tape station instrument with RNA screen tape.
  • RNA libraries were prepared using the TruSeq RNA library prep kit v2 (Illumina). 100ng of RNA samples were used unless limited by sample concentration where the totality of RNA samples were used ( ⁇ 50ul) for library prep, following supplier’s protocol. Library concentrations were normalized to 2nM and pooled. Sequencing was performed using Novaseq 6000 instruments using 100/200 cycle Novaseq SP Kit (Illumina). RNA-seq reads were aligned to GRCh38 using STAR (v2.7.7a). STAR was additionally used to quantify gene expression.
  • RNAseq analysis identified over 2000 genes that were differentially expressed in gp130 ICTs compared to control EGFRt ICTs following the 14-day repetitive stimulation assay (FIG. 18A).
  • the differentially regulated genes represent various categories, including checkpoint molecules, cell-surface receptors, T cell memory and exhaustion markers, as well as other notable T cell transcription factors (FIG. 18B).
  • a noteworthy trend in the data is that gp130 ICTs at Day 14 more closely resemble Day 0 samples than the other groups tested.
  • ATAC-seq analysis revealed differential chromatin accessibility across various loci in gp130 ICTs compared to EGFRt or C7R ICTs (FIG. 19).
  • Logic gate ICTs expressing L- gp130 were also analyzed by ATAC-seq to evaluate chromatin accessibility changes of two exhaustion markers, TIGIT and TOX, at day 0 and after a 14 day repetitive stimulation assay.
  • ICTs expressing L-gp130 displayed restricted accessibility of key exhaustion markers TIGIT and TOX (FIG. 19), indicating that L-gp130 expression preserved a stem T cell phenotype.
  • Some specific examples include diminished transcriptional activity at the TIGIT and TOX loci, indicated by reduced reads across those gene loci.
  • LG T cells were measured 3 times weekly by caliper and peripheral blood was drawn once weekly for PK studies.
  • LG T cells equipped with mbIL-15 or C7R were compared to LG T cells expressing control EGFRt. Tumor volume was measured by caliper along with body weight. Cell counting was performed as in Example 3 above. Characterization of L-gp130- or C7R-Expressing LG T Cells [00450] Details of the in vivo interrogation of LG T cells expressing SPAs are detailed in FIG. 21.
  • LG T cells prepared as detailed above, were administered IV. Tumors were measured 3 times weekly by caliper and peripheral blood was drawn once weekly for PK studies. LG T cells equipped with C7R or L-gp130 were compared to LG T cells expressing control EGFRt/NGFRt molecules. Tumor volume was measured by caliper along with body weight. Cell counting was performed as in Example 3 above. Characterization of L-gp130- or C7R-Expressing LG T Cells in a Renal Cell Carcinoma Model [00451] Details of the in vivo interrogation of LG T cells expressing SPAs are detailed in FIG. 24A.
  • mice were subcutaneously injected on the right dorsal flank with 2e6 cells of 786-O-EFG- CA9-ALPG/MSLN_MCB tumor cells in 50% Sigma-Aldrich Extracellular Matrix E1270 to PBS suspension.
  • mice were checked for palpable tumors.
  • mice were measured twice a week until they demonstrated the mean tumor volume of approximately 300mm3.
  • mice reached the average tumor volume of 299mm3 and were randomized into 10 groups consisting of 7-8 mice. Following randomization, the T cells were thawed and rested overnight for intravenous injection (I.V.).
  • mice were harvested and normalized for I.V. injections.
  • the T cells were suspended in 100uL of PBS at doses of 0.3e6 and 0.05e6.
  • mice were monitored twice a week for tumor volumes, body weights and clinical observations. Each mouse was bled on days 5, 12, 19, 40 post treatment and 100uL of blood was collected via submandibular vein. Blood was processed for immune phenotyping of ICTs and Total T cells and edited T cells were quantified.
