WO2023183769A1 - Échafaudages et films minces de chitosane pour l'expansion de cellules souches neurales humaines - Google Patents

Échafaudages et films minces de chitosane pour l'expansion de cellules souches neurales humaines Download PDF

Info

Publication number
WO2023183769A1
WO2023183769A1 PCT/US2023/064698 US2023064698W WO2023183769A1 WO 2023183769 A1 WO2023183769 A1 WO 2023183769A1 US 2023064698 W US2023064698 W US 2023064698W WO 2023183769 A1 WO2023183769 A1 WO 2023183769A1
Authority
WO
WIPO (PCT)
Prior art keywords
chitosan
cells
film
chitin
scaffold
Prior art date
Application number
PCT/US2023/064698
Other languages
English (en)
Inventor
Miqin Zhang
Yoshiki Ando
Fei-Chien CHANG
Yang Zhou
Matthew Michael JAMES
Original Assignee
University Of Washington
Kyocera Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Washington, Kyocera Corporation filed Critical University Of Washington
Publication of WO2023183769A1 publication Critical patent/WO2023183769A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08L—COMPOSITIONS OF MACROMOLECULAR COMPOUNDS
    • C08L5/00—Compositions of polysaccharides or of their derivatives not provided for in groups C08L1/00 or C08L3/00
    • C08L5/08—Chitin; Chondroitin sulfate; Hyaluronic acid; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08B—POLYSACCHARIDES; DERIVATIVES THEREOF
    • C08B37/00—Preparation of polysaccharides not provided for in groups C08B1/00 - C08B35/00; Derivatives thereof
    • C08B37/0006—Homoglycans, i.e. polysaccharides having a main chain consisting of one single sugar, e.g. colominic acid
    • C08B37/0024—Homoglycans, i.e. polysaccharides having a main chain consisting of one single sugar, e.g. colominic acid beta-D-Glucans; (beta-1,3)-D-Glucans, e.g. paramylon, coriolan, sclerotan, pachyman, callose, scleroglucan, schizophyllan, laminaran, lentinan or curdlan; (beta-1,6)-D-Glucans, e.g. pustulan; (beta-1,4)-D-Glucans; (beta-1,3)(beta-1,4)-D-Glucans, e.g. lichenan; Derivatives thereof
    • C08B37/0027—2-Acetamido-2-deoxy-beta-glucans; Derivatives thereof
    • C08B37/003—Chitin, i.e. 2-acetamido-2-deoxy-(beta-1,4)-D-glucan or N-acetyl-beta-1,4-D-glucosamine; Chitosan, i.e. deacetylated product of chitin or (beta-1,4)-D-glucosamine; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08J—WORKING-UP; GENERAL PROCESSES OF COMPOUNDING; AFTER-TREATMENT NOT COVERED BY SUBCLASSES C08B, C08C, C08F, C08G or C08H
    • C08J5/00—Manufacture of articles or shaped materials containing macromolecular substances
    • C08J5/18—Manufacture of films or sheets
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0618—Cells of the nervous system
    • C12N5/0623—Stem cells
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08J—WORKING-UP; GENERAL PROCESSES OF COMPOUNDING; AFTER-TREATMENT NOT COVERED BY SUBCLASSES C08B, C08C, C08F, C08G or C08H
    • C08J2305/00—Characterised by the use of polysaccharides or of their derivatives not provided for in groups C08J2301/00 or C08J2303/00
    • C08J2305/08—Chitin; Chondroitin sulfate; Hyaluronic acid; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C08—ORGANIC MACROMOLECULAR COMPOUNDS; THEIR PREPARATION OR CHEMICAL WORKING-UP; COMPOSITIONS BASED THEREON
    • C08J—WORKING-UP; GENERAL PROCESSES OF COMPOUNDING; AFTER-TREATMENT NOT COVERED BY SUBCLASSES C08B, C08C, C08F, C08G or C08H
    • C08J2405/00—Characterised by the use of polysaccharides or of their derivatives not provided for in groups C08J2401/00 or C08J2403/00
    • C08J2405/08—Chitin; Chondroitin sulfate; Hyaluronic acid; Derivatives thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/11—Epidermal growth factor [EGF]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/115—Basic fibroblast growth factor (bFGF, FGF-2)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/90—Polysaccharides
    • C12N2501/91—Heparin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00—Supports or coatings for cell culture, characterised by material
    • C12N2533/50—Proteins
    • C12N2533/52—Fibronectin; Laminin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2533/00—Supports or coatings for cell culture, characterised by material
    • C12N2533/70—Polysaccharides
    • C12N2533/72—Chitin, chitosan

Definitions

  • the Sequence Listing XML associated with this application is provided in XML format and is hereby incorporated by reference into the specification.
  • the name of the XML file containing the sequence listing is 3915- P1222WOUW_Seq_List_20230310.xml.
  • the XML file is 53 KB; was created on March 10, 2023; and is being submitted electronically via Patent Center with the filing of the specification.
