JP7029138B2 - A method for producing a linked nucleic acid fragment, a linked nucleic acid fragment, and a library composed of the linked nucleic acid fragment. - Google Patents

Description

The present invention relates to a method for producing a linked nucleic acid fragment, a linked nucleic acid fragment, and a library composed of these linked nucleic acid fragments.

Development of functional proteins is underway in various fields such as pharmaceuticals, foods, and reagents for research and development. In the development of such functional proteins, a technique called "evolutionary engineering" for selecting peptides and protein molecules having a desired function from a group (library) of functional molecules such as various proteins and peptides is available. Has been developed. Among such technologies, there is a display technology in which functional peptide molecules are selected, corresponding nucleic acid fragments such as DNA and RNA are linked to these molecules, amplified, and then their sequences are read by sequencing. Are known.

Nucleic acid fragments used in these display technologies and the like are produced by the following methods. That is, first, a nucleic acid fragment having a specific genetic sequence is replicated by performing a polymerase chain reaction (hereinafter, may be abbreviated as "PCR") from a nucleic acid as a template using a primer, and further these. By ligating the nucleic acid fragments of the above, it is produced as a ligated nucleic acid fragment having a plurality of gene sequences.

As a technique for linking nucleic acid fragments, for example, Patent Document 1 discloses a technique for forming a protruding end at the end of each nucleic acid fragment with a restriction enzyme (hereinafter referred to as "prior art 1"). A restriction enzyme is an enzyme that recognizes a specific base sequence and specifically cleaves the site (hereinafter referred to as "recognized base sequence"). Its recognition base sequence is relatively short, 4 to 6 base pairs. Therefore, since the corresponding recognition base sequence is surely present in the long-chain nucleic acid molecule with a certain probability, there is an advantage that the protruding end can be formed by various nucleic acid molecules.
On the other hand, since the corresponding recognition base sequence is surely present in the long-chain nucleic acid molecule with a certain probability, the nucleic acid fragment may be cleaved at an undesired portion.

In addition, since the number of protruding bases at the protruding ends formed by restriction enzymes is relatively short, fragments that should not be joined may be linked. Further, when a long fragment is formed, the protruding end on the 3'side and the protruding end on the 5'side of the same fragment may be connected to form a ring. That is, when a restriction enzyme is used, it is easy to make a connection error at the time of ligation, and it is difficult to obtain a ligation fragment having a desired sequence.
Therefore, in order to obtain the desired linked nucleic acid fragment with high accuracy in one step, the work of ligating and purifying the fragment to be ligated and then ligating and purifying with the fragment to be ligated is repeated. There is a problem that the work is complicated, inefficient, and costly.

In addition, in order to create a novel functional molecule, it is important to have a random sequence region in which a random mutation is inserted in the linked nucleic acid fragment. For example, in Patent Document 2, a mutation is introduced into the VHH (Variable domain of the heavy-chain of heavy-chain antibody) region of a special antibody having no light chain of camelids such as Bactrian camel, dromedary and llama. A technology has been proposed (hereinafter referred to as "advanced technology 2"). This special antibody has many advantages such as small molecular weight, high thermal stability, and easy modification by protein engineering compared to antibody molecules, so it is expected to be used in various fields. ing.
However, natural VHH has a problem that it cannot recognize low molecular weight compounds having a molecular weight of 1,000 or less and specifically bind them. Therefore, the prior art 2 is a DNA library encoding an antibody capable of binding to a polymer for a small molecule having a molecular weight of 1,000 or less by introducing a mutation into the region of DNA encoding the VHH region of the camel antibody. Discloses the technology for producing.

However, when a restriction enzyme is used to obtain a ligated nucleic acid fragment from a nucleic acid fragment into which a random mutation has been introduced, for example, if the sequence into which the random mutation has been introduced contains a recognition base sequence, the relevant site is the restriction enzyme. Because it is disconnected by, the following problems occur. That is, (1) a linked nucleic acid fragment having the sequence as designed cannot be obtained, and a protein having a function is not produced. (2) the reading frame is shifted due to cleavage by a restriction enzyme, and the produced protein loses its function. (3) When the above phenomena occur, the degree of freedom in library design becomes low and it becomes difficult to maintain diversity, so the quality of the library deteriorates. (4) The degree of freedom in library design Problems such as being restricted can also occur.

In Non-Patent Document 1, inosine is introduced into the primer used in the PCR reaction when preparing a DNA fragment to be introduced into a plasmid vector, and the nucleolytic enzyme Endonuclease V is used instead of the restriction enzyme to end the fragment. Discloses a technique for forming a protruding end (hereinafter referred to as "advanced technique 3"). Here, Endonuclease V is an enzyme that recognizes inosine and cleaves the phosphodiester bond at a position separated from inosine by a specific number of bases.
By utilizing this property, by introducing inosine into a portion other than the target sequence region to be introduced into the plasmid vector, the target sequence region to be introduced into the plasmid vector can be reliably cut out. However, the prior art 3 is a technique for introducing a DNA fragment into a plasmid vector as it is, and does not efficiently connect the DNA fragments to each other.

Japanese Patent Application No. 2014-236045 Japanese Unexamined Patent Publication No. 2016-44126

Baumann et al. BMC Biotechnology 2013, 13:81

The problem to be solved by the present invention is to provide a method for producing a linked nucleic acid fragment that can efficiently and accurately obtain a linked nucleic acid fragment containing a target gene sequence region, and to obtain a target gene sequence region with accuracy. It is an object of the present invention to provide a well-containing linked nucleic acid fragment and a library composed of these linked nucleic acid fragments.

The inventors of the present invention have completed the present invention by proceeding with diligent research under the above circumstances.
That is, in the present invention, a sequence region corresponding to the specific gene sequence region is obtained by performing a polymerase chain reaction using a template nucleic acid containing a specific gene sequence region and a primer in which inosin is introduced at an arbitrary position. A replication step that replicates multiple nucleic acid fragments, including; a protruding end that forms a protruding end with a different number of bases at the end of the nucleic acid fragment using an enzyme that recognizes inosin and breaks down phosphodiester bonds at specific positions. The formation step; includes a linking step of linking nucleic acid fragments to each other using an enzyme that links the protruding ends having the same number of bases with a phosphodiester bond to produce a plurality of linked nucleic acid fragments. A method for producing a restriction enzyme-independent linked nucleic acid fragment.

Here, in the ligation step, it is preferable to ligate nucleic acid fragments having protruding ends having different base numbers in one step. Further, it is preferable that the number of bases at the protruding end is 3 or more and 12 or less, and the difference in the number of bases at the protruding end with different bases is 2 or more.

The introduction position of the inosin is a position corresponding to the third base of the triplet sequence corresponding to the amino acid, and the triplet sequence is a triplet sequence corresponding to the same amino acid even if the third base is changed. It is preferable to further include a primer design step for designing the primer.

The sequence region corresponding to the specific gene sequence region is preferably a random region into which a random mutation is inserted. The enzyme used here that recognizes inosine and degrades the phosphodiester bond at a specific position is preferably any enzyme selected from the group consisting of Endonuclease V and T4 pyrimidine dimer glycosylase (PDG).

The enzyme linked by the phosphodiester bond is preferably any enzyme selected from the group consisting of Taq DNA ligase, T4 DNA ligase and E. coli DNA ligase. Further, in the replication step, it is preferable to use a DNA polymerase that recognizes inosin, and the DNA polymerase is selected from the group consisting of KOD DNA polymerase, KOD-Multi & Epi- and KOD DNA polymerase, and TaKaRa Taq. It is preferably either enzyme.

The template nucleic acid is preferably a DNA sequence encoding an antibody, and the specific gene sequence region is preferably a sequence region encoding a complementarity determining region of an antibody. Further, the specific gene sequence region is preferably a plurality of complementarity determining regions having the same length.

Another aspect of the present invention is a ligated peptide library composed of a ligated peptide encoded by the nucleotide sequence represented by SEQ ID NO: 15 in the sequence listing, wherein in SEQ ID NO: 15, r, b, d, v, k, s, h and s are mixed bases, r means that the appearance rate of A, T, G and C is 25%; b means that the appearance rate of T and C is 50%. Representation; d means that the appearance rate of T and G is 19%, and the appearance rate of C and A is 27%; v means that the appearance rate of T, C and A is 28%, and G The appearance rate of is 16%; k means that the appearance rate of T is 13%, the appearance rate of C is 20%, the appearance rate of A is 35%, and the appearance rate of G is 32%. Representation; h means that the appearance rate of T is 13%, the appearance rate of C is 20%, the appearance rate of A is 35%, and the appearance rate of G is 32%; s is the appearance rate of T and C. Represents a linked peptide library with 37% and an appearance rate of G of 26%. Yet another aspect of the present invention is a ligated peptide library characterized by being composed of peptides having the amino acid sequences represented by SEQ ID NOs: 20 to 59 in the sequence listing .
Yet another embodiment of the present invention is a linked nucleic acid fragment library composed of nucleic acid fragments having the nucleotide sequence represented by SEQ ID NO: 15 in the sequence listing. Here, r, b, d, v, k, s, h and s in SEQ ID NO: 15 are the same as above.
Another aspect of the present invention is a ligated nucleic acid fragment library comprising composed of peptide-encoding nucleic acid fragments having the amino acid sequences represented by SEQ ID NOs: 20-59 in the sequence listing.

INDUSTRIAL APPLICABILITY According to the present invention, a method for producing a linked nucleic acid fragment capable of efficiently and accurately obtaining a linked nucleic acid fragment is provided, and the linked nucleic acid fragment is composed of an efficiently obtained and highly accurate linked nucleic acid fragment and these linked nucleic acid fragments. Library can be provided.

FIG. 1 is a diagram showing an outline of a method for producing a linked nucleic acid fragment of the present embodiment. FIG. 2 is a schematic diagram showing a structural difference between a conventional antibody and a camel antibody. FIG. 3 is a schematic diagram showing the structure of inosine in DNA and the cleavage site of Endonuclease V. FIG. 4 is a table showing triplet sequences corresponding to the same amino acids even if the third base is changed in the triplet sequence.

FIG. 5 is a diagram showing an outline of a method for producing a template nucleic acid (template DNA) of an example. FIG. 6 is a schematic diagram showing the structure of the template nucleic acid (template DNA) of the example. FIG. 7 is a gel electrophoresis photograph showing the results of gel electrophoresis of the obtained template DNA. FIG. 8 is a diagram showing an outline of a method for producing the 1st DNA fragment of the example.

FIG. 9 is a diagram showing an outline of a method for producing a 2nd DNA fragment of an example. FIG. 10 is a diagram showing an outline of a method for producing a 3rd DNA fragment of an example. FIG. 11 is a diagram showing an outline of a method for producing a 4th DNA fragment of an example. FIG. 12 is a gel electrophoresis photograph showing the results of gel electrophoresis of each DNA fragment.

FIG. 13 is a gel electrophoresis photograph showing the results of gel electrophoresis of the 1st DNA fragment having a protruding end. FIG. 14 is a gel electrophoresis photograph showing the results of gel electrophoresis of a 4th DNA fragment having a protruding end. FIG. 15 is a gel electrophoresis photograph showing the results of gel electrophoresis of the 2nd DNA fragment having a protruding end. FIG. 16 is a gel electrophoresis photograph showing the results of gel electrophoresis of a 3rd DNA fragment having a protruding end.

FIG. 17 is a gel electrophoresis photograph showing the results of electrophoresis of each DNA fragment before the formation of the protruding end and each DNA fragment after the formation of the protruding end. FIG. 18 is a diagram showing an outline of the ligation reaction of the examples. FIG. 19 is a gel electrophoresis photograph showing the results of gel electrophoresis of the results of ligation reaction with each DNA fragment before the formation of protruding ends and a predetermined combination. FIG. 20 is a gel electrophoresis photograph showing the results of electrophoresis of the result of ligation reaction by mixing all the DNA fragments after the formation of protruding ends.

FIG. 21 is a diagram showing the base sequence of the unnatural VHH DNA (541 bp) used in the examples. FIG. 22 is a diagram showing the base sequence of restriction enzyme-independent VHH DNA (628 bp) obtained in the examples. FIG. 23 is a list showing the results of sequencing and analysis of the sequences of the construct DNA obtained in the examples. FIG. 24 is a list (continued) showing the results of sequencing and analysis of the construct DNA sequences obtained in the examples.

Hereinafter, a method for producing a linked nucleic acid fragment according to the present invention, an embodiment of a linked nucleic acid fragment and a library composed of these linked nucleic acid fragments will be described with reference to FIGS. 1 to 25.

1. 1. Method for Producing Linked Nucleic Acid Fragment The method for producing the linked nucleic acid fragment of the present embodiment is (a1) a replication step of replicating a plurality of nucleic acid fragments; (a2) a protruding end forming step of forming a protruding end; (a3) a linking step. Includes a ligation step to produce a nucleic acid fragment. Here, in the replication step of (a1), the above-mentioned identification is carried out by performing a polymerase chain reaction (PCR) using a template nucleic acid containing a specific gene sequence region and a primer in which inosine is introduced at an arbitrary position. Multiple nucleic acid fragments containing the sequence region corresponding to the gene sequence region of the gene are replicated. Then, in the protruding end forming step of (a2), an enzyme that recognizes inosine and decomposes a phosphodiester bond at a specific position is used to form a protruding end having a different number of bases at the end of the nucleic acid fragment. do. Then, (a3) the protruding ends having the same number of bases are ligated with an enzyme by a phosphodiester bond to produce a linked nucleic acid fragment.
FIG. 1 shows an outline of a method for producing a linked nucleic acid fragment of the present embodiment.

(1) Replication Step (1-1) Template Nucleic Acid The template nucleic acid containing a specific gene sequence region used in this embodiment is not particularly limited. For example, chemically synthesized non-naturally-derived ones, naturally-derived ones, non-naturally-derived or naturally-derived nucleic acids introduced with mutations at random, and the like can be mentioned.

The template nucleic acid of this embodiment may be DNA encoding an antibody. Further, the antibody may be a VHH antibody (Variable domain of the heavy-chain of heavy-chain antibody) shown in FIG. Here, the VHH antibody is a special antibody having no light chain present in the blood of camelids such as Bactrian camel, dromedary camel, and llama, and is attracting attention as a next-generation antibody. And it is said that the DNA library of VHH antibody is highly useful in industry.

Heavy chain antibodies derived from camel family animals have a Y-shaped structure like immunoglobulin G (hereinafter abbreviated as "IgG"), which is a type of antibody conventionally known, but as shown in FIG. 2, IgG Unlike, there is no light chain and it is composed only of heavy chains. In addition, IgG performs molecular recognition at two V-shaped tips that are bifurcated in a Y-shaped structure, but this heavy chain antibody also performs molecular recognition in the variable regions of two single heavy chain loop structures.

This VHH consists of three CDRs (Complementarity-Determining Regions), which are variable regions and other frameworks, and there are various mutants, but basically they include similar regions. It has become. The chain length of CDR1 and CDR2 is about 8 aa (8 amino acids), while that of CDR3 is relatively long, about 7 to 20 a.a.
VHH has a smaller molecular weight than scFv (Single-Chain Variable Fragment), which is a molecular recognition site of IgG, has high refolding efficiency after heat denaturation, and is easy to chemically modify. Therefore, it has been attracting attention in recent years as a molecule that can be used as a molecular recognition scaffold having a plurality of variable regions such as an antibody and a low molecular weight antibody, and is regarded as a promising molecule that can be used for the development of pharmaceuticals and diagnostic agents. ..

On the other hand, VHH tends to have weak molecular recognition for small molecules such as sugar chains, especially small molecules such as MW <1,500 Da, due to the lack of the heavy chain light chain interface of conventional antibodies. There is. When VHH recognizes a molecule, the protein formed by the three CDRs recognizes and captures this molecule in a configuration that pinches the target molecule with three fingers. However, because the lengths of the CDRs are different, it is difficult to capture the small molecule compound, and as a result, the molecular recognition ability is lowered.

In order to improve these weaknesses of VHH, as the template nucleic acid of the present embodiment, for example, the lengths of CDR1 and 2 are extended so that the three CDRs of VHH described above are substantially equal to the length of the longest CDR3. The use of DNA fragments with improved cognitive ability for small molecules can be mentioned. For example, a DNA fragment having the same length of CDR1 = CDR2 = CDR3 = 16a.a, which does not exist in nature, can be used as a template nucleic acid. This is because the cognitive ability of small molecule compounds can be improved by including three CDRs having the same length.

(1-2) Design of primer containing inosine In the replication step of this embodiment, a polymerase chain reaction is carried out using a primer in which inosine is introduced at an arbitrary position. In this example, a primer containing inosine is designed, and four types of DNA fragments containing inosine are prepared using the primer.

The following points need to be considered when designing the primer.
(I) When inosine is inserted into the primer during PCR, the base appearing at the complementary position is cytosine (sequence notation is C) in most cases (C> A = T >>> G).
(Ii) Consider the cleavage position of the nucleolytic enzyme that can be used in the protruding end forming step.
For example, the cleavage site of Endonuclease V that can be used as a nucleolytic enzyme cleaves the second and third phosphodiester bonds on the 3'side of inosine with an efficiency of 95% and 5%, respectively, as shown in FIG. ..

In consideration of the above points, inosine is inserted at an appropriate position so that amino acids can be accurately reproduced during translation. Specifically, in the present embodiment, in the primer design step, the introduction position of inosin is the position corresponding to the third base of the triplet sequence corresponding to the amino acid, and the triplet sequence is the same even if the third base changes. It is preferable to design the primer so that it has a triplet sequence corresponding to the amino acid of. In the present embodiment, the first base, the second base, and the third base of the triplet sequence refer to the bases located at the first, second, and third positions, respectively, counting from the 5'end side of the triplet.

FIG. 4 shows a triplet encoding an amino acid in which the translated amino acid does not change even if the third base of the triplet is replaced with another base (amino acid enclosed in the frame in the figure). For example, the amino acid represented by the triplet of ACX is threonine regardless of whether X = A, G, C, or T. Therefore, it is preferable to insert inosine at the position of the third base of the triplet of the primer encoding threonine when translated. By designing a primer in which inosine is introduced at such a position, the reading frame does not shift, so that the amino acid can be accurately expressed from the obtained linked nucleic acid fragment.

When designing a primer or preparing a template nucleic acid, it is also possible to include a random region in which a random mutation is inserted in the sequence region corresponding to a specific gene sequence region.
Here, the ratio of amino acids appearing in the random region can be arbitrarily set, and for example, all amino acids can be set to appear. It is also possible to reduce the appearance ratio of cysteine. When cysteine appears frequently, it forms disulfide bonds within or between molecules, which may affect the three-dimensional structure of VHH, and the formation of such a three-dimensional structure reduces the function of the obtained protein. Is also directly connected. This is because it is effective to reduce the appearance ratio of cysteine in order to suppress this. Furthermore, in order to ensure the diversity of random regions, it is preferable to reduce the appearance ratio of stop codons.

When the template nucleic acid replicated by PCR is, for example, DNA having CRD1 to 3 encoding a VHH antibody as described above, as shown in FIG. 1, a fragment containing CDR1 and 2, a fragment containing CDR3, and both ends. It is preferable to design a primer that replicates so that fragments of the above, that is, four types of fragments, are formed.

In order to design a primer for replicating four types of fragments, a primer capable of forming a protruding end such that a different number of bases protrudes at the end of each fragment in the protruding end forming step described later is provided for each fragment. It is preferable to design. This is because by forming such a protruding end, it is possible to reduce the probability that a connection error will occur when the fragments are connected to each other at the protruding end.

The protruding ends with different base numbers are defined as follows. Taking the case of preparing four types of nucleic acid fragments (first to fourth fragments) as an example, there are three types of protruding ends to be linked (between the first fragment and the second fragment, the second fragment). -The protruding end connecting the third fragment and the fourth fragment), which means that the number of bases at the protruding end at these three cutting positions is different. In addition, it is necessary that the number of bases of each protruding end to be linked and the number of bases of the protruding end paired with each other are the same.

In order to design the primer so that the number of bases at the protruding end of each fragment is different, it is preferable to adjust the inosine introduction site while paying attention to the above points. In the present embodiment, since an enzyme that recognizes inosine and decomposes the phosphodiester bond at a specific position is used in the protruding end forming step described later, the base sequence can be cleaved at an arbitrary position by adjusting the introduction position of inosine. .. Therefore, it is possible to design a primer that specifies the cutting position of each fragment so that the number of bases at the protruding end is different.

The primer may be designed so that the number of bases at the different protruding ends is, for example, 6 bases or more and 12 bases or less, and the difference in the number of bases at the protruding ends having different base numbers is 3 bases or more. preferable. In particular, since the protruding ends having different base numbers of 9 bases and 12 bases include the number of bases at the protruding ends that are not formed by a natural restriction enzyme, it becomes easier to connect them more accurately. Since the difference in the number of bases at the protruding end is preferably 3 bases or more, when CDR1 to CDR3 are included in separate fragments, three types of protrusions having three different base numbers: 6 bases, 9 bases, and 12 bases. It is preferably a fragment having an end.

(1-3) Polymerase chain reaction (PCR reaction)
By performing a polymerase chain reaction using the above-mentioned primers, it is possible to replicate a plurality of nucleic acid fragments containing a sequence region corresponding to the specific gene sequence region.
PCR can be carried out by a conventional method using, for example, any conditions, reagents, and devices other than those shown in Examples described later.

In this embodiment, since a primer containing inosine is used in the PCR reaction, the amplification factor by PCR may be very low or may not be amplified. Therefore, it is preferable to select and use a DNA replication enzyme (DNA polymerase) capable of reliably recognizing inosine and capable of efficient and accurate amplification.

Normally, the DNA polymerase used for PCR recognizes four common nucleobases, adenine, thymine, guanine, and cytosine (the notations in the sequence are A, T, G, and C, respectively), and DNA strands. However, when a primer containing a "special" base such as inosin is used in the sequence, the amplification factor by PCR may be very low or may not be amplified. Therefore, in order to maintain the fidelity of replication, it is preferable to use a DNA polymerase capable of recognizing inosine and capable of efficient and accurate amplification.

Examples of such a DNA polymerase include KOD DNA polymerases such as KOD-Multi & Epi- (manufactured by TOYOBO) and other polymerases, and it is preferable to use KOD DNA polymerase because of its high heat resistance.

(2) Overhanging end formation step In this step, different bases are attached to at least one end of the duplicated nucleic acid fragment as described above by using an enzyme that recognizes inosine and decomposes the phosphodiester bond at a specific position. Form a protruding end of a number.

Enzymes that recognize inosine and break down phosphodiester bonds at specific positions include, for example, Endonuclease V and other endonucleases.

In the protruding end forming step, for example, Endonuclease V is added to the DNA fragment obtained by the PCR reaction under any other conditions shown in Examples described later, and the temperature is set to a predetermined temperature (for example, 37 ° C.) for a predetermined time. It can be allowed to stand (eg, 1 hour) to cleave a DNA fragment containing inosine.

In the protruding end forming step, since the fragment is replicated using the primer as described above, the protruding end can be freely formed at an arbitrary position. For example, when four types of nucleic acid fragments (first to fourth fragments) are obtained by the above-mentioned PCR reaction, there are three types of protruding ends connecting each fragment, and the three protruding ends are connected. It is preferable to form protruding ends having different numbers of bases.

A commonly used restriction enzyme, if a specific base sequence is present, cleaves the base sequence at that position. Therefore, for example, if such a base sequence exists in a random region, the base sequence is cleaved there, so that a fragment containing the target base sequence region cannot be obtained. On the other hand, Endonuclease V recognizes inosine and cleaves the bond between specific bases at a specific number of positions away from inosine, so that the bond between bases is cleaved at the place where inosine is not introduced. There is no. Therefore, in the protruding end forming step of the present embodiment, by setting the position where inosine is incorporated to a region other than the target random region, cleavage does not occur in the region of the target base sequence, and the purpose is efficient and accurate. Fragments are obtained.

(3) Linking Step In the linking step, a plurality of nucleic acid fragments are definitely linked to each other by using an enzyme formed at the protruding end and linking the protruding ends having the same number of bases by a phosphodiester bond. Produce a ligated nucleic acid fragment.

Examples of the enzyme that connects the protruding ends having the same number of bases include Taq DNA ligase and other ligases, and it is preferable to use Taq DNA ligase. Taq DNA ligase is an enzyme that catalyzes the phosphodiester bond between the 5'end phosphate group and the 3'end hydroxyl group of two complementary DNAs, and the base sequence is completely paired. The ligation reaction occurs only when there is no gap, that is, when the sequences are completely complementary. Therefore, the protruding ends can be connected more accurately.

For example, as described above, when ligating fragments in which protruding ends having three different base numbers of 6 bases, 9 bases and 12 bases are formed, protruding ends that are not formed by natural restriction enzymes are formed. Since they satisfy the above-mentioned ligation reaction, they can be ligated with high accuracy.

That is, in the connection step, even if fragments having protruding ends composed of different base numbers are mixed, the probability that a connection error will occur when connecting the fragments is extremely low. Therefore, for example, four types of nucleic acid fragments can be ligated at one time.
Thereby, by mixing all the fragments and mixing with the enzyme to carry out a ligation reaction, a ligated nucleic acid fragment can be obtained by one ligation reaction.

2. 2. Nucleic acid library composed of linked nucleic acid fragments A DNA library can be constructed using the linked nucleic acid fragments obtained as described above.
As the linked nucleic acid fragment of the present embodiment, for example, when random mutations are introduced into CDR1, CDR2, and CDR3 of the VHH antibody as described above, and one having CDR1 to CDR3 of the same length that does not exist in nature is used. Will be described below by taking as an example.
By constructing a non-natural VHH DNA library from such a linked nucleic acid fragment, it becomes possible to obtain a novel antibody that does not exist in nature and has high recognition ability even for small molecules.

By analyzing the obtained linked nucleic acid fragment by direct sequencing and confirming the presence or absence of mutation, it is possible to construct a restriction enzyme-independent DNA library that is more accurate and maintains diversity.

The library consisting of linked nucleic acid fragments of the present embodiment can also be applied to, for example, display technology. As such a display, a cell demanding display such as a cell surface layer display and a phage display, and a cell non-demanding display such as a ribosome display, an mRNA display, and a cDNA display are known.
Above all, in order to efficiently obtain a novel VHH antibody which is a target peptide, it is preferable to apply cDNA display technology. That is, the cDNA display technology can screen a specific VHH antibody gene from the library of the present embodiment and efficiently produce a large amount of VHH antibody based on the obtained VHH antibody gene.

Examples of the use of the library in the cDNA display include the following methods.
First, an mRNA having a desired sequence is obtained from a library consisting of ligated nucleic acid fragments, and an mRNA-linker in which this mRNA and a linker are bound is obtained. The mRNA-linker is then cell-free translated to obtain the mRNA-mutation-introduced antibody. Then, the mRNA-mutation-introduced antibody is immobilized on a solid phase such as beads to obtain a solid-phase-bound mRNA-mutation-introduced antibody. Subsequently, the solid phase-bound mRNA-mutation-introduced antibody is reverse-transcribed to obtain an mRNA-linker-cDNA-mutation-introduced antibody conjugate to obtain a cDNA display released from the solid phase.

Then, the DNA encoding the mutagenesis antibody is selected from the cDNA display by the affinity selection by the fusion protein on the C-terminal side of the antibody coding region, and the DNA encoding the selected mutagenesis antibody is amplified by PCR.
In this way, a cDNA library or peptide library can be constructed by repeating the selection process of generating the displayed cDNA or peptide and identifying the sequence.

The method for producing a linked nucleic acid fragment, the linked nucleic acid fragment, and the nucleic acid library composed of the linked nucleic acid fragment according to the present embodiment are as described above, but the embodiments disclosed this time are exemplary in all respects. It should be considered that it is not restrictive. The scope of the present invention is shown by the scope of claims, not the above description, and is intended to include all modifications within the meaning and scope equivalent to the scope of claims.

Next, examples of the present invention will be described. The present invention is not construed as being limited to the following examples.

(Example 1)
1. 1. Preparation of Restriction-Independent VHH DNA Fragment In this example, a restriction enzyme-independent VHH DNA fragment was prepared.

(1) Template DNA
The Flag-tag sequence was inserted into an unnatural VHH cloned DNA (541 bp) owned by Saitama University Nemoto Laboratory to prepare a template VHH DNA (574 bp). This is because when the VHH DNA described later is divided into four types of DNA fragments, the reaction with the PCR Clean UP Mini Kit (manufactured by Favorgen) cannot be performed unless the chain length of the 4th DNA fragment is less than 100 bp. Because. Therefore, in order to extend the chain length of the 4th DNA fragment, the Flag-tag sequence generally used when purifying an antibody was introduced. Table 1 shows the PCR reaction composition of the mold preparation.

The unnatural VHH cloned DNA (541 bp) used is shown in SEQ ID NO: 1. Further, the Flag-tag insertion primer for introducing the Flag-tag sequence is shown in SEQ ID NO: 2, and the New Left is shown in SEQ ID NO: 3. In the following SEQ ID NO: 1, the consecutive notation of N represents CDR.

[SEQ ID NO: 1]
GATCCCGCGA AATTAATACG ACTCACTATA GGGGAAGTAT TTTTACAACA ATTACCAACA ACAACAACAA ACAACAACAA CATTACATTT TACATTCTAC AACTACAAGC CACCATGGGC GAGGTGCAGC TGGTGGAGAG CGGAGGAGGA TCCGTGCAGG CTGGAGGAAG CCTGCGCCTG AGCTGCGCTG CTAGCGGANN NNNNNNNNNN NNNNNNNNNN NNNNNTGGTT CCGCCAGGCT CCTGGAAAGG AGCGCGAGGG AGTGNNNNNN NNNNNNNNNN NNNNNNNNAC CTACTACGCT GACAGCGTGA AGGGACGCTT CACCATCAGC CAGGACAACG CCAAGAACAC CGTGTACCTG CAGATGAACA GCCTGAAGCC TGAGGACACC GCTATCTACT ACTGCGCTGC TNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN TACTGGGGAC AGGGAACCCA GGTGACCGTG GGAGGAGGCA GCCATCATCA TCATCATCAC GGCGGAAGCA GGACGGGGGG CGGCGGGGAA A

[SEQ ID NO: 2]: Flag-tag insertion primer (82 mer)
5'-AAAGGTGCGGCGGGGGGCAGGACGATGGTGGGAACAGTAGCAGTAGGAACATCAGCGAAGGCGGCACTACTACTACTACTAC-3'

[SEQ ID NO: 3]: Newleft (33 mer)
GATCCCGCGAAATTAATACGACTCACTATAGGG

The DNA fragments shown in SEQ ID NOs: 1 to 3 were prepared as PCR reaction solutions having the compositions shown in Table 1. The PCR program was as follows, and steps 1 and 2 were repeated for 25 cycles.
1.98 ° C 2 minutes 2.98 ° C 10 seconds 3.66 ° C 10 seconds 4.72 ° C 1 minute 5.72 ° C 2 minutes 6.10 ° C

By performing the above PCR program, template VHH DNA as shown in FIGS. 5 and 6 was obtained. The obtained template VHH DNA was subjected to gel electrophoresis (200 V, 50 minutes) to confirm the upshift of the band of VHH cloned DNA. A 100 bp DNA ladder (manufactured by Promega) was used as a marker, and unnatural VHH cloned DNA (541 bp) was placed in the first lane and a PCR product was placed in the second lane for migration.

As shown in FIG. 7, the PCR product (third lane) showed a band at the position of 574 bp, confirming that the Flag-tag sequence could be inserted. This is column-purified once to remove unnecessary primers. Then, full-length PCR was performed and replicated. Gel electrophoresis was performed by the following method.

(Creation of modified polyacrylamide gel)
Clean the two glass plates (one with spacers) and the gasket with 70% ethanol and dry. After drying, insert a gasket between the two glass plates and clip it from the left and right to fix it. The comb that creates the lane to which the sample is applied should also be washed with 70% ethanol.

The 4% acrylamide gel solution was adjusted as follows. 4.8 g of urea, 1 mL of 5X TBE, and 1 mL of 40% acrylamide solution were mixed and adjusted to 10 mL with ultrapure water. To this, add 25 μL of APS (Ammonium peroxodisulfate: ammonium peroxodisulfate) and 10 μL of TEMED (N, N, N, N-Tetramethy-ethylenediamine: N, N, N, N-tetramethylethylrangeamine) immediately. It was agitated and poured between the glass plates fixed with clips, and the comb was inserted. After that, it was allowed to stand for about 30 minutes until the polymerization reaction of acrylamide was completed.

(Electrophoresis)
Place 0.5X TBE in the lower layer of the electrophoresis tank and circulate in a constant temperature bath at 60 ° C. After the polymerization reaction is completed, remove the left and right clips and combs, wash away the acrylamide fragments that interfere with the migration with spartel and water, and then set them in the electrophoresis tank device. A 0.5X TBE was also placed in the upper layer of the electrophoresis tank, and pre-running was performed for 9 minutes.

Mix 2X Loading buffer with the sample to a concentration of 1X and denature at 85 ° C. for 3 minutes. After that, the urea precipitate was blown off from the lane of the acrylamide gel after pre-running by a water stream, and the sample was applied. Then, electrophoresis was performed at a constant voltage of 200 V for an arbitrary time.

(Analysis by imager)
After the electrophoresis is complete, the polyacrylamide gel is removed from the device and the nucleic acid is stained by direct application with 104-fold diluted SYBR Gold. After that, polyacrylamide gel was placed on a glass plate and analyzed by an imager (Typhoon FLA 9500, manufactured by GE Healthcare Japan).

(2) Primer design Primers having a constant sequence (SEQ ID NOs: 3 and SEQ ID NO: 4), inosine-introduced primers (SEQ ID NOs: 5 to 10), and primers having inosine and a random region (SEQ ID NOs: 11 to 13) are prepared. (See Table 2).

(3) Preparation of DNA Fragment Four types of DNA fragments (1st DNA fragment to 4th DNA fragment) were prepared by performing PCR using each of the above primers.

(3-1) 1 ^st DNA fragment
The PCR reaction solution for preparing the 1st ^DNA fragment was adjusted to the composition as shown in Table 3. The PCR program was as follows, and steps 2 and 3 were repeated for 25 cycles. KOD-Multi & Epi- was used as the DNA polymerase, and 2X PCR Buffer for KOD -Multi & Epi- (manufactured by TOYOBO) was used as the buffer. The outline of the preparation of the 1st ^DNA fragment is shown in FIG.

1.94 ° C 2 minutes 2.98 ° C 10 seconds 3.68 ° C 5 seconds 4.68 ° C 2 minutes 5.10 ° C

(3-2) 2nd ^DNA fragment
The PCR reaction solution for preparing the 2nd DNA fragment was adjusted to the composition as shown in Tables 4 and 5. The PCR programs were as follows, and steps 2 to 4 were repeated for 25 cycles.
1.94 ° C 2 minutes 2.98 ° C 10 seconds 3.62 ° C 5 seconds 4.68 ° C 105 seconds 5.68 ° C 2 minutes 6.10 ° C

KOD-Multi & Epi- was used as the DNA polymerase, and 2X PCR Buffer for KOD -Multi & Epi- (manufactured by TOYOBO) was used as the buffer. The outline of the preparation of the 2nd ^DNA fragment is shown in FIG.

(3-3) 3rd ^DNA fragment
The PCR reaction solution for preparing the 3rd ^DNA fragment was adjusted to the composition as shown in Table 6. The PCR program was as follows, and steps 2 to 4 were repeated for 25 cycles. 1.94 ° C 2 minutes 2.98 ° C 10 seconds 3.60 ° C 5 seconds 4.68 ° C 10 seconds 5.68 ° C 2 minutes 6. 10 ° C

KOD-Multi & Epi- was used as the DNA polymerase, and 2X PCR Buffer for KOD -Multi & Epi- (manufactured by TOYOBO) was used as the buffer. The outline of the preparation of the 3rd ^DNA fragment is shown in Fig. 10.

(3-4) 4th ^{DNA Fragment} The PCR reaction solution for preparing the 4th DNA fragment was adjusted to the composition as shown in Table 7. The PCR programs were as follows, and steps 2 to 4 were repeated for 25 cycles.
1.94 ° C 2 minutes 2.98 ° C 10 seconds 3.66 ° C 5 seconds 4.68 ° C 10 seconds 5.68 ° C 2 minutes 6.10 ° C

As the DNA polymerase, KOD-Multi & Epi- and 2X PCR Buffer for KOD -Multi & Epi- (manufactured by TOYOBO) were used. The outline of the preparation of the 4th ^DNA fragment is shown in FIG.

Each of the obtained DNA fragments was subjected to gel electrophoresis (200 V, 20 minutes) in the same manner as described above, and the band upshift of each fragment was confirmed. A 100 bp DNA ladder (manufactured by Promega) was used as a marker, and PCR products using the 1st to 4th DNA fragments were flowed in the 1st to 4th lanes, respectively.
As shown in Fig. 12, it was confirmed that the desired DNA fragments were successfully synthesized. These DNA fragments were increased to a 500 μL scale (50 μL × 10) and PCR was performed. Further, ethanol precipitation and column purification using the same method as above were performed to obtain four types of DNA fragments.

(4) Formation of protruding ends by Endonuclease V
Using the reaction compositions shown in Tables 8 and 9 in which Endonuclease V (manufactured by NEB) and 10X NE Buffer 4 (manufactured by NEB) were added to the four types of DNA fragments obtained by PCR, the mixture was allowed to stand at 37 ° C. for 1 hour. A DNA fragment containing inosine was cleaved. Since the 2nd ^DNA fragment and the 3rd ^DNA fragment are designed to contain two inosine in each sequence, the number of Endonuclease V units (enzyme amount) in the reaction composition in Table 8 is doubled. And reacted.

After that, 8 M urea (special grade, manufactured by Wako Pure Chemical Industries, Ltd.) was added so that the ratio of the amount of the enzyme-treated reaction solution was 9: 1 (final concentration 7.2 M), and the temperature was 42 ° C. for 0 minutes and 5 minutes. The DNA was denatured by allowing it to stand for 10 minutes, 20 minutes, and 30 minutes, respectively. A short DNA fragment containing cleaved inosine was removed using a PCR Clean UP Mini Kit (manufactured by Favorgen) to obtain a DNA fragment having a protruding end.

After forming the protruding end, each DNA fragment was subjected to gel electrophoresis (200 V, 150 minutes) in the same manner as described above, and the band upshift of each fragment is shown in FIGS. 13 to 16. A 100 bp DNA ladder (manufactured by Promega) was used as a marker.
FIG. 13 shows the results of electrophoresis of the 1st DNA fragment, FIG. 14 shows the 4th DNA fragment, FIG. 15 shows the 2nd DNA fragment, and FIG. 16 shows the results of electrophoresis of the 3rd DNA fragment. In addition, FIG. 17 shows the band upshift of each DNA fragment before the formation of the protruding end and each DNA fragment after the formation of the protruding end by electrophoresis.

As shown in FIGS. 13 to 16, it was confirmed that each fragment was cleaved with a short DNA fragment containing inosine by Endonuclease V. From the results shown in FIGS. 14 to 17, the 1st DNA fragment has 6-base protruding ends, the 2nd DNA fragment has 6-base and 12-base protruding ends, and the 3rd DNA fragment has 12-base and 9-base protruding ends. It was confirmed that the terminal was formed, and the protruding end of 9 bases was formed in the 4th DNA fragment.
That is, it was confirmed that each fragment was cleaved at the site adjusted with the inosine introduction primer, and it was confirmed that the number of overhanging bases could be adjusted at both ends of the DNA fragment.

For urea treatment, the time condition was changed from 5 minutes to 30 minutes, and DNA denaturation was observed at a temperature condition of 42 ° C. and 8 M urea (final concentration 7.2 M). As shown in FIGS. 13 and 14, there was no change in the urea treatment time between the 1st ^DNA fragment and the 4th ^DNA fragment, but as shown in FIG. 15, the urea treatment time was 30 for the 2nd ^DNA fragment. In minutes, the 168 bp band was thickened by removing the 12-base DNA fragment.
From this, in the 1st ^DNA fragment and the 4th ^DNA fragment, the DNA fragment removed by denaturation is relatively short at 6 bases and 9 bases, so it is not necessary to denature with urea, and relatively like 12 bases. It was suggested that when making long overhangs, urea treatment may improve the yield of DNA with overhangs.

(5) Linkage reaction The DNA fragments forming the above four types of protruding ends were combined, and a ligation reaction was carried out using Taq DNA ligase and 10 X Taq DNA ligase reaction buffer (manufactured by NEB), respectively.
First, each DNA fragment was mixed to prepare a reaction composition shown in Table 10, and the mixture was allowed to stand at 45 ° C. for 30 minutes to carry out a ligation reaction. Furthermore, DNA fragments forming four types of protruding ends were mixed together, and the reaction composition shown in Table 11 was allowed to stand at 45 ° C. for 30 minutes for a ligation reaction to synthesize unnatural VHH DNA. .. The outline of the ligation reaction is shown in FIG.

The linked DNA fragments subjected to each ligation reaction were electrophoresed to confirm the band upshift of each fragment. FIG. 19 shows the electrophoresis results of each DNA fragment before the formation of the protruding end and the result of the ligation reaction with the following combinations. A 100 bp DNA ladder (manufactured by Promega) was used as a marker, and each DNA fragment before the formation of the protruding end was used in the first to fourth lanes, and the above a to f were used in the fifth to tenth lanes. The result of the ligation reaction in combination was placed and run.

a: Combination of 1st ^DNA fragment and 2nd ^DNA fragment with protruding end formation,
b: Combination of 2nd ^DNA fragment and 3rd ^DNA fragment with protruding end formation,
c: Combination of 3rd ^DNA fragment and 4th ^DNA fragment with protruding end formation,
d: Combination of 1st ^DNA fragment and 3rd ^DNA fragment with protruding end formation,
e: Combination of 1st ^DNA fragment and 4th ^DNA fragment with protruding end formation,
f: Combination of 2nd ^DNA fragment and 4th ^DNA fragment with protruding end formation

From the results shown in FIG. 20, it was confirmed that the ligation reaction was performed only in the combinations (a, b, c) having the same number of overhanging bases. From this, it is considered that a ligation reaction with higher specificity can be performed as compared with the restriction enzyme.

In addition, FIG. 20 shows the reaction time of the product obtained by mixing all the DNA fragments after the formation of the protruding end and performing the ligation reaction between 30 minutes and 120 minutes, and PCR of all the ligation reactions described above. The electrophoresis results of the products (5 cycles, 8 cycles) amplified by the above are shown. A 100 bp DNA ladder (manufactured by Promega) was used as a marker.

From the results shown in FIG. 21, the presence of the result of the ligation reaction could not be confirmed by electrophoresis in the undiluted solution of the DNA fragment mixture in which the ligation reaction was performed, but when full-length PCR was performed using the mixture, 8-cycle replication was performed. The ligation reaction result was confirmed by. That is, it was confirmed that the synthesis of long-chain DNA could be achieved by linking four types of DNA fragments at once. From the band intensity ratio, the ligation efficiency of long-chain DNA was 5.9%.

(6) Sequence analysis A full-length ligation reaction was performed, and the synthesized VHH DNA was subjected to full-length PCR, and the obtained PCR product was analyzed by direct sequencing. The following 7 items were confirmed.
a: A tailing of the ligated DNA b: Insertion of DNA into the vector c: Transformation of the vector into E. coli d: Plate culture e: Confirmation by colony PCR f: Liquid culture and purification g: Analysis

Each method is described in detail below.
a: A tailing of the ligated DNA For the A tailing of the ligated DNA, one base of A was added to the 3'end by PCR with Ex Taq. This enables insertion into a vector such as pGEM-T Easy Vector in which one base of T is added to the 3'end. The reaction composition and reaction conditions are shown below.

The PCR program was as follows, and steps 2 and 3 were repeated for 25 cycles.
1.98 ° C 2 minutes 2.98 ° C 10 seconds 3.66 ° C 5 seconds 4.72 ° C 1 minute 5.72 ° C 2 minutes 6.10 ° C

b: Insertion of DNA into the vector To insert the ligated DNA into the vector, pGEM-T Easy Vector system (pGEM-T Easy Vector, T4 DNA ligase, 2X Rapid Ligation Buffer, T4 DNA: manufactured by Promega) ) Was used.
First, the tube containing the pGEM-T Easy Vector was centrifuged, and the vector was collected at the bottom of the tube. Next, the reaction solutions shown in Table 13 were prepared. Finally, the reaction solution was stirred by pipetting and incubated at room temperature for 1 hour.

c: Transformation of vector to E. coli
The vector into which the DNA was inserted was incorporated into competent cell DH5α. First, the reaction solution after incubation was centrifuged and the vector was collected at the bottom of the tube. Next, 2 μL of this reaction solution was placed in a tube placed on ice, and 50 μL of competent cell DH5α melted on ice was added and mixed. The mixed solution was lightly stirred and then allowed to stand on ice for 20 minutes. After 20 minutes, the tube was placed on a constant temperature plate at 42 ° C. for 45 seconds to give heat shock to the competent cells, and then immediately returned to ice and allowed to stand for 2 minutes. After 2 minutes, 950 μL of SOC medium at room temperature was added, mixed, and incubated at 37 ° C. for 1.5 hours with shaking.

d: Plate culture In plate culture, first, a plate medium having the composition shown in Table 14 was prepared. The plates were then seeded with transformed E. coli and incubated overnight at 37 ° C. The materials in the table are Bacto-tryptone (manufactured by Becton), Bacto-yeast extract (manufactured by Becton), NaCl (special grade, manufactured by Wako Pure Chemical Industries, Ltd.), and agar (special grade, manufactured by Wako Pure Chemical Industries, Ltd.). board.

e: Confirmation by colony PCR In the confirmation by colony PCR, the colony obtained by plate culture is inserted as a template for PCR, PCR is performed, and the target DNA is inserted into the vector contained in the colony for electrophoresis. I checked if it was there. The composition of the PCR reaction solution and the PCR cycle conditions are shown below.

The PCR program was as follows, and steps 2 to 4 were repeated for 25 cycles.
1.94 ° C 2 minutes 2.98 ° C 10 seconds 3.55 ° C 10 seconds 4.68 ° C 36 seconds 5.68 ° C 1 minute 6.10 ° C Stand still

f: Liquid culture and purification First, Escherichia coli in which DNA insertion was confirmed by colony PCR was cultured in a liquid medium having the composition shown below. The vector was then purified using a plasmid DNA Extraction Mini Kit (manufactured by Favorgen).

g: Analysis Requested sequence analysis by sending a solution of the specified composition to Eurofins Genomics. As a result, a DNA sequence having a total length of 628 bp as shown in SEQ ID NO: 14 could be read.

[SEQ ID NO: 14]
GATCCCGCGA AATTAATACG ACTCACTATA GGGGAAGTAT TTTTACAACA ATTACCAACA ACAACAACAA ACAACAACAA CATTACATTT TACATTCTAC AACTACAAGC CACCATGGGC GAGGTGCAGC TGGTGGAGAG CGGAGGAGGA TCCGTGCAGG CTGGAGGAAG CCTGCGCCTG AGCTGCGCTG CTAGCGGANN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNTGGT TCCGCCAGGC TCCTGGAAAG GAGCGCGAGG GAGTGNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNACCTACT ACGCCGACAG CGTGAAGGGA CGCTTCACCA TCAGCCAGGA CAACGCCAAG AACACCGTGT ACCTGCAGAT GAACAGCCTG AAGCCAGAGG ACACCGCTAT CTACTACTGC GCTGCTNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNNNNNNN NNNNTACTGG GGCCAGGGCA CCCAGGTGAC CGTGGGAGGA GGCAGCCATC ATCATCATCA TCACGGCGGA AGCGACTACA AGGATGACGA TGACAAGGGT GGTAGCAGGA CGGGGGGCGG CGTGGAAA

It was confirmed that in the eight samples that could be read correctly, only one mutation occurred at a position that was not a mutation due to inosine substitution. In this mutation, C at position 426 was mutated to T, but there was no change in the amino acid (proline) expressed by this mutation. The base appearing at the complement of the position where inosine was inserted was cytosine, but none of the expressed amino acids changed.
From the above, it was confirmed that the restriction enzyme-independent DNA library was successfully prepared.

As shown in FIGS. 21 and 22, in the base sequence of the restriction enzyme-independent DNA (628 bp) obtained by the above method, DNA fragments having the same length of CDR1 to CDR3 (indicated by N), which do not exist in nature, are equal. was gotten.

(Example 2)
2. 2. Preparation and Selection of Library by cDNA Display A cDNA display molecule was obtained from the restriction enzyme-independent DNA library obtained by the same method as in Example 1 above, and selection was performed to further prepare a library.

(1) Fragment for construct for cDNA display A full construct DNA of VHH having the following sequence was obtained by the same method as in Example 1 above. In the following sequences, r, b, d, v, k, s, h and s are abbreviations indicating mixed bases, respectively. In r, the ratios of A, T, G, and C are 25% each, and in b, T and C are 50% each. Further, d is 19% for T and G, 27% for C and A, and v is 28% for T, C and A and 16% for G. k is 13% for T, 20% for C, 35% for A, 32% for G, and h is 24% for T and G, 22% for C, 30% for A, and s is. , T and Cga 37%, G is 26%.

[SEQ ID NO: 15]
5'--3'

(2) Selection of full-length VHH-encoded DNA In order to remove incomplete VHH-encoded DNA due to frameshifting due to insertion, deletion, etc., or the appearance of stop codons, the obtained VHH-encoding library is used. Once, it was converted into a cDNA display and purified by His-tag. The specific procedure is shown below.

(2-1) Transcription of library DNA Transcription was performed on a 20 μL scale using 2.34 pmol of dsDNA according to the protocol attached to the Promega kit (RiboMAX Large Scale RNA Production Systems-T7). After incubating at 37 ° C for 2 hours, 1 μL of the DNAse (RQ1 DNAse) included in the above kit was added to this system, and the mixture was further incubated at 37 ° C for 15 minutes. The synthesized mRNA was purified using the After Tri-Reagent RNA Clean-Up Kit (manufactured by Favogen).

Modified oligonucleotides used to make the Short Biotin-segment Puromycin (SBP) -linker used below, "Puromycin Segment (PS)", and "Short Biotin". "Segment (SBS)" was obtained from Geneworld (Tokyo, Japan). This PS has the following structure.

5'-(S) -TC (F)-((Spc18) x4) -CC- (Puro) -3'

Here, (S) represents 5'-thiol modifier C6, and (F) represents fluorescein-dT. (Puro) represents puromycin CPG and (Spc18) represents spacer phosphoramidite 18. In addition, the SBS has the following structure.

[SEQ ID NO: 16]
5'-CC- (rG) C (TB) C (rG) ACCCCGCCGCCCCCCG (T) CCT-3'

Here, (T) represents the amino modifier C6dT, and (TB) represents biotin-dT. (RG) represents revolving G. EMCS was purchased from Dojin Kagaku (Kumamoto, Japan). The B domain of protein A was obtained from pEZZ 18 protein A gene fusion vector (manufactured by GE Healthcare). The forward primer contained the T7 promoter, the "omega" 5'-untranslated region of tobacco mosaic virus, the Kozak sequence, and the ATG start codon. Reverse primers are hexahistidine tag, spacer sequence (GGGGGAGGCAGC: SEQ ID NO: 17), and complementary sequence ligable between mRNA and puromycin linker DNA at the 3'end of puromycin linker DNA (AGGACGGGGGGCGGGGAAA: SEQ ID NO: 18). ) Was included. In the case of Oct-1's Pou-specific DNA binding domain of Oct-1 (PDO), the template was generated by replacing the B domain with PDO.

[SEQ ID NO: 17]
GGGGAGGCAGC

[SEQ ID NO: 18]
AGGACGGGGGGCGGGGAAA

Immediately prior to use, 20 nmol PS 5'-thiol groups were reduced with 0.1 M DTT in 50 μL 1 M phosphate buffer (pH 7.0) for 1 hour at room temperature to reduce NAP-5. Desalted with a column (manufactured by GE Healthcare). A total of 10 nmol of SBS and 2 μmol of EMCS were added to 100 μL of 0.2 M sodium phosphate buffer (pH 7.0) and the mixture was incubated at 37 ° C. for 30 minutes to co-precipitate (Quick-precip Plus, Edge BioSystems). ) Was used for ethanol precipitation. Then, it was dissolved in diethyl pyrocarbonate (DEPC) treated water. The reduced PS was immediately added to the solution and the mixture was stirred at 4 ° C. overnight. DTT was added to a final concentration of 50 mM and incubated at room temperature for 30 minutes to terminate the reaction. Ethanol precipitation was performed at room temperature to remove excess PS. To remove the SBA and uncrosslinked SBS-EMCS complex, the ethanol precipitate was dissolved in DEPC-treated water and purified using C18 HPLC under the following conditions.

Column: AR-300, 4.6 x 250 mm (manufactured by Nacalai Tesque, Japan)
Solvent A: 0.1 M Triethylammonium acetate (TEAA)
Solvent B: acetonitrile / water (80:20, v / v)
Radiant B / A: 15-35% over 33 minutes
Flow rate: 0.5 mL / min Detection: Absorbance 254 nm and 490 nm

Fractions corresponding to peaks at absorbance 254 nm (corresponding to a single peak at 490 nm) were collected, the fractions were dried, and puromycin-linker DNA was resuspended in DEPC-treated water and stored. ..

To 200 pmol of mRNA obtained by transcription, 220 pmol of the above SBS puromycin linker DNA, 20 μL of 10 x T4 RNA ligase buffer (TaKaRa), and 12 μL of 0.1% BSA were added, and Nuclease-free water (Promega) was added. The product was added to prepare a total of 185 μL. After incubating at 90 ° C. for 1 minute, the mixture was incubated at 70 ° C. for 1 minute and cooled to 25 ° C. at a rate of 0.04 ° C./sec. 5 μL of T4 polynucleotide kinase (TaKaRa) and 10 μL of T4 RNA ligase (TaKaRa) were added and incubated at 25 ° C. for 1 hour.

(2-2) Translation
180 pmol of mRNA-linker conjugate was translated with a 1.5 mL scale cell-free translation system (Retic Lysate IVTKit, Ambion). For translation, 50 μL of the mRNA-linker conjugate was dispensed into a Protein LoBind tube (manufactured by Eppendorf) and performed at 30 ° C. for 20 minutes. Then, MgCl ₂ and KCl were added to the final concentrations of 75 mM and 900 mM, respectively, and incubated at 37 ° C. for 1 hour to obtain a translation product mRNA-protein conjugate.

(2-3) Reverse transcription Collect 5 tubes of translation product each (400 μL x 6), 80 μL 0.5 M EDTA (pH 8.0), 480 μL 2 x binding buffer (2 M) 20 mM Tris-HCl (pH 7.5) containing NaCl, 2 mM EDTA, 0.2% Tween-20) is added and incubated at 4 ° C. for 10 minutes to bind to the mRNA-protein conjugate. Ribosomes were removed. Dynabeads MyOne C1 Streptavidin was pre-washed with 1x binding buffer. Prepare 6 new 1.75 mL tubes, add 150 μL of washed Dynabeads MyOne C1 Streptavidin and 960 μL of the above translation product (mRNA-protein conjugate), and add a cooling thermoblock rotator (manufactured by Nissin Rika). , SNP-24B), and the mixture was stirred at 20 ° C. for 15 minutes.

The supernatant was transferred to a tube with fresh 1.75 mL containing 150 μL of Dynabeads MyOne C1 Streptavidin and stirred in the same manner. Further similar operations were performed again using a new tube containing Dynabeads MyOne C1 Streptavidin, for a total of 3 operations. The Dynabeads MyOne C1 Streptavidin obtained as described above was washed twice with 150 μL of 1x binding buffer, and 450 μL each was put into a total of 6 tubes. Reverse transcription was performed using ReverTra Ase (manufactured by Toyobo Co., Ltd.) on a scale of 225 μL for 450 μL of Dynabeads according to the protocol attached to this kit. The mixture was stirred at 42 ° C. for 40 minutes using a cooling thermoblock rotator.

(2-4) Recovery from magnetic beads
225 containing 1,000 U of RNase T1 (Ambion) after washing Dynabeads with 450 μL of 1 x His-tag binding buffer (20 mM phosphate buffer (pH 7.4) containing 0.5 M NaCl and 0.05% Tween 20). μL of 1 x His-tag binding buffer was added and incubated at 37 ° C. for 10 minutes. The supernatant was collected and this operation was repeated once more. By performing the above operation in sequence for 6 450 μL Dynabeads, mRNA / cDNA-protein was recovered on a 450 μL scale.

(2-5) Purification by His-tag
His Mag Sepharose Ni (magnetic particles, manufactured by GE healthcare) was washed with 1 x His-tag binding buffer. Take 450 μL from the mRNA / cDNA-protein sample recovered as described above, add 50 μL of Mag Sepharose Ni washed as described above, and stir at 10 ° C. for 3 hours using a cooling thermoblock rotator. Then, the mRNA / cDNA-protein was bound to Mag Sepharose Ni. The magnetic particles were washed twice in 100 μL 1xHis-tag binding buffer. Then, 25 μL of elution buffer (1 M NaCl, 5 mM EDTA, 50 mM Tris-HCl (pH 7.4) containing 0.1% Tween-20) was added, and a microtube mixer (Tomy Seiko Co., Ltd., MT-360) was added. ) Was used to stir at room temperature for 15 minutes. The same operation was performed again. A total of 50 μL of elution buffer was subjected to ethanol precipitation using Quick-Precip Plus Solution (Edge Bio).

(2-6) Preparation of full construct DNA from cDNA display molecule 100 μL of PCR reaction solution (0.2 mM dNTPs, 8 μM F1, 8 μM New Ytag to HGGS-R (sequence: 5') of ethanol-precipitated cDNA display molecule. -TTTCCCCGCCGCCCCCCGTCCTGCTTCCGCCGTGATGAT-3': SEQ ID NO: 19), 1xPrimeSTAR buffer containing 0.02U / μL PrimeSTAR HS DNA polymerase (Mg ²⁺ )), and amplified by the following PCR program. The PCR program was as follows, and steps 2 to 4 were performed for 10 cycles.
1.94 ° C 2 minutes 2.94 ° C 15 seconds 3.68 ° C 5 seconds 4.72 ° C 35 seconds 5.72 ° C (2 minutes)

[SEQ ID NO: 19]
5'-TTTCCCCGCCGCCCCCCGTCCTGCTTCCGCCGTGATGAT-3'

The PCR product was run on 8M urea-denatured 4.5% PAGE, and full construct DNA (541mer) was excised and purified. Purified full construct DNA is added to 200 μL of PCR reaction (1x PrimeSTAR buffer (Mg ²⁺ ), 0.2 mM dNTPs, 0.4 μM Newleft, 0.4 μM NewYtag, 0.02 U / μL PrimeSTAR HS DNA polymerase). After dispensing 50 μL into each of the above tubes, the following PCR program was performed. The PCR program was as follows, and steps 2 to 4 were performed for 6 cycles.

1.94 ° C 2 minutes 2.94 ° C 15 seconds 3.68 ° C 5 seconds 4.72 ° C 35 seconds 5.72 ° C 2 minutes

The double-stranded full-construct DNA obtained by the above PCR amplification was purified by combining the PCR products into 125 μL x 2 and using two spin columns (FavorPrep PCR Clean-Up Mini Kit, manufactured by Favorgen). .. To 80 μL of this eluate, 120 μL of Nuclease-free water (included with the kit) is added, and 1/10 times the amount of co-precipitant (Quick-Precip Plus Solution, EdgeBio) is added for ethanol precipitation, and finally 20 μL. It was dissolved in Nuclease-free water and stocked at -20 ° C.

(2-7) Cloning In order to examine the quality of the VHH DNA library after purification by His-tag described above (how much DNA encoding full-length VHH is contained), as follows. Cloning and sequencing analysis of this library DNA was performed.
First, the library DNA was ligated to pGEM-T easy Vector (manufactured by Promega), and Competent high DH5α (manufactured by Toyobo Co., Ltd.) was transformed with this and cultured on an LB plate at 37 ° C. overnight. ..

We picked up 40 clones and asked Operon Biotechnology Co., Ltd. to perform sequencing analysis. Information on the VHH sequence obtained from the DNA sequence is shown below. In addition, "*" indicates the appearance of the Stop codon. As a result of sequence analysis, it was confirmed that 35 of the 40 clones were DNA encoding full-length VHH. The percentage of the full length VHH encoded in this library was about 88%.
From the above, it was confirmed that the library could be produced.

The present invention is useful in the fields of pharmaceuticals and diagnostic agents.

SEQ ID NO: 1: VHH DNA library base sequence SEQ ID NO: 2: Flag-tag insertion primer base sequence SEQ ID NO: 3: Nucleotide sequence of primer (Newleft) SEQ ID NO: 4: Nucleotide sequence of primer (NewYtag) SEQ ID NO: 5: Inosin Primer base sequence SEQ ID NO: 6: Inosin primer base sequence SEQ ID NO: 7: Inosin primer base sequence SEQ ID NO: 8: Inosin primer base sequence SEQ ID NO: 9: Inosin primer base sequence SEQ ID NO: 10: Inosin primer base sequence sequence No. 11: Nucleotide sequence of primer for random mutation insertion SEQ ID NO: 12: Nucleotide sequence of primer for random mutation insertion SEQ ID NO: 13: Nucleotide sequence of primer for random mutation insertion SEQ ID NO: 14: Base of restriction enzyme-independent DNA library SEQ ID NO: 15: Nucleotide sequence of VHH full construct Sequence number 16: Nucleotide sequence of puromycin segment SEQ ID NO: 17: Spacer sequence SEQ ID NO: 18: Complementary sequence number that can be ligated between mRNA and puromycin linker DNA 19: Nucleotide sequence of NewY tag to HGGS-R SEQ ID NO: 20: Sequence information of VHH obtained by cloning (1)
SEQ ID NO: 21: VHH sequence information obtained by cloning (2)
SEQ ID NO: 22: VHH sequence information obtained by cloning (3)
SEQ ID NO: 23: VHH sequence information obtained by cloning (4)
SEQ ID NO: 24: VHH sequence information obtained by cloning (5)
SEQ ID NO: 25: VHH sequence information obtained by cloning (6)
SEQ ID NO: 26: VHH sequence information obtained by cloning (7)
SEQ ID NO: 27: VHH sequence information obtained by cloning (8)
SEQ ID NO: 28: VHH sequence information obtained by cloning (9)
SEQ ID NO: 29: VHH sequence information obtained by cloning (10)
SEQ ID NO: 30: VHH sequence information obtained by cloning (11)
SEQ ID NO: 31: Sequence information of VHH obtained by cloning (12)
SEQ ID NO: 32: VHH sequence information obtained by cloning (13)
SEQ ID NO: 33: VHH sequence information obtained by cloning (14)
SEQ ID NO: 34: VHH sequence information obtained by cloning (15)
SEQ ID NO: 35: VHH sequence information obtained by cloning (16)
SEQ ID NO: 36: VHH sequence information obtained by cloning (17)
SEQ ID NO: 37: VHH sequence information obtained by cloning (18)
SEQ ID NO: 38: VHH sequence information obtained by cloning (19)
SEQ ID NO: 39: VHH sequence information obtained by cloning (20)
SEQ ID NO: 40: VHH sequence information obtained by cloning (21)
SEQ ID NO: 41: VHH sequence information obtained by cloning (22)
SEQ ID NO: 42: VHH sequence information obtained by cloning (23)
SEQ ID NO: 43: VHH sequence information obtained by cloning (24)
SEQ ID NO: 44: VHH sequence information obtained by cloning (25)
SEQ ID NO: 45: Sequence information of VHH obtained by cloning (26)
SEQ ID NO: 46: VHH sequence information obtained by cloning (27)
SEQ ID NO: 47: Sequence information of VHH obtained by cloning (28)
SEQ ID NO: 48: VHH sequence information obtained by cloning (29)
SEQ ID NO: 49: VHH sequence information obtained by cloning (30)
SEQ ID NO: 50: VHH sequence information obtained by cloning (31)
SEQ ID NO: 51: Sequence information of VHH obtained by cloning (32)
SEQ ID NO: 52: Sequence information of VHH obtained by cloning (33)
SEQ ID NO: 53: VHH sequence information obtained by cloning (34)
SEQ ID NO: 54: Sequence information of VHH obtained by cloning (35)
SEQ ID NO: 55: Sequence information of VHH obtained by cloning (36)
SEQ ID NO: 56: VHH sequence information obtained by cloning (37)
SEQ ID NO: 57: Sequence information of VHH obtained by cloning (38)
SEQ ID NO: 58: Sequence information of VHH obtained by cloning (39)
SEQ ID NO: 59: Sequence information of VHH obtained by cloning (40)

Claims (15)

By performing a polymerase chain reaction using a template nucleic acid containing a specific gene sequence region and a primer in which inosine is introduced at an arbitrary position, a plurality of nucleic acid fragments containing the sequence region corresponding to the specific gene sequence region can be obtained. The duplication process to duplicate and
A protruding end forming step of forming protruding ends having different base numbers by using an enzyme that recognizes inosine and decomposes a phosphodiester bond at a specific position at the end of the nucleic acid fragment.
Among the protruding ends formed in the protruding end forming step, nucleic acid fragments containing protruding ends having the same number of bases are linked to each other by ligating the protruding ends with an enzyme to produce a plurality of linked nucleic acid fragments. A method for producing a restriction enzyme-independent linked nucleic acid fragment, which comprises a linking step. The method for producing a linked nucleic acid fragment according to claim 1, wherein in the linking step, nucleic acid fragments having protruding ends having different numbers of bases are linked to each other in one step. The linked nucleic acid fragment according to claim 1 or 2, wherein the number of bases constituting the protruding end is 3 or more and 12 or less, and the difference in the number of bases of the protruding ends having different bases is 2 or more. Manufacturing method. The introduction position of the inosin is the position corresponding to the third base of the triplet sequence corresponding to the amino acid.
The invention according to any one of claims 1 to 3, further comprising a primer design step of designing the primer so that the triplet sequence is a triplet sequence corresponding to the same amino acid even if the third base is changed. A method for producing a linked nucleic acid fragment. The method for producing a linked nucleic acid fragment according to any one of claims 1 to 4, wherein the sequence region corresponding to the specific gene sequence region is a random region into which a random mutation is inserted. The method for producing a linked nucleic acid fragment according to any one of claims 1 to 5, wherein the enzyme that recognizes inosine and decomposes the phosphodiester bond at a specific position is Endonuclease V or T4 pyrimidine dimer glycosylase (PDG). The production according to any one of claims 1 to 6, wherein the enzyme linking the fragments is any enzyme selected from the group consisting of Taq DNA ligase, T4 DNA Ligase, and E. coli DNA Ligase. Method. The method for producing a linked nucleic acid fragment according to any one of claims 1 to 7, wherein a DNA polymerase that recognizes inosine is used in the replication step. The method for producing a linked nucleic acid fragment according to claim 8, wherein the DNA polymerase is an enzyme selected from the group consisting of KOD-Multi & Epi-, KOD DNA polymerase, and TaKaRa Taq. The method for producing a linked nucleic acid fragment according to any one of claims 1 to 9, wherein the template nucleic acid is a DNA sequence encoding an antibody. The method for producing a linked nucleic acid fragment according to claim 10, wherein the specific gene sequence region is a region including a sequence region encoding a complementarity determining region of an antibody. A ligated peptide library composed of ligated peptides encoded by the nucleotide sequence represented by SEQ ID NO: 15 in the sequence listing, wherein in SEQ ID NO: 15, r, b, d, v, k, s, h and s are , A mixed base, r represents a 25% appearance rate of A, T, G and C; b represents a 50% appearance rate of T and C; d represents a T and G appearance rate. The appearance rate is 19%, the appearance rate of C and A is 27%; v means that the appearance rate of T, C and A is 28%, and the appearance rate of G is 16%. It means that the appearance rate of T is 13%, the appearance rate of C is 20%, the appearance rate of A is 35%, and the appearance rate of G is 32%; h is the appearance rate of T. The rate is 13%, the appearance rate of C is 20%, the appearance rate of A is 35%, and the appearance rate of G is 32%; s is the appearance rate of T and C is 37%, and the appearance rate of G is 37%. A linked peptide library that represents an appearance rate of 26%. The linked peptide library according to claim 12, which is composed of a peptide having an amino acid sequence represented by SEQ ID NOs: 20 to 59 in the sequence listing. A linked nucleic acid fragment library composed of nucleic acid fragments having the nucleotide sequence represented by SEQ ID NO: 15 in the sequence listing, in SEQ ID NO: 15, r, b, d, v, k, s, h and s are. It is a mixed base, where r means that the appearance rate of A, T, G and C is 25%; b means that the appearance rate of T and C is 50%; d means the appearance of T and G. The rate is 19%, the appearance rate of C and A is 27%; v means that the appearance rate of T, C and A is 28%, and the appearance rate of G is 16%. Represents; k means that the appearance rate of T is 13%, the appearance rate of C is 20%, the appearance rate of A is 35%, and the appearance rate of G is 32%; h is the appearance rate of T. Means that the appearance rate of C is 13%, the appearance rate of C is 20%, the appearance rate of A is 35%, and the appearance rate of G is 32%; A linked nucleic acid fragment library representing a rate of 26%. The linked nucleic acid fragment library according to claim 14, which comprises a nucleic acid fragment having a nucleotide sequence encoding a peptide having an amino acid sequence represented by SEQ ID NOs: 20 to 59 in the sequence listing.

Images