  • Results [00452] SPAs were compared with control EGFRt in LG T cells.
  • C7R-expressing LG T cells achieved a complete response (CR) in 100% of mice, which was a ⁇ 9-fold higher rate than EGFRt-expressing cells (3/10).
  • mbIL-15-expressing LG T cells achieved a CR in 7/10 mice, which was a ⁇ 5-fold higher rate than EGFRt-expressing cells (FIG. 22A).
  • CR results of all groups are provided in Table E.
  • Anti-tumor efficacy correlated with LG T cell expansion detected in the blood, with eventual contraction of the LG T cells (FIG. 22B).
  • endpoint splenic LG T cells were isolated and enumerated. Total edited cell count was plotted and the fold-increase in SPA LG T cells compared to the EGFRt LG T cell control group is indicated (FIG. 22C).
  • Table E shows CR results in mice treated with LG T cells expressing indicated SPA molecule or control
  • L-gp130 and C7R-expressing LG T cells cleared tumors better than EGFRt LG T cells, with 100% CR in all mice compared to 0% in control mice (FIG. 23A).
  • Anti-tumor efficacy correlated with LG T expansion detected in the blood (FIG. 23B).
  • 786-O-engrafted mice treated with ICTs expressing the L-gp130 SPA controlled tumor better than mice treated with control ICTs expressing EGFRt, with 10/10 mice achieving CR versus 0/10 in the control group (FIG. 24B).
  • Blood PK demonstrated improved proliferation in gp130-expressing T cells, with maximum expansion observed at 19-days post T-cell injection, while 0/6 mice examined from the control group had detectable edited T cell levels in the blood (FIG. 24C).
  • the data demonstrate improved tumor clearance by SPA- equipped ICTs in an alternative cancer model (Renal Cell Carcinoma).
  • T cells were engineered to express the ALPG priming receptor (primeR) (SEQ ID NO: 24) and MSLN CAR (SEQ ID NO: 31), as well as inducible expression of IL-2 (SEQ ID NO: 74) upon activation of the primeR (“LG T cells”).
  • Engineered T cells were co-cultured with K562 target cells expressing no antigen, primeR antigen (ALPG) only, or both primeR and CAR antigens (MSLN/ALPG) for 72 hours.
  • T cells were engineered to express the ALPG priming receptor (primeR) (SEQ ID NO: 24) and MSLN CAR (SEQ ID NO: 31), as well as inducible expression of IL-2 (SEQ ID NO: 86) upon activation of the primeR.
  • Primary R ALPG priming receptor
  • MSLN CAR SEQ ID NO: 31
  • Engineered T cells, T cells expressing only the logic gate, and RNP-only control cells were co-cultured with K562 target cells expressing no antigen or both ALPG and MSLN for 72 hours.
  • T cells were resuspended in medium and serially diluted prior to being added to 96-well flat-bottom, white-walled assay plates.
  • the serial dilution of T cells resulted in the following co-culture effector:target (E:T) ratios once 1 ⁇ 10 4 target cells are added/well: 1:1, 1:3, and 1:9, in technical duplicates.
  • E:T co-culture effector:target
  • Each T cell population was co-cultured with Luciferase+ K562 tumor cell lines that either express no antigen or both PrimeR and CAR antigens (ALPG/MSLN). Cytotoxicity at the end of the 72 hour co-culture was measured using an end-point luciferase assay.
  • T cells from two or three donors were engineered to express the ALPG priming receptor (primeR) (SEQ ID NO: 24) and MSLN CAR (SEQ ID NO: 31), as well as inducible expression of IL-2 (SEQ ID NO: 86) upon activation of the primeR with two different orientations of cytokine placement within the expression construct: payload-2A (self- cleaving peptide)-CAR or CAR-2A-payload.
  • primaryR ALPG priming receptor
  • MSLN CAR SEQ ID NO: 31