  • hESCs human embryonic stem cell
  • hiPSC human induced pluripotent stem cell
  • hNSCs human NCSs
  • hNSCs human NCSs
  • preclinical studies and clinical trials have demonstrated that the administration of stem cells or differentiated cells could restore neurogenesis and function.
  • cell therapy often requires administration of billions of clinical-grade cells per patient for the treatment to be safe and effective. Limited cell quantity also limited the significance level of the trials as a consequence of allogenic or autologous variation, varied cell yield and culture expansion time, affecting dosage and treatment cycles.
  • the present disclosure provides porous chitosan scaffolds useful for neural stem cell adhesion, maintenance, and proliferation, and methods for using and fabricating the scaffolds.
  • the disclosure provides porous chitosan scaffolds for cell culture.
  • the porous chitosan scaffold comprises chitosan having a degree of deacetylation of about 98 percent (as measured by H NMR), wherein the scaffold has a chitosan density from about 0.02 to about 0.15 g/cm 3 .
  • the disclosure provides methods for culturing cells, comprising introducing cells to be cultured into a chitosan scaffold described herein and maintaining/culturing the cells introduced into the scaffold.
  • cell populations can be maintained (e.g., maintaining multipotency without differentiation of pluripotent cells or maintained without expansion of the cell population), expanded (i.e., increased in number), or otherwise cultured.
  • the disclosure provides methods for fabricating a chitosan scaffold.
  • the method comprises:
  • the disclosure provides compositions useful cell culture (e.g., for neural stem cell adhesion and proliferation).
  • the composition comprises a linear heteropolysaccharide containing P-(l,4)-linked-D-glucosamine (GlcN) and P-(l,4)-linked-N-acetyl-D-glucosamine (GlcNAc), wherein the ratio of GlcN: (GlcNAc+GlcN) is from about 0.75 to about 1.00 (e.g., greater than about 0.78).
  • the present disclosure also provides thin films useful for neural stem cell adhesion, maintenance, and proliferation, and methods for using and fabricating the films.
  • films comprising chitin and chitosan are provided.
  • the film comprises:
  • chitin in an amount from 0 to about 90 percent by weight based on the total weight of the film, wherein the chitin has a degree of deacetylation from about 0 to about 15 percent, as measured by !ll NMR;
  • chitosan in an amount from about 10 to about 100 percent by weight based on the total weight of the film, wherein the chitosan has a degree of deacetylation from about 75 to about 100 percent, as measured by 1 H NMR, and wherein the film has a degree of deacetylation from about 75 to about 100 percent.
  • the disclosure provides methods for culturing cells, comprising introducing cells to be cultured onto a chitin/chitosan film described herein and culturing the cells introduced into the film.
  • cell populations can be maintained (e.g., maintaining multipotency without differentiation of pluripotent cells or maintained without expansion of the cell population), expanded (i.e., increased in number), or otherwise cultured.
  • the disclosure provides methods for fabricating chitin/chitosan films.
  • the method comprises:
  • FIG. 1A illustrates the microstructure of representative scaffolds before and after the end points of degradation studies was examined by SEM. Scale bar represents 100 pm. All images are at the same magnification.
  • FIG. 1C are photographs of representative scaffolds before and after incubation.
  • FIG. ID compares representative scaffold mass monitored at indicated time points. Data presented as mean ⁇ standard deviation. * p ⁇ 0.05; ** p ⁇ 0.005; *** p ⁇ 0.0001; t p ⁇ 0.05 at day 0 among 6CS and others.
  • FIG. 2A compares Young’s modulus of compression tests on lyophilized (dry) and rehydrated representative scaffolds. The inset presets the fold changes of respective dry and hydrated data.
  • FIG. 2B compares stress-strain curves of the hydrated scaffolds.
  • FIG. 2D illustrates the mapping of AFM elastic modulus and the histogram. Scale bars are 500 nm.
  • FIGS. 3 A and 3B compare adhesion and proliferation of two hNSC lines in representative scaffolds, NSC-H14 cells (3A) and ReNcell VM cells (3B).
  • FIGS. 4A and 4B compare representative fluorescence images of cells cultured for 4 days in representative scaffolds for cell line NSC-H14 (4A) and ReNcell (4B). Cells were stained with calcein-AM (live) and ethidium homodimer- 1 (dead). Scale bars represent 200 pm.
  • FIGS. 5A-5E compare flow cytometry analysis of NSC-H14 cells grown in representative 3D scaffolds or on 2D controls. The viable population gated after live-dead staining (5A). Comparison of Ki67 expression after 4 days of culture (5B). The population with SOX2+/nestin+ double-positive on day 4 and day 7 of each culture (5C). The population with SOXl+/Ki67+ expression (5D). Representative dot plots gated for SOX2 and nestin showing expression or loss of SOX2+/nestin+ for both cell lines after 4 days (5E).
  • FIGS. 6A and 6B compare flow cytometry analysis of ReNcell for the comparison of SOX2+/nestin+ and SOXl+/Ki67+ population, respectively, after 4 days of culture (6A); changes of SOX2+/nestin+ population on day 4, 7, and 13 (6B).
