WO2023191631A1 - Antisense nucleic acids for use in the treatment for lmna mutation carriers - Google Patents
Antisense nucleic acids for use in the treatment for lmna mutation carriers Download PDFInfo
- Publication number
- WO2023191631A1 WO2023191631A1 PCT/NL2023/050168 NL2023050168W WO2023191631A1 WO 2023191631 A1 WO2023191631 A1 WO 2023191631A1 NL 2023050168 W NL2023050168 W NL 2023050168W WO 2023191631 A1 WO2023191631 A1 WO 2023191631A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- allele
- nucleic acid
- lmna
- expression
- antisense
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/33—Alteration of splicing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/34—Allele or polymorphism specific uses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
Definitions
- TITLE ANTISENSE NUCLEIC ACIDS FOR USE IN THE TREATMENT FOR LMNA MUTATION CARRIERS FIELD
- the invention relates to antisense molecules suitable for the treatment of heart diseases. More in particular, the invention relates to siRNAs and shRNAs suitable for use in the treatment of cardiac laminopathies, in particular dilated cardiomyopathy. BACKGROUND OF THE INVENTION
- the currently used therapies for heart failure have successfully improved symptoms and survival for most forms of heart failure. However, in a minority of patients, these evidence-based treatments do not halt the progression of the disease, which leaves these patients with therapy-resistant heart failure.
- the present invention provides an isolated antisense molecule capable of reducing or inhibiting expression of an allele of the LMNA gene in a mammalian cell, said antisense molecule comprises an antisense nucleic acid strand which is substantially complementary to a target region of a transcript encoded by the LMNA gene, wherein said antisense nucleic acid strand is at least complementary to SNP rs538089, rs505058 or rs4641 in said target region.
- said antisense molecule is capable of reducing expression of a mutant LMNA allele.
- a preferred isolated antisense molecule according to the invention comprises an antisense nucleic acid strand of 15-30 nucleotides in length.
- said antisense nucleic acid strand is complementary to at least 7, more preferably 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleotides in said target region.
- said antisense nucleic acid strand is complementary to at least 7, more preferably 8, 9, 10, 11 or 12 consecutive nucleotides.
- said target region comprises at least 15, 16, 17, 18 or 19 nucleotides in said target region.
- said target region comprises the nucleic acid sequence selected from the group consisting of: i. GAUGACCUGCUCCAUCACCACCACGUGAGUGGUAGCCGCCGCUGA (SEQ ID NO:1), ii. GAUGACCUGCUCCAUCACCACCAUGUGAGUGGUAGCCGCCGCUGA (SEQ ID NO:2), iii. GAUGACCUGCUCCAUCACCACCACGGCUCCCACUGCAGCAGCUC (SEQ ID NO:3), and iv.
- said target region comprises the nucleic acid sequence selected from the group consisting of: i. CCUGCUCCAUCACCACCACGUGAGUGGUAGCCGCCGC (SEQ ID NO:5), ii.
- CCUGCUCCAUCACCACCAUGUGAGUGGUAGCCGCCGC SEQ ID NO:6
- iii. CCUGCUCCAUCACCACCACGGCUCCCACUGCAGCAGC SEQ ID NO:7
- CCUGCUCCAUCACCACCAUGGCUCCCACUGCAGCAGC SEQ ID NO:8 or a nucleic sequence being at least 80% homologous thereto. More preferably, at least 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99% homologous thereto.
- said antisense nucleic acid strand comprises a nucleic acid sequence having a consecutive strand of at least 12, 13, 14, 1516, 17, 18 or 19 nucleotides selected from the nucleic acid sequence according to SEQ ID NO:151, SEQ ID NO:152, SEQ ID NO:153 or SEQ ID NO:154.
- said antisense nucleic acid strand comprises a antisense strand as defined in Table 1 or a nucleic acid analogue sequence thereof.
- said antisense nucleic acid strand further comprises a sense strand as defined in Table 1 or a nucleic acid analogue sequence thereof.
- said isolated antisense comprises the nucleic acid sequence selected from the group consisting of SEQ ID NO:71, SEQ ID NO:72, SEQ ID NO:73 and SEQ ID NO:74.
- the dsNA comprises a sense nucleic acid strand of 15-30 nucleotides in length; and wherein the sense nucleic acid strand is complementary to said antisense nucleic acid strand and the sense nucleic acid strand and antisense nucleic acid strand form a duplex region.
- the antisense strand and the sense strand are operably linked by means of a loop strand to form a hairpin structure comprising a duplex structure and a loop structure.
- said dsNA is a shRNA containing an isolated antisense strand of RNA of 15 to 30 nucleotides, preferably 19 nucleotides in length having a 5′ end and a 3′ end, wherein the antisense strand is preferably complementary to at least 15 nucleotides of said target region, and wherein preferably the 5′ end of the sense strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, and an isolated antisense strand of RNA of 15 to 30 nucleotides in length having a 5′ end and a 3′ end, wherein preferably at least 12 nucleotides of the antisense and sense strands are complementary to each other and preferably form a small interfering RNA (siRNA) duplex under physiological conditions.
- siRNA small interfering RNA
- said antisense RNA of the invention is encoded by a oligonucleotide having the following structure: 5’-CCGGAA-19 bp sense strand-TCAAGAC-19bp antisense strand- TTTTTTTG-3’ and reverse 5’-AATTCAAAAAAA-19bp sense strand-GTCTTGA-19bp antisense strand-TT-3’.
- the sense strand is exactly the targeted sequence in the mRNA and the antisense strand its reverse complementary sequence that will eventually bind the mRNA and induce its breakdown and/or inhibition.
- the present invention also provides an expression cassette comprising a nucleic acid encoding said antisense nucleic acid strand according to the invention.
- said nucleic acid encoding said antisense nucleic acid strand of the invention comprises the nucleic acid sequence according to any of SEQ ID Nos 75- 150.
- These expression cassettes may further contain a promoter.
- Such promoters can be regulatable promoters or constitutive promoters. Examples of suitable promoters include a CMV, RSV, pol II or pol III promoter.
- the expression cassette may further contain a polyadenylation signal, such as a synthetic minimal polyadenylation signal.
- the expression cassette may further contain a marker gene.
- said expression cassette comprises 2 nucleic acids encoding said antisense nucleic acid strand according to the invention, wherein a first nucleic acid encodes an antisense strand which reduces the Lamin A isoform and a second nucleic acid encodes an antisense strand which is capable of reducing the Lamin C isoform.
- Expression of the antisense nucleic acid strands preferably is regulatable such that only one of the antisense nucleic acid strands is or can be expressed in a target cell.
- the present invention provides a vector containing the expression cassette described above.
- the vector may contain two expression cassettes, a first expression cassette containing a nucleic acid encoding the antisense strand of the RNA duplex and a second expression cassette containing the nucleic acid encoding a sense strand of the RNA duplex.
- appropriate vectors include adenoviral, lentiviral, adeno-associated viral (AAV), poliovirus, HSV, or murine Maloney-based viral vectors.
- the vector is a lentiviral vector.
- the vector is an AAV.
- said expression cassette encodes any of the ASOs or dsNA as described above.
- the invention further provides a cell containing an expression cassette according to the invention.
- said cell is a mammalian cell, preferably a human cell.
- said cell is a heart cell, preferably a Human induced pluripotent stem cell- derived cardiomyocyte (hiPSC-CM).
- the invention further provides a pharmaceutical composition for reducing the expression of the LMNA gene in an organism, comprising the antisense molecule of the invention and a pharmaceutically acceptable carrier.
- the invention further provides an isolated antisense molecule according to the invention for use in a medical treatment.
- the invention further provides the isolated antisense molecule according to the invention, the nucleic acid encoding the isolated antisense molecule of the invention, the expression cassette of the invention, or the expression vector of the invention, the pharmaceutical composition according to the invention for use in the treatment of a heart failure.
- said treatment is a treatment of a laminopathy, preferably dilated cardiomyopathy.
- the invention further provides a method for selecting an antisense molecule which is suitable for the medical treatment of a disease caused by an autosomal dominant mutation present on a mutant allele of a gene, said method comprising: a. Providing a nucleic acid sample of a subject suffering from a disease which is caused by an autosomal dominant mutation present on a mutant allele of a gene, b.
- the invention further provides an in vitro method for reducing the expression of a mutant LMNA allele in a cell, comprising the following steps: (a) introducing into the cell an antisense molecule of the invention which, upon introduction into a cell expressing a LMNA mutant allele, reduces the expression of the LMNA mutant allele; and (b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the LMNA mutant allele, thereby reducing expression of the LMNA mutant allele in the cell.
- said expression of the LMNA mutant gene is by at least 20%.
- the black outlined rectangle shows the common shared exon 10 between the lamin A and lamin C isoform.
- lamin C continues with exon 10B (grey hatched rectangle) whereas lamin A continues with exon 11 (grey filled rectangle) and exon 12 (not shown).
- shRNAs were designed for each specific isoform and to target either the C allele or T allele.
- Figure 2 shows an overview of the results of the shRNAs targeting lamin C in the LMNA H222P hiPSC-CMs.
- Figure 2A shows the relative expression of the C allele, T allele and total lamin A after treatment with the shRNAs targeting the C allele of rs4641 in lamin C.
- Figure 2B shows the relative expression of the C allele, T allele and total lamin C after treatment with the shRNAs targeting the C allele of rs4641 in lamin C.
- Figure 2C shows the relative expression of the C allele, T allele and total lamin A after treatment with the shRNAs targeting the T allele of rs4641 in lamin C.
- Figure 2D shows the relative expression of the C allele, T allele and total lamin C after treatment with the shRNAs targeting the T allele of rs4641 in lamin C. Bars present the mean and the errors bars present SEM.
- Figure 3 shows an overview of the results of the shRNAs targeting the C allele of rs4641 in lamin A in LMNA H222P and healthy hiPSC-CMs.
- Figure 3A shows the relative expression of the C allele, T allele and total lamin A after treatment with the shRNAs targeting the C allele of rs4641 in lamin A in LMNA H222P hiPSC-CMs.
- Figure 3B shows the relative expression of the C allele, T allele and total lamin C after treatment with the shRNAs targeting the C allele of rs4641 in lamin A in LMNA H222P hiPSC-CMs.
- Figure 3C shows the relative expression of the C allele, T allele and total lamin A after treatment with the shRNAs targeting the C allele of rs4641 in lamin A in healthy hiPSC-CMs.
- Figure 4 shows an overview of the results of the shRNAs targeting the T allele of rs4641 in lamin A in LMNA H222P and healthy hiPSC-CMs.
- Figure 4A shows the relative expression of the C allele, T allele and total lamin A after treatment with the shRNAs targeting the T allele of rs4641 in lamin A in LMNA H222P hiPSC-CMs.
- Figure 4B shows the relative expression of the C allele, T allele and total lamin C after treatment with the shRNAs targeting the T allele of rs4641 in lamin A in LMNA H222P hiPSC-CMs.
- Figure 4C shows the relative expression of the C allele, T allele and total lamin A after treatment with the shRNAs targeting the T allele of rs4641 in lamin A in healthy hiPSC-CMs.
- Figure 5 shows the improvement of nuclear roundness after downregulation of the mutant LMNA allele by targeting the T allele of rs4641 by shRNA T17 in LMNA H222P hiPSC-CMs.
- Figure 6 Schematic representation of the targeting siRNAs.
- the LMNA gene encodes 2 mRNA splice isoforms, LMNA and LMNC.
- SNP rs4641 (indicated in bold) is the last nucleotide shared by both isoforms in the middle of exon 10, after which LMNC is not splice and ends at exon 10, while LMNA splices immediately after rs4641 to exon 11. Because of the splicing we need to design LMNA (lower panel of siRNA) and LMNC (upper panel of siRNAs) specific siRNAs of which the sequences we will test for allele- specificity are indicated in the figure. Note that the siRNA sequences are written from 3’ to 5’, while all other sequences are written from 5’ to 3’. Figure 7. shRNA design and its conversion to active siRNA.
- the shRNA encoded by the virus consists of 2 complementary sequences (grey shaded) with a non- complementary sequence in the middle. These sequences, when they are transcribed from the virus, form a hairpin like structure, where complementary parts bind and the non-complementary part form a loop. This loop is removed by the enzyme Dicer to form an siRNA duplex. Of this duplex the so-called guide or antisense strand (dark grey shaded) is incorporated into the RNA induced silencing complex to bind and degrade the targeting mRNA, while the other passenger or sense strand of the siRNA duplex is degraded.
- B & D show the percentage of expression of the mutant (T) and wildtype allele (C) of LMNA and LMNC respectively to visualize the balance between expression of the two alleles.
- Figure 13 Effects of shRNA targeting the C allele of LMNC on allele-specific expression of the LMNC and LMNA splice isoform respectively.
- B & D show the percentage of expression of the mutant (T) and wildtype allele (C) of LMNC and LMNA respectively to visualize the balance between expression of the two alleles.
- B & D show the percentage of expression of the mutant (T) and wildtype allele (C) of LMNC and LMNA respectively to visualize the balance between expression of the two alleles.
- a & C allele specific expression of the wildtype (C) allele and the mutant (T) allele of LMNC and LMNA respectively and the effect on total LMNA/C expression levels relatively to the expression in the SCR negative control condition.
- SNP rs4641 is the last shared nucleotide of both isoforms
- the inventors designed isoform specific siRNAs.
- the LMNA mutation i.e. the disease-causing mutation, can be located on both alleles of the SNP (C or T allele), meaning that the inventors designed siRNAs for both SNP alleles on both the lamin A and lamin C isoform.
- the inventors showed an improvement of nuclear roundness after downregulation of a mutant allele of LMNA by a shRNA targeting the region described above which demonstrates that this silencing is effective.
- One goal of this invention is to provide a treatment wherein a mutant allele is suppressed.
- the isolated antisense molecule of the invention works for all mutations in the LMNA gene.
- the inventors used a cell line harboring the LMNA H222P mutation.
- the H222P mutation is located on the rs4641 T allele. So, by suppressing the rs4641 C allele they would potentially aggravate the disease (as the wildtype is the healthy allele), whereas by suppressing the rs4641 T allele they would potentially alleviate the disease (suppressing mutant allele).
- antisense molecule refers to an oligonucleotide molecule that contains sequence complementarity to target RNA molecules, such as mRNA, viral RNA, or other RNA species, and that reduces the function of their target RNA after sequence-specific binding.
- target RNA molecules such as mRNA, viral RNA, or other RNA species
- ASO antisense oligonucleotide
- siRNA siRNA
- shRNA shRNA
- interfering RNA molecule interfering RNA molecule
- antisense oligomer which terms may be used interchangeably herein below.
- nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, composed of monomers (nucleotides) containing a sugar, phosphate and a base that is either a purine or pyrimidine. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated.
- degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., (1991) Nucleic Acids Research 19: 5081; Ohtsuka et al., (1985) J Biol Chem 260: 2605-2608; Rossolini et al., (1994) Mol Cell Probes 8: 91-98).
- a “nucleic acid fragment” is a portion of a given nucleic acid molecule.
- nucleotide sequence refers to a polymer of DNA or RNA which can be single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers.
- nucleic acid refers to a polymer of DNA or RNA which can be single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers.
- nucleic acid “nucleic acid molecule”, “nucleic acid fragment”, “nucleic acid sequence or segment”, or “polynucleotide” are used interchangeably and may also be used interchangeably with gene, cDNA, DNA and RNA encoded by a gene.
- nucleic acid analogue refers to compounds which are analogous (structurally similar) to naturally occurring RNA and DNA.
- antisense molecules or dsNA molecules of the invention can be comprised of naturally occurring nucleotides or can be comprised of at least one modified nucleotide, such as a 2’-O-methyl modified nucleotide, a nucleotide comprising a 5’-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group.
- fragments and variants of the disclosed nucleotide sequences and proteins or partial-length proteins encoded thereby are also encompassed by the present invention.
- fragment or “portion” is meant a full length or less than full length of the nucleotide sequence encoding, or the amino acid sequence of, a polypeptide or protein.
- polypeptide and “protein” are used interchangeably. Both terms refer to a molecule composed of a chain of amino acid residues bound together via covalent peptide bonds.
- gene is used broadly to refer to any segment of nucleic acid associated with a biological function. Thus, genes include coding sequences and/or the regulatory sequences required for their expression.
- variants include those sequences that, because of the degeneracy of the genetic code, encode the identical amino acid sequence of the native protein.
- Naturally occurring allelic variants such as these can be identified with the use of molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques.
- variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis, which encode the native protein, as well as those that encode a polypeptide having amino acid substitutions.
- RNA interference is the process of sequence-specific, post-transcriptional gene silencing initiated by siRNA. RNAi is seen in a number of organisms such as Drosophila, nematodes, fungi and plants, and is believed to be involved in anti-viral defense, modulation of transposon activity, and regulation of gene expression. During RNAi, siRNA induces degradation of target mRNA with consequent sequence-specific reduction or even inhibition of gene expression.
- siRNA or “small-interfering ribonucleic acid” according to the invention has the meanings known in the art, including the following aspects. The siRNA consists of two strands of ribonucleotides which hybridize along a complementary region under physiological conditions.
- the duplex can be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10 nucleotides in length. In some embodiments, the length of the duplex is 19-25 nucleotides in length.
- the RNA duplex portion of the siRNA can be part of a hairpin structure. In addition to the duplex portion, the hairpin structure may contain a loop portion positioned between the two sequences that form the duplex. The loop can vary in length. In some embodiments the loop is 5, 6, 7, 8, 9, 10, 11, 12 or 13 nucleotides in length.
- the hairpin structure can also contain 3′ or 5′ overhang portions.
- nucleotide overhang refers to the unpaired nucleotide or nucleotides that protrude from the duplex structure of a dsRNA when a 3’-end of one strand of the dsRNA extends beyond the 5’-end of the other strand, or vice versa.
- Bount or “blunt end” means that there are no unpaired nucleotides at that end of the dsRNA, i.e., no nucleotide overhang.
- a “blunt ended" dsRNA is a dsRNA that is double-stranded over its entire length, i.e., no nucleotide overhang at either end of the molecule.
- antisense strand refers to the strand of a dsRNA which includes a region that is substantially complementary to a target sequence.
- region of complementarity refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, as defined herein.
- sense strand refers to the strand of a dsRNA that includes a region that is substantially complementary to a region of the antisense strand. “Treating” as used herein refers to ameliorating at least one symptom of, curing and/or preventing the development of a disease or a condition.
- the LMNA gene encodes mRNA that is spliced into several alternative mRNAs which encode different lamin proteins, such as Lamin A or Lamin C.
- Said process of substantial silencing of the LMNA gene through RNA interference preferably is directed at specifically silencing an allele of the LMNA gene, while expression of the second allele is not altered by said process.
- one allele of the LMNA gene is silenced.
- mutant LMNA allele or “mutant LMNA gene” as used herein refers to a variant of the LMNA allele or gene of which the product has a negative effect on nuclear structure and function.
- the mutant LMNA allele has a dominant negative effect, meaning that a heterozygotic expression of the mutant allele has a negative effect on nuclear structure and function.
- antisense oligomer or “antisense compound” or “antisense oligonucleotide” or “oligonucleotide” are used interchangeably and refer to a sequence of cyclic subunits (i.e. purine or pyrimidine), each bearing a base-pairing moiety, linked by intersubunit linkages that allow the base-pairing moieties to hybridize to a target sequence in a nucleic acid (typically an RNA) by Watson-Crick base pairing, to form a nucleic acid:oligomer heteroduplex within the target sequence.
- the cyclic subunits may be based on ribose or another pentose sugar or, in certain embodiments, a morpholino group.
- peptide nucleic acids PNAs
- locked nucleic acids LNAs
- 2′-O-Methyl oligonucleotides other antisense agents known in the art.
- an antisense oligomer can be designed to block or inhibit translation of mRNA or to inhibit natural pre-mRNA splice processing, or induce degradation of targeted mRNAs, and may be said to be “directed to” or “targeted against” a target sequence with which it hybridizes.
- the target sequence is a region surrounding or including an AUG start codon of an mRNA, a 3′ or 5′ splice site of a pre-processed mRNA, or a branch point.
- the target sequence may be within an exon or within an intron or a combination.
- the target sequence for a splice site may include an mRNA sequence having its 5′ end 1 to about 25 base pairs downstream of a normal splice acceptor junction in a preprocessed mRNA.
- a preferred target sequence for a splice is any region of a preprocessed mRNA that includes a splice site or is contained entirely within an exon coding sequence or spans a splice acceptor or donor site.
- Said preferred target sequence in a target region of a gene comprises a single nucleotide polymorphism (SNP), allowing degradation of a specific allele that, for example, carries a mutation.
- SNP single nucleotide polymorphism
- An oligomer is more generally said to be “targeted against” a biologically relevant target such as, in the present invention, a human LMNA gene pre-mRNA encoding the lamin A protein, when it is targeted against the nucleic acid of the target in the manner described above.
- Said antisense oligomer is preferably designed to induce degradation of a specific allele of the human LMNA gene, such as a SNP rs4641 T or SNP rs4641 C allele that carries a disease-causing mutation in cis configuration.
- antisense oligonucleotides mean agents that are unmodified or chemically modified single-stranded nucleic acid molecules (usually 15-30 nt in length), which can selectively hybridize to their target complementary sequence within mRNA through Watson- Crick base pairing.
- Formation of an ASO -mRNA heteroduplexes induces the effects as follows: 1) activates RNase H endonuclease or as in bacteria endoribonucleases - RNase III and RNase E - leading to degradation of the bound mRNA, and leaving the ASO intact; 2) causes translational arrest by steric hindrance of ribosomal activity; 3) inhibits mRNA splicing; 4) destabilizes pre- mRNA. Indeed, what effect will occur depends on the ASO chemical composition and location of hybridization, but the subsequent result is specific down-regulation of the target gene and protein expression.
- the term “rs4641” refers to an SNP located on chr1:156137743 (GRCh38.p13).
- LMNA mutation refers to a mutation in the LMNA gene which preferably has a dominant negative effect and specifically causes a laminopathy, more specifically cardiomyopathy.
- RNA interference a strategy that results in substantial silencing of a specific targeted allele via RNA interference. Use of this strategy results in markedly diminished in vitro and in vivo expression of targeted genes or alleles.
- silencing in the context of silencing an allele means that the mRNA of the targeted allele is specifically inhibited and/or degraded by the presence of the introduced antisense molecule, such that expression of the targeted allele is reduced by about 10% to 100% as compared to the level of expression seen when the antisense molecule of the invention is not present.
- an allele when substantially silenced, it will have at least 40%, 50%, 60%, 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, generally at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% reduction expression as compared to when the isolated antisense molecule is not present.
- the expression of the non-targeted allele is not substantially altered as compared to the level of expression seen when the antisense molecule of the invention is not present.
- substantially silencing in the context of silencing a gene means that the mRNA of the targeted allele is inhibited and/or degraded by the presence of the introduced isolated antisense molecule, such that expression of the targeted allele is reduced by about 10% to 100% as compared to the level of expression seen when the isolated antisense molecule is not present.
- an allele when substantially silenced, it will have at least 40%, 50%, 60%, to 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or even 100% reduction expression as compared to when the isolated antisense molecule is not present.
- substantially normal activity means the level of expression of an allele or gene when an isolated antisense molecule has not been introduced to a cell.
- the inventors developed siRNA that would specifically eliminate production of the Lamin A/C protein from the mutant allele, i.e. the allele having the disease-causing mutation.
- the inventors successfully allele-specifically silenced expression of the mutant LMNA mRNA without interfering with expression of the wild type mRNA.
- lamin A/C is an essential protein it is critically important that efforts be made to silence only the mutant allele.
- This allele-specific strategy has obvious therapeutic potential for the treatment of diseases caused by LMNA mutations, in particular laminopathies, including dilated cardiomyopathy.
- said antisense nucleic acid strand is complementary to at least 7, more preferably 8, 9, 10, 11 or 12 consecutive nucleotides.
- said target region comprises at least 15, 16, 17, 18 or 19 nucleotides.
- the isolated antisense molecule is selected from: a. a double stranded nucleic acid (dsNA) or a chemically modified version thereof, or b.
- dsNA double stranded nucleic acid
- dsNA single stranded antisense oligonucleotide
- Preferred embodiments of dsNA are synthetic double stranded small interfering RNA (siRNA) and vector driven short hairpin RNA (shRNA). Both siRNA and vector driven shRNA have been demonstrated to be effective in in vitro and in vivo applications, each with their respective advantages. Most siRNA are structurally designed to promote efficient incorporation into the Ago2 containing RISC, the RNase III containing Dicer-substrate design improves the efficiency of siRNA at least 10-fold by initial association and processing at the pre-RISC. Vector driven shRNA utilizes the host microRNA biogenesis pathway, which appears to be very efficient.
- siRNA is more readily chemically modified while shRNA expression can be modulated and regulated by specific promoters.
- allele-specific suppression by shRNA may be long lasting, as a vector encoding the shRNA may be integrated into the genome of a cell.
- an RNA molecule is constructed containing two complementary strands or a hairpin sequence (such as a 21-bp hairpin) representing sequences directed against the target region encoded a part of the LMNA gene comprising SNP rs538089, rs505058 or rs4641.
- the siRNA, or a nucleic acid encoding the siRNA is introduced to the target cell, such as a diseased heart cell.
- the siRNA reduces target mRNA and protein expression of the targeted, mutated allele.
- the dsRNA of the invention is chemically modified to enhance stability.
- the nucleic acids of the invention may be synthesized and/or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry", Beaucage, S.L. et al. (Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Chemical modifications may include, but are not limited to 2’ modifications, introduction of non-natural bases, covalent attachment to a ligand, replacement of phosphate linkages with thiophosphate linkages, and combinations thereof.
- the integrity of the duplex structure is strengthened by at least one, and preferably two, chemical linkages.
- Chemical linking may be achieved by any of a variety of well-known techniques, for example by introducing covalent, ionic or hydrogen bonds; hydrophobic interactions, van der Waals or stacking interactions; by means of metal-ion coordination, or through use of purine analogues, and combinations thereof.
- the chemical groups that can be used to modify the dsRNA include, without limitation, methylene blue; bifunctional groups, preferably bis-(2-chloroethyl)amine; N-acetyl-N’-(p-glyoxylbenzoyl)cystamine; 4- thiouracil; and psoralen.
- the linker is a hexaethylene glycol linker.
- the dsRNA are produced by solid phase synthesis and the hexa-ethylene glycol linker is incorporated according to standard methods (e.g., Williams, D.J., and K.B. Hall, Biochem. (1996) 35:14665-14670).
- the 5’-end of the antisense strand and the 3’-end of the sense strand are chemically linked via a hexaethylene glycol linker.
- at least one nucleotide of the dsRNA comprises a phosphorothioate or phosphorodithioate groups.
- the ends of the dsRNA is preferably formed by a triple-helix structure.
- the construct encoding the therapeutic siRNA is configured such that the one or more strands of the siRNA are encoded by a nucleic acid that is immediately contiguous to a promoter and that are under control of said promoter meaning that said promoter will drive expression of said nuclei acid after introduction into a target cell.
- the construct is introduced into the target cell, such as by injection, allowing for diminished expression of the target-allele in the cell.
- the present invention provides an expression cassette comprising a nucleic acid encoding at least said antisense nucleic acid strand.
- said expression cassette comprises a nucleic acid encoding the complete isolated antisense molecule according to the invention.
- the siRNA of the invention may form a hairpin structure that contains a duplex structure and a loop structure.
- the loop structure may contain from 4 to 13, more preferably 4-10 nucleotides, such as 4, 5 or 6 nucleotides. Preferably said loop contains the sequence UCAAGAC.
- the duplex is less than 30 nucleotides in length, such as from 19 to 25 nucleotides.
- the siRNA may further contain an overhang region. Such an overhang may be a 3′ overhang region or a 5′ overhang region. The overhang region may be, for example, from 1 to 6 nucleotides in length.
- the present invention also provides an expression cassette containing an isolated nucleic acid sequence encoding a first segment, a second segment located immediately 3′ of the first segment, and a third segment located immediately 3′ of the second segment, wherein the first and third segments are each less than 30 base pairs in length and each more than 10 base pairs in length, and wherein the sequence of the third segment is the complement of the sequence of the first segment, and wherein the isolated nucleic acid sequence functions as a small interfering RNA molecule (siRNA) targeted against a gene of interest.
- the expression cassette may be contained in a vector, such as a viral vector.
- the expression cassette may further contain a pol II promoter, as described herein. Examples of pol II promoters include regulatable promoters and constitutive promoters.
- the present invention also provides a method of treating a patient by administering to the patient a composition of the expression cassette described above.
- the present invention further provides a method of reducing the expression of a specific gene product in a cell by contacting a cell with an expression cassette as described above.
- the present invention also provides a method of treating a patient, by administering to the patient a composition containing an expression cassette according to the invention.
- Said expression cassette preferably encompasses shC17, shC17mm5, shC17mm7, shC13mm17, shT14, shT17, shT17mm5 and shT17mm7 as described in Example 2.
- nucleic Acid Molecules of the Invention Sources of nucleotide sequences from which the present nucleic acid molecules can be obtained include any vertebrate, preferably mammalian, cellular source.
- the nucleic acid molecules of the invention include single and double-stranded interfering RNA molecules, which are also useful to reduce expression of a target allele.
- Oligonucleotide-mediated mutagenesis is a method for preparing substitution variants. This technique is known in the art.
- nucleic acid encoding a siRNA can be altered by hybridizing an oligonucleotide encoding the desired mutation to a DNA template, where the template is the single-stranded form of a plasmid or bacteriophage containing the unaltered or native gene sequence. After hybridization, a DNA polymerase is used to synthesize an entire second complementary strand of the template that will thus incorporate the oligonucleotide primer, and will code for the selected alteration in the nucleic acid encoding siRNA. Generally, oligonucleotides of at least 25 nucleotides in length are used.
- An optimal oligonucleotide will have 12 to 15 nucleotides that are completely complementary to the template on either side of the nucleotide(s) coding for the selected alteration. This ensures that the oligonucleotide will hybridize properly to the single-stranded DNA template molecule.
- the oligonucleotides are readily synthesized using techniques known in the art.
- the DNA template can be generated by those vectors that are either derived from bacteriophage M13 vectors (the commercially available M13 mp 18 and M13 mp 19 vectors are suitable), or those vectors that contain a single-stranded phage origin of replication. Thus, the DNA that is to be altered may be inserted into one of these vectors to generate single-stranded template.
- single-stranded DNA template may be generated by denaturing double- stranded plasmid (or other) DNA using standard techniques.
- the oligonucleotide is hybridized to the single-stranded template under suitable hybridization conditions.
- a DNA polymerizing enzyme usually the Klenow fragment of DNA polymerase I, is then added to synthesize the complementary strand of the template using the oligonucleotide as a primer for synthesis.
- a heteroduplex molecule is thus formed such that one strand of DNA encodes the altered form of the DNA, and the other strand (the original template) encodes the native, unaltered sequence of the DNA.
- This heteroduplex molecule is then transformed into a suitable host cell, usually a prokaryote such as E. coli JM101. After the cells are grown, they are plated onto agarose plates and screened using the oligonucleotide primer radiolabeled with 32-phosphate to identify the bacterial colonies that contain the altered DNA. The altered region is then removed and placed in an appropriate vector, generally an expression vector of the type typically employed for transformation of an appropriate host.
- the method described immediately above may be modified such that a homoduplex molecule is created wherein both strands of the plasmid contain the alteration(s). The modifications are as follows: The single-stranded oligonucleotide is annealed to the single-stranded template as described above.
- dCTP-(*S) deoxyriboadenosine
- dGTP deoxyriboguanosine
- dTTP deoxyribothymidine
- dCTP-(*S) modified thiodeoxyribocytosine
- This mixture is added to the template- oligonucleotide complex.
- DNA polymerase Upon addition of DNA polymerase to this mixture, a strand of DNA identical to the template except for the altered bases is generated.
- this new strand of DNA will contain dCTP-(*S) instead of dCTP, which serves to protect it from restriction endonuclease digestion.
- operably linked DNA sequences are DNA sequences that are linked are contiguous. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accord with conventional practice.
- the recombinant DNA to be introduced into the cells may contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors.
- the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells.
- reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. Reporter genes that encode for easily assayable proteins are well known in the art.
- a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a protein whose expression is manifested by some easily detectable property, e.g., enzymatic activity.
- reporter genes include the chloramphenicol acetyl transferase gene (cat) from Tn9 of E. coli and the luciferase gene from firefly Photinus pyralis.
- Expression of the reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells.
- the general methods for constructing recombinant DNA that can transfect target cells are well known to those skilled in the art, and the same compositions and methods of construction may be utilized to produce the DNA useful herein. For example, Sambrook and Russell, infra, provides suitable methods of construction.
- the recombinant DNA can be readily introduced into the host cells, e.g., mammalian, bacterial, yeast or insect cells by transfection with an expression vector composed of DNA encoding the siRNA by any procedure useful for the introduction into a particular cell, e.g., physical or biological methods, to yield a cell having the recombinant DNA stably integrated into its genome or existing as a episomal element, so that the DNA molecules, or sequences of the present invention are expressed by the host cell.
- the DNA is introduced into host cells via a vector.
- the host cell is preferably of eukaryotic origin, e.g., plant, mammalian, insect, yeast or fungal sources, but host cells of non-eukaryotic origin may also be employed.
- Physical methods to introduce a preselected DNA into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like.
- Biological methods to introduce the DNA of interest into a host cell include the use of DNA and RNA viral vectors.
- DNA and RNA viral vectors For mammalian gene therapy, as described hereinbelow, it is desirable to use an efficient means of inserting a copy gene into the host genome.
- Viral vectors, and especially retroviral vectors have become the most widely used method for inserting genes into mammalian, e.g., human cells.
- Other viral vectors can be derived from poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like.
- a “transfected”, or “transduced” host cell or cell line is one in which the genome has been altered or augmented by the presence of at least one heterologous or recombinant nucleic acid sequence.
- the host cells of the present invention are typically produced by transfection with an antisense molecule, a DNA sequence in a plasmid expression vector, a viral expression vector, or as an isolated linear DNA sequence.
- the transfected DNA can become a chromosomally integrated recombinant DNA sequence, which is composed of sequence encoding the siRNA.
- a variety of assays may be performed.
- PCR techniques While useful, will not demonstrate integrity of the RNA product. Further information about the nature of the RNA product may be obtained by Northern blotting. This technique demonstrates the presence of an RNA species and gives information about the integrity of that RNA. The presence or absence of an RNA species can also be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and only demonstrate the presence or absence of an RNA species. While Southern blotting and PCR may be used to detect the recombinant DNA segment in question, they do not provide information as to whether the preselected DNA segment is being expressed.
- the cells are transfected or otherwise genetically modified ex vivo.
- the cells are isolated from a mammal (preferably a human), nucleic acid introduced (i.e., transduced or transfected in vitro) with a vector for expressing a heterologous (e.g., recombinant) gene encoding the therapeutic agent expressing an antisense molecule, and then administered to a mammalian recipient for delivery of the therapeutic agent in situ.
- the mammalian recipient may be a human and the cells to be modified are autologous cells, i.e., the cells are isolated from the mammalian recipient.
- the cells are transfected or transduced or otherwise genetically modified in vivo.
- the expression vector is in the form of a plasmid, which is transferred into the target cells by one of a variety of methods: physical, electroporation, scrape loading, microparticle bombardment or by cellular uptake as a chemical complex (e.g., calcium or strontium co-precipitation, complexation with lipid, complexation with ligand)).
- a chemical complex e.g., calcium or strontium co-precipitation, complexation with lipid, complexation with ligand
- cationic liposome complexation including LipofectinTM (Gibco-BRL, Gaithersburg, Md.) and TransfectamTM (ProMega, Madison, Wis.).
- the antisense strand and the sense strand are operably linked by means of an RNA loop strand to form a hairpin structure comprising a duplex structure and a loop structure.
- the loop structure preferably contains from 4 to 13, more preferably between 4 and 10 nucleotides. In an embodiment, said loop structure contains 4, 5 or 6 nucleotides.
- said loop contains the sequence UCAAGAC.
- the duplex formed by the two strands of RNA may be between 15 and 25 base pairs in length, preferably 19 base pairs in length.
- the antisense strand preferably is 19 nucleotides in length.
- the sense strand preferably is 19 nucleotides in length.
- the shRNA may further contain an overhang region.
- Such an overhang may be a 3′ overhang region or a 5′ overhang region.
- the overhang region may be, for example, from 1 to 6 nucleotides in length.
- the invention further provides a nucleic acid encoding the isolated antisense molecule of the invention.
- said shRNA of the invention is encoded by an oligonucleotide having the following structure: forward 5’-CCGGAA-19 bp sense strand-TCAAGAC-19bp antisense strand-TTTTTTTG-3’ and/or reverse 5’- AATTCAAAAAAA-19bp sense strand-GTCTTGA-19bp antisense strand-TT-3’.
- the sense strand has the same sequence as the targeted sequence in the mRNA and the antisense strand its reverse complementary sequence that will eventually bind the mRNA and induce its breakdown and/or inhibition.
- said gene is selected from the LMNA, Potassium Voltage-Gated Channel Subfamily Q Member 1 (KCNQ1), Neurofibromin 1 (NF1), Fibrillin 1 (FBN1), BReast CAncer Gene 1 (BRCA1), BRCA2, Tuberous Sclerosis Complex 1 (TSC1) and TSC2 gene.
- said SNP is selected from rs1057128, rs8234 and rs17215465.
- said disease is a heart failure, tuberous sclerosis, breast cancer, neurofibromitosis Type I, Huntington disease, hypertrophic cardiomyopathy, polycystic kidney disease , osteogenesis imperfecta, chondrodysplasia, centronuclear myopathy and Marfan syndrome.
- said heart failure is a laminopathy, preferably dilated cardiomyopathy.
- the UN1-22 line was derived from a healthy male and the full characterization was previously published (Shinnawi, 2015 Stem Cell Reports 2015;5:582–596.). Both lines are heterozygous for SNP rs4641 located in LMNA.
- mTeSR-1 StemCell Technologies; 85850
- FAL356231 diluted growth factor reduced Matrigel
- CDM3 medium RPMI 1640, Gibco 21875; 500 ⁇ g/ml human serum albumin, Sigma A9731; 213 ⁇ g/ml L-ascorbic acid 2 phosphate, Sigma A8960; 1% penicillin/streptomycin
- 6 ⁇ M CHIR99021 Stemgent; 04-0004-10
- CDM3 CDM3 with 2 ⁇ M Wnt-C59 (Selleck Chemicals; S7037) for two days.
- Virus production To produce third-generation lentivirus of pLKO.1-puro based constructs we co- transfected 4x10 ⁇ 6 HEK293T cells with 4 ⁇ g of the expression plasmid, 2.7 ⁇ g pMDLg/pRRE, 1 ⁇ g pRSV-Rev, 1.4 ⁇ g pVSVG using Genejammer (Agilent; 204130) according to the manufacturer’s protocol. The next day we changed the HEK293T medium to CDM3 medium. We collected this medium containing the produced lentivirus 24 hours after previous change and used it directly for hiPSC-CMs transduction.
- HiPSC-CM infection We dissociated hiPSC-CMs 2 to 4 days before lentiviral transduction to ensure homogenous cell populations between conditions.
- RNA isolation We isolated total RNA from all samples using 1 ml TriReagent (Sigma Aldrich; T9424). We added TriReagent directly to live cells growing on a dish. We performed total RNA isolation according to the manufacturer’s protocol.
- SNP rs4641 is the last shared nucleotide of the two mRNA isoforms derived from LMNA, namely lamin A and lamin C. Both isoforms share the first 566 amino acids, but due to alternative splicing differ after exon 10, lamin A continues with exons 11 and 12, whereas lamin C continues with exon 10B.
- shRNAs C17 and T17 give isoform and allele-specific downregulation of lamin A
- shRNAs targeting the alleles of the lamin A isoform starting with targeting the C allele of lamin A.
- this effect is allele-specific since we did not observe downregulation of the T allele of lamin A.
- the allele-specific effect is also isoform specific, since shRNA C17 showed no downregulation of any lamin C allele ( Figure 3, panel B). All other tested shRNAs showed no lamin A nor lamin C downregulation.
- shRNA T17 showed an isoform and allele-specific downregulation of 55% ( Figure 4, panel C and D).
- shRNAs which downregulate isoform and allele- specifically either the C or T allele of SNP rs4641 of lamin A with an efficiency around 50% in 2 different hiPSC-CMs lines.
- Downregulation of the mutant H222P allele with shRNA T17 improves nuclear roundness
- shRNA C17 downregulation of the C allele
- shRNA T17 downregulation of the T allele
- the nuclear shape is a measure of how severely a cell is affected by a certain mutation.
- downregulation of the rs4641 T allele and thereby the mutant allele improved the nuclear roundness significantly (p ⁇ 0.001). See Figure 5.
- Cardiomyocytes were dissociated by TrypLE Express (Gibco; 12604) incubation for 15 to 45 minutes, after which they were plated on Matrigel-coated plates in RPMI/B27 with 2 ⁇ M Thiazovivin for further experiments.
- shRNA sequences according to Huang et al. (2014) and added mismatches based on the known interaction regions of miRNAs with their targets and on the results of the original shRNA selection. Additional shRNA targeting sequences and primer sequences used for qRT-PCR are included in Tables 3 and 4, respectively.
- SNP rs4641 is located at the last nucleotide that is shared between the two isoforms. This, in combination with the data of Huang et al., (Huang et al., 2009. Nucleic Acids Res 37: 7560–7569), who showed that the highest allele-specificity is obtained when the nucleotide that distinguishes both alleles is located in the middle of the siRNA, indicates that we need to design allele-specific siRNAs targeting both LMNA and LMNC separately. Furthermore, because both the T allele and C allele of the SNP can reside on the mutant allele in different patients, we do need to design siRNAs targeting both alleles of SNP rs4641.
- siRNAs are expressed as viral shRNA constructs in vitro according to the design depicted in Figure 7. Allele-specific targeting of rs4641 in the LMNA isoform
- shC11 also non allele-specifically inhibited the LMNA isoform by 25% and the shC17 increased both the levels of the C and T allele, but the T allele to a larger extend, which therefore also resulted in a slight shift in allelic balance of LMNA (from 48:52% in SCR to 43:57% in shC17). This implies that shC17 might be a good candidate that could affect both splice isoforms.
- the forward primer contains the full shRNA sequence with overhangs added for cloning.
- ShRNA starts with the non-capital aa at position 5/6 and ends with the non-capital t-stretch.
- Ref reference number.
- Fw forward.
- Rv reversed.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Cardiology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Hospice & Palliative Care (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Heart & Thoracic Surgery (AREA)
- Epidemiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Analytical Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Immunology (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR1020247036183A KR20250021303A (ko) | 2022-03-30 | 2023-03-30 | Lmna 돌연변이 보인자에 대한 치료에 사용하기 위한 안티센스 핵산 |
| AU2023246365A AU2023246365A1 (en) | 2022-03-30 | 2023-03-30 | Antisense nucleic acids for use in the treatment for lmna mutation carriers |
| EP23714866.3A EP4499826A1 (en) | 2022-03-30 | 2023-03-30 | Antisense nucleic acids for use in the treatment for lmna mutation carriers |
| US18/851,915 US20260002152A1 (en) | 2022-03-30 | 2023-03-30 | Antisense Nucleic Acids for Use in the Treatment for LMNA Mutation Carriers |
| JP2025504030A JP2025513932A (ja) | 2022-03-30 | 2023-03-30 | Lmna変異キャリアのための治療における使用のためのアンチセンス核酸 |
| CN202380041546.9A CN119790153A (zh) | 2022-03-30 | 2023-03-30 | 用于lmna突变携带者治疗的反义核酸 |
| CA3246987A CA3246987A1 (en) | 2022-03-30 | 2023-03-30 | Antisense nucleic acids intended for use in the treatment of LMNA mutation carriers |
| MX2024012034A MX2024012034A (es) | 2022-03-30 | 2024-09-27 | Ácidos nucleicos antisentido para usarse en el tratamiento de portadores de mutaciones lmna |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP22165710 | 2022-03-30 | ||
| EP22165710.9 | 2022-03-30 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023191631A1 true WO2023191631A1 (en) | 2023-10-05 |
Family
ID=81074125
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/NL2023/050168 Ceased WO2023191631A1 (en) | 2022-03-30 | 2023-03-30 | Antisense nucleic acids for use in the treatment for lmna mutation carriers |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US20260002152A1 (cg-RX-API-DMAC7.html) |
| EP (1) | EP4499826A1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2025513932A (cg-RX-API-DMAC7.html) |
| KR (1) | KR20250021303A (cg-RX-API-DMAC7.html) |
| CN (1) | CN119790153A (cg-RX-API-DMAC7.html) |
| AU (1) | AU2023246365A1 (cg-RX-API-DMAC7.html) |
| CA (1) | CA3246987A1 (cg-RX-API-DMAC7.html) |
| MX (1) | MX2024012034A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2023191631A1 (cg-RX-API-DMAC7.html) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025096498A1 (en) * | 2023-10-30 | 2025-05-08 | Research Institute At Nationwide Children's Hospital | Compositions and methods for treating diseases or conditions associated with progerin expression |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003070918A2 (en) | 2002-02-20 | 2003-08-28 | Ribozyme Pharmaceuticals, Incorporated | Rna interference by modified short interfering nucleic acid |
| WO2007047913A2 (en) * | 2005-10-20 | 2007-04-26 | Isis Pharmaceuticals, Inc | Compositions and methods for modulation of lmna expression |
| WO2020061497A1 (en) * | 2018-09-20 | 2020-03-26 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulation of lmna expression |
-
2023
- 2023-03-30 CA CA3246987A patent/CA3246987A1/en active Pending
- 2023-03-30 WO PCT/NL2023/050168 patent/WO2023191631A1/en not_active Ceased
- 2023-03-30 US US18/851,915 patent/US20260002152A1/en active Pending
- 2023-03-30 JP JP2025504030A patent/JP2025513932A/ja active Pending
- 2023-03-30 KR KR1020247036183A patent/KR20250021303A/ko active Pending
- 2023-03-30 CN CN202380041546.9A patent/CN119790153A/zh active Pending
- 2023-03-30 EP EP23714866.3A patent/EP4499826A1/en active Pending
- 2023-03-30 AU AU2023246365A patent/AU2023246365A1/en active Pending
-
2024
- 2024-09-27 MX MX2024012034A patent/MX2024012034A/es unknown
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003070918A2 (en) | 2002-02-20 | 2003-08-28 | Ribozyme Pharmaceuticals, Incorporated | Rna interference by modified short interfering nucleic acid |
| WO2007047913A2 (en) * | 2005-10-20 | 2007-04-26 | Isis Pharmaceuticals, Inc | Compositions and methods for modulation of lmna expression |
| WO2020061497A1 (en) * | 2018-09-20 | 2020-03-26 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulation of lmna expression |
Non-Patent Citations (15)
| Title |
|---|
| ANDREAS PERROT ET AL: "Identification of mutational hot spots in LMNA encoding lamin A/C in patients with familial dilated cardiomyopathy", BASIC RESEARCH IN CARDIOLOGY, STEINKOPFF-VERLAG, DA, vol. 104, no. 1, 15 September 2008 (2008-09-15), pages 90 - 99, XP019712671, ISSN: 1435-1803 * |
| BATZER ET AL., NUCLEIC ACIDS RESEARCH, vol. 19, 1991, pages 5081 |
| BONNE ET AL., ANN NEUROL, vol. 48, 2000, pages 170 - 80 |
| BURRIDGE, NAT METHODS 2014, vol. 11, 2014, pages 855 - 860 |
| HUANG ET AL., NUCLEIC ACIDS RES, vol. 37, 2009, pages 7560 - 7569 |
| HUANG ET AL.: "37", NUCLEIC ACIDS RES, 2009, pages 7560 - 7569 |
| KARIM HARHOURI ET AL: "Antisense-Based Progerin Downregulation in HGPS-Like Patients’ Cells", CELLS, vol. 5, no. 3, 11 July 2016 (2016-07-11), pages 31, XP055403717, DOI: 10.3390/cells5030031 * |
| MARTIN ET AL., HELV. CHIM. ACTA, vol. 78, 1995, pages 486 - 504 |
| OHTSUKA ET AL., J BIOL CHEM, vol. 260, 1985, pages 2605 - 2608 |
| ROSSOLINI ET AL., MOL CELL PROBES, vol. 8, 1994, pages 91 - 98 |
| SAMBROOKRUSSELL: "CSHL Press: Long Island", 2001, article "Molecular Cloning" |
| SHINNAWI, STEM CELL REPORTS 2015, vol. 5, 2015, pages 582 - 596 |
| SHURONG HUANG ET AL: "Correction of cellular phenotypes of Hutchinson-Gilford Progeria cells by RNA interference", HUMAN GENETICS, SPRINGER, BERLIN, DE, vol. 118, no. 3-4, 6 October 2005 (2005-10-06), pages 444 - 450, XP019428072, ISSN: 1432-1203, DOI: 10.1007/S00439-005-0051-7 * |
| WILLIAMS, D.JK.B. HALL, BIOCHEM., vol. 35, 1996, pages 14665 - 14670 |
| ZARAGOZA MICHAEL ET AL: "Dupuytren's and Ledderhose Diseases in a Family with LMNA-Related Cardiomyopathy and a Novel Variant in the ASTE1 Gene", CELLS, vol. 6, no. 4, 1 November 2017 (2017-11-01), pages 40, XP093005970, DOI: 10.3390/cells6040040 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2025096498A1 (en) * | 2023-10-30 | 2025-05-08 | Research Institute At Nationwide Children's Hospital | Compositions and methods for treating diseases or conditions associated with progerin expression |
Also Published As
| Publication number | Publication date |
|---|---|
| JP2025513932A (ja) | 2025-04-30 |
| US20260002152A1 (en) | 2026-01-01 |
| AU2023246365A1 (en) | 2024-10-17 |
| MX2024012034A (es) | 2025-03-07 |
| CA3246987A1 (en) | 2023-10-05 |
| EP4499826A1 (en) | 2025-02-05 |
| KR20250021303A (ko) | 2025-02-12 |
| CN119790153A (zh) | 2025-04-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9523093B2 (en) | Huntington's disease therapeutic compounds | |
| EP2673286B1 (en) | Therapeutic compounds | |
| AU2008260103B2 (en) | Reduction of off-target RNA interference toxicity | |
| US20080293142A1 (en) | Multiple shRNA Expression Vectors and Methods of Construction | |
| US20090215862A1 (en) | Micro rna | |
| EP2647711A2 (en) | Alternative export pathways for vector expressed RNA interference | |
| AU2015272128A1 (en) | Antisense oligonucleotides useful in treatment of Pompe disease | |
| JP2015524264A (ja) | 遺伝子発現の下方制御のための核酸 | |
| US20250084437A1 (en) | Recombinant lentiviral vector for stem cell-based gene therapy of sickle cell disorder | |
| US20260002152A1 (en) | Antisense Nucleic Acids for Use in the Treatment for LMNA Mutation Carriers | |
| KR101420564B1 (ko) | TGF-β2 발현을 억제하는 shRNA | |
| US20250215436A1 (en) | Antisense Nucleic Acids for Use in the Treatment for KCNQ1 Mutation Carriers | |
| JP4505566B2 (ja) | 肺癌治療剤 | |
| JP2025135809A (ja) | マイクロrna発現カセット、発現ベクター、及びそれらの利用 | |
| WO2024251244A9 (zh) | 多核苷酸、药物组合物及其用途 | |
| KR20210074227A (ko) | Myc 인핸서 결실용 가이드 rna 및 이의 용도 | |
| WO2019036871A1 (zh) | 特异敲低人miR-148a、miR-185和miR-424表达的Tud RNA及其应用 | |
| HK1236224A1 (en) | Huntington's disease therapeutic compounds | |
| HK1236224B (en) | Huntington's disease therapeutic compounds |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23714866 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2024/012034 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2025504030 Country of ref document: JP Ref document number: AU2023246365 Country of ref document: AU |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112024019966 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2023246365 Country of ref document: AU Date of ref document: 20230330 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023714866 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2023714866 Country of ref document: EP Effective date: 20241030 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202380041546.9 Country of ref document: CN |
|
| ENP | Entry into the national phase |
Ref document number: 112024019966 Country of ref document: BR Kind code of ref document: A2 Effective date: 20240926 |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020247036183 Country of ref document: KR |
|
| WWP | Wipo information: published in national office |
Ref document number: MX/A/2024/012034 Country of ref document: MX |
|
| WWP | Wipo information: published in national office |
Ref document number: 202380041546.9 Country of ref document: CN |