  • LG T cells were co-cultured in media containing 12.5 ng/mL human IL-7 and IL-15. Seven days after electroporation, logic gate CAR T cells were stained for PrimeR and CAR expression using anti-myc PE and anti-Flag APC respectively, and analyzed by flow cytometry. Leakiness (antigen independent expression of CAR) is calculated by dividing the %CAR positive population by the total primeR+ population.
  • T cells were engineered to express the ALPG priming receptor (primeR) (SEQ ID NO: 24) and MSLN CAR (SEQ ID NO: 31), as well as inducible expression of IL-2 (SEQ ID NO: 86) or Super-2 (SEQ ID NO: 132) upon activation of the primeR. Edited cells were co- cultured with K562 target cells expressing PrimeR and CAR antigens (MSLN/ALPG) at a 1:1 E:T ratio. Control cells that were not engineered with inducible IL-2 expression were cultured in medium containing exogenous IL-2 or control medium.
  • primaryR ALPG priming receptor
  • MSLN CAR SEQ ID NO: 31
  • inducible expression of IL-2 SEQ ID NO: 86
  • Super-2 SEQ ID NO: 132
  • LG T cells After a 72-hour co-culture, the levels of IL-2 secretion after engagement of the priming antigen indicated that cytokine secretion was induced by activation of the primeR. Furthermore, co-culture with both primeR and CAR antigens enhanced IL-2 secretion (FIG. 25B). This indicates that inducible cytokine expression in LG T cells can provide a method of delivering high levels of cytokine payloads to the tumor microenvironment. [00461] To assess the effects of inducible cytokine expression on the function of logic gate- expressing T cells, LG T cells were engineered to have inducible IL-2 expression upon stimulation of the priming receptor primeR or control.
  • LG T cells were engineered to have inducible IL-2 expression or control upon stimulation of primeR. LG T cells were then repeatedly stimulated with target cells expressing primeR and CAR antigens every 2-3 days over a 14 day period, and cell counts were taken continuously. Control LG T cells were also incubated in the presence of exogenous IL-2 or control medium. LG T cells with inducible IL-2 expression showed the highest degree of expansion over the 14-day stimulation, with control cells incubated with exogenous IL-2 also showing expansion over the course of the experiment (FIG. 28). By contrast LG T cells stimulated in the absence of cytokines did not substantially expand over the course of the stimulation.
  • T cells were engineered to express the ALPG priming receptor (primeR) (SEQ ID NO: 24) and MSLN CAR (SEQ ID NO: 31), as well as to have inducible expression of IL-2 (SEQ ID NO: 86), IL-12/23p40 (SEQ ID NO: 94), IL-18 (SEQ ID NO: 98), or IL-21 (SEQ ID NO: 90) upon activation of primeR.
  • primaryR ALPG priming receptor
  • MSLN CAR SEQ ID NO: 31
  • IL-2 SEQ ID NO: 86
  • IL-12/23p40 SEQ ID NO: 94
  • IL-18 SEQ ID NO: 98
  • IL-21 SEQ ID NO: 90
  • Engineered T cells were co-cultured with K562 target cells expressing no antigen, primeR antigen (ALPG) only, or both PrimeR and CAR antigens (MSLN/ALPG) for 72 hours. Supernatants were collected for cytokine quantification by Milliplex MAP Human High Sensitivity T cell Panel Premixed 21-plex.
  • APG primeR antigen
  • MSLN/ALPG both PrimeR and CAR antigens
  • T cells were engineered to express the ALPG priming receptor (primeR) (SEQ ID NO: 24) and MSLN CAR (SEQ ID NO: 31)in addition to inducible expression of IL-2 (SEQ ID NO: 86), IL-12/23p40 (SEQ ID NO: 94), IL-18 (SEQ ID NO: 98), or IL-21 (SEQ ID NO: 90).
  • Edited cells were co-cultured with K562 target cells expressing primeR and CAR antigens (MSLN/ALPG) at a 1:1 E:T ratio.
  • Control cells that were not engineered with inducible IL-2 expression were cultured in medium containing exogenous IL-2 or control medium.