  • FIG. 7 compares images of cells in scaffolds sustained for multipotency-associated protein expression. Immunofluorescence staining for SOX2, nestin, and DAPI after 7 days of culture. Scale bars represents 100 pm; all images were obtained at the same magnification.
  • FIG. 8 compares the mRNA expression analysis of NSC-H14 for NSC pluripotent markers, lineage-specification proteins for possible differentiation, and selected transmembrane proteins.
  • FIGS. 9A and 9B illustrate the ! H NMR spectra of chitosan and chitin.
  • FIG. 9C is a schematic illustration of films with a wide range of DD constructed by tuning chitosan/chitin ratio.
  • FIGS. 10A-10C present surface characterization of representative chitosan/chitin films.
  • Chitosan/chitin films with different chitosan-to-chitin ratios were examined by SEM for the texture of the surface (10A).
  • Top row shows lower magnifications (all white scale bars are 300 pm).
  • the bottom row shows higher magnifications (all black scale bars are 15 pm).
  • FIG. 10B is a photograph of representative hydrated films in 48-well plate in preparation for cell culture. The inset is a magnified view showing a pattern underneath the well plate.
  • FIGS. 12A-12C compare elastic modulus of representative films determined by nanomechanical measurement using AFM.
  • FIG. 12A shows elastic modulus mapping of representative films hydrated in PBS sampling an area 3 x 3 nm.
  • FIG. 12B compares average elastic modulus of representative dried chitosan/chitin films. The elastic moduli are presented as the tip moved forward to and backward from the sample. ** p ⁇ 0.0001 comparing R100 to R80; the others are not significantly different from each other.
  • FIGS. 13A-13C illustrates cell metabolic activity determined by alamarBlue viability assay.
  • FIG. 13A compares cell adhesion on day 1 and proliferation on day 3, relative to a Geltrex-coated surface as the control.
  • FIG. 13B shows control hNSC culture on Geltrex-coated surfaces exhibited more than a 3 -fold increase in cell number over 3 days.
  • FIG. 13C compares phase contract images of hNSC-H14 cells cultured on representative chitosan/chitin films, collagen, or Geltrex-coated surfaces. All images are shown at the same magnification. Scale bar represents 50 pm.
  • FIGS. 14A-14D compare flow cytometry for hNSCs collected from each substrate for the expression of proliferation marker protein Ki67 (14A), numbers indicated Ki67 + population%; Ki67 + /SOX2 + double positive populations (14B), nestin and SOX2 expression (14C), and neural stem cell population with SOXl + /SOX2 + /nestin + for all conditions on day 3 of culture (14D).
  • FIG. 15 illustrates characterization of NSC phenotype using immunocytochemistry staining for (left) nestin-green and SOX2, and (right) SOX2 and PAX6. DAPI staining for nuclei are shown. The cells were analyzed after 5 days of culture. Scale bar represents 50 pm. All images are acquired at the same magnification.
  • FIG. 16 illustrates integrin expression profile comparing selected culture conditions. The data are presented as the fold-change relative to the expression level of Geltrex 2D control (set as 1-fold). Noncoat refers to where the cells were cultured in plain wells without any coating.
  • FIGS. 17A and 17B illustrate characterization of hNSCs on pure chitosan films made of chitosan from different suppliers.
  • FIG. 17B shows bright field micrographs on day 2 of culture. Scale bar represents 200 pm.
  • the present disclosure provides porous chitosan scaffolds and thin films useful for neural stem cell adhesion, maintenance, and proliferation. Methods for using and fabricating the scaffolds are also provided.
  • the present disclosure provides porous chitosan scaffolds useful for neural stem cell adhesion, maintenance, and proliferation, and methods for using and fabricating the scaffolds.
  • the present disclosure provides porous scaffolds made of plain medical grade chitosan that are able to renew and expand hNSCs in a chemically defined condition.
  • the physicochemical properties of the scaffold regulated the maintenance and multipotency of hNSCs.
  • hNSCs formed colonies in the porous structure and expressed NSC multipotency markers.
  • the scaffolds made of pure chitosan or high chitosan concentration support adhesion, proliferation, and expansion of hNSCs is greater than for other types of scaffolds. Protein and gene expression analysis showed that chitosan scaffolds enriched the multipotent cell population while suppressing the survival of differentiated population.
  • the disclosure provides porous chitosan scaffolds for cell culture (e.g., for neural stem cell adhesion and proliferation).
  • the porous chitosan scaffold comprises chitosan having a degree of deacetylation of about 98 percent (as measured by ll NMR), wherein the scaffold has a chitosan density from about 0.02 to about 0.15 g/cm 3 .
  • the porous chitosan scaffold consists essentially of chitosan having a degree of deacetylation of about 98 percent (as measured by NMR), wherein the scaffold has a chitosan density from about 0.02 to about 0.15 g/cm 3 .
  • the porous chitosan scaffold consists of chitosan having a degree of deacetylation (DD) of about 98 percent (as measured by NMR), wherein the scaffold has a chitosan density from about 0.02 to about 0.15 g/cm 3 .
