WO2023201226A1 - Compositions and methods for universal tumor cell killing - Google Patents

Compositions and methods for universal tumor cell killing Download PDF

Info

Publication number
WO2023201226A1
WO2023201226A1 PCT/US2023/065627 US2023065627W WO2023201226A1 WO 2023201226 A1 WO2023201226 A1 WO 2023201226A1 US 2023065627 W US2023065627 W US 2023065627W WO 2023201226 A1 WO2023201226 A1 WO 2023201226A1
Authority
WO
WIPO (PCT)
Prior art keywords
tumor
antigen
cells
target antigen
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2023/065627
Other languages
English (en)
French (fr)
Inventor
Eric Smith
Dimitris Skokos
Kara Olson
Lauric Haber
Joyce WEI
Chia-Yang Lin
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Regeneron Pharmaceuticals Inc
Original Assignee
Regeneron Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Regeneron Pharmaceuticals Inc filed Critical Regeneron Pharmaceuticals Inc
Priority to IL316002A priority Critical patent/IL316002A/en
Priority to CA3247475A priority patent/CA3247475A1/en
Priority to AU2023254191A priority patent/AU2023254191A1/en
Priority to KR1020247035962A priority patent/KR20250004700A/ko
Priority to JP2024560297A priority patent/JP2025512377A/ja
Priority to EP23721256.8A priority patent/EP4507790A1/en
Priority to CN202380046150.3A priority patent/CN119546329A/zh
Publication of WO2023201226A1 publication Critical patent/WO2023201226A1/en
Priority to MX2024012557A priority patent/MX2024012557A/es
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2809Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against the T-cell receptor (TcR)-CD3 complex
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2818Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against CD28 or CD152
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2887Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD20
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/46Hybrid immunoglobulins
    • C07K16/468Immunoglobulins having two or more different antigen binding sites, e.g. multifunctional antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/30Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732Antibody-dependent cellular cytotoxicity [ADCC]
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/734Complement-dependent cytotoxicity [CDC]