  • T cells Following a 2-3 day co-culture period, T cells, media was changed and cells were stained with anti-Myc PE antibodies and measured by flow cytometry with CountBright beads to attain the total number of T cells and RPMI cells/well. Once cell counts were acquired, cell concentration was re-normalized to the initial 1:1 ratio. This process was repeated over a 14-day period.
  • Constructs were prepared to operably link IL-7 (SEQ ID NO: 88) to signal peptides from IgKVIII (SEQ ID NO: 118), CD44 (SEQ ID NO: 100), tPA (SEQ ID NO: 130), trypsinogen (SEQ ID NO: 114), CD5 (SEQ ID NO: 104), IL-2 (SEQ ID NO: 108), secrecon (SEQ ID NO: 128), CD3E (SEQ ID NO: 102), IgE (SEQ ID NO: 120), OSM (SEQ ID NO: 122), ITGAL (SEQ ID NO: 106), GMCSF (SEQ ID NO: 110), chymotryspinogen (SEQ ID NO: 112), IgK (SEQ ID NO: 116), IgG2H (SEQ ID NO: 124), or BM40 (SEQ ID NO: 126).
  • LG1 T cells were engineered to have inducible expression of IL-7 with each of the signal peptides upon activation of primeR.
  • Engineered T cells were co-cultured with K562 target cells expressing both ALPG and MSLN for 72 hours. Supernatants were collected for cytokine quantification by Milliplex MAP Human High Sensitivity T cell Panel Premixed 21- plex. Results [00467]
  • LG T cells were engineered to have inducible expression of IL-2, IL-12/23p40, IL- 18, or IL-21 upon activation of primeR.
  • Engineered cells were co-cultured with target cells expressing both primeR and CAR antigens.
  • Engineered cells expressing each of these constructs were co-cultured with target cells expressing both primeR and CAR antigens.
  • Levels of secreted IL-7 were shown to vary based on the specific signal peptide used (FIG. 32B).
  • Signal peptides from IgGKVIII and CD44 yielded the lowest relative levels of secreted IL-7, whereas BM40 and IgG2H yielded the highest IL-7 relative secretion levels.
  • Example 8 In vivo Characterization of LG T Cells with Inducible Cytokine Expression Materials and Methods [00469] Female 6 to 7-week-old NSG MHC I/II DKO mice (Jax) were implanted subcutaneously with 1 ⁇ 10 6 MSTO-211H-MSLN-ALPG cells in 50% Matrigel. Mice were staged at tumor volumes of approximately 80-150 mm 3 .
  • T cells expressing the ALPG priming receptor (primeR) (SEQ ID NO: 24) and MSLN CAR (SEQ ID NO: 31) with inducible expression of EGFRt control (SEQ ID NO: 84), IL-2 (SEQ ID NO: 86), IL-7 (SEQ ID NO: 88), or IL-21 (SEQ ID NO: 90) upon activation of the primeR were injected via the tail vein.
  • Tumor volumes were measured via caliper over the course of the study. 100 ⁇ L of whole blood from the mice were collected by retro-orbital bleeding 7, 14, 21, 28 and 42 days post LG T cell administration and T cell titers were measured by flow cytometry.
  • mice treated with RNP-only control T cells, EGFRt control- expressing LG T cells, and LG T cells with inducible expression of IL-2, IL-7 or IL-21 were assessed for their anti-tumor responses.
  • Mice treated with LG T cells inducibly expressing any of the cytokines showed robust suppression of tumor growth, whereas mice treated with LG T cells expressing EGFRt control showed more a relatively more limited suppression of tumor growth, and mice treated with RNP-only T cells showed no improvement in tumor suppression compared to no-treatment control (FIG. 33A).
  • LG T cells expressing any of the inducible cytokines showed increased expansion compared to control T cells (FIG. 33B).
  • Example 9 High-Throughput Screening of LG T Cells Expressing a Combination including a suppressor of gene expression and an SPA and/or a Cytokine Materials and Methods Editing and Normalization of T Cells: [00471] To generate a library of T cells for screening T cells from 2 donors were incubated in a 384-well plate with plasmids encoding the CAR, PrimeR, and combinations including a synthetic pathway activator, a cytokine, and an sgRNA for gene silencing. A diagram of the production of edited cells is shown in FIG. 34A. Edited cells were stained with Ki-67 to measure cell count.