  • DD degree of deacetylation
  • chitosan refers to a linear heteropolysaccharide containing both P-(l,4)-linked-D-glucosamine (GlcN) and P-(l,4)-linked-N-acetyl-D- glucosamine (GlcNAc) monomers and having a degree of deacetylation about 75 to about 100% (e.g., about 98%) (as measured by !H NMR).
  • the chitosan of the scaffold has a degree of deacetylation (DD) that can be determined by, for example, dissolving the scaffold in deuterated water (e.g., 2.5% DC1 in D2O at 10 mg/mL) and then measuring by fl NMR, as described in Example 2, Determination of the degree of deacetylation.
  • the DD was calculated using the integrals of the protons on the acetyl groups (H- Acetyl) and the protons on all monomers, the hexose repeat units (H2-H6), using Equation (1) (see Example 2).
  • chitosan useful in the scaffolds and methods described herein is a medical grade chitosan (commercially available from Matexcel, Shirley NY, catalog number NAT-002) and has the degree of deacetylation 98.3 ⁇ 0.1%.
  • Representative chitosan scaffolds described herein are prepared from 0.5, 1, 2, 4, and 6 wt% chitosan in a suitable solvent. These representative chitosan scaffolds are designated herein by chitosan concentration (wt%) used to prepare the scaffolds (e.g., 0.5CS, ICS, 2CS, 4CS, 6CS).
  • Density of dry chitosan scaffold (g/cm 3 )
  • the density of dry chitosan scaffold is defined as the mass of the dry chitosan scaffold in grams in the geometric volume of the chitosan scaffold in cm 3 .
  • chitosan scaffolds described herein are prepared from 0.5, 1, 2, 4, and 6 wt% chitosan in a suitable solvent and the viscosities of these solutions are summarized below.
  • Viscosity mPa.s (chitosan dissolved in 2% (w/w) acetic acid aqueous solution)
  • viscosity is affected by chitosan molecular weight, chitosan degree of deacetylation, concentration wt%, solvent choice, and processing temperature.
  • chitosan scaffolds described herein have significant mechanical strength.
  • Elastic modulus (compression) for representative dry and hydrated chitosan scaffolds described herein are summarized below.
  • representative chitosan scaffolds described herein have elastic modulus (compression; dry) greater than about 300 kPa (e.g., about 300-1000, 500-900, 600-800 kPa) and elastic modulus (compression; hydrated) greater than about 50 kPa (e.g., about 50-150, 60-125, 70-110 kPa). In other embodiments, representative chitosan scaffolds described herein have elastic modulus (compression; dry) greater than about 50 kPa.
  • Representative chitosan scaffolds described herein have advantageous pore size (i.e., pore diameter). Pore size for representative chitosan scaffolds described herein are summarized below.
  • representative chitosan scaffolds described herein have pore size (i.e., pore diameter) less than about 115 pM (e.g., 75-110, 80-105 pM).
  • pore size remains substantially unchanged after cell culture (see FIG. IB).
  • the chitosan scaffolds described herein have advantageous functionality. Depending on cell culture conditions, the scaffold can maintain hNSC during population expansion either with or without differentiation, as desired.
  • the chitosan has a molecular weight from about 5 to about 500 kDa (e.g., from about 5 to about 250 kDa).
  • molecular weight refers to weight average molecular weight
  • the scaffold has a width from about 3 mm to about 100 mm (e.g., 6.50, 9.75, 15.5, 21.90 mm).
  • the scaffold has a depth from about 0.1 mm to about 15 mm (e.g., 500 pm, 1 mm, or 2 mm).
  • Representative chitosan scaffolds described herein have aspect ratios as follows: 0.05, 5mm /100 mm (10 cm dish, widest); 0.25, 0.4 mm/1.6 mm (sliced); and 0.15, 16 mm/120 mm (15 mL tube, tallest). These aspect ratios distinguish the porous chitosan scaffolds described herein from similarly constituted thin films.
  • the scaffold has an aspect ratio (height/width) from about 0.01 to about 0.50 (e.g., from about 0.1 to about 0.50). In certain embodiments, the scaffold has an elastic modulus from about 0.2 to about 500 kPa.
  • the disclosure provides methods for culturing cells, comprising introducing cells to be cultured into a chitosan scaffold described herein and maintaining/culturing the cells introduced into the scaffold.
  • the scaffolds described herein are used for maintaining multipotency without differentiation of pluripotent cells (e.g., neuron stem cells, human induced pluripotent cells (hiPSC)-derived neural progenitor cells, human embryonic stem cells (hESC)-derived neural stem or progenitor cells, neuron cells).
  • pluripotent cells e.g., neuron stem cells, human induced pluripotent cells (hiPSC)-derived neural progenitor cells, human embryonic stem cells (hESC)-derived neural stem or progenitor cells, neuron cells.
  • the scaffolds described herein are used for culturing cells (e.g., neuron stem cells, human induced pluripotent cells (hiPSC)-derived neural progenitor cells, human embryonic stem cells (hESC) -derived neural stem or progenitor cells, neuron cells).