Definitions

  • Cancer is one of North America’ s leading causes of death. Despite decades of research, many cancers continue to not respond or develop resistance to traditional chemotherapies and other therapeutics. Recently, advances in immunotherapy have produced some promising therapies, but even these therapeutics tend to prove effective only in specific patients and cancer types. Thus, there is a need for novel treatments for cancer.
  • compositions provided herein are based, in part, on the unexpected discovery that CD28 bispecific antibodies targeting tumor associated antigens, antigens targeting cells in the tumor microenvironment, or an immune antigen (e.g., an antigen expressed on the surface of an immune cell in the tumor or tumor microenvironment) can induce killing of cancer or tumor cells lacking expression of such antigens.
  • an immune antigen e.g., an antigen expressed on the surface of an immune cell in the tumor or tumor microenvironment
  • kits for mediating killing of a tumor cell in a tumor in a subject by administering to the subject a multispecific (e.g., bispecific) antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein, wherein the tumor cell does not express or is not predicted to express the target antigen.
  • a multispecific (e.g., bispecific) antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein, wherein the tumor cell does not express or is not predicted to express the target antigen.
  • at least a subset of tumor cells in the tumor do not express the target antigen.
  • kits for inducing killing of tumor cells and/or inducing T cell activation against tumor cells in a tumor in a subject comprising administering to the subject a multispecific antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein.
  • a multispecific antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein.
  • at least a subset of tumor cells in the tumor do not express the target antigen.
  • compositions for treating cancer in a subject with a tumor comprising administering to the subject a multispecific antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein.
  • a multispecific antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein.
  • at least a subset of tumor cells in the tumor do not express the target antigen.
  • the target antigen is a tumor associated antigen (TAA).
  • TAA tumor associated antigen
  • the target antigen is an antigen associated with a tumor microenvironment (e.g., the microenvironment of the tumor in the subject).
  • the target antigen is an antigen on an immune cell, on tumor cell stroma, or on the extracellular matrix within the tumor microenvironment.
  • extracellular matrix antigens include nectin (e.g., nectin-3 or nectin-4), versican (VACN), fibronectin and carcinoembryonic antigen-related cell adhesion molecules (CEACAM) protein antigens.
  • the methods provided herein may further comprise determining that at least the subset of the tumor cells in the tumor do not express the target antigen.
  • the tumor cells do not express the target antigen if the expression of the target antigen is below the level of detection or below signal to noise ratio.
  • kits for treating cancer in a subject comprising i) determining that the subject comprises a tumor comprising tumor cells that do not express target antigen, and ii) administering to the subject a multispecific antigen binding molecule comprising a first antigen binding region specific for the target antigen and a second antigen binding region specific for a CD28 protein.
  • kits for selecting a subject for cancer therapy comprising: i) determining that the subject comprises a tumor comprising tumor cells that do not express a target antigen; and ii) administering to the subject a multispecific antigen binding molecule with a first antigen binding region specific for the target antigen and a second antigen binding region specific for a CD28 protein, optionally wherein the tumor cells do not express the target antigen if the expression of the target antigen is below the level of detection or below signal to noise ratio, thereby selecting a subject for cancer therapy.
  • the target antigen is a tumor associated antigen (TAA).
  • TAA tumor associated antigen
  • the tumor may be a heterogeneous tumor further comprising tumor cells that express the TAA.
  • the tumor microenvironment of the tumor comprises cells that express the TAA.
  • at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% of the tumor cells in the tumor do not express the TAA.
  • at least 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%- 100%, 70%-100%, 80%-100% or 90%-100% of the tumor cells in the tumor do not express the TAA.
  • the target antigen is an antigen associated with the tumor microenvironment of the tumor, such as an antigen associated with the tumor stroma, an antigen associated with the extracellular matrix of the tumor, an antigen associated with a blood vessel in the tumor microenvironment, or an antigen associated with a cancer-associated fibroblast
  • the target antigen is an antigen associated with the tumor stroma selected from PSA, CEA, CA-125, CA-19, COL10, FAP, B7H3, LRRC15, and fibronectin-EDB isoform.
  • the target antigen is an antigen associated with the extracellular matrix of the tumor selected from nectin (e.g., nectin-3 or nectin-4), versican (VACN), fibronectin and a carcinoembryonic antigen-related cell adhesion molecules (CEACAM) protein.
  • nectin e.g., nectin-3 or nectin-4
  • VACN versican
  • fibronectin e.g., fibronectin and a carcinoembryonic antigen-related cell adhesion molecules (CEACAM) protein.
  • CEACAM carcinoembryonic antigen-related cell adhesion molecules
  • the tumor microenvironment of the tumor comprises cells that express the target antigen.
  • the target antigen is an antigen expressed on the surface of a cancer-associated fibroblast (e.g., a-smooth muscle actin (a-SMA), fibroblast activation protein (FAP), S100A4, platelet-derived growth factor receptors (PDGFRot/p), vimentin, PDPN, CD70, CD10, GPR77, CD10, CD74, CD146, CAV1, Saa3-, or CD49e).
  • a cancer-associated fibroblast e.g., a-smooth muscle actin (a-SMA), fibroblast activation protein (FAP), S100A4, platelet-derived growth factor receptors (PDGFRot/p), vimentin, PDPN, CD70, CD10, GPR77, CD10, CD74, CD146, CAV1, Saa3-, or CD49e.
  • a-SMA a-smooth muscle actin
  • FAP fibroblast activation protein
  • PDGFRot/p platelet-derived
  • the target antigen is an antigen expressed on the surface of a blood vessel in the tumor microenvironment, such as DLK1, EphA2, HBB, NG2, NRP1, NRP2, PDGFR , PSMA, RGS5, TEM1, VEGFR1 or VEGFR2.
  • the target antigen is an immune antigen.
  • the immune antigen is an antigen expressed on the surface of an immune cell.
  • the immune cell may be a macrophage, a neutrophil, an eosinophil, a basophil, a mast cell, a monocyte, a dendritic cell, a natural killer cell, a T cell or a B cell.
  • the immune cell has infiltrated the tumor or tumor microenvironment of the tumor.
  • the immune antigen may be selected from any one of the immune antigens listed in Table 4.
  • the tumor cells in the tumor do not express the target antigen. In some embodiments, at least 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%- 100%, 70%-100%, 80%-100% or 90%-100% of the tumor cells in the tumor do not express the target antigen.
  • the tumor comprises immune cells (e.g., B cells and/or CD20-expressing cells).
  • the tumor cells that do not express the target antigen also do not express CD20.
  • the target antigen may be selected from CD38, EGFR, CD22, MUC16, PSMA,CA9, FOLR1, HER2, and SLAMF7.
  • the target antigen may be CD22.
  • the multispecific antigen binding molecule may be a bispecific antibody (e.g., any one of the bispecific antibodies listed in Table 3) or a bispecific antibody fragment such as a bispecific T-engaging antibody (BiTE), a dualaffinity re-targeting molecule (DART), and a tandem diabody (TandAb).
  • the multispecific antigen binding molecule is administered to the subject conjointly with a second multispecific antigen binding molecule with a first antigen binding region specific for a second target antigen (e.g., a second tumor associated antigen (TAA2)) and a second antigen binding region specific for a CD3 protein.
  • a second target antigen e.g., a second tumor associated antigen (TAA2)
  • TAA2 tumor associated antigen
  • the second multispecific antigen binding molecule is a bispecific antibody or a bispecific antibody fragment, such as a bispecific T-engaging antibody (BiTE), a dual-affinity re-targeting molecule (DART), and a tandem diabody (TandAb).
  • BiTE bispecific T-engaging antibody
  • DART dual-affinity re-targeting molecule
  • TandAb tandem diabody
  • the second target antigen may be selected from any one of the antigens listed in Table 2.
  • the second target antigen may be a CD20 protein.
  • the second multispecific antigen binding molecule is selected from any one of the multispecific antigen binding molecules in Table 5.
  • the multispecific antigen binding molecule may demonstrate a costimulatory effect when administered conjointly with the second multispecific antigen binding molecule.
  • the costimulatory effect is one or more of the following: activating T-cells, inducing IL-2 release, inducing CD25+ up-regulation in PBMCs, and increasing T-cell mediated cytotoxicity.
  • the tumor cells are tumor cells of a B cell cancer.
  • B cell cancers include, but are not limited to, diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), mantle cell lymphoma (MCL), marginal zone lymphomas, burkitt lymphoma, lymphoplasmacytic lymphoma (Waldenstrom macroglobulinemia), hairy cell leukemia, primary central nervous system (CNS) lymphoma, or primary intraocular lymphoma (lymphoma of the eye).
  • DLBCL diffuse large B-cell lymphoma
  • CLL chronic lymphocytic leukemia
  • SLL small lymphocytic lymphoma
  • MCL mantle cell lymphoma
  • marginal zone lymphomas marginal zone lymphomas
  • burkitt lymphoma lymphoplasmacytic lymphoma
  • hairy cell leukemia hairy cell leukemia
  • CNS central nervous system
  • CNS
  • the tumor is a solid tumor.
  • the tumor may be an adenocarcinoma, an adrenal tumor, an anal tumor, a bile duct tumor, a bladder tumor, a bone tumor, a blood born tumor, a brain/CNS tumor, a breast tumor, a cervical tumor, a colorectal tumor, an endometrial tumor, an esophageal tumor, an Ewing tumor, an eye tumor, a gallbladder tumor, a gastrointestinal, a kidney tumor, a laryngeal or hypopharyngreal tumor, a liver tumor, a lung tumor, a mesothelioma tumor, a multiple myeloma tumor, a muscle tumor, a nasopharyngeal tumor, a neuroblastoma, an oral tumor, an osteosarcoma, an ovarian tumor, a pancreatic tumor, a penile tumor, a pituitary tumor, a primary tumor, a prostate tumor
  • the multispecific antigen binding molecule may be administered systemically, intravenously, subcutaneously, or intramuscularly.
  • the multispecific antigen binding molecule may be administered to the subject in a pharmaceutically acceptable formulation.
  • the method further comprises administering an additional anti-cancer agent.
  • the additional anti-cancer agent may be a chemotherapeutic agent, an immune checkpoint inhibitor, CAR-T cells, or a tumor vaccine.
  • the immune checkpoint inhibitor may be an anti-PD-1 antibody, an anti-PDLl antibody, an anti-CTLA4 antibody, or an anti-LAG3 antibody.
  • the subject is afflicted with a refractory cancer.
  • a method of treating cancer in a subject with a tumor comprising administering to the subject: a first multispecific antigen binding molecule with an antigen binding region specific for a first target antigen) and an antigen binding region specific for a CD28 protein; and a second multispecific antigen binding molecule with an antigen binding region specific for a second target antigen and an antigen binding region specific for a CD3 protein, wherein the first target antigen is not the same antigen as the second target antigen.
  • the first and/or second target antigens are tumor associated antigens (TAAs).
  • the method further comprises determining that the tumor comprises a subset of tumor cells that do not express the first target antigen.
  • a method of treating cancer in a subject with a tumor comprising determining if the tumor comprises tumor cells that do not express a first target antigen, administering to the subject: a first multispecific antigen binding molecule with an antigen binding region specific for the first target antigen and an antigen binding region specific for a CD28 protein; and a second multispecific antigen binding molecule with an antigen binding region specific for a second target antigen and an antigen binding region specific for a CD3 protein, wherein the first target antigen is not the same antigen as the second target antigen.
  • the first and/or second target antigens are tumor associated antigens (TAAs).
  • At least a subset of the tumor cells in the tumor do not express the first target antigen. In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, or at least 80% of the tumor cells in the tumor do not express the first target antigen. In some embodiments, at least a subset of the tumor cells in the tumor do not express the second target antigen. In some embodiments, the tumor is a heterogeneous tumor comprising cells that express the first target antigen and cells that express the second target antigen. In some embodiments, the tumor cells in the tumor do not express both the first target antigen and the second target antigen.
  • the first target antigen is an antigen associated with the tumor microenvironment of the tumor, such as an antigen associated with the tumor stroma, an antigen associated with the extracellular matrix of the tumor, an antigen associated with a blood vessel in the tumor microenvironment, or an antigen associated with a cancer-associated fibroblast
  • the first target antigen is an antigen associated with the tumor stroma selected from PSA, CEA, CA-125, CA-19, COL10, FAP, B7H3, LRRC15, and fibronectin- EDB isoform.
  • the first target antigen is an antigen associated with the extracellular matrix of the tumor selected from nectin (e.g., nectin-3 or nectin-4), versican (VACN), fibronectin and a carcinoembryonic antigen-related cell adhesion molecules (CEACAM) protein.
  • nectin e.g., nectin-3 or nectin-4
  • VACN versican
  • fibronectin e.g., fibronectin and a carcinoembryonic antigen-related cell adhesion molecules (CEACAM) protein.
  • CEACAM carcinoembryonic antigen-related cell adhesion molecules
  • the tumor microenvironment of the tumor comprises cells that express the target antigen.
  • the first target antigen is an antigen expressed on the surface of a cancer-associated fibroblast (e.g., a-smooth muscle actin (a-SMA), fibroblast activation protein (FAP), S100A4, platelet-derived growth factor receptors (PDGFRot/p), vimentin, PDPN, CD70, CD10, GPR77, CD10, CD74, CD146, CAV1, Saa3-, or CD49e).
  • a cancer-associated fibroblast e.g., a-smooth muscle actin (a-SMA), fibroblast activation protein (FAP), S100A4, platelet-derived growth factor receptors (PDGFRot/p), vimentin, PDPN, CD70, CD10, GPR77, CD10, CD74, CD146, CAV1, Saa3-, or CD49e.
  • a-SMA a-smooth muscle actin
  • FAP fibroblast activation protein
  • PDGFRot/p platelet-
  • the first target antigen is an antigen expressed on the surface of a blood vessel in the tumor microenvironment, such as DLK1, EphA2, HBB, NG2, NRP1, NRP2, PDGFR , PSMA, RGS5, TEM1, VEGFR1 and VEGFR2.
  • the first target antigen is an immune antigen.
  • the immune antigen is an antigen expressed on the surface of an immune cell.
  • the immune cell may be a macrophage, a neutrophil, an eosinophil, a basophil, a mast cell, a monocyte, a dendritic cell, a natural killer cell, a T cell or a B cell.
  • the immune cell has infiltrated the tumor or tumor microenvironment of the tumor.
  • the immune antigen may be selected from any one of the immune antigens listed in Table 4. [0037] In some embodiments, at least 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%,
  • 100% of the tumor cells in the tumor do not express the first or second target antigen. In some embodiments, at least 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80%-100% or 90%-100% of the tumor cells in the tumor do not express the first and/or second target antigen.
  • the first target antigen may be selected from any one of the antigens listed in Table 2.
  • the first target antigen may be CD22.
  • the first target antigen may be a non- immune antigen.
  • the non-immune antigen may be a CD38, EGFR, MUC16, PSMA, CA9, FOLR1, HER2, or SLAMF7.
  • the first multispecific antigen binding molecule is a bispecific antibody or a bispecific antibody fragment, such as a bispecific T-engaging antibody (BiTE), a dual-affinity re-targeting molecule (DART), and a tandem diabody (TandAb).
  • the first multispecific antigen binding molecule is selected from the bispecific antibodies listed in Table 3.
  • the second target antigen is selected from any one of the antigens listed in Table 2.
  • the second target antigen may be CD20.
  • the second target antigen may be an immune antigen.
  • the immune antigen is CD22, CD20, CD72, CD19, CD21, CD24, or CD79.
  • the second multispecific antigen binding molecule may be a bispecific antibody or a bispecific antibody fragment. In some embodiments, the second multispecific antigen binding molecule is selected from the bispecific antibodies listed in Table 5.
  • the second multispecific antigen binding molecule is a bispecific antibody or a bispecific antibody fragment, such as a bispecific T-engaging antibody (BiTE), a dual-affinity re-targeting molecule (DART), and a tandem diabody (TandAb).
  • BiTE bispecific T-engaging antibody
  • DART dual-affinity re-targeting molecule
  • TandAb tandem diabody
  • the first multispecific antigen binding molecule demonstrates a costimulatory effect when administered conjointly with the second multispecific antigen binding molecule.
  • the costimulatory effect may be one or more of the following: activating T-cells, inducing IL-2 release, inducing CD25+ up-regulation in PBMCs, and increasing T-cell mediated cytotoxicity.
  • the tumor may be from a B cell cancer, such as diffuse large B-cell lymphoma (DLBCL), follicular lymphoma, chronic lymphocytic leukemia (CLL), small lymphocytic lymphoma (SLL), mantle cell lymphoma (MCL), marginal zone lymphomas, burkitt lymphoma, lymphoplasmacytic lymphoma (Waldenstrom macroglobulinemia), hairy cell leukemia, primary central nervous system (CNS) lymphoma, or primary intraocular lymphoma (lymphoma of the eye).
  • DLBCL diffuse large B-cell lymphoma
  • CLL chronic lymphocytic leukemia
  • SLL small lymphocytic lymphoma
  • MCL mantle cell lymphoma
  • marginal zone lymphomas marginal zone lymphomas
  • burkitt lymphoma lymphoplasmacytic lymphoma
  • hairy cell leukemia hairy cell leukemia
  • CNS central nervous system
  • the tumor is a solid tumor.
  • the tumor may be an adenocarcinoma, an adrenal tumor, an anal tumor, a bile duct tumor, a bladder tumor, a bone tumor, a blood born tumor, a brain/CNS tumor, a breast tumor, a cervical tumor, a colorectal tumor, an endometrial tumor, an esophageal tumor, an Ewing tumor, an eye tumor, a gallbladder tumor, a gastrointestinal, a kidney tumor, a laryngeal or hypopharyngreal tumor, a liver tumor, a lung tumor, a mesothelioma tumor, a multiple myeloma tumor, a muscle tumor, a nasopharyngeal tumor, a neuroblastoma, an oral tumor, an osteosarcoma, an ovarian tumor, a pancreatic tumor, a penile tumor, a pituitary tumor, a primary tumor, a prostate tumor
  • the first multispecific antigen binding molecule is administered systemically, intravenously, subcutaneously, or intramuscularly.
  • the second multispecific antigen binding molecule may be administered systemically, intravenously, subcutaneously, or intramuscularly.
  • the first multispecific antigen binding molecule and/or the second multispecific antigen binding molecule may be administered to the subject in a pharmaceutically acceptable formulation.
  • the method further comprises administering an additional anti-cancer agent.
  • the additional anti-cancer agent is a chemotherapeutic agent, an immune checkpoint inhibitor, CAR-T cells, or a tumor vaccine.
  • the additional anti-cancer agent is an immune checkpoint inhibitor.
  • the immune checkpoint inhibitor is an anti-PD-1 antibody, an anti-PDLl antibody, an anti-CTLA4 antibody, or an anti-LAG3 antibody.
  • the subject may be afflicted with a refractory cancer.
  • Figure lA- Figure 1C show CD28 is expressed on intratumoral CD8 T cells from r/r NHL patients both prior to and post odronextamab treatment.
  • Figure 1A shows a representative image of multiplex IHC staining (CD3, CD8, CD28, and DAPI) of a baseline DLBCL patient sample from a odronextamab phase I study.
  • Figure IB shows density of CD4+CD28+ and CD8+CD28+ cells from baseline DLBCL and FL samples.
  • N 64.
  • Figure 1C shows representative images of DLBCL patient samples from baseline (top left) and 5 weeks post the start of odronextamab treatment (top right). Density of CD8+Cd28+ and CD8+CD28+ cells from paired DLBCL and FL sample at baseline and 5 weeks on treatment.
  • Figure 2A- Figure 2H shows REGN5837 bispecific antibody enhances odronextamab mediated T cell activation, cytotoxicity, and effector function in vitro.
  • WSU-DLCL2 cells were incubated with lymphocyte-enriched human PBMC with a dose titration of odronextamab and a fixed concentration of REGN5837 (ranging from 7.72 x 10-" to 1.00 x 10’ 7 M).
  • Figure 2A shows tumor cell killing was calculated by percent dead cells.
  • Figure 2B and Figure 2D shows activation of CD4 and CD 8 T cells was represented by CD25 upregulation.
  • Figure 2C and Figure 2E shows proliferation was calculated by percent divided of CD4 and CD8 T cells.
  • Figure 2F shows supernatants were assessed for cytokine release of IL-2, IL-4, IL-6, IL-10, TNF-a, IFN-y, and IL-17A. Arrows indicate fold change of EC50 or fold change of max cytokine concentration between highest concentration of REGN5837 (1.00 x 10 -7 M) to no REGN5837.
  • FIG. 2G shows REGN5837 (R5837) augmentation of T cell killing of CD22 negative cells was determined by incubating purified human T cells with varying ratios of mixed CD22+ and CD22-WSU-DLCL2 tumor cells along with a fixed concentration of REGN5837 (ranging from 4.63 x 10’ 10 to 1.67 x 10 -8 M) and 5 pM of odronextamab. Killing of CD22+ targets is depicted in shades of red while killing of the CD22- targets is depicted in shades of blue.
  • Figure 2H shows activation of T cells in the mixed WSU-DLCL2 CD22+ and CD22-cultures was determined by upregulation of CD25.
  • Figure 3A- Figure 3F show REGN5837 enhances odronextamab antitumor efficacy and expands intratumoral CD8 T cells in a WSU-DLCL2 tumor model in a prophylactic treatment setting.
  • Figure 3A shows treatment schema for WSU-DLCL2 tumors implanted into NSG animals.
  • Figure 3B shows individual tumor volumes are plotted. Ratios indicate the number of tumor free mice.
  • Figure 3C shows average tumor growth (left) and survival (right). Statistical significance for average tumor growth was calculated with 2 way ANOVA and Tukey's multiple comparisons. Statistical significance for survival was calculated using the Kaplan-Meier method with log-rank test. *P ⁇ 0.05, "P ⁇ 0.01, ***P ⁇ 0.001.
  • WSU-DLCL2 tumor bearing animals were sacrificed 26 days post implantation to immunophenotype intratumoral T cell responses.
  • UMAP plot of all live cells from the tumor was overlaid with color-coded immune cell subsets identified by FlowSOM (Figure 3D left) and density UMAP plots (Figure 3D right) revealed skewing of certain populations in response to combination treatment.
  • Figure 3E shows density of WSU-DLCL2 cells (left) and density of intratumoral CD8+ T cells (right).
  • Figure 3F shows pie charts depicting proportions of activated and memory subsets for intratumoral CD8 T cells in response to treatment (left). Density of effector memory and central memory intratumoral CD8+ T cells (right). Statistics were calculated with 1 way ANOVA with Tukey's test. ***P ⁇ 0.001, ****P ⁇ 0.0001
  • Figure 4A- Figure 4F show REGN5837 mediated co- stimulation enhances odronextamab anti-tumor efficacy against B cells malignancies in a therapeutic treatment setting.
  • Figure 4A shows treatment schema for therapeutic treatment of WSU-DLCL2 tumors implanted into NSG animals.
  • Figure 4B shows individual tumor volumes are plotted. Ratios indicate the number of tumor free mice.
  • Figure 4C shows average tumor growth (left) and Survival (right). Statistical significance for average tumor growth was calculated with 2 way ANOVA and Tukey's multiple comparisons. Statistical significance for survival was calculated using the Kaplan-Meier method with log-rank test. *P ⁇ 0.05, **P ⁇ 0.01.
  • Figure 4D shows treatment schema for therapeutic treatment of NALM6-luc tumors implanted into PBMC engrafted NSG animals.
  • Figure 4E shows BLI showing tumor burden in individual mice.
  • Figure 4F shows average NALM6-luc tumor growth. Significance was calculated with 2way ANOVA and Tukey's multiple comparisons. *P ⁇ 0.05, ***P ⁇ 0.001.
  • Figure 5A- Figure 5J shows a combination of REGN5837 with odronextamab enhances peripheral and intratumoral T cell responses in human immune system reconstituted animals bearing WSU-DLCL2 tumors.
  • Figure 5 A shows treatment schema for WSU-DLCL2 tumors implanted into human immune system reconstituted animals.
  • Figure 5B shows individual tumor volumes are plotted.
  • Figure 5C shows average tumor growth (left) and survival (right).
  • Statistical significance for average tumor growth was calculated with 2 way ANOVA and Tukey's multiple comparisons.
  • Statistical significance for survival was calculated using the Kaplan-Meier method with log-rank test. *P ⁇ 0.05, "P ⁇ 0.01.
  • Figure 5D shows time course of peripheral CD8 T cell counts (left) and peripheral B cell counts (right) in response to treatment.
  • Figure 5E shows time course of serum cytokines induced in response to treatment.
  • WSU-DLCL2 tumor bearing human immune system animals were sacrificed 30 days post implantation to immunophenotype intratumoral T cell responses.
  • UMAP plot of all live cells from the blood, spleen, and tumor was overlaid with color-coded immune cell subsets identified by FlowSOM (Figure 5F left) and density UMAP plots (Figure 5F right) revealed skewing of certain populations in response to combination treatment.
  • Figure 5G shows density of intratumoral CD4 T cells (top right), CD8 T cells (top left), and WSU-DLCL2 cells (bottom).
  • FIG. 5H shows UMAP plot of all intratumoral T cells was overlaid with color-coded metaclusters identified by FlowSOM (left) and density UMAP plots (right) revealed skewing of certain metaclusters.
  • Figure 51 shows a heat map of T cell activation, memory, dysfunction markers used by FlowSOM to identify T cell metaclusters.
  • Figure 5J shows frequencies of selected T cell clusters that are enriched or decreased in response to combination treatment. Statistics were calculated with 1 way ANOVA with Tukey's test. *P ⁇ 0.05, "P ⁇ 0.01, ****P ⁇ 0.0001.
  • Figure 6A- Figure 6D show synergistic activation of CD8 T cells in the peripheral blood of cynomolgus monkeys when REGN5837 is combined with odronextamab. Cynomolgus monkeys received a single dose of REGN5837 at either 1 or 10 mg/kg (indicated in parentheses) in combination with a dose titration of Odronextamab. Blood was collected at the indicated times after dose (hours).
  • Figure 6A shows B cell counts at 5 hrs post dosing (left) and for duration of experiment (right).
  • Figure 6B shows peripheral CD8+ T cell counts at 5 hrs post dosing (left) and for the duration of the experiment (right).
  • Figure 6C shows ICOS upregulation on peripheral CD8+ T cells at 5 hrs post dosing (left) and proliferation (right) at 4 days post dosing.
  • Figure 7A- Figure 7C shows expression of CD22 expression is variable on resected DLBCL patient samples.
  • Figure 7A shows chromogenic immunohistochemical staining for CD20 and CD22 on resected treatment naive DLBCL patient samples.
  • Figure 7B shows representative images of DLBCL patient samples with high (top) and low (bottom) % of CD22 expression from multiplex IHC staining for PAX5, CD20, and CD22.
  • Figure 7C shows percentage of B cell marker positive cells from treatment naive DLBCL patient samples.
  • Figure 8A- Figure 8B show CD28, CTLA4, CD80 and CD86 are detectable DLBCL patient samples by chromogenic IHC.
  • Figure 8A shows representative images of chromogenic staining for CD28, CTLA4, CD80, and CD86 on treatment naive resected DLBCL patient samples (Tristar).
  • Figure 8B shows density of CD28', CTLA4', CD86', and CD80' cells from 25 DLBCL patient samples.
  • Figure 9A- Figure 9D show REGN5837 bispecific antibody potentiates odronextamab mediated T cell cytotoxicity and proliferation.
  • Figure 9A shows REGN5837, non-targeted control antibodies, or a CD28 superagonist (REGN2329) were anchored to assay plates using the wet-coating method. Human PBMCs were incubated in the antibody coated assay plates and cytokine release measured after 50-54 hours. Data shown are from 4 individual donors. Cytokines for which a significant release response is observed compared with the non-binding control group are indicated (Tukey's post hoc test).
  • Figure 9B shows a number of CD22 (left) and CD20 (right) epitopes per cell on the WSU-DLCL2 cell line reported as antibody binding capacity.
  • Figure 9C shows a summary of REGN5837 mediated human CD4 and CD8 T cell proliferation in the presence or absence of odronextamab when cultured with NALM-6 or Raji CD80/CD86 DKO cells. NC, not calculated.
  • Figure 9D shows CD22 (left) and CD20 (right) expression by flow cytometry on WSU-DLCL2 CD22 ko (red) and WSU-DLCL2 CD22wt (green) lines.
  • Figure lOA- Figure 10D show odronextamab monotherapy treatment suppresses tumor growth but does not mediate complete tumor rejection in a WSU- DLBCL (DLBCL) tumor model.
  • Figure 10A shows treatment schema for WSU-DLCL2 tumors implanted into NSG animals.
  • Figure 10B shows individual tumor growth curves in response to dose titration of odronextamab.
  • Figure 10C shows average tumor growth and Figure 10D shows survival. Statistical significance for survival was calculated using the Kaplan-Meier method with log-rank test between isotype treatment and R1979 titration. ***P ⁇ 0.001, ****P ⁇ 0.0001.
  • Figure llA- Figure HE show REGN5837 in combination with odronextamab promotes intratumoral T cell expansion and activation and the killing of WSU-DLBCL2 tumor cells in vivo.
  • Figure 11 A shows treatment schema for immunophenotyping of WSU-DLCL2 tumors in NSG mice at 26 days post implantation.
  • Figure 11B shows tumor mass plotted for each treatment group at 26 days post implantation.
  • Figure 11C shows the percentage of indicated cell population from total live cells demonstrating an expansion of CD4 and CD8 T cells and a skewing away from WSU-DLCL2 cells.
  • Figure 1 ID shows the density of intratumoral CD4 T cells plotted.
  • Figure HE shows percentage of memory subsets plotted for intratumoral CD4 T cells. Statistics were calculated with 1 way ANOVA with Tukey's test. *P ⁇ 0.05, **P ⁇ 0.01, ***P ⁇ 0.001, ****P ⁇ 0.0001.
  • Figure 12A- Figure 12B show REGN5837 augments IL-2 production and enhancement of T cell proliferation in the presence of signal 1 mediated by an allogenic response of by odronextamab.
  • the capacity of REGN5837 to mediate IL-2 release and T- cell proliferation in the presence of a human B-cell leukemia cell line was determined using enriched human primary T cells and allogeneic NALM-6 cells.
  • Figure 12A shows assays were performed in the presence of odronextamab (500 pM) to provide signal 1, or in the absence of odronextamab where signal 1 was provided solely by the allogeneic response and a dose titration of REGN5837 or a non-binding CD28 bispecific control antibody.
  • FIG. 12B shows a summary of REGN5837 mediated concentration-dependent increases in IL-2 release and T-cell proliferation in the presence and absence of odronextamab.
  • Figure 13A- Figure 13H show that a combination of REGN5837 with odronextamab expands peripheral and intratumoral T cells in human immune system reconstituted animals bearing DLBCL tumors.
  • Figure 13A shows a time course of peripheral CD4 T cell counts.
  • Figure 13B shows a time course of serum IL- 10 induced in response to treatment.
  • Figure 13C shows average WSU-DLCL2 tumor growth prior to sacrifice for immunophenotyping. Statistical significance was calculated with 2 way ANOVA and Tukey's multiple comparisons between combination treatment and isotype (black stars) or combination treatment and REGN5837 monotherapy (red stars).
  • Figure 13D shows a percentage of WSU-DLCL2 cells (left) and T cells (right) from all live intratumoral cells.
  • Figure 13E and Figure 13F shows the percentage of memory and activated subsets of intratumoral CD8 (Figure 13E) and CD4 (Figure 13F) T cells.
  • Figure 13G and Figure 13H show the intratumoral density of memory CD8 ( Figure 13G) and CD4 ( Figure 13H) T cells.
  • Statistics were calculated with 1 way ANOVA with Tukey's test. *P ⁇ 0.05, **P ⁇ 0.01, ***l) ⁇ 0.001, ****P ⁇ 0.0001.
  • Figure 14A- Figure 14E show odronextamab efficiently depletes splenic and blood B cells while promoting effector memory T cell induction in human immune system reconstituted animals bearing DEBCE tumors.
  • Figure 14A and Figure 14B show a percentage of B cells (left) and T cells (right) from spleen ( Figure 14 A) or blood ( Figure 14B) at 30 days post implantation of WSU-DLCL2 tumors.
  • Figure 14C shows enumeration of B and T cells subsets in the spleen.
  • Figure 14D shows density UMAP plots (right) of all live cells in the blood.
  • Figure 14E shows enumeration of B and T cells subsets in the blood.
  • Figure 15A- Figure 15B show synergistic activation of CD4 T cells in peripheral blood of cynomolgus monkeys when REGN5837 is combined with odronextamab.
  • Figure 15A shows peripheral CD4 T cell counts at 4 days post dosing (left) and for the duration of the experiment.
  • Figure 15B shows ICOS upregulation on peripheral CD4 T cells at 5 hours post dosing (left) and proliferation (right) at 4 days post dosing.
  • Figure 16 shows CD22 expression is more variable than CD20 expression in DLBCL patient samples.
  • Figure 17 shows that, in a mixed culture of CD22wt and CD22ko tumor cells, CD22xCD28 combined with CD20xCD3 can mediate enhanced T cell killing of bystander CD22ko target cells.
  • Figure 18 shows an exemplary expression profile for EGFR target antigen in several cancers.
  • Figure 19 shows an exemplary expression profile for PMSA target antigen in several cancers.
  • Figure 20 shows an exemplary expression profile for CA9 target antigen in several cancers.
  • Figure 21 shows an exemplary expression profile for HER2 target antigen in several cancers.
  • Figure 22 shows an exemplary expression profile for SLAMF7 target antigen in several cancers.
  • Figure 23 shows an exemplary expression profile for MUC16 target antigen in several cancers.
  • Figure 24 shows an exemplary expression profile for FOLR1 target antigen in sever cancers.
  • Figure 25 shows an exemplary expression profile for CD38 target antigen in several cancers.
  • Figure 26 shows an exemplary expression profile for CD22 target antigen in several cancers.
  • culturing T cells with target cells expressing CD22 + and an anti-CD28/anti-CD22 bispecific antibody augmented CD3 bispecific -mediated tumor cell lysis.
  • the disclosure herein is based, in part, on the discovery that combination treatment with anti-CD28/anti-CD22 bispecific antibody increased CD3 bispecific- mediated tumor cell lysis of both the CD22 + and CD22- target populations. Similar methods also increased CD4 and CD8 T cell activation in both the CD22 + and CD22- target populations. Therefore, Applicant shows that anti-CD28 bispecific antibodies targeting a tumor associated antigen can increase killing of tumor cells lacking the tumor associated antigen.
  • compositions for mediating killing of a tumor cell in a tumor in a subject by administering to the subject a multispecific antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein, wherein the tumor cell does not express or is not predicted to express the target antigen.
  • the tumor cell does not express or is not predicted to express the target antigen.
  • at least a subset of tumor cells in the tumor do not express the target antigen.
  • kits for inducing killing of tumor cells and/or inducing T cell activation against tumor cells in a tumor in a subject comprising administering to the subject a multispecific antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein.
  • a multispecific antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein.
  • at least a subset of tumor cells in the tumor do not express the target antigen.
  • Also provided herein are methods and compositions for treating cancer in a subject with a tumor the method comprising administering to the subject a multispecific antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein.
  • a multispecific antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein.
  • at least a subset of tumor cells in the tumor do not express the target antigen.
  • the phrase when referring to tumor cells in the tumor that “do not express the target antigen”, the phrase includes experimental detection or confirmation that at least a subset of tumor cells do not express the target antigen, as well as methods involved predicting (i.e., with or without further experimental confirmation) that the tumor cells do not express the target antigen.
  • the target antigen is a tumor associated antigen (TAA).
  • TAA tumor associated antigen
  • the target antigen is an antigen associated with a tumor microenvironment (e.g., the microenvironment of the tumor in the subject).
  • the target antigen is an antigen on an immune cell, on tumor cell stroma, or on the extracellular matrix within the tumor microenvironment.
  • extracellular matrix antigens include nectin (e.g., nectin-3 or nectin-4), versican (VACN), fibronectin and carcinoembryonic antigen-related cell adhesion molecules (CEACAM).
  • administering means providing a pharmaceutical agent or composition to a subject, and includes, but is not limited to, administering by a medical professional and self-administering.
  • Such an agent can contain, for example, a bispecific antibody or a bispecific antibody fragment provided herein.
  • antibody may refer to both an intact antibody and an antigen binding fragment thereof. Intact antibodies are glycoproteins that include at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds. Each heavy chain includes a heavy chain variable region (abbreviated herein as Vn) and a heavy chain constant region.
  • Vn heavy chain variable region
  • Each light chain includes a light chain variable region (abbreviated herein as VL) and a light chain constant region.
  • VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
  • CDR complementarity determining regions
  • FR framework regions
  • Each Vn and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
  • the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
  • antibody includes, for example, monoclonal antibodies, polyclonal antibodies, chimeric antibodies, humanized antibodies, human antibodies, multispecific antibodies (e.g., bispecific antibodies, trispecific antibodies), single-chain antibodies and antigen-binding antibody fragments.
  • antigen binding fragment and “antigen-binding portion” of an antibody, as used herein, refer to one or more fragments of an antibody that retain the ability to bind to an antigen.
  • Non-limiting examples of antigen-binding fragments include: (i) Fab fragments; (ii) F(ab')2 fragments; (iii) Fd fragments; (iv) Fv fragments; (v) single-chain Fv (scFv) molecules; (vi) dAb fragments; and (vii) minimal recognition units consisting of the amino acid residues that mimic the hypervariable region of an antibody (e.g., an isolated complementarity determining region (CDR) such as a CDR3 peptide), or a constrained FR3-CDR3-FR4 peptide.
  • CDR complementarity determining region
  • engineered molecules such as domain-specific antibodies, single domain antibodies, domain-deleted antibodies, chimeric antibodies, CDR-grafted antibodies, diabodies, triabodies, tetrabodies, minibodies, nanobodies (e.g. monovalent nanobodies, bivalent nanobodies, etc.), small modular immunopharmaceuticals (SMIPs), and shark variable IgNAR domains, are also encompassed within the expression “antigen-binding fragment,” as used herein.
  • SMIPs small modular immunopharmaceuticals
  • antibody can include (unless otherwise stated or clear from context) any art-known constructs or formats utilizing antibody structural and/or functional features including without limitation intrabodies, domain antibodies, antibody mimetics, Zybodies®, Fab fragments, Fab’ fragments, F(ab’)2 fragments, Fd’ fragments, Fd fragments, isolated CDRs or sets thereof, single chain antibodies, singlechain Fvs (scFvs), disulfide-linked Fvs (sdFv), polypeptide-Fc fusions, single domain antibodies (e.g., shark single domain antibodies such as IgNAR or fragments thereof), cameloid antibodies, camelized antibodies, masked antibodies (e.g., Probodies®), affybodies, anti-idiotypic (anti-Id) antibodies (including, e.g., anti-anti-Id antibodies), Small Modular ImmunoPharmaceuticals (“SMIPsTM”), single chain or Tandem diabodies (TandAb
  • An antibody for use in the instant invention may be a bispecific antibody.
  • a bispecific antibody has binding sites for two different antigens within a single antibody polypeptide. Antigen binding may be simultaneous or sequential.
  • Triomas and hybrid hybridomas are two examples of cell lines that can secrete bispecific antibodies.
  • bispecific antibodies produced by a hybrid hybridoma or a trioma are disclosed in U.S. Patent 4,474,893.
  • Bispecific antibodies have been constructed by chemical means (Staerz et al. (1985) Nature 314:628, and Perez et al. (1985) Nature 316:354) and hybridoma technology (Staerz and Bevan (1986) Proc. Natl. Acad. Sci. USA, 83:1453, and Staerz and Bevan (1986) Immunol. Today 7:241).
  • Bispecific antibodies are also described in U.S. Patent 5,959,084. Fragments of bispecific antibodies are described in U.S. Patent 5,798,229.
  • Bispecific agents can also be generated by making heterohybridomas by fusing hybridomas or other cells making different antibodies, followed by identification of clones producing and co-assembling both antibodies. They can also be generated by chemical or genetic conjugation of complete immunoglobulin chains or portions thereof such as Fab and Fv sequences.
  • Antibodies may also be “humanized,” which is intended to include antibodies made by a non-human cell having variable and constant regions which have been altered to more closely resemble antibodies that would be made by a human cell. For example, by altering the non-human antibody amino acid sequence to incorporate amino acids found in human germline immunoglobulin sequences.
  • the humanized antibodies of the disclosure may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g. , mutations introduced by random or sitespecific mutagenesis in vitro or by somatic mutation in vivo), for example in the CDRs.
  • the term “humanized antibody”, as used herein, also includes antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
  • a “cancer-associated fibroblasts” include fibroblasts found within and surrounding tumor tissues, which are activated from normal resident tissue fibroblasts or transdifferentiated from non-fibroblastic lineage such as epithelial cells and adipocytes due to the stimulation of tumor microenvironment.
  • Exemplary cancer associated fibroblast antigens include a-smooth muscle actin (a-SMA), fibroblast activation protein (FAP), S100A4, platelet-derived growth factor receptors (PDGFRot/p), vimentin, PDPN, CD70, CdlO, GPR77, CD10, CD74, CD146, CAV1, Saa3-., and CD49e. More details regarding antigens and biomarkers can be found in Han, C., Eiu, T. & Yin, R. Biomarkers for cancer-associated fibroblasts. Biomark Res 8, 64 (2020).
  • carcinomas which are cancers of the epithelial tissue (e.g., skin, squamous cells); sarcomas which are cancers of the connective tissue (e.g., bone, cartilage, fat, muscle, blood vessels, etc.); leukemias which are cancers of blood forming tissue (e.g., bone marrow tissue); lymphomas and myelomas which are cancers of immune cells; and central nervous system cancers which include cancers from brain and spinal tissue.
  • carcinomas which are cancers of the epithelial tissue (e.g., skin, squamous cells)
  • sarcomas which are cancers of the connective tissue (e.g., bone, cartilage, fat, muscle, blood vessels, etc.)
  • leukemias which are cancers of blood forming tissue (e.g., bone marrow tissue)
  • lymphomas and myelomas which are cancers of immune cells
  • central nervous system cancers which include cancers from brain and spinal tissue.
  • cancer(s) and” “neoplasm(s)” are used herein interchangeably.
  • cancer refers to all types of cancer or neoplasm or malignant tumors including leukemias, carcinomas and sarcomas, whether new or recurring. Specific examples of cancers are: carcinomas, sarcomas, myelomas, leukemias, lymphomas and mixed type tumors.
  • Non-limiting examples of cancers are new or recurring cancers of the brain, melanoma, bladder, breast, cervix, colon, head and neck, kidney, lung, non-small cell lung, mesothelioma, ovary, prostate, sarcoma, stomach, uterus and medulloblastoma.
  • the cancer comprises a solid tumor.
  • the cancer comprises a metastasis.
  • CAR chimeric antigen receptor
  • a desired antigen e.g., a tumor antigen
  • T cell receptor- activating intracellular domain e.g., a T cell receptor-activating intracellular domain
  • scFv extracellular single chain antigen-binding domain fused to the intracellular signaling domain of the T cell antigen receptor complex zeta chain, and have the ability, when expressed in T cells, to redirect antigen recognition based on the monoclonal antibody's specificity.
  • the phrase “conjoint administration” or “administered conjointly” refers to any form of administration of two or more different therapeutic agents such that the second agent is administered while the previously administered therapeutic agent is still effective in the body (e.g., the two agents are simultaneously effective in the subject, which may include synergistic effects of the two agents).
  • the different therapeutic agents can be administered either in the same formulation or in separate formulations, either concomitantly or sequentially.
  • the different therapeutic agents can be administered within about one hour, about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, or about a week of one another.
  • a subject who receives such treatment can benefit from a combined effect of different therapeutic agents.
  • costimulatory domain refers to the cognate binding partner on a T-cell that specifically binds with a costimulatory ligand, thereby mediating a costimulatory response by the cell, such as, but not limited to proliferation.
  • the costimulatory domain may be a human costimulatory domain.
  • Exemplary costimulatory molecules include, CD28, 4-1BB, CD27, CD8, 4-1BB (CD137), 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, and B7-H3.
  • costimulatory ligand refers to a molecule on an antigen presenting cell that specifically binds a cognate costimulatory molecule on a T-cell, thereby providing a signal which mediates a T cell response, including, but not limited to, proliferation activation, differentiation and the like.
  • a costimulatory ligand can include but is not limited to CD7, B7-1 (CD80), B7-2 (CD86), PD-L1, PD-L2, 4-1BBL, OX40L, inducible costimulatory ligand (ICOS-L), intercellular adhesion molecule (ICAM), CD30L, CD40, CD70, CD83, HLA-G, MICA, M1CB, HVEM, lymphotoxin beta receptor, 3/TR6, ILT3, ILT4, an agonist or antibody that binds Toll ligand receptor and a ligand that specifically binds with B7-H3.
  • a “costimulatory signal” refers to a signal, which in combination with a primary signal, leads to T cell proliferation and/or upregulation or downregulation of key molecules.
  • epitope refers to an antigenic determinant that interacts with a specific antigen binding site in the variable region of an antibody molecule known as a paratope.
  • a single antigen may have more than one epitope.
  • different antibodies may bind to different areas on an antigen and may have different biological effects.
  • Epitopes may be either conformational or linear.
  • a conformational epitope is produced by spatially juxtaposed amino acids from different segments of the linear polypeptide chain.
  • a linear epitope is one produced by adjacent amino acid residues in a polypeptide chain.
  • an epitope may include moieties of saccharides, phosphoryl groups, or sulfonyl groups on the antigen.
  • immune cell includes any white blood cell that developed from stem cells in bone marrow. Examples include macrophages, neutrophils, eosinophils, basophils, mast cells, monocytes, dendritic cells, natural killer cells, T cells or B cells. Immune cells can be present in the tumor or tumor microenvironment.
  • the phrase “pharmaceutically acceptable” refers to those agents, compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • the phrase “pharmaceutically-acceptable carrier” means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting an agent from one organ, or portion of the body, to another organ, or portion of the body.
  • a pharmaceutically-acceptable material such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting an agent from one organ, or portion of the body, to another organ, or portion of the body.
  • Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient.
  • materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as com starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydro
  • a therapeutic that “prevents” a condition refers to a compound that, when administered to a statistical sample prior to the onset of the disorder or condition, reduces the occurrence of the disorder or condition in the treated sample relative to an untreated control sample, or delays the onset or reduces the severity of one or more symptoms of the disorder or condition relative to the untreated control sample.
  • nucleic acid or fragment thereof indicates that, when optimally aligned with appropriate nucleotide insertions or deletions with another nucleic acid (or its complementary strand), there is nucleotide sequence identity in at least about 95%, and more preferably at least about 96%, 97%, 98% or 99% of the nucleotide bases, as measured by any well-known algorithm of sequence identity, such as FASTA, BLAST or Gap, as discussed below.
  • a nucleic acid molecule having substantial identity to a reference nucleic acid molecule may, in certain instances, encode a polypeptide having the same or substantially similar amino acid sequence as the polypeptide encoded by the reference nucleic acid molecule.
  • the term “substantial similarity” or “substantially similar” means that two peptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT using default gap weights, share at least 95% sequence identity, even more preferably at least 98% or 99% sequence identity.
  • residue positions which are not identical differ by conservative amino acid substitutions.
  • a "conservative amino acid substitution” is one in which an amino acid residue is substituted by another amino acid residue having a side chain (R group) with similar chemical properties (e.g., charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change the functional properties of a protein.
  • the percent sequence identity or degree of similarity may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well-known to those of skill in the art. See, e.g., Pearson (1994) Methods Mol. Biol. 24: 307-331, herein incorporated by reference.
  • Examples of groups of amino acids that have side chains with similar chemical properties include (1) aliphatic side chains: glycine, alanine, valine, leucine and isoleucine; (2) aliphatic- hydroxyl side chains: serine and threonine; (3) amide-containing side chains: asparagine and glutamine; (4) aromatic side chains: phenylalanine, tyrosine, and tryptophan; (5) basic side chains: lysine, arginine, and histidine; (6) acidic side chains: aspartate and glutamate, and (7) sulfur-containing side chains are cysteine and methionine.
  • Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine-valine, glutamate-aspartate, and asparagine-glutamine.
  • a conservative replacement is any change having a positive value in the PAM250 log-likelihood matrix disclosed in Gonnet et al. (1992) Science 256: 1443-1445, herein incorporated by reference.
  • a "moderately conservative" replacement is any change having a nonnegative value in the PAM250 log-likelihood matrix.
  • a specified ligand or antibody when referring to a polypeptide refers to a binding reaction which is determinative of the presence of the protein or polypeptide or receptor in a heterogeneous population of proteins and other biologies.
  • a specified ligand or antibody under designated conditions (e.g. immunoassay conditions in the case of an antibody), a specified ligand or antibody “specifically binds” to its particular “target” (e.g. an antibody specifically binds to an antigen) when it does not bind in a significant amount to other proteins present in the sample or to other proteins to which the ligand or antibody may come in contact in an organism.
  • a first molecule that “specifically binds” a second molecule has an affinity constant (Ka) greater than about 10 5 M -1 (e.g., 10 6 M" 1 , 10 7 M" 1 , 10 8 M” 1 , 10 9 M" 1 , 10 10 M” 1 , 10 11 M" 1 , and 10 12 M -1 or more) with that second molecule.
  • Ka affinity constant
  • a CAR specifically binds to its peptide/MHC with an affinity of at least a KD of about 10-4 M or less, and binds to the predetermined antigen/binding partner with an affinity (as expressed by KD) that is at least 10 fold less, at least 100 fold less or at least 1000 fold less than its affinity for binding to a non-specific and unrelated peptide/MHC complex (e.g., one comprising a BSA peptide or a casein peptide).
  • MHC e.g., class I MHC or class II MHC
  • a CAR specifically binds to its peptide/MHC with an affinity of at least a KD of about 10-4 M or less, and binds to the predetermined antigen/binding partner with an affinity (as expressed by KD) that is at least 10 fold less, at least 100 fold less or at least 1000 fold less than its affinity for binding to a non-specific and unrelated peptide/MHC complex (e.g., one comprising
  • the term “subject” means a human or non-human animal selected for treatment or therapy. In certain embodiments provided herein the subject is a human subject. In some embodiments provided herein, the subject is a subject in need of a method provided herein, such as a subject who has cancer.
  • the “tumor microenvironment” refers to the cellular environment in which the tumor exists, and includes, for example, the stroma, interstitial fluids surrounding the tumor, surrounding blood vessels, immune cells, other cells, fibroblasts, signaling molecules, and the extracellular matrix.
  • treatment refers to clinical intervention designed to alter the natural course of the individual being treated during the course of clinical pathology. Desirable effects of treatment include decreasing the rate of progression, ameliorating or palliating the pathological state, and remission or improved prognosis of a particular disease, disorder, or condition.
  • An individual is successfully “treated,” for example, if one or more symptoms associated with a particular disease, disorder, or condition are mitigated or eliminated.
  • terapéuticaally-effective amount and “effective amount” as used herein means the amount of an agent which is effective for producing the desired therapeutic effect in at least a sub-population of cells in a subject at a reasonable benefit/risk ratio applicable to any medical treatment.
  • the methods and compositions provided herein relate to the use of therapeutic antibodies (e.g., bispecific antibody disclosed herein, such as a bispecific antibody with an antigen binding region specific for a first target antigen and an antigen binding region specific for a CD28 protein, optionally administered conjointly with a second anti-CD3 bispecific antibody and/or an immune checkpoint inhibitor).
  • therapeutic antibodies e.g., bispecific antibody disclosed herein, such as a bispecific antibody with an antigen binding region specific for a first target antigen and an antigen binding region specific for a CD28 protein, optionally administered conjointly with a second anti-CD3 bispecific antibody and/or an immune checkpoint inhibitor.
  • antibody encompasses both full antibody molecules and antigen-binding fragments of full antibody molecules.
  • antigen-binding fragments include: (i) Fab fragments; (ii) F(ab')2 fragments; (iii) Fd fragments; (iv) Fv fragments; (v) single-chain Fv (scFv) molecules;
  • dAb fragments and (vii) minimal recognition units consisting of the amino acid residues that mimic the hypervariable region of an antibody (e.g., an isolated complementarity determining region (CDR) such as a CDR3 peptide), or a constrained FR3-CDR3-FR4 peptide.
  • CDR complementarity determining region
  • Other engineered molecules such as domainspecific antibodies, single domain antibodies, domain-deleted antibodies, chimeric antibodies, CDR-grafted antibodies, diabodies, triabodies, tetrabodies, minibodies, nanobodies (e.g. monovalent nanobodies, bivalent nanobodies, etc.), small modular immunopharmaceuticals (SMIPs), and shark variable IgNAR domains, are also encompassed within the expression “antigen-binding fragment,” as used herein.
  • SMIPs small modular immunopharmaceuticals
  • An antigen-binding fragment of an antibody will typically comprise at least one variable domain.
  • the variable domain may be of any size or amino acid composition and will generally comprise at least one CDR which is adjacent to or in frame with one or more framework sequences.
  • the VH and VL domains may be situated relative to one another in any suitable arrangement.
  • the variable region may be dimeric and contain VH-VH, VH-VL or VL-VL dimers.
  • the antigen-binding fragment of an antibody may contain a monomeric VH or VL domain.
  • an antigen-binding fragment of an antibody may contain at least one variable domain covalently linked to at least one constant domain.
  • variable and constant domains that may be found within an antigen-binding fragment of an antibody disclosed herein include: (i) VH-CH1; (ii) VH-CH2; (iii) VH-CH3; (iv) VH-CH1-CH2; (v) VH-CH1-CH2-CH3; (vi) VH-CH2-CH3; (vii) VH-CL; (viii) VL-CH1; (ix) VL-CH2; (x) VL-CH3; (xi) VL-CH1- CH2; (xii) VL-CH1-CH2-CH3; (xiii) VL-CH2-CH3; and (xiv) VL-CL.
  • variable and constant domains may be either directly linked to one another or may be linked by a full or partial hinge or linker region.
  • a hinge region may consist of at least 2 (e.g., 5, 10, 15, 20, 40, 60 or more) amino acids which result in a flexible or semi-flexible linkage between adjacent variable and/or constant domains in a single polypeptide molecule.
  • an antigen-binding fragment of an antibody antibody disclosed herein may comprise a homo-dimer or hetero-dimer (or other multimer) of any of the variable and constant domain configurations listed above in non- co valent association with one another and/or with one or more monomeric VH or VL domain (e.g., by disulfide bond(s)).
  • antigen-binding fragments may be monospecific or multispecific (e.g., bispecific or trispecific).
  • a multispecific antigenbinding fragment of an antibody will typically comprise at least two different variable domains, wherein each variable domain is capable of specifically binding to a separate antigen or to a different epitope on the same antigen.
  • Any multispecific antibody format, including the exemplary bispecific antibody formats disclosed herein may be adapted for use in the context of an antigen-binding fragment of an antibody disclosed herein using routine techniques available in the art.
  • At least one variable domain of a multispecific antibody is capable of specifically binding to a T cell co-stimulatory domain, such as CD28. In certain embodiments provided herein, at least one variable domain of a multispecific antibody disclosed herein is capable of specifically binding to CD3.
  • the antibodies provided herein may function through complement-dependent cytotoxicity (CDC) or antibody-dependent cell-mediated cytotoxicity (ADCC).
  • CDC complement-dependent cytotoxicity
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • FcRs Fc receptors
  • NK Natural Killer
  • the constant region of an antibody is important in the ability of an antibody to fix complement and mediate cell-dependent cytotoxicity.
  • the isotype of an antibody may be selected on the basis of whether it is desirable for the antibody to mediate cytotoxicity.
  • the multispecific (e.g., bispecific or trispecific) antibodies provided herein are human antibodies.
  • the term “human antibody,” as used herein, is intended to include antibodies having variable and constant regions derived from human germline immunoglobulin sequences.
  • the human antibodies disclosed herein may include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo), for example in the CDRs and in particular CDR3.
  • the term "human antibody”, as used herein is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences.
  • the antibodies provided herein may be recombinant human antibodies.
  • the term “recombinant human antibody,” as used herein, is intended to include all human antibodies that are prepared, expressed, created or isolated by recombinant means, such as antibodies expressed using a recombinant expression vector transfected into a host cell (described further below), antibodies isolated from a recombinant, combinatorial human antibody library (described further below), antibodies isolated from an animal (e.g., a mouse) that is transgenic for human immunoglobulin genes (see e.g., Taylor et al. (1992) Nucl. Acids Res.
  • Such recombinant human antibodies have variable and constant regions derived from human germline immunoglobulin sequences. In certain embodiments, however, such recombinant human antibodies are subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo.
  • an immunoglobulin molecule comprises a stable four chain construct of approximately 150-160 kDa in which the dimers are held together by an interchain heavy chain disulfide bond.
  • the dimers are not linked via inter-chain disulfide bonds and a molecule of about 75-80 kDa is formed composed of a covalently coupled light and heavy chain (half-antibody).
  • the frequency of appearance of the second form in various intact IgG isotypes is due to, but not limited to, structural differences associated with the hinge region isotype of the antibody.
  • a single amino acid substitution in the hinge region of the human IgG4 hinge can significantly reduce the appearance of the second form (Angal et al. (1993) Molecular Immunology 30:105) to levels typically observed using a human IgGl hinge.
  • the instant disclosure encompasses antibodies having one or more mutations in the hinge, CH2 or CH3 region which may be desirable, for example, in production, to improve the yield of the desired antibody form.
  • the monospecific or multispecific (e.g., bispecific or trispecific) antibodies disclosed herein may comprise one or more amino acid substitutions, insertions and/or deletions in the framework and/or CDR regions of the heavy and light chain variable domains as compared to the corresponding germline sequences from which the antibodies were derived.
  • Such mutations can be readily ascertained by comparing the amino acid sequences disclosed herein to germline sequences available from, for example, public antibody sequence databases.
  • the present disclosure includes antibodies, and antigen-binding fragments thereof, which are derived from any of the amino acid sequences disclosed herein, wherein one or more amino acids within one or more framework and/or CDR regions are mutated to the corresponding residue(s) of the germline sequence from which the antibody was derived, or to the corresponding residue(s) of another human germline sequence, or to a conservative amino acid substitution of the corresponding germline residue(s) (such sequence changes are referred to herein collectively as "germline mutations").
  • Germline mutations A person of ordinary skill in the art, starting with the heavy and light chain variable region sequences disclosed herein, can easily produce numerous antibodies and antigen-binding fragments which comprise one or more individual germline mutations or combinations thereof.
  • all of the framework and/or CDR residues within the VH and/or VL domains are mutated back to the residues found in the original germline sequence from which the antibody was derived.
  • only certain residues are mutated back to the original germline sequence, e.g., only the mutated residues found within the first 8 amino acids of FR1 or within the last 8 amino acids of FR4, or only the mutated residues found within CDR1, CDR2 or CDR3.
  • one or more of the framework and/or CDR residue(s) are mutated to the corresponding residue(s) of a different germline sequence (i.e., a germline sequence that is different from the germline sequence from which the antibody was originally derived).
  • the antibodies disclosed herein may contain any combination of two or more germline mutations within the framework and/or CDR regions, e.g., wherein certain individual residues are mutated to the corresponding residue of a particular germline sequence while certain other residues that differ from the original germline sequence are maintained or are mutated to the corresponding residue of a different germline sequence.
  • antibodies and antigen-binding fragments that contain one or more germline mutations can be easily tested for one or more desired property such as, improved binding specificity, increased binding (e.g., as measured by cell binding titration or FACS binding) or binding affinity (e.g., KD), improved or enhanced antagonistic or agonistic biological properties (as the case may be), reduced immunogenicity, etc.
  • desired property such as, improved binding specificity, increased binding (e.g., as measured by cell binding titration or FACS binding) or binding affinity (e.g., KD), improved or enhanced antagonistic or agonistic biological properties (as the case may be), reduced immunogenicity, etc.
  • Antibodies and antigen-binding fragments obtained in this general manner are encompassed within the present disclosure.
  • the multispecific (e.g., bispecific or trispecific) antibodies provided herein comprise variants of any of the HCVR, LCVR, and/or CDR amino acid sequences disclosed herein having one or more conservative substitutions.
  • the anti-CD40 antagonist antibodies or CD3 multispecific (e.g., bispecific or trispecific) antibodies provided herein have HCVR, LCVR, and/or CDR amino acid sequences with, e.g., 10 or fewer, 8 or fewer, 6 or fewer, 4 or fewer, etc. conservative amino acid substitutions relative to any of the HCVR, LCVR, and/or CDR amino acid sequences disclosed herein.
  • antibodies and multispecific antigen-binding molecules comprising an Fc domain comprising one or more mutations which enhance or diminish antibody binding to the FcRn receptor, e.g., at acidic pH as compared to neutral pH.
  • the present disclosure includes antibodies comprising a mutation in the CH2 or a CH3 region of the Fc domain, wherein the mutation(s) increases the affinity of the Fc domain to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).
  • Such mutations may result in an increase in serum half-life of the antibody when administered to an animal.
  • Non-limiting examples of such Fc modifications include, e.g., a modification at position 250 (e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a modification at position 428 and/or 433 (e.g., H/L/R/S/P/Q or K) and/or 434 (e.g., H/F or Y); or a modification at position 250 and/or 428; or a modification at position 307 or 308 (e.g., 308F, V308F), and 434.
  • a modification at position 250 e.g., E or Q
  • 250 and 428 e.g., L or F
  • 252 e.g., L/Y/F/W or T
  • 254 e.g., S
  • the modification comprises a 428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L, 2591 (e.g., V259I), and 308F (e.g., V308F) modification; a 433K (e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and 256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L modification (e.g., T250Q and M428L); and a 307 and/or 308 modification (e.g., 308F or 308P).
  • a 428L e.g., M428L
  • 434S e.g., N434S
  • 428L, 2591 e.g., V259I
  • 308F e.g., V308F
  • 433K
  • the present disclosure includes multispecific antigen-binding molecules (e.g., anti-CD28/anti-TAA bispecific or anti-CD3/anti-TAA bispecific antibodies), comprising an Fc domain comprising one or more pairs or groups of mutations selected from the group consisting of: 250Q and 248L (e.g., T250Q and M248L); 252Y, 254T and 256E (e.g., M252Y, S254T and T256E); 428L and 434S (e.g., M428L and N434S); and 433K and 434F (e.g., H433K and N434F).
  • Fc domain comprising one or more pairs or groups of mutations selected from the group consisting of: 250Q and 248L (e.g., T250Q and M248L); 252Y, 254T and 256E (e.g., M252Y, S254T and T256E); 428L and 434S (e.g.
  • antigen-binding molecules having amino acid sequences that vary from those of the exemplary molecules disclosed herein but that retain the ability to bind the same antigen or antigens.
  • Such variant molecules may comprise one or more additions, deletions, or substitutions of amino acids when compared to parent sequence, but exhibit biological activity that is essentially equivalent to that of the described bispecific antigen-binding molecules.
  • the present disclosure includes antigen-binding molecules that are bioequivalent to any of the exemplary antigen-binding molecules set forth herein.
  • Two antigen-binding proteins, or antibodies are considered bioequivalent if, for example, they are pharmaceutical equivalents or pharmaceutical alternatives whose rate and extent of absorption do not show a significant difference when administered at the same molar dose under similar experimental conditions, either single does or multiple dose.
  • antigenbinding proteins will be considered equivalents or pharmaceutical alternatives if they are equivalent in the extent of their absorption but not in their rate of absorption and yet may be considered bioequivalent because such differences in the rate of absorption are intentional and are reflected in the labeling, are not essential to the attainment of effective body drug concentrations on, e.g., chronic use, and are considered medically insignificant for the particular drug product studied.
  • two antigen-binding proteins are bioequivalent if there are no clinically meaningful differences in their safety, purity, and potency.
  • two antigen-binding proteins are bioequivalent if a patient can be switched one or more times between the reference product and the biological product without an expected increase in the risk of adverse effects, including a clinically significant change in immunogenicity, or diminished effectiveness, as compared to continued therapy without such switching.
  • two antigen-binding proteins are bioequivalent if they both act by a common mechanism or mechanisms of action for the condition or conditions of use, to the extent that such mechanisms are known.
  • Bioequivalence may be demonstrated by in vivo and in vitro methods.
  • Bioequivalence measures include, e.g., (a) an in vivo test in humans or other mammals, in which the concentration of the antibody or its metabolites is measured in blood, plasma, serum, or other biological fluid as a function of time; (b) an in vitro test that has been correlated with and is reasonably predictive of human in vivo bioavailability data; (c) an in vivo test in humans or other mammals in which the appropriate acute pharmacological effect of the antibody (or its target) is measured as a function of time; and (d) in a well- controlled clinical trial that establishes safety, efficacy, or bioavailability or bioequivalence of an antigen-binding protein.
  • Bioequivalent variants of the exemplary bispecific antigen-binding molecules set forth herein may be constructed by, for example, making various substitutions of residues or sequences or deleting terminal or internal residues or sequences not needed for biological activity.
  • cysteine residues not essential for biological activity can be deleted or replaced with other amino acids to prevent formation of unnecessary or incorrect intramolecular disulfide bridges upon renaturation.
  • bioequivalent antigen-binding proteins may include variants of the exemplary bispecific antigen-binding molecules set forth herein comprising amino acid changes which modify the glycosylation characteristics of the molecules, e.g., mutations which eliminate or remove glycosylation.
  • binding in the context of the binding of an antibody, immunoglobulin, antibody-binding fragment, or Fc-containing protein to either, e.g., a predetermined antigen, such as a cell surface protein or fragment thereof, typically refers to an interaction or association between a minimum of two entities or molecular structures, such as an antibody- antigen interaction.
  • binding affinity typically corresponds to a KD value of about 10-7 M or less, such as about 10-8 M or less, such as about 10-9 M or less when determined by, for instance, surface plasmon resonance (SPR) technology in a BIAcore 3000 instrument using the antigen as the ligand and the antibody, Ig, antibody-binding fragment, or Fc-containing protein as the analyte (or antiligand).
  • SPR surface plasmon resonance
  • Cell -based binding strategies such as fluorescent-activated cell sorting (FACS) binding assays, are also routinely used, and FACS data correlates well with other methods such as radioligand competition binding and SPR (Benedict, CA, J Immunol Methods. 1997, 201(2):223-31; Geuijen, CA, et al. J Immunol Methods. 2005, 302(l-2):68-77).
  • the antibody or antigen-binding protein provided herein binds to the predetermined antigen or cell surface molecule (receptor) having an affinity corresponding to a KD value that is at least ten-fold lower than its affinity for binding to a non-specific antigen (e.g., BSA, casein).
  • a non-specific antigen e.g., BSA, casein
  • the affinity of an antibody corresponding to a KD value that is equal to or less than ten-fold lower than a non-specific antigen may be considered non-detectable binding, however such an antibody may be paired with a second antigen binding arm for the production of a bispecific antibody disclosed herein.
  • KD refers to the dissociation equilibrium constant of a particular antibody- antigen interaction, or the dissociation equilibrium constant of an antibody or antibody-binding fragment binding to an antigen.
  • binding affinity There is an inverse relationship between KD and binding affinity, therefore the smaller the KD value, the higher, i.e. stronger, the affinity.
  • the terms “higher affinity” or “stronger affinity” relate to a higher ability to form an interaction and therefore a smaller KD value
  • the terms “lower affinity” or “weaker affinity” relate to a lower ability to form an interaction and therefore a larger KD value.
  • a higher binding affinity (or KD) of a particular molecule e.g.
  • antibody to its interactive partner molecule (e.g. antigen X) compared to the binding affinity of the molecule (e.g. antibody) to another interactive partner molecule (e.g. antigen Y)
  • a binding ratio determined by dividing the larger KD value (lower, or weaker, affinity) by the smaller KD (higher, or stronger, affinity), for example expressed as 5-fold or 10-fold greater binding affinity, as the case may be.
  • kd (sec -1 or 1/s) refers to the dissociation rate constant of a particular antibody- antigen interaction, or the dissociation rate constant of an antibody or antibody-binding fragment. Said value is also referred to as the koff value.
  • ka (M-l x sec-1 or 1/M) refers to the association rate constant of a particular antibody- antigen interaction, or the association rate constant of an antibody or antibody-binding fragment.
  • KA (M- 1 or 1/M) refers to the association equilibrium constant of a particular antibody-antigen interaction, or the association equilibrium constant of an antibody or antibody-binding fragment.
  • the association equilibrium constant is obtained by dividing the ka by the kd.
  • EC50 refers to the half maximal effective concentration, which includes the concentration of an antibody which induces a response halfway between the baseline and maximum after a specified exposure time.
  • the EC50 essentially represents the concentration of an antibody where 50% of its maximal effect is observed.
  • the EC50 value equals the concentration of an antibody disclosed herein that gives half-maximal binding to cells expressing CD28 or tumor-associated antigen (e.g., a antigen disclosed in Table 2), as determined by e.g. a FACS binding assay.
  • a FACS binding assay e.g., a tumor-associated antigen disclosed in Table 2
  • decreased binding of CD28 multispecific antibodies can be defined as an increased EC50 antibody concentration which enables binding to the half-maximal amount of target cells.
  • the EC50 value represents the concentration of a CD28 multispecific antibody disclosed herein that elicits half-maximal depletion of target cells by T cell cytotoxic activity.
  • increased cytotoxic activity e.g. T cell-mediated tumor cell killing
  • EC50, or half maximal effective concentration value is observed with a decreased EC50, or half maximal effective concentration value.
  • Antigen-binding domains specific for particular antigens can be prepared by any antibody generating technology known in the art. Once obtained, two different antigen-binding domains, specific for two different antigens (e.g., CD28 and a human tumor antigen), can be appropriately arranged relative to one another to produce a bispecific antigen-binding molecule disclosed herein using routine methods. In certain embodiments, one or more of the individual components (e.g., heavy and light chains) of the multispecific antigen-binding molecules disclosed herein are derived from chimeric, humanized or fully human antibodies. Methods for making such antibodies are well known in the art.
  • one or more of the heavy and/or light chains of the bispecific antigen-binding molecules disclosed herein can be prepared using VELOCIMMUNETM technology.
  • VELOCIMMUNETM technology or any other human antibody generating technology
  • high affinity chimeric antibodies to a particular antigen e.g., CD28 or human tumor associated antigen
  • the antibodies are characterized and selected for desirable characteristics, including affinity, selectivity, epitope, etc.
  • the mouse constant regions are replaced with a desired human constant region to generate fully human heavy and/or light chains that can be incorporated into the bispecific antigenbinding molecules disclosed herein.
  • Genetically engineered animals may be used to make human bispecific antigen-binding molecules.
  • a genetically modified mouse can be used which is incapable of rearranging and expressing an endogenous mouse immunoglobulin light chain variable sequence, wherein the mouse expresses only one or two human light chain variable domains encoded by human immunoglobulin sequences operably linked to the mouse kappa constant gene at the endogenous mouse kappa locus.
  • Such genetically modified mice can be used to produce fully human bispecific antigen-binding molecules comprising two different heavy chains that associate with an identical light chain that comprises a variable domain derived from one of two different human light chain variable region gene segments. (See, e.g., US 2011/0195454).
  • Fully human refers to an antibody, or antigen-binding fragment or immunoglobulin domain thereof, comprising an amino acid sequence encoded by a DNA derived from a human sequence over the entire length of each polypeptide of the antibody or antigen-binding fragment or immunoglobulin domain thereof.
  • the fully human sequence is derived from a protein endogenous to a human.
  • the fully human protein or protein sequence comprises a chimeric sequence wherein each component sequence is derived from human sequence. While not being bound by any one theory, chimeric proteins or chimeric sequences are generally designed to minimize the creation of immunogenic epitopes in the junctions of component sequences, e.g. compared to any wild-type human immunoglobulin regions or domains.
  • the methods and compositions provided herein relate to CD28 antigen-binding molecules (i.e., antigen binding molecules that comprise at least one antigen binding region that binds to CD28).
  • the CD28 multispecific antigen-binding molecules provided herein further comprise an antigen binding domain that binds to a target antigen (e.g., an antigen expressed on a cancer cell, such as a tumor associated antigen (TAA)).
  • TAA tumor associated antigen
  • the provided herein are second antigen binding molecules that are CD3 multispecific antigen-binding molecules provided herein further comprise an antigen binding domain that binds to a target antigen (e.g., an antigen expressed on a cancer cell, such as a tumor associated antigen (TAA)).
  • a target antigen e.g., an antigen expressed on a cancer cell, such as a tumor associated antigen (TAA)
  • the target antigen is a tumor associated antigen (TAA).
  • TAA tumor associated antigen
  • the target antigen is an antigen associated with a tumor microenvironment (e.g., the microenvironment of the tumor in the subject).
  • the target antigen is an antigen on an immune cell, on tumor cell stroma, or on the extracellular matrix within the tumor microenvironment.
  • extracellular matrix antigens include nectin (e.g., nectin-3 or nectin-4), versican (VACN), fibronectin and carcinoembryonic antigen-related cell adhesion molecules (CEACAM).
  • multispecific antigen-binding molecule refers to a protein, polypeptide or molecular complex comprising at least a first antigenbinding region and a second antigen-binding region.
  • each antigenbinding domain within the multispecific antigen-binding molecule may comprises at least one CDR that alone, or in combination with one or more additional CDRs and/or FRs, specifically binds to a particular antigen.
  • the first antigenbinding domain specifically binds a first antigen (e.g., CD28), and the second antigenbinding domain specifically binds a second, distinct antigen (e.g., a tumor associated antigen).
  • the CD28 multispecific antigen-binding molecule is an CD28 multispecific antibody, such as a CD28 bispecific antibody.
  • the CD28 multispecific antibodies of provided herein may be, for example, bi-specific, or trispecific. Multispecific antibodies may be specific for different epitopes of one target polypeptide or may contain antigen-binding domains specific for more than one target polypeptide. See, e.g., Tutt et al., 1991, J. Immunol. 147:60-69; Kufer et al., 2004, Trends Biotechnol. 22:238-244.
  • the CD28 bispecific antibodies provided herein can be linked to or co-expressed with another functional molecule, e.g., another peptide or protein.
  • another functional molecule e.g., another peptide or protein.
  • an antibody or fragment thereof can be functionally linked (e.g., by chemical coupling, genetic fusion, noncovalent association or otherwise) to one or more other molecular entities, such as another antibody or antibody fragment to produce a bi-specific or a multispecific antibody with a second or additional binding specificity.
  • CD28 refers to an Cluster of Differentiation 28, which is one of the proteins expressed on T cells that provide co-stimulatory signals required for T cell activation and survival. T cell stimulation through CD28 in addition to the T-cell receptor (TCR) can provide a potent signal for the production of various interleukins.
  • Human CD28 comprises the amino acid sequence as set forth below.
  • CD28 means human CD28 unless specified as being from a non-human species, e.g., “mouse CD28,” “monkey CD28,” etc.
  • cell surface-expressed CD28 means one or more CD28 protein(s) that is/are expressed on the surface of a cell in vitro or in vivo, such that at least a portion of a CD28 protein is exposed to the extracellular side of the cell membrane and is accessible to an antigen-binding portion of an antibody.
  • Cell surface-expressed CD28 includes CD28 proteins contained within the context of a functional T cell receptor in the membrane of a cell.
  • a cell surface-expressed CD28 can comprise or consist of a CD28 protein expressed on the surface of a cell which normally expresses CD28 protein.
  • cell surface-expressed CD28 can comprise or consist of CD3 protein expressed on the surface of a cell that normally does not express human CD28 on its surface but has been artificially engineered to express CD28 on its surface.
  • the present disclosure includes bispecific antibodies wherein one arm of an immunoglobulin binds CD28, and the other arm of the immunoglobulin is specific for a target antigen (e.g., a tumor antigen, or “TAA”).
  • TAA tumor antigen
  • the present disclosure includes trispecific antibodies wherein a first arm of an immunoglobulin binds CD28, a second arm of the immunoglobulin is specific for a tumor antigen, and a third arm of the immunoglobulin binds an additional T cell antigen (e.g., CD3) or an additional tumor antigen.
  • the CD28 multispecific antibody may comprise any of the antibodies disclosed in US 2020/0239576.
  • the CD28- binding arm may comprise any of the HCVR/LCVR or CDR amino acid sequences as disclosed in US 2020/0239576.
  • the CD28-binding arm binds to human CD28 and induces human T cell activation.
  • the CD28- binding arm binds weakly to human CD28 and induces human T cell activation.
  • the CD28-binding arm binds weakly to human CD28 and induces tumor- associated antigen-expressing cell killing in the context of a bispecific or multispecific antibody.
  • the multispecific antibodies or antigen-binding fragments for use in the present disclosure comprise an antigen-binding arm that binds to ICOS, HVEM, CD27, 4-1BB, 0X40, DR3, GITR, CD30, SLAM, CD2, 2B4, CD226, TIM1, or TIM2 to induce T cell activation.
  • the CD28 multispecific antigen-binding molecule comprises an antigen-binding domain specific for a tumor associated antigen.
  • the tumor associated antigen is an immune tumor antigen. In certain embodiments, the tumor associated antigen is an non-immune tumor antigen.
  • the tumor associated antigen can be any one of the antigens selected from Table 2 below.
  • the tumor associated antigen is selected from AIM-2, ALDH1A1, alpha-actinin-4, alpha-fetoprotein (“AFP”), ARTCI, B-RAF, BAGE- 1, BCLX (L), BCMA, BCR-ABL fusion protein b3a2, beta-catenin, BING-4, CA-125, CALCA, carcinoembryonic antigen (“CEA”), CASP-5, CASP-8, CD20, CD274, CD45, Cdc27, CDK12, CDK4, CDKN2A, CEA, CLPP, COA-1, CPSF, CSNK1A1, CTAG1, CTAG2, cyclin DI, Cyclin-Al, dek-can fusion protein, DKK1, EFTUD2, Elongation factor 2, ENAH (hMena), Ep-CAM, EpCAM, EphA3, epithelial tumor antigen (“ETA”), ETV6-AML1 fusion protein, EZH2, FGF5, FLT3-IT
  • the tumor associated antigen can include ADAM 17, BCMA, CA-IX, CD19, CD20, CD21, CD22, CD24, CD30, CD33, CD38, CD52, CD56, CD70, CD72, CD74, CD79b, CD123, CD138, CDH3, CEA, EphA2, EpCAM, ERBB2, ENPP3, EGFR, EGFR-vIII, FLT3, FOLR1, GD-2, glypican-3, gpA33, GPNMB, GPRC5D, HER2, HER3, LMP1, LMP2A, MUC16, Mesothelin, PSMA, PSCA, RON, ROR1, ROR2, STEAP1, STEAP2, SSTR2, SSTR5, 5T4, and Trop-2.
  • the tumor antigen may be CD19, CD123, STEAP2, CD20, SSTR2, CD38, STEAP1, 5T4, ENPP3, PSMA, MUC16, GPRC5D, or BC
  • the tumor associated antigen may be an non- immune associated antigen selected from CD38, EGFR, MUC16, PSMA, CA9, FOLR1, HER2, and SLAMF7.
  • the tumor associated antigen may be an immune associated antigen selected from CD22, CD20, CD72, CD19, CD21, CD24, and CD79.
  • CD22 (Siglec 2) is a receptor expressed on the cell membranes of B cells. CD22 mediates B-cel/ B-cell interactions. It also may be involved in the localization of B-cells in lymphoid tissues. CD22 binds sialylated glycoproteins; one of which is CD45. It also preferentially binds to alpha-2, 6-linked sialic acid.
  • CD20 is a non-glycosylated phosphoprotein expressed on the cell membranes of mature B cells.
  • CD20 is considered a B cell tumor-associated antigen because it is expressed by more than 95% of B-cell non- Hodgkin lymphomas (NHLs) and other B-cell malignancies, but it is absent on precursor B-cells, dendritic cells and plasma cells.
  • the human CD20 protein has the amino acid sequence shown in SEQ ID NO: 5 of U.S. Patent Application Publication No. US 2020/0129617, the content of which is incorporated by reference herein in its entirety.
  • MUC16 refers to mucin 16.
  • MUC16 is a single transmembrane domain highly glycosylated integral membrane glycoprotein that is highly expressed in ovarian cancer.
  • the amino acid sequence of human MUC16 is set forth in SEQ ID NO: 1899 of U.S. Patent Application Publication No. US 2018/0118848A1, the content of which is incorporated by reference herein in its entirety.
  • BCMA refers to B-cell maturation antigen.
  • BCMA also known as TNFRSF17 and CD269
  • TNFRSF17 and CD269 is a cell surface protein expressed on malignant plasma cells, and plays a central role in regulating B cell maturation and differentiation into immunoglobulin-producing plasma cells.
  • the amino acid sequence of human BCMA is shown in SEQ ID NO: 115 of U.S. Patent Application Publication No. US 2020/0024356, the content of which is incorporated by reference herein in its entirety. It can also be found in GenBank accession number NP_001183.2.
  • PSMA refers to prostate-specific membrane antigen, also known as folate hydrolase 1 (FOLH1).
  • FOLH1 folate hydrolase 1
  • PSMA is an integral, non-shed membrane glycoprotein that is highly expressed in prostate epithelial cells and is a cell-surface marker for prostate cancer.
  • the amino acid sequence of human PSMA is set forth in SEQ ID NO: 7 of U.S. Patent Application Publication No. US 2020/0129617, the content of which is incorporated by reference herein in its entirety.
  • the CD28 multispecific antibody may be a bispecific CD28xCD19 antibody, a bispecific CD28xCD22 antibody, a bispecific CD28xCD20 antibody, a bispecific CD28xCD72 antibody, a bispecific CD28xCD20 antibody, a bispecific CD28xCD19 antibody, a bispecific CD28xCD21 antibody, a bispecific CD28x CD24 antibody, or a bispecific CD28xCD79 antibody.
  • the CD28 multispecific antibody may be a bispecific CD28xCD38 antibody, a bispecific CD28xEGFR antibody, a bispecific CD28xMUC16 antibody, a bispecific CD28xPSMA antibody, a bispecific CD28xCA9 antibody, a bispecific CD28xCD20 antibody, a bispecific CD28xFOLRl antibody, a bispecific CD28xHER2 antibody, and a bispecific CD28xSLAM7 antibody.
  • the mulitispecific antigen-binding molecule is a mulitispecific antibody or antigen-binding fragment thereof.
  • Each antigen-binding domain of a mulitispecific antibody comprises a heavy chain variable domain (HCVR) and a light chain variable domain (LCVR).
  • HCVR heavy chain variable domain
  • LCVR light chain variable domain
  • the CDRs of the first antigen-binding domain may be designated with the prefix "Al" and the CDRs of the second antigen-binding domain may be designated with the prefix "A2".
  • the CDRs of the first antigen-binding domain may be referred to herein as A1-HCDR1, A1-HCDR2, and A1-HCDR3; and the CDRs of the second antigen-binding domain may be referred to herein as A2-HCDR1, A2-HCDR2, and A2- HCDR3.
  • the CDRs of the first antigen-binding domain may be designated with the prefix "Al”
  • the CDRs of the second antigen-binding domain may be designated with the prefix "A2”
  • the CDRs of the third antigen-binding domain may be designated with the prefix "A3”.
  • the CDRs of the first antigen-binding domain may be referred to herein as A1-HCDR1, Al- HCDR2, and A1-HCDR3; the CDRs of the second antigen-binding domain may be referred to herein as A2-HCDR1, A2-HCDR2, and A2-HCDR3; and the CDRs of the third antigen-binding domain may be referred to herein as A3-HCDR1, A3-HCDR2, and A3-HCDR3.
  • the bispecific antigen-binding molecules discussed above or herein may be bispecific antibodies.
  • the bispecific antibody comprises a human IgG heavy chain constant region.
  • the human IgG heavy chain constant region is isotype IgGl.
  • the human IgG heavy chain constant region is isotype IgG4.
  • the bispecific antibody comprises a chimeric hinge that reduces Fey receptor binding relative to a wild-type hinge of the same isotype.
  • the CD28 multispecific antibody is any one of the multispecific antibodies in Table 3.
  • the target antigen is an antigen associated with the tumor microenvironment of the tumor.
  • an antigen associated with the tumor microenvironment includes any antigen on a cell within the stroma, the interstitial fluids surrounding the tumor, blood vessels surrounding the tumor, and the extracellular matrix. Also included are antigens associated with immune cells, other cells, fibroblasts, or signaling molecules in the tumor microenvironment.
  • the target antigen is an antigen associated with the tumor stroma selected from PSA, CEA, CA-125, CA-19, COLIO, FAP, B7H3, LRRC15, and fibronectin-EDB isoform.
  • the target antigen is an antigen associated with the extracellular matrix of the tumor selected from nectin(e.g., nectin-3 or nectin-4), versican (VACN), fibronectin and a carcinoembryonic antigen-related cell adhesion molecules (CEACAM) protein.
  • nectin e.g., nectin-3 or nectin-4
  • VACN versican
  • fibronectin e.g., fibronectin and a carcinoembryonic antigen-related cell adhesion molecules (CEACAM) protein.
  • CEACAM carcinoembryonic antigen-related cell adhesion molecules
  • the target antigen is an antigen expressed on the surface of a cancer-associated fibroblast (e.g., a-smooth muscle actin (a-SMA), fibroblast activation protein (FAP), S100A4, platelet-derived growth factor receptors (PDGFRa/p), vimentin, PDPN, CD70, CD10, GPR77, CD10, CD74, CD146, CAV1, Saa3-, or CD49e).
  • a cancer-associated fibroblast e.g., a-smooth muscle actin (a-SMA), fibroblast activation protein (FAP), S100A4, platelet-derived growth factor receptors (PDGFRa/p), vimentin, PDPN, CD70, CD10, GPR77, CD10, CD74, CD146, CAV1, Saa3-, or CD49e.
  • a-SMA a-smooth muscle actin
  • FAP fibroblast activation protein
  • PDGFRa/p platelet-derived growth factor receptor
  • the target antigen is an antigen expressed on the surface of a blood vessel in the tumor microenvironment, such as DLK1, EphA2, HBB, NG2, NRP1, NRP2, PDGFR , PSMA, RGS5, TEM1, VEGFR1 and VEGFR2.
  • the target antigen is an immune antigen.
  • the immune antigen is an antigen expressed on the surface of an immune cell.
  • the immune cell may be a macrophage, a neutrophil, an eosinophil, a basophil, a mast cell, a monocyte, a dendritic cell, a natural killer cell, a T cell or a B cell.
  • the immune cell has infiltrated the tumor or tumor microenvironment of the tumor.
  • the immune antigen may be selected from any one of the immune antigens listed in Table 4.
  • the first antigen-binding domain and the second antigen-binding domain may be directly or indirectly connected to one another to form a bispecific antigenbinding molecule disclosed herein.
  • the first antigen-binding domain and the second antigen-binding domain may each be connected to a separate multimerizing domain.
  • the association of one multimerizing domain with another multimerizing domain facilitates the association between the two antigen-binding domains, thereby forming a bispecific antigen-binding molecule.
  • a "multimerizing domain” is any macromolecule, protein, polypeptide, peptide, or amino acid that has the ability to associate with a second multimerizing domain of the same or similar structure or constitution.
  • a multimerizing domain may be a polypeptide comprising an immunoglobulin CH3 domain.
  • a non- limiting example of a multimerizing component is an Fc portion of an immunoglobulin (comprising a CH2-CH3 domain), e.g., an Fc domain of an IgG selected from the isotypes IgGl, IgG2, IgG3, and IgG4, as well as any allotype within each isotype group.
  • Bispecific antigen-binding molecules disclosed herein will typically comprise two multimerizing domains, e.g., two Fc domains that are each individually part of a separate antibody heavy chain.
  • the first and second multimerizing domains may be of the same IgG isotype such as, e.g., IgGl/IgGl, IgG2/IgG2, IgG4/IgG4.
  • the first and second multimerizing domains may be of different IgG isotypes such as, e.g., IgGl/IgG2, IgGl/IgG4, IgG2/IgG4, etc.
  • the multimerizing domain is an Fc fragment or an amino acid sequence of from 1 to about 200 amino acids in length containing at least one cysteine residue. In other embodiments, the multimerizing domain is a cysteine residue, or a short cysteine-containing peptide.
  • Other multimerizing domains include peptides or polypeptides comprising or consisting of a leucine zipper, a helix-loop motif, or a coiled- coil motif.
  • any bispecific antibody format or technology may be used to make the bispecific antigen-binding molecules disclosed herein.
  • an antibody or fragment thereof having a first antigen binding specificity can be functionally linked (e.g., by chemical coupling, genetic fusion, noncovalent association or otherwise) to one or more other molecular entities, such as another antibody or antibody fragment having a second antigen-binding specificity to produce a bispecific antigen-binding molecule.
  • bispecific formats that can be used in the methods provided herein include, without limitation, e.g., scFv-based or diabody bispecific formats, IgG-scFv fusions, dual variable domain (DVD)-Ig, Quadroma, knobs-into-holes, common light chain (e.g., common light chain with knobs-into-holes, etc.), CrossMab, CrossFab, (SEED)body, leucine zipper, Duobody, IgGl/IgG2, dual acting Fab (DAF)-IgG, and Mab2 bispecific formats (see, e.g., Klein et al. 2012, mAbs 4:6, 1-11, and references cited therein, for a review of the foregoing formats).
  • the multimerizing domains may comprise one or more amino acid changes (e.g., insertions, deletions or substitutions) as compared to the wild-type, naturally occurring version of the Fc domain.
  • the disclosure includes bispecific antigen-binding molecules comprising one or more modifications in the Fc domain that results in a modified Fc domain having a modified binding interaction (e.g., enhanced or diminished) between Fc and FcRn.
  • the bispecific antigen-binding molecule comprises a modification in a CH2 or a CH3 region, wherein the modification increases the affinity of the Fc domain to FcRn in an acidic environment (e.g., in an endosome where pH ranges from about 5.5 to about 6.0).
  • Non-limiting examples of such Fc modifications include, e.g., a modification at position 250 (e.g., E or Q); 250 and 428 (e.g., L or F); 252 (e.g., L/Y/F/W or T), 254 (e.g., S or T), and 256 (e.g., S/R/Q/E/D or T); or a modification at position 428 and/or 433 (e.g., L/R/S/P/Q or K) and/or 434 (e.g., H/F or Y); or a modification at position 250 and/or 428; or a modification at position 307 or 308 (e.g., 308F, V308F), and 434.
  • a modification at position 250 e.g., E or Q
  • 250 and 428 e.g., L or F
  • 252 e.g., L/Y/F/W or T
  • 254 e.g., S or T
  • the modification comprises a 428L (e.g., M428L) and 434S (e.g., N434S) modification; a 428L, 2591 (e.g., V259I), and 308F (e.g., V308F) modification; a 433K (e.g., H433K) and a 434 (e.g., 434Y) modification; a 252, 254, and 256 (e.g., 252Y, 254T, and 256E) modification; a 250Q and 428L modification (e.g., T250Q and M428L); and a 307 and/or 308 modification (e.g., 308F or 308P).
  • a 428L e.g., M428L
  • 434S e.g., N434S
  • 428L, 2591 e.g., V259I
  • 308F e.g., V308F
  • 433K
  • bispecific antigen-binding molecules comprising a first CH3 domain and a second Ig CH3 domain, wherein the first and second Ig CH3 domains differ from one another by at least one amino acid, and wherein at least one amino acid difference reduces binding of the bispecific antibody to Protein A as compared to a bi-specific antibody lacking the amino acid difference.
  • the first Ig CH3 domain binds Protein A and the second Ig CH3 domain contains a mutation that reduces or abolishes Protein A binding such as an H95R modification (by IMGT exon numbering; H435R by EU numbering).
  • the second CH3 may further comprise a Y96F modification (by IMGT; Y436F by EU).
  • the Fc domain may be chimeric, combining Fc sequences derived from more than one immunoglobulin isotype.
  • a chimeric Fc domain can comprise part or all of a CH2 sequence derived from a human IgGl, human IgG2 or human IgG4 CH2 region, and part or all of a CH3 sequence derived from a human IgGl, human IgG2 or human IgG4.
  • a chimeric Fc domain can also contain a chimeric hinge region.
  • a chimeric hinge may comprise an "upper hinge” sequence, derived from a human IgGl, a human IgG2 or a human IgG4 hinge region, combined with a "lower hinge” sequence, derived from a human IgGl, a human IgG2 or a human IgG4 hinge region.
  • a particular example of a chimeric Fc domain that can be included in any of the antigen-binding molecules set forth herein comprises, from N- to C-terminus: [IgG4 CHI] - [IgG4 upper hinge] - [IgG2 lower hinge] - [IgG4 CH2] - [IgG4 CH3].
  • chimeric Fc domains that can be included in any of the antigen-binding molecules disclosed herein are described in US Publication 2014/0243504, published August 28, 2014, which is herein incorporated in its entirety. Chimeric Fc domains having these general structural arrangements, and variants thereof, can have altered Fc receptor binding, which in turn affects Fc effector function.
  • the CD28 multispecific (e.g., bispecific or trispecific) antibodies disclosed herein may comprise one or more amino acid substitutions, insertions and/or deletions in the framework and/or CDR regions of the heavy and light chain variable domains as compared to the corresponding germline sequences from which the antibodies were derived. Such mutations can be readily ascertained by comparing the amino acid sequences disclosed herein to germline sequences available from, for example, public antibody sequence databases.
  • the present disclosure includes antibodies, and antigenbinding fragments thereof, which are derived from any of the amino acid sequences disclosed herein, wherein one or more amino acids within one or more framework and/or CDR regions are mutated to the corresponding residue(s) of the germline sequence from which the antibody was derived, or to the corresponding residue(s) of another human germline sequence, or to a conservative amino acid substitution of the corresponding germline residue(s) (such sequence changes are referred to herein collectively as "germline mutations").
  • Germline mutations A person of ordinary skill in the art, starting with the heavy and light chain variable region sequences disclosed herein, can easily produce numerous antibodies and antigen-binding fragments which comprise one or more individual germline mutations or combinations thereof.
  • all of the framework and/or CDR residues within the VH and/or VL domains are mutated back to the residues found in the original germline sequence from which the antibody was derived.
  • only certain residues are mutated back to the original germline sequence, e.g., only the mutated residues found within the first 8 amino acids of FR1 or within the last 8 amino acids of FR4, or only the mutated residues found within CDR1, CDR2 or CDR3.
  • one or more of the framework and/or CDR residue(s) are mutated to the corresponding residue(s) of a different germline sequence (i.e., a germline sequence that is different from the germline sequence from which the antibody was originally derived).
  • the antibodies disclosed herein may contain any combination of two or more germline mutations within the framework and/or CDR regions, e.g., wherein certain individual residues are mutated to the corresponding residue of a particular germline sequence while certain other residues that differ from the original germline sequence are maintained or are mutated to the corresponding residue of a different germline sequence.
  • antibodies and antigen-binding fragments that contain one or more germline mutations can be easily tested for one or more desired property such as, improved binding specificity, increased binding (e.g., as measured by cell binding titration or FACS binding) or binding affinity (e.g., KD), improved or enhanced antagonistic or agonistic biological properties (as the case may be), reduced immunogenicity, etc.
  • desired property such as, improved binding specificity, increased binding (e.g., as measured by cell binding titration or FACS binding) or binding affinity (e.g., KD), improved or enhanced antagonistic or agonistic biological properties (as the case may be), reduced immunogenicity, etc.
  • Antibodies and antigen-binding fragments obtained in this general manner are encompassed within the present disclosure.
  • 100% of the tumor cells in the tumor do not express the target antigen. In some embodiments, less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%,
  • a percentage range of tumor cells in the tumor do not express the target antigen, wherein the upper and lower percentage range are disclosed herein.
  • tumor antigens can be identified by direct interrogation of the tumor immunopeptidome; i.e., all endogenous peptides that are presented by MHC molecules on the cell surface. In this approach, after extraction from tumor cells, peptides are eluted from their complexes with MHC molecules and then subjected to liquid chromatography coupled with tandem mass spectrometry (LC- MS/MS).
  • LC- MS/MS tandem mass spectrometry
  • MS spectra may be compared with customized databases, which are generated by combining sequencing data from patients’ tumors with the reference protein sequences.
  • quantification of tumor antigens m a platform termed SureQuant-IsoMHC, which utilizes a series of pMHC isotopologues and internal standard-triggered targeted mass spectrometry to generate an embedded multipoint calibration curve to determine endogenous pMHC concentrations.
  • SureQuant-IsoMHC utilizes a series of pMHC isotopologues and internal standard-triggered targeted mass spectrometry to generate an embedded multipoint calibration curve to determine endogenous pMHC concentrations.
  • Stopfer LE Gajadhar AS, Patel B, Gallien S, Frederick DT, Boland GM, Sullivan RJ, White FM.
  • Absolute quantification of tumor antigens using embedded MHC-I isotopologue calibrants Proc Natl Acad Sci U S A.
  • T cell receptor(TCR)-mimetic antibodies can be used to estimate antigen copy number.
  • measurement of expression of a target antigen may be accomplished by measurement of nucleic acid expression (e.g., RNA, such as mRNA expression) in a tumor cell. Nucleic acid expression can be accomplished through nucleic acid amplification and related techniques.
  • the CD28 multispecific antibodies disclosed herein may be administered conjointly with a CD3 antibody (e.g., a CD3 multispecific antibody).
  • the CD3 multispecific antibody is any one of the CD3 multispecific antibodies listed in Table 5.
  • the present disclosure includes antibodies having the HCVR, LCVR and/or CDR amino acid sequences of the antibodies set forth herein, the anti-CD3 antibodies disclosed in WO 2014/047231 or WO 2017/053856, the bispecific anti-CD20 x anti-CD3 antibodies disclosed in WO 2014/047231, the bispecific anti-PSMA x anti-CD3 antibodies disclosed in WO 2017/023761, the bispecific anti- MUC16 x anti-CD3 antibodies disclosed in WO 2018/067331 or WO2018/058003, the bispecific anti-STEAP2 x anti-CD3 antibodies disclosed in WO 2018/058001, or the bispecific anti-BCMA x anti-CD3 antibodies disclosed in WO 2020/018820, each of which is incorporated herein by reference.
  • Additional exemplary CD3 multispecific antibodies that can be used in the compositions and methods disclosed herein include but are not limited to, e.g., bispecific CD3xCD123 antibodies disclosed in U.S. Patent No. 10,787,521B2, U.S. Patent Application Publication Nos. 2018/0222987 Al and US 2019/0241657A1, and International Application Publication Nos. WO 2016/036937A1, WO 2017/210443A1, WO 2019/050521A1, WO 2019/210147A1, WO 2019/232528A1, and WO 2020/092404 Al; bispecific CD3xSTEAP2 antibodies disclosed in International Application Publication Nos.
  • WO 2018/058001A1 bispecific CD3xCD20 antibodies disclosed in WO 2014/047231A1, WO 2015/143079A1, WO 2016/081490A1, WO 2017/112775A1, WO 2017/210485A1, WO 2018/114748A1, WO 2018/093821A8, WO 2018/223004A1, WO 2018/188612A1, WO 2019/155008A1, WO 2019/228406A1, WO 2020/088608 Al, WO 2020/156405A1, and U.S. Patent Application Publication Nos. US 2020/0199231 Al, and US 2020/0172627A1; bispecific CD3xSSTR 2 antibodies disclosed in International Application Publication No.
  • WO 2018/005706A1 bispecific CD3xCD38 antibodies disclosed in International Application Nos. WO 2015/149077A1 and WO 2020/018556A1, and U.S. Patent Application Publication Nos. US 2018/0305465A1 and US 2020/0102403 Al; bispecific CD3xSTEAPl antibodies disclosed in Olivier Nolan-Stevaux (2020) Abstract at Proceedings of the Annual Meeting of the American Association for Cancer Research 2020; bispecific CD3x5T4 antibodies disclosed in International Application Publication No. WO 2013/041687A1, U.S. Patent Application Publication Nos. US 2017/0342160A1, US 20200277397 Al; bispecific CD3xENPP3 antibodies as descried in International Application Publication No.
  • the aforementioned multispecific (e.g., bispecific or trispecific) antigen-binding molecules that specifically bind CD3 and a tumor antigen may comprise an anti-CD3 antigen-binding molecule which binds to CD3 with a weak binding affinity such as exhibiting a KD of greater than about 40 nM, as measured by an in vitro affinity binding assay.
  • the aforementioned bispecific antigen-binding molecules may comprise an anti-CD3 antigen-binding molecule which binds to CD3 and exhibits an EC50 of greater than about 100 nM, as measured by a FACS titration assay.
  • the aforementioned bispecific antigen-binding molecules may comprise an anti-CD3 antigenbinding molecule which exhibits no measurable or observable binding to CD3, as measured by an in vitro affinity binding assay or a FACS titration assay, yet retains ability to activate human PBMC cells and/or induce cytotoxic activity on tumor antigenexpressing cell lines.
  • kits for mediating killing of a tumor cell in a tumor in a subject by administering to the subject a multispecific antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein, wherein the tumor cell does not express or is not predicted to express the target antigen.
  • the tumor cell does not express or is not predicted to express the target antigen.
  • at least a subset of tumor cells in the tumor do not express the target antigen.
  • kits for inducing killing of tumor cells and/or inducing T cell activation against tumor cells in a tumor in a subject comprising administering to the subject a multispecific antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein.
  • a multispecific antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein.
  • at least a subset of tumor cells in the tumor do not express the target antigen.
  • Also provided herein are methods and compositions for treating cancer in a subject with a tumor the method comprising administering to the subject a multispecific antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein.
  • a multispecific antigen binding molecule with a first antigen binding region specific for a target antigen and a second antigen binding region specific for a CD28 protein.
  • at least a subset of tumor cells in the tumor do not express the target antigen.
  • kits for selecting a subject for cancer therapy comprising: i) determining that the subject comprises a tumor comprising tumor cells that do not express a target antigen; and ii) administering to the subject a multispecific antigen binding molecule with a first antigen binding region specific for the target antigen and a second antigen binding region specific for a CD28 protein, optionally wherein the tumor cells do not express the target antigen if the expression of the target antigen is below the level of detection or below signal to noise ratio, thereby selecting a subject for cancer therapy.
  • the multispecific antigen binding molecule is a bispecific T cell engager.
  • the multispecific antigen binding molecule is a bispecific antibody fragment, such as a bispecific T-engaging antibody (BiTE), a dual-affinity re-targeting molecule (DART), or a tandem diabody (TandAb).
  • BiTE bispecific T-engaging antibody
  • DART dual-affinity re-targeting molecule
  • TandAb tandem diabody
  • a bispecific T-cell engager (BiTE) is a small fusion protein containing two antibody binding sites.
  • DARTs are bispecific engagers that use a diabody back bone with the addition of a c-terminal disulfide bridge that improves stabilization.
  • Tandem diabodies (TandAbs) are a type of bispecific antibody fragment.
  • a tandAb is a tetravalent bispecific molecule, 2+2 antigen-binding valency, consisting of Fv domains. TandAbs are typically expressed as a monomeric subunit (single chain Diabody, scDb) with four variable domains from two parental antibodies.
  • the methods provided herein may further comprise determining that at least the subset (e.g., at least 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2%, 2.1%, 2.2%, 2.3%, 2.4%, 2.5%, 2.6%, 2.7%, 2.8%, 2.9%, 3%, 3.1%, 3.2%, 3.3%, 3.4%, 3.5%, 3.6%, 3.7%, 3.8%, 3.9%, 4%, 4.1%, 4.2%, 4.3%, 4.4%, 4.5%, 4.6%, 4.7%, 4.8%, 4.9%, 5%, 5.1%, 5.2%, 5.3%, 5.4%, 5.5%, 5.6%, 5.7%, 5.8%, 5.9%, 6%, 6.1%, 6.2%, 6.3%, 6.4%, 6.5%, 6.6%, 6.7%, 6.8%, 6.9%, 7%, 7.1%, 7.2%, 7.3%, 7.4%, 7.5%, 7.6%
  • the methods provided herein may further comprise determining that at least the subset (e.g., at least 0.1%-l%, l%-5%, l%-10%, 5%-10%, 10%-15%, 10%- 20%, 15%- 20%, 15%-25%, 20%- 25%, 25%-30%, 20%-30%, 25%-35%, 30%- 35%, 30%-40%, 35%-40%, 40%-45%, 40%-50%, 45%-50%, 50%-55%, 50%-60%, 55%- 60%, 60%-65%, 60%-70%, 65%-70%, 65%-75%, 70%-75%, 70%-80%, 75%-85%, 75%-80%, 80%-90%, 85%-90%, 85%-95%, 90%-95%, 90%-100%, or 95%-100%) of the tumor cells in the tumor or tumor microenvironment do not express the target antigen (e.g., the target antigen, the first target antigen, or the second target antigen).
  • the target antigen e.g., the target antigen, the first target antigen, or the second target
  • the present methods may be utilized with a subject whose tumor does not express the target antigen (e.g., 100% of tumor does not express or is not predicted to express the target antigen) if a portion of the cells in the tumor microenvironment do express or are predicted to express the target antigen.
  • the target antigen e.g., 100% of tumor does not express or is not predicted to express the target antigen
  • both the first target antigen and the second target antigen can be selected from an antigen listed in Table 2, the first target antigen and the second target antigen cannot be the same antigen.
  • the first or second multispecific antigen binding molecule is a bispecific T cell engager.
  • the first or second multispecific antigen binding molecule is a bispecific antibody fragment, such as a bispecific T-engaging antibody (BiTE), a dual-affinity re-targeting molecule (DART), or a tandem diabody (TandAb).
  • BiTE bispecific T-engaging antibody
  • DART dual-affinity re-targeting molecule
  • TandAb tandem diabody
  • agents disclosed herein may be used alone or conjointly administered with another type of therapeutic agent.
  • the different therapeutic agents can be administered either in the same formulation or in separate formulations, either concomitantly or sequentially.
  • the different therapeutic agents can be administered within about one hour, about 12 hours, about 24 hours, about 36 hours, about 48 hours, about 72 hours, or about a week of one another.
  • a subject who receives such treatment can benefit from a combined effect of different therapeutic agents.
  • kits comprising administering to a subject a multispecific antigen binding molecule at a dosing frequency of about four times a week, twice a week, once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every eight weeks, once every twelve weeks, or less frequently so long as a therapeutic response is achieved.
  • composition e.g., a pharmaceutical composition, containing at least one agent described herein together with a pharmaceutically acceptable carrier.
  • the composition includes a combination of multiple (e.g., two or more, three or more, four or more, or five or more) agents described herein.
  • the pharmaceutical composition is delivered locally or systemically.
  • the pharmaceutical composition may be administered locally to a tumor present in the subject or the tumor microenvironment.
  • the agent or pharmaceutical composition is administered with a second cancer therapeutic agent.
  • the agents described herein may be administered conjointly with any other cancer therapy, including immunotherapies.
  • Additional cancer therapies include immune checkpoint inhibition.
  • the immune checkpoint inhibitor inhibits an immune checkpoint protein.
  • Immune checkpoint inhibition broadly refers to inhibiting the checkpoints that cancer cells can produce to prevent or downregulate an immune response.
  • immune checkpoint proteins are CTLA-4, PD-1, VISTA, B7-H2, B7-H3, PD-L1, B7-H4, B7-H6, ICOS, HVEM, PD-L2, CD160, gp49B, PIR-B, KIR family receptors, TIM-1, TIM-3, TIM-4, LAG-3, BTLA, SIRPalpha (CD47), CD48, 2B4 (CD244), B7.1, B7.2, ILT-2, ILT-4, TIGIT, HHLA2, butyrophilins, A2aR, and combinations thereof.
  • the immune checkpoint inhibitor may be cemiplimab (REGN2810), nivolumab (BMS-936558, MDX-1106, ONO-4538), pembrolizumab (MK- 3475, SCH 900475), atezolizumab (MPDL3280A, RG7446, RO5541267), durvalumab (MEDI4736, MEDL4736), avelumab (MSB0010718C), ipilimumab (BMS-734016, IBI310, MDX-010), SHR1210, sintilimab (IBI308), spartalizumab (PDR001), tislelizumab (BGB-A317), pidilizumab, BCD- 100, toripalimab (JS001), BAY 1905254, ASP 8374, PF-06801591, AMP-224, AB122, AK105, AMG 404, BCD-100,
  • Additional cancer immunotherapies include adoptive immunotherapies such as autologous or allogenic T cell therapy or autologous or allogenic CAR T cell therapy.
  • adoptive immunotherapy is a treatment method designed to boost a patient's immune response against a tumor or cancer cells. The method involves the removal of immune cells from an individual, the forming of effector cells ex vivo, the expansion of the cells to clinically-relevant numbers and the re-infusion of the cells into the patient.
  • kits for treating cancers that include conjoint administration of an agent disclosed herein and an allogeneic or autologous CTLs expressing a T cell receptor that specifically binds to an peptide (e.g., a cancer peptide or a subject-specific peptide) presented on a class I MHC.
  • the CTLs are from a cell bank or from the subject to which the CTLs are being administered.
  • the MHC is a class I MHC.
  • the class II MHC has an a chain polypeptide that is HLA- DMA, HLA-DOA, HLA-DPA, HLA-DQA or HLA-DRA.
  • the class II MHC has a chain polypeptide that is HLA-DMB, HLA-DOB, HLA-DPB, HLA-DQB or HLA-DRB.
  • the CTLs are stored in a cell library or bank before they are administered to the subject.
  • the additional cancer therapy may be a cell therapy.
  • a cell therapy includes, for example, tumor-infiltrating lymphocytes, modified TCR lymphocytes, or modified CAR lymphocytes.
  • the methods disclosed herein also include T-cell therapy, as well as any other adoptive therapy, such as therapy with natural killer cells or macrophage therapy.
  • the cell therapy may contain unmodified cells, such as in traditional TIL therapy, or genetically modified cells.
  • the methods included herein comprise any method known in the art to achieve the targeting of cells in the cell therapy to tumor targets.
  • the cell therapy may include cells comprising chimeric antigen receptors (CARs). Single chain antibodies may be used, and CARs may also contain costimulatory domains.
  • CARs chimeric antigen receptors
  • the cell therapy comprises cells of a type selected from the group consisting of T cells, CD8 + cells, CD4 + cells, NK cells, 5-y T cells, regulatory T cells, and peripheral mononuclear cells blood.
  • TILs, T cells, CD8 + cells, CD4 + cells, NK cells, 5-y T cells, regulatory T cells, or peripheral blood mononuclear cells form cell therapy as disclosed herein.
  • the cell therapy comprises T cells.
  • tumor infiltrating lymphocytes or TIL refers to white blood cells that have left the bloodstream and migrated into the tumor.
  • Lymphocytes can be divided into three groups containing B cells, T cells, and natural killer cells.
  • the cell therapy comprises T cells that are modified with target specific chimeric antigen receptors or, in particular, selected T cell receptors.
  • T cells includes, but is not limited to, CD3 + cells, including CD4 + helper cells, CD8 + cytotoxic T cells, and y5 T cells.
  • APCs antigen presenting cells
  • the APCs are B cells, antigen presenting T-cells, dendritic cells, or artificial antigen-presenting cells (e.g., aK562 cells).
  • Dendritic cells for use in the process may be prepared by taking PBMCs from a patient sample and adhering them to plastic.
  • the monocyte population sticks and all other cells can be washed off.
  • the adherent population is then differentiated with IL-4 and GM-CSF to produce monocyte derived dendritic cells.
  • These cells may be matured by the addition of IL-ip, IL-6, PGE-1 and TNF-a (which upregulates the important co-stimulatory molecules on the surface of the dendritic cell) and are then transduced with one or more of the peptides provided herein.
  • the APC is an artificial antigen-presenting cell, such as an aK562 cell.
  • the artificial antigen-presenting cells are engineered to express CD80, CD83, 41BB-L, and/or CD86.
  • Exemplary artificial antigen-presenting cells including aK562 cells, are described U.S. Pat. Pub. No. 2003/0147869, which is hereby incorporated by reference. Exemplary methods of producing antigen presenting cells can be found in W02013088114, hereby incorporated in its entirety.
  • TIL cells are potent at killing.
  • TIL cells are effector cells differentiated in vivo in solid tumors (see, U.S. Patent No. 5,126,1 32, which describes a method for generating TIL cells for adoptive immunotherapy of cancer).
  • TIL cells may be produced, for example, by removing a tumor sample from a patient, isolating lymphocytes that were infiltrating into 10 the tumor sample, growing these TIL cells ex vivo in the presence of IL-2 and reinfusing the cells to the patient along with IL-2.
  • the additional cancer therapy may be CAR-T cell therapy.
  • Chimeric antigen receptors are molecules combining antibody-based specificity for tumor- associated surface antigens with T cell receptor- activating intracellular domains with specific anti-tumor cellular immune activity (Eshhar, 1997, Cancer Immunol Immunother 45(3-4) 131-136; Eshhar et al., 1993, Proc Natl Acad Sci USA 90(2):720-724; Brocker and Karjalainen, 1998, Adv Immunol 68:257-269).
  • Second and third generation CARs also provide appropriate costimulatory signals via CD28 and/or CD137 (4-1BB) intracellular activation motifs, which augment cytokine secretion and anti-tumor activity in a variety of solid tumor and leukemia models (Pinthus, et al, 2004, J Clin Invest 114(12): 1774-1781 ; Milone, et al., 2009, Mol Ther 17(8): 1453-1464; Sadelain, et al., 2009, Curr Opin Immunol 21(2):215- 223).
  • Chimeric Antigen Receptor (CAR) T cell therapy involves genetic modification of patient's autologous T-cells to express a CAR specific for a tumor antigen, following by ex vivo cell expansion and re-infusion back to the patient.
  • CARs are fusion proteins of a selected single-chain fragment variable from a specific monoclonal antibody and one or more T cell receptor intracellular signaling domains. This T cell genetic modification may occur either via viral-based gene transfer methods or nonviral methods, such as DNA- based transposons, CRISPR/Cas9 technology or direct transfer of in vitro transcribed- mRNA by electroporation.
  • the additional cancer therapy may be a natural killer cell therapy.
  • Natural killer (NK) cells can recognize tumor cells as targets and as such may be useful for immunotherapy of cancer (Vivier et al., 2011, Science 331:44-49; Ruggeri et al., 2002, Science 295:2097-2100; Cooley et al., 2010, Blood 116:2411-2419; Miller et al., 2005, Blood 105:3051-3057; Rubnitz et al., 2010, J Clin Oncol. 28:955-959).
  • NK cells have been used to treat patients with various forms of cancer (Vivier et al., 2011, Science 331:44-49; Caligiuri, 2008, Blood 112(3):461-469; Ruggeri et al., 2002, Science 295:2097-2100; Miller et al., 2005, Blood 105:3051-3057).
  • Methods are available that make it possible to obtain a large number of human NK cells that demonstrate a higher anti-tumor capacity than that of non-expanded NK cells (see U.S. Pat. No. 7,435,596; Imai et al., 2005, Blood 106:376-83; Fujisaki et al., 2009, Cancer Res.
  • NK cells expanded from primary peripheral blood mononucleated cells PBMCs
  • NK cells comprising a chimeric antigen receptor or other modifications.
  • the additional cancer therapy may be macrophage cell therapy.
  • the cell therapy comprises ex vzvo-grown cytotoxic macrophages.
  • Macrophages cells can recognize tumor cells as targets and as such may be useful for immunotherapy of cancer (Andreesen R, Hennemann B, Krause SW. Adoptive immunotherapy of cancer using monocyte-derived macrophages: rationale, current status, and perspectives. J Leukoc Biol. 1998 Oct;64(4):419-26). Macrophages are potent immune effector cells whose functional plasticity leads to antitumor as well as protumor function in different settings, and this plasticity has led to notable efforts to deplete or repolarize tumor-associated macrophages.
  • macrophages are adoptively transferred after, for example, ex vivo genetic modification (Anderson NR, Minutolo NG, Gill S, Klichinsky M. Macrophage-Based Approaches for Cancer Immunotherapy. Cancer Res. 2021 Mar 1 ;81(5) : 1201- 1208).
  • the cytotoxic T cells may be tumor-infiltrating lymphocytes.
  • Expanding the CTLs may comprise contacting the CTLs with antigen presenting cells (APCs) expressing a cancer-specific or tumor- specific antigen to create antigen- specific CTLs.
  • the sample comprising T-cells or the isolated CTLs is irritated prior to administration to the subject.
  • the method may further comprises contacting the CTLs with an anti-CD3 monoclonal antibody (OKT3) prior to administration to the subject.
  • the method further comprises contacting the CTLs with human interleukin (IL)-2 prior to administration to the subject.
  • An additional cancer therapy also includes any known stimulating agents of immune cells, such agents include those that induce, for example, proliferation expansion, or activation of such immune cells.
  • Exemplary stimulating methods include administration of stimulatory cytokines, such as IL-2, IL-12, IL-15, IL-18, and IL-21.
  • the subject has received a chemotherapy drug prior to administration of the agent.
  • the subject may be refractory to a chemotherapy drug.
  • Chemotherapeutic agents include alkylating agents such as thiotepa and cyclophosphamide (CytoxanTM); alkyl sulfonates such as busulfan, improsulfan and piposulfan; aziridines such as benzodopa, carboquone, meturedopa, and uredopa; emylerumines and memylamelamines including alfretamine, triemylenemelamine, triethylenephosphoramide, triethylenethiophosphoramide, and trimemylolomelamine; acetogenins (especially bullatacin and bullatacinone); a camptothecin (including synthetic analogue topotecan); bryostatin; callystatin; CC-1065 (including its adozelesin, carzelesin and bizelesin synthetic analogues);
  • chemotherapeutic agent include anti-hormonal agents that act to regulate or inhibit hormone action on tumors such as anti-estrogens and selective estrogen receptor modulators (SERMs), including, for example, tamoxifen (including NolvadexTM), raloxifene, droloxifene, 4-hydroxytamoxifen, trioxifene, keoxifene, LY117018, onapristone, and toremifene (FarestonTM); inhibitors of the enzyme aromatase, which regulates estrogen production in the adrenal glands, such as, for example, 4(5)- imidazoles, aminoglutethimide, megestrol acetate (MegaceTM), exemestane, formestane, fadrozole, vorozole (RivisorTM), letrozole (FemaraTM), and anastrozole (ArimidexTM); and anti- androgens such as flutamide, nilutamide,
  • SERMs selective
  • compositions and/or agents disclosed herein may be specially formulated for administration in solid or liquid form, including those adapted for the following: (1) oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; or (2) parenteral administration, for example, by subcutaneous, intramuscular, intravenous, intrathecal, intracerebral or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation.
  • oral administration for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue
  • parenteral administration for example, by subcutaneous, intramuscular, intravenous, intrathecal, intracer
  • Methods of preparing pharmaceutical formulations or compositions include the step of bringing into association an agent described herein with the carrier and, optionally, one or more accessory ingredients.
  • the formulations are prepared by uniformly and intimately bringing into association an agent described herein with liquid carriers, or finely divided solid carriers, or both, and then, if necessary, shaping the product.
  • compositions provided herein can be formulated with suitable carriers, excipients, and other agents that provide improved transfer, delivery, tolerance, and the like.
  • suitable carriers, excipients, and other agents that provide improved transfer, delivery, tolerance, and the like.
  • a multitude of appropriate formulations can be found in the formulary known to all pharmaceutical chemists: Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, PA.
  • formulations include, for example, powders, pastes, ointments, jellies, waxes, oils, lipids, lipid (cationic or anionic) containing vesicles (such as LIPOFECTINTM, Life Technologies, Carlsbad, CA), DNA conjugates, anhydrous absorption pastes, oil-in-water and water-in-oil emulsions, emulsions carbowax (polyethylene glycols of various molecular weights), semi-solid gels, and semi-solid mixtures containing carbowax.
  • vesicles such as LIPOFECTINTM, Life Technologies, Carlsbad, CA
  • DNA conjugates such as LIPOFECTINTM, Life Technologies, Carlsbad, CA
  • DNA conjugates such as LIPOFECTINTM, Life Technologies, Carlsbad, CA
  • DNA conjugates such as LIPOFECTINTM, Life Technologies, Carlsbad, CA
  • DNA conjugates such as LIPOFECTINTM, Life Technologies, Carlsbad, CA
  • the dose of antigen-binding molecule administered to a patient may vary depending upon the age and the size of the patient, target disease, conditions, route of administration, and the like.
  • Various delivery systems are known and can be used to administer a pharmaceutical composition provided herein, e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the mutant viruses, receptor mediated endocytosis (see, e.g., Wu et al., 1987, J. Biol. Chem. 262:4429-4432).
  • Methods of introduction include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes.
  • composition may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local.
  • epithelial or mucocutaneous linings e.g., oral mucosa, rectal and intestinal mucosa, etc.
  • Administration can be systemic or local.
  • a pharmaceutical composition provided herein can be delivered subcutaneously or intravenously with a standard needle and syringe.
  • a pen delivery device readily has applications in delivering a pharmaceutical composition disclosed herein.
  • Such a pen delivery device can be reusable or disposable.
  • a reusable pen delivery device generally utilizes a replaceable cartridge that contains a pharmaceutical composition. Once all of the pharmaceutical composition within the cartridge has been administered and the cartridge is empty, the empty cartridge can readily be discarded and replaced with a new cartridge that contains the pharmaceutical composition. The pen delivery device can then be reused.
  • a disposable pen delivery device there is no replaceable cartridge. Rather, the disposable pen delivery device comes prefilled with the pharmaceutical composition held in a reservoir within the device. Once the reservoir is emptied of the pharmaceutical composition, the entire device is discarded.
  • Numerous reusable pen and autoinjector delivery devices have applications in the subcutaneous delivery of a pharmaceutical composition disclosed herein. Examples include, but are not limited to AUTOPENTM (Owen Mumford, Inc., Woodstock, UK), DISETRONICTM pen (Disetronic Medical Systems, Bergdorf, Switzerland), HUMALOG MIX 75/25TM pen, HUMALOGTM pen, HUMALIN 70/30TM pen (Eli Lilly and Co., Indianapolis, IN), NOVOPENTM I, II and III (Novo Nordisk, Copenhagen, Denmark), NOVOPEN JUNIORTM (Novo Nordisk, Copenhagen, Denmark), BDTM pen (Becton Dickinson, Franklin Lakes, NJ), OPTIPENTM, OPTIPEN PROTM, OPTIPEN STARLETTM, and OPTICLIKTM (sanofi- aventis, Frankfurt, Germany), to name only a few.
  • Examples of disposable pen delivery devices having applications in subcutaneous delivery of a pharmaceutical composition disclosed herein include, but are not limited to the SOLOSTARTM pen (sanofi-aventis), the FLEXPENTM (Novo Nordisk), and the KWIKPENTM (Eli Lilly), the SURECLICKTM Autoinjector (Amgen, Thousand Oaks, CA), the PENLETTM (Haselmeier, Stuttgart, Germany), the EPIPEN (Dey, L.P.), and the HUMIRATM Pen (Abbott Labs, Abbott Park IL), to name only a few.
  • the pharmaceutical composition can be delivered in a controlled release system.
  • a pump may be used (see Langer, supra; Sefton, 1987, CRC Crit. Ref. Biomed. Eng. 14:201).
  • polymeric materials can be used; see, Medical Applications of Controlled Release, Langer and Wise (eds.), 1974, CRC Pres., Boca Raton, Florida.
  • a controlled release system can be placed in proximity of the composition’s target, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, 1984, in Medical Applications of Controlled Release, supra, vol. 2, pp. 115-138). Other controlled release systems are discussed in the review by Langer, 1990, Science 249:1527-1533.
  • the injectable preparations may include dosage forms for intravenous, subcutaneous, intracutaneous and intramuscular injections, drip infusions, etc. These injectable preparations may be prepared by methods publicly known. For example, the injectable preparations may be prepared, e.g., by dissolving, suspending or emulsifying the antibody or its salt described above in a sterile aqueous medium or an oily medium conventionally used for injections.
  • aqueous medium for injections there are, for example, physiological saline, an isotonic solution containing glucose and other auxiliary agents, etc., which may be used in combination with an appropriate solubilizing agent such as an alcohol (e.g., ethanol), a polyalcohol (e.g., propylene glycol, polyethylene glycol), a nonionic surfactant [e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)], etc.
  • an alcohol e.g., ethanol
  • a polyalcohol e.g., propylene glycol, polyethylene glycol
  • a nonionic surfactant e.g., polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil
  • oily medium there are employed, e.g., sesame oil, soybean oil, etc., which may be used in combination with a solubilizing agent such as benzyl benzoate, benzyl alcohol, etc.
  • a solubilizing agent such as benzyl benzoate, benzyl alcohol, etc.
  • the pharmaceutical compositions for oral or parenteral use described above are prepared into dosage forms in a unit dose suited to fit a dose of the active ingredients.
  • dosage forms in a unit dose include, for example, tablets, pills, capsules, injections (ampoules), suppositories, etc.
  • the agents described herein may be administered in multiple doses, such as initial doses, secondary doses and tertiary doses.
  • the terms “initial dose,” “secondary doses,” and “tertiary doses,” refer to the temporal sequence of administration of the antigen-binding molecule disclosed herein.
  • the “initial dose” is the dose which is administered at the beginning of the treatment regimen (also referred to as the “baseline dose”);
  • the “secondary doses” are the doses which are administered after the initial dose; and the “tertiary doses” are the doses which are administered after the secondary doses.
  • the initial, secondary, and tertiary doses may all contain the same amount of the therapeutic agents described herein, but generally may differ from one another in terms of frequency of administration. In certain embodiments, however, the amount of an antigenbinding molecule contained in the initial, secondary and/or tertiary doses varies from one another (e.g., adjusted up or down as appropriate) during the course of treatment. In certain embodiments, two or more (e.g., 2, 3, 4, or 5) doses are administered at the beginning of the treatment regimen as "loading doses" followed by subsequent doses that are administered on a less frequent basis (e.g., "maintenance doses").
  • each secondary and/or tertiary dose is administered 1 to 26 (e.g., 1, IV2, 2, 216, 3, 316, 4, 416, 5, 516, 6, 616, 7, 716, 8, 816, 9, 916, 10, 1016, 11, 1116, 12, I 2T, 13, 1316, 14, 1416, 15, 1516, 16, 1616, 17, 1716, 18, 1816, 19, 1916, 20, 2016, 21, 2116, 22, 2216, 23, 2316, 24, 2416, 25, 2516, 26, 2616, or more) weeks after the immediately preceding dose.
  • the phrase "the immediately preceding dose,” as used herein, means, in a sequence of multiple administrations, the dose of the therapeutic agents described herein which is administered to a patient prior to the administration of the very next dose in the sequence with no intervening doses.
  • the methods according to this aspect disclosed herein may comprise administering to a patient any number of secondary and/or tertiary doses of the therapeutic agents described herein.
  • a single secondary dose is administered to the patient.
  • two or more (e.g., 2, 3, 4, 5, 6, 7, 8, or more) secondary doses are administered to the patient.
  • only a single tertiary dose is administered to the patient.
  • two or more (e.g., 2, 3, 4, 5, 6, 7, 8, or more) tertiary doses are administered to the patient.
  • each secondary dose may be administered at the same frequency as the other secondary doses. For example, each secondary dose may be administered to the patient 1 to 2 weeks after the immediately preceding dose. Similarly, in embodiments involving multiple tertiary doses, each tertiary dose may be administered at the same frequency as the other tertiary doses. For example, each tertiary dose may be administered to the patient 2 to 4 weeks after the immediately preceding dose. Alternatively, the frequency at which the secondary and/or tertiary doses are administered to a patient can vary over the course of the treatment regimen. The frequency of administration may also be adjusted during the course of treatment by a physician depending on the needs of the individual patient following clinical examination.
  • the methods described herein may be used to treat any cancer, including any cancerous or pre-cancerous tumor.
  • Cancers that may be treated by methods and compositions provided herein include, but are not limited to, cancer of the bladder, blood, bone, bone marrow, brain, breast, colon, esophagus, gastrointestine, gum, head, kidney, liver, lung, nasopharynx, neck, ovary, prostate, skin, stomach, testis, tongue, or uterus.
  • the cancer may specifically be of the following histological type, though it is not limited to these: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatrix carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular carcinoma and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenocarcinoma in adenomatous polyp; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; bronchioloalveolar adenocarcinoma; papillary adenocarcinoma; chromophobe carcinoma; acid