  • Ki-67 data was wrangled and cells were normalized for both overall count and fraction of edited cells prior to commencement of the continuous stimulation assay.
  • a detailed schematic of the normalization workflow is shown in FIG. 34B.
  • Continuous Stimulation assay [00472] To evaluate the cytolytic and proliferative capacity of the engineered T cells, continuous stimulation assay was performed. Briefly, the engineered T cells and tumor cells were seeded at 1:100 (250 edited T cells: 25K RPMI 8226 target cells) with complete RPMI medium (RPMI 1640 + glutamax, 10% fetal bovine serum, 15ng/ul gentamicin). Media exchange occurred in every co-culture 3 times a week (every 2-3 days) with the RPMI medium .
  • a split and re-challenge was performed at day 12 of co-culture.
  • each well was mixed to achieve a homogenous mixture and 25% of the volume (50 ⁇ l) was acquired and replated to a new plate.
  • 25K tumor cells were introduced to the new plate containing the split co-culture cells.
  • the assay was concluded at 14 days of co-culture and target cell count and T cell count were measured via Incucyte using the manufacturer's protocol.
  • FIG. 34C A detailed schematic of the continuous stimulation assay setup and output is shown in FIG. 34C. Results [00473] Normalized results of the continuous stimulation assay screen are shown in FIGs. 35A and 35B.
  • the combination of L-gp130 with an sgRNA targeting PTPN2 yielded no improvement in LG T cell expansion compared to either L-gp130 or the sgRNA alone (FIG. 37A).
  • the combination of C7R with an sgRNA targeting CISH yielded no additional decrease in target cell count compared to either C7R or the sgRNA alone (FIG. 37B).
  • the ANOVA analysis was carried out with a fixed CAR module and across every tested background. Briefly, the ANOVA model coefficients of interaction terms with nominal a p- value ⁇ 0.05.
  • Example 10 Analysis of LG T Cells Expressing a Combination including one or more shRNAs, additional suppressors of gene expression, and an SPA and/or a Cytokine Materials and Methods Editing and Normalization of T Cells: [00477] To generate a library of T cells for screening T cells from 2 donors were incubated in a 384-well plate with plasmids encoding the CAR, PrimeR, and combinations including one or more shRNAs, a synthetic pathway activator, a cytokine, and an sgRNA for gene silencing. Edited cells were stained with Ki-67 to measure cell count. Ki-67 data was wrangled and cells were normalized for both overall count and fraction of edited cells prior to commencement of the continuous stimulation assay.
  • Continuous Stimulation assay To evaluate the cytolytic and proliferative capacity of the engineered T cells, continuous stimulation assay was performed. Briefly, the engineered T cells and tumor cells were seeded at 1:50 (500 edited T cells: 25K RPMI 8226 target cells) with complete RPMI medium (RPMI 1640 + glutamax, 10% fetal bovine serum, 15ng/ul gentamicin) with or without 5ng/ml TGF-beta treatment. Media exchange occurred in every co-culture 3 times a week (every 2-3 days) with the RPMI medium with or without 5ng/ml TGF-beta treatment. A split and re-challenge was performed at day 9 and 12 of co-culture.
  • each well was mixed to achieve a homogenous mixture and 25% of the volume (50 ⁇ l) was acquired and replated to a new plate.
  • 25% of the volume (50 ⁇ l) was acquired and replated to a new plate.
  • 25K tumor cells were introduced to the new plate containing the split co-culture cells. The assay was concluded at 14 days of co-culture and target cell count and T cell count were measured via Incucyte using the manufacturer's protocol.