  • hiPSC human induced pluripotent cells
  • hESC human embryonic stem cells
  • the scaffolds described herein are used for culturing astrocyte, oligodendrocyte, or motor neuron cells.
  • cell populations can be maintained (e.g., maintaining multipotency without differentiation of pluripotent cells or maintained without expansion of the cell population), expanded (i.e., increased in number), or otherwise cultured.
  • the scaffolds described herein are used for tissue engineering.
  • the disclosure provides methods for maintaining and/or culturing cells, comprising introducing cells to be maintained or cultured into a chitosan scaffold described herein and maintaining and/or culturing the cells introduced into the scaffold.
  • the cells are neuron stem cells, human induced pluripotent cells (hiPSC)-derived neural progenitor cells, or neuron cells.
  • hiPSC human induced pluripotent cells
  • the cells are human neural stem cells.
  • the cells are passaged out of the scaffold.
  • the disclosure provides methods for fabricating a chitosan scaffold. In certain embodiments, the method comprises:
  • freezing the cast chitosan solution includes a heat treatment process.
  • the polymer solution was first pre-cooled at 0 °C for 60 min. Then, the temperature was dropped to -5 °C (0.125 °C/min) and maintained at -5 °C for 20 min. Next, the temperature was further dropped to -20 °C (1 °C/min) and maintained at -20 °C for 120 min. After that, the temperature was raised back to -2 °C (1 °C/min) for another 600 min before drying started. The frozen polymer solution was drying at -2 °C, and the pressure was controlled below 500 mTorr.
  • the scaffold shape/dimensions are pre-determined by shape/dimensions of vessel and optional further processing of the so-formed scaffold by, for example, slicing, trimming, cutting, into customizable shapes (e.g., a “star-shaped” scaffold can be made).
  • the polymer solution is first pre-cooled at 0 °C for 60 min. Then, the temperature is dropped to -5 °C (0.125 °C/min) and maintained at -5 °C for 20 min. Next, the temperature is further dropped to -20 °C (1 °C/min) and maintained at -20 °C for 120 min. After that, the temperature is raised back to -2 °C (1 °C/min) for another 600 min before drying started. The frozen polymer solution is dried at -2 °C, and pressure is controlled below 500 mTorr.
  • the chitosan solution is a formic acid solution, an acetic acid solution (e.g., 1-8% aqueous acetic acid), a dichloroacetic acid solution, a trichloroacetic acid, a potassium hydroxide solution, or a phosphoric acid solution.
  • the chitosan scaffolds were fabricated by homogenizing medical grade chitosan powder in 2-4% acetic acid solution followed by lyophilizing in multiwell plates, producing a scaffold dimension compatible with cell culture procedures.
  • the scaffolds could be fabricated in 24-, 48- or 96-well plate format as needed.
  • FIGS. 1A-1D compare the characterization of microstructure and the stability of representative scaffolds.
  • the micro structure varied with chitosan concentration, as shown in the SEM images (FIG. 1A).
  • the microstructure stability was also investigated comparing SEM images before and after 35 days of incubation in cell medium. Qualitatively, the porous micro structure did not present discernible changes in the SEM images (FIG. 1A) after long-term incubation in the medium.
  • the micro structure was monitored by measuring the pore diameter before and after the incubation using SEM images and ImageJ (FIG. IB). No significant increase in pore diameter was found; decrease in pore diameter of representative scaffolds 2CS and 05CS was likely due to drying.
  • FIG. 1C shows the scaffolds before and after the 35 days of incubation in cell medium. Before the incubation, as expected, the pore diameter increased with the decrease in chitosan polymer concentration.
  • the diameter of 6CS (6 wt% CS) scaffolds was the smallest at 83 ⁇ 33 pm (p ⁇ 0.05 compared to others), while the largest diameter was found on 05CS (0.5 wt% CS) and 4CHA (4 wt% CHA) scaffolds at approximately 120 pm. After the incubation, no statistically significant (p > 0.05) decreases or increases were found for most samples.
  • FIG. ID shows that there was no significant mass loss in most samples during the incubation. Compared to the mass at day 0, no significant loss of mass was found after 35 days of incubation for all types of scaffolds except for 6CS at day 25 (94.6 + 1.3%) and 4CS at day 7 (93.9 + 2.8%).
  • the scaffolds were fabricated with a wide range of stiffness to explore the optimal microenvironment to cultivate hNSCs in the scaffolds made with polymer chitosan and hyaluronic acid.
  • This mechanical property has been a main consideration in engineering ex vivo ECM for tissue regeneration.
  • the artificial ECM would possess mechanical stiffness similar to the targeted tissue; however, many published artificial matrices could support NSCs growth or differentiation when the substrate stiffness is far from that of native brain tissue.
  • FIGS. 2A-2D compare mechanical properties of the scaffolds.
  • FIG. 2A presents the modulus of lyophilized (dry) and hydrated samples of each type of scaffolds and the fold-change comparing dry and hydrated values.
  • FIG. 2B shows the representative stressstrain curves of the hydrated samples.
  • These scaffolds covered a wide range of physiological-relevant elastic modulus.