  • Hodgkin's disease Hodgkin's lymphoma; paragranuloma; small lymphocytic malignant lymphoma; diffuse large cell malignant lymphoma; follicular malignant lymphoma; mycosis fungoides; other specified non- Hodgkin's lymphomas; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative small intestinal disease; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid sarcoma; and hairy cell leukemia.
  • compositions or methods are useful for treating a CD20-expressing cancer or tumor.
  • the compositions or methods are useful for treating a B cell malignancy, including non-Hodgkin lymphoma, Hodgkin lymphoma, chronic lymphocytic leukemia, acute lymphoblastic leukemia, small lymphocytic lymphoma, diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, marginal zone lymphoma, Waldenstrom macroglobulinemia, primary mediastinal B-cell lymphoma, lymphoblastic lymphoma, or Burkitt lymphoma.
  • the cancer is follicular lymphoma.
  • the cancer is diffuse large B-cell lymphoma (DLBCL).
  • the cancer comprises a solid tumor.
  • the tumor is an adenocarcinoma, an adrenal tumor, an anal tumor, a bile duct tumor, a bladder tumor, a bone tumor, a blood born tumor, a brain/CNS tumor, a breast tumor, a cervical tumor, a colorectal tumor, an endometrial tumor, an esophageal tumor, an Ewing tumor, an eye tumor, a gallbladder tumor, a gastrointestinal, a kidney tumor, a laryngeal or hypopharyngeal tumor, a liver tumor, a lung tumor, a mesothelioma tumor, a multiple myeloma tumor, a muscle tumor, a nasopharyngeal tumor, a neuroblastoma, an oral tumor, an osteosarcoma, an ovarian tumor, a pan
  • the tumor being treated is one that is not expected to express a particular target antigen.
  • exemplary target antigens e.g., exemplary TAAs
  • TAAs exemplary TAAs
  • TANTIGEN 2.0 (found on the World Wide Web at projects.met- hilab.org/tadb/index.php; more details can be found in Zhang, G., Chitkushev, L., Olsen, L.R. et al.
  • TANTIGEN 2.0 a knowledge base of tumor T cell antigens and epitopes.
  • BMC Bioinformatics 22, 40 (2021) the Cancer Epitope Database and Analysis Resource (CEDAR)(more details can be found in Kosaloglu-Yalcin, Z.
  • CEDAR Cancer Epitope Database and Analysis Resource
  • the tumor is not predicted to express the target antigen based on known expression profiles (e.g., expression profiles disclosed herein).
  • a tumor type is predicted not to express a target antigen if less than 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, 10.5%, 11%, 11.5%, 12%, 12.5%, 13%, 13.5%, 14%, 14.5%, 15%, 15.5%, 16%, 16.5%, 17%, 17.5%, 18%, 18.5%, 19%, 19.5%, 20%, 20.5%, 21%, 21.5%, 22%, 22.5%, 23%, 23.5%, 24%, 24.5%, 25%, 25.5%, 26%, 26.5%, 27%, 27.5%, 28%, 28.5%, 29%, 29.5%, 30%, 30.5%, 31%, 31.5%, 3
  • the exemplary expression profiles disclosed herein are informative as to the tumor types that can be treated using the methods disclosed herein, but will not be limiting to the cancer or tumor type that can be treated using the methods disclosed herein.
  • the tumor being treated may be a tumor that has been tested and does not express or contains a subset of tumor cells that do not express the target antigen, despite tumor antigen expression profiles showing the tumor type typically expresses the target antigen.
  • the target antigen is enriched in a specific tumor type, but the target antigen is not expressed in a subset of tumor cells in the specific tumor type in the patient. In some embodiments, the target antigen is typically expressed in a variety of tumor types, but the target antigen is not expressed in a subset of tumor cells in the patient.
  • Screening, diagnostic, and/or prognostic assays are also provided for identifying the levels or quantifying the amount of a tumor associated antigen on the cancer or tumor cells in a cancer in a subject.
  • at least a subset of tumor cells in the tumor do not express the target antigen.
  • the methods provided herein may further comprise determining or quantifying if at least the subset (e.g., at least 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%,
  • the present methods may be utilized with a subject whose tumor does not express the target antigen (e.g., about 100% of tumor does not express or is not predicted to express the target antigen) if a portion of the cells in the tumor microenvironment do express or are predicted to express the target antigen.
  • the target antigen e.g., about 100% of tumor does not express or is not predicted to express the target antigen
  • the methods provided herein may further comprise determining that at least the subset of the tumor cells in the tumor do not express the target antigen.
  • the tumor cells do not express the target antigen if the expression of the target antigen is below the level of detection or below signal to noise ratio.
  • a tumor associated antigen may be measured by any method know in the art.
  • a biological sample may be taken from a patient. Samples may be obtained by any means known in the art. Samples may also be taken directly from the cancer, the tumor, or tumor microenvironment.
  • biological sample is intended to include tissues, cells, and biological fluids isolated from a subject, as well as tissues, cells, and fluids present within a subject.
  • the determined percentage of tumor cells that express a target antigen can be determined by measuring the level or expression of a target antigen from a biological sample (e.g., a biopsy of the tumor or tumor microenvironment) taken from a subject. In some embodiments, said percentage can then be extrapolated to quantify a predicted total percentage of tumor and/or tumor microenvironment cells in the subject that express the target antigen.
  • a biological sample e.g., a biopsy of the tumor or tumor microenvironment
  • a detection method encompassed by the present disclosure may be used to detect mRNA, protein, or genomic DNA of the tumor associated antigen or a biologically active fragment thereof in a biological sample in vitro, as well as in vivo.
  • in vitro techniques for detection of mRNA include Northern hybridizations and in situ hybridizations.
  • in vitro techniques for detection of protein include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence.
  • In vitro techniques for detection of genomic DNA include Southern hybridizations.
  • in vivo techniques for detection of protein include introducing into a subject a labeled antibody against the desired protein to be detected.
  • the antibody may be labeled with a radioactive marker whose presence and location in a subject may be detected by standard imaging techniques.
  • the assays described herein may include measuring tumor associated antigen levels post isolation from cells (e.g., after a biopsy or isolation of a biological sample). These may be conducted in cell-free formats using known components of gene expression of the tumor associated antigen. It may be desirable to immobilize certain components of the assay and such embodiments may benefit from the use of well-known adaptations for biomolecule immobilization, such as the use of microtitre plates, beads, test tubes, micro-centrifuge tubes in combination with derivatizable moieties, such as fusion protein domains, biotinylation, antibodies, and the like.
  • a biological sample may be obtained from a subject and the biological sample may be contacted with a compound or an agent capable of detecting an tumor associated antigen protein or a polynucleotide (e.g., mRNA or genomic DNA) encoding said tumor associated antigen in the biological sample.
  • An agent for detecting the mRNA or genomic DNA may comprise a labeled nucleic acid probe capable of hybridizing to the mRNA or genomic DNA.
  • the nucleic acid probe may be, for example, a sequence that is complementary to the nucleic acid encoding the tumor associated antigen, or a portion thereof, such as an oligonucleotide of at least 15, 20, 25, 30, 25, 40, 45, 50, 100, 250 or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to the desired mRNA or genomic DNA.
  • oligonucleotide of at least 15, 20, 25, 30, 25, 40, 45, 50, 100, 250 or 500 nucleotides in length and sufficient to specifically hybridize under stringent conditions to the desired mRNA or genomic DNA.
  • the methods further involve obtaining a control biological sample from a control subject, contacting the control sample with a compound or agent capable of detecting protein, mRNA or genomic DNA, such that the presence of the desired protein, mRNA or genomic DNA is detected in the biological sample, and comparing the presence of the protein, mRNA or genomic DNA in the control sample with the presence of the protein, mRNA or genomic DNA in the control sample.
  • assays described herein may be conducted in cell- free formats using known components of gene expression of the tumor associated antigen. It may be desirable to immobilize certain components of the assay, and such embodiments may benefit from the use of well-known adaptations for biomolecule immobilization, such as the use of microtitre plates, beads, test tubes, micro-centrifuge tubes in combination with derivatizable moieties, such as fusion protein domains, biotinylation, antibodies, and the like.
  • Analysis of one or more regions of nucleic acids of a tumor associated antigen in a subject may be useful for predicting whether a subject has or is likely to benefit from the methods disclosed herein. For example, detecting the tumor associated antigen in a portion of the cancer, such that the cancer would be classified as a heterologous cancer, would indicate the subject would benefit from the methods disclosed herein. Similarly, analysis of genomic copy number of a tumor associated antigen in a subject may be useful for predicting whether a subject would benefit from the methods disclosed herein. In some embodiments, methods encompassed by the present disclosure may be characterized as comprising detecting, in a sample of cells from the subject, the presence or absence of one or more polymorphic regions of the gene encoding the tumor associated antigen.
  • Amplification may be performed, e.g., by PCR and/or LCR (see Wu and Wallace, (1989) Genomics 4:560), according to methods known in the art.
  • genomic DNA of a cell is exposed to two PCR primers and amplification for a number of cycles sufficient to produce the required amount of amplified DNA.
  • Alternative amplification methods include: self-sustained sequence replication (Guatelli, J.C. et al., 1990, Proc. Natl. Acad. Sci. USA 87:1874-1878), transcriptional amplification system (Kwoh, D.Y. et al., 1989, Proc. Natl. Acad. Sci. USA 86:1173-1177), Q-Beta Replicase (Lizardi, P.M. et al., 1988, Bio/Technology 6:1197), and self-sustained sequence replication (Guatelli et al., (1989) Proc. Nat. Acad. Sci.
  • nucleic acid based sequence amplification (NABSA), or any other nucleic acid amplification method, followed by the detection of the amplified molecules using techniques well-known to those of skill in the art.
  • NABSA nucleic acid based sequence amplification
  • any of a variety of sequencing reactions known in the art may be used to directly sequence the nucleic acids in the biological sample, by comparing the sequence of the sample sequence with the corresponding reference (control) sequence.
  • Exemplary sequencing reactions include those based on techniques developed by Maxam and Gilbert (Proc. Natl Acad Sci USA (1977) 74:560) or Sanger (Sanger et al. (1977) Proc. Nat. Acad. Sci 74:5463). It is also contemplated that any of a variety of automated sequencing procedures may be utilized when performing the subject assays (Biotechniques (1995) 19:448), including sequencing by mass spectrometry (see, for example, U.S. Patent No.
  • the occurrence of only one, two or three of the nucleic acid bases need be determined in the sequencing reaction.
  • A-track or the like e.g., where only one nucleotide is detected, may be carried out.
  • Antibodies directed against the tumor associated antigen may also be used in disease diagnostics and prognostics.
  • diagnostic methods may be used to detect abnormalities in the level of such polypeptide expression, or abnormalities in the structure and/or tissue, cellular, or subcellular location of such polypeptides.
  • Structural differences may include, for example, differences in the size, electronegativity, or antigenicity of the mutant polypeptide relative to the normal polypeptide.
  • Protein from the tissue or cell type to be analyzed may easily be detected or isolated using techniques that are well-known to one of skill in the art, including but not limited to Western blot analysis. For a detailed explanation of methods for carrying out Western blot analysis, see Sambrook et al, 1989, supra, at Chapter 18.
  • the protein detection and isolation methods employed herein may also be such as those described in Harlow and Lane, for example (Harlow, E. and Lane, D., 1988, “Antibodies: A Laboratory Manual”, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York), which is incorporated herein by reference in its entirety.
  • This may be accomplished, for example, by immunofluorescence techniques employing a fluorescently labeled antibody (see below) coupled with light microscopic, flow cytometric, or fluorimetric detection.
  • the antibodies (or fragments thereof) useful according to the present disclosure may, additionally, be employed histologically, as in immunofluorescence or immunoelectron microscopy, for in situ detection of the tumor associated antigen. In situ detection may be accomplished by removing a histological specimen from a subject, and applying thereto a labeled antibody disclosed herein.
  • the antibody (or fragment) is may be applied by overlaying the labeled antibody (or fragment) onto a biological sample.
  • a solid phase support or carrier is used as a support capable of binding an antigen or an antibody.
  • supports or carriers include glass, polystyrene, polypropylene, polyethylene, dextran, nylon, amylases, natural and modified celluloses, polyacrylamides, gabbros, and magnetite.
  • the nature of the carrier may be either soluble to some extent or insoluble for the purposes encompassed by the present disclosure.
  • the support material may have virtually any possible structural configuration so long as the coupled molecule is capable of binding to an antigen or antibody.
  • the support configuration may be spherical, as in a bead, or cylindrical, as in the inside surface of a test tube, or the external surface of a rod.
  • the surface may be flat such as a sheet, test strip, etc.
  • Supports include, but are not limited to, polystyrene beads. Those skilled in the art will know many other suitable carriers for binding antibody or antigen, or will be able to ascertain the same by use of routine experimentation.
  • EIA enzyme immunoassay
  • the enzyme which is bound to the antibody, will react with an appropriate substrate, such as a chromogenic substrate, in such a manner as to produce a chemical moiety that may be detected, for example, by spectrophotometric, fluorimetric or by visual means.
  • an appropriate substrate such as a chromogenic substrate
  • Enzymes that may be used to detectably label the antibody include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, delta- 5 -steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate, dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta-galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase.
  • the detection may be accomplished by colorimetric methods that employ a chromogenic substrate for the enzyme. Detection may also be accomplished by visual comparison of the extent of enzymatic reaction of a substrate in comparison with similarly prepared standards.
  • Detection may also be accomplished using any of a variety of other immunoassays.
  • a radioimmunoassay RIA
  • the radioactive isotope may be detected by such means as the use of a gamma counter or a scintillation counter or by autoradiography.
  • the antibody it is also possible to label the antibody with a fluorescent compound.
  • a fluorescent compound When the fluorescently labeled antibody is exposed to light of the proper wave length, its presence can then be detected due to fluorescence.
  • fluorescent labeling compounds are fluorescein isothiocyanate, rhodamine, phycoerythrin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.
  • the antibody may
  • DTP A diethylenetriaminepentacetic acid
  • EDTA ethylenediaminetetraacetic acid
  • the antibody also may be detectably labeled by coupling it to a chemiluminescent compound.
  • the presence of the chemiluminescent-tagged antibody is then determined by detecting the presence of luminescence that arises during the course of a chemical reaction.
  • chemiluminescent labeling compounds are luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester.
  • Bioluminescence is a type of chemiluminescence found in biological systems in which a catalytic protein increases the efficiency of the chemiluminescent reaction. The presence of a bioluminescent protein is determined by detecting the presence of luminescence. Important bioluminescent compounds for purposes of labeling are luciferin, luciferase and aequorin.
  • sample nucleic acid to be analyzed by any of the above-described diagnostic and prognostic methods may be obtained from any cell type or tissue of a subject.
  • a subject's bodily fluid e.g. blood
  • nucleic acid tests may be performed on dry samples (e.g., hair or skin).
  • Fetal nucleic acid samples may be obtained from maternal blood as described in International Patent Application No. W091/07660 to Bianchi.
  • amniocytes or chorionic villi may be obtained for performing prenatal testing.
  • Diagnostic procedures may also be performed in situ directly upon tissue sections (fixed and/or frozen) of subject tissue obtained from biopsies or resections, such that no nucleic acid purification is necessary.
  • Nucleic acid reagents may be used as probes and/or primers for such in situ procedures (see, for example, Nuovo, G.J., 1992, PCR in situ hybridization: protocols and applications, Raven Press, NY).
  • Fingerprint profiles may be generated, for example, by utilizing a differential display procedure, Northern analysis and/or RT-PCR.
  • the subject may be diagnosed with a cancer, and the tumor cells in the tumor in the subject are not predicted to express the target antigen if known issue or tumor expression profiles typically do not express the target antigen.
  • the subject may be diagnosed with a cancer, and the tumor cells in the tumor in the subject are not predicted to express the target antigen if known issue or tumor expression profiles show that less than 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%,
  • the present disclosure further pertains to novel agents identified by the above-described screening assays. Accordingly, screening, diagnostic, and/or prognostic assays are also provided for identifying an antibody specific for a tumor associated antigen that induces/mitigates killing of or activates T cells against tumor cells that do not express the tumor associated antigen. [0261] In one embodiment, the present disclosure provides assays for screening candidate or test compounds which are substrates of or interact with a tumor associated antigen.
  • an assay is a cell-based assay in which a cell, such as a cancer cell, is contacted with a test agent, and the ability of the test compound to kill tumor cells or activate T cells is determined. Determining the ability of the test agent to perform the functions discussed may be accomplished by monitoring biomarkers described herein, for example, biopsy, biomarker expression, physical assays, and the like.
  • the ability of the test agent to modulate the binding of an antibody to its target substrate may also be determined. Determining the ability of the test agent to bind may be accomplished, for example, by coupling the substrate with a radioisotope or enzymatic label such that binding of the substrate to the antibody may be determined by detecting the labeled substrate in a complex.
  • the target substrate may also be coupled with a radioisotope or enzymatic label to monitor the ability of a test agent to modulate binding to the substrate in a complex.
  • Determining the ability of the test agent to bind a target protein may be accomplished, for example, by coupling the agent with a radioisotope or enzymatic label such that binding may be determined by detecting the labeled agent in a complex.
  • agents may be labeled with 125 ⁇ 35g, l ⁇ C, or ⁇ H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting.
  • Agents can further be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product.
  • the ability of an agent to bind is determined with or without the labeling of any of the interactants.
  • a microphysiometer may be used to detect the interaction without labeling any component (McConnell, H. M. et al. (1992) Science 257:1906-1912.
  • a “microphysiometer” e.g., Cytosensor
  • LAPS light-addressable potentiometric sensor
  • cell-based systems may be used to identify agents that treat a cancer disclosed herein.
  • such cell systems may be exposed to an agent at a sufficient concentration and for a time sufficient to elicit such an amelioration of disease symptoms in the exposed cells.
  • the cells may be examined to determine whether one or more of the disease phenotypes has been altered to resemble a more normal or more wild type phenotype.
  • animals or animal-based disease systems such as those described herein, may be used to identify such agents.
  • animal models may be used as test substrates for the identification of drugs, pharmaceuticals, therapies, and interventions which may be effective in binding a tumor associated antigen or other target herein, such as to treat or prevent a cancer disclosed herein.
  • Example 1 CD22-targeted CD28 bispecific antibody enhances anti-tumor efficacy of Odronextamab in refractory diffuse large B-cell lymphoma model
  • REGN5837 a bispecific antibody that crosslinks CD22 expressing tumor cells with CD28 expressing T cells, enhances the activity of Odronextamab by potentiating T cell activation and cytolytic function.
  • REGN5837 promotes the anti-tumor activity of Odronextamab and induces the intratumoral expansion of plastic reprogrammable T cells while skewing away from a dysfunctional state.
  • REGN5837 monotherapy shows activity and no toxicity in primate studies, and it augments T cell activation when dosed in combination with Odronextamab.
  • a therapeutic strategy in the field of cancer immunotherapy is the use of bispecific antibodies to redirect T cells to tumors in order to enhance anti-tumor activity. This has led to the approval of Blincyto, a CD19xCD3 T-cell engager for the treatment of acute lymphoblastic leukemia and Removab, an EpCAMxCD3 bispecific antibody for the treatment of malignant ascites. These T cell redirecting therapeutics are designed to engage a tumor antigen with one antigen-binding fragment (Fab) arm and a T cell activating receptor with the other Fab arm.
  • Fab antigen-binding fragment
  • Odronextamab is a CD20xCD3 bispecific antibody that efficiently triggers T cell mediated killing of CD20 expressing cells in preclinical tumor models.
  • T cells require the engagement of the T cell receptor complex (TCR) which provides “signal 1” and the additional engagement of a costimulatory receptor which provides “signal 2”.
  • TCR T cell receptor complex
  • Odronextamab activates T cells by providing signal 1 through the cross-linking of CD3, further enhancement of T cell effector function and activation can be mediated by the addition of a costimulatory signal.
  • CD22xCD28 is a hinge- stabilized human IgG4-based antibody designed to enhance T cell responses against CD22 expressing tumors (i.e. NHL) by bridging CD22 expressing cells with CD28 expressing T cells.
  • CD22 is a transmembrane protein that binds sialic acid and is found on normal B cells and malignant B cells such as DLBCL tumors.
  • CD22 regulates signal transduction of the B cell antigen receptor, B cell migration, and maintenance of peripheral B cell homeostasis and survival.
  • CD28 By cross-linking CD22 on tumor cells with CD28 on the T cells, critical CD28 costimulatory signals can be transduced for the enhancement of CD20xCD3 directed T cell activation.
  • potent amplification of Odronextamab anti-tumor activity can be achieved by combining with REGN5837 against DLBCL tumors cells, both in vitro and in vivo.
  • CD28 expression is detected on intratumoral CD8 + T cells at baseline and post Odronextamab treatment in r/r NHL patients.
  • CD22 is a well-validated tumor target for the treatment of B cell leukemia and lymphoma, with broad but variable expression within DLBCL patient samples (Fig. 7A-Fig. 7C). Additionally, it was observed that a significant population of CD28 + cells from treatment-naive resected DLBCL patient samples that can be targeted with the CD22xCD28 bispecific antibody (Fig. 8A and Fig. 8B). Analysis of baseline samples from a dose-finding phase I study (ClinicalTrials.gov Identifier: NCT02290951) for Odronextamab demonstrated that this CD28 expression was preferentially on intratumoral CD8 + T cells and to a lesser extent on CD4 + T cells (Fig. 1A and B).
  • CD22xCD28 bispecific antibody may allow for the specific engagement of CD28 and the potential enhancement of Odronextamab activity.
  • REGN5837 augments Odronextamab mediated T cell activation and effector function in vitro.
  • PBMCs lymphocyte-enriched human peripheral blood mononuclear cells
  • DEBCE cells expressing high levels of CD20 and CD22 (Fig. 9B)
  • REGN5837 activity was assayed in the presence of Odronextamab, as the CD28 bispecific cannot mediate costimulatory activity in the absence of signal 1, or engagement of the TCR/CD3 complex, unlike a TeGenero-like CD28 superagonist (Fig. 9A).
  • Administration of REGN5837 costimulation enhanced Odronextamab mediated cytotoxicity of WSU- DLCL2 cells (Fig. 2A), upregulated activation marker CD25 on CD4 + (Fig. 2B) and CD8 + (Fig. 2D) T cells, and induced proliferation of CD4 + (Fig. 2C) and CD8 + (Fig. 2E) T cells in a concentration dependent manner (Table 6).
  • CD22 expression is variable within DEBCE patient samples with tumors containing a mixture of CD22 + and CD22- tumor cells (Fig. 1A-C)
  • the ability of REGN5837 to augment the ability of T cells to kill CD22 + and CD22- targets was also evaluated.
  • Purified T cells were incubated with CRISPR-edited CD22 deficient and CD22 wild-type WSU-DLCL2 cells and stimulated with a fixed concentration of Odronextamab (5 pM) and REGN5837 ranging from 4.63 x IO -10 to 1.67 x 10’ 8 M.
  • Culturing T cells with target cells expressing CD22 + and REGN5837 augmented Odronextamab-mediated tumor cell lysis; while as expected, culturing T cells with target cells that do not express CD22 did not result in enhanced cytotoxicity (Fig. 2G). However, culturing T cells with a mixed population consisting of 20-80% CD22 + targets resulted in increased killing of both the CD22 + and CD22- target populations (Fig. 2G) and increased CD4 and CD8 T cell activation (Fig. 2H) in a REGN5837 dose dependent manner. While CD22- target cells were not lysed at the same magnitude as CD22 + target cells at the highest concentration of REGN5837 evaluated (11% survival of CD22 + cells vs.
  • REGN5837 mediated costimulation enhances Odronextamab anti-tumor efficacy in a xenogeneic DLBCL tumor model.
  • CD22xCD28 mediated costimulation enhances CD20xCD3 anti-tumor efficacy against preclinical models of B cell malignancies
  • B-ALL B cell acute lymphoblastic leukemia
  • B-ALL B cell acute lymphoblastic leukemia
  • Immunodeficient animals were pre-engrafted with human PBMCs and implanted 12 days later intravenously with NALM-6 B-ALL cells engineered to express luciferase to allow for in vivo tracking using bioluminescence imaging (BLI).
  • BBI bioluminescence imaging
  • Delaying treatment to 8 days post implantation resulted in a non- significant trend towards decreased tumor burden in the Odronextamab treated group (Fig. 4E and Fig. 4F).
  • the combination of REGN5837 with Odronextamab induced a significant suppression of tumor growth (Fig. 4F).
  • WSU-DECE2 tumors were subcutaneously implanted into SIRPA h/h TPO h/m Rag2 ⁇ /_ Il2rg '' mice, or human immune system (HIS) animals, that were engrafted with fetal liver CD34 + cells. Animals were randomized into indicated treatment groups based on the fetal liver donor, human T cell engraftment frequency, and sex. Monotherapy with Odronextamab at 0.4 mpk did not suppress tumor growth, while combination treatment with REGN5837 significantly inhibited tumor growth (Fig.
  • REGN5837 monotherapy also induced tumor rejection (Fig. 5B and Fig. 5C) as underlying this antitumor response was the allogeneicity between donor T cells and WSU-DECE2 tumor cells which provides “signal 1”.
  • REGN5837 enhanced T cell activation and effector function mediated by an allogeneic signal I (Fig. 12A and Fig. 12B); therefore, this increased anti-tumor activity in vivo may be attributed to the costimulation of an allogeneic response.
  • Combinatorial treatment induced a significant post first dose cytokine release (TNFa, IL-2, IL- 10) in comparison to Odronextamab monotherapy, while there was a trend towards increased IL-6.
  • TNFa post first dose cytokine release
  • IL-2 IL-2
  • IL- 10 IL-6
  • Combination of REGN5837 with Odronextamab enhances anti-tumor activity by augmenting intratumoral T cell accumulation and skewing T cells towards a reprogrammable state and away from a dysfunctional phenotype.
  • Odronextamab monotherapy was sufficient to mediate a significant depletion of B cells in comparison to isotype and REGN5837 monotherapy treatment.
  • the combinatorial treatment depleted splenic B cells to a similar extent as Odronextamab monotherapy with a trend towards expanding splenic (Fig. 14A and C) and blood (Fig. 14B and E) T cell populations in comparison to isotype treated animals.
  • the combination of Odronextamab and REGN5837 treatment resulted in a significant reduction in the frequency of tumor cells (Fig. 13D left) with a concomitant expansion of intratumoral T cells (Fig. 13D right) in comparison to Odronextamab monotherapy.
  • Metacluster 1 represents a population of CD8 + T cells that has a reprogrammable (CD38 10 CD101 10 ) phenotype, or a reversible state of dysfunction that has previously been described in the literature while metacluster 3 represents a dysfunctional population of CD8 T cells (PDl hl CD28 + Ki67 + ) that is highly proliferative but associated with a lack of effector cytokine production and tumor progression (Fig. 51).
  • Metacluster 11 is a population of PD-1 + CD38 10 CD4 + T cells which is reported to exhibit better tumor control than CD38 hl CD4 + T cells in metacluster 10 due to the maintenance of sternness and effector function and the prevention of metabolic exhaustion (Fig. 51). Therefore, these data demonstrated that not only does costimulation with the CD22xCD28 bispecific antibody in combination with Odronextamab expand intratumoral T cells, but also prevents the induction of dysfunctional T cells leading to the enhancement of anti-tumor immunity.
  • T cells as shown by upregulation of ICOS and induction of proliferation. Concomitant with T cell activation was the sustained depletion of peripheral B cells at all evaluated concentrations of Odronextamab (Fig. 6A). Addition of REGN5837 to Odronextamab efficiently depleted peripheral B cells similarly to Odronextamab alone. Of note, combination with REGN5837 at 1 mpk significantly expanded and activated peripheral CD8 + (Fig. 6B and 6C) and CD4 + T (Fig. 15A and 15B) cells in comparison to Odronextamab monotherapy and placebo control.
  • Odronextamab monotherapy resulted in dose-dependent increases in serum cytokines (Fig. 6D) which correlated with previous observations from additional tumor targeted CD3 bispecific antibodies.
  • the combination of Odronextamab (at 0.1 mpk) with REGN5837 (at 1 mpk) significantly increased IL-2 production in comparison to placebo, with a trend towards increased serum IL-6, reflecting the increased T cell activation observed with combinatorial treatment (Fig. 6C and Fig. 15B).
  • REGN5837 can potentiate Odronextamab mediated activity by promoting cytotoxicity of DLBCL and other NHL cell lines in vitro and by potently enhancing anti-tumor activity against DLBCL tumors that cannot be cleared by CD3 bispecific antibody treatment. While Odronextamab as a single agent suppressed WSU-DLCL2 tumor growth, only combinatorial treatment with REGN5837 resulted in curative responses and enhanced overall survival in preclinical in vivo models.
  • the combination of REGN5837 and Odronextamab not only maintained cytotoxicity against CD20 expressing cells, but also resulted in a significant expansion of intratumoral T cells, with an enhanced induction of effector memory cells in comparison to Odronextamab monotherapy.
  • Further characterization of the intratumoral immune compartment from HIS mice revealed that the addition of CD28 costimulation to Odronextamab skewed the CD8 + T cell population to a reprogrammable phenotype (CD38 10 CD101 10 ), or a plastic dysfunctional state that under the right conditions, can be reversed, allowing the re-invigorated T cells to produce high levels of pro-inflammatory cytokines and mediate anti-tumor immunity.
  • Odronextamab is currently being evaluated in Phase 1 and Phase 2 clinical trials for the treatment of r/r B cell NHL, where the patient population has been heavily pre-treated and has failed at least 2 prior lines of treatment.
  • Results from early Odronextamab clinical trials reveal encouraging activity with an ORR of 92.9% and a complete response rate (CR) of 75.0% for refractory follicular lymphoma patients receiving at least 5 mg of Odronextamab weekly.
  • Example 2 Material and Methods for Example 1
  • the DLBCL cell line was obtained from DSMZ (ACC 575) and maintained in RPMI-1640 with 10% FBS (Seradigm) supplemented with penicillin, streptomycin, glutamine, and 1 mM HEPES (Gibco).
  • a CRISPR-edited CD22 deficient line was generated by electroporation of Cas9 ribonucleoprotein (RNP) with TrueCutTM Cas9 Protein v2 (Invitrogen) and a High Scoring TrueGuideTM Synthetic sgRNA targeting human CD22 (Invitrogen guide RNA: CCGGTGCACCTCAATGACAG) using the NeonTM Transfection System 100 pL Kit (Invitrogen).
  • CD22 deficient cells were bulk sorted 96 hours post electroporation.
  • NALM6-luc tumor experiments the NALM6 cell line (DSMZ: ACC 128) was modified with the EFla-Luciferase-2A-GFP-Puro lentivirus (GenTarget) in order to image tumor cell growth in vivo.
  • the cell line was maintained in RPMI with 10% FBS supplemented with PSG (penicillin, streptomycin, and glutamine) and puromycin selection (1 ug/ml).
  • WSU-DLCL2 cells (3 x 10 6 cells) were collected and mixed with 5 x 10 5 PBMCs (ReachBio) and resuspended in a 1:1 mixture of PBS and GFR Matrigel (Coming).
  • Female NSG mice (Jackson Laboratory) were subcutaneously injected with the cell mixture in the right flank.
  • WSU-DLCL2 cells (3 x 10 6 cells) were implanted subcutaneously in SIRPA h/h TPO h/m Rag2 _/_ I12rg _/_ mice that were engrafted with fetal liver CD34 + cells; animals were segregated to have similar distribution of fetal liver donors, human immune cell engraftment frequency, and sex for each treatment group.
  • mice were randomized to receive blinded treatments of either isotype controls (EGFRV3xCD3 or MUC16xCD28) or test articles (REGN5837, Odronextamab) which were administered as monotherapy or in combination by intraperitoneal injection at specified concentrations on day 1, day 8, and day 15 post implantation for prophylactic treatment, and on d8, dl5, and d22 for therapeutic treatment.
  • Tumor growth was monitored over time using digital caliper (VWR) measurements of X and Y diameter (perpendicular measurements of length and width). Tumor volume was calculated (X*Y*(X/2) where X is the shorter diameter).
  • Mice were euthanized when the tumor reached a designated tumor end-point (tumor diameter > 20 mm, or tumor ulceration). This designated endpoint is in accordance with IACUC standards.
  • mice Female immunodeficient NSG mice (Jackson Laboratories) were engrafted with 4 x 10 6 human PBMCs (ReachBio) and animals that were successfully engrafted were injected intravenously with 5 x 10 6 cells of NALM6-luc cells 12 days post PBMC engraftment. Mice were randomized to receive blinded treatments of either isotype controls (EGFRV3xCD3 or MUC16xCD28) or test articles (REGN5837, Odronextamab) which were administered as monotherapy or in combination by intraperitoneal injection at specified concentrations on day 8, day 15, and day 22 post implantation.
  • isotype controls EGFRV3xCD3 or MUC16xCD28
  • test articles REGN5837, Odronextamab
  • FlowSOM from OMIQ was run on samples acquired on the Symphony (BD Biosciences). Analyses were run on equal numbers of events per sample. The range in events was determined by the sample with the fewest cells.
  • FlowSOM clustering of intratumoral CD8 + T cells in Omiq.ai was run on selected parameters (activation/dysfunction and memory markers) with default settings.
  • UMAP a high dimensional reduction method, was run on all samples within Omiq.ai. Samples from each treatment group were concatenated and FlowSOM clusters overlaid upon the UMAP plots.
  • Antibodies diluted to 10 Jlg/ml in PBS were wet-coated onto polypropylene plates overnight. Diluted antibody (100 pl) was added in triplicate to a 96- well polypropylene assay plate. Plates were stored overnight at 4°C to allow adsorption of the antibodies, and the plates washed twice with PBS prior to use in the proliferation assay.
  • PBMCs were isolated from leukocyte-enriched peripheral blood (New York Blood Center) obtained from four healthy individual donors.
  • the PBMCs from each donor were resuspended in RPMI medium (Irvine Scientific) containing 10% human AB serum (GemCell) and penicillin/streptomycin/glutamine (100 units/ml, 100 flg/ml, 292 flg/ml, respectively, Gibco) and then added to the 96-well assay plates at 100,000 cells/well in a final volume of 200 l/well. The assay plates were then incubated at 37°C + 5% CO2 for 54 hours. At 54 hours, the assay plates were centrifuged and 100 of supernatant was removed for cytokine analysis.
  • Cytokine concentrations for IFNg, IL1B, IL2, IL4, IL6, IL8, IL 10, IL13, and TNFa were determined using the V-PLEX Proinflammatory Panel 1 Human Kit according to the manufacturer’s instructions. Mean and range of concentrations (pg/mL) obtained from 4 donors were plotted, with individual data points representing average concentrations for each individual donor obtained from assays performed in triplicate wells.
  • Previously frozen human CD3 + T-cells isolated from healthy donor leukocyte packs via density gradient centrifugation using 50 mL SepMateTM tubes were thawed the day of the assay in stimulation media (X-VIVO 15 cell culture media supplemented with 10% FBS, HEPES, NaPyr, NEAA, and 0.01 mM BME) containing 50 U/ml benzonase nuclease and plated into 96-well round bottom plates at a concentration of 1 x 10 5 cells/well.
  • stimulation media X-VIVO 15 cell culture media supplemented with 10% FBS, HEPES, NaPyr, NEAA, and 0.01 mM BME
  • NALM6 cells were treated with 10 ug/mL of Mitomycin C in primary stimulation media at a concentration of 10 x 10 6 cells/mL.
  • mitomycin C-treated cells were washed 3 times with D-PBS containing 2% FBS and added to the wells containing CD3 + T-cells at a final concentration of 5 x 10 4 cells per well.
  • irrelevant hlgGl mAb was added (100 nM/well) to block Fc receptors.
  • a fixed concentration of Odronextamab or non- binding isotype control at 500pM with a dose titration of REGN5837 or a non-binding isotype control from 3.1pM to 200nM was added to the wells.
  • Human PBMCs were thawed and plated in complete media (RPMI cell culture media supplemented with 10% FBS, penicillin-streptomycin-glutamine) at IxlO 6 cells/mL and incubated overnight at 37°C in order to enrich for lymphocytes by depleting adherent cells such as macrophages, dendritic cells, and some monocytes.
  • complete media RPMI cell culture media supplemented with 10% FBS, penicillin-streptomycin-glutamine
  • adherent cells such as macrophages, dendritic cells, and some monocytes.
  • PBMC were harvested and labeled with IpM of Violet Cell Tracker fluorescent tracking dye.
  • WSU-DLCL2 cells were labeled with IpM of the fluorescent dye Vybrant CFDA-SE.
  • 5,000 labeled target cells were plated in roundbottom 96 well plates at a 1:5 ratio with labeled PBMC.
  • Serial dilutions of R5837 were combined with serial dilutions of R1979 and added to labeled target and effector cells, and the plates incubated were for 72 hours at 37°C. After incubation, the cells were washed and stained with LIVE/DEAD stain in PBS, followed by staining with a cocktail of fluorophore-labeled antibodies to CD2, CD4, CD8, and CD25 for analysis of surviving target cells, T cell activation and proliferation.
  • Counting beads (20 pL per well) were added immediately before sample analysis on a BD Celesta flow cytometer.
  • Target cell killing was assessed by calculating the number of live, CFDA- SE labeled target cells/well by normalizing to the number of beads collected/well. Percent viability was normalized to the number of living target cells in the control condition (target cells in the presence of PBMC only). T cell activation was assessed by reporting the %CD25 on CD4+ and CD8+ T cells. T cell proliferation was assessed by reporting the percentage of cells that had decreased MFI of the Violet Cell Tracker dye.
  • the EC50 values of the antibodies were determined from a four-parameter logistic equation over a 9-point dose-response curve using GraphPad Prism software. Maximum responses for percent cytotoxicity, T cell activation, proliferation and cytokine release was taken as the plateau value generated by the Prism curve fit. Fold change in EC50 was calculated as EC50NOR5837/EC50[M]R5837 and fold change in maximum cytokine release was calculated as Max[M]R5837/MaxN O R5837.
  • a fully automated multiplex immunohistochemistry assay was performed on the Ventana Discovery ULTRA platform (Ventana Medical Systems, Arlington, AZ). Five rounds of sequential primary antibody and secondary-Horse Radish Peroxidase- conjugated antibody applications were performed. Heat denaturation between each step to completely remove the bound primary and secondary antibody was performed to eliminate downstream cross-reactivity. This allowed primary antibodies raised in the same species to be used. The fluorescent dyes used were carefully selected to ensure spectral separation and provide optimal staining. The combination and order of application of the primary antibody and tyramide-fluorophore was optimized to ensure that both the epitope and fluorophore could withstand the repeated heat denaturation steps. Optimal concentrations of each antibody were determined, and they were applied in the following sequence and detected with the indicated fluorophore.
  • Assessments of treatment related effects included body weight measurements, clinical observations, veterinary physical examinations (which included assessments of heart rate, body temperature, and respiratory rates), neuromuscular/musculoskeletal observations, clinical pathology (hematology, blood and/or tissue samples were collected for cytokine analysis, immunophenotyping analysis, histopathology, and toxicokinetic evaluation.
  • peripheral blood flow cytometry blood was collected into potassium EDTA tubes; lysed; stained with CD3, CD4, CD8, CD14, CD16, CD20, CD28, and Ki67 (BD Biosciences), and CD278 (BioLegend); and analyzed with FACSCanto II flow cytometer.
  • cytokine analysis blood was collected into serum separator tubes with anticoagulant.
  • Serum was separated via centrifugation at 1000g to 2000g at 4°C for 10 to 15 min and analyzed using the MSD U-Plex platform (IL- 10, IL-2, IL-6, MCP-1, and TNF-a, and IFN-y.).
  • MSD U-Plex platform IL- 10, IL-2, IL-6, MCP-1, and TNF-a, and IFN-y.
  • Example 3 REGN5837 enhances cytotoxicity mediated by human T cells activated with the CD20xCD3 bispecific antibody REGN1979 against B cell lymphoma cells that do or do not express surface CD22.
  • T cells were isolated from freshly thawed PBMC using the EasySep Human T-Cell Isolation kit and used immediately.
  • WSU-DLCL2/CD22 WT cells were labeled with IpM of the fluorescent dye Vybrant CFDA-SE.
  • WSU-DLCL2/CD22 KO cells were labeled with IpM of the fluorescent dye CellTrace Far Red.
  • Labeled WSU- DLCL2/CD22 WT and WSU-DLCL2/CD22 KO target cells were plated at different ratios (0:100, 20:80, 40:60, 60:40, 80:20, 100:0) in round-bottom 96 well plates, and unlabeled T cells were added at a final effector to target ratio of 5:1.
  • Target and effector cells were incubated with 5 pM CD20xCD3 (REGN1979) alone, or with different concentrations of REGN5837 (16.7nM, 2.77nM, 463pM), and the plates were incubated for 72 hours at 37°C.
  • WSU-DLCL2/CD22 WT killing was assessed by calculating the number of live, CFDA-SE labeled target cells/well by normalizing to the number of beads collected/well.
  • WSU-DLCL2/CD22 KO killing cell killing was assessed by calculating the number of live, Far- Red labeled target cells/well by normalizing to the number of beads collected/well. Percent viability was normalized to the number of living target cells in the control condition (target cells in the presence of effector cells only).
  • T cell activation was assessed by reporting the MFI of CD25 on CD4+ and CD8+ T cells.
  • REGN5837 enhanced the REGN1979 mediated killing of WSU-DLCL2/CD22 KO cells in cultures that contained 20% or more WSU-DLCL2/CD22 WT cells.
  • REGN5837 did not enhance REGN1979 mediated killing of WSU- DLCL2/CD22 KO cells in the absence of any WSU-DLCL2/CD22 WT cells in the culture (Table 10).
  • REGN5837 In cultures containing WSU-DLCL2/CD22 WT cells, REGN5837 enhanced REGN1979 mediated T cell activation in a dose dependent manner, with greater T cell activation observed when higher ratios of WSU-DLCL2/CD22 WT cells were present. REGN5837 did not enhance REGN1979 mediated T cell activation in the absence of any WSU-DLCL2/CD22 WT cells in the culture (Table 11). [0312] In summary, REGN5837 co-stimulation increased REGN1979 mediated killing of target cells lacking CD22 expression as long as CD22 expressing cells were present in the culture.
  • any polynucleotide and polypeptide sequences which reference an accession number correlating to an entry in a public database, such as those maintained by The Institute for Genomic Research (TIGR) on the World Wide Web and/or the National Center for Biotechnology Information (NCBI) on the World Wide Web.
  • TIGR The Institute for Genomic Research
  • NCBI National Center for Biotechnology Information

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Public Health (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2023/065627 2022-04-11 2023-04-11 Compositions and methods for universal tumor cell killing Ceased WO2023201226A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
IL316002A IL316002A (en) 2022-04-11 2023-04-11 Compositions and methods for universal tumor cell killing
CA3247475A CA3247475A1 (en) 2022-04-11 2023-04-11 COMPOSITIONS AND METHODS FOR THE DESTRUCTION OF UNIVERSAL TUMOR CELLS
AU2023254191A AU2023254191A1 (en) 2022-04-11 2023-04-11 Compositions and methods for universal tumor cell killing
KR1020247035962A KR20250004700A (ko) 2022-04-11 2023-04-11 보편적 종양 세포 사멸을 위한 조성물 및 방법
JP2024560297A JP2025512377A (ja) 2022-04-11 2023-04-11 ユニバーサルな腫瘍細胞殺傷のための組成物及び方法
EP23721256.8A EP4507790A1 (en) 2022-04-11 2023-04-11 Compositions and methods for universal tumor cell killing
CN202380046150.3A CN119546329A (zh) 2022-04-11 2023-04-11 用于通用肿瘤细胞杀伤的组合物和方法
MX2024012557A MX2024012557A (es) 2022-04-11 2024-10-10 Composiciones y metodos para la destruccion universal de celulas tumorales

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202263329762P 2022-04-11 2022-04-11
US63/329,762 2022-04-11
US202263347330P 2022-05-31 2022-05-31
US63/347,330 2022-05-31

Publications (1)

Publication Number Publication Date
WO2023201226A1 true WO2023201226A1 (en) 2023-10-19

Family

ID=86286242

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/065627 Ceased WO2023201226A1 (en) 2022-04-11 2023-04-11 Compositions and methods for universal tumor cell killing

Country Status (10)

Country Link
US (1) US20230357446A1 (enExample)
EP (1) EP4507790A1 (enExample)
JP (1) JP2025512377A (enExample)
KR (1) KR20250004700A (enExample)
CN (1) CN119546329A (enExample)
AU (1) AU2023254191A1 (enExample)
CA (1) CA3247475A1 (enExample)
IL (1) IL316002A (enExample)
MX (1) MX2024012557A (enExample)
WO (1) WO2023201226A1 (enExample)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TWI756187B (zh) * 2015-10-09 2022-03-01 美商再生元醫藥公司 抗lag3抗體及其用途

Citations (90)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4474893A (en) 1981-07-01 1984-10-02 The University of Texas System Cancer Center Recombinant monoclonal antibodies
WO1991007660A1 (en) 1989-11-13 1991-05-30 Children's Medical Center Corporation Non-invasive method for isolation and detection of fetal dna
US5126132A (en) 1989-08-21 1992-06-30 The United States Of America As Represented By The Department Of Health And Human Services Tumor infiltrating lymphocytes as a treatment modality for human cancer
WO1994016101A2 (en) 1993-01-07 1994-07-21 Koester Hubert Dna sequencing by mass spectrometry
WO1994021822A1 (en) 1993-03-19 1994-09-29 Sequenom, Inc. Dna sequencing by mass spectrometry via exonuclease degradation
US5500362A (en) 1987-01-08 1996-03-19 Xoma Corporation Chimeric antibody with specificity to human B cell surface antigen
US5605798A (en) 1993-01-07 1997-02-25 Sequenom, Inc. DNA diagnostic based on mass spectrometry
US5798229A (en) 1993-08-02 1998-08-25 Merck Patent Gesellschaft Mit Beschrankter Haftung Bispecific molecules recognizing lymphocyte antigen CD2 and tumor antigens
US5821337A (en) 1991-06-14 1998-10-13 Genentech, Inc. Immunoglobulin variants
US5959084A (en) 1990-10-29 1999-09-28 Chiron Corporation Bispecific antibodies, methods of production and uses thereof
US20030147869A1 (en) 2002-01-03 2003-08-07 James Riley System and methods for promoting expansion of polyclonal and antigen-specific cytotoxic T lymphocytes in response to artificial antigen presenting cells
US7435596B2 (en) 2004-11-04 2008-10-14 St. Jude Children's Research Hospital, Inc. Modified cell line and method for expansion of NK cell
US7575923B2 (en) 1998-04-21 2009-08-18 Micromet Ag CD19xCD3 specific polypeptides and uses thereof
US7635472B2 (en) 2003-05-31 2009-12-22 Micromet Ag Pharmaceutical compositions comprising bispecific anti-cd3, anti-cd19 antibody constructs for the treatment of b-cell related disorders
US20110195454A1 (en) 2010-02-08 2011-08-11 Regeneron Pharmaceuticals, Inc. Common Light Chain Mouse
WO2012055961A1 (en) 2010-10-27 2012-05-03 Micromet Gmbh Means and methods for treating dlbcl
WO2013041687A1 (en) 2011-09-23 2013-03-28 Amgen Research (Munich) Gmbh Bispecific binding molecules for 5t4 and cd3
WO2013072406A1 (en) 2011-11-15 2013-05-23 Amgen Research (Munich) Gmbh Binding molecules for bcma and cd3
WO2013088114A1 (en) 2011-12-12 2013-06-20 Cell Medica Limited Process of expanding t cells
US20130273055A1 (en) 2010-11-16 2013-10-17 Eric Borges Agents and methods for treating diseases that correlate with bcma expression
US8586713B2 (en) 2009-06-26 2013-11-19 Regeneron Pharmaceuticals, Inc. Readily isolated bispecific antibodies with native immunoglobulin format
WO2014047231A1 (en) 2012-09-21 2014-03-27 Regeneron Pharmaceuticals, Inc. Anti-cd3 antibodies, bispecific antigen-binding molecules that bind cd3 and cd20, and uses thereof
US20140243504A1 (en) 2013-02-01 2014-08-28 Regeneron Pharmaceuticals, Inc. Antibodies comprising chimeric constant domains
WO2014140248A1 (en) 2013-03-15 2014-09-18 Amgen Research (Munich) Gmbh Binding molecules for bcma and cd3
WO2015143079A1 (en) 2014-03-19 2015-09-24 Regeneron Pharmaceuticals, Inc. Antibody compositions for tumor treatment
WO2015149077A1 (en) 2014-03-28 2015-10-01 Xencor, Inc. Bispecific antibodies that bind to cd38 and cd3
WO2016036937A1 (en) 2014-09-05 2016-03-10 Janssen Pharmaceutica Nv Cd123 binding agents and uses thereof
WO2016048938A1 (en) 2014-09-26 2016-03-31 Macrogenics, Inc. Bi-specific monovalent diabodies that are capable of binding cd19 and cd3, and uses thereof
US9315567B2 (en) 2012-08-14 2016-04-19 Ibc Pharmaceuticals, Inc. T-cell redirecting bispecific antibodies for treatment of disease
WO2016081490A1 (en) 2014-11-17 2016-05-26 Regeneron Pharmaceuticals, Inc. Methods for tumor treatment using cd3xcd20 bispecific antibody
WO2016086189A2 (en) 2014-11-26 2016-06-02 Xencor, Inc. Heterodimeric antibodies that bind cd3 and tumor antigens
WO2016105450A2 (en) 2014-12-22 2016-06-30 Xencor, Inc. Trispecific antibodies
WO2016166629A1 (en) 2015-04-13 2016-10-20 Pfizer Inc. Therapeutic antibodies and their uses
US20160326249A1 (en) 2014-01-15 2016-11-10 Zymeworks Inc. Bi-specific cd3 and cd19 antigen-binding constructs
WO2017023761A1 (en) 2015-07-31 2017-02-09 Regeneron Pharmaceuticals, Inc. Anti-psma antibodies, bispecific antigen-binding molecules that bind psma and cd3, and uses thereof
WO2017031104A1 (en) 2015-08-17 2017-02-23 Janssen Pharmaceutica Nv Anti-bcma antibodies, bispecific antigen binding molecules that bind bcma and cd3, and uses thereof
US9603651B2 (en) 2013-02-21 2017-03-28 Medtronic, Inc. Methods for simultaneous cardiac substrate mapping using spatial correlation maps between neighboring unipolar electrograms
WO2017053856A1 (en) 2015-09-23 2017-03-30 Regeneron Pharmaceuticals, Inc. Optimized anti-cd3 bispecific antibodies and uses thereof
WO2017087603A1 (en) 2015-11-18 2017-05-26 Sorrento Therapeutics, Inc. Chemically-locked bispecific antibodies
WO2017096368A1 (en) 2015-12-04 2017-06-08 Macrogenics, Inc. Bi-specific monovalent diabodies that are capable of binding cd19 and cd3, and uses thereof
WO2017095267A1 (ru) 2015-12-01 2017-06-08 Общество С Ограниченной Ответственностью "Международный Биотехнологический Центр "Генериум" (Ооо "Мбц "Генериум") Биспецифические антитела против cd3*cd19
WO2017112775A1 (en) 2015-12-22 2017-06-29 Regeneron Pharmaceuticals, Inc. Combination of anti-pd-1 antibodies and bispecific anti-cd20/anti-cd3 antibodies to treat cancer
WO2017134134A1 (en) 2016-02-03 2017-08-10 Amgen Research (Munich) Gmbh BCMA and CD3 Bispecific T Cell Engaging Antibody Constructs
US20170320947A1 (en) 2015-12-07 2017-11-09 Xencor, Inc. Heterodimeric antibodies that bind cd3 and psma
US20170342160A1 (en) 2014-12-19 2017-11-30 Biotecnol Limited Fusion Protein Comprising Three Binding Domains to 5T4 and CD3
WO2017210443A1 (en) 2016-06-01 2017-12-07 Xencor, Inc. Bispecific antibodies that bind cd123 and cd3
WO2017210485A1 (en) 2016-06-01 2017-12-07 Xencor, Inc. Bispecific antibodies that bind cd20 and cd3 for use in the treatment of lymphoma
WO2018005706A1 (en) 2016-06-28 2018-01-04 Xencor, Inc. Heterodimeric antibodies that bind somatostatin receptor 2
WO2018017786A2 (en) 2016-07-20 2018-01-25 Janssen Pharmaceutica Nv Anti- gprc5d antibodies, bispecific antigen binding molecules that bind gprc5d and cd3, and uses thereof
WO2018058003A1 (en) 2016-09-23 2018-03-29 Regeneron Pharmaceuticals, Inc. Anti-muc16 (mucin 16) antibodies
WO2018058001A1 (en) 2016-09-23 2018-03-29 Regeneron Pharmaceuticals, Inc. Anti-steap2 antibodies, antibody-drug conjugates, and bispecific antigen-binding molecules that bind steap2 and cd3, and uses thereof
WO2018093821A1 (en) 2016-11-15 2018-05-24 Genentech, Inc. Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies
WO2018114748A1 (en) 2016-12-20 2018-06-28 F. Hoffmann-La Roche Ag Combination therapy of anti-cd20/anti-cd3 bispecific antibodies and 4-1bb (cd137) agonists
US20180222987A1 (en) 2015-01-23 2018-08-09 Sanofi Anti-cd3 antibodies, anti-cd123 antibodies and bispecific antibodies specifically binding to cd3 and/or cd123
WO2018188612A1 (zh) 2017-04-12 2018-10-18 鸿运华宁(杭州)生物医药有限公司 一种能与人cd19或cd20和人cd3结合的双特异性抗体及其应用
US20180305465A1 (en) 2015-11-25 2018-10-25 Amgen Inc. Heterodimeric antibodies that bind cd3 and cd38
WO2018223004A1 (en) 2017-06-01 2018-12-06 Xencor, Inc. Bispecific antibodies that bind cd20 and cd3
WO2019050521A1 (en) 2017-09-07 2019-03-14 Macrogenics, Inc. DOSAGE SCHEMES OF BISPECIFIC DIACORPS CD123 X CD3 IN THE TREATMENT OF HEMATOLOGICAL MALIGNANCIES
WO2019075359A1 (en) 2017-10-13 2019-04-18 Harpoon Therapeutics, Inc. TRISPECIFIC PROTEINS AND METHODS OF USE
US20190241657A1 (en) 2016-07-18 2019-08-08 Sanofi Bispecific antibody-like binding proteins specifically binding to cd3 and cd123
WO2019155008A1 (en) 2018-02-09 2019-08-15 Genmab A/S Pharmaceutical compositions comprising bispecific antibodies directed against cd3 and cd20 and their uses
US20190263920A1 (en) 2016-11-02 2019-08-29 Engmab Sarl Bispecific antibody against bcma and cd3 and an immunological drug for combined use in treating multiple myeloma
US20190284279A1 (en) 2017-11-15 2019-09-19 Beijing Luzhu Biotechnology Co., Ltd Bispecific antibody binding to human cd19 and cd3
WO2019191120A1 (en) 2018-03-27 2019-10-03 Systimmune, Inc. Guidance and navigation control proteins and method of making and using thereof
WO2019210147A1 (en) 2018-04-27 2019-10-31 Xencor, Inc. Dosing of a bispecific antibody that bind cd123 and cd3
WO2019220369A2 (en) 2018-05-16 2019-11-21 Janssen Biotech, Inc. Methods of treating cancers and enhancing efficacy of t cell redirecting therapeutics
WO2019226761A1 (en) 2018-05-23 2019-11-28 Celgene Corporation Antiproliferative compounds and bispecific antibody against bcma and cd3 for combined use
WO2019228406A1 (en) 2018-05-29 2019-12-05 Wuxi Biologics (Shanghai) Co., Ltd. A novel anti-cd3/anti-cd20 bispecific antibody
WO2019232528A1 (en) 2018-06-01 2019-12-05 Xencor, Inc. Dosing of a bispecific antibody that bind cd123 and cd3
WO2019237081A1 (en) 2018-06-07 2019-12-12 Cullinan Management, Inc. Multi-specific binding proteins and methods of use thereof
WO2019246356A1 (en) 2018-06-21 2019-12-26 Regeneron Pharmaceuticals, Inc. Methods for treating cancer with bispecific anti-cd3xmuc16 antibodies and anti-pd-1 antibodies
US20200024356A1 (en) 2018-07-19 2020-01-23 Regeneron Pharmaceuticals, Inc. Bispecific Anti-BCMA x Anti-CD3 Antibodies and Uses Thereof
WO2020018556A1 (en) 2018-07-16 2020-01-23 Amgen Inc. Method of treating multiple myeloma
WO2020025596A1 (en) 2018-07-31 2020-02-06 Amgen Research (Munich) Gmbh Dosing regimen for bcma-cd3 bispecific antibodies
WO2020048525A1 (en) 2018-09-07 2020-03-12 Generon (Shanghai) Corporation Ltd. Bispecific antigen binding proteins and uses thereof
US20200102403A1 (en) 2013-11-04 2020-04-02 Glenmark Pharmaceuticals S.A. T cell retargeting hetero-dimeric immunoglobulins
US20200129617A1 (en) 2018-08-31 2020-04-30 Regeneron Pharmaceuticals, Inc. Dosing Strategy that Mitigates Cytokine Release Syndrome for Therapeutic Antibodies
WO2020092404A1 (en) 2018-10-30 2020-05-07 Macrogenics, Inc. Bispecific cd123 x cd3 diabodies for the treatment of hematologic malignancies
WO2020088608A1 (zh) 2018-11-01 2020-05-07 安源医药科技(上海)有限公司 同源二聚体型双特异性抗体及其制备方法和用途
US20200140552A1 (en) 2018-10-09 2020-05-07 Sanofi Trispecific anti-cd38, anti-cd28, and anti-cd3 binding proteins and methods of use for treating viral infection
US20200172627A1 (en) 2017-06-02 2020-06-04 Hoffmann-La Roche Inc. Type ii anti-cd20 antibody and anti-cd20/cd3 bispecific antibody for treatment of cancer
WO2020132066A1 (en) * 2018-12-19 2020-06-25 Regeneron Pharmaceuticals, Inc. Bispecific anti-cd28 x anti-cd22 antibodies and uses thereof
US20200199231A1 (en) 2015-01-08 2020-06-25 Genmab A/S Bispecific antibodies against cd3 and cd20
WO2020135335A1 (en) 2018-12-24 2020-07-02 Generon (Shanghai) Corporation Ltd. Multispecific antigen binding proteins capable of binding cd19 and cd3, and use thereof
WO2020156405A1 (en) 2019-01-28 2020-08-06 Wuxi Biologics (Shanghai) Co. Ltd. Novel bispecific cd3/cd20 polypeptide complexes
US20200277397A1 (en) 2018-03-12 2020-09-03 Genmab A/S Antibodies
WO2020180726A1 (en) 2019-03-01 2020-09-10 Xencor, Inc. Heterodimeric antibodies that bind enpp3 and cd3
US20200283523A1 (en) 2017-09-22 2020-09-10 WuXi Biologics Ireland Limited Novel bispecific cd3/cd19 polypeptide complexes
WO2020191346A1 (en) 2019-03-21 2020-09-24 Regeneron Pharmaceuticals, Inc. Combination of il-4/il-13 pathway inhibitors and plasma cell ablation for treating allergy
US10787521B2 (en) 2013-08-23 2020-09-29 Macrogenics, Inc. Bi-specific monovalent diabodies that are capable of binding CD123 and CD3, and uses thereof

Patent Citations (96)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4474893A (en) 1981-07-01 1984-10-02 The University of Texas System Cancer Center Recombinant monoclonal antibodies
US5500362A (en) 1987-01-08 1996-03-19 Xoma Corporation Chimeric antibody with specificity to human B cell surface antigen
US5126132A (en) 1989-08-21 1992-06-30 The United States Of America As Represented By The Department Of Health And Human Services Tumor infiltrating lymphocytes as a treatment modality for human cancer
WO1991007660A1 (en) 1989-11-13 1991-05-30 Children's Medical Center Corporation Non-invasive method for isolation and detection of fetal dna
US5959084A (en) 1990-10-29 1999-09-28 Chiron Corporation Bispecific antibodies, methods of production and uses thereof
US5821337A (en) 1991-06-14 1998-10-13 Genentech, Inc. Immunoglobulin variants
WO1994016101A2 (en) 1993-01-07 1994-07-21 Koester Hubert Dna sequencing by mass spectrometry
US5547835A (en) 1993-01-07 1996-08-20 Sequenom, Inc. DNA sequencing by mass spectrometry
US5605798A (en) 1993-01-07 1997-02-25 Sequenom, Inc. DNA diagnostic based on mass spectrometry
WO1994021822A1 (en) 1993-03-19 1994-09-29 Sequenom, Inc. Dna sequencing by mass spectrometry via exonuclease degradation
US5798229A (en) 1993-08-02 1998-08-25 Merck Patent Gesellschaft Mit Beschrankter Haftung Bispecific molecules recognizing lymphocyte antigen CD2 and tumor antigens
US7575923B2 (en) 1998-04-21 2009-08-18 Micromet Ag CD19xCD3 specific polypeptides and uses thereof
US20030147869A1 (en) 2002-01-03 2003-08-07 James Riley System and methods for promoting expansion of polyclonal and antigen-specific cytotoxic T lymphocytes in response to artificial antigen presenting cells
US7635472B2 (en) 2003-05-31 2009-12-22 Micromet Ag Pharmaceutical compositions comprising bispecific anti-cd3, anti-cd19 antibody constructs for the treatment of b-cell related disorders
US7435596B2 (en) 2004-11-04 2008-10-14 St. Jude Children's Research Hospital, Inc. Modified cell line and method for expansion of NK cell
US8586713B2 (en) 2009-06-26 2013-11-19 Regeneron Pharmaceuticals, Inc. Readily isolated bispecific antibodies with native immunoglobulin format
US20110195454A1 (en) 2010-02-08 2011-08-11 Regeneron Pharmaceuticals, Inc. Common Light Chain Mouse
WO2012055961A1 (en) 2010-10-27 2012-05-03 Micromet Gmbh Means and methods for treating dlbcl
US20130273055A1 (en) 2010-11-16 2013-10-17 Eric Borges Agents and methods for treating diseases that correlate with bcma expression
WO2013041687A1 (en) 2011-09-23 2013-03-28 Amgen Research (Munich) Gmbh Bispecific binding molecules for 5t4 and cd3
WO2013072406A1 (en) 2011-11-15 2013-05-23 Amgen Research (Munich) Gmbh Binding molecules for bcma and cd3
WO2013088114A1 (en) 2011-12-12 2013-06-20 Cell Medica Limited Process of expanding t cells
US9315567B2 (en) 2012-08-14 2016-04-19 Ibc Pharmaceuticals, Inc. T-cell redirecting bispecific antibodies for treatment of disease
WO2014047231A1 (en) 2012-09-21 2014-03-27 Regeneron Pharmaceuticals, Inc. Anti-cd3 antibodies, bispecific antigen-binding molecules that bind cd3 and cd20, and uses thereof
US20140243504A1 (en) 2013-02-01 2014-08-28 Regeneron Pharmaceuticals, Inc. Antibodies comprising chimeric constant domains
US9603651B2 (en) 2013-02-21 2017-03-28 Medtronic, Inc. Methods for simultaneous cardiac substrate mapping using spatial correlation maps between neighboring unipolar electrograms
WO2014140248A1 (en) 2013-03-15 2014-09-18 Amgen Research (Munich) Gmbh Binding molecules for bcma and cd3
US10787521B2 (en) 2013-08-23 2020-09-29 Macrogenics, Inc. Bi-specific monovalent diabodies that are capable of binding CD123 and CD3, and uses thereof
US20200102403A1 (en) 2013-11-04 2020-04-02 Glenmark Pharmaceuticals S.A. T cell retargeting hetero-dimeric immunoglobulins
US20160326249A1 (en) 2014-01-15 2016-11-10 Zymeworks Inc. Bi-specific cd3 and cd19 antigen-binding constructs
WO2015143079A1 (en) 2014-03-19 2015-09-24 Regeneron Pharmaceuticals, Inc. Antibody compositions for tumor treatment
WO2015149077A1 (en) 2014-03-28 2015-10-01 Xencor, Inc. Bispecific antibodies that bind to cd38 and cd3
WO2016036937A1 (en) 2014-09-05 2016-03-10 Janssen Pharmaceutica Nv Cd123 binding agents and uses thereof
WO2016048938A1 (en) 2014-09-26 2016-03-31 Macrogenics, Inc. Bi-specific monovalent diabodies that are capable of binding cd19 and cd3, and uses thereof
WO2016081490A1 (en) 2014-11-17 2016-05-26 Regeneron Pharmaceuticals, Inc. Methods for tumor treatment using cd3xcd20 bispecific antibody
WO2016086189A2 (en) 2014-11-26 2016-06-02 Xencor, Inc. Heterodimeric antibodies that bind cd3 and tumor antigens
US20170342160A1 (en) 2014-12-19 2017-11-30 Biotecnol Limited Fusion Protein Comprising Three Binding Domains to 5T4 and CD3
WO2016105450A2 (en) 2014-12-22 2016-06-30 Xencor, Inc. Trispecific antibodies
US20200199231A1 (en) 2015-01-08 2020-06-25 Genmab A/S Bispecific antibodies against cd3 and cd20
US20180222987A1 (en) 2015-01-23 2018-08-09 Sanofi Anti-cd3 antibodies, anti-cd123 antibodies and bispecific antibodies specifically binding to cd3 and/or cd123
WO2016166629A1 (en) 2015-04-13 2016-10-20 Pfizer Inc. Therapeutic antibodies and their uses
WO2017023761A1 (en) 2015-07-31 2017-02-09 Regeneron Pharmaceuticals, Inc. Anti-psma antibodies, bispecific antigen-binding molecules that bind psma and cd3, and uses thereof
WO2017031104A1 (en) 2015-08-17 2017-02-23 Janssen Pharmaceutica Nv Anti-bcma antibodies, bispecific antigen binding molecules that bind bcma and cd3, and uses thereof
WO2017053856A1 (en) 2015-09-23 2017-03-30 Regeneron Pharmaceuticals, Inc. Optimized anti-cd3 bispecific antibodies and uses thereof
WO2017087603A1 (en) 2015-11-18 2017-05-26 Sorrento Therapeutics, Inc. Chemically-locked bispecific antibodies
US20180305465A1 (en) 2015-11-25 2018-10-25 Amgen Inc. Heterodimeric antibodies that bind cd3 and cd38
WO2017095267A1 (ru) 2015-12-01 2017-06-08 Общество С Ограниченной Ответственностью "Международный Биотехнологический Центр "Генериум" (Ооо "Мбц "Генериум") Биспецифические антитела против cd3*cd19
WO2017096368A1 (en) 2015-12-04 2017-06-08 Macrogenics, Inc. Bi-specific monovalent diabodies that are capable of binding cd19 and cd3, and uses thereof
US20170320947A1 (en) 2015-12-07 2017-11-09 Xencor, Inc. Heterodimeric antibodies that bind cd3 and psma
WO2017112775A1 (en) 2015-12-22 2017-06-29 Regeneron Pharmaceuticals, Inc. Combination of anti-pd-1 antibodies and bispecific anti-cd20/anti-cd3 antibodies to treat cancer
WO2017134134A1 (en) 2016-02-03 2017-08-10 Amgen Research (Munich) Gmbh BCMA and CD3 Bispecific T Cell Engaging Antibody Constructs
WO2017210485A1 (en) 2016-06-01 2017-12-07 Xencor, Inc. Bispecific antibodies that bind cd20 and cd3 for use in the treatment of lymphoma
WO2017210443A1 (en) 2016-06-01 2017-12-07 Xencor, Inc. Bispecific antibodies that bind cd123 and cd3
WO2018005706A1 (en) 2016-06-28 2018-01-04 Xencor, Inc. Heterodimeric antibodies that bind somatostatin receptor 2
US20190241657A1 (en) 2016-07-18 2019-08-08 Sanofi Bispecific antibody-like binding proteins specifically binding to cd3 and cd123
WO2018017786A2 (en) 2016-07-20 2018-01-25 Janssen Pharmaceutica Nv Anti- gprc5d antibodies, bispecific antigen binding molecules that bind gprc5d and cd3, and uses thereof
WO2018067331A9 (en) 2016-09-23 2018-06-07 Regeneron Pharmaceuticals, Inc. Bi specific anti-muc16-cd3 antibodies and anti-muc16 drug conjugates
US20180118848A1 (en) 2016-09-23 2018-05-03 Regeneron Pharmaceuticals, Inc. Anti-MUC16 Antibodies, Antibody-Drug Conjugates, and Bispecific Antigen-Binding Molecules that Bind MUC16 and CD3, and Uses Thereof
WO2018067331A1 (en) 2016-09-23 2018-04-12 Regeneron Pharmaceuticals, Inc. Bi specific anti-muc16-cd3 antibodies and nti-muc16 drug conjugates
WO2018058003A1 (en) 2016-09-23 2018-03-29 Regeneron Pharmaceuticals, Inc. Anti-muc16 (mucin 16) antibodies
WO2018058001A1 (en) 2016-09-23 2018-03-29 Regeneron Pharmaceuticals, Inc. Anti-steap2 antibodies, antibody-drug conjugates, and bispecific antigen-binding molecules that bind steap2 and cd3, and uses thereof
US20190263920A1 (en) 2016-11-02 2019-08-29 Engmab Sarl Bispecific antibody against bcma and cd3 and an immunological drug for combined use in treating multiple myeloma
WO2018093821A1 (en) 2016-11-15 2018-05-24 Genentech, Inc. Dosing for treatment with anti-cd20/anti-cd3 bispecific antibodies
WO2018114748A1 (en) 2016-12-20 2018-06-28 F. Hoffmann-La Roche Ag Combination therapy of anti-cd20/anti-cd3 bispecific antibodies and 4-1bb (cd137) agonists
WO2018188612A1 (zh) 2017-04-12 2018-10-18 鸿运华宁(杭州)生物医药有限公司 一种能与人cd19或cd20和人cd3结合的双特异性抗体及其应用
WO2018223004A1 (en) 2017-06-01 2018-12-06 Xencor, Inc. Bispecific antibodies that bind cd20 and cd3
US20200172627A1 (en) 2017-06-02 2020-06-04 Hoffmann-La Roche Inc. Type ii anti-cd20 antibody and anti-cd20/cd3 bispecific antibody for treatment of cancer
WO2019050521A1 (en) 2017-09-07 2019-03-14 Macrogenics, Inc. DOSAGE SCHEMES OF BISPECIFIC DIACORPS CD123 X CD3 IN THE TREATMENT OF HEMATOLOGICAL MALIGNANCIES
US20200283523A1 (en) 2017-09-22 2020-09-10 WuXi Biologics Ireland Limited Novel bispecific cd3/cd19 polypeptide complexes
WO2019075359A1 (en) 2017-10-13 2019-04-18 Harpoon Therapeutics, Inc. TRISPECIFIC PROTEINS AND METHODS OF USE
US20190284279A1 (en) 2017-11-15 2019-09-19 Beijing Luzhu Biotechnology Co., Ltd Bispecific antibody binding to human cd19 and cd3
WO2019155008A1 (en) 2018-02-09 2019-08-15 Genmab A/S Pharmaceutical compositions comprising bispecific antibodies directed against cd3 and cd20 and their uses
US20200277397A1 (en) 2018-03-12 2020-09-03 Genmab A/S Antibodies
WO2019191120A1 (en) 2018-03-27 2019-10-03 Systimmune, Inc. Guidance and navigation control proteins and method of making and using thereof
WO2019210147A1 (en) 2018-04-27 2019-10-31 Xencor, Inc. Dosing of a bispecific antibody that bind cd123 and cd3
WO2019220369A2 (en) 2018-05-16 2019-11-21 Janssen Biotech, Inc. Methods of treating cancers and enhancing efficacy of t cell redirecting therapeutics
WO2019226761A1 (en) 2018-05-23 2019-11-28 Celgene Corporation Antiproliferative compounds and bispecific antibody against bcma and cd3 for combined use
WO2019228406A1 (en) 2018-05-29 2019-12-05 Wuxi Biologics (Shanghai) Co., Ltd. A novel anti-cd3/anti-cd20 bispecific antibody
WO2019232528A1 (en) 2018-06-01 2019-12-05 Xencor, Inc. Dosing of a bispecific antibody that bind cd123 and cd3
WO2019237081A1 (en) 2018-06-07 2019-12-12 Cullinan Management, Inc. Multi-specific binding proteins and methods of use thereof
WO2019246356A1 (en) 2018-06-21 2019-12-26 Regeneron Pharmaceuticals, Inc. Methods for treating cancer with bispecific anti-cd3xmuc16 antibodies and anti-pd-1 antibodies
WO2020018556A1 (en) 2018-07-16 2020-01-23 Amgen Inc. Method of treating multiple myeloma
US20200024356A1 (en) 2018-07-19 2020-01-23 Regeneron Pharmaceuticals, Inc. Bispecific Anti-BCMA x Anti-CD3 Antibodies and Uses Thereof
WO2020018820A1 (en) 2018-07-19 2020-01-23 Regeneron Pharmaceuticals, Inc. BISPECIFIC ANTI-BCMA x ANTI-CD3 ANTIBODIES AND USES THEREOF
WO2020025596A1 (en) 2018-07-31 2020-02-06 Amgen Research (Munich) Gmbh Dosing regimen for bcma-cd3 bispecific antibodies
US20200129617A1 (en) 2018-08-31 2020-04-30 Regeneron Pharmaceuticals, Inc. Dosing Strategy that Mitigates Cytokine Release Syndrome for Therapeutic Antibodies
WO2020048525A1 (en) 2018-09-07 2020-03-12 Generon (Shanghai) Corporation Ltd. Bispecific antigen binding proteins and uses thereof
US20200140552A1 (en) 2018-10-09 2020-05-07 Sanofi Trispecific anti-cd38, anti-cd28, and anti-cd3 binding proteins and methods of use for treating viral infection
WO2020092404A1 (en) 2018-10-30 2020-05-07 Macrogenics, Inc. Bispecific cd123 x cd3 diabodies for the treatment of hematologic malignancies
WO2020088608A1 (zh) 2018-11-01 2020-05-07 安源医药科技(上海)有限公司 同源二聚体型双特异性抗体及其制备方法和用途
US20200239576A1 (en) 2018-12-19 2020-07-30 Regeneron Pharmaceuticals, Inc. Bispecific anti-cd28 x anti-cd22 antibodies and uses thereof
WO2020132066A1 (en) * 2018-12-19 2020-06-25 Regeneron Pharmaceuticals, Inc. Bispecific anti-cd28 x anti-cd22 antibodies and uses thereof
WO2020135335A1 (en) 2018-12-24 2020-07-02 Generon (Shanghai) Corporation Ltd. Multispecific antigen binding proteins capable of binding cd19 and cd3, and use thereof
WO2020156405A1 (en) 2019-01-28 2020-08-06 Wuxi Biologics (Shanghai) Co. Ltd. Novel bispecific cd3/cd20 polypeptide complexes
WO2020180726A1 (en) 2019-03-01 2020-09-10 Xencor, Inc. Heterodimeric antibodies that bind enpp3 and cd3
WO2020191346A1 (en) 2019-03-21 2020-09-24 Regeneron Pharmaceuticals, Inc. Combination of il-4/il-13 pathway inhibitors and plasma cell ablation for treating allergy

Non-Patent Citations (60)

* Cited by examiner, † Cited by third party
Title
"Enzyme Immunoassay", 1981, KGAKU SHOIN
"GenBank", Database accession no. NP_001183.2
"Medical Applications of Controlled Release", 1974, CRC PRES.
ANDERSON NRMINUTOLO NGGILL SKLICHINSKY M.: "Macrophage-Based Approaches for Cancer Immunotherapy.", CANCER RES., vol. 81, no. 5, 1 March 2021 (2021-03-01), pages 1201 - 1208, XP055926972, DOI: 10.1158/0008-5472.CAN-20-2990
ANGAL ET AL., MOLECULAR IMMUNOLOGY, vol. 30, 1993, pages 105
BENEDICT, CA, J IMMUNOL METHODS., vol. 201, no. 2, 1997, pages 223 - 31
BIOTECHNIQUES, vol. 19, 1995, pages 448
BROCKERKARJALAINEN, ADV IMMUNOL, vol. 68, 1998, pages 257 - 269
BUTLER, METH. ENZYMOL., vol. 73, 1981, pages 482 - 523
CALIGIURI, BLOOD, vol. 112, no. 3, 2008, pages 461 - 469
CHO ET AL., CLIN CANCER RES., vol. 16, 2010, pages 3901 - 3909
CLYNES ET AL., PROC. NATL. ACAD. SCI. (USA, vol. 95, 1998, pages 652 - 656
COHEN ET AL., ADV CHROMATOGR, vol. 36, 1996, pages 127 - 162
COOLEY ET AL., BLOOD, vol. 116, 2010, pages 2411 - 2419
DIMITRIS SKOKOS ET AL: "A class of costimulatory CD28-bispecific antibodies that enhance the antitumor activity of CD3-bispecific antibodies", SCI. TRANSL. MED, 8 January 2020 (2020-01-08), pages Article No.: eaaw7888, XP055671428, Retrieved from the Internet <URL:https://stm.sciencemag.org/content/12/525/eaaw7888.full.pdf> [retrieved on 20200225], DOI: 10.1126/scitranslmed.aaw7888 *
ESHHAR ET AL., PROC NATL ACAD SCI USA, vol. 90, no. 2, 1993, pages 720 - 724
ESHHAR, CANCER IMMUNOL IMMUNOTHER, vol. 45, no. 3-4, 1997, pages 131 - 136
FUJISAKI ET AL., CANCER RES., vol. 69, 2009, pages 4010 - 4017
GAOWEI FAN ET AL: "Bispecific antibodies and their applications", JOURNAL OF HEMATOLOGY & ONCOLOGY, vol. 8, no. 130, 1 December 2015 (2015-12-01), pages 1 - 14, XP055298353, DOI: 10.1186/s13045-015-0227-0 *
GEUIJEN, CA ET AL., J IMMUNOL METHODS., vol. 302, no. 1-2, 2005, pages 68 - 77
GOODSON, MEDICAL APPLICATIONS OF CONTROLLED RELEASE, vol. 2, 1984, pages 115 - 138
GRIFFIN ET AL., APPL BIOCHEM BIOTECHNOL, vol. 38, 1993, pages 147 - 159
GUATELLI ET AL., PROC. NAT. ACAD. SCI., vol. 87, 1989, pages 1874
GUATELLI, J.C. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1990, pages 1874 - 1878
HARLOW, E.LANE, D.: "Antibodies: A Laboratory Manual", 1988, COLD SPRING HARBOR LABORATORY PRESS
J LEUKOC BIOL., vol. 64, no. 4, October 1998 (1998-10-01), pages 419 - 26
KLEIN ET AL., MABS, vol. 4, no. 6, 2012, pages 1 - 11
KOȘALOĞLU- YALÇIN, Z. ET AL.: "The Cancer Epitope Database and Analysis Resource: A Blueprint for the Establishment of a New Bioinformatics Resource for Use by the Cancer Immunology Community", FRONTIERS IN IMMUNOLOGY, vol. 12, 2021
KUFER ET AL., TRENDS BIOTECHNOL., vol. 22, 2004, pages 238 - 244
KWOH, D.Y. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 1173 - 1177
L.R. ET AL.: "TANTIGEN 2.0: a knowledge base of tumor T cell antigens and epitopes", BMC BIOINFORMATICS, vol. 22, 2021, pages 40
LANGER, SCIENCE, vol. 249, 1990, pages 1527 - 1533
LIZARDI, P.M. ET AL., BIO/TECHNOLOGY, vol. 6, 1988, pages 1197
MAXAMGILBERT, PROC. NATL ACAD SCI USA, vol. 74, 1977, pages 560
MCCONNELL, H. M., SCIENCE, vol. 257, 1992, pages 1906 - 1912
MILLER ET AL., BLOOD, vol. 106, 2005, pages 3051 - 3057
MILONE ET AL., MOL THER, vol. 17, no. 8, 2009, pages 1453 - 1464
OLIVIER NOLAN-STEVAUX, ABSTRACT AT PROCEEDINGS OF THE ANNUAL MEETING OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, 2020
PEARSON, METHODS MOL. BIOL., vol. 24, 1994, pages 307 - 331
PINTHUS ET AL., J CLIN INVEST, vol. 114, no. 12, 2004, pages 1774 - 1781
POWELL ET AL.: "Compendium of excipients for parenteral formulations", J PHARM SCI TECHNOL, vol. 52, 1998, pages 238 - 311, XP009119027
PROC NATL ACAD SCI USA., vol. 118, 14 September 2021 (2021-09-14), pages 37
RUBNITZ ET AL., J CLIN ONCOL., vol. 28, pages 955 - 959
RUGGERI ET AL., SCIENCE, vol. 295, 2002, pages 2097 - 2100
SADELAIN ET AL., CURR OPIN IMMUNOL, vol. 21, no. 2, 2009, pages 215 - 223
SANGER ET AL., PROC. NAT. ACAD. SCI, vol. 74, 1977, pages 5463
SEFTON, CRC CRIT. REF. BIOMED. ENG., vol. 14, 1987, pages 201
SHAH NIRALI N. ET AL: "Characterization of CD22 expression in acute lymphoblastic leukemia : CD22 Expression in ALL", PEDIATRIC BLOOD AND CANCER, vol. 62, no. 6, 1 March 2015 (2015-03-01), US, pages 964 - 969, XP093065131, ISSN: 1545-5009, Retrieved from the Internet <URL:https://api.wiley.com/onlinelibrary/tdm/v1/articles/10.1002%2Fpbc.25410> DOI: 10.1002/pbc.25410 *
STAERZ ET AL., NATURE, vol. 316, 1985, pages 354
STAERZBEVAN, IMMUNOL. TODAY, vol. 7, 1986, pages 241
STAERZBEVAN, PROC. NATL. ACAD. SCI. USA, vol. 83, 1986, pages 1453
TAYLOR ET AL., NUCL. ACIDS RES., vol. 20, 1992, pages 6287 - 6295
TUTT ET AL., J. IMMUNOL., vol. 147, pages 60 - 69
VIVIER ET AL., SCIENCE, vol. 331, 2011, pages 44 - 49
VOLLER ET AL., J. CLIN. PATHOL., vol. 31, 1978, pages 507 - 520
VOLLER: "Diagnostic Horizons", vol. 2, 1978, MICROBIOLOGICAL ASSOCIATES QUARTERLY PUBLICATION, article "The Enzyme Linked Immunosorbent Assay (ELISA", pages: 1 - 7
WAITE JANELLE C. ET AL: "Tumor-targeted CD28 bispecific antibodies enhance the antitumor efficacy of PD-1 immunotherapy", SCIENCE TRANSLATIONAL MEDICINE, vol. 12, no. 549, 24 June 2020 (2020-06-24), pages 2325, XP093057250, ISSN: 1946-6234, DOI: 10.1126/scitranslmed.aba2325 *
WEI JOYCE ET AL: "CD22-targeted CD28 bispecific antibody enhances antitumor efficacy of odronextamab in refractory diffuse large B cell lymphoma models", SCIENCE TRANSLATIONAL MEDICINE, vol. 14, no. 670, 9 November 2022 (2022-11-09), XP093064408, ISSN: 1946-6234, DOI: 10.1126/scitranslmed.abn1082 *
WU ET AL., J. BIOL. CHEM., vol. 262, 1987, pages 4429 - 4432
WUWALLACE, GENOMICS, vol. 4, 1989, pages 560

Also Published As

Publication number Publication date
KR20250004700A (ko) 2025-01-08
EP4507790A1 (en) 2025-02-19
JP2025512377A (ja) 2025-04-17
AU2023254191A1 (en) 2024-10-17
CN119546329A (zh) 2025-02-28
IL316002A (en) 2024-11-01
US20230357446A1 (en) 2023-11-09
MX2024012557A (es) 2024-12-06
CA3247475A1 (en) 2023-10-19

Similar Documents

Publication Publication Date Title
AU2019405736B2 (en) Bispecific anti-MUC16 x anti-CD28 antibodies and uses thereof
TWI878150B (zh) 嵌合抗原及t細胞受體以及使用方法
CA3090793C (en) MODIFIED MULTIPOTENTED STEM CELLS, AND METHODS OF PREPARATION AND USE
ES2891578T3 (es) Antígeno quimérico y receptores de células T y métodos de uso
WO2019246514A1 (en) Bispecific anti-psma x anti-cd28 antibodies and uses thereof
EP4284512B1 (en) Compositions and methods for treating cytokine release syndrome
CN112996504A (zh) 通过抑制泛素缀合酶e2 k(ube2k)治疗癌症的方法
US20230357446A1 (en) Compositions and methods for universal tumor cell killing
HK40122651A (zh) 用於通用肿瘤细胞杀伤的组合物和方法
HK40125786A (en) Compositions and methods for treating cytokine release syndrome
HK40104245A (en) Compositions and methods for treating cytokine release syndrome
HK40104245B (en) Compositions and methods for treating cytokine release syndrome
HK40054961A (en) Methods of treating cancer by inhibiting ubiquitin conjugating enzyme e2 k (ube2k)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23721256

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 316002

Country of ref document: IL

WWE Wipo information: entry into national phase

Ref document number: AU2023254191

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2024560297

Country of ref document: JP

Ref document number: MX/A/2024/012557

Country of ref document: MX

ENP Entry into the national phase

Ref document number: 2023254191

Country of ref document: AU

Date of ref document: 20230411

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2023721256

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2023721256

Country of ref document: EP

Effective date: 20241111

WWE Wipo information: entry into national phase

Ref document number: 11202407109X

Country of ref document: SG

WWE Wipo information: entry into national phase

Ref document number: 202380046150.3

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 202380046150.3

Country of ref document: CN