  • LG T cells were prepared to express shRNAs targeting Fas (SEQ ID NO: 171) and PTPN2 (SEQ ID NO: 167), Fas alone, or Fas and PTPN2 in combination with an sgRNA targeting CISH (SEQ ID NO: 164), RASA2 (SEQ ID NO: 161), SOCS1 (SEQ ID NO: 162), or ZC3H12A (SEQ ID NO: 163).
  • Cells were then run on a continuous stimulation assay in control medium or medium supplemented with one of IL-2, IL-7, IL-12, IL-15, IL-18, or IL-21.
  • Example 11 In vivo analysis of LG T cells expressing a synthetic pathway activator and cytokine payload Materials and Methods [00483] To determine the anti-cancer efficacy of L-gp130 SPA + IL-2 combination modules, a late stage MSTO-211H-EFG-ALPG h /MSLN h subcutaneous xenograft model was utilized. 1x10 6 MSTO-211H-EFG-ALPG h /MSLN h cells in 50% matrigel were inoculated into the right dorsal flank of six-to-seven-weeks old, female NSG MHC I/II DKO mice.
  • mice were injected intravenously with a single dose of 0.05, 0.1, 0.3 and 0.7 x10 6 L-gp130 or L-gp130 + IL-2 containing ICT and the negative control RNP T cells were administered at the highest dose equivalent to the total T cells administered in the cohort of the L-gp130 + IL2. Mice were dosed individually by fixed volume (200 ⁇ L) on the day of treatment as described above. Tumor growth and body weight were monitored twice per week.
  • Whole blood samples were collected at day 7, 14, 21, 42, 56 and 70 in K 2 EDTA tubes through survival technique and processed for staining of total and receptor positive T cells.
  • Whole blood samples were collected on day 1, 3, 7, 14, 21, 42, 56 into serum separator tubes, processed to serum and snap frozen. Serum samples were assessed for human cytokine concentrations via a Luminex 13-plex assay per manufacturer’s protocol.
  • animals were necropsied for liver, lungs, spleen, kidneys, heart, brain and tumor.
  • ICT cells expressing a cytokine IL-2 payload and L-gp130 were assessed as compared to ICT cells expressing L-gp130 and a control cytokine NGFR.
  • ICT cells expressing L-gp130 (SPA.I) and an IL2 payload had a greater than 14 fold enhanced potency as compared to ICT cells expressing L-gp130 (SPA.I) alone, in the MSTO (mesothelioma) in vivo model.
  • FIG. 41A shows the mean tumor volume in mice after treatment with the indicated ICT cells.
  • FIG. 41B shows the total T cells at 7, 14, 21, and 42 days post T cell injection.
  • the 0.05e6 SPA.I plus IL2 ICT cell dose outperformed the 0.7e6 dose of SPA.I only T cells in controlling the tumor volume.
  • the IL-2 payload module significantly increased the SPA.I ICT cell potency.
  • Serum IL-2 was detected in only one animal in the 0.7e6 high dose SPA.I plus IL-2 ICT cell group (FIG. 42).
  • the IL-2 payload module did not correspond to detectable human IL-2 in mouse serum at time points assessed (Day 1, 3, 7, 14, 21, and 42) with the exception of one animal from the high dose group (0.7e6 edited T cells/mouse) (FIG. 42). Thus, the IL-2 payload was not released into circulation in vivo. [00486] Inclusion of the IL-2 payload module did correspond with increased detectable human IFN- ⁇ in mouse serum at time points assessed. IFN- ⁇ was detected in the mouse serum at days 14, 21, and 42 post injection in the animals dosed with 0.7e6, 0.3e6, and 0.1e6 L- gp130 (SPA.I) plus IL-2 ICT cells (FIG. 42).
  • IFN- ⁇ was also detected in the mouse serum at day 42 post injection in the animals dosed with the lowest dose of 0.05e6 L-gp130 (SPA.I) plus IL-2 ICT cells (FIG. 42).
  • the ICT cells expressing only L-gp130 (SPA.I) induced very low levels of detectable IFN- ⁇ on Days 14 and 21 only in the higher cell dosages (0.7e6 and 0.3e6).
  • Example 12 In vitro validation of payload enhancement of other immune cells Materials and Methods [00487] Cryopreserved T cells were activated and cultured in preparation for DNA knock-in as described previously.
  • T cells were removed from CD3/CD28 beads and electroporated with a Cas9 RNP targeting the TRAC locus and a DNA plasmid encoding the NY-ESO TCR.
  • Post electroporation T cells were cultured for an additional 5 days in IL-7 and IL-15 and then assessed via flow cytometry for successful TRAC knockout and knock in the NY-ESO TCR via tetramer and TCR V ⁇ 13.1 antibody staining.
  • TCR knock in T cells were then enriched via a PE-TCR V ⁇ 13.1 antibody, a biotinylated anti-PE antibody, and streptavidin beads.
  • TCR knock in T cells were seeded at 10,000 TCR + T cells per well in a 96 well with 10,000 mCherry expressing A375 target cells. Tumor cell killing was assessed by fluorescent imaging over time in the incucyte instrument according to the manufacturer’s instructions. Cultures were maintained in RPMI1640 media + 10% FBS +/- 1ng/ml IL-2 or IL-15. Every 3 days non-adherent cells in each well were split 1:1 and half were reseeded with 10,000 fresh A375 target cells for a total of 4 target cell stimulations. In between stimulations, the remaining half of the non-adherent cells were stained with the TCR V ⁇ 13.1 antibody to quantify TCR expansion.
  • the addition of IL-2 or IL-15 increased the TCR expansion and tumor lysis as compared to no cytokine addition (TCR group).
  • TCR group no cytokine addition
  • the delayed addition of exogenous IL2 or IL-15 still resulted in improved TCR T cell tumor control.
  • exogenous IL-2 or IL-15 significantly improved TCR T cell tumor control.
  • IL- 15 showed full tumor control in four target cell stimulations every 14 days, even after delayed addition of IL-15.
  • Example 13 In vitro ICT cytolytic assay with IL-15 Materials and Methods Continuous Stimulation Assay [00491] To evaluate the cytolytic and proliferative capacity of the engineered T cells, a continuous stimulation assay was performed as in Example 2 and Example 10 with ICT cells expressing IL-15. Briefly, the engineered T cells and tumor cells were seeded at 1:50 (500 edited T cells: 25K RPMI 8226 target cells) with complete RPMI medium (RPMI 1640 + glutamax, 10% fetal bovine serum, 15ng/ml gentamicin, 5 ng/ml TGFb). Media exchange occurred in every co-culture 3 times a week (every 2-3 days) with the RPMI medium mentioned above.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Medicinal Chemistry (AREA)
  • Biochemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Epidemiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Hematology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Virology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2023/065998 2022-04-20 2023-04-20 Cells comprising a suppressor of gene expression and/or a synthetic pathway activator and/or an inducible payload Ceased WO2023205724A2 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
AU2023256671A AU2023256671A1 (en) 2022-04-20 2023-04-20 Cells comprising a suppressor of gene expression and/or a synthetic pathway activator and/or an inducible payload
CN202380038696.4A CN119156398A (zh) 2022-04-20 2023-04-20 包含基因表达阻遏因子和/或合成途径激活因子和/或诱导型有效载荷的细胞
CA3248111A CA3248111A1 (en) 2022-04-20 2023-04-20 CELLS COMPRISING A GENE EXPRESSION SUPPRESSANT AND/OR A SYNTHETIC PATHWAY ACTIVATOR AND/OR AN INDUCIBLE PAYLOAD
JP2024561779A JP2025514751A (ja) 2022-04-20 2023-04-20 遺伝子発現のサプレッサー及び/または合成経路活性化因子及び/または誘導性ペイロードを含む細胞
EP23792773.6A EP4496806A2 (en) 2022-04-20 2023-04-20 Cells comprising a suppressor of gene expression and/or a synthetic pathway activator and/or an inducible payload
US18/919,328 US20250049854A1 (en) 2022-04-20 2024-10-17 Cells comprising a suppressor of gene expression and/or a syntheticpathway activator and/or an inducible payload
MX2024012971A MX2024012971A (es) 2022-04-20 2024-10-21 Células que comprenden un supresor de la expresión genética y/o un activador de la vía sintética y/o una carga útil inducible