  • the softest scaffold was 05CS with Young’s modulus at 4.1 ⁇ 0.9 kPa, while the most stiff being 6CS with 782.2 ⁇ 242.4 kPa.
  • the scaffolds softened upon hydration showing the softest similarly being 05CS at 1.2 ⁇ 0.4 kPa and 6CS with the highest modulus at 100.2 ⁇ 34 kPa.
  • the modulus of lyophilized (dry) samples could be 4- to 38-fold higher than the modulus of the hydrated samples, as indicated in the fold-change plot (inset) in FIG. 2A. It was found that 2CS scaffolds presented the most drastic change in the moduli before and after rehydration, while higher or lower concentration led to smaller differences between dry and rehydrated state.
  • the limited changes found on 6CS and 4CS was likely due to high polymer density leading to compact microstructure, as shown in the SEM images.
  • the stress-strain curves of 6CS and 4CS featured a prominent elastic region and higher resistance to strain than the rest of the samples. It was noticed in the SEM images that as the chitosan concentration increased, the pore size and frequency of interconnected channels between pores decreased.
  • the mechanical properties of hydrated samples would be more representative of the condition in the cell culture.
  • the local elastic modulus of hydrated samples at micro- to nanoscale was then further characterized via AFM and the analysis is summarized in FIGS. 2C and 2D.
  • the association of moduli and chitosan concentration was similar to that found via compression test: the moduli increased with chitosan concentration.
  • Scaffold 6CS and 4CS were similar at approximately 200 kPa, following the moduli decreasing from 2CS, ICS, to 05CS, and the modulus of 4CHA was at a similar range to 2CS at around 100 kPa.
  • the median of elastic moduli characterized by AFM were higher than the that by the compression tests.
  • the compression test measures the behavior of the bulk structure.
  • the stress- strain curves showed stages of elasticity of the pore wall, the buckling, and followed by the densification of the collapsed structure (FIG. 2B).
  • the AFM tips exerted resistance forces from the polymer network comprising pore wall surface itself, which is likely a closer simulation of the force the cell cytoskeleton retraction would sense.
  • the moduli by AFM were considered a more biological relevant indication of the tissue matrix stiffness.
  • the mechanical property of native tissue is more often characterized by macroscale approaches.
  • shear, elastic, or storage moduli were reported to be within 1 - 100 kPa depending on the brain section and the method.
  • Stiffness of mouse embryonic developing brain found nanomechanical elastic moduli was determined to be approximately 50 to 500 Pa as measured by AFM.
  • the modulus of the neural ECM could direct cell response, such as morphology, gene expression, migration, differentiation, and neurite extension.
  • the modulus of SVZ was shown to increase from around 70 Pa at E14.5 to 170 Pa at stage E18.5, likely correlated to the switch from neurogenesis to gliogenesis.
  • the stiffness of the neural stem and progenitor cells themselves changes as well, in response to local microenvironment cues.
  • NSC-H14 and ReNcell VM Two different hNSCs, NSC-H14 and ReNcell VM, were used to examine cell behavior in these 3D scaffolds cultured with the NSC maintenance medium.
  • the cells survived in the scaffolds or on 2D control were quantified via alamarBlue metabolic activity assay on specific day points up to 11 days, as shown in FIG. 3.
  • the initial adhesion and survival could be characterized by the data on day 1 comparing different scaffold types, suggesting that 6CS scaffold was the most supportive for NSC-H14 adhesion while no evident differences among scaffold types for ReNcell.
  • the proliferation of NSC-H14 cells became apparent after 5 days and increased noticeably from day 5 to 11.
  • Eive/dead staining (FIG. 4) observations correlate to the data of metabolic activities.
  • Eower magnification images show dispersion of the cells within the scaffolds while higher magnification images show cells formed adherent clusters. More uniform dispersion of cell clusters could be found on 6CS, 4CS, and 2CS scaffolds, where the cells formed semi-aggregates with adherent morphology at the periphery of the aggregates. More cells were also observed in scaffolds of higher polymer concentration, such as 6CS and 4CS.
  • the data shows the scaffolds made of higher chitosan content producing matrix with higher elastic modulus supported better adhesion and thereby proliferation of hNSCs.
  • the multipotency was maintained on both cultures.
  • comparison of mechanical properties showed a stiffer hydrogel matrix promoted more uniform early adhesion, distribution, and polarized cell morphology than a softer matrix.
  • Chitosan with high degree of deacetylation DD exposes mostly -NH2 or -NH3 + functional groups on polymer; the medical grade chitosan used herein was characterized as approximately 95% DD.
  • Chitosan is well known to present a cationic surface to support mammalian cell adhesion due to the presence of -NH3 + .
  • most amine groups deprotonate and exhibit -NH2.
  • chitosan scaffolds could be superior to CHA scaffolds in hNSC adhesion and growth.
  • the preference of hNSC growth on scaffolds of high chitosan concentration over scaffolds of low chitosan concentration could also be considered to be influenced partly by the surface charge.
  • the surface charge of chitosan highly correlates to available amine groups, whose quantity could be altered by chitosan concentration. It has been reported that more amine groups on chitosan led to better Schwann cells adhesion and proliferation.
  • Hyaluronic acid could provide a more attractive surface for most mammalian cell culture in spite of the negative surface charge.
  • Hyaluronic was recognized as a versatile biopolymer and known for activating cell surface proteins such as CD44.
  • culture substrates made of pure hyaluronic acid limited the adhesion of stem cells. Pure hyaluronic acid often present limited support for cell growth; in some cases, it was utilized to prevent mammalian cell and tissue adhesion. The presence of hyaluronic acid contributes to local tissue hydration and weakens cell anchorage to the extracellular matrix.
  • FIG. 5A Live/dead cell gating on hNSC-H14 cells shows the viable cell population from 3D on day 4 was approximately 80-90% with 6CS at highest around 95%, closest to that of 2D control. Conversely, data on day 7 showed higher viability on 6CS, 4CS, and 2CS scaffolds but decreased viability on ICS and 4CHA scaffold to 50-70%.
  • Ki67 cell proliferation marker Ki67
  • FIG. 5B shows the slower growth kinetics found in low concentraion chitosan and CHA scaffolds. Apart from 6CS samples, other scaffold types resulted in decreased Ki67 expression. The data consistently provided evidence showing CHA as an undesirable scaffold type of cultivating hNSC.
  • FIG. 5C shows high concentration chitosan scaffolds sustained the SOX2+/nestin+ double-positive NSC population from day 4 to day 7, the same as standard 2D culture; yet CHA condition was unable to maintain the expression.
  • Comparison of SOXl+/Ki67+ population FIG. 5D
  • FIG. 6 presents the time-course changes of SOX2+/nestin+ population. Initially, SOX2 and nestin could be maintained at 80-95% after 4 days. Similar to findings with NSC-H14 cells, SOX2 and nestin expression decreased if the cells were cultured for too long and too dense, especially on day 13, a time point after which the decline in proliferation had occurred.
  • the cells in 2D was the most sensitive in cutlure density, as shown by the significant loss of Ki67 and NSC proteins on day 13. Many cells were found dying and floating in the 2D cultre at this time point while the cell morphology lost regular 2D NSC-like features.
  • 6CS scaffold-cultivated cells sustained NSC proteins and Ki67+ percentage similar to the standard 2D culture. Scaffold 4CS maintained the percentage sometimes similar to that of 2D, but more consistent results were found on 6CS. Lowered chitosan concentration and CHA scaffolds sometimes could also yield data similar to that of 6CS but varied considerably from batch to batch.
  • the cells that survived and proliferated in the scaffolds were populations enriched with NSC protein expression, the population likely with better self-renewal capability.
  • the 3D scaffold microenvironment likely posed a selection condition where differentiating, apoptotic, quiescent, or senescent cell population detached from the scaffold surface, leaving most cells with higher NSC protein expression.
  • SOX2 and nestin subcellular location and their effect on NSC maintenance is briefly discussed here. Both SOX2 and nestin are known to be involved in NSC maintenance and could protect NSCs from apoptosis.
  • SOX2 is expressed at high level in adult stem cells, especially multipotent, lineage committed cells of neural or epithelial fate, playing a role in self-renewal and symetrical proliferation of stem cells.
  • SOX2 was found to regulate self-renweal of NSCs through EGFR signaling feedback loop and inhibit mitochondria-dependent apoptosis related to caspase-9 activation.
  • S0X2 when the expression is promoted by AKT activity, could inhibit NSC differentiation, such as by surpressing GFAP transcription.
  • SOX2 overexpression and reduction in SOX2 level could impair self-renewal capacity; one way, for example, through cyclin kinase activity, p21/p53-mediated SOX2 overexpression was found leading to replicative stress and then senescence.
  • PI3K/AKT pathway could sustain SOX2 at a proper level, whereas in return, SOX2 Zrans-activates PI3KCA and 0PA1 genes thereby activating a positive feedback loop for PI3K/AKT signaling.
  • SOX2 was found to be a immediate functional downstream Akt target, but not affected through Akt-mTOR pathway. SOX2 protein failed to function if degraded by cytoplasmic proteasomes, as a result of impaired nuclear import.
  • This subcellular distribution could also be regulated by AKT.
  • PI3K/AKT pathway inhibition could lead to SOX2 translocation from nucleus to cytoplasm; inhibition of Akt led to SOX2 cytoplasmic retention.
  • the mechanism of SOX2 and proliferation was still unclear, and the effect varied in different tissues, with various molecular associations found.
  • the aforementioned 0PA1 protein drives mitochondrial fusion and could induce senescence-associated mitochondrial elongation. Mitochondrial dysfunction could deplete adult NSC pool and impair neurogenesis, namely, affecting proliferation and neuronal maturation.
  • RT-qPCR was performed on cells extracted after 4 days of culture. All expression levels were normalized to those of 2D control which was set as 1-fold (FIG. 8). All NSC multipotency markers, PAX6, SOX1, SOX2 and nestin, were expressed for all 3D condition 1-4 fold higher than 2D; yet CHA promoted 7-13 fold upregulated PAX6, SOX1, and SOX2, with nestin similar to 2D. The results correlated to the immunostaining where nestin on CHA was lower than chitosan scaffolds.
  • DCX is often considered as neuronal progenitor marker, associated with immature neurons, neuron migration, and expressed transiently during neurogenesis.
  • GFAP is a common marker of astrocytes and glial cells, but also astrocyte-like proliferating multipotent neural stem/progenitor cell population in adult brain. It was likely chitosan scaffolds promoted the NSC maintenance and self-newel population, whereas simultaneously a small fraction of cells was primed towards early neuro-glial phenotype.
  • CHA scaffolds promoted spherical-like aggregates and could also likely promote astrocytic differentiation.
  • a number of studies reported that neurospheres, spherical cellular aggregates, enriched astrocyte differentiation efficiency and GFAP expression.
  • Other lineage- specific markers were downregulated or similar to those in 2D controls, including 0LIG2, TBR1, and TUBB3.
  • TBR1 is expressed in neuron subtypes, glutamatergic and cortical neurons, regulating neuron projection in neurodevelopment with other transcription factors.
  • TUBB3 often signifies pan-neuronal and the existence of immature neurons.
  • 0LIG2, TBR1, and TUBB3 on 3D suggested the absence of intermediate and late differentiation stage of oligodendrocyte and neuron.
  • CHA scaffolds promoted upregulated GFAP and more loss of NSC markers according to flow cytometry analysis
  • 0LIG2 and TBR1 were downregulated as well, while TUBB3 maintained similar to that on 2D.
  • the transmembrane protein cadherins and integrins were either more activated or expressed at similar level to those on 2D control. Cell adhesion and proliferation likely was associated with the upregulation of E-cadherin and N-cadherin. More active integrin a5pi, a6pi, and avpi, also known to be assisting hNSC multipotency, were also upregulated. These mRNA gene expression analyses show cells on the scaffolds likely maintained the undifferentiated states through unique cell-cell and cell-matrix interaction. The chitosan scaffolds maintained NSC marker expression meanwhile suppressing oligodendrocytes development and neuronal maturation. Cells passaged from the 3D chitosan scaffolds maintain SQX2 and nestin
  • the multipotency of cells passaged from the scaffolds was exemplified by the proliferation and SOX2 and nestin expression.
  • Cells were passaged from 6CS scaffolds after 5 days and subsequently replated on 2D surface. The cells grew near confluency after 4 days of culture, similar to the rate of the cells on usual 2D control, indicating the cells preserved proliferation capacity.
  • the NSC multipotency markers, nuclear SOX2 and nestin, were strongly expressed in immunofluorescence staining.
  • porous scaffolds made of pristine medical grade chitosan were able to serve as a preferable 3D culture matrix for hNSC expansion and self-renewal in a chemically-defined conditions.
  • the scaffolds made of higher chitosan content were found to lead to stiffer structure with higher elastic modulus both macro- and microscopically.
  • Higher chitosan concentration supported cell adhesion, uniform cell spreading, a polarized morphology, which was found associated with higher proliferation rate as well as self-renewal capacity.
  • the level of NSC multipotency protein marker expression on the 6CS scaffolds was comparable to the level on standard 2D control coated with ECM extract.
  • chitosan scaffolds likely suppressed oligodendrocytes differentiation and neuronal maturation.
  • the cells collected from 6CS scaffold culture maintained proliferation and self-renewal capacity on a par with the standard 2D culture.
  • the porous 3D chitosan scaffolds offer advantages over other 3D culture systems involving complex designs. These 3D chitosan scaffolds were fabricated with simple and robust processes, which provides an ideal scalable solution for hNSCs generation in large quantity. The relatively cost-effective fabrication processes have tremendous potential for facilitating cGMP compliant manufacturing.
  • Chitosan is a versatile biopolymer already applied clinically, allowing rapid translation for clinical-grade stem cell generation. These chitosan 3D porous scaffolds can be utilized in various stem cell research, preclinical and clinical applications. Chitosan Thin Films
  • the present disclosure provides compositions useful for neural stem cell adhesion and proliferation, films comprising chitosan and chitin for neural stem cell adhesion and proliferation, and methods for using and fabricating the compositions and films.
  • compositions useful cell culture e.g., for neural stem cell adhesion and proliferation.
  • the composition comprises a linear heteropolysaccharide containing P-(l,4)-linked-D-glucosamine (GlcN) and P-(l,4)-linked-N-acetyl-D- glucosamine (GlcNAc), wherein the ratio of GlcN: (GlcNAc+GlcN) is from about 0.75 to about 1.00 (e.g., greater than about 0.78).
  • the ratio of GlcN: (GlcNAc+GlcN) is from about 0.93 to about 1.00.
  • the ratio of GlcN: (GlcNAc+GlcN) is about 0.93.
  • the composition comprises:
  • a linear heteropolysaccharide containing P-(l,4)-linked-D-glucosamine (GlