WO2023189403A1 - Pcr using rna/dna chimeric primer and method for ligating amplified fragments thereof - Google Patents

Abstract

[Problem] To provide a method for efficiently and accurately ligating amplified fragments of a target nucleic acid sequence. [Solution] Nucleic acid is ligated by this method that comprises: a step of performing PCR for a target nucleic acid sequence using one or more primer pairs, wherein at least one primer is an RNA/DNA chimeric primer including an RNA sequence on the 5' side, to prepare amplified fragments, wherein the target nucleic acid sequence has been used as the template; a step of digesting an RNA sequence included in the amplified fragments by an RNase H treatment to form cohesive ends; and a step of ligating at least two amplified fragments by ligating the cohesive ends each other to prepare ligated nucleic acid.

Description

PCR using RNA/DNA chimeric primer and its amplified fragment ligation method

The present invention relates to techniques of nucleic acid chemistry. More specifically, the present invention relates to PCR using RNA/DNA chimeric primers and a method for joining amplified fragments thereof.

When improving the function of a protein, amino acid substitutions and the like are generally added by mutating the DNA encoding the protein. To this end, a library containing mutants with amino acid substitutions at various positions is created at random, and the library is screened for mutants with better functionality. By repeating the process of adding further mutations to the obtained protein and screening again, it becomes possible to obtain proteins with even better functions. In other words, this series of work is a new kind of biotechnology in which the process of molecular evolution that takes place in nature is ultra-speeded up in the laboratory, and highly functional molecules similar to those found in living things are evolved and created right before our eyes. It's technology. This technique is also called "evolutionary molecular engineering" because it resembles the process of evolution in nature.

For example, Patent Document 1 (Japanese Unexamined Patent Application Publication No. 2016-098198) discloses that among a plurality of DNA fragments consisting of a base sequence obtained by dividing a DNA encoding an antibody into a plurality of parts, said DNA does not have at least a nonsense mutation or a frameshift mutation. A method is described for producing a DNA library by selecting and recovering fragments and ligating at least two of the recovered DNA fragments to form DNA encoding the antibody. In this method, in the step of selecting and recovering multiple DNA fragments consisting of base sequences obtained by dividing DNA into multiple parts, the divided DNA fragments are transcribed into mRNA, and the end of the mRNA and the end of a nucleic acid linker are ligated. and forming a complex in which a product obtained by translating the mRNA and the mRNA are linked via the nucleic acid linker, and further, reverse transcribing the mRNA of the complex and recovering the DNA fragment. This is done by In this method, each DNA fragment is subjected to PCR using a primer having a restriction enzyme recognition sequence, and a restriction enzyme recognition site is introduced at one end or both ends of each amplified fragment. Thereafter, the amplified fragments are cut with the restriction enzyme and further ligated to produce a DNA library.

In order to create ligated nucleic acid fragments, methods of fragmenting using restriction enzymes and ligating are conventionally known. However, since restriction enzymes perform sequence-dependent cleavage, if a restriction enzyme recognition sequence is included at a location other than the desired one, the reading frame may shift due to cleavage, or a linked nucleic acid fragment having the designed sequence may not be obtained. First, a problem may arise in that functional proteins are not produced. To avoid these phenomena, the degree of freedom of the library is restricted.

In recent years, a technique has been developed in which PCR is performed using primers with inosine introduced at arbitrary positions, and after amplification, an overhanging end is formed using an enzyme that recognizes inosine and decomposes phosphodiester bonds at specific positions.

Non-Patent Document 1 (Baumann et al. BMC Biotechnology 2013, 13:81) states that PCR is performed using a primer with the third base from the 5' end as a deoxyinosine base, and the amplified product is treated with endonuclease V. A technique for creating a protruding end by doing this is disclosed. With this method, overhanging ends can be created without using type II restriction enzymes and without depending on the sequence. This method is used not to link nucleic acid sequences together, but to introduce them directly into a plasmid vector.

In Patent Document 2 (Japanese Unexamined Patent Publication No. 2019-149985), PCR is performed using a primer containing inosine at an arbitrary position to create multiple amplified fragments, and the amplified product is treated with T4 pyrimidine dimer glycosylase (PDG) or endonuclease. A technique has been disclosed in which a plurality of amplified fragments are ligated by treatment with V to create overhanging ends.

Nucleic acid amplification methods include PCR, which repeats denaturation, annealing, and amplification by regularly changing the temperature, autonomous sequence replication reaction (3SR), which performs isothermal amplification, isothermal chimeric primer-initiated nucleic acid amplification (ICAN), and ligase chain reaction. Various methods such as reaction (LCR) and LAMP method are known. In such nucleic acid amplification methods, mutated proteins having more desirable properties are produced by introducing mutations at a fixed rate.

RNA/DNA chimeric primers are also used for amplification by chimeric primer-initiated nucleic acid amplification (ICAN) under isothermal conditions. In ICAN, an RNA/DNA chimeric primer containing an RNA portion on the 3' side of the primer is used to extend the chain. RNaseH cleaves the RNA portion derived from the chimeric primer, and an elongation reaction accompanied by a strand displacement reaction and a template exchange reaction occurs from the cleaved portion. Genes are amplified by repeating this reaction.

In the blood of camelid animals such as alpacas and llamas, in addition to IgG antibodies composed of two heavy chains (H chain) and light chain (L chain), there are also antibodies composed only of heavy chains (heavy chain Antibody; HCAb) exists. The variable region of HCAb, called VHH, is composed of three CDRs (CDR1 to CDR3) called CDRs (complementarity determining regions) and four framework regions (FR1 to FR4), and is similar to IgG antibodies. , Fab fragments, and single-chain antibody scFv, it is expected to be applied to pharmaceuticals using antibody engineering technology. VHH is inexpensive to produce, can be stably stored and transported at room temperature, and the structure of the antigen-binding site (paratope) to which VHH binds is more diverse than that of conventional antibody antigen-binding sites. Therefore, VHHs that allow various administration routes such as oral, pulmonary, and nasal administration are being developed, and are expected to be applied to future drug discovery. As one of its applications, Patent Document 3 (Japanese Unexamined Patent Publication No. 2016-44126) discloses that desired mutations are introduced into each of multiple DNA fragments containing the complementarity determining region in the heavy chain of a camelid antibody. , these are linked together to synthesize modified double-stranded DNA, the mRNA encoding these is linked to a puromycin-DNA linker, and after the mRNA-linker is prepared, these are translated in a cell-free translation system. A method for producing next-generation fragment antibodies has been proposed in which an mRNA-mutated antibody is immobilized on a solid phase, followed by reverse transcription, cDNA display, and selection.

Japanese Patent Application Publication No. 2016-098198 JP2019-149985A Japanese Patent Application Publication No. 2016-44126

There has been a desire for a nucleic acid amplification and ligation method that can be used for ligation of nucleic acid sequences without depending on the sequence. For example, when using a primer containing inosine, the base appearing at the complementary position of inosine is cytosine (C). Furthermore, the cleavage site of endonuclease V cleaves the second and third phosphodiester bonds on the 3' side of inosine at a rate of 95% and 5%, respectively. Therefore, inosine is located at the third base of the triplet, and even if this third base changes, it is necessary to create a triplet sequence that corresponds to the same amino acid, which creates constraints on primer design.

Additionally, from the perspective of evolutionary engineering, a method for linking nucleic acid fragments into which mutations have been introduced with a certain probability has been desired. Therefore, for example, when it is necessary to increase the introduction of mutations due to PCR, it is necessary to develop a method that can appropriately increase the mutation introduction rate.

Furthermore, it goes without saying that a method with fewer steps and fewer or no operations such as changing containers is desirable not only from the viewpoint of simplicity but also from the viewpoint of preventing contamination.

The present invention performs PCR using an RNA/DNA chimeric primer, digests the sequence derived from the RNA sequence of the primer by treating with RNaseH to create overhanging ends, and uses the overhanging ends to connect multiple amplified fragments. This is the way to do it.
Specifically, the nucleic acid amplification and ligation method of the present invention uses one or more primer pairs in which at least one primer is an RNA/DNA chimera primer containing an RNA sequence on the 5' side for a desired nucleic acid sequence. performing PCR to create an amplified fragment using the desired nucleic acid sequence as a template;
Digesting the RNA sequence contained in the amplified fragment by RNaseH treatment to form overhanging ends;
The step of ligating at least two amplified fragments by ligating their overhanging ends to create a ligated nucleic acid.

In the above method, the forward primer of one of the primer pairs that amplifies adjacent amplified fragments when ligated among the amplified fragments contained in the ligated nucleic acids is an RNA/DNA chimera primer; The reverse primer of the other primer pair is an RNA/DNA chimeric primer, and the RNA sequences contained in the forward primer and the reverse primer can have substantially complementary sequences. As a result, a single strand complementary to the ends of other amplified fragments is generated at one end or both ends of the amplified fragment after PCR. The amplified fragments are linked using the complementary single strands.

As the DNA polymerase for PCR, any polymerase can be used as long as it is thermostable; for example, rTth DNA polymerase, KOD DNA polymerase derived from Thermococcus kodakarensis KOD 1 strain, Pfu DNA polymerase, and Taq DNA polymerase. etc. can be used. For example, PrimeSTAR (registered trademark) series (manufactured by Takara Bio Inc.), TaKaRa Ex Taq (registered trademark) series (manufactured by Takara Bio Inc.), TaKaRa La Taq (registered trademark) series (manufactured by Takara Bio Inc.), TaKaRa Taq (trademark) Series (manufactured by Takara Bio), Speed Star (trademark) (manufactured by Takara Bio), MightyAmp (trademark) series, Prelude (trademark) PreAmp Master Mix (manufactured by Clontech), SuperPlex (trademark) Premix (manufactured by Clontech), Titanium (registered trademark) Taq DNA polymerase (manufactured by Clontech), Advantage (registered trademark) 2 polymerase mix & PCR kit (manufactured by Clontech), Advantage (registered trademark) GC2 polymerase mix & PCR kit (manufactured by Clontech), CloneAmp (trademark) HiFi PCR Premix (manufactured by Clontech), High Yield PCR EcoDry (trademark) Premix (manufactured by Clontech), High Fidelity PCR EcoDry (trademark) Premix (manufactured by Clontech), SeqA mp (trademark) DNA Polymerase (manufactured by Clontech), KOD -Plus series (manufactured by Toyobo Co., Ltd.), KOD One (registered trademark) series (manufactured by Toyobo Co., Ltd.), KOD DNA Polymerase (manufactured by Toyobo Co., Ltd.), KOD FX Neo, KOD FX (manufactured by Toyobo Co., Ltd.), KOD -Multi&Epi - (registered trademark) (manufactured by Toyobo Co., Ltd.), Blend Taq (registered trademark) series (manufactured by Toyobo Co., Ltd.), KOD Dash (registered trademark) (manufactured by Toyobo Co., Ltd.), Quick Taq (registered trademark) (manufactured by Toyobo Co., Ltd.) ), rTaq DNA Polymerase (manufactured by Toyobo Co., Ltd.), Q5 High-Fidelity DNA Polymerase series (New England Biolab Japan Co., Ltd.), Phusion High-Fidelity DNA Poly merase series (New England Biolab Japan Co., Ltd.), OneTaq DNA Polymerase (New England Biolab Japan Co., Ltd.) can be widely used, but is not limited to the above, and those skilled in the art can select a DNA polymerase depending on the purpose.

In the case of PCR using rTth DNA polymerase, it is desirable to perform the PCR in the presence of Mn ²⁺ or Mg ²⁺ .
In the case of PCR using a DNA polymerase other than rTth DNA polymerase, it is desirable to further perform reverse transcription using rTth DNA polymerase before RNaseH treatment.

The protruding ends of the amplified fragments after PCR can be ligated using, for example, Taq DNA ligase, T4 DNA ligase, and E. coli. This can be carried out using an enzyme selected from the group consisting of E. coli DNA ligase.

In the present invention, a desired nucleic acid sequence is amplified by PCR using one or more primer pairs in which at least one of the primers is an RNA/DNA chimera primer containing an RNA sequence on the 5' side. , providing a nucleic acid fragment comprising an RNA sequence derived from the chimeric primer at either the 5' or 3' end, or both the 5' and 3' ends of the desired nucleic acid sequence.

The present invention provides a pair of primers in which at least one primer is an RNA/DNA chimeric primer containing an RNA sequence on the 5'side;
DNA polymerase and
RNaseH and
Taq DNA ligase, T4 DNA ligase, and E. and an enzyme selected from the group consisting of E. coli DNA ligase.

In the method of the present invention, a protruding end can be formed by using an RNA/DNA chimeric primer, so that a target nucleic acid sequence can be easily amplified and ligated.
With this method, primers can be designed without depending on the nucleic acid sequence, and the mutation introduction rate can also be changed by selecting a polymerase.

Furthermore, when using restriction enzymes, for example, the cleavage is sequence-dependent because the cleavage occurs at the restriction enzyme recognition site, and if the restriction enzyme recognition site is included at a location other than the intended location, unintended fragments may occur. may occur. In the present invention, since nucleic acid sequences can be ligated without the need for restriction enzymes, nucleic acid ligation can be performed sequence-independently and with fewer steps. Furthermore, during ligation, it is possible to create an overhanging end that has a longer single-stranded portion than the overhanging end produced by restriction enzyme cleavage. Furthermore, when using a restriction enzyme that produces a protruding end, only a protruding end having a single strand of about 4 bases can be produced, whereas in the present invention, for example, a protruding end having a single strand of about 1 to 15 bases can be produced. Since it is possible to create a , the concatenation is highly accurate and can be concatenated in an array-independent manner.

Furthermore, in the present invention, the mutation introduction rate can be controlled by the DNA polymerase used. For example, DNA polymerases with high replication fidelity, such as KOD One (registered trademark) series (manufactured by Toyobo Co., Ltd.), KOD-Plus series (manufactured by Toyobo Co., Ltd.), PrimeSTAR Max (manufactured by Takara Bio Inc.), The mutation introduction rate can be changed depending on whether PCR is performed using CloneAmp (trademark) HiFi PCR Premix (manufactured by Clontech), Pfu DNA polymerase, Taq DNA polymerase, etc., or rTth DNA polymerase. Here, a DNA polymerase with high replication fidelity is a DNA polymerase that has a strong proofreading activity, and has a DNA sequence replication accuracy that is about 10 times or more, preferably about 50 times or more, than Taq DNA polymerase. Say polymerase. For example, if you want to amplify and link nucleic acids without introducing mutations, perform PCR using a DNA polymerase with high replication fidelity, and if you want to tolerate some mutations, perform PCR using Taq DNA polymerase to reduce mutations even further. When actively introducing mutations, the rate of mutation introduction can be controlled by performing PCR using rTth DNA polymerase. Furthermore, when performing PCR using rTth DNA polymerase, the mutation introduction rate can be changed depending on whether Mn ²⁺ or Mg ²⁺ is added. That is, if you want to introduce more mutations, Mn ²⁺ is added, and if you want to lower the mutation introduction rate than when Mn ²⁺ is added, Mg ²⁺ is added. In this way, by controlling the mutation introduction rate, a library containing mutants with amino acid substitutions at various sites can be created at random, and this can be preferably used for "evolutionary molecular engineering" to screen for proteins with more desirable properties. be able to.

In addition, when the above PCR is performed using DNA polymerase with high replication fidelity or Taq DNA polymerase, and reverse transcription is further performed using rTth DNA polymerase before RNaseH treatment, a short period of time after PCR and before reverse transcription using rTth DNA polymerase may be A heating step may be further performed.
After PCR is amplified using a DNA polymerase with high replication fidelity or Taq DNA polymerase, the efficiency of reverse transcription usually decreases unless a purification step is performed. However, by performing reverse transcription after short-time heating after PCR, reverse transcription can be performed with high efficiency without a purification step. Since no purification step is required after PCR, it is possible to perform a one-pot reaction, that is, to proceed with reverse transcription after sequential PCR in the same container.

This short heating step involves heating at a temperature of about 80 to 110°C, preferably about 85 to 105°C, more preferably about 90 to 100°C, for about 5 to 60 seconds, preferably about 10 to 40 seconds. , more preferably by heating for about 15 to 30 seconds. As an example, by heating at 95° C. for 20 seconds, reverse transcription using rTth DNA polymerase can be performed with high efficiency without performing a purification step.
Although not intending to be bound by theory, it is believed that if purification is not performed after PCR is completed, reverse transcription is hindered because DNA polymerase, which has high replication fidelity, is attached to the DNA strand. However, it is thought that by heating the PCR product for a short time, the attached DNA polymerase detached from the DNA strand, making reverse transcription possible without purification.

Furthermore, VHHs having various sequences can be created from existing VHHs by performing shuffling according to the present invention using nucleic acids encoding VHHs. The method of the present invention can, for example, create a humanized VHH library in which the framework region (FR) is designed based on the human FR sequence and the structural characteristics obtained as a result of VHH crystal structure analysis data, Various VHHs can be designed by introducing Furthermore, it is also possible to create a VHH antibody with higher binding ability by introducing mutations to increase thermostability, or by shuffling a portion of CDRs from multiple VHHs.

By applying the present invention, mutations can be introduced into any specific region of any polypeptide. For example, a nucleotide region encoding a specific region in which you want to introduce random mutations (dotted line in Figure 11) is amplified by error-prone PCR to generate nucleotide fragments containing the specific region into which various mutations have been introduced. obtain. The obtained fragment is amplified using an RNA/DNA chimeric primer to create an overhang at one or both of the 3' or 5' ends. By performing PCR using an RNA/DNA chimera primer on the side that connects to the nucleotide fragment containing the specific region, an overhang is introduced into the remaining nucleotide sequence encoding the polypeptide, and the specific region is mutated. ligated with a nucleotide fragment containing By this method, it is possible to create a library in which random mutations are introduced only into specific regions of any polypeptide.

In FIG. 11, an overhang is introduced into only one of the nucleotide fragments containing the specific region into which a mutation has been introduced, but it is also possible to introduce overhang ends at both ends, and in that case, the 3' end It is possible to link both the and 5' ends with other nucleotide fragments.

Using this method, for example, various mutations can be introduced into arbitrary regions such as CDR1 to CDR3 of VHH to select VHH with better binding activity, or mutations can be introduced into the ligand-binding region of the receptor. The binding activity with the ligand can be changed by

FIG. 1 is a schematic diagram showing one method of the present invention. It is a schematic diagram showing the case where PCR is performed using rTth DNA polymerase. It is a schematic diagram showing the case where PCR is performed using Taq DNA polymerase. It is a schematic diagram of the construction of a VHH gene in an example. 1 is a photograph of a denaturing polyacrylamide gel electrophoresis (PAGE) gel that confirmed the ligation of DNA fragments produced by PCR under Mn ²⁺ addition conditions in Examples. 1 is a photograph of a denaturing polyacrylamide gel electrophoresis (PAGE) gel that confirmed the ligation of DNA fragments produced by PCR under Mg ²⁺ addition conditions in Examples. FIG. 2 is a schematic diagram of shuffling between VHH genes in Examples. This is a photograph of a denaturing polyacrylamide gel electrophoresis (PAGE) gel that confirmed the ligation of fragments A and B of VHH#1 to VHH#3 in Examples. 1 is a photograph of a denaturing polyacrylamide gel electrophoresis (PAGE) gel in which PCR conditions using rTth DNA polymerase in Examples were investigated. 1 is a photograph of a denaturing polyacrylamide gel electrophoresis (PAGE) gel in which conditions for producing overhanging ends using a combination of PrimeSTAR Max and rTth DNA polymerase in Examples were investigated. FIG. 1 is a schematic diagram showing one embodiment of the present invention in which a mutation is introduced into any specific region of a polypeptide. 1 is a photograph of a denaturing polyacrylamide gel electrophoresis (PAGE) gel in the case where purification is not performed before reverse transcription using a DNA polymerase with high replication fidelity in an example. FIG. 2 is a photograph of a denaturing polyacrylamide gel electrophoresis (PAGE) gel in an example in which heat treatment was performed without purification before reverse transcription using a DNA polymerase with high replication fidelity. FIG. 2 is a schematic diagram of creating a VHH library in which random mutations are introduced into CDR3 in Examples. 1 is a photograph of a denaturing polyacrylamide gel electrophoresis (PAGE) gel showing that a VHH library in which random mutations were introduced into CDR3 was created by ligation in an example.

The present invention will be described below with reference to the accompanying drawings as necessary. It should be understood that the terms used herein have the meanings commonly used in the art, unless otherwise specified. Accordingly, unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In this specification, the singular forms include the plural unless specifically stated otherwise.

As used herein, "nucleic acid" is a biopolymer in which nucleotides consisting of a base, sugar, and phosphoric acid are linked by phosphodiester bonds. Nucleic acid is a general term for ribonucleic acid (RNA) and deoxyribonucleic acid (DNA). RNA has a sugar moiety of ribose, and 2-deoxyribose has the hydroxyl group at the 2' position of ribose replaced with a hydrogen group. Things are DNA. A base is attached to the 1' position of the sugar. Furthermore, the 3'-position of the sugar and the 5'-position of the adjacent sugar are bonded in a phosphate ester structure, and this bond is repeated to form a long chain. Chain elongation in transcription, translation, and PCR proceeds in the direction from the 5' position to the 3' position. Of the two ends of the sugar chain, the 5' end with phosphoric acid bonded and cut is called the 5' end, and the opposite end is called the 3' end. Furthermore, the 5' side of regions on adjacent nucleic acids is called upstream, and the 3' side is called downstream.
As used herein, unless otherwise specified, the length of a nucleic acid is any length. Furthermore, in this specification, "oligonucleotide derivatives" or "polynucleotide derivatives" are included as long as they do not inhibit the amplification reaction.

PCR is a nucleic acid amplification technique, also called polymerase chain reaction. A short single-stranded primer with a sequence complementary to the target nucleic acid region, a free nucleotide, and a DNA polymerase are added to the template DNA to be amplified. Double-stranded DNA is denatured at high temperature to become single-stranded, then cooled to anneal the primer to the complementary site of the single-stranded DNA, and then reheated to form single-stranded DNA using the primer as a starting point by DNA polymerase. Extends a strand complementary to DNA. The template DNA is then amplified exponentially by repeating the same cycle from denaturation of the double-stranded DNA to proceed with amplification. As used herein, the term PCR also includes RT-PCR (reverse transcription polymerase chain reaction), in which reverse transcription is performed using RNA as a template, and PCR is performed on the resulting cDNA.

A primer is a short oligonucleotide that serves as a starting point for DNA replication. In the PCR method, a pair of primers consisting of a forward primer and a reverse primer is usually used. Forward primer refers to a primer that anneals to the antisense strand of template DNA among a pair of primers used in the PCR method, and reverse primer refers to a primer that anneals to the sense strand of template DNA. Generally, DNA primers are used in PCR, but in the method of the present invention, one or both of the paired primers is an RNA/DNA chimera primer. An RNA/DNA primer is one that contains an RNA sequence on the 5' side of the primer. The length of the RNA sequence contained in the RNA/DNA primer is not particularly limited as long as it is long enough to create a protruding end to which the amplified fragments can be properly ligated; can be set.

The DNA polymerase used in PCR is not particularly limited as long as it is a heat-resistant DNA polymerase, but rTth DNA polymerase, KOD DNA polymerase, Pfu DNA polymerase, PrimeSTAR Max (manufactured by Takara Bio Inc.), Taq DNA polymerase, etc. can be used. Without being limited to these, those skilled in the art can select various DNA polymerases depending on the purpose.

RNase, particularly RNase H, can be used to digest the RNA sequence contained in the amplified fragment generated by PCR. RNase H, also called ribonuclease H, is an endoribonuclease that hydrolytically cleaves RNA forming a DNA/RNA hybrid double strand to produce single-stranded DNA.

Complementary refers to a state in which the pairing bases (A and T, G and C, A and U) can hydrogen bond and form base pairs in the base sequence of a double-stranded nucleic acid. This specification includes not only complementarity between DNA and DNA, but also complementarity between DNA and RNA. In this specification, a complementary sequence includes not only a sequence in which all bases are complementary, but also a sequence in which there is a degree of complementarity that allows them to pair with each other, and this case is defined as having a substantially complementary sequence. It is said that it does.

An overhanging end is also referred to as a cohesive end or sticky end, and refers to an end structure having a single-stranded nucleic acid with mutually complementary sequences protruding from the 5' or 3' end of the DNA strand. In the present invention, the length of the RNA sequence contained in the RNA/DNA primer corresponds to the length of the single-stranded portion of the overhanging end, for example, the overhanging end having a single-stranded portion of about 1 to 15 residues. can be formed.

DNA ligase is an enzyme that joins the ends of DNA strands with phosphodiester bonds, and is used in genetic engineering to create recombinant DNA, especially by acting on complementary strands with overhanging ends to create DNA fragments. Used when connecting. In the present invention, any DNA ligase can be used to join the overhanging ends, and examples include Taq DNA ligase, T4 DNA ligase, and E. coli. E. coli DNA ligase can be used.

Taq DNA ligase forms a phosphodiester bond between the 5' phosphate end and 3' hydroxyl end of the oligonucleotide and ligates it only when the single-stranded parts of the overhanging ends of the DNA are completely complementary and there are no gaps. It is an enzyme that causes T4 DNA ligase is an enzyme that forms a phosphodiester bond between the 5' phosphate end and 3' hydroxyl end of an oligonucleotide to link them, and requires Mg ²⁺ and ATP. E. E. coli DNA ligase is an enzyme that forms a phosphodiester bond between the 5' phosphate end and 3' hydroxyl end of an oligonucleotide to link them, and requires NAD.

Reverse transcription refers to the synthesis of DNA using RNA as a template in the presence of reverse transcriptase, which is an RNA-dependent DNA polymerase. Examples of the reverse transcriptase include rTth DNA polymerase, which is a thermostable DNA polymerase derived from the hyperthermophilic bacterium Thermus thermophilus HB8. When using rTth DNA polymerase, reverse transcription can be performed in the presence of Mn ²⁺ or Mg ²⁺ to enhance activity. When using rTth DNA polymerase, in order to promote the activity, Mn ²⁺ is added to a final concentration of about 0.1 mM to 1.0 mM, preferably 0.3 mM to 0.8 mM, for example, a final concentration of 0.63 mM. Alternatively, it is desirable to add Mg ²⁺ to a final concentration of about 0.5mM to 1.8mM, preferably about 0.8mM to 1.5mM, for example, 1.25mM.

One embodiment of the present invention will be described using FIG. 1.
Although DNA1 and DNA2 are drawn separately in the figure, DNA1 and DNA2 may be separate regions of one DNA. Furthermore, three or more pairs of primers may be used to amplify three or more DNAs or to produce three or more DNA fragments.
The reverse primer for DNA1 and the forward primer for DNA2 are RNA/DNA chimeric primers. The RNA/DNA chimera primer has an RNA sequence in its 5' end (in the figure, the black part in the arrow indicating the primer), and the RNA sequence in the RNA/DNA chimera primer of DNA1 and the RNA/DNA chimera of DNA2 The RNA sequences in the primers have mutually complementary sequences. Using DNA1 and DNA2 as templates, PCR is performed using a heat-resistant DNA polymerase, such as rTth DNA polymerase, KOD DNA polymerase, Pfu DNA polymerase, PrimeSTAR Max (manufactured by Takara Bio Inc.), or Taq DNA polymerase, etc., and amplification is performed as necessary. Perform reverse transcription.

Next, by performing RNaseH treatment, the RNA sequence contained in the end of the amplified fragment (in the figure, the black part at the end of the PCR amplified fragment) is digested, thereby creating a protruding end. The protruding ends of DNA1 and DNA2 are single-stranded DNA sequences that are complementary to each other, and can be specifically linked using a phosphodiester bond-linking enzyme. Enzymes linked by phosphodiester bonds, such as Taq DNA ligase, T4 DNA ligase, and E. Examples include enzymes selected from the group consisting of E. coli DNA ligase.

The case where PCR is performed using rTth DNA polymerase will be further explained using FIG. 2. When performing PCR using rTth DNA polymerase as the DNA polymerase, a complementary strand of the RNA sequence in the RNA/DNA primer is also created during amplification. When the amplified fragment amplified by PCR is treated with RNaseH to digest the RNA sequence contained at the end of the amplified fragment, an overhanging end having a single-stranded portion can be created.
This figure shows the case in which an overhanging end is created only at one end, but by using RNA/DNA primers for both primers (forward primer and reverse primer) of the primer pair, it is possible to create an overhang at both ends. It is also possible to create overhanging ends.

Note that when performing PCR using rTth DNA polymerase, it is desirable to perform it in the presence of Mn ²⁺ or Mg ²⁺ . In the presence of Mn ²⁺ , approximately 61 mutations are introduced into 10,386 bases of the amplified fragment, resulting in a mutation introduction rate of approximately 5.9 mutations/1 kbp. On the other hand, in the presence of Mg ²⁺ , approximately 420 mutations are introduced into the 129,888 bases of the amplified fragment, resulting in a mutation introduction rate of approximately 3.2 mutations/1 kbp. This mutation introduction rate is slightly higher than the mutation introduction rate of approximately 1.4 pieces/1 kbp when Taq DNA polymerase, which will be described later, is used. Therefore, when performing PCR using rTth DNA polymerase in the presence of Mn ²⁺ or Mg ²⁺ , a library containing more mutations is created and the library is screened for mutants with better functionality. This is particularly preferred when the purpose is evolutionary molecular engineering.

The case where PCR is performed using a DNA polymerase with high replication fidelity such as Taq DNA polymerase, KOD DNA polymerase, Pfu DNA polymerase, PrimeSTAR Max (manufactured by Takara Bio Inc.), etc. will be further explained using FIG. 3. When performing PCR using Taq DNA polymerase or a DNA polymerase with high replication fidelity as a DNA polymerase, a complementary strand to the RNA sequence in the RNA/DNA primer is not created, and the ends of the amplified fragment consist of the RNA sequence. A single strand will remain. Therefore, reverse transcription is performed using an appropriate DNA polymerase, such as rTth DNA polymerase, to create a double strand, which is then treated with RNaseH. It is desirable to add Mn ²⁺ or Mg ²⁺ during reverse transcription. When the RNA sequence contained at the end of the amplified fragment is digested by RNaseH treatment, an overhanging end having a single-stranded portion can be created.
This figure shows the case in which an overhanging end is created only at one end, but by using RNA/DNA primers for both primers (forward primer and reverse primer) of the primer pair, it is possible to create an overhang at both ends. It is also possible to create overhanging ends.

This method uses Taq DNA polymerase or a DNA polymerase with high replication fidelity in the PCR step. Compared to the case of using rTth DNA polymerase, this method requires a step of performing reverse transcription with rTth DNA polymerase after PCR, so rTth DNA polymerase is used in the PCR step. Although there is one additional step compared to the method, this reverse transcription step only involves adding rTth DNA polymerase, etc. to the container after PCR. As mentioned above, when performing PCR using rTth DNA polymerase, the mutation introduction rate is high, but in this method of performing PCR using Taq DNA polymerase or the like or a DNA polymerase with high replication fidelity, the mutation introduction rate is low. Specifically, when performing PCR using a DNA polymerase with high replication fidelity, such as KOD DNA polymerase, Pfu DNA polymerase, or PrimeSTAR Max (manufactured by Takara Bio Inc.), it is easier to introduce mutations than when using Taq DNA polymerase. The rate is even lower. Therefore, it is particularly preferred when amplifying and ligating nucleic acid sequences without introducing mutations into template sequences.

The present invention will be described below based on Examples, but the following Examples are for illustrating the present invention and are not intended to limit the present invention.

<Example 1: Construction of VHH gene using DNA fragment prepared by PCR using rTth DNA polymerase (Mn ²⁺ addition conditions)>
PCR using rTth DNA polymerase was performed using DNA encoding VHH as a template and three types of primer sets. It was confirmed that the original sequence could be created by creating protruding ends for each DNA fragment by treating with RNaseH and ligating them (FIG. 4).

<1-1 Production of RNA-containing DNA fragment by PCR>
Artificial gene synthesis was outsourced to Eurofins Co., Ltd., and VHH#1, the DNA encoding VHH, was synthesized. Its DNA sequence is as follows.

VHH#1 (577bp):

(Sequence number 1)

Base number: region name
14-33: T7 promoter
34-36: 5`cap
37-107:Ω
110-114: kozak
118-516:VHH
517-528:GGGS
529-546：His Tag
547-555: GGS
556-577：NewYtag(cnvK)

PCR was performed using VHH#1 as a template and three types of primers to obtain VHH#1-α (SEQ ID NO: 8), VHH#1-β (SEQ ID NO: 9), and VHH#1-γ (SEQ ID NO: 10). Three types of RNA-containing DNA fragments were prepared. The sequences of the three types of primer sets used are as follows.

25 μL of 2xRT Quick Master mix (manufactured by Toyobo Co., Ltd.) as rTth DNA polymerase, 2.5 μL of 50 mM Mn(OAc) ₂ , 2.0 μL of 10 μM Forward primer, 2.0 μL of 10 μM Reverse primer, template DNA (plasmid) 1000-fold dilution) was mixed and adjusted to 50 μL using UltraPure (trademark) DNase/RNase-Free Distilled Water (UPDW) (manufactured by Thermo Fisher Scientific). The PCR program for preparing VHH#1-α and VHH#1-β was as follows, and steps 3 to 5 were repeated for 25 cycles.
1.90 ℃ 30 seconds 2.94 ℃ 1 minute 3.94 ℃ 30 seconds 4.60 ℃ 30 seconds 5.72 ℃ 25 seconds 6.72 ℃ 7 minutes 7.10 ℃ ∞

The PCR program for VHH#1-γ preparation was as follows, and steps 3 to 5 were repeated for 25 cycles.
1.90 ℃ 30 seconds 2.94 ℃ 1 minute 3.94 ℃ 30 seconds 4.65 ℃ 30 seconds 5.72 ℃ 25 seconds 6.72 ℃ 7 minutes 7.10 ℃ ∞

The sequences of the amplified VHH#1-α, VHH#1-β, and VHH#1-γ are as follows.

VHH#1-α (201bp):
GATCCCGCGAAATTAATACGACTCACTATAGGGGAAGTATTTTTACAACAATTACCAAACAACAACAACAAACAACAACAATTACATTTTACATTCTACAACTACAAGCCACCATGGCTGAGGTGCAGCTCGTGGAGTCTGGGGGAGGATTGGTGCAGGCTGGGGGCTCTCTGAGACTCTCGTGTGCAATTAATGACCGT
(Sequence number 8)

VHH#1-β (152bp):
ATGACCGTACCTTTAGTAACTATTCCATGGGCTGGTTCCGCCAGGCTCCAGGGAAGGAGCGTGAGTTTGTCGCGGCTATTACTCATAATGGTAGTACAAACTTTCCAGACTCCGTGAAGGGCCGATTCACCATCTCCGTAGACAAGGCCAAG
(Sequence number 9)

VHH#1-γ (237bp):
CCAAGAACACGGTGTATTCTGCAAATGAACAGCCTGAAACCCGAGGACACGGCCGTCTATTACTGTGCGGTAGACCATAGTTTTATCACGGTAGTACGTGGAGAGGAAGATCTCGAAGTTTGGGGCCAGGGCACCCTGGTCACTGTCTCCTCAGCGCACCACAGCGAAGACCCCACGGGGGGAGGCAGCCATCATCATCATCATCACGGCGGAAGCAGGACGGGGGGCGGCGTGGAAA
(Sequence number 10)

<1-2 Purification of fragment DNA containing RNA site>
RNA-containing DNA fragments were purified using AMPure XP (manufactured by Beckman Coulter) according to the attached manual. Elution was performed with 30 μL of UPDW.

<1-3 Formation of protruding ends by RNaseH treatment>
Add 0.3 μL of RNase H (manufactured by Takara Bio) and 3.0 μL of 10xNEBuffer2 (manufactured by New England Biolabs) to 27 μL of purified RNA-containing DNA fragment DNA solution, and incubate at 37°C for 30 minutes to remove RNA. Disassembled the parts.

<1-4 Ligation of DNA fragments using T4 DNA ligase>
Ligation was performed in all combinations of the VHH#1-α, VHH#1-β, and VHH#1-γ DNA fragments having overhanging ends. Each DNA fragment was mixed in equal molar amounts, 2.0 μL of 10xT4 ligase buffer and 1.0 μL of T4 DNA ligase (manufactured by Takara Bio Inc.) were added, and the reaction solution was adjusted to 20 μL with UPDW. . After 24 hours of incubation at 16°C, reaction samples were confirmed by 4% denaturing polyacrylamide gel electrophoresis (PAGE) containing 8M urea (Figure 5).

The specific PAGE conditions are as follows. First, 4.8 g of urea (manufactured by Fuji Film Wako Pure Chemical Industries, Ltd.), 1.0 mL of 5x TBE (manufactured by Nippon Gene Co., Ltd.), and 1.0 mL of a 40% (w/v) acrylamide bis mixture (19:1) (Fuji Film (manufactured by Wako Pure Chemical Industries, Ltd.) was mixed and diluted to 10 mL with MilliQ water. The mixture was heated in a microwave for about 10 seconds to completely melt the urea. Add 25 μL of 20% (w/v) ammonium persulfate solution and 10 μL of N,N,N',N'-tetramethylethylenediamine (manufactured by Fuji Film Wako Pure Chemical Industries, Ltd.), mix gently, and transfer to a Rapidus mini-slab electrophoresis tank ( The gel was poured into a gel plate (8 x 9 cm size, 1 mm thick) for ATTO (manufactured by ATTO) and allowed to stand at room temperature for 30 minutes to solidify the gel. The gel was set in a Rapidus mini-slab electrophoresis tank set at 60°C, and a pre-run was performed at 200V for 10 minutes. 2 μL of 2x loading buffer was added to 1 μL of sample, boiled at 95° C. for 3 minutes, applied to the gel, and run at 200 V for 25 minutes. The gel was stained with SYBR Nucleic Acid Gel Stain (manufactured by Thermo Fisher Scientific) solution diluted 10,000 times with TE (pH 8.0), and then stained using an Amersham Typhoon scanner. (manufactured by Cytiva).

As is clear from Figure 5, the expected ligation products can be confirmed under the mixed conditions of α and β, β and γ, and α, β, and γ, indicating that the protruding ends of complementary sequences are ligated together. It was confirmed that

<1-5 Confirmation of ligation product by cloning and sequencing>
Cloning and direct sequencing of the ligation products were performed to further confirm that the desired sequence had been constructed. First, PCR was performed on the ligation product by repeating steps 2 to 4 for 30 cycles using the following program using Newleft and NewYtag (cnvK) primers and Taq DNA polymerase (Takara Ex Taq (manufactured by Takara Bio Inc.)). went.

1.98 °C 2 minutes 2.98 °C 10 seconds 3.66 °C 5 seconds 4.72 °C 1 minute 5.72 °C 2 minutes 6.10 °C ∞

After confirming the PCR product by 4% denaturing PAGE containing 8M urea, it was purified by AMPure XP according to the protocol and eluted in 40 μL of UPDW. Ligation high Ver. 2 (manufactured by Toyobo), the purified product was inserted into pGEM-T Easy vector (manufactured by Promega) according to the manual. According to the manual, competent cells DH5α were transformed with the vector into which the generated product was inserted, seeded on LB plates (+100 μg/mL ampicillin), and plate cultured.

E. coli derived from colonies whose inserts were confirmed by colony PCR were cultured overnight in 5 mL of LB liquid medium (+100 μg/mL ampicillin), and the next day, bacterial cells were collected by centrifugation. Thereafter, the plasmid was purified using FastGene Plasmid Mini Kit (manufactured by Nippon Genetics) according to the manual. Sequencing of 18 plasmids was outsourced to Eurofin Genomics. As a result, out of 18 samples, only one sample had the same sequence as the target DNA. As a result of calculating the number of mutations, the error rate was 5.9 errors per 1000 bp (61 errors/10386 bp (577 bp x 18)).

<Example 2: Ligation using PCR product with rTth DNA polymerase (Mg ²⁺ addition conditions)>
Since the mutation introduction rate was somewhat high in PCR using rTth DNA polymerase in the presence of Mn ²⁺ , suppression of the mutation introduction rate by the use of Mg ²⁺ was investigated.

<2-1 Construction of VHH gene using DNA fragment prepared by PCR under Mg ²⁺ addition conditions>
The VHH gene was constructed under the same conditions as the experiment described in Example 1, except that 50 mM Mn(OAc _{) 2} was changed to 50 mM MgCl2. The results of ligation between the VHH#1-α, VHH#1-β, and VHH#1-γ fragments are shown in FIG. Even when DNA fragments prepared under Mg ²⁺ addition conditions were used, the expected ligation products of α and β, β and γ, and α, β, and γ could be confirmed.

In order to evaluate the error rate of the VHH gene constructed by the method using Mg ²⁺ , analysis was performed using next generation sequencing (NGS). NGS was performed using MiSeq Reagent Kit v3 (600-cycle) (manufactured by Illumina). Samples for NGS analysis were prepared according to the manual of Nextera XT DNA Library Prep Kit (manufactured by Illumina). First, two-step PCR amplification was performed using the PAGE-purified VHH gene of interest as a template. PrimeSTAR Max (manufactured by Takara Bio Inc.) was used for PCR. The first step of PCR was performed using the primer set described below. The obtained PCR product was purified using AMPure XP, and second-stage PCR was performed using the purified product as a template. For the second step of PCR, the indexing primer specified in the kit was used. The PCR product was purified using AMPure XP in the same manner as above, and the DNA concentration was measured using NanoPad DS-11 (manufactured by DeNovix). Furthermore, the DNA was made into a single strand, subjected to treatments such as dilution, and then loaded into a cartridge.The reagent cartridge was then set in MiSeq System (manufactured by Illumina) and run was performed.

VHH sequences were extracted from the NGS output data, 300 sequences were randomly selected from among them, and the sequences were confirmed. A total of 420 mutations were confirmed in 300 sequences. Therefore, the mutation rate was 3.2 errors per 1000 bp (420 errors/129888 bp (577 bp x 300 sequences)). Since the error rate under the Mn ²⁺ addition condition was 5.9 errors/1000 bp, it was found that the mutation rate could be suppressed to about half by adding Mg ²⁺ instead of Mn ²⁺ .

Furthermore, it has been reported that rTth DNA polymerase has reverse transcription activity under Mn ²⁺ addition conditions, but this time it was confirmed that reverse transcription can be performed for approximately several bp even under Mg ²⁺ addition conditions.

<2-2 Shuffling between VHH genes>
Three types of VHH genes with a common framework region (FR) are divided within FR3, and a mixture of N-terminal and C-terminal fragments is ligated to create a total of nine types of VHH gene sequences. A model experiment was conducted (Figure 7). The N-terminal fragment was designated A, and the C-terminal fragment was designated B. The three types of VHH genes used are as shown in SEQ ID NO: 1, SEQ ID NO: 11, and SEQ ID NO: 12.

VHH#2 (573bp):

(Sequence number 11)

VHH#3 (570bp):

(Sequence number 12)

<2-3 Shuffling>
PCR was performed in the presence of Mg ²⁺ using rTth DNA polymerase using the combinations of the primers in Tables 1 and 3 and the templates of VHH#1 to VHH#3 in Table 4, and the 5' Fragment A, which is a DNA fragment on the side, and fragment B, which is a DNA fragment on the 3' side, were prepared. The PCR conditions for fragments A and B were as follows, and steps 3 to 5 were repeated for 25 cycles.

fragment A
1.90 ℃ 30 seconds 2.94 ℃ 1 minute 3.94 ℃ 30 seconds 4.60 ℃ 30 seconds 5.72 ℃ 25 seconds 6.72 ℃ 7 minutes 7.10 ℃ ∞

fragment B
1.90 ℃ 30 seconds 2.94 ℃ 1 minute 3.94 ℃ 30 seconds 4.65 ℃ 30 seconds 5.72 ℃ 25 seconds 6.72 ℃ 7 minutes 7.10 ℃ ∞

The PCR product was purified using AMPure XP (manufactured by Beckman Coulter). For the ligation reaction, a mixture of fragment A (3.0 μL for each fragment, 9.0 μL in total) and fragment B (3.0 μL for each fragment, 9.0 μL in total), 4.0 μL of 10xT4 ligase buffer, and 2.0 μL of T4 DNA. Ligase (manufactured by Takara Bio) was added, and the volume of the reaction solution was adjusted to 40 μL using UPDW. After incubation at 16°C for 24 hours, each ligation product was confirmed on 4% denaturing PAGE containing 8M urea (Figure 8).

<Sequence analysis of ligation products by next generation sequencing (NGS)>
The ligation products of the fragment A mixture and the fragment B mixture were analyzed by NGS. NGS analysis was performed in the same manner as in Example 2-1. As a result of NGS analysis, the expected nine types of VHH genes were included (Table 5), confirming that the shuffling was successful.

<Example 3: Production of RNA-containing PCR product by combining general PCR and reverse transcription using rTth DNA polymerase>
As a method for producing an RNA-containing PCR product using an RNA/DNA chimeric primer and rTth DNA polymerase, we investigated a method in which the overhanging end portion of RNA is reverse transcribed using rTth DNA polymerase after general PCR. The template DNA and RNA/DNA chimera primers used in the study are as follows.

PF_1D11-#81 (520bp)
GATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCAATGGAAGTACAATTAGTTGAATCTGGTGGTGGGCTTGTACAGCCAGGTGGGAGTCTGCGCCTGAGCTGTGCAGCGAGTGGTCGTACTTTCTCTCGTTACACTATGGGTTGGTTTCGCCAGGCACCGGGAAAAGGCCGTGAGGGCGTGGCGGCTCAAC ACTGGTGCTGGTACTACTTACTACGCTGACTCGGTCAAAGGCCGGTTTACCATCAGCCGTGACAACGCGAAGAACACCCTGTATCTCCAGATGAATTCCCTGCGTGCTGAAGATACTGCCGTGTACTACTGCGCTGCCCAGACCTCTGATTACAACGGTTGGGGTAACCGTTATTGGGGTCAAGGCACGTTGGTGACAGTCTCTTCAGGGGGAGGATCCCATCATCATCATCATCATCACGGCGGAAGCAGGACGGGGGGCGGC GTGGAAA
(Sequence number 17)

First, PCR was performed using PF_1D11-#81 as a template, the primer set of FW-Shuffling-PL (SEQ ID NO: 18) and NewYtag (cnvk) (SEQ ID NO: 7) shown below, and rTth DNA polymerase (using RT Quick Master mix). We conducted a study of the conditions. The final concentration was 1x RT-PCR Quick Master Mix, 0.3 μM FW-Shuffling-PL, 0.3 μM NewYtag (cnvK), 0.04 ng/μL template DNA, 0-2.5 mM Mn(OAc) ₂ Or _MgCl2 , 20 μL of PCR reaction solution was prepared. The PCR program was as follows, and steps 2 to 4 were repeated for 15 cycles.

FW-Shuffling-PL (lowercase letters are RNA)
5'-gaagauacTGCCGTGTACTACTGC-3'
(Sequence number 18)

1.94 °C 1 minute 2.94 °C 30 seconds 3.60 °C 30 seconds 4.72 °C 1 minute 5.72 °C 2 minutes 6.16 °C ∞

PCR was also performed using PrimeSTAR Max (manufactured by Takara Bio Inc.) for the purpose of comparison and use in the next study process. A 50 μL PCR reaction solution was prepared such that the final concentration was 1x PrimeSTAR Max, 0.3 μM FW-Shuffling-PL, 0.3 μM NewYtag (cnvK), and 0.04 ng/μL template DNA.
The PCR program was as follows, and steps 1 to 3 were repeated for 15 cycles.
1.95 ℃ 10 seconds 2.50 ℃ 5 seconds 3.72 ℃ 5 seconds 4.16 ℃ ∞

1 μL of each PCR reaction solution was applied to 4.5% denaturing PAGE containing 8 M urea (60° C., 200 V, 20 minutes) to confirm the PCR product (FIG. 9). In the PCR sample using PrimeSTAR Max, two bands were confirmed, which are thought to be a 160mer extended by FW-Shuffling-PL and a 152mer extended by NewYtag (cnvK) (lane 2). On the other hand, in some of the PCR products produced by rTth DNA polymerase ( lanes 4, 5, 10, and 11), only a band considered to be a 160mer was confirmed. This is considered to be because the complementary DNA is extended to the RNA portion by rTth DNA polymerase. Two bands can be seen in lanes 6, 7, and 12, but this is thought to be due to degradation of the RNA portion due to the too high Mn ²⁺ or Mg ²⁺ concentration. Furthermore, in these lanes, a subband appears slightly above 200 bp. Based on the above results, conditions for complementary strand synthesis for the RNA portion of the PCR product using PrimeSTAR Max were investigated using a final Mn ²⁺ concentration of 0.63 mM or a final Mg ²⁺ concentration of 1.25 mM.

PrimeSTAR Max PCR samples were purified by AMPure XP and eluted with 30 μL of UPDW. Using 3 μL of this purified product, a 25 μL reaction sample was prepared at a final concentration of 1× RT-PCR Quick Master Mix, 0.63 mM Mn(OAc) ₂ , or 1.25 mM MgCl ₂ . 1 μL for reference and 2×10 μL for reaction were separated and incubated at 60° C. and 72° C. for 10 minutes each. Furthermore, each reaction solution was dispensed into 5 μL×2, 0.5 μL of 10×NE Buffer 2 and 0.2 μL of RNase H were added to one half, and further incubated at 37° C. for 10 minutes. 1 μL of each reaction solution was applied to 4.5% denaturing PAGE containing 8 M urea (60° C., 200 V, 20 minutes) to confirm the product (FIG. 10). Under either Mn ²⁺ or Mg ²⁺ conditions, only the 160mer band could be confirmed under the 72°C condition (lanes 5 and 10), indicating that reverse transcription had occurred. Furthermore, by RNaseH treatment, a band considered to be a 152mer appeared again, which is thought to be due to degradation of the RNA portion. From the above results, it was confirmed that overhanging ends can be created by performing reverse transcription using rTth DNA polymerase on a PCR product using an RNA/DNA chimeric primer and further treating with RNaseH.

<Example 4: Examination of method of direct reverse transcription after PCR reaction>
Using the above-mentioned PrimeSTAR Max PCR reaction solution, reaction solutions S1 to S9 were prepared according to the compositions shown in Table 6. The reaction solutions were incubated (72° C., 8 minutes) without purification, and then 2 μL of each reaction solution was analyzed on 5% denaturing PAGE containing 8 M urea (60° C., 200 V, 30 minutes) (FIG. 12).

When reverse transcription was performed using rTth DNA polymerase using the purified PrimeSTRA Max PCR product as a template, it was confirmed that a single 160mer band was obtained (Example 3, Figure 10, lane 10), but the product was not purified. In this experiment, no conditions were found that resulted in a single band (FIG. 12), indicating that the RNA region in the primer was not reverse transcribed.

Subsequently, the PCR reaction solution using PrimeSTAR Max was heated at 95° C. for 20 seconds, and then a reverse transcription reaction solution was prepared according to the composition shown in Table 7. Thereafter, the reaction solutions were incubated without purification (8 minutes at 72°C), and 2 μL of each reaction solution was analyzed on 5% denaturing PAGE containing 8M urea (60°C, 200V, 30 minutes) (Figure 13 ).

As shown in Figure 13, one 160mer band was confirmed by heating at 95°C for 20 seconds after the end of PCR (lanes 3 to 10), and by heating the PCR product for a short time, It was confirmed that reverse transcription occurs without purifying the PCR product.

<Example 5: Preparation of library into which CDR3 random mutations have been introduced>
As shown in FIG. 14, a VHH library was created in which random mutations were introduced into CDR3. Specifically, among the nucleotides encoding VHH, the region encoding CDR3 was amplified using an error-prone primer to introduce random mutations. Furthermore, PCR was performed using a DNA/RNA chimera primer as a forward primer and a primer containing FR4, His-tag, and linker hybridized region (LHR) sequences as a reverse primer, and the protruding end and FR4 and A nucleotide fragment encoding a randomly mutated CDR3 having a linker binding region was obtained. On the other hand, PCR was performed using a nucleotide sequence encoding VHH as a template and a DNA/RNA chimera primer as a reverse primer, and a nucleotide fragment containing CDR1 and CDR2 and FR1, FR2, and FR3 having an overhanging end near CDR3 was obtained. I got it. Both fragments were ligated using ligase to obtain a VHH library in which random mutations were introduced into CDR3.
The template DNA and primers used are as follows.

>PF_1E1-#5 (529 bp)

(Sequence number 26)

Error prone PCR was performed using PF_1E1-#5 DNA as a template and PL_FR3_FW (SEQ ID NO: 18) and PL-FR4-RV (SEQ ID NO: 20). For error prone PCR, GeneMorph II Random Mutagenesis kit from Agilent Technologies, Inc. was used. According to the instructions of the kit, a 0.01 ng template DNA/25 μL reaction solution was prepared, and the PCR program described in the instructions was executed. The PCR reaction solution was purified using AMPure XP, eluted with 20 μL of UPDW, and the concentration was determined using DS-11+ NanoPad (mtCDR3 DNA).
Subsequently, the entire amount of mtCDR3 DNA was added to prepare 100 μL of a PCR reaction solution with a final concentration of 1×PrimeSTAR Max, 0.3 μM PL_FR3_FW, and 0.3 μM PL_FR4-end_RV. The PCR program was as follows, and steps 1 to 3 were repeated for 15 cycles.

1. 95°C for 10 seconds 2. 60°C for 8 seconds 3. 72°C for 10 seconds It was purified using AMPure XP, further eluted with 20 μL of UPDW, and the concentration was determined using DS-11+ NanoPad (mtCDR3-end DNA).

To obtain the plus-strand 5' fragment of PF_1E1-#5 with an RNA site, 1 ng of PF_1E1-#5 DNA was included, final concentration was 1x PrimeSTAR Max, 0.3 μM Newleft (-2G), 0.3 μM 50 μL of a PCR reaction solution consisting of RV-Shuffling-PL was prepared. In addition, in order to obtain a positive strand 3' fragment containing mtCDR3 having an RNA site, 100 ng of mtCDR3-end DNA was included, the final concentration was 1x PrimeSTAR Max, 0.3 μM FW-Shuffling-PL, 0.3 μM 50 μL of a PCR reaction solution consisting of NewYtag (cnvK) was prepared. The PCR program was as follows, and steps 1 to 3 were repeated 20 cycles for the former and 10 cycles for the latter.

1.95 °C 10 seconds 2.55 °C 5 seconds 3.72 °C 5 seconds 4.95 °C 10 seconds

Next, prepare 150 μL of a reaction solution containing 37.5 μL of PCR reaction solution with a final concentration of 1x RT-PCR Quick MM and 1.25 mM MgCl ₂ and incubate at 72°C for 10 minutes to perform reverse transcription for the RNA site. was carried out. 1 μL of RNaseH was added to the reverse transcription reaction solution and incubated at 37° C. for 15 minutes to create protruding ends. It was purified using AMPure XP, eluted into 20 μL of UPDW, and the concentration was determined using DS-11+ NanoPad.
A 15 μL reaction solution was prepared containing 1 pmol each of the 5′-side fragment and the 3′-side fragment with overhanging ends, 1×T4 DNA ligation buffer, and 1 μL of T4 DNA ligase, and incubated at 16° C. for 1 hour. A 0.5 μL portion of the ligation product was analyzed on 4% denaturing PAGE containing 8 M urea (60° C., 200 V, 20 minutes) (FIG. 15). In the sample with ligase, a nucleotide encoding a full-length VHH of approximately 500 bp was detected (lane 3).

A 100 μL PCR reaction solution containing the remaining 14.5 μL of the ligation reaction solution with a final concentration of 1x PrimeSTAR Max, 0.3 μM Newleft, and 0.3 μM NewYtag (cnvK) was prepared and dispensed into two 50 μL bottles. The PCR program was as follows, and steps 1 to 3 were repeated for 5 cycles.

1.95℃ 10 seconds 2.65℃ 5 seconds 3.72℃ 10 seconds

The PCR product was purified using AMPure XP and then eluted into 20 μL of UPDW. This PCR product was subjected to 4% PAGE containing 8M urea (60°C, 200V, 25 minutes) to purify the ligation product band. 200 μL of a PCR reaction solution consisting of 1x PrimeSTAR Max containing the entire amount of the PAGE-purified ligation product, 0.3 μM Newleft, and 0.3 μM NewYtag (cnvK) was prepared and dispensed into 4 x 50 μL tubes. The PCR program was as follows, and steps 1 to 3 were repeated for 5 cycles.

1.95℃ 10 seconds 2.65℃ 5 seconds 3.72℃ 10 seconds

The PCR product was purified using AMPure XP and eluted in 30 μL of UPDW.
The prepared library DNA in which random mutations were introduced into CDR3 was analyzed by NGS to evaluate the introduction of mutations. NGS analysis was performed in the same manner as in Example 2. The population of sequences included in the library was confirmed from the number of unique sequence counts, and the top 20 abundances are shown in Table 9. Although the majority were wild type (WT), many sequences with mutations in CDR3 were also confirmed, confirming the construction of a CDR3 mutation library.

Claims (12)

1. PCR is performed on the desired nucleic acid sequence using one or more primer pairs, in which at least one primer is an RNA/DNA chimera primer containing an RNA sequence on the 5' side, and amplification is performed using the desired nucleic acid sequence as a template. a step of creating a fragment;
   Digesting the RNA sequence contained in the amplified fragment by RNaseH treatment to form overhanging ends;
   A method for linking nucleic acids, comprising the step of linking at least two amplified fragments by linking their overhanging ends to create linked nucleic acids.
2. Among the amplified fragments contained in the linked nucleic acids, the forward primer of one of the primer pairs that amplifies adjacent amplified fragments when linked is an RNA/DNA chimera primer, and the other primer is an RNA/DNA chimera primer. 2. The method according to claim 1, wherein the pair of reverse primers is an RNA/DNA chimeric primer, and the RNA sequences contained in the forward primer and the reverse primer have substantially complementary sequences.
3. The method according to claim 1 or 2, wherein the PCR is performed using rTth DNA polymerase.
4. 4. The method of claim 3, wherein the PCR is performed in the presence of Mn2 ⁺ .
5. 4. The method of claim 3, wherein the PCR is performed in the presence of Mg2 ⁺ .
6. The method according to claim 1, wherein the PCR is performed using a DNA polymerase with high replication fidelity or Taq DNA polymerase, and further reverse transcription is performed using rTth DNA polymerase before treatment with RNaseH.
7. 7. The method of claim 6, wherein the reverse transcription is performed in the presence of Mn2 ⁺ .
8. 7. The method of claim 6, wherein the reverse transcription is performed in the presence of Mg2 ⁺ .
9. The method according to claim 6, wherein after PCR and before reverse transcription using rTth DNA polymerase, heating is performed at 80 to 100°C for 10 to 60 seconds.
10. The overhanging ends are ligated using Taq DNA ligase, T4 DNA ligase, and E. 2. The method according to claim 1, wherein the method is carried out with an enzyme selected from the group consisting of E. coli DNA ligase.
11. 5 of the desired nucleic acid sequence, which is amplified by PCR using a primer pair in which at least one of the primers is an RNA/DNA chimera primer containing an RNA sequence on the 5' side. A nucleic acid fragment comprising an RNA sequence derived from said chimeric primer at either the ' or 3' end, or both the 5' and 3' ends.
12. DNA polymerase and
    RNaseH and
    Taq DNA ligase, T4 DNA ligase, and E. and an enzyme selected from the group consisting of E. coli DNA ligase.

Images