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
US202263333076P 2022-04-20 2022-04-20
US63/333,076 2022-04-20
US202263369656P 2022-07-27 2022-07-27
US63/369,656 2022-07-27
US202263376499P 2022-09-21 2022-09-21
US202263376531P 2022-09-21 2022-09-21
US63/376,499 2022-09-21
US63/376,531 2022-09-21
US202263384600P 2022-11-21 2022-11-21
US63/384,600 2022-11-21

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/919,328 Continuation US20250049854A1 (en) 2022-04-20 2024-10-17 Cells comprising a suppressor of gene expression and/or a syntheticpathway activator and/or an inducible payload

Publications (2)

Publication Number Publication Date
WO2023205724A2 true WO2023205724A2 (en) 2023-10-26
WO2023205724A3 WO2023205724A3 (en) 2023-11-30

Family

ID=88420722

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/065998 Ceased WO2023205724A2 (en) 2022-04-20 2023-04-20 Cells comprising a suppressor of gene expression and/or a synthetic pathway activator and/or an inducible payload

Country Status (8)

Country Link
US (1) US20250049854A1 (https=)
EP (1) EP4496806A2 (https=)
JP (1) JP2025514751A (https=)
CN (1) CN119156398A (https=)
AU (1) AU2023256671A1 (https=)
CA (1) CA3248111A1 (https=)
MX (1) MX2024012971A (https=)
WO (1) WO2023205724A2 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024192100A1 (en) * 2023-03-13 2024-09-19 Arsenal Biosciences, Inc. Synthetic pathway activators
WO2025085846A1 (en) * 2023-10-20 2025-04-24 A2 Biotherapeutics, Inc. Engineered interleukins and uses thereof
WO2025059385A3 (en) * 2023-09-14 2025-05-01 Outpace Bio, Inc. Anti-mesothelin chimeric antigen receptors and methods of use
WO2026026761A1 (zh) * 2024-07-31 2026-02-05 浙江瑞加美生物科技有限公司 一种功能增强的通用型双靶点BCMA/CD19-mbIL15-CAR-DNT细胞的构建、制备与应用

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA3095757A1 (en) * 2018-04-06 2019-10-10 The Regents Of The University Of California Methods of treating glioblastomas
WO2021096783A1 (en) * 2019-11-07 2021-05-20 The Regents Of The University Of California Use of mog for priming a treatment for glioblastoma
AU2021334366A1 (en) * 2020-08-28 2023-05-11 Arsenal Biosciences, Inc. Engineered immune cells with priming receptors
AU2022366987A1 (en) * 2021-10-14 2024-05-16 Arsenal Biosciences, Inc. Immune cells having co-expressed shrnas and logic gate systems

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2024192100A1 (en) * 2023-03-13 2024-09-19 Arsenal Biosciences, Inc. Synthetic pathway activators
WO2025059385A3 (en) * 2023-09-14 2025-05-01 Outpace Bio, Inc. Anti-mesothelin chimeric antigen receptors and methods of use
WO2025085846A1 (en) * 2023-10-20 2025-04-24 A2 Biotherapeutics, Inc. Engineered interleukins and uses thereof
WO2026026761A1 (zh) * 2024-07-31 2026-02-05 浙江瑞加美生物科技有限公司 一种功能增强的通用型双靶点BCMA/CD19-mbIL15-CAR-DNT细胞的构建、制备与应用

Also Published As

Publication number Publication date
US20250049854A1 (en) 2025-02-13
JP2025514751A (ja) 2025-05-09
CA3248111A1 (en) 2023-10-26
CN119156398A (zh) 2024-12-17
WO2023205724A3 (en) 2023-11-30
AU2023256671A1 (en) 2024-12-05
MX2024012971A (es) 2025-02-10
EP4496806A2 (en) 2025-01-29

Similar Documents

Publication Publication Date Title
US12037407B2 (en) Immune cells having co-expressed shRNAS and logic gate systems
US20250049854A1 (en) Cells comprising a suppressor of gene expression and/or a syntheticpathway activator and/or an inducible payload
US20220235380A1 (en) Immune cells having co-expressed shrnas and logic gate systems
US20230340409A1 (en) Engineered immune cells with priming receptors
US20250270288A1 (en) Synthetic pathway activators
WO2023225059A2 (en) Systems of engineered receptors targeting psma and ca9
US12257304B2 (en) Systems targeting PSMA and CA9
HK40119727A (zh) 包含基因表达阻遏因子和/或合成途径激活因子和/或诱导型有效载荷的细胞
WO2025199346A1 (en) Antigen binding proteins that bind tmprss4 and methods of use thereof
EP4701654A2 (en) Novel receptors for transcription regulation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23792773

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2024561779

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: MX/A/2024/012971

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2023792773

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2023792773

Country of ref document: EP

Effective date: 20241023

WWE Wipo information: entry into national phase

Ref document number: 202380038696.4

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: AU2023256671

Country of ref document: AU

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2023256671

Country of ref document: AU

Date of ref document: 20230420

Kind code of ref document: A

WWP Wipo information: published in national office

Ref document number: MX/A/2024/012971

Country of ref document: MX