WO2023195923A2 - Compound screening and therapeutic uses - Google Patents

Compound screening and therapeutic uses Download PDF

Info

Publication number
WO2023195923A2
WO2023195923A2 PCT/SG2023/050227 SG2023050227W WO2023195923A2 WO 2023195923 A2 WO2023195923 A2 WO 2023195923A2 SG 2023050227 W SG2023050227 W SG 2023050227W WO 2023195923 A2 WO2023195923 A2 WO 2023195923A2
Authority
WO
WIPO (PCT)
Prior art keywords
bap1
cca
tbt
tumour
lsd1
Prior art date
Application number
PCT/SG2023/050227
Other languages
French (fr)
Other versions
WO2023195923A3 (en
Inventor
Jing Han HONG
Jing Tan
Bin Tean Teh
Original Assignee
Singapore Health Services Pte Ltd
Agency For Science, Technology And Research
National University Of Singapore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Singapore Health Services Pte Ltd, Agency For Science, Technology And Research, National University Of Singapore filed Critical Singapore Health Services Pte Ltd
Publication of WO2023195923A2 publication Critical patent/WO2023195923A2/en
Publication of WO2023195923A3 publication Critical patent/WO2023195923A3/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/50—Pyridazines; Hydrogenated pyridazines
    • A61K31/502—Pyridazines; Hydrogenated pyridazines ortho- or peri-condensed with carbocyclic ring systems, e.g. cinnoline, phthalazine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/5375—1,4-Oxazines, e.g. morpholine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4703—Inhibitors; Suppressors
    • C—CHEMISTRY; METALLURGY
    • C40—COMBINATORIAL TECHNOLOGY
    • C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
    • C40B40/00—Libraries per se, e.g. arrays, mixtures
    • C40B40/04—Libraries containing only organic compounds
    • C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPRs]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/31—Combination therapy
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2740/00—Reverse transcribing RNA viruses
    • C12N2740/00011—Details
    • C12N2740/10011—Retroviridae
    • C12N2740/16011—Human Immunodeficiency Virus, HIV
    • C12N2740/16041—Use of virus, viral particle or viral elements as a vector
    • C12N2740/16043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0083—Miscellaneous (1.14.99)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y204/00—Glycosyltransferases (2.4)
    • C12Y204/02—Pentosyltransferases (2.4.2)
    • C12Y204/0203—NAD+ ADP-ribosyltransferase (2.4.2.30), i.e. tankyrase or poly(ADP-ribose) polymerase
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
    • C12Y304/19—Omega peptidases (3.4.19)
    • C12Y304/19012—Ubiquitinyl hydrolase 1 (3.4.19.12)

Definitions

  • the present invention relates to the field of molecular biology.
  • the present invention relates to a method of compound screening and cancer treatment.
  • Cancer is a major disease worldwide and a major public health concern. External and internal factors can contribute to cancer and some types of genetic mutations are associated with poorer overall survival and disease-free survival in these cancers.
  • Several therapeutic strategies have been used for tumours, including small molecule inhibitors, chemotherapeutic drugs and radiotherapy but they are met with limited success.
  • the present disclosure refers to a method of treating a B API -related tumour in a subject, the method comprising: obtaining a sample from the subject; determining whether BAP1 in the sample is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional.
  • the present disclosure refers to a pharmaceutical composition comprising an LSD1 inhibitor and a PARP inhibitor, wherein the LSD1 inhibitor is SP2577 or SP2509, and wherein the PARP inhibitor is olaparib.
  • the present disclosure refers to a method of screening and identifying an anti-proliferative and anti-cancer compound, the method comprising: obtaining a population of BAP 1 -deficient cells; treating said B API -deficient cell population with the antiproliferative compound and; determining a change in proliferative activity of the population of BAP 1- deficient cells compared to a population of cells producing functional BAP1 protein.
  • Figure 1 shows that intact deubiquitinase function is required for BAP1 to suppress tumour growth.
  • Figure 1(A) shows that mutations in BAP1 are highly prevalent in mesothelioma (MESO), cholangiocarcinoma (CHOL), uveal melanoma (UM) and clear cell renal cell carcinoma (KIRC).
  • Figure 1(B) shows the cell lines used to obtain the data disclosed herein.
  • Bile duct normal cell lines are H69.
  • Cholangiocarcinoma cell lines are human liver bile duct carcinoma cell line (HUCCT1), TBT-CCA-S5 (abbreviated as S5) and extrahepatic bile duct carcinoma cell line (TFK-
  • Mesothelioma cell lines are H28 and H2452.
  • Kidney normal cell lines are human kidney 2 (HK-
  • FIG. 1 shows the immunoblot of B API isogenic cells lines obtained from the bile duct normal cell line (H69), cholangiocarcinoma cell lines (HUCCT1), TBT-CCA-S5 (abbreviated as S5) and extrahepatic bile duct carcinoma cell line (TFK-1).
  • Figure 1(D) shows the immunoblot of BAP1 isogenic cells lines obtained from kidney normal cell lines (which are human kidney 2 (HK-2)) and clear cell renal cell carcinoma cell line UMRC6.
  • Figure 1(E) shows the immunoblot of BAP1 isogenic cells lines made from mesothelioma cell lines H28 and H2452.
  • Figure 1(F) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that loss of BAP1 enhances proliferation in bile duct normal cell lines (H69).
  • Figure 1(G) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that loss of B API enhances proliferation in human bile duct carcinoma cell line (HUCCT1).
  • Figure 1(H) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that only restoring a fully functional BAP1 reduces proliferation in bile duct carcinoma cell line TBT-CCA-S5 (abbreviated as S5).
  • Figure 1(1) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that only restoring a fully functional BAP1 reduces proliferation in extrahepatic bile duct carcinoma cell line (TFK-1).
  • Figure 1(J) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that loss of B API enhances proliferation in normal human kidney cell line (HK-2).
  • Figure 1(K) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that only restoring a fully functional BAP1 reduces proliferation in kidney cancer cell line UMRC6.
  • Figure 1(L) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that only restoring a fully functional BAP1 reduces proliferation in mesothelioma cell line H28.
  • Figure 1(M) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that only restoring a fully functional B API reduces proliferation in mesothelioma cell line H2454.
  • Figure 1(N) is a graph that shows the changes in tumour volume over 50 days which indicates that a functional BAP1 is required to suppress tumour growth in TBT-CCA-S5 EV (S5 EV; whereby EV refers to “empty vector control”), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) mouse xenograft tumours.
  • the mutant BAP1 refers to a BAP1 C91A mutant.
  • Figure 1(0) is a graph that shows the changes in tumour weight which indicates that a functional BAP1 is required to fully suppress tumour growth in TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT) mouse xenograft tumours.
  • Figure 2(A) is a Venn diagram showing that 64 pathways are found to be specifically downregulated in TBT-CCA-S5 BAP1 wild-type (S5 WT) as compared to TBT-CCA-S5 EV (S5 EV) and TBT-CCA-S5 BAP1 mutant (S5 MUT) cell lines and 10 of the 64 pathways are related to DNA damage.
  • Figure 2(B) shows a heatmap that indicates that the expression of genes involved in DNA damage repair were higher in TBT- CCA-S5 EV (S5 EV) and TBT-CCA-S5 BAP1 mutant (S5 MUT) as compared to TBT-CCA-S5 BAP1 wild-type (S5 WT).
  • Figure 2(C) shows a heatmap that indicates that the expression of genes involved in DNA damage repair were higher in cholangiocarinoma, clear cell renal cell carcinoma (ccRCC) and mesothelioma tumours with nonsense or frameshift mutations in BAP1 from the Cancer Genome Atlas (TCGA) compared with cholangiocarinoma, ccRCC and mesothelioma tumours with no mutations in known DNA damage repair genes including BAP1.
  • Figure 2(D) shows the results of immunofluorescence staining using yH2A.X in human bile duct carcinoma cell line (HUCCT1) isogenic cell lines.
  • Figure 2(E) is a bar graph that shows the quantification of the number of cells with more than 10 yH2A.X foci from Figure 2 (D).
  • Figure 2(F) shows the results of immunofluorescence staining using yH2A.X in TBT-CCA-S5 EV (S5 EV), TBT- CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT).
  • Figure 2(G) a bar graph that shows the quantification of the number of cells with more than 10 yH2A.X foci from Figure 2(F).
  • GG-NER global genome nucleotide excision repair
  • TC-NER transcription coupled nucleotide excision repair
  • BER base excision repair
  • NHEJ non homologous end joining
  • HR homologous recombination
  • MMR mismatch repair
  • Figure 3 shows that BAP1 deubiquitinates components of the global genome nucleotide excision repair pathway.
  • Figure 3(A) shows the Venn diagram showing the number of targets identified by PTMScan Ubiquitin Remnant Motif immunoprecipitation of TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) cells.
  • Figure 3(B) shows the results of a gene ontology analysis of the targets in Figure 3 (A), which unveiled four pathways related to GG-NER out of the top eleven significant DNA damage repair related pathways.
  • Figure 3(D) is a graph that shows the relative intensity of nuclear localised XPC at different indicated time points for human bile duct carcinoma cell line (HUCCT1) isogenic cell lines, human bile duct carcinoma cell line (HUCCT1) and BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO).
  • Figure 3(E) is a graph that shows the relative intensity of nuclear localised CSB after 10J/m 2 UV irradiation at different indicated time points for TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wildtype (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT).
  • Figure 3(F) is an in vitro deubiquitination assay performed in human embryonic kidney 293T cells (HEK293T) cells introduced with the indicated plasmids of Damage Specific DNA Binding Protein 1 (DDB1).
  • Figure 3(G) is an in vitro deubiquitination assay performed in human embryonic kidney 293T cells (HEK293T) cells introduced with the indicated plasmids of RAD23 Homolog B, Nucleotide Excision Repair Protein (RAD23B).
  • Figure 3(H) is an in vitro deubiquitination assay performed in human embryonic kidney 293T cells (HEK293T) cells introduced with the indicated plasmids of COP9 signalosome complex subunit 7 (COPS7).
  • HEK293T human embryonic kidney 293T cells
  • COPS7 COP9 signalosome complex subunit 7
  • Figure 3(1) are the colony formation assays for human bile duct carcinoma cell line (HUCCT1) isogenic cell lines, human bile duct carcinoma cell line (HUCCT1) and BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO), which had been transfected with the indicated genes after 10J/m 2 UV irradiation.
  • HCCT1 human bile duct carcinoma cell line
  • HCCT1 KO human bile duct carcinoma cell line
  • Figure 3(J) are the colony formation assays for TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT), which had been transfected with the indicated genes after 10J/m 2 UV irradiation.
  • GG-NER global genome nucleotide excision repair, presence, absence.
  • Figure 4 shows that loss of functional BAP1 sensitises tumour cells to LSD1 inhibitors, SP2509 and SP2577.
  • Figure 4(A) are the colony formation assays of B API isogenic cell lines treated with the indicated concentration of SP2509 in pM, showing that cells without a functional BAP1 are more sensitive to SP2509.
  • Figure 4(B) is a graph that shows the changes in tumour volume of TBT- CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) mouse xenograft tumours treated with 120mg/kg SP2577 (5 on 2 off) over 40 days.
  • Figure 4(C) is a bar graph that shows the percentage of apoptotic cells in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT) after 96-hour treatment with IpM SP2509.
  • HCCT1 human bile duct carcinoma cell line
  • HCCT1 KO BAP1 knockout human bile duct carcinoma cell line
  • TBT-CCA-S5 isogenic cell lines TBT-CCA-S5 EV
  • S5 WT TBT-CCA-S5 BAP1 wild-type
  • S5 MUT TBT- CCA-S5 BAP1 mutant
  • Figure 4(D) shows the immunoblot for apoptosis marker, cleaved PARP1 (c-PARPl) and cleaved caspase 3 (c-Caspase 3) in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after 4 days treatment with IpM SP2509. represents a p-value ⁇ 0.05 and “**” represents a p-value ⁇ 0.005; calculated using Student’s T-test.
  • Figure 5 shows that SP2509 aggravates nucleotide excision repair inefficiency when BAP1 is deficient.
  • Figure 5(A) is a Venn diagram showing pathways altered in TBT-CCA-S5 EV (S5 EV SP) and TBT-CCA-S5 BAP1 mutant (S5 MUT SP) after SP2509 treatment as compared to TBT- CCA-S5 BAP1 wild-type (S5 WT SP) after SP2509 treatment.
  • the control cells are TBT-CCA-S5 EV (S5 EV Con) and TBT-CCA-S5 B API mutant (S5 MUT Con) and TBT-CCA-S5 B API wild-type (S5 WT Con).
  • Figure 5(B) is a bar graph showing fold change in the expression of the indicated genes in TBT-CCA-S5 EV (S5 EV SP), TBT-CCA-S5 WT (S5 WT SP) and TBT-CCA-S5 MUT (SF MUT SP) after SP2509 treatment from RNASeq DEseq2 values.
  • Figure 5(C) shows the immunofluorescence staining of XPC for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after treatment with SP2509. Only the intensities of XPC in the nucleus were quantified.
  • Figure 5(D) shows the immunofluorescence staining of CSCB for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA- S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT) after treatment with SP2509. Only the intensities of CSCB in the nucleus were quantified.
  • Figure 6 shows that SP2509 prevents H3K9me3/2 demethylation during NER.
  • Figure 6(A) shows the co-immunoprecipitation of LSD1 and BAP1 in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT) without or without treatment with SP2509 showing interaction between LSD1 and BAP1.
  • HCCT1 human bile duct carcinoma cell line
  • HCCT1 KO BAP1 knockout human bile duct carcinoma cell line
  • TBT-CCA-S5 isogenic cell lines TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild
  • Figure 6(B) shows the ChlP-Seq profiles of BAP1 and LSD1 in human bile duct carcinoma cell line (HUCCT1), TBT-CCA-S5 WT and TBT-CCA-S5 MUT cell lines with and without SP2509 treatment.
  • Figure 6(C) shows the colony formation assays for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) transfected with the indicated genes with SP2509 treatment.
  • HCCT1 human bile duct carcinoma cell line
  • HCCT1 KO BAP1 knockout human bile duct carcinoma cell line
  • TBT-CCA-S5 isogenic cell lines TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) transfected with the indicated genes with SP2509 treatment.
  • Figure 6(D) shows the immunoblot for H3K4mel, H3K4me2, H3K4me3, H3K9mel, H3K9me2, H3K9me3 in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with and without SP2509 treatment.
  • H3K4mel human bile duct carcinoma cell line
  • BAP1 knockout human bile duct carcinoma cell line HCCT1 KO
  • TBT-CCA-S5 isogenic cell lines TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-
  • Figure 6(E) shows the ChlP-Seq profiles of H3K9mel, H3K9me2 and H3K9me3 in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout humanbile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with and without SP2509 treatment.
  • H3K9mel human bile duct carcinoma cell line
  • BAP1 knockout humanbile duct carcinoma cell line HUCCT1 KO
  • TBT-CCA-S5 isogenic cell lines TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT
  • Figure 7 shows that tumour cells with loss of functional BAP1 are more sensitive to a synergistic combination of SP2509 and olaparib.
  • Figure 7(A) shows a chart of combination indexes for BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO), TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 mutant (S5 MUT) treated with a combination of SP2509 and olaparib.
  • Figure 7(B) shows the colony formation assay of human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after combined treatment of SP2509 and olaparib.
  • HCCT1 human bile duct carcinoma cell line
  • S5 EV TBT-CCA-S5 EV
  • S5 WT TBT-CCA-S5 BAP1 wild-type
  • S5 MUT TBT-CCA-S5 BAP1 mutant
  • Figure 7(C) is a graph which shows that a synergy is also observed in TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) mouse xenograft tumours treated with a combination of 120mg/kg SP2577 and 200mg/kg olaparib (5 on, 2 off for 2 weeks, 3 days per week subsequently).
  • FIG. 7(D) is a graph which shows that a synergy is also observed in CCA-PDX3 tumours treated with a combination of 120mg/kg SP2577 and 200mg/kg olaparib (5 on 2 off for 2 weeks, 3 days per week subsequently).
  • Figure 7(E) is immunohistochemistry staining of Ki67 for CCA-PDX3 after the indicated treatment, which shows that cell proliferation decreased after combined compound treatment.
  • Figure 7(F) a bar graph which shows the percentage of apoptotic cells in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S50 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after 96hour treatment with SP2509, olaparib or a combination of both compounds.
  • HAT1 human bile duct carcinoma cell line
  • S5 EV TBT-CCA-S5 BAP1 wild-type
  • S5 MUT TBT-CCA-S5 BAP1 mutant
  • Figure 7(G) shows the immunoblot for apoptosis marker, cleaved PARP1 (c-PARPl) and cleaved caspase 3 (c-Caspase 3) in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO).
  • Figure 7(H) shows the immunoblot for apoptosis marker, cleaved PARP1 (c-PARPl) and cleaved caspase 3 (c-Caspase 3) in TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after 96-hour treatment with the indicated compounds.
  • c-PARPl cleaved PARP1
  • c-Caspase 3 cleaved caspase 3
  • Figure 7(1) shows the ChlP-Seq profiles of BAP1, LSD1 and PARP1 in human bile duct carcinoma cell line (HUCCT1), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT). Symbols used: “*” represents a p-value ⁇ 0.05 and “**” represents a p-value ⁇ 0.005, calculated using Student’s T- test.
  • Figure 8 shows that BAP1 is a tumour suppressor.
  • Figure 8(A) is a graph which shows the overall survival, progression free survival, disease specific survival and disease-free months for cholangiocarcinoma, mesothelioma and clear cell renal cell carcinoma patients (ccRCC) with BAP1 mutations compared to patients with no BAP1 mutations.
  • Figure 8(B) is an immunoblot which shows that H2AK119UB is a deubiquitinase substrate for functional BAP1 in cholangiocarcinoma isogenic cell lines used in this study.
  • Figure 8(C) is an immunoblot which shows that H2AK119UB is a deubiquitinase substrate for functional BAP1 in ccRCC isogenic cell lines used in this study.
  • Figure 8(D) is an immunoblot which shows that H2AK119UB is a deubiquitinase substrate for functional BAP1 in mesothelioma isogenic cell lines used in this study.
  • Figure 9 shows that BAP1 deubiquitinates components of the GG-NER pathway.
  • Figure 9(B) shows the immunoblotting after 10J/m 2 UV irradiation at different indicated time points for chromatin-bound XPC and CSCB for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT).
  • Figure 9(C) shows the immunoblotting of DDB 1, RAD23B and COPS7B in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) number represents the intensity of the band.
  • Figure 9(D) shows the immunoprecipitation of DDB 1 , RAD23B and COPS7B in human liver duct carcinoma (HUCCT1) and BAP1 knockout human liver bile duct carcinoma (HUCCT1 KO) isogenic cell lines where immunoblotting was performed with K48UB antibodies.
  • Figure 9(E) shows the immunoprecipitation of DDB 1, RAD23B and COPS7B in TBT- CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) where immunoblotting was performed with K48UB antibodies.
  • S5 EV TBT-CCA-S5 EV
  • S5 WT TBT-CCA-S5 BAP1 wild-type
  • S5 MUT TBT-CCA-S5 BAP1 mutant
  • Figure 9(F) shows the colony formation assays for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT) with or without 10J/m 2 UV irradiation.
  • Figure 9(G) shows the control colony formation assays (no UV irradiation) for human bile duct carcinoma (HUCCT1) and BAP1 knockout human bile duct carcinoma (HUCCT1 KO) isogenic cell lines transfected with the indicated genes.
  • Figure 9(H) shows the control colony formation assays (no UV irradiation) for TBT- CCA-S5 isogenic cell lines, TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) transfected with the indicated genes.
  • Figure 10 shows that loss of functional BAP1 sensitises tumour cells to LSD1 inhibitors, SP2509.
  • Figure 10(A) shows the compound screening using SelleckChem anti-cancer small molecule inhibitor screening (422 compounds) on H69 and H69 BAPl-knockout (KO) cell lines. Scoring was performed by subtracting the percentage inhibition of growth of H69 BAP1 knockout (BAP1 KO) cells with the percentage inhibition of growth of H69 cells. SP2509 and olaparib are one of the top hits.
  • Figure 10(B) shows the colony formation assays of BAP1 isogenic cell lines transfected with control of LSD 1 siRNA and shows that cells without a functional BAP1 are more sensitive to the knockdown of LSD1.
  • Figure 10(C) shows the tumours of SP2577 treated TBT-CCA- S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after harvest.
  • Scale bar lcm.
  • Figure 11 shows the presence of increased stimulation and requirement for NER pathway in cells deficient in BAP1 upon treatment with SP2509.
  • Figure 11(A) is a heatmap showing the expression of the genes in the indicated DNA damage repair pathways in TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with, represented by C, and without, represented by S, treatment with SP2509.
  • Figure 11(B) is a bar graph of the results of real-time qPCR which shows the changes in the expression of DDB2 and XPC in TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with or without treatment with SP2509. Values were normalised with the expression in cells without SP2509 treatment.
  • Figure 11(C) shows that LSD1 colocalised with the UV damage DNA adduct marker CPD after localised 10J/m 2 UV treatment through a 5pm isopore membrane.
  • Figure 11(D) shows the immunoblotting of chromatin bound XPC and CSCB after SP2509 treatment in human liver bile duct carcinoma cell line (HUCCT1), BAP1 knockout human liver bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 BAP1 wildtype (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT).
  • GG-NER global genome nucleotide excision repair
  • TC-NER transcription coupled nucleotide excision repair
  • DSB double stranded DNA break repair
  • SSB single stranded DNA break repair
  • MMR mismatch repair.
  • Figure 11(F) shows the nucleosome occupancy profiles in human bile duct carcinoma cell line (HUCCT), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO), TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with or without exposure to SP2509.
  • Figure 12 shows that SP2509 further compromises NER by obstructing chromatin decondensation in B API -related tumours.
  • Figure 12(A) shows an immunoblot of DDB1, RAD23B, COPS7B in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 BAP1 wildtype (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with and without treatment with SP2509.
  • Figure 12(B) shows the colony formation assays for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBTS5 isogenic cell lines, TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) transfected with the indicated genes without SP2509 treatment (control).
  • Figure 12(C) shows the colony formation assays of human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) treated with the indicated concentration of GSK467, CPI-455, ML324 or JIC-04 in pM, showing that cells without a functional BAP1 are more sensitive to H3K9me demethylation inhibitors but not H3K4me demethylation inhibitors.
  • H3K9me demethylation inhibitors but not H3K4me demethylation inhibitors.
  • Figure 13 shows tumour cells with loss of functional BAP1 are more sensitive to olaparib.
  • Figure 13(A) shows the colony formation assays of BAP1 isogenic cell lines treated with the indicated concentration of olaparib in pM, showing that cells without a functional BAP 1 are more sensitive to olaparib.
  • Figure 13(B) shows the changes in TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) mouse xenograft tumours treated with 200mg/kg olaparib (5 on 2 off) measured using tumour volume. “**” represents a p -value ⁇ 0.005; calculated using Student’s T-test.
  • Figure 14 shows that tumour cells with loss of functional BAP1 are more sensitive to a synergistic combination of SP2509 and olaparib.
  • Figure 14(A) shows a chart of combination indexes for human bile duct carcinoma cell line (HUCCT1) and TBT-CCA-S5 WT treated with a combination of SP2509 and olaparib.
  • Figure 14(B) shows colony formation assays of a panel of BAP1 isogenic cell lines of different tumour origins, including uveal melanoma MP46 isogenic cell lines, treated with SP2509, olaparib, or both compounds, showing that treatment with both SP2509 and olaparib is more effective than single.
  • Figure 14(D) shows immunohistochemistry staining for BAP1 in 2 CCA-PDX tumours, and CCA-PDX3 was shown to be negative for BAP1 expression.
  • Figure 14(F) shows the coimmunoprecipitation of LSD1 and BAP1 in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) showing interaction between LSD1, PARP1 and BAP1.
  • Figure 14(G) shows the quantification of the intensities of XPC in the nucleus for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) after treatment with olaparib and SP2509 from immunofluorescence staining. Only the intensities of XPC in the nucleus were quantified.
  • Figure 14(H) shows the quantification of the intensities of XPC in the nucleus for TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 B API mutant (S5 MUT) after treatment with olaparib and SP2509 from immunofluorescence staining. Only the intensities of XPC in the nucleus were quantified.
  • Figure 14(1) shows the quantification of the intensities of CSB in the nucleus for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human liver bile duct carcinoma cell line (HUCCT1 KO) after treatment with olaparib and SP2509 from immunofluorescence staining. Only the intensities of CSB in the nucleus were quantified. represents p-value ⁇ 0.05 ** represents p-value ⁇ 0.005.
  • Figure 14(J) shows the quantification of the intensities of CSB in the nucleus XPC for TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after treatment with olaparib and SP2509 from immunofluorescence staining. Only the intensities of CSB in the nucleus were quantified. represents p-value ⁇ 0.05; “**” represents p-value ⁇ 0.005.
  • FIG. 15 is a figure which shows that when the NER pathway is activated, recognition proteins such as PARP1, DDB1, RAD23B, COPS7B are recruited to the site of lesion.
  • BAP1 maintains the level of DDB1, RAD23B and COPS7B while LSD1 demethylates H3K9me2 to aid chromatin decondensation.
  • BAP1 is mutated, lesion recognition is affected, delaying NER.
  • Further inhibition of PARP1 or/and LSD1 by using olaparib or SP2509/ SP2577 further abrogates lesion recognition or/and hinder DNA winding for repair respectively, impeding NER, tipping the cells towards apoptosis.
  • Figure 16 shows that treatment with SP2509 and olaparib alone or in combination does not cause significant toxicity in mouse models and cells.
  • Figure 16(A) shows no significant changes in the weight of mice treated with TBT-CCA-S5 EV (S5 EV) and vehicle control; TBT-CCA-S5 EV (S5 EV) and a combination of SP2509 and olaparib; TBT-CCA-S5 BAP1 wild-type (S5 WT) and vehicle control; TBT-CCA-S5 BAP1 wild-type (S5 WT) and a combination of SP2509 and olaparib; TBT-CCA-S5 BAP1 mutant (S5 MUT) and vehicle control; and TBT-CCA-S5 BAP1 mutant (S5 MUT) with a combination of SP2509 and olaparib; over a period of four weeks post-treatment.
  • Figure 16(B) are histological images showing no significant morphological changes in the kidney, liver and sple
  • Figure 17 is an in vitro cell survival assay data showing the cell survival rates in cell lines of different tumour origins, including cholangiocarcinoma (CCA), renal cell carcinoma (ccRCC), mesothelioma and uveal melanoma cell lines, measured over a period of 9 days after treatment with SP2509 alone, olaparib alone, or with a combination of SP2509 and olaparib.
  • Figure 17(A) shows that upon treatment with SP2509, cells lacking functional BAP1 had lower survivability compared to cells with functional BAP1.
  • Figure 17(B) shows that cells upon treatment with a combination of SP2509 and olaparib, cells lacking functional BAP1 had lower survivability compared to cells with functional BAP1.
  • Figure 17(C) shows upon treatment with olaparib, cells lacking functional BAP1 had lower survivability compared to cells with functional BAP1.
  • Figure 18 is a bar graph showing the percentage inhibition of cell growth in bile duct normal (H69) cells and H69 BAPl-knockout (KO) cells upon treatment with LSD1 inhibitors, OG- L002, SP2509, and GSK-LSD1.
  • anti -proliferative refers to a resulting decrease of cell growth (also referred to as proliferation).
  • An anti-proliferative effect means cell proliferation is decreased when an anti-proliferative compound is applied to said cells.
  • cells with mutant or non-functional BAP1 are shown to proliferate at a higher rate compared to cells with functional BAP1.
  • cell proliferation can be measured using, but not limited to, a cell viability assay, cell-staining, immunohistology, and the like.
  • anti-proliferative as used herein can be used synonymously with the term “anti -cancer”.
  • BAP 1 refers to both the gene that expresses, and the protein
  • BRCA-1 associated protein 1 It has been shown herein that the loss of functional gene BAP1 (written in italics) also leads to the loss of the functional protein BAP1 (written without italics), using immunoblotting for BAP1 expression. Therefore, the terms “BAP1” (with italics) and “BAP1” (without italics) are used interchangeably, and which is to be used is understood depending on the context of the present disclosure.
  • B API -deficient refers to both loss of BAP1 and loss of functional BAP1.
  • knocking out BAP1 leads to loss of BAP1, and introducing mutant (non-functional) forms of BAP1 likewise leads to loss of functional BAP1.
  • BAP 1 -related cancer refers to cancer that are caused, for example, by deficient BAP1. Such cancers can also be referred to as being B API -deficient, or BAP 1 -dependent cancers. These terms are used synonymously throughout the present specification.
  • GG-NER global genome nucleotide excision repair
  • TC-NER transcription coupled nucleotide excision repair
  • BER base excision repair
  • NHEJ non homologous end joining
  • HR homologous recombination
  • MMR mismatch repair
  • BAPP BRCA-1 associated protein 1
  • HCC hepatocellular carcinoma
  • the BAP1 gene is a tumour suppressor gene that encodes for a nuclear-localised deubiquitinating enzyme (DUB).
  • the BAP1 protein consists of a N-terminal ubiquitin carboxyl hydrolase domain (UCH), a host cell factor 1 (HCF1) binding domain (HBM), a nuclear localisation signal (NLS), and other domains for protein-protein interaction, such as, but not limited to, a C- terminal domain (CTD) with a coiled-coil motif.
  • CCD C- terminal domain
  • the ubiquitin carboxyl hydrolase domain confers the BAP1 protein with deubiquitinating capabilities through the catalytic triad that is made up of a cysteine, histidine and aspartic acid amino acid.
  • the BAP1 protein functions as a tumour suppressor via its deubiquitinase activity, regulating many cellular processes such as regulation of gene transcription, apoptosis, metabolism, protein turnover, epithelial- mesenchymal transition, cell cycle control and DNA damage repair.
  • DNA damage The integrity of DNA is constantly challenged by many endogenous or exogenous factors, which include replication errors, reactive oxygen species, ultraviolet radiation or carcinogens.
  • the damaged DNA has to be recognised and repaired, else genome instability will arise, leading to diseases, such as, but not limited to, cancer.
  • Cells react to DNA damage by activating different DNA damage response pathways depending on the type of DNA lesion, which may be single or doublestrand breaks, DNA mismatches, bulky DNA adducts, damaged or inappropriate bases, in order to repair the lesion appropriately. Accumulation of unresolved DNA damage will cause cell death, which is vital for the whole organism to maintain genome integrity and function normally.
  • PARP1 Poly(ADP-ribose) Polymerase 1
  • DDR DNA damage repair pathway
  • proteins with roles in chromatin modification such as, for example, Suppressor of Variegation 3-9 Homolog 2 (Suv39H2), Lysine-specific histone demethylase 1A (LSD1), and BAP1 are recruited for the repair of DNA double-stranded.
  • the B API protein allows for the assembly of various factors involved in homologous recombination repair, such as BRCA1 and RAD51, to the site of DNA double stranded breaks.
  • the BAP1 protein can also deubiquitinate Histone 2A (H2A) in the proximity of the DNA lesion, which can increase accessibility of the chromatin to DNA repair proteins involved in other repair processes such as DNA resection.
  • H2A deubiquitinate Histone 2A
  • the BAP1 protein is thought to be involved in other DNA damage repair pathways, but this has yet to be reported.
  • Inactivation of BAP1 has been associated with the progression and aggressiveness of various cancers, including, but not limited to hepatocellular carcinoma, stomach cancer, cholangiocarcinoma (CCA), renal cell carcinoma (RCC), uveal melanoma (UM) and mesothelioma (MPM).
  • CCA cholangiocarcinoma
  • RRC renal cell carcinoma
  • UM uveal melanoma
  • MPM mesothelioma
  • BAP1-related tumours are increasing steadily world-wide.
  • BAP1 mutations are associated with poorer overall survival and disease-free survival in these cancers.
  • Several therapeutic strategies have been used for BAP1- related tumours, including, but not limited to, small molecule inhibitors (for example, EZH2 inhibitors), chemotherapeutic drugs (for example, gemcitabine), and radiotherapy, all of which have been met with limited success.
  • a method of treating a BAP1- related tumour in a subject comprising the stages of obtaining a sample from the subject; determining whether BAP1 in the sample is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional.
  • the method comprising the stages of obtaining a sample from the subject; determining whether BAP1 in the sample is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional, wherein the LSD1 inhibitor is SP2509 or SP2577.
  • a PARP inhibitor and a LSD1 inhibitor in the manufacture of a medicament for treating a BAP1- related tumour in a subject.
  • the disclosure refers to a PARP inhibitor and a LSD1 inhibitor for use in treating a BAP1- related tumour.
  • the method of treating a BAP1- related tumour comprises determining whether BAP1 is functional or non-functional. Such a determination can be made, for example, in a sample obtained from a subject.
  • the method of treating a BAPl- related tumour comprises administering to the subject an amount of a PARP inhibitor.
  • the method of treating a BAP1- related tumour comprises administering to the subject an amount of a LSD1 inhibitor.
  • the amounts disclosed herein are therapeutic amounts.
  • the method of treating a BAP1- related tumour comprises administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor.
  • the compounds or pharmaceutical compositions disclosed herein are to be administered to the subject if BAP1 is or is found to be non-functional.
  • a method of treating a BAP1- related tumour in a subject comprising obtaining a sample from the subject; determining whether BAP1 in the sample is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional.
  • the LSD1 inhibitor is, but is not limited to, SP2509, SP2577, OG-L002, GSK-LSD1, and siRNA that targets LSD1.
  • the method comprises determining whether BAP1 is functional or non-functional in a sample obtained from a subject; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional, wherein the LSD1 inhibitor is SP2509 or SP2577.
  • the method comprises determining whether BAP1 in a sample obtained from a subject is functional or nonfunctional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional, wherein the LSD1 inhibitor is SP2509.
  • the method comprises determining whether BAP1 in a sample obtained from a subject is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP 1 in the subject is non-functional, wherein the LSD1 inhibitor is SP2577.
  • the method comprises determining whether BAP1 in a sample obtained from a subject is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the subject is non-functional, wherein the LSD1 inhibitor is an siRNA that targets LSD1.
  • the method comprises determining whether BAP1 in a sample obtained from a subject is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the subject is non-functional, wherein an siRNA that targets SEQ ID NO: 1.
  • BAP1 protein was shown to be involved in DNA damage nucleotide excision repair (NER) pathway by regulating the turnover of proteins that are important in DNA lesion recognition.
  • NER DNA damage nucleotide excision repair
  • Growth of BAP1- related tumours is inhibited by various inhibitors, for example, but not limited to, the LSD1 inhibitor, SP2509, SP2577, GG-L002, GSK-LSD1, and siRNA that targets LSD1, and the PARP inhibitor, olaparib.
  • the method disclosed herein is a method of treating a BAP1- related tumour in a subject, the method comprising obtaining a sample from the subject; determining whether BAP1 in the sample is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional, wherein the LSD1 inhibitor is SP2509, SP2577, GG-L002, GSK-LSD1, and siRNA that targets LSD1.
  • the LSD1 inhibitor is SP2509 or SP2577.
  • the method disclosed herein describes treating a BAP1- related tumour with an LSD1 inhibitor and a PARP inhibitor.
  • LSD1 inhibitor refers to one or more compounds that target and inhibit the function of the LSD1 gene or the LSD1 protein, either directly or indirectly. Such an inhibition can be a reversible or irreversible inhibition.
  • the effect of such inhibitors of LSD 1 can be, for example, a reduction in cell proliferation, a reduction in the production of inflammatory cytokines.
  • an LSD1 inhibitor can be, but is not limited to, a compound that targets a H3 pocket in LSD1.
  • the LSD1 inhibitor refers to but is not limited to, a compound that targets LSD1 to regulate gene expression.
  • An LSD1 inhibitor also refers to, but is not limited to, a compound that targets LSD1 to regulate or modulate gene expression related to DNA repair, or that targets LSD 1 -mediated DNA repair directly on a protein level.
  • the LSD1 inhibitor refers to, but is not limited to, a compound that targets LSD1 for DNA methylation.
  • the LSD1 inhibitor refers to but is not limited to, a compound that targets LSD1 for autophagy.
  • an LSD1 inhibitor can be, but is not limited to, a peptide, an organic compound, a synthetic compound, and siRNA.
  • an LSD1 inhibitor can be, but is not limited to, a 2-PCPA derivative or other racemic mixtures thereof, a N-alkylated 2-PCPA derivative, a compound that contains a benzohydrazide scaffold, a compound that contains a tetrahydrofolate, a polymyxin antibiotic,
  • the LSD1 inhibitor is SP2509, SP2577, OG-L002, or GSK-LSD1.
  • the LSD1 inhibitor is SP2509. In another example, the LSD1 inhibitor is SP2509.
  • an LSD1 inhibitor can be, but is not limited to, an siRNA.
  • siRNA refers to small or short interfering RNA molecules. These siRNAs are able to target and silence a target gene or a gene of interest, such as, for example, knocking down or knocking out a target gene.
  • the siRNA-based inhibitor is an siRNA sequence that targets all or part of an mRNA sequence of LSD1. In one example, the siRNA binds to or targets part or all of the cDNA sequence of LSD1.
  • the target sequence of the siRNA is GCCCAAAGAAACTGTGGTGTCTCGTTGGCGTGCTGATCCCTGGGCTCGGGGCTCTTATT CCTATGTTGCTGCAGGATCATCTGGAAATGACTATGATTTAATGGCTCAGCCAATCACT CCTGGCCCCTCGATTCCAGGTGCCACAGCCGATTCCACGACTCTTCTTTGCGGGAGA ACATACGATCCGTAACTACCCAGCCACAGTGCATGGTGCTCTGCTGAGTGGGCTGCGAG AAGCGGGAAGAATTGCAGACCAGTTTTTGGG (SEQ ID NO: 1).
  • the siRNA is a mixture of siRNA sequences.
  • the mixture of siRNA sequences can be a heterogenous or homogenous mixture of siRNAs.
  • PARP inhibitor refers to a compound that targets and/or binds the PARP1 gene or the PARP protein family (including, for example, but not limited to, PARP1, PARP2 and others) and inhibits function of the same.
  • the binding of such an inhibitor can be reversible or irreversible.
  • the results of PARP inhibition are, but are not limited to, suppression of the repair of DNA damage, increase in efficacy of DNA-alkylating agents, inactivation of the DNA damage repair system, inducing the formation of double-stranded DNA breaks, apoptosis, or radiosensitize tumour cells.
  • Examples of a PARP inhibitors are, but are not limited to, a nicotinamide analogue, a benzamide analogue, a quinazoline analogue, a compound comprising a carboxamide group of the benzamide pharmacophore in the second aromatic ring, niraparib, rucaparib, olaparib, or combinations thereof.
  • Structures of PARP inhibitors can be, but are not limited to,
  • the PARP inhibitor is niraparib, rucaparib, olaparib, or combinations thereof. In another example, the PARP inhibitor is olaparib.
  • the method disclosed herein comprises administering olaparib and an LSD1 inhibitor. In another example, the method comprises administering niraparib and an LSD1 inhibitor. In another example, the method comprises administering rucaparib and a LSD1 inhibitor.
  • the method disclosed herein comprises administering olaparib and an siRNA that targets LSD1.
  • the method comprises administering niraparib and an siRNA that targets LSD1.
  • the method comprises administering rucaparib and a siRNA that targets LSD1.
  • the method comprises administering SP2509 and a PARP inhibitor. In another example, the method comprises administering SP2577 and a PARP inhibitor.
  • the PARP inhibitor is olaparib and the LSD1 inhibitor is SP2509 or SP2577. In another example, the PARP inhibitor is olaparib and the LSD1 inhibitor is SP2509. In yet another example, the PARP inhibitor is olaparib and the LSD1 inhibitor is SP2577.
  • the inhibitors and compounds disclosed herein can be administered to the subject in need thereof in the form of one or more pharmaceutical compositions.
  • Such pharmaceutical compositions can include pharmaceutically adjuvants, pharmaceutically carriers, and the like.
  • the PARP inhibitor is comprised in one pharmaceutical composition
  • the LSD1 inhibitor is comprised in another pharmaceutical composition.
  • the pharmaceutical compositions disclosed herein can be administered to the subject sequentially, simultaneously as separate pharmaceutical compositions, or simultaneously in a single pharmaceutical composition.
  • a method of treating a BAPl-related tumour also referred to as a BAP 1 -dependent or B API -deficient tumour
  • the tumour is a cancer tumour.
  • the tumour can be, but is not limited to, to a mesothelioma, a melanoma and a carcinoma tumour, as exemplary types of tumours or cancers.
  • the tumour can be, but is not limited to, cholangiocarcinoma, hepatocellular carcinoma, mesothelioma, uveal melanoma, stomach cancer, and renal cell carcinoma tumour.
  • the method disclosed herein is used to treat any one or more of the following cancers: mesothelioma, cholangiocarcinoma (CCA), clear cell renal cell carcinoma (ccRCC), and/or uveal melanoma.
  • CCA cholangiocarcinoma
  • ccRCC clear cell renal cell carcinoma
  • uveal melanoma any one or more of the following cancers: mesothelioma, cholangiocarcinoma (CCA), clear cell renal cell carcinoma (ccRCC), and/or uveal melanoma.
  • tumours can be classified by their location in the body of a subject.
  • the tumour can be, but is not limited to, a bile duct tumour, a kidney tumour, a heart tumour, a lung tumour, a uveal tumour, breast tumour, skin tumour, thyroid tumour, colon tumour, bladder tumour, stomach tumour, prostate tumour, hepatocellular tumour, pancreatic tumour, cholangiocarcinoma tumour, and an abdomen tumour.
  • the tumour is, but is not limited to, a bile duct tumour, a kidney tumour, a heart tumour, a lung tumour, a uveal tumour, and an abdomen tumour.
  • the method of screening comprises obtaining a population of BAP 1 -deficient cells.
  • the method of screening comprises treating a population of BAP 1 -deficient cells with an anti-proliferative compound.
  • the method of screening comprises treating a population of BAP 1 -deficient cells obtained from a subject with an anti-proliferative compound.
  • the method of screening comprises determining a change in proliferative activity of a population of B API -deficient cells compared to a population of cells producing functional BAP1 protein.
  • the method of screening comprises determining a change in proliferative activity of a population of BAP 1 -deficient cells obtained from a subject compared to a population of cells producing functional BAP1 protein.
  • a method of screening and identifying an anti-proliferative compound comprising the stages of obtaining a population of B API -deficient cells, treating said BAP 1 -deficient cell population with the anti -proliferative compound and, determining a change in proliferative activity of the population of B API -deficient cells compared to a population of cells producing functional BAP1 protein.
  • a method of screening and identifying an antiproliferative compound wherein the population of B API -deficient cells is derived from a tumour. In one example, there is disclosed a method of screening and identifying an anti-proliferative compound wherein the population of BAP 1 -deficient cells derived from a tumour is from a patient thought to be suffering from a B API -dependent cancer.
  • a reagent in the manufacture of a kit for diagnosing a B API -related cancer.
  • analyses include, but are not limited to, genetic analysis, expression analysis (for example using heatmaps), analysis of mRNA or RNA relating to BAP1, protein expression analysis, protein function analysis and the like.
  • a person skilled in the art would also be aware what parts would be required in such a kit for determining whether a sample is B API -related in the context of the present invention.
  • kits can be, but are not limited to, buffers, primers, digestion enzymes, detection reagents, developing reagents, polymerases, supports for imaging, chromatography gels, SDS-PAGE gels, and the like.
  • Loss of BAP1 is a driver for cancer development in multiple cancers with high incidence rates, such as, but not limited to mesothelioma, cholangiocarcinoma, uveal melanoma and ccRCC.
  • BAP1 -inactivating mutations generally correlate with cancer aggressiveness, low overall survival, disease-free survival, and poor response to chemotherapy.
  • Limited successful therapeutic strategies are available to treat BAP1- related cancers on both a genetic and proteomic level.
  • EZH2 and PARP inhibitors are in clinical trials for cancer patients with BAP1 defects, no complete responders have been observed in completed clinical trials. Most studies focus on targeting BAP1 loss in single cancer, but such therapeutic discoveries may not be applicable to other cancer types.
  • a comprehensive pan-cancer approach is applied to search for compounds that can effectively inhibit the tumour growth of BAP1- related cancers.
  • at least the following candidates, SP2509, SP2577, and olaparib have been identified and have shown the ability to act in combinational synergy.
  • olaparib can be replaced with niraparib.
  • the transcriptomic profiling disclosed herein indicates the necessity of BAP1 deubiquitinase function in repairing multiple types of DNA damage responses, including nucleotide excision repair (NER) and homologous recombination.
  • the BAP1 protein has been reported to be recruited to the sites of DNA double stranded breaks to promote repair by homologous recombination, possibly by deubiquitinating H2Aub at these sites to increase chromatin accessibility to allow for subsequent repair procedures.
  • BAP1 has also been shown to mediate repair of another type of DNA lesion, namely DNA bulky adducts.
  • Potential deubiquitination targets of BAP 1 have been identified as DDB1, RAD23B and COPS7B. These targets are essential to recognise DNA bulky adducts in the GG-NER pathway. Without BAP1, the global genome nucleotide excision repair (GG-NER) process is consequently hindered by elevated levels of DNA damage.
  • GG-NER global genome nucleotide ex
  • SP2509 a LSD1 inhibitor
  • SP2509 a LSD1 inhibitor
  • LSD1 is important in chromatin de-condensation, which is important and common after DNA recognition step for both global genome nucleotide excision repair (GG-NER) and transcription-coupled nucleotide excision repair (TC-NER). Impairment of both crucial steps obstructs NER, resulting in accumulation of unresolved DNA lesions, and thereby causing apoptosis.
  • GG-NER global genome nucleotide excision repair
  • TC-NER transcription-coupled nucleotide excision repair
  • BAP1, LSD1 and PARP1 can interact at a protein and a chromatin level. This information indicates that, under some circumstances, during nucleotide excision repair (NER), BAP1, LSD1 and PARP1 are in such close proximity that they associate with each other.
  • NER nucleotide excision repair
  • PARP is a well-studied molecule in DNA damage repair responses, with promiscuity for recognition of various types of DNA lesions.
  • Several single cancer type studies have also shown that PARP inhibitors can reduce growth of BAP 1 -deficient cells.
  • At least three PARP inhibitors, olaparib, niraparib and rucaparib, have already been approved by the FDA for different malignancies, such as, breast, prostate and ovarian cancer.
  • Olaparib is also one of compounds identified in the compound screening assay disclosed herein and had been shown herein to effectively inhibit the growth of BAP 1 -deficient cells. When SP2509 and olaparib are used in tandem, combinational synergism is observed.
  • BAP1 can exert its function as a tumour suppressor by regulating other cellular processes.
  • BAP1 has been shown to mediate the turnover of type 3 inositol- 1, 4, 5 -trisphosphate receptor (IP3R3), promoting apoptosis by regulation calcium (Ca2 + ) release from the endoplasmic reticulum into the cytosol and mitochondria.
  • IP3R3 type 3 inositol- 1, 4, 5 -trisphosphate receptor
  • Epigenetic modulation of H2Aub by BAP1 to regulate the expression of various pro-survival genes has been shown to affect apoptotic pathways.
  • epigenetic remodelling also links BAP1 to metabolism-related biological processes that promotes ferroptosis.
  • drug toxicity refers to any potentially harmful, unintended effects (also referred to as side effects) that an inhibitor, compound, or drug can have on a living subject when administered to the same.
  • a toxic effect of a drug is visualised in a marked reduction, for example, animal model weight.
  • the toxic effect of the inhibitors disclosed herein is shown in both in vitro and in vivo models used herein, thereby underlining the safety of the claimed inhibitors in treatment.
  • the inhibitors are a combination of SP2577/SP2509 and olaparib.
  • SP2577/SP2509 and olaparib that effectively inhibit tumour growth in BAP1- related cancer cells of different cancer types.
  • NER nucleotide excision repair
  • the efficacy of SP2577/SP2509 and olaparib is evident in both in vitro and in vivo models used herein. These compounds are therefore therapeutic strategies for treating BAP1- related cancers.
  • TBT-CCA-S5 (abbreviated as S5) is an in-house patient-derived cell line that is BAP1 deficient.
  • BAP1 WT denoted as WT
  • BAPl MUT denoted as MUT
  • UCH abrogated ubiquitin carboxyl hydrolase
  • BAP1 protects cells from DNA damage through its deubiquitinase activity
  • transcriptomic pathways differentially expressed in TBT-CCA-S5 EV and TBT-CCA-S5 MUT cell lines were compared to TBT-CCA-S5 WT cell lines ( Figure 2(A)).
  • 64 pathways found to be specifically downregulated in TBT-CCA-S5 WT as compared to TBT-CCA-S5 EV and TBT-CCA- S5 MUT cell lines 10 of the pathways are related to DNA damage ( Figure 2(A)).
  • GG-NER global genome nucleotide excision repair
  • BAP1 deubiquitination targets include H2AK119Ub, FOXK2, HCF-1, MBD5, MBD6 and OGT.
  • a highly sensitive PTMScan Ubiquitin Remnant Motif immunoprecipitation method was used, followed by mass spectrometry, to identify additional deubiquitination targets of BAP1.
  • 235 peptides of such deubiquitination targets of BAPl were only found ubiquitinated in S5 EV and S5 MUT cell lines ( Figure 3(A)).
  • GG-NER Global genome nucleotide excision repair
  • TC-NER transcription-coupled nucleotide excision repair
  • NER transcription-coupled nucleotide excision repair
  • GG-NER global genome nucleotide excision repair
  • CSA and CSB are responsible for identifying the lesion and releasing the stalled RNA polymerase II from actively transcribed sites.
  • COPS7B regulates the activity of both DDB1 and CSA.
  • the remaining repair processes in the two of nucleotide excision repair (NER) pathways are identical.
  • the lesion is verified and the DNA is unwound by helicase activity, allowing other protein complexes access to define the cleavage site and strand specificity, the damaged DNA region is cleaved and the excised DNA then replaced with a newly synthesised DNA patch.
  • XPC and CSB are essential for recruitment of other downstream components needed for nucleotide excision repair (NER) and are therefore good indicators for the progression of global genome nucleotide excision repair (GG-NER) and transcription-coupled nucleotide excision repair (TC-NER), respectively.
  • GG-NER global genome nucleotide excision repair
  • TC-NER transcription-coupled nucleotide excision repair
  • BAP 1 can therefore regulate the turnover of DDB 1 , RAD23B and COPS7B , to mediate global genome nucleotide excision repair (GG-NER) progression.
  • the endogenous protein levels of DDB 1 , RAD23B and COPS7B were higher ( Figure 9(C)) and ubiquitination level of DDB 1 , RAD23B and COPS7B were lower ( Figure 9(D), (E)) in cells with functional BAP1, suggesting that deubiquitination by BAP1 can protect them from degradation.
  • SP2509 was proven to be effective in inhibiting the clonogenic potential of B API -deficient cells originating from mesotheliomas, cholangiocarcinoma (CCA) and clear cell renal cell carcinomas (ccRCC), dependent on intact UCH function of BAP1 ( Figure 4(A)).
  • the percentage survival of cells deficient in functional BAP1 treated with a combination of SP2509 and olaparib was consistently lower than cells deficient in functional BAP1 treated with S2509 only (CCA cell line: about 20-40% percentage survival of cells treated with SP2509 only vs about 10-20% percentage survival of cells treated with SP2509 and olaparib; ccRCC cell line: about 40% percentage survival of cells treated with SP2509 only vs about 10-20% percentage survival of cells treated with SP2509 and olaparib; Mesothelioma cell line: about 20-30% percentage survival of cells treated with SP2509 only vs about 10-20% percentage survival of cells treated with SP2509 and olaparib; uveal melanoma cell line: about 40% percentage survival of cells treated with SP2509 only vs about 15% percentage survival of cells treated with SP2509 and olaparib) ( Figure 17(A) and Figure 17(B)).
  • SP2509 further compromises nucleotide excision repair (NER) by obstructing chromatin decondensation in BAPl-related tumours
  • NER nucleotide excision repair
  • GG-NER global genome nucleotide excision repair
  • TC-NER transcription-coupled nucleotide excision repair
  • ATAC-Sequencing analysis showed that SP2509 affects chromatin accessibility and nucleosome occupancy in cells with functional B API .
  • Nucleosome occupancy profiles in human bile duct carcinoma cell line (HUCCT), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO), TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with or without exposure to SP2509 were investigated using ATAC-Sequencing (Figure 11(F)).
  • LSD1 can interact with BAP1 to effect nucleotide excision repair (NER), but did not affect or depend on BAP1 deubiquitination targets. Without being bound by theory, LSD1 is therefore thought to play a role in nucleotide excision repair (NER) steps after DNA damage recognition.
  • NER nucleotide excision repair
  • ESDI is a histone demethylase that is capable of catalysing the demethylation of mono- and di-methylated histone 3 lysine 4 (H3K4me2 and H3K4mel) and histone 3 lysine 9 (H3K9me2 and H3K9mel).
  • H3K4me2 and H3K4mel histone 3 lysine 4
  • H3K9me2 and H3K9mel histone 3 lysine 9
  • H3K9mel mark is known to be associated with the euchromatin, where the chromatin structure is relaxed.
  • H3K9me2 and H3K9me3 have been found in the heterochromatin region, where the chromatin structure is compact.
  • H3K9me3 has been shown to promote the formation of heterochromatin regions. Therefore, taken together, the data suggests that LSD1 can play roles downstream to damage recognition in nucleotide excision repair (NER) by decondensing the DNA through demethylation of H3K9me3/2 to enable nucleotide excision repair (NER) to proceed smoothly.
  • NER nucleotide excision repair
  • GG-NER global genome nucleotide excision repair
  • Tumour cells with loss of functional BAP1 are more sensitive to a synergistic combination of SP2509 and olaparib
  • PARP catalyses the polymerisation of a negatively charged poly (ADP-ribose) (PAR) to itself and its target proteins. Proteins involved in a DNA damage response are recruited to the sites of DNA damage through non-covalent binding to PAR. PARP has been reported to play multiple roles in nucleotide excision repair (NER). PARP1 is one of the first proteins to recognise and arrive at the site of lesion and will add PAR to itself. DDB2 and XPC will then be recruited by binding to PAR. Other proteins recruited through binding to PAR include chromatin remodelers involved in chromatin decondensation and proteins required for lesion verification. Therefore, PARP plays an important role in facilitating efficient nucleotide excision repair (NER).
  • NER nucleotide excision repair
  • Hematoxylin and eosin-stained histology images do not show morphological changes in tissues of the liver, kidney and spleen of mice dosed with SP2577 and olaparib singly and in combination ( Figure 16(B)). This data suggests that treatment with SP2577 or olaparib alone or in combination results in little to no adverse effects on mice organ structures.
  • LSD1 inhibitors were assessed by measuring the percentage inhibition of growth in cells were treated with LSD1 inhibitors, OG-L002, SP2509, and GSK-LSD1. The results demonstrated that LSD1 inhibitors were effective in inhibiting cell growth in cells deficient in BAP1 ( Figure 18). The Y-axis indicates the normalised percentage inhibition of cell growth in H69 BAP1 KO cells, wherein the read out had been normalised to that of the H69 cells.
  • H69 was obtained from D. Jefferson (New England Medical Center, Tufts University) and cultured in H69 enriched media as previously described (82).
  • HUCCT1 HRRB
  • TFK-1 DSMZ
  • HK-2 ATCC
  • H28 ATCC
  • H2454 ATCC
  • UMRC-6 Sigma Aldrich
  • TBT- CCA-S5 was derived from patient tumours. Briefly, tumour cells were dissociated from primary tumours using collagenase, seeded and maintained in H69 enriched media (82).
  • BAP1 was knocked out using CRISPR-Cas9 mediated gene editing in H69, HUCCT1 and HK-2.
  • Two gRNAs were ligated into BbsI digested vectors. Left gRNA was cloned into the BbsI digested pX330A-2A-GFP- 1X2 (Addgene #58766, with addition of green fluorescent protein (GFP)) whereas the right gRNA was cloned into a BbsI digested pX330S backbone (Addgene #58778).
  • Golden gate assembly was performed to assemble the two gRNAs into the pX330A-2A-GFP-lX2 plasmid, which was transfected into cells using Lipofectamine 3000 (Thermo Scientific). Individual GFP-positive single cells were collected and cultured. Individual clones were validated by polymerase chain reaction (PCR) of genomic DNA and the expression of B API was confirmed to be knocked out by immunoblotting. Three to five individual knockout clones were pooled to form the final knockout cell line.
  • PCR polymerase chain reaction
  • the gRNAs used for deletion of B API are:
  • the cDNA of wildtype and mutant (C91S) BAP1 were cloned from pcDNA3.1 zeo(-)/BAPl and pcDNA3.1 zeo(-)/BAPl (C91A) plasmids, respectively.
  • the cDNA was either cloned into pBabe (Addgene 1764) or pLenti-GFP (Addgene 17448).
  • Retroviruses were packaged using Platinum-A (Plat-A) Retroviral Packaging Cell Line, while lentiviruses were packaged using HEK93T cells with packaging plasmid psPAX2 (Addgene 12260) and the envelope plasmid pMD2.G (Addgene 12259). Cells were selected with puromycin for 3 days.
  • the cDNA of DDB 1 , RAD23B and COPS7B was cloned from cDNA extracted from H69 cells.
  • the cDNAs were then cloned to pCMV-FLAG N-terminal Flag tagged plasmid. These plasmids were then transiently introduced into indicated cells using Lipofectamine 3000 (Thermo Scientific) for in vitro ubiquitination study.
  • the cDNAs were also cloned into pLenti-GFP (Addgene 17448). Lentiviruses were packaged using HEK93T cells and transfected cells were selected by puromycin selection. These cells are used for colony formation assays.
  • Clonogenic assays were performed by seeding of 10,000 cells in 6-well plates one day before addition of compounds disclosed herein or transfection of indicated plasmid. The cells were allowed to grow for 7-9 days before staining by crystal violet.
  • the compounds used herein are: olaparib (Santa Cruz, sc-302017), SP2509 (Selleckchem, S7680), ML324 (Targetmol, T6593), JIB- 04 (Targetmol, T1868), CPI-455 (Targetmol, T3552), GSK467 (Targetmol, T5484).
  • the siRNA used herein is siLSDl(Sigma Aldrich, EHU098171).
  • IxlO 5 cells were seeded in 6-well plates and treated with indicated agents for 96 hours. Apoptotic cells were quantified using the Annexin V-FITC Apoptosis detection kit (Thermo scientific) according to the manufacturer’s protocol. Data was acquired and analysed using BD FACSCalibur Flow Cytometer (BD Biosciences) and Flowjo.
  • Olaparib (Targetmol) was dissolved in DMSO and diluted to 25mg/mL in PBS containing 10% 2-hydroxy-propyl-beta-clodextrin.
  • SP 2577 (Ctech Global) was dissolved in solution containing 10% ethanol, 40% PEG-400 and 50% PBS (pH 9.0). After the subcutaneous implanted tumours reach a calculated average volume of 50-100 mm3, the mice (minimum 30g in weight) were randomised into 2 treatment groups: (1) Compound and (2) vehicle control.
  • Olaparib was dosed by oral gavage and SP2577 was dosed by i.p. once daily for 5 consecutive days a week (5 on, 2 off).
  • the compounds were first dosed for 5 consecutive days a week (5 on, 2 off) for 2 weeks, and then subsequently dosed 3 evenly spaced-out days a week (1 on, 1 off, 1 on, 1 off, 1 on, 2 off).
  • the mice were provided with food and water ad libitum and monitored for changes in general health daily. Tumour volume was monitored every 3-4 days. Tumour volume was calculated as (length x width x width) x 71/6. Animals were sacrificed when the total tumour volume on both flanks exceeded 2000 mm 3 .
  • mice weight was measured weekly basis to ensure no drastic loss in weight after drug regimen was started.
  • the kidney, spleen, and liver of the mice were harvested and fixed in formalin.
  • the fixed tissues were embedded in paraffin blocks and then sectioned onto slides. Hematoxylin and eosin staining was performed on the sectioned tissues and the morphology observed under a light microscope.
  • At least 10 ng of the amplified DNA was used for library preparation with NEBNext ChlP-Seq library prep reagent set (NEB). Each library was sequenced to an average depth of 20-50 million reads on HiSeq4000 or Novaseq.
  • Antibodies used for ChlP-Seq are: BAP1 (Santa Cruz, SC-28383, Lot 12319), LSD1 (Bethyl, A300-215A, Lot 1), PARP1 (Cell signalling, 9532, Lot 9), H3K9mel (Abeam, ab8896, Lot GR3299164-1), H3K9me2 (Abeam, abl220, Lot GR3228498-2), H3K9me3 (Abeam, ab8898, Lot GR3302452-1). Burrows-Wheeler Aligner (BWA-mem) was used to map the raw ChlP-seq sequences against the human reference genome (hgl9). Duplicates removed by rmdup and only reads with mapQ >10 and with were used. Significant peaks were called using MACS2. NGSplot was used to visualise ChlP-seq profiles.
  • RNAseq libraries were prepared from I pg of total RNA using Illumina Tru-Seq Stranded Total RNA kit (Illumina) using the manufacturer’s protocol. Paired-end 150 bp sequencing was performed using Illumina HiSeq4000 sequencer. RNA-seq data were mapped to hgl9 (hs37d5) using STAR and gene expression levels were quantified with STAR. Log fold change of differential expression genes was computed with DESeq2.Only genes with
  • Heatmapper was used to generate heatmaps.
  • PTMScan Ubiquitin Remnant Motif immunoprecipitation PTMScan Ubiquitin Remnant Motif (K-a-GG) Kit (Cell Signalling) was used to pulldown for ubiquitinated peptides following the manufacturer’s instructions. Three replicates were performed. The immunoprecipitated peptides were separated on a Cl 8 reversed-phase column (Easy-Spray, 50 cm x 75 pm internal diameter, 2 pm particles) maintained at 50°C using an EASY-nLClOOO liquid chromatography coupled to an Orbitrap Fusion mass spectrometer (Thermo Scientific).
  • Samples were eluted using 0.1% formic acid in water and 0.1% formic acid in 99% acetonitrile as mobile phases with a 3-27% acetonitrile gradient over 45 minutes, followed by a ramp to 50% acetonitrile over 15 minutes, and finally a steep gradient to 90% acetonitrile over 5 minutes. The final mixture was maintained for 5 minutes to elute all remaining peptides. Total gradient duration was 70 minutes at a constant flow rate of 300 nl/min.
  • Data was acquired in data-dependent mode with the following parameters: Samples were ionized using 2.5 kV and 300°C at the nanospray source and positively-charged precursor MSI signals between 350-1,550 m/z were detected using an Orbitrap analyser set to 60,000 resolution, automatic gain control (AGC) target of 400,000 ions, and maximum injection time (IT) of 50 milliseconds. Precursors with charges 3-7 and having the highest ion counts in each MSI scan were further fragmented using collision- induced dissociation (CID) at 35% normalized collision energy and their MS2 signals were analysed by ion trap at an AGC of 15,000 and maximum IT of 50 milliseconds.
  • AGC automatic gain control
  • IT maximum injection time
  • Precursors used for MS2 scans were excluded for 90 seconds in order to avoid re-sampling of high abundance peptides.
  • the MS1- MS2 cycles were repeated every 3 seconds until completion of the run.
  • Identification of proteins within each sample was performed using MaxQuant (vl.5.5.1).
  • Raw mass spectra were searched against the human proteome.
  • Carbamidomethylation on Cys was set as the fixed modification and deamidation of asparagine and glutamine, acetylation on protein N terminus, oxidation of Met methionine, and diglycine (GlyGly) on lysine were set as dynamic modifications for the search. Trypsin/P was set as the digestion enzyme and was allowed up to two missed cleavage sites.
  • Precursors and fragments were accepted if they had a mass error within 20 ppm and 0.5 Daltons, respectively.
  • Peptides were matched to spectra at a false discovery rate (FDR) of 1 % against the decoy database.
  • FDR false discovery rate
  • Label-free quantitation (LFQ) was also performed on MaxQuant using the FastLFQ method with a minimum ratio count of 2. Only ubiquitinated peptides that were detected in TBT-CCA-S5 EV and TBTS5 Mut but not TBT-CCA-S5 WT were considered to be targets of B API.
  • ATAC-Sequencing was performed as per described in Buenrostro et al. 2015 ATAC- Seq peaks were called using nfcore/atacseq, Nucleosome positioning was determined using NucleoATAC.
  • Ubiquitination targets were validated by in vitro protein ubiquitination assay.
  • HEK293 cells were transfected with HA-UB (Addgene #17608) and other indicated plasmids. After three days, the cells were incubated with lOmM MG132 for 3 hours before they were harvested and lysed (50 mM Tris HC1, pH 7.4, 150 mM NaCl ,1 mM EDTA and 1% Triton X-100).
  • the FLAG tagged proteins were allowed to bind to Dynabeads Protein G (ThermoFisher Scientific Corporation, Waltham, MA, USA) that had been conjugated with Monoclonal Anti-Flag M2 antibody overnight and washed five times (0.5 M Tris HC1, pH 7.4, 150mM NaCl). Elution was performed by heating the beads with 2x Laemmli Sample Buffer (Bio-rad) at 95°C for 30 minutes at 2000 rpm on a Thermo-mixer and analysed by immunoblotting. Ub-conjugated proteins were detected using HA antibody (Santa Cruz, SC-7392).
  • IP For endogenous protein ubiquitination, IP was performed using the following antibodies: DDB1 (Bethyl, A300-462), RAD23B (Santa Cruz, SC-166507), and COPS7B (Abeam, abl24718) and ubiquitinated proteins were detected by K48-Ub antibody (Millipore, 05-1307).
  • Cells were cross-linked with 1% formaldehyde for 10 minutes at room temperature and quenched by adding glycine to a final concentration of 0.2M. Cytoplasmic proteins were removed, and nuclear proteins were extracted using nuclear extraction buffer (50 mM HEPES-KOH pH7.5, 150mM NaCl, 2mM EDTA, 1% Triton X-100, 0.1% Sodium deoxycholate, 1% SDS), followed by 8M Urea and then sonicated. The extracted nuclear proteins were incubated with Protein G Dynabeads (LifeTechnologies) that had been conjugated with 20pg antibodies for each protein of interest and overnight at 4°C. Beads were washed 5 times with RIPA buffer.
  • Nuclear extraction buffer 50 mM HEPES-KOH pH7.5, 150mM NaCl, 2mM EDTA, 1% Triton X-100, 0.1% Sodium deoxycholate, 1% SDS
  • the extracted nuclear proteins were incubated with Protein G Dynabeads (
  • Elution was performed by heating the beads with 2x Laemmli Sample Buffer (Bio-rad) at 99°C for 30 minutes at 2000 rpm on a Thermomixer.
  • the antibodies used are: BAP1 (Santa Cruz, SC-28383) and LSD1 (Bethyl, A300-215A).
  • Protein extracts were quantified using BCA assay (Thermo scientific). At least 5 pg of protein was used for each immunoblotting experiment. Proteins were transferred to nitrocellulose membranes by transferring at 100V for 90 minutes in ice. Western blotting was performed by incubating membranes overnight at 4°C with the following antibodies: ubiquityl- Histone H2A (Cell Signaling, 8240), Histone H2A antibody (Abeam, abl8255), BAP1 (Santa Cruz, SC-28383), LSD1 (Bethyl, A300-215A), PARP1 (Cell signalling, 9532), H3K9mel (Abeam, ab8896), H3K9me2 (Abeam, abl220), H3K9me3 (Abeam, ab8898), DDB1 (Bethyl, A300-462), RAD23B (Santa Cruz, SC-166507), COPS7B (Abeam, abl24718), K48-Ub antibody (M

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Epidemiology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

Disclosed herein a method of treating a BAP1-related tumour in a subject, the method comprising determining whether BAP1 in the sample is functional or non-functional, and administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional. Also disclosed herein is a method screening and identifying an anti- proliferative compound.

Description

COMPOUND SCREENING AND THERAPEUTIC USES
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the priority benefit of Singapore Provisional Application No. SG 10202203435U, filed 4 April 2022, which is hereby incorporated by reference in its entirety.
FIELD OF INVENTION
[0002] The present invention relates to the field of molecular biology. In particular, the present invention relates to a method of compound screening and cancer treatment.
BACKGROUND
[0003] Cancer is a major disease worldwide and a major public health concern. External and internal factors can contribute to cancer and some types of genetic mutations are associated with poorer overall survival and disease-free survival in these cancers. Several therapeutic strategies have been used for tumours, including small molecule inhibitors, chemotherapeutic drugs and radiotherapy but they are met with limited success.
[0004] There is currently no FDA approved targeted therapy for B API -deficient tumours. While potential therapeutic drugs are still in clinical trials, no improvement in the survival of the patients suffering from cancer has been reported from these trials, over the current standard of care. [0005] Thus, there is an unmet need to provide new cancer treatments.
SUMMARY
[0006] In one aspect, the present disclosure refers to a method of treating a B API -related tumour in a subject, the method comprising: obtaining a sample from the subject; determining whether BAP1 in the sample is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional. [0007] In another aspect, the present disclosure refers to a pharmaceutical composition comprising an LSD1 inhibitor and a PARP inhibitor, wherein the LSD1 inhibitor is SP2577 or SP2509, and wherein the PARP inhibitor is olaparib.
[0008] In yet another aspect, the present disclosure refers to a method of screening and identifying an anti-proliferative and anti-cancer compound, the method comprising: obtaining a population of BAP 1 -deficient cells; treating said B API -deficient cell population with the antiproliferative compound and; determining a change in proliferative activity of the population of BAP 1- deficient cells compared to a population of cells producing functional BAP1 protein. BRIEF DESCRIPTION OF THE DRAWINGS
[0009] Figure 1 shows that intact deubiquitinase function is required for BAP1 to suppress tumour growth. Figure 1(A) shows that mutations in BAP1 are highly prevalent in mesothelioma (MESO), cholangiocarcinoma (CHOL), uveal melanoma (UM) and clear cell renal cell carcinoma (KIRC). Figure 1(B) shows the cell lines used to obtain the data disclosed herein. Bile duct normal cell lines are H69. Cholangiocarcinoma cell lines are human liver bile duct carcinoma cell line (HUCCT1), TBT-CCA-S5 (abbreviated as S5) and extrahepatic bile duct carcinoma cell line (TFK-
1). Mesothelioma cell lines are H28 and H2452. Kidney normal cell lines are human kidney 2 (HK-
2). Clear cell renal cell carcinoma cell lines are UMRC6. BAP1 is not expressed in S5, TFK-1, UMRC6, H28 and H2454. Figure 1(C) shows the immunoblot of B API isogenic cells lines obtained from the bile duct normal cell line (H69), cholangiocarcinoma cell lines (HUCCT1), TBT-CCA-S5 (abbreviated as S5) and extrahepatic bile duct carcinoma cell line (TFK-1). Figure 1(D) shows the immunoblot of BAP1 isogenic cells lines obtained from kidney normal cell lines (which are human kidney 2 (HK-2)) and clear cell renal cell carcinoma cell line UMRC6. Figure 1(E) shows the immunoblot of BAP1 isogenic cells lines made from mesothelioma cell lines H28 and H2452. Figure 1(F) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that loss of BAP1 enhances proliferation in bile duct normal cell lines (H69). Figure 1(G) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that loss of B API enhances proliferation in human bile duct carcinoma cell line (HUCCT1). Figure 1(H) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that only restoring a fully functional BAP1 reduces proliferation in bile duct carcinoma cell line TBT-CCA-S5 (abbreviated as S5). Figure 1(1) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that only restoring a fully functional BAP1 reduces proliferation in extrahepatic bile duct carcinoma cell line (TFK-1). Figure 1(J) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that loss of B API enhances proliferation in normal human kidney cell line (HK-2). Figure 1(K) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that only restoring a fully functional BAP1 reduces proliferation in kidney cancer cell line UMRC6. Figure 1(L) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that only restoring a fully functional BAP1 reduces proliferation in mesothelioma cell line H28. Figure 1(M) is a graph that shows the changes in the relative cell proliferation over 5 days which indicates that only restoring a fully functional B API reduces proliferation in mesothelioma cell line H2454. Figure 1(N) is a graph that shows the changes in tumour volume over 50 days which indicates that a functional BAP1 is required to suppress tumour growth in TBT-CCA-S5 EV (S5 EV; whereby EV refers to “empty vector control”), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) mouse xenograft tumours. As disclosed herein, the mutant BAP1 refers to a BAP1 C91A mutant. Figure 1(0) is a graph that shows the changes in tumour weight which indicates that a functional BAP1 is required to fully suppress tumour growth in TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT) mouse xenograft tumours. Abbreviations used: UM: Uveal melanoma, UCEC: Uterine Corpus Endometrial Carcinoma, LIHC: Liver hepatocellular carcinoma, BLCA: Bladder Urothelial Carcinoma, KIRP: Kidney renal papillary cell carcinoma, SKCM: Skin Cutaneous Melanoma, CESC: Cervical squamous cell carcinoma and endocervical adenocarcinoma. [00010] Figure 2 shows that there is increased DNA damage observed in BAP 1 -deficient mutants. Figure 2(A) is a Venn diagram showing that 64 pathways are found to be specifically downregulated in TBT-CCA-S5 BAP1 wild-type (S5 WT) as compared to TBT-CCA-S5 EV (S5 EV) and TBT-CCA-S5 BAP1 mutant (S5 MUT) cell lines and 10 of the 64 pathways are related to DNA damage. Figure 2(B) shows a heatmap that indicates that the expression of genes involved in DNA damage repair were higher in TBT- CCA-S5 EV (S5 EV) and TBT-CCA-S5 BAP1 mutant (S5 MUT) as compared to TBT-CCA-S5 BAP1 wild-type (S5 WT). Figure 2(C) shows a heatmap that indicates that the expression of genes involved in DNA damage repair were higher in cholangiocarinoma, clear cell renal cell carcinoma (ccRCC) and mesothelioma tumours with nonsense or frameshift mutations in BAP1 from the Cancer Genome Atlas (TCGA) compared with cholangiocarinoma, ccRCC and mesothelioma tumours with no mutations in known DNA damage repair genes including BAP1. Figure 2(D) shows the results of immunofluorescence staining using yH2A.X in human bile duct carcinoma cell line (HUCCT1) isogenic cell lines. Figure 2(E) is a bar graph that shows the quantification of the number of cells with more than 10 yH2A.X foci from Figure 2 (D). Figure 2(F) shows the results of immunofluorescence staining using yH2A.X in TBT-CCA-S5 EV (S5 EV), TBT- CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT). Figure 2(G) a bar graph that shows the quantification of the number of cells with more than 10 yH2A.X foci from Figure 2(F). Abbreviations used: GG-NER: global genome nucleotide excision repair, TC-NER: transcription coupled nucleotide excision repair, BER: base excision repair, NHEJ: non homologous end joining, HR: homologous recombination, MMR: mismatch repair.
[00011] Figure 3 shows that BAP1 deubiquitinates components of the global genome nucleotide excision repair pathway. Figure 3(A) shows the Venn diagram showing the number of targets identified by PTMScan Ubiquitin Remnant Motif immunoprecipitation of TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) cells. Figure 3(B) shows the results of a gene ontology analysis of the targets in Figure 3 (A), which unveiled four pathways related to GG-NER out of the top eleven significant DNA damage repair related pathways. Figure 3(C) shows the results of immunofluorescence staining for BAP1 and cyclobutane pyrimidine dimers (CPD) after 10J/m2 UV irradiation through a 5 pm isopore polycarbonate membrane filter. Scale bar = 20pm. Figure 3(D) is a graph that shows the relative intensity of nuclear localised XPC at different indicated time points for human bile duct carcinoma cell line (HUCCT1) isogenic cell lines, human bile duct carcinoma cell line (HUCCT1) and BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO). Figure 3(E) is a graph that shows the relative intensity of nuclear localised CSB after 10J/m2 UV irradiation at different indicated time points for TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wildtype (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT). Figure 3(F) is an in vitro deubiquitination assay performed in human embryonic kidney 293T cells (HEK293T) cells introduced with the indicated plasmids of Damage Specific DNA Binding Protein 1 (DDB1). Figure 3(G) is an in vitro deubiquitination assay performed in human embryonic kidney 293T cells (HEK293T) cells introduced with the indicated plasmids of RAD23 Homolog B, Nucleotide Excision Repair Protein (RAD23B). Figure 3(H) is an in vitro deubiquitination assay performed in human embryonic kidney 293T cells (HEK293T) cells introduced with the indicated plasmids of COP9 signalosome complex subunit 7 (COPS7). Figure 3(1) are the colony formation assays for human bile duct carcinoma cell line (HUCCT1) isogenic cell lines, human bile duct carcinoma cell line (HUCCT1) and BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO), which had been transfected with the indicated genes after 10J/m2 UV irradiation. Figure 3(J) are the colony formation assays for TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT), which had been transfected with the indicated genes after 10J/m2 UV irradiation. Abbreviations and symbols used: GG-NER: global genome nucleotide excision repair, presence, absence.
[00012] Figure 4 shows that loss of functional BAP1 sensitises tumour cells to LSD1 inhibitors, SP2509 and SP2577. Figure 4(A) are the colony formation assays of B API isogenic cell lines treated with the indicated concentration of SP2509 in pM, showing that cells without a functional BAP1 are more sensitive to SP2509. Figure 4(B) is a graph that shows the changes in tumour volume of TBT- CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) mouse xenograft tumours treated with 120mg/kg SP2577 (5 on 2 off) over 40 days. Figure 4(C) is a bar graph that shows the percentage of apoptotic cells in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT) after 96-hour treatment with IpM SP2509. Figure 4(D) shows the immunoblot for apoptosis marker, cleaved PARP1 (c-PARPl) and cleaved caspase 3 (c-Caspase 3) in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after 4 days treatment with IpM SP2509. represents a p-value <0.05 and “**” represents a p-value <0.005; calculated using Student’s T-test.
[00013] Figure 5 shows that SP2509 aggravates nucleotide excision repair inefficiency when BAP1 is deficient. Figure 5(A) is a Venn diagram showing pathways altered in TBT-CCA-S5 EV (S5 EV SP) and TBT-CCA-S5 BAP1 mutant (S5 MUT SP) after SP2509 treatment as compared to TBT- CCA-S5 BAP1 wild-type (S5 WT SP) after SP2509 treatment. The control cells are TBT-CCA-S5 EV (S5 EV Con) and TBT-CCA-S5 B API mutant (S5 MUT Con) and TBT-CCA-S5 B API wild-type (S5 WT Con). Figure 5(B) is a bar graph showing fold change in the expression of the indicated genes in TBT-CCA-S5 EV (S5 EV SP), TBT-CCA-S5 WT (S5 WT SP) and TBT-CCA-S5 MUT (SF MUT SP) after SP2509 treatment from RNASeq DEseq2 values. Figure 5(C) shows the immunofluorescence staining of XPC for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after treatment with SP2509. Only the intensities of XPC in the nucleus were quantified. Figure 5(D) shows the immunofluorescence staining of CSCB for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA- S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT) after treatment with SP2509. Only the intensities of CSCB in the nucleus were quantified. Figure 5(E) shows the immunofluorescence staining using yH2A.X in humanbile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with and without treatment with SP2509. Quantifications of the number of cells with more than 10 yH2A.X foci from F were shown in the bar chart. Scale bar=20pm. Symbols used: “*” represents a p-value <0.05 and “**” represents a p-value <0.005, calculated using Student’s T-test.
[00014] Figure 6 shows that SP2509 prevents H3K9me3/2 demethylation during NER. Figure 6(A) shows the co-immunoprecipitation of LSD1 and BAP1 in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT) without or without treatment with SP2509 showing interaction between LSD1 and BAP1. Figure 6(B) shows the ChlP-Seq profiles of BAP1 and LSD1 in human bile duct carcinoma cell line (HUCCT1), TBT-CCA-S5 WT and TBT-CCA-S5 MUT cell lines with and without SP2509 treatment. Figure 6(C) shows the colony formation assays for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) transfected with the indicated genes with SP2509 treatment. Figure 6(D) shows the immunoblot for H3K4mel, H3K4me2, H3K4me3, H3K9mel, H3K9me2, H3K9me3 in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with and without SP2509 treatment. Figure 6(E) shows the ChlP-Seq profiles of H3K9mel, H3K9me2 and H3K9me3 in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout humanbile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with and without SP2509 treatment.
[00015] Figure 7 shows that tumour cells with loss of functional BAP1 are more sensitive to a synergistic combination of SP2509 and olaparib. Figure 7(A) shows a chart of combination indexes for BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO), TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 mutant (S5 MUT) treated with a combination of SP2509 and olaparib. Figure 7(B) shows the colony formation assay of human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after combined treatment of SP2509 and olaparib. Figure 7(C) is a graph which shows that a synergy is also observed in TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) mouse xenograft tumours treated with a combination of 120mg/kg SP2577 and 200mg/kg olaparib (5 on, 2 off for 2 weeks, 3 days per week subsequently). [PDX] Figure 7(D) is a graph which shows that a synergy is also observed in CCA-PDX3 tumours treated with a combination of 120mg/kg SP2577 and 200mg/kg olaparib (5 on 2 off for 2 weeks, 3 days per week subsequently). Figure 7(E) is immunohistochemistry staining of Ki67 for CCA-PDX3 after the indicated treatment, which shows that cell proliferation decreased after combined compound treatment. Figure 7(F) a bar graph which shows the percentage of apoptotic cells in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S50 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after 96hour treatment with SP2509, olaparib or a combination of both compounds. Figure 7(G) shows the immunoblot for apoptosis marker, cleaved PARP1 (c-PARPl) and cleaved caspase 3 (c-Caspase 3) in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO). Figure 7(H) shows the immunoblot for apoptosis marker, cleaved PARP1 (c-PARPl) and cleaved caspase 3 (c-Caspase 3) in TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after 96-hour treatment with the indicated compounds. Figure 7(1) shows the ChlP-Seq profiles of BAP1, LSD1 and PARP1 in human bile duct carcinoma cell line (HUCCT1), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT). Symbols used: “*” represents a p-value <0.05 and “**” represents a p-value <0.005, calculated using Student’s T- test.
[00016] Figure 8 shows that BAP1 is a tumour suppressor. Figure 8(A) is a graph which shows the overall survival, progression free survival, disease specific survival and disease-free months for cholangiocarcinoma, mesothelioma and clear cell renal cell carcinoma patients (ccRCC) with BAP1 mutations compared to patients with no BAP1 mutations. Figure 8(B) is an immunoblot which shows that H2AK119UB is a deubiquitinase substrate for functional BAP1 in cholangiocarcinoma isogenic cell lines used in this study. Figure 8(C) is an immunoblot which shows that H2AK119UB is a deubiquitinase substrate for functional BAP1 in ccRCC isogenic cell lines used in this study. Figure 8(D) is an immunoblot which shows that H2AK119UB is a deubiquitinase substrate for functional BAP1 in mesothelioma isogenic cell lines used in this study. Figure 8(E) shows the tumours of TBT- CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after harvest. Scale bar =lcm.
[00017] Figure 9 shows that BAP1 deubiquitinates components of the GG-NER pathway. Figure 9(A) shows the immunofluorescence staining of XPC and CSB for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT- CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after 10J/m2 UV irradiation at different indicated time points. Scale bar=20pm. Figure 9(B) shows the immunoblotting after 10J/m2 UV irradiation at different indicated time points for chromatin-bound XPC and CSCB for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT). Figure 9(C) shows the immunoblotting of DDB 1, RAD23B and COPS7B in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) number represents the intensity of the band. Figure 9(D) shows the immunoprecipitation of DDB 1 , RAD23B and COPS7B in human liver duct carcinoma (HUCCT1) and BAP1 knockout human liver bile duct carcinoma (HUCCT1 KO) isogenic cell lines where immunoblotting was performed with K48UB antibodies. Figure 9(E) shows the immunoprecipitation of DDB 1, RAD23B and COPS7B in TBT- CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) where immunoblotting was performed with K48UB antibodies. Figure 9(F) shows the colony formation assays for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT) with or without 10J/m2 UV irradiation. Figure 9(G) shows the control colony formation assays (no UV irradiation) for human bile duct carcinoma (HUCCT1) and BAP1 knockout human bile duct carcinoma (HUCCT1 KO) isogenic cell lines transfected with the indicated genes. Figure 9(H) shows the control colony formation assays (no UV irradiation) for TBT- CCA-S5 isogenic cell lines, TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) transfected with the indicated genes.
[00018] Figure 10 shows that loss of functional BAP1 sensitises tumour cells to LSD1 inhibitors, SP2509. Figure 10(A) shows the compound screening using SelleckChem anti-cancer small molecule inhibitor screening (422 compounds) on H69 and H69 BAPl-knockout (KO) cell lines. Scoring was performed by subtracting the percentage inhibition of growth of H69 BAP1 knockout (BAP1 KO) cells with the percentage inhibition of growth of H69 cells. SP2509 and olaparib are one of the top hits. Figure 10(B) shows the colony formation assays of BAP1 isogenic cell lines transfected with control of LSD 1 siRNA and shows that cells without a functional BAP1 are more sensitive to the knockdown of LSD1. Figure 10(C) shows the tumours of SP2577 treated TBT-CCA- S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after harvest. Scale bar =lcm.
[00019] Figure 11 shows the presence of increased stimulation and requirement for NER pathway in cells deficient in BAP1 upon treatment with SP2509. Figure 11(A) is a heatmap showing the expression of the genes in the indicated DNA damage repair pathways in TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with, represented by C, and without, represented by S, treatment with SP2509. Figure 11(B) is a bar graph of the results of real-time qPCR which shows the changes in the expression of DDB2 and XPC in TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with or without treatment with SP2509. Values were normalised with the expression in cells without SP2509 treatment. Figure 11(C) shows that LSD1 colocalised with the UV damage DNA adduct marker CPD after localised 10J/m2 UV treatment through a 5pm isopore membrane. Figure 11(D) shows the immunoblotting of chromatin bound XPC and CSCB after SP2509 treatment in human liver bile duct carcinoma cell line (HUCCT1), BAP1 knockout human liver bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 BAP1 wildtype (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT). Figure 11(E) shows the immunofluorescence staining of thymine dimers for human liver bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after treatment with SP2509. Only the intensities of thymine dimers in the nucleus were quantified. Scale bar=20pm. ** represents p-value <0.005 * represents p-value <0.05, calculated using Student’s T-test. GG-NER: global genome nucleotide excision repair, TC-NER: transcription coupled nucleotide excision repair, DSB: double stranded DNA break repair, SSB: single stranded DNA break repair, MMR: mismatch repair. Figure 11(F) shows the nucleosome occupancy profiles in human bile duct carcinoma cell line (HUCCT), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO), TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with or without exposure to SP2509.
[00020] Figure 12 shows that SP2509 further compromises NER by obstructing chromatin decondensation in B API -related tumours. Figure 12(A) shows an immunoblot of DDB1, RAD23B, COPS7B in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 BAP1 wildtype (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with and without treatment with SP2509. Figure 12(B) shows the colony formation assays for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBTS5 isogenic cell lines, TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) transfected with the indicated genes without SP2509 treatment (control). Figure 12(C) shows the colony formation assays of human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) treated with the indicated concentration of GSK467, CPI-455, ML324 or JIC-04 in pM, showing that cells without a functional BAP1 are more sensitive to H3K9me demethylation inhibitors but not H3K4me demethylation inhibitors.
[00021] Figure 13 shows tumour cells with loss of functional BAP1 are more sensitive to olaparib. Figure 13(A) shows the colony formation assays of BAP1 isogenic cell lines treated with the indicated concentration of olaparib in pM, showing that cells without a functional BAP 1 are more sensitive to olaparib. Figure 13(B) shows the changes in TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) mouse xenograft tumours treated with 200mg/kg olaparib (5 on 2 off) measured using tumour volume. “**” represents a p -value <0.005; calculated using Student’s T-test.
[00022] Figure 14 shows that tumour cells with loss of functional BAP1 are more sensitive to a synergistic combination of SP2509 and olaparib. Figure 14(A) shows a chart of combination indexes for human bile duct carcinoma cell line (HUCCT1) and TBT-CCA-S5 WT treated with a combination of SP2509 and olaparib. Figure 14(B) shows colony formation assays of a panel of BAP1 isogenic cell lines of different tumour origins, including uveal melanoma MP46 isogenic cell lines, treated with SP2509, olaparib, or both compounds, showing that treatment with both SP2509 and olaparib is more effective than single. Figure 14(C) shows the TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT- CCA-S5 BAP1 mutant (S5 MUT) tumours treated with indicated compounds after harvest. Scale bar = 1cm. Figure 14(D) shows immunohistochemistry staining for BAP1 in 2 CCA-PDX tumours, and CCA-PDX3 was shown to be negative for BAP1 expression. Figure 14(E) shows CCA-PDX3 tumours treated with indicated compounds after harvest. Scale bar = 1cm. Figure 14(F) shows the coimmunoprecipitation of LSD1 and BAP1 in human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) and TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) showing interaction between LSD1, PARP1 and BAP1. Figure 14(G) shows the quantification of the intensities of XPC in the nucleus for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO) after treatment with olaparib and SP2509 from immunofluorescence staining. Only the intensities of XPC in the nucleus were quantified. Figure 14(H) shows the quantification of the intensities of XPC in the nucleus for TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 B API mutant (S5 MUT) after treatment with olaparib and SP2509 from immunofluorescence staining. Only the intensities of XPC in the nucleus were quantified. Figure 14(1) shows the quantification of the intensities of CSB in the nucleus for human bile duct carcinoma cell line (HUCCT1), BAP1 knockout human liver bile duct carcinoma cell line (HUCCT1 KO) after treatment with olaparib and SP2509 from immunofluorescence staining. Only the intensities of CSB in the nucleus were quantified. represents p-value<0.05 ** represents p-value <0.005. Figure 14(J) shows the quantification of the intensities of CSB in the nucleus XPC for TBT-CCA-S5 isogenic cell lines, TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) after treatment with olaparib and SP2509 from immunofluorescence staining. Only the intensities of CSB in the nucleus were quantified. represents p-value<0.05; “**” represents p-value <0.005.
[00023] Figure 15 is a figure which shows that when the NER pathway is activated, recognition proteins such as PARP1, DDB1, RAD23B, COPS7B are recruited to the site of lesion. BAP1 maintains the level of DDB1, RAD23B and COPS7B while LSD1 demethylates H3K9me2 to aid chromatin decondensation. When BAP1 is mutated, lesion recognition is affected, delaying NER. Further inhibition of PARP1 or/and LSD1 by using olaparib or SP2509/ SP2577, further abrogates lesion recognition or/and hinder DNA winding for repair respectively, impeding NER, tipping the cells towards apoptosis.
[00024] Figure 16 shows that treatment with SP2509 and olaparib alone or in combination does not cause significant toxicity in mouse models and cells. Figure 16(A) shows no significant changes in the weight of mice treated with TBT-CCA-S5 EV (S5 EV) and vehicle control; TBT-CCA-S5 EV (S5 EV) and a combination of SP2509 and olaparib; TBT-CCA-S5 BAP1 wild-type (S5 WT) and vehicle control; TBT-CCA-S5 BAP1 wild-type (S5 WT) and a combination of SP2509 and olaparib; TBT-CCA-S5 BAP1 mutant (S5 MUT) and vehicle control; and TBT-CCA-S5 BAP1 mutant (S5 MUT) with a combination of SP2509 and olaparib; over a period of four weeks post-treatment. Figure 16(B) are histological images showing no significant morphological changes in the kidney, liver and spleen tissue of mice treated with SP2577 and olaparib alone and in combination.
[00025] Figure 17 is an in vitro cell survival assay data showing the cell survival rates in cell lines of different tumour origins, including cholangiocarcinoma (CCA), renal cell carcinoma (ccRCC), mesothelioma and uveal melanoma cell lines, measured over a period of 9 days after treatment with SP2509 alone, olaparib alone, or with a combination of SP2509 and olaparib. Figure 17(A) shows that upon treatment with SP2509, cells lacking functional BAP1 had lower survivability compared to cells with functional BAP1. Figure 17(B) shows that cells upon treatment with a combination of SP2509 and olaparib, cells lacking functional BAP1 had lower survivability compared to cells with functional BAP1. Figure 17(C) shows upon treatment with olaparib, cells lacking functional BAP1 had lower survivability compared to cells with functional BAP1.
[00026] Figure 18 is a bar graph showing the percentage inhibition of cell growth in bile duct normal (H69) cells and H69 BAPl-knockout (KO) cells upon treatment with LSD1 inhibitors, OG- L002, SP2509, and GSK-LSD1. DEFINITIONS
[00027] As used herein, the term “anti -proliferative” refers to a resulting decrease of cell growth (also referred to as proliferation). An anti-proliferative effect means cell proliferation is decreased when an anti-proliferative compound is applied to said cells. In the context of the present application, cells with mutant or non-functional BAP1 are shown to proliferate at a higher rate compared to cells with functional BAP1. As appreciated by a person skilled in the art, cell proliferation can be measured using, but not limited to, a cell viability assay, cell-staining, immunohistology, and the like. The term “anti-proliferative” as used herein can be used synonymously with the term “anti -cancer”.
[00028] As used herein, the term “BAP 1 ” refers to both the gene that expresses, and the protein,
BRCA-1 associated protein 1. It has been shown herein that the loss of functional gene BAP1 (written in italics) also leads to the loss of the functional protein BAP1 (written without italics), using immunoblotting for BAP1 expression. Therefore, the terms “BAP1” (with italics) and “BAP1” (without italics) are used interchangeably, and which is to be used is understood depending on the context of the present disclosure.
[00029] As used herein, the term "B API -deficient" refers to both loss of BAP1 and loss of functional BAP1. As appreciated by a person skilled in the art, knocking out BAP1 leads to loss of BAP1, and introducing mutant (non-functional) forms of BAP1 likewise leads to loss of functional BAP1. As used herein, the term “BAP 1 -related” cancer refers to cancer that are caused, for example, by deficient BAP1. Such cancers can also be referred to as being B API -deficient, or BAP 1 -dependent cancers. These terms are used synonymously throughout the present specification.
[00030] Abbreviations used throughout the disclosure: GG-NER: global genome nucleotide excision repair, TC-NER: transcription coupled nucleotide excision repair, BER: base excision repair, NHEJ: non homologous end joining, HR: homologous recombination, MMR: mismatch repair.
DETAILED DESCRIPTION
[00031] Cancer is a major disease worldwide and a major public health concern. Internal factors can contribute to cancer and the factors can be genetic mutations. Some types of genetic mutations are associated with poorer overall survival and disease-free survival in these cancers. One mutation involved in many different cancers is the BRCA-1 associated protein 1 (BAPP) mutation. BAP1 mutation is a primary genetic event that drives cancer progression, with epigenetic aberrations occurring as downstream consequences. Inactivating BAP1 mutations have been identified in a plethora of cancers, such as, but not limited to, cholangiocarcinoma, mesothelioma, uveal melanoma, renal cell carcinoma and hepatocellular carcinoma (HCC). These cancers are usually associated with increased and altered DNA methylation patterns as well as poor overall survival and disease -free survival rates.
[00032] To date, there is no effective treatment, or FDA approved targeted therapy, to target these BAPl-related tumours in different cancers. Potential therapeutic drugs are still in clinical trials but no significant improvement in the survival of the patients has been reported from these trials. For example, the clinical trial (NCT01587352) for vorinsostat (HDAC inhibitor) for metastatic uveal melanoma with BAP1 mutations concluded that there was no clinically significant improvement in overall survival or progression-free survival of its trial subjects. Basket clinical trials (see, for example, NCT03207347, NCT03786796, NCT03531840, NCT03375307) for PARP inhibitors in cancers with mutations in DNA damage repair genes (which can include BAP1 along others) are still ongoing and inconclusive. In one clinical trial (NCT02860286) for tazemetostat (an EZH2 inhibitor) in malignant mesothelioma with BAP1 mutations, only 2 out of 61 patients showed partial response.
[00033] The BAP1 gene is a tumour suppressor gene that encodes for a nuclear-localised deubiquitinating enzyme (DUB). The BAP1 protein consists of a N-terminal ubiquitin carboxyl hydrolase domain (UCH), a host cell factor 1 (HCF1) binding domain (HBM), a nuclear localisation signal (NLS), and other domains for protein-protein interaction, such as, but not limited to, a C- terminal domain (CTD) with a coiled-coil motif. The ubiquitin carboxyl hydrolase domain confers the BAP1 protein with deubiquitinating capabilities through the catalytic triad that is made up of a cysteine, histidine and aspartic acid amino acid. Ubiquitination and deubiquitination are important, reversible, post-translational protein modifications that can control protein degradation. The BAP1 protein functions as a tumour suppressor via its deubiquitinase activity, regulating many cellular processes such as regulation of gene transcription, apoptosis, metabolism, protein turnover, epithelial- mesenchymal transition, cell cycle control and DNA damage repair.
[00034] The integrity of DNA is constantly challenged by many endogenous or exogenous factors, which include replication errors, reactive oxygen species, ultraviolet radiation or carcinogens. The damaged DNA has to be recognised and repaired, else genome instability will arise, leading to diseases, such as, but not limited to, cancer. Cells react to DNA damage by activating different DNA damage response pathways depending on the type of DNA lesion, which may be single or doublestrand breaks, DNA mismatches, bulky DNA adducts, damaged or inappropriate bases, in order to repair the lesion appropriately. Accumulation of unresolved DNA damage will cause cell death, which is vital for the whole organism to maintain genome integrity and function normally.
[00035] Among the different proteins that detect DNA lesions, Poly(ADP-ribose) Polymerase 1 (PARP1) is one of the most abundant. PARP1 is rapidly recruited to sites with different types of DNA lesions to initiate the necessary DNA damage repair (DDR) pathway. Of these different DDR pathways, the repair of DNA double-stranded breaks is the most extensively studied and described. Various proteins with roles in chromatin modification, such as, for example, Suppressor of Variegation 3-9 Homolog 2 (Suv39H2), Lysine-specific histone demethylase 1A (LSD1), and BAP1 are recruited for the repair of DNA double-stranded. Acting through its deubiquitinase activity, the B API protein allows for the assembly of various factors involved in homologous recombination repair, such as BRCA1 and RAD51, to the site of DNA double stranded breaks. In addition, the BAP1 protein can also deubiquitinate Histone 2A (H2A) in the proximity of the DNA lesion, which can increase accessibility of the chromatin to DNA repair proteins involved in other repair processes such as DNA resection. Other than repairing DNA double-stranded breaks, the BAP1 protein is thought to be involved in other DNA damage repair pathways, but this has yet to be reported.
[00036] Inactivation of BAP1 has been associated with the progression and aggressiveness of various cancers, including, but not limited to hepatocellular carcinoma, stomach cancer, cholangiocarcinoma (CCA), renal cell carcinoma (RCC), uveal melanoma (UM) and mesothelioma (MPM). Thus, in one example, the cancer referred to herein is, but is not limited to, hepatocellular carcinoma, stomach cancer, cholangiocarcinoma (CCA), renal cell carcinoma (RCC), uveal melanoma (UM) and mesothelioma (MPM).
[00037] The incidences of these BAPl-related tumours are increasing steadily world-wide. BAP1 mutations are associated with poorer overall survival and disease-free survival in these cancers. Several therapeutic strategies have been used for BAP1- related tumours, including, but not limited to, small molecule inhibitors (for example, EZH2 inhibitors), chemotherapeutic drugs (for example, gemcitabine), and radiotherapy, all of which have been met with limited success.
[00038] Thus, disclosed herein is a method of treating a BAP1- related tumour in a subject. In one example, the method comprising the stages of obtaining a sample from the subject; determining whether BAP1 in the sample is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional. In another example, the method comprising the stages of obtaining a sample from the subject; determining whether BAP1 in the sample is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional, wherein the LSD1 inhibitor is SP2509 or SP2577. In another example, there is disclosed use of a PARP inhibitor and a LSD1 inhibitor in the manufacture of a medicament for treating a BAP1- related tumour in a subject. In yet another example, the disclosure refers to a PARP inhibitor and a LSD1 inhibitor for use in treating a BAP1- related tumour.
[00039] In another example, the method of treating a BAP1- related tumour comprises determining whether BAP1 is functional or non-functional. Such a determination can be made, for example, in a sample obtained from a subject. In a further example, the method of treating a BAPl- related tumour comprises administering to the subject an amount of a PARP inhibitor. In another example, the method of treating a BAP1- related tumour comprises administering to the subject an amount of a LSD1 inhibitor. In another example, the amounts disclosed herein are therapeutic amounts. In another example, the method of treating a BAP1- related tumour comprises administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor.
[00040] In another example, the compounds or pharmaceutical compositions disclosed herein are to be administered to the subject if BAP1 is or is found to be non-functional.
[00041] In one example, disclosed herein is a method of treating a BAP1- related tumour in a subject, the method comprising obtaining a sample from the subject; determining whether BAP1 in the sample is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional. In one example, the LSD1 inhibitor is, but is not limited to, SP2509, SP2577, OG-L002, GSK-LSD1, and siRNA that targets LSD1. In another example, the method comprises determining whether BAP1 is functional or non-functional in a sample obtained from a subject; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional, wherein the LSD1 inhibitor is SP2509 or SP2577. In another example, the method comprises determining whether BAP1 in a sample obtained from a subject is functional or nonfunctional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional, wherein the LSD1 inhibitor is SP2509. In another example, the method comprises determining whether BAP1 in a sample obtained from a subject is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP 1 in the subject is non-functional, wherein the LSD1 inhibitor is SP2577. In another example, the method comprises determining whether BAP1 in a sample obtained from a subject is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the subject is non-functional, wherein the LSD1 inhibitor is an siRNA that targets LSD1. In yet another example, the method comprises determining whether BAP1 in a sample obtained from a subject is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the subject is non-functional, wherein an siRNA that targets SEQ ID NO: 1.
[00042] It was further sought to identify new compounds that are therapeutically effective for BAPl-mutant cancers through understanding the mechanistic roles that the BAP1 protein plays in the cell. As discussed herein, the BAP1 protein was shown to be involved in DNA damage nucleotide excision repair (NER) pathway by regulating the turnover of proteins that are important in DNA lesion recognition. Growth of BAP1- related tumours is inhibited by various inhibitors, for example, but not limited to, the LSD1 inhibitor, SP2509, SP2577, GG-L002, GSK-LSD1, and siRNA that targets LSD1, and the PARP inhibitor, olaparib. This inhibition is thought to be due to retardation of NER efficiency by hampering DNA decompaction and further lesion detection upon the addition of these inhibitors. [00043] Thus, in one example, the method disclosed herein is a method of treating a BAP1- related tumour in a subject, the method comprising obtaining a sample from the subject; determining whether BAP1 in the sample is functional or non-functional; administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional, wherein the LSD1 inhibitor is SP2509, SP2577, GG-L002, GSK-LSD1, and siRNA that targets LSD1. In one example, the LSD1 inhibitor is SP2509 or SP2577.
[00044] The efficacy of the inhibitors used in the method disclosed herein was demonstrated both in in vitro BAP 1 -deficient cell models and in vivo B API -deficient mouse xenografts and BAP1- deficient patient-derived xenografts (PDX). These inhibitors represent therapeutic approaches which have been shown to be effective in the treatment of BAP1- related tumours, thereby improving prognosis and survival for patients suffering from the cancers disclosed herein. In addition, it was shown in the experimental data provided herein that the combination of an LSD 1 inhibitor and a PARP inhibitor produces a synergistic effect in the treatment of BAP1- related tumours.
[00045] Thus, in one example, the method disclosed herein describes treating a BAP1- related tumour with an LSD1 inhibitor and a PARP inhibitor. As used herein, the term “LSD1 inhibitor” are refers to one or more compounds that target and inhibit the function of the LSD1 gene or the LSD1 protein, either directly or indirectly. Such an inhibition can be a reversible or irreversible inhibition. The effect of such inhibitors of LSD 1 can be, for example, a reduction in cell proliferation, a reduction in the production of inflammatory cytokines. Structurally speaking, an LSD1 inhibitor can be, but is not limited to, a compound that targets a H3 pocket in LSD1. In another example, the LSD1 inhibitor refers to but is not limited to, a compound that targets LSD1 to regulate gene expression. An LSD1 inhibitor also refers to, but is not limited to, a compound that targets LSD1 to regulate or modulate gene expression related to DNA repair, or that targets LSD 1 -mediated DNA repair directly on a protein level. In another example, the LSD1 inhibitor refers to, but is not limited to, a compound that targets LSD1 for DNA methylation. In another example, the LSD1 inhibitor refers to but is not limited to, a compound that targets LSD1 for autophagy.
[00046] As disclosed herein, an LSD1 inhibitor can be, but is not limited to, a peptide, an organic compound, a synthetic compound, and siRNA. For example, an LSD1 inhibitor can be, but is not limited to, a 2-PCPA derivative or other racemic mixtures thereof, a N-alkylated 2-PCPA derivative, a compound that contains a benzohydrazide scaffold, a compound that contains a tetrahydrofolate, a polymyxin antibiotic,
Figure imgf000016_0001
Figure imgf000016_0002
- HO! , a compound with the structure of
Figure imgf000017_0001
a compound with the structure of
Figure imgf000017_0002
(SP2509), or any other functionally similar compound, or derivative thereof. In one example, the LSD1 inhibitor is SP2509, SP2577, OG-L002, or GSK-LSD1. In one example, the LSD1 inhibitor is SP2509. In another example, the LSD1 inhibitor is SP2509.
[00047] In one example, an LSD1 inhibitor can be, but is not limited to, an siRNA. As used herein, the term “siRNA” refers to small or short interfering RNA molecules. These siRNAs are able to target and silence a target gene or a gene of interest, such as, for example, knocking down or knocking out a target gene. In one example, the siRNA-based inhibitor is an siRNA sequence that targets all or part of an mRNA sequence of LSD1. In one example, the siRNA binds to or targets part or all of the cDNA sequence of LSD1. In one example, the target sequence of the siRNA is GCCCAAAGAAACTGTGGTGTCTCGTTGGCGTGCTGATCCCTGGGCTCGGGGCTCTTATT CCTATGTTGCTGCAGGATCATCTGGAAATGACTATGATTTAATGGCTCAGCCAATCACT CCTGGCCCCTCGATTCCAGGTGCCCCACAGCCGATTCCACGACTCTTCTTTGCGGGAGA ACATACGATCCGTAACTACCCAGCCACAGTGCATGGTGCTCTGCTGAGTGGGCTGCGAG AAGCGGGAAGAATTGCAGACCAGTTTTTGGG (SEQ ID NO: 1). In one example, the siRNA is a mixture of siRNA sequences. In another example, the mixture of siRNA sequences can be a heterogenous or homogenous mixture of siRNAs.
[00048] As used herein, the term “PARP inhibitor” refers to a compound that targets and/or binds the PARP1 gene or the PARP protein family (including, for example, but not limited to, PARP1, PARP2 and others) and inhibits function of the same. The binding of such an inhibitor can be reversible or irreversible. The results of PARP inhibition are, but are not limited to, suppression of the repair of DNA damage, increase in efficacy of DNA-alkylating agents, inactivation of the DNA damage repair system, inducing the formation of double-stranded DNA breaks, apoptosis, or radiosensitize tumour cells. [00049] Examples of a PARP inhibitors are, but are not limited to, a nicotinamide analogue, a benzamide analogue, a quinazoline analogue, a compound comprising a carboxamide group of the benzamide pharmacophore in the second aromatic ring, niraparib, rucaparib, olaparib, or combinations thereof. Structures of PARP inhibitors can be, but are not limited to,
Figure imgf000018_0001
(olaparib), or any other functionally similar compound, or derivative thereof. In one example, the PARP inhibitor is niraparib, rucaparib, olaparib, or combinations thereof. In another example, the PARP inhibitor is olaparib.
[00050] In one example, the method disclosed herein comprises administering olaparib and an LSD1 inhibitor. In another example, the method comprises administering niraparib and an LSD1 inhibitor. In another example, the method comprises administering rucaparib and a LSD1 inhibitor.
[00051] In one example, the method disclosed herein comprises administering olaparib and an siRNA that targets LSD1. In another example, the method comprises administering niraparib and an siRNA that targets LSD1. In another example, the method comprises administering rucaparib and a siRNA that targets LSD1.
[00052] In another example, the method comprises administering SP2509 and a PARP inhibitor. In another example, the method comprises administering SP2577 and a PARP inhibitor. [00053] In one example, the PARP inhibitor is olaparib and the LSD1 inhibitor is SP2509 or SP2577. In another example, the PARP inhibitor is olaparib and the LSD1 inhibitor is SP2509. In yet another example, the PARP inhibitor is olaparib and the LSD1 inhibitor is SP2577.
[00054] The inhibitors and compounds disclosed herein can be administered to the subject in need thereof in the form of one or more pharmaceutical compositions. Such pharmaceutical compositions can include pharmaceutically adjuvants, pharmaceutically carriers, and the like. In another example, the PARP inhibitor is comprised in one pharmaceutical composition, while the LSD1 inhibitor is comprised in another pharmaceutical composition. Thus, the pharmaceutical compositions disclosed herein can be administered to the subject sequentially, simultaneously as separate pharmaceutical compositions, or simultaneously in a single pharmaceutical composition.
[00055] In another example, there is disclosed a method of treating a BAPl-related tumour (also referred to as a BAP 1 -dependent or B API -deficient tumour), where the tumour is a cancer tumour. The tumour can be, but is not limited to, to a mesothelioma, a melanoma and a carcinoma tumour, as exemplary types of tumours or cancers. In another example, the tumour can be, but is not limited to, cholangiocarcinoma, hepatocellular carcinoma, mesothelioma, uveal melanoma, stomach cancer, and renal cell carcinoma tumour. In one example, the method disclosed herein is used to treat any one or more of the following cancers: mesothelioma, cholangiocarcinoma (CCA), clear cell renal cell carcinoma (ccRCC), and/or uveal melanoma.
[00056] Alternatively, tumours can be classified by their location in the body of a subject. Thus, in one example, the tumour can be, but is not limited to, a bile duct tumour, a kidney tumour, a heart tumour, a lung tumour, a uveal tumour, breast tumour, skin tumour, thyroid tumour, colon tumour, bladder tumour, stomach tumour, prostate tumour, hepatocellular tumour, pancreatic tumour, cholangiocarcinoma tumour, and an abdomen tumour. In another example, the tumour is, but is not limited to, a bile duct tumour, a kidney tumour, a heart tumour, a lung tumour, a uveal tumour, and an abdomen tumour.
[00057] In one example, there is disclosed a method of screening and identifying an antiproliferative compound. In another example, the method of screening comprises obtaining a population of BAP 1 -deficient cells. In another example, the method of screening comprises treating a population of BAP 1 -deficient cells with an anti-proliferative compound. In another example, the method of screening comprises treating a population of BAP 1 -deficient cells obtained from a subject with an anti-proliferative compound. In another example, the method of screening comprises determining a change in proliferative activity of a population of B API -deficient cells compared to a population of cells producing functional BAP1 protein. In another example, the method of screening comprises determining a change in proliferative activity of a population of BAP 1 -deficient cells obtained from a subject compared to a population of cells producing functional BAP1 protein. In a specific example, there is disclosed a method of screening and identifying an anti-proliferative compound, the method comprising the stages of obtaining a population of B API -deficient cells, treating said BAP 1 -deficient cell population with the anti -proliferative compound and, determining a change in proliferative activity of the population of B API -deficient cells compared to a population of cells producing functional BAP1 protein.
[00058] In one example, there is disclosed a method of screening and identifying an antiproliferative compound wherein the population of B API -deficient cells is derived from a tumour. In one example, there is disclosed a method of screening and identifying an anti-proliferative compound wherein the population of BAP 1 -deficient cells derived from a tumour is from a patient thought to be suffering from a B API -dependent cancer.
[00059] In one example, there is disclosed use of a reagent in the manufacture of a kit for diagnosing a B API -related cancer. A person skilled in the art would appreciate and be aware of methods available in order to ascertain as to whether a cancer is B API -related or not. Such analyses include, but are not limited to, genetic analysis, expression analysis (for example using heatmaps), analysis of mRNA or RNA relating to BAP1, protein expression analysis, protein function analysis and the like. A person skilled in the art would also be aware what parts would be required in such a kit for determining whether a sample is B API -related in the context of the present invention. Such components of a kit can be, but are not limited to, buffers, primers, digestion enzymes, detection reagents, developing reagents, polymerases, supports for imaging, chromatography gels, SDS-PAGE gels, and the like.
[00060] Loss of BAP1 is a driver for cancer development in multiple cancers with high incidence rates, such as, but not limited to mesothelioma, cholangiocarcinoma, uveal melanoma and ccRCC. BAP1 -inactivating mutations generally correlate with cancer aggressiveness, low overall survival, disease-free survival, and poor response to chemotherapy. Limited successful therapeutic strategies are available to treat BAP1- related cancers on both a genetic and proteomic level. While EZH2 and PARP inhibitors are in clinical trials for cancer patients with BAP1 defects, no complete responders have been observed in completed clinical trials. Most studies focus on targeting BAP1 loss in single cancer, but such therapeutic discoveries may not be applicable to other cancer types. In the information disclosed herein, a comprehensive pan-cancer approach is applied to search for compounds that can effectively inhibit the tumour growth of BAP1- related cancers. Based on the information provided herein, at least the following candidates, SP2509, SP2577, and olaparib, have been identified and have shown the ability to act in combinational synergy. In one example, olaparib can be replaced with niraparib.
[00061] The transcriptomic profiling disclosed herein indicates the necessity of BAP1 deubiquitinase function in repairing multiple types of DNA damage responses, including nucleotide excision repair (NER) and homologous recombination. The BAP1 protein has been reported to be recruited to the sites of DNA double stranded breaks to promote repair by homologous recombination, possibly by deubiquitinating H2Aub at these sites to increase chromatin accessibility to allow for subsequent repair procedures. BAP1 has also been shown to mediate repair of another type of DNA lesion, namely DNA bulky adducts. Potential deubiquitination targets of BAP 1 have been identified as DDB1, RAD23B and COPS7B. These targets are essential to recognise DNA bulky adducts in the GG-NER pathway. Without BAP1, the global genome nucleotide excision repair (GG-NER) process is consequently hindered by elevated levels of DNA damage.
[00062] By performing compound screening, SP2509, a LSD1 inhibitor, was identified as an inhibitor that effectively sensitises B API -deficient cells, or cells with aberrant BAP1 deubiquitinase function, to apoptosis. SP2509 has been observed to inhibit different functions of LSD1, depending on context, including H3K4me2 demethylation, H3K9me2 demethylation and protein-protein interaction. It was shown that that SP2509 inhibits H3K9me2 demethylation. ChlP-Seq analysis showed accumulation of H3K9me2 at sites where BAP1 and LSD1 both binds upon SP2509 treatment, indicating chromatin compaction which may hinder subsequent repair processes. The interaction between LSD1 and BAP1 was also shown to increase after SP2509 treatment, accompanied by greater impediment of nucleotide excision repair (NER) processes with increased DNA damage levels. This can be seen, for example in the figures presented herewith. Specifically, the height of the curves for BAP1 and LSD1 increased in the ChlP-Seq profiles in Figure 6(B), the intensity of the bands in coimmunoprecipitation is also stronger in Figure 6(A) after SP2509 treatment. Without being bound by theory, it is therefore thought that LSD1 is important in chromatin de-condensation, which is important and common after DNA recognition step for both global genome nucleotide excision repair (GG-NER) and transcription-coupled nucleotide excision repair (TC-NER). Impairment of both crucial steps obstructs NER, resulting in accumulation of unresolved DNA lesions, and thereby causing apoptosis.
[00063] It was shown that BAP1, LSD1 and PARP1 can interact at a protein and a chromatin level. This information indicates that, under some circumstances, during nucleotide excision repair (NER), BAP1, LSD1 and PARP1 are in such close proximity that they associate with each other.
[00064] PARP is a well-studied molecule in DNA damage repair responses, with promiscuity for recognition of various types of DNA lesions. Several single cancer type studies have also shown that PARP inhibitors can reduce growth of BAP 1 -deficient cells. At least three PARP inhibitors, olaparib, niraparib and rucaparib, have already been approved by the FDA for different malignancies, such as, breast, prostate and ovarian cancer. Olaparib is also one of compounds identified in the compound screening assay disclosed herein and had been shown herein to effectively inhibit the growth of BAP 1 -deficient cells. When SP2509 and olaparib are used in tandem, combinational synergism is observed. This synergism is replicable in both in vitro and in vivo models. Combining LSD1 inhibitor and PARP inhibitor for cancer therapy had not been reported. In addition, it is not known that an LSD1 inhibitor may impede rate of NER repair together with PARP inhibitor in cancers with mutations in BAP1. So far, LSD1 inhibitor and PARP inhibitor has been used singly for cancer treatment, in cancers where levels of LSD1 are enhanced and in cancers with known mutations in genes regulating DNA repair pathway respectively. Mechanistically, it was shown that using the inhibitors together resulted in greater hinderance in the nucleotide excision repair (NER) pathway and resulted in an increase in levels of DNA damage levels. The increase of unresolved DNA lesions tips B API -deficient cells towards apoptosis.
[00065] Other than via DNA damage, BAP1 can exert its function as a tumour suppressor by regulating other cellular processes. For example, BAP1 has been shown to mediate the turnover of type 3 inositol- 1, 4, 5 -trisphosphate receptor (IP3R3), promoting apoptosis by regulation calcium (Ca2+) release from the endoplasmic reticulum into the cytosol and mitochondria. Epigenetic modulation of H2Aub by BAP1 to regulate the expression of various pro-survival genes has been shown to affect apoptotic pathways. Similarly, epigenetic remodelling also links BAP1 to metabolism-related biological processes that promotes ferroptosis. Separately, in uveal melanoma and clear cell renal cell carcinoma (ccRCC), loss of BAP1 has been observed to promote an immune-suppressive microenvironment. All these reports indicate the multi-faceted cellular roles of BAP1 as a tumour suppressor and points to other potential vulnerabilities which can be targeted in BAP1- related cancers. [00066] Figure 16(A) disclosed herein showed that the weight of mice treated with a combination of SP2509 and olaparib was indistinguishable from the weight of mice treated with vehicle control. Thus, this data illustrates that the inhibitors disclosed herein can be administered to the subject in need thereof, with minimal drug toxicity effects. The term “drug toxicity”, as used herein, refers to any potentially harmful, unintended effects (also referred to as side effects) that an inhibitor, compound, or drug can have on a living subject when administered to the same. In the art, such a toxic effect of a drug is visualised in a marked reduction, for example, animal model weight. The toxic effect of the inhibitors disclosed herein is shown in both in vitro and in vivo models used herein, thereby underlining the safety of the claimed inhibitors in treatment. In one example, the inhibitors are a combination of SP2577/SP2509 and olaparib.
[00067] Thus, disclosed herein are two exemplary compounds, SP2577/SP2509 and olaparib, that effectively inhibit tumour growth in BAP1- related cancer cells of different cancer types. Loss of BAP1 impairs nucleotide excision repair (NER) and application of the combination of SP2577/SP2509 and olaparib exacerbates this impairment, nudging the cells towards apoptosis as damaging DNA lesions accumulate. The efficacy of SP2577/SP2509 and olaparib is evident in both in vitro and in vivo models used herein. These compounds are therefore therapeutic strategies for treating BAP1- related cancers.
[00068] The invention illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. For example, the terms "comprising", "including", "containing", etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the invention claimed. Thus, it should be understood that although the present invention has been specifically disclosed by preferred embodiments and optional features, modification and variation of the inventions embodied therein herein disclosed may be resorted to by those skilled in the art, and that such modifications and variations are considered to be within the scope of this invention.
[00069] The invention has been described broadly and generically herein. Each of the narrower species and subgeneric groupings falling within the generic disclosure also form part of the invention. This includes the generic description of the invention with a proviso or negative limitation removing any subject matter from the genus, regardless of whether or not the excised material is specifically recited herein.
[00070] Other embodiments are within the following claims and non- limiting examples. In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group.
EXPERIMENTAL SECTION
Intact deubiquitinase function is required for BAP1 to suppress tumour growth
[00071] Loss of BAP1 is highly prevalent in mesothelioma, cholangiocarcinoma, uveal melanoma and clear cell renal cell carcinoma (ccRCC) (Figure 1(A)), and impacts the overall survival and progression free survival of patients, disease specific survival and disease-free months of patients (Figure 8(A)). Therefore, a panel of BAP1 isogenic cell lines from these three origins were assembled: mesothelium (mesothelioma: H28 and H2452), bile duct (bile duct normal: H69, cholangiocarcinoma: HUCCT1, TBT-CCA-S5 and TFK-1) and kidney (kidney normal: HK-2, ccRCC: UMRC6) (Figure 1(B)). Of these cell lines, TBT-CCA-S5 (abbreviated as S5) is an in-house patient-derived cell line that is BAP1 deficient.
[00072] CRISPR-Cas9 mediated gene editing was used to knock-out BAP1 in BAP 1 -proficient cell lines and BAP1 was re-expressed in B API -deficient cell lines using lentivirus transduction. Two forms of BAP were re-expressed: BAP1 WT (denoted as WT), which is the normal wildtype variant of BAPl and BAPl MUT (denoted as MUT), a BAPl C91A variant with abrogated ubiquitin carboxyl hydrolase (UCH) function that hinders deubiquitination of H2AK119UB, which was validated using immunoblot (Figure 1(C)-(E), Figure 8(B)-(D)).
[00073] Loss of BAP1 expression enhances cell proliferation (Figure 1(F)-(M)). While presence of BAP1 WT suppresses cell proliferation, BAP1 MUT is unable to, suggesting that a functional UCH domain is one of the factors important for tumour suppression (Figure 1(H), (I), (K), (L), (M)). A similar trend is observed in tumour formation assays in mouse xenografts, as measured by tumour volume and weight (Figure 1(N) and (O), Figure 8(E)). The data shows unequivocally that BAP1 is a tumour suppressor-dependent on its UCH function.
BAP1 protects cells from DNA damage through its deubiquitinase activity [00074] To elucidate the function of BAP1 with respect to its deubiquitinase function, transcriptomic pathways differentially expressed in TBT-CCA-S5 EV and TBT-CCA-S5 MUT cell lines were compared to TBT-CCA-S5 WT cell lines (Figure 2(A)). Of the 64 pathways found to be specifically downregulated in TBT-CCA-S5 WT as compared to TBT-CCA-S5 EV and TBT-CCA- S5 MUT cell lines, 10 of the pathways are related to DNA damage (Figure 2(A)). The expression of the genes involved in DNA damage repair were higher in cells without BAP1 WT (Figure 2(B)) and in cancer tissues of B API -deficient or BAPl-related mesothelioma, cholangiocarcinoma and clear cell renal cell carcinoma patients (Figure 2(C)). Immunofluorescence staining using yH2A.X confirmed lower level of DNA damage in cell lines with WT variant of B API WT only (Figure 2(D)- (G)). Hence, it is shown that BAP1 regulates DNA damage response through its UCH domain.
BAP1 deubiquitinates lesion recognition proteins in global genome nucleotide excision repair (GG-NER) pathway
[00075] Several BAP1 deubiquitination targets are known, including H2AK119Ub, FOXK2, HCF-1, MBD5, MBD6 and OGT. A highly sensitive PTMScan Ubiquitin Remnant Motif immunoprecipitation method was used, followed by mass spectrometry, to identify additional deubiquitination targets of BAP1. 235 peptides of such deubiquitination targets of BAPlwere only found ubiquitinated in S5 EV and S5 MUT cell lines (Figure 3(A)). Gene ontology analysis of these targets unveiled four pathways related to global genome nucleotide excision repair pathway (GG- NER), out of the top eleven significant DNA damage repair related pathways (Figure 3(B)), with 3 likely BAP1 deubiquitination targets being: DDB1, RAD23B and COPS7B. BAP1 was found to localise at sites with UV-induced lesions which require NER (Figure 3(C)), providing further evidence of the involvement of BAP1 in the nucleotide excision repair (NER) pathway.
[00076] Global genome nucleotide excision repair (GG-NER) and transcription-coupled nucleotide excision repair (TC-NER) are the two main nucleotide excision repair (NER) pathways in eukaryotic cells. Transcription-coupled nucleotide excision repair (TC-NER) pathway repairs lesions caused by bulky adducts in the actively transcribed regions of the DNA, while the global genome nucleotide excision repair (GG-NER) pathway repairs the same lesions in non-transcribed regions of the DNA, with the only difference in the damage recognition module of the repair pathway. In the global genome nucleotide excision repair (GG-NER) pathway, the lesions are first recognised by the heterodimer complex DDB2-DDB 1 , which then recruits the XPC-RAD23B complex to the chromatin. The binding of the latter complex is the trigger for cascade of nucleotide excision repair (NER) events. In transcription-coupled nucleotide excision repair (TC-NER), CSA and CSB are responsible for identifying the lesion and releasing the stalled RNA polymerase II from actively transcribed sites. COPS7B regulates the activity of both DDB1 and CSA. Other than their respective mechanisms for lesion recognition, the remaining repair processes in the two of nucleotide excision repair (NER) pathways are identical. Subsequently, the lesion is verified and the DNA is unwound by helicase activity, allowing other protein complexes access to define the cleavage site and strand specificity, the damaged DNA region is cleaved and the excised DNA then replaced with a newly synthesised DNA patch.
[00077] After DNA lesion recognition, degradation of XPC and CSB is essential for recruitment of other downstream components needed for nucleotide excision repair (NER) and are therefore good indicators for the progression of global genome nucleotide excision repair (GG-NER) and transcription-coupled nucleotide excision repair (TC-NER), respectively. Immunofluorescence staining of XPC and CSB after UV irradiation showed that level of XPC in the nucleus peaked and then decreased at later time points when functional BAP1 was deficient, but not for the level of CSB in the nucleus, which peaked and decreased at the same time points. This implies that BAP1 plays a role in GG-NER, but not TC-NER (Figure 3(D), Figure 3(E), Figure 9(A)). This further supported by immunoblotting of the levels of XPC and CSB in the nucleus (Figure 9(B)).
[00078] BAP 1 can therefore regulate the turnover of DDB 1 , RAD23B and COPS7B , to mediate global genome nucleotide excision repair (GG-NER) progression. The endogenous protein levels of DDB 1 , RAD23B and COPS7B were higher (Figure 9(C)) and ubiquitination level of DDB 1 , RAD23B and COPS7B were lower (Figure 9(D), (E)) in cells with functional BAP1, suggesting that deubiquitination by BAP1 can protect them from degradation. In vitro deubiquitination assays were performed and reduced ubiquitination of DDB1 (Figure 3(F)), RAD23B (Figure 3(G)) and COPS7B (Figure 3(H)) was found when functional BAP1 was present.
[00079] Cells with functional BAP1 were shown to be more sensitive to UV radiation (Figure 9(F)). The ubiquitination sites (identified by mass spectrometry) of DDB1, RAD23B and COPS7B were mutated (named as mDDBl, mRAD23B and mCOPS7B), so that they could no longer be ubiquitinated and degraded, and were subsequently introduced into BAP1 isogenic cell lines. Introduced mDDB 1 , mRAD23B and mCOPS7B were unable to confer additional protection of cells with functional BAP1 against UV radiation (Figure 3(1) and (J), Figure 9(G) and (H)). However, cells that were deficient or contained BAP1 MUT were more resistant to UV radiation than when nonmutated version of the proteins were introduced (Figure 3(1) and (J), Figure 9(H)), suggesting that the turnover of DDB 1, RAD23B and COPS7B by BAP1 are important for effective nucleotide excision repair (NER). Overall, the data demonstrates that DDB1, RAD23B and COPS7B are deubiquitination targets of BAP1 and regulation of turnover by BAP1 is important for global genome nucleotide excision repair (GG-NER).
Loss of functional BAP1 sensitises tumour cells to LSD1 inhibitor SP2509
[00080] Identification of compounds that are effective in treating B API -deficient cells as clinical therapeutic strategies for B API -related cancer patients was of interest. An anti-cancer, small molecule inhibitor screening (422 compounds) was performed on parental and BAP1 knockout (KO) cell lines to find compounds that are capable of inhibiting proliferation of BAP1 KO compared to parental cell lines (Figure 10(A)). Using this strategy, SP2509, a LSD1 inhibitor, was found as of the top hits from the screen. SP2509 was proven to be effective in inhibiting the clonogenic potential of B API -deficient cells originating from mesotheliomas, cholangiocarcinoma (CCA) and clear cell renal cell carcinomas (ccRCC), dependent on intact UCH function of BAP1 (Figure 4(A)).
[00081 ] The specificity of the compounds against LSD 1 was validated by knocking down LSD 1 in vitro, which showed, similar to the use of SP2509, that the tumorigenic potential of BAP 1 -deficient cells was reduced (Figure 10(B)). The effectiveness of SP2577, a clinical formation of SP2509, in growth inhibition of BAP 1 -deficient and BAP1 MUT tumours was also shown in vivo in mouse xenografts (Figure 4(B), Figure 10(C)). SP2509 was also observed to target cells that are deficient in, or that do not contain, functional BAP1 by inducing apoptosis (Figure 4(C) and Figure 4(D)).
[00082] The effectiveness of SP2509 in inducing cell death was validated using in vitro cell survival assay. The cell survival rates in cell lines of different tumour origins, including cholangiocarcinoma (CCA), renal cell carcinoma (ccRCC), mesothelioma and uveal melanoma cell lines, were measured over a period of 9 days after treatment with SP2509 alone or with a combination of SP2509 and olaparib. The results showed that upon treatment with SP2509, cells lacking functional BAP1 had lower survivability compared to cells with functional BAP1 (Figure 17(A)). Accordingly, it was also demonstrated that upon treatment with a combination of SP2509 and olaparib, cells lacking functional BAP1 had lower survivability compared to cells with functional BAP1 (Figure 17(B)). A comparison between the percentage survivability of cells exposed to SP2509 only and cells exposed to a combination of SP2509 and olaparib also revealed the synergistic effects of SP2509 and olaparib in inducing cell death. The percentage survival of cells deficient in functional BAP1 treated with a combination of SP2509 and olaparib was consistently lower than cells deficient in functional BAP1 treated with S2509 only (CCA cell line: about 20-40% percentage survival of cells treated with SP2509 only vs about 10-20% percentage survival of cells treated with SP2509 and olaparib; ccRCC cell line: about 40% percentage survival of cells treated with SP2509 only vs about 10-20% percentage survival of cells treated with SP2509 and olaparib; Mesothelioma cell line: about 20-30% percentage survival of cells treated with SP2509 only vs about 10-20% percentage survival of cells treated with SP2509 and olaparib; uveal melanoma cell line: about 40% percentage survival of cells treated with SP2509 only vs about 15% percentage survival of cells treated with SP2509 and olaparib) (Figure 17(A) and Figure 17(B)).
SP2509 further compromises nucleotide excision repair (NER) by obstructing chromatin decondensation in BAPl-related tumours
[00083] Transcriptomics analysis revealed upregulation in the global genome nucleotide excision repair (GG-NER) pathway and genes after SP2509 treatment in S5 EV and S5 BAP1 MUT cells as compared to S5 BAP1 WT cells (Figure 5(A) and Figure 5(B), Figure 11(A)). This data was validated using qPCR in two sets of isogenic cell lines (Figure 11(B)). This implies the presence of increased stimulation and requirement for nucleotide excision repair (NER) pathway upon treatment with SP2509. Similar to BAP1, LSD1 was found to be able to localise at sites with UV-induced lesions which required nucleotide excision repair (NER; Figure 11(C)). Interestingly, impediment of both the global genome nucleotide excision repair (GG-NER) and transcription-coupled nucleotide excision repair (TC-NER) pathways was detected. This was represented by increased nuclear level of XPC and CSB respectively observed through immunofluorescence (Figure 5(C) and Figure 5(D)) and immunoblotting (Figure 11(D)), after SP2509 treatment in cells that are deficient in, or that do not contain, functional BAP1. This was accompanied by increased DNA damage (Figure 5(E)) and increased levels of bulky lesions, such as thymine dimers that require nucleotide excision repair (NER; Figure 11(E)), suggesting rate of NER is hindered by the inhibition of LSD1.
[00084] ATAC-Sequencing analysis showed that SP2509 affects chromatin accessibility and nucleosome occupancy in cells with functional B API . Nucleosome occupancy profiles in human bile duct carcinoma cell line (HUCCT), BAP1 knockout human bile duct carcinoma cell line (HUCCT1 KO), TBT-CCA-S5 EV (S5 EV), TBT-CCA-S5 BAP1 wild-type (S5 WT) and TBT-CCA-S5 BAP1 mutant (S5 MUT) with or without exposure to SP2509 were investigated using ATAC-Sequencing (Figure 11(F)). It was found with SP2509 treatment nucleosomal occupancies in cells with functional BAP1 were diminished, but the nucleosomal occupancy in B API -deficient and BAP1 mutant cells were unchanged, suggesting higher chromatin accessibility in cells with functional BAP1 with SP2509 treatment.
[00085] Co-immunoprecipitation assays showed that LSD1 and BAP1 interact on a protein level, with slight increase in interaction with SP2509 treatment (Figure 6(A)). This interaction was also observed on a chromatin level with a similar trend (Figure 6(B)). The relationship between ESDI and BAP1 was investigated. It was found that SP2509 treatment did not alter the protein level of the de-ubiquitination targets of BAP1, DDB1, RAD23B and COPS7B, significantly (Figure 12(A)). Furthermore, the introduction of mDDBl, mRAD23B and mCOPS7B did not confer significant protection of cells deficient in functional BAP1 from SP2509 induced death (Figure 6(C), Figure 12(B)). The data suggests that LSD1 can interact with BAP1 to effect nucleotide excision repair (NER), but did not affect or depend on BAP1 deubiquitination targets. Without being bound by theory, LSD1 is therefore thought to play a role in nucleotide excision repair (NER) steps after DNA damage recognition.
[00086] ESDI is a histone demethylase that is capable of catalysing the demethylation of mono- and di-methylated histone 3 lysine 4 (H3K4me2 and H3K4mel) and histone 3 lysine 9 (H3K9me2 and H3K9mel). Demethylation of H3K4me2 and H3K4mel negatively regulates gene expression by shaping the chromatin into a repressive conformation. It has also been shown that LSD1 is recruited to sites of DNA damage to demethylate H3K4me2, promoting DNA repair. On the other hand, H3K9me2 demethylation by LSD1 remodels the chromatin into an active conformation, thereby activating gene expression. Roles of LSD 1 -mediated H3K9me2 demethylation in DNA damage repair have not been reported. [00087] A global increase in H3K9me2 and H3K9me3 levels was detected upon SP2509 treatment, but not in H3K4me3 or H3K4me2 (Figure 6(D)), indicating that SP2509 inhibits the demethylation activity of LSD1 specifically for H3K9me2/3 in the present context. At the chromatin level, an increase in H3K9me3 and H3K9me2 and decrease in H3K9mel occupancy was found to be present with SP2509, with cells deficient in functional BAP1 having a markedly lower H3K9mel levels and slightly higher H3K9me3 and H3K9me2 levels when compared to cells with functional BAP1 (Figure 6(E)). Using small molecule compounds that inhibit H3K9me3/2 and H3K4me3/2 demethylation separately (Figure 12(C)), it was shown that, in order to reduce tumorigenic potential of cells deficient in functional BAP1, inhibition of H3K9me3/2 demethylation is more important than inhibition of H3K4me3/2. H3K9mel mark is known to be associated with the euchromatin, where the chromatin structure is relaxed. On the other hand, H3K9me2 and H3K9me3 have been found in the heterochromatin region, where the chromatin structure is compact. In addition, H3K9me3 has been shown to promote the formation of heterochromatin regions. Therefore, taken together, the data suggests that LSD1 can play roles downstream to damage recognition in nucleotide excision repair (NER) by decondensing the DNA through demethylation of H3K9me3/2 to enable nucleotide excision repair (NER) to proceed smoothly. Meanwhile, BAP1 works upstream of LSD1 in nucleotide excision repair (NER) to regulate the turnover of the proteins involved in global genome nucleotide excision repair (GG-NER) damage recognition.
Tumour cells with loss of functional BAP1 are more sensitive to a synergistic combination of SP2509 and olaparib
[00088] Deficiency in BAP1 has been demonstrated to sensitise cells to PARP inhibitors. Currently, PARP inhibitors are being used in two ongoing clinical trials (NCT03207347, NCT03531840) in mesothelioma patients selected for BAP1 mutations. In the present disclosure, olaparib, a PARP inhibitor, was found in the compound screen (Figure 10(A)) and its effectiveness in cells deficient in, or that did not contain, functional BAP1 was validated in colony formation assays (Figure 13(A)) and in vivo in mouse xenograft models (Figure 13(B)).
[00089] Recruitment of PARP is one of the earliest events in diverse types of DNA damage responses. PARP catalyses the polymerisation of a negatively charged poly (ADP-ribose) (PAR) to itself and its target proteins. Proteins involved in a DNA damage response are recruited to the sites of DNA damage through non-covalent binding to PAR. PARP has been reported to play multiple roles in nucleotide excision repair (NER). PARP1 is one of the first proteins to recognise and arrive at the site of lesion and will add PAR to itself. DDB2 and XPC will then be recruited by binding to PAR. Other proteins recruited through binding to PAR include chromatin remodelers involved in chromatin decondensation and proteins required for lesion verification. Therefore, PARP plays an important role in facilitating efficient nucleotide excision repair (NER).
[00090] Compound synergism was observed when, for example, olaparib and SP2509 were used in combination in vitro (Figure 7(A) and Figure 7(B), Figure 14(A), Figure 14B) and in vivo in mouse xenografts (Figure 7(C), Figure 14(C)) and in PDX models (Figure 7(D), Figure 14(D), Figure 14(E)). Increased apoptosis was observed with compound combination treatment (Figure 7(G) to (H)). PARP1, LSD1 and BAP1 were shown to localise in the same chromatin regions (Figure 6(B), Figure 7(1)) and are also found associated with each other in co-immunoprecipitation (Co-IP) experiments (Figure 6(A), Figure 14(F)). Upon combination treatment, the nucleotide excision repair (NER) ability of the cells was also impaired (Figure 14(G)-(J)). These findings suggest that the combination of SP2509 and olaparib is a more effective therapeutic target for BAP1- related tumours clinically compared to the usage of a single compound.
[00091] Overall, the results show that in normal cells, when the nucleotide excision repair (NER) pathway is activated, several proteins that regulate detection, including PARP1, DDB1, RAD23B, COPS7B, are recruited to the site of lesion (Figure 15). BAP1 maintains the level of DDB 1, RAD23B and COPS7B to facilitate the damage recognition. DNA will need to be unwound for effective DNA repair to occur and LSD1 demethylates H3K9me2 to aid chromatin decondensation. When BAP1 is deficient, lesion recognition is abrogated, and nucleotide excision repair (NER) is delayed. Further inhibition of PARP1 or/and LSD1 undermines lesion recognition or/and hinders DNA winding for repair respectively, impeding NER, tipping the cells towards apoptosis.
[00092] To assess the drug toxicity of SP2509 and olaparib, the weight of mice, with or without functional BAP1, dosed with either vehicle control or a combination of SP2509 and olaparib, was monitored and measured over a period of four weeks post-treatment. The results showed that the weight of mice (with or without functional BAP1) remained stable after the combination treatment, suggesting that the combination drug treatment was not toxic on the mice (Figure 16(A)). Drug toxicity of SP2509 and olaparib was further assessed by examining mice tissues/organs morphology upon treatment with SP2509 and olaparib, alone or in combination. Hematoxylin and eosin-stained histology images do not show morphological changes in tissues of the liver, kidney and spleen of mice dosed with SP2577 and olaparib singly and in combination (Figure 16(B)). This data suggests that treatment with SP2577 or olaparib alone or in combination results in little to no adverse effects on mice organ structures.
Inhibition of LSD1 prevents cell growth in BAPl-deficient cells
[00093] The effects of LSD1 inhibitors in inhibiting cell growth were assessed by measuring the percentage inhibition of growth in cells were treated with LSD1 inhibitors, OG-L002, SP2509, and GSK-LSD1. The results demonstrated that LSD1 inhibitors were effective in inhibiting cell growth in cells deficient in BAP1 (Figure 18). The Y-axis indicates the normalised percentage inhibition of cell growth in H69 BAP1 KO cells, wherein the read out had been normalised to that of the H69 cells.
Cell lines
[00094] H69 was obtained from D. Jefferson (New England Medical Center, Tufts University) and cultured in H69 enriched media as previously described (82). HUCCT1 (HSRRB), TFK-1 (DSMZ), HK-2 (ATCC), H28 (ATCC) and H2454 (ATCC) were maintained in RPMI-1640 medium + 10% FBS (Gibco). UMRC-6 (Sigma Aldrich) was maintained in DMEM + 10% FBS (Gibco). TBT- CCA-S5 was derived from patient tumours. Briefly, tumour cells were dissociated from primary tumours using collagenase, seeded and maintained in H69 enriched media (82). All cell lines were maintained at 37°C in a humidified chamber in the presence of 5% CO2 and routinely confirmed to be free of mycoplasma. Cells used for experiments were between 3 and 10 passages from thawing. Experiments are performed in accordance to approved IRB protocols (NUS-IRB Ref: N-19-047, CIRB Ref 2019/2133).
CRISP-Cas9 mediated silencing of BAP1
[00095] BAP1 was knocked out using CRISPR-Cas9 mediated gene editing in H69, HUCCT1 and HK-2. Two gRNAs were ligated into BbsI digested vectors. Left gRNA was cloned into the BbsI digested pX330A-2A-GFP- 1X2 (Addgene #58766, with addition of green fluorescent protein (GFP)) whereas the right gRNA was cloned into a BbsI digested pX330S backbone (Addgene #58778). Golden gate assembly was performed to assemble the two gRNAs into the pX330A-2A-GFP-lX2 plasmid, which was transfected into cells using Lipofectamine 3000 (Thermo Scientific). Individual GFP-positive single cells were collected and cultured. Individual clones were validated by polymerase chain reaction (PCR) of genomic DNA and the expression of B API was confirmed to be knocked out by immunoblotting. Three to five individual knockout clones were pooled to form the final knockout cell line.
The gRNAs used for deletion of B API are:
Left (5’ - 3’, hgl9 chr3: 52444330-52444349): CGCAGCACCCGGGCCTAGTA (SEQ ID NO: 2) Right (5’-3’ hgl 9 chr3: 52442555-52442574): TAGAGACCTTTCGCCGGGAC (SEQ ID NO: 3) Re-expression of BAP1
[00096] The cDNA of wildtype and mutant (C91S) BAP1 were cloned from pcDNA3.1 zeo(-)/BAPl and pcDNA3.1 zeo(-)/BAPl (C91A) plasmids, respectively. The cDNA was either cloned into pBabe (Addgene 1764) or pLenti-GFP (Addgene 17448). Retroviruses were packaged using Platinum-A (Plat-A) Retroviral Packaging Cell Line, while lentiviruses were packaged using HEK93T cells with packaging plasmid psPAX2 (Addgene 12260) and the envelope plasmid pMD2.G (Addgene 12259). Cells were selected with puromycin for 3 days.
Cloning
[00097] The cDNA of DDB 1 , RAD23B and COPS7B was cloned from cDNA extracted from H69 cells. The cDNAs were then cloned to pCMV-FLAG N-terminal Flag tagged plasmid. These plasmids were then transiently introduced into indicated cells using Lipofectamine 3000 (Thermo Scientific) for in vitro ubiquitination study. The cDNAs were also cloned into pLenti-GFP (Addgene 17448). Lentiviruses were packaged using HEK93T cells and transfected cells were selected by puromycin selection. These cells are used for colony formation assays.
Compound screening and proliferation assays [00098] An anti-cancer small molecule inhibitor screening of 422 compounds (SelleckChem) was used for screening. CellTiter-Glo Luminescent Cell Viability Assay (Promega) was used to determine the proliferation of the cells after treatment.
[00099] All proliferation assays for cell growth were performed immediately after transfection of indicated plasmids. CellTiter-Glo Luminescent Cell Viability Assay (Promega) or Cell Counting Kit-8 Cell Proliferation Assay (Dojindo) was used to determine the proliferation of the cells at the indicated time duration according to the manufacturer’s protocol.
Clonogenic assays
[000100] Clonogenic assays were performed by seeding of 10,000 cells in 6-well plates one day before addition of compounds disclosed herein or transfection of indicated plasmid. The cells were allowed to grow for 7-9 days before staining by crystal violet. The compounds used herein are: olaparib (Santa Cruz, sc-302017), SP2509 (Selleckchem, S7680), ML324 (Targetmol, T6593), JIB- 04 (Targetmol, T1868), CPI-455 (Targetmol, T3552), GSK467 (Targetmol, T5484). The siRNA used herein is siLSDl(Sigma Aldrich, EHU098171).
Apoptosis Assay
[000101] IxlO5 cells were seeded in 6-well plates and treated with indicated agents for 96 hours. Apoptotic cells were quantified using the Annexin V-FITC Apoptosis detection kit (Thermo scientific) according to the manufacturer’s protocol. Data was acquired and analysed using BD FACSCalibur Flow Cytometer (BD Biosciences) and Flowjo.
In vivo tumour formation
[000102] All animal studies were conducted in compliance with animal protocols approved by Institutional Animal Care and Use Committee (IACUC) of Singapore (IACUC Ref. No.: 2018/SHS/1371). Male NSG mice (Jackson Lab) mice (at least 8 weeks old) were implanted with 1 x 106 cells subcutaneously. Tumour volume was monitored every 3-4 days. Tumour volume was calculated as (length x width x width) x 71/6. Animals were sacrificed when the total tumour volume on both flanks exceeded 2000 mm3.
Olaparib and SP2577 in vivo efficiency study
[000103] Olaparib (Targetmol) was dissolved in DMSO and diluted to 25mg/mL in PBS containing 10% 2-hydroxy-propyl-beta-clodextrin. SP 2577 (Ctech Global) was dissolved in solution containing 10% ethanol, 40% PEG-400 and 50% PBS (pH 9.0). After the subcutaneous implanted tumours reach a calculated average volume of 50-100 mm3, the mice (minimum 30g in weight) were randomised into 2 treatment groups: (1) Compound and (2) vehicle control. Olaparib was dosed by oral gavage and SP2577 was dosed by i.p. once daily for 5 consecutive days a week (5 on, 2 off). For compound combination studies, the compounds were first dosed for 5 consecutive days a week (5 on, 2 off) for 2 weeks, and then subsequently dosed 3 evenly spaced-out days a week (1 on, 1 off, 1 on, 1 off, 1 on, 2 off). The mice were provided with food and water ad libitum and monitored for changes in general health daily. Tumour volume was monitored every 3-4 days. Tumour volume was calculated as (length x width x width) x 71/6. Animals were sacrificed when the total tumour volume on both flanks exceeded 2000 mm3.
Olaparib and SP2577 toxicity in vivo study
[000104] Mice weight was measured weekly basis to ensure no drastic loss in weight after drug regimen was started. When the animals were sacrificed at the end of the drug regimen, the kidney, spleen, and liver of the mice were harvested and fixed in formalin. The fixed tissues were embedded in paraffin blocks and then sectioned onto slides. Hematoxylin and eosin staining was performed on the sectioned tissues and the morphology observed under a light microscope.
ChlP-seq
[000105] 20 million cells were cross-linked with 1% formaldehyde for 10 minutes at room temperature, and quenched by adding glycine to a final concentration of 0.2M. Chromatin was fragmented to around 300-500bp by sonication (Vibra cell, SONICS). The fragmented chromatin was incubated with Protein G Dynabeads (Lif eTechnologies) that had been conjugated with 20pg antibodies for each protein of interest and overnight at 4°C. The beads with the bound protein crosslinked with chromatin were then washed 6 times with wash buffer at room temperature. Reverse crosslink was performed using Proteinase K treatment. At least 10 ng of the amplified DNA was used for library preparation with NEBNext ChlP-Seq library prep reagent set (NEB). Each library was sequenced to an average depth of 20-50 million reads on HiSeq4000 or Novaseq. Antibodies used for ChlP-Seq are: BAP1 (Santa Cruz, SC-28383, Lot 12319), LSD1 (Bethyl, A300-215A, Lot 1), PARP1 (Cell signalling, 9532, Lot 9), H3K9mel (Abeam, ab8896, Lot GR3299164-1), H3K9me2 (Abeam, abl220, Lot GR3228498-2), H3K9me3 (Abeam, ab8898, Lot GR3302452-1). Burrows-Wheeler Aligner (BWA-mem) was used to map the raw ChlP-seq sequences against the human reference genome (hgl9). Duplicates removed by rmdup and only reads with mapQ >10 and with were used. Significant peaks were called using MACS2. NGSplot was used to visualise ChlP-seq profiles.
RNA-Seq
[000106] Qiagen RNeasy Mini kit was used to extract RNA and RNAseq libraries were prepared from I pg of total RNA using Illumina Tru-Seq Stranded Total RNA kit (Illumina) using the manufacturer’s protocol. Paired-end 150 bp sequencing was performed using Illumina HiSeq4000 sequencer. RNA-seq data were mapped to hgl9 (hs37d5) using STAR and gene expression levels were quantified with STAR. Log fold change of differential expression genes was computed with DESeq2.Only genes with |log2 fold-change|>l and p-value<0.05 are considered significant. GSEA (v3.0) was used to perform Gene Set Enrichment Analysis (GSEA). Heatmapper was used to generate heatmaps. PTMScan Ubiquitin Remnant Motif immunoprecipitation PTMScan Ubiquitin Remnant Motif (K-a-GG) Kit (Cell Signalling) was used to pulldown for ubiquitinated peptides following the manufacturer’s instructions. Three replicates were performed. The immunoprecipitated peptides were separated on a Cl 8 reversed-phase column (Easy-Spray, 50 cm x 75 pm internal diameter, 2 pm particles) maintained at 50°C using an EASY-nLClOOO liquid chromatography coupled to an Orbitrap Fusion mass spectrometer (Thermo Scientific). Samples were eluted using 0.1% formic acid in water and 0.1% formic acid in 99% acetonitrile as mobile phases with a 3-27% acetonitrile gradient over 45 minutes, followed by a ramp to 50% acetonitrile over 15 minutes, and finally a steep gradient to 90% acetonitrile over 5 minutes. The final mixture was maintained for 5 minutes to elute all remaining peptides. Total gradient duration was 70 minutes at a constant flow rate of 300 nl/min. Data was acquired in data-dependent mode with the following parameters: Samples were ionized using 2.5 kV and 300°C at the nanospray source and positively-charged precursor MSI signals between 350-1,550 m/z were detected using an Orbitrap analyser set to 60,000 resolution, automatic gain control (AGC) target of 400,000 ions, and maximum injection time (IT) of 50 milliseconds. Precursors with charges 3-7 and having the highest ion counts in each MSI scan were further fragmented using collision- induced dissociation (CID) at 35% normalized collision energy and their MS2 signals were analysed by ion trap at an AGC of 15,000 and maximum IT of 50 milliseconds. Precursors used for MS2 scans were excluded for 90 seconds in order to avoid re-sampling of high abundance peptides. The MS1- MS2 cycles were repeated every 3 seconds until completion of the run. Identification of proteins within each sample was performed using MaxQuant (vl.5.5.1). Raw mass spectra were searched against the human proteome. Carbamidomethylation on Cys was set as the fixed modification and deamidation of asparagine and glutamine, acetylation on protein N terminus, oxidation of Met methionine, and diglycine (GlyGly) on lysine were set as dynamic modifications for the search. Trypsin/P was set as the digestion enzyme and was allowed up to two missed cleavage sites. Precursors and fragments were accepted if they had a mass error within 20 ppm and 0.5 Daltons, respectively. Peptides were matched to spectra at a false discovery rate (FDR) of 1 % against the decoy database. Label-free quantitation (LFQ) was also performed on MaxQuant using the FastLFQ method with a minimum ratio count of 2. Only ubiquitinated peptides that were detected in TBT-CCA-S5 EV and TBTS5 Mut but not TBT-CCA-S5 WT were considered to be targets of B API.
ATAC-Sequencing
[000107] ATAC-Sequencing was performed as per described in Buenrostro et al. 2015 ATAC- Seq peaks were called using nfcore/atacseq, Nucleosome positioning was determined using NucleoATAC.
In vitro ubiquitination assay
[000108] Ubiquitination targets were validated by in vitro protein ubiquitination assay. HEK293 cells were transfected with HA-UB (Addgene #17608) and other indicated plasmids. After three days, the cells were incubated with lOmM MG132 for 3 hours before they were harvested and lysed (50 mM Tris HC1, pH 7.4, 150 mM NaCl ,1 mM EDTA and 1% Triton X-100). The FLAG tagged proteins were allowed to bind to Dynabeads Protein G (ThermoFisher Scientific Corporation, Waltham, MA, USA) that had been conjugated with Monoclonal Anti-Flag M2 antibody overnight and washed five times (0.5 M Tris HC1, pH 7.4, 150mM NaCl). Elution was performed by heating the beads with 2x Laemmli Sample Buffer (Bio-rad) at 95°C for 30 minutes at 2000 rpm on a Thermo-mixer and analysed by immunoblotting. Ub-conjugated proteins were detected using HA antibody (Santa Cruz, SC-7392). For endogenous protein ubiquitination, IP was performed using the following antibodies: DDB1 (Bethyl, A300-462), RAD23B (Santa Cruz, SC-166507), and COPS7B (Abeam, abl24718) and ubiquitinated proteins were detected by K48-Ub antibody (Millipore, 05-1307).
Co-immunoprecipitation
[000109] Cells were cross-linked with 1% formaldehyde for 10 minutes at room temperature and quenched by adding glycine to a final concentration of 0.2M. Cytoplasmic proteins were removed, and nuclear proteins were extracted using nuclear extraction buffer (50 mM HEPES-KOH pH7.5, 150mM NaCl, 2mM EDTA, 1% Triton X-100, 0.1% Sodium deoxycholate, 1% SDS), followed by 8M Urea and then sonicated. The extracted nuclear proteins were incubated with Protein G Dynabeads (LifeTechnologies) that had been conjugated with 20pg antibodies for each protein of interest and overnight at 4°C. Beads were washed 5 times with RIPA buffer. Elution was performed by heating the beads with 2x Laemmli Sample Buffer (Bio-rad) at 99°C for 30 minutes at 2000 rpm on a Thermomixer. The antibodies used are: BAP1 (Santa Cruz, SC-28383) and LSD1 (Bethyl, A300-215A).
Immunoblotting
[000110] Cell pellets were collected and washed twice in cold PBS, before they are lysed in RIPA buffer supplemented with protease and phosphatase inhibitor cocktail for whole cell protein lysate immunoblotting (Roche). For extraction of nuclear and chromatin-bound proteins, cytoplasmic proteins were first removed, and nuclear proteins were subsequently extracted using nuclear extraction buffer (50 mM HEPES-KOH pH7.5, 150 mM NaCl, 2 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 1% SDS), followed by 8M urea. The extracted nuclear proteins were then resuspended in RIPA buffer and sonicated. Protein extracts were quantified using BCA assay (Thermo scientific). At least 5 pg of protein was used for each immunoblotting experiment. Proteins were transferred to nitrocellulose membranes by transferring at 100V for 90 minutes in ice. Western blotting was performed by incubating membranes overnight at 4°C with the following antibodies: ubiquityl- Histone H2A (Cell Signaling, 8240), Histone H2A antibody (Abeam, abl8255), BAP1 (Santa Cruz, SC-28383), LSD1 (Bethyl, A300-215A), PARP1 (Cell signalling, 9532), H3K9mel (Abeam, ab8896), H3K9me2 (Abeam, abl220), H3K9me3 (Abeam, ab8898), DDB1 (Bethyl, A300-462), RAD23B (Santa Cruz, SC-166507), COPS7B (Abeam, abl24718), K48-Ub antibody (Millipore, 05-1307), H3K4mel (Abeam, ab8895), H3K4me2 (Abeam, ab32356), H3K4me3 (Millipore, 07-473), Tubulin (Proteintech, 66240), XPC (Bethyl, A301-122A), CSB (Bethyl, A301-345A), cleaved Caspase 3 (Cell signalling, 9664), cleaved PARP1 (Cell signalling, 5625). Membranes were then incubated in secondary antibodies for 1 hour at room temperature and the immunoreactivity was detected with SuperSignal West Femto Maximum Sensitivity Substrate (Thermo scientific).
Immunofluorescence staining
[000111] Cells were plated on p-Dish 35 mm imaging dishes (ibidi). Fixation was performed for 10 minutes using 4% paraformaldehyde (Sigma- Aldrich) at room temperature, followed by permeabilization using 0.3% Triton-X 100 (Sigma-Aldrich) on ice for 5-10 minutes. The cells were then blocked and then incubated overnight with the indicated primary antibodies. The cells were then incubated appropriate AlexaFluor conjugated secondary antibodies (Thermo scientific). Hoechst 33342 was used for nuclear staining. The dishes were mounted with PBS. Images were acquired by confocal microscope (Zeiss LSM700). The antibodies used are: CSB (Santa Cruz, SC-166042), XPC (Thermo Scientific, PA3-956), Phospho-Histone H2A.X (Serl39) (Abeam, abl 1175).
SEQUENCE LISTING
Figure imgf000035_0001

Claims

1. A method of treating a BAPl-related tumour in a subject, the method comprising: a. obtaining a sample from the subject; b. determining whether BAP1 in the sample is functional or non-functional; c. administering to the subject a therapeutically effective amount of a PARP inhibitor and a LSD1 inhibitor if BAP1 in the sample is non-functional.
2. The method of claim 1, wherein the BAPl-related tumour is selected from the group consisting of a mesothelioma, a melanoma and a carcinoma.
3. The method of claim 1, wherein the BAPl-related tumour is selected from the group consisting of a bile duct tumour, a kidney tumour, a heart tumour, a lung tumour, a uveal tumour, and an abdomen tumour.
4. The method of claim 1 and 2, wherein the BAPl-related tumour is selected from the group consisting of mesothelioma, cholangiocarcinoma (CCA), clear cell renal cell carcinoma (ccRCC), and uveal melanoma.
5. The method of any one of the preceding claims, wherein the LSD1 inhibitor is selected from the group consisting of SP2509, SP2577, OG-L002, GSK-LSD1, and siRNA that targets LSD1.
6. The method of any one of claims 1 to 5, wherein the LSD1 inhibitor is SP2509 or SP2577.
7. The method of any one of claims 1 to 6, wherein the LSD1 inhibitor is SP2577.
8. The method of any one of the preceding claims, wherein the PARP inhibitor is selected from the group consisting of niraparib, rucaparib, olaparib, and combinations thereof.
9. The method of claim 8, wherein the PARP inhibitor is olaparib or niraparib.
10. The method of any one of claims 1 to 9, wherein the LSD1 inhibitor is SP2577, and the PARP inhibitor is olaparib.
11. The method of any one of claims 1 to 6 and 8 to 9, wherein the LSD1 inhibitor is SP2509, and the PARP inhibitor is olaparib.
12. The method of any one of claims 1 to 5, wherein the LSD1 inhibitor is the siRNA targets an LSD1 cDNA sequence of SEQ ID NO:1.
13. A pharmaceutical composition comprising an LSD1 inhibitor and a PARP inhibitor, wherein the LSD1 inhibitor is SP2577 or SP2509, and wherein the PARP inhibitor is olaparib.
14. A method of screening and identifying an anti-proliferative compound, the method comprising: a. obtaining a population of BAP 1 -deficient cells; b. treating said B API -deficient cell population with the anti -proliferative compound and; c. determining a change in proliferative activity of the population of B API -deficient cells compared to a population of cells producing functional BAP1 protein.
15. The method of claim 14, wherein the population of BAP 1 -deficient cells is derived from a tumour.
16. The method of claim 15, wherein the tumour is derived from a patient thought to be suffering from a B API -related cancer.
PCT/SG2023/050227 2022-04-04 2023-04-04 Compound screening and therapeutic uses WO2023195923A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
SG10202203435U 2022-04-04
SG10202203435U 2022-04-04

Publications (2)

Publication Number Publication Date
WO2023195923A2 true WO2023195923A2 (en) 2023-10-12
WO2023195923A3 WO2023195923A3 (en) 2023-11-23

Family

ID=88244203

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2023/050227 WO2023195923A2 (en) 2022-04-04 2023-04-04 Compound screening and therapeutic uses

Country Status (1)

Country Link
WO (1) WO2023195923A2 (en)

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012009475A1 (en) * 2010-07-14 2012-01-19 Oregon Health & Science University Methods of treating cancer with inhibition of lysine-specific demethylase 1
WO2019133697A1 (en) * 2017-12-27 2019-07-04 Tesaro, Inc. Methods of treating cancer

Also Published As

Publication number Publication date
WO2023195923A3 (en) 2023-11-23

Similar Documents

Publication Publication Date Title
Chen et al. A BAP31 intrabody induces gastric cancer cell death by inhibiting p27kip1 proteasome degradation
Liu et al. Oxidative DNA damage causes premature senescence in mouse embryonic fibroblasts deficient for Krüppel‐like factor 4
JP2023525164A (en) Target-specific degradants and their medical uses
AU2016222587B2 (en) Compositions and methods of treating Fanconi Anemia
CN113209303B (en) WWP1 degradation oncoprotein MUC1 inhibition tumor through lysosome approach and application thereof
Xu et al. Allosteric inhibition of HSP70 in collaboration with STUB1 augments enzalutamide efficacy in antiandrogen resistant prostate tumor and patient-derived models
EP3513192B1 (en) Cell death biomarker
Yang et al. BAP1 regulates AMPK-mTOR signalling pathway through deubiquitinating and stabilizing tumour-suppressor LKB1
Sun et al. OTUD6A in tubular epithelial cells mediates angiotensin II-induced kidney injury by targeting STAT3
Shi et al. MTA2 sensitizes gastric cancer cells to PARP inhibition by induction of DNA replication stress
WO2021105224A1 (en) Kdm subfamily 6 protein inhibitor for use in the treatment of cancer
US12109212B2 (en) Methods of treating cancer having an active Wnt/β-catenin pathway
WO2023195923A2 (en) Compound screening and therapeutic uses
KR101957613B1 (en) Aryl amine substituted quinoxaline used as anticancer drugs
KR102685770B1 (en) Composition for preventing or treating liver cancer comprising OSMI-1 and antitumor agent
Luo et al. CSE reduces OTUD4 triggering lung epithelial cell apoptosis via PAI-1 degradation
Masliantsev et al. Hippo signaling pathway in gliomas. Cells 2021, 10, 184
US20180369203A1 (en) Methods of treating cancer by administering a mek inhibitor in combination with a proteasome inhibitor
Cook Targeting BCL-2 Family Proteins In Therapy Induced Senescent Cancer Cell Models
Liu et al. Osteopontin Regulation of MerTK+ Macrophages Promotes Crohn’s Disease Intestinal Fibrosis
HO et al. Expression of transduced Nucleolin promotes the clearance of accumulated alpha-synuclein
Alhazmi The Antioxidant Sulforaphane (SFN) Elicits It's Cytotoxicity by Inactivating the Promyelocytic Leukemia Protein (PML)
Zema Notch signalling in development and disease: Maml1 and Jagged1 not always on the shadow of Notch
Marques Epigenetic Regulators as New Therapeutic Targets in Pediatric Sarcoma
Gao et al. Yap1-2 Isoform Is the Primary Mediator in TGF-b1 Induced EMT in Pancreatic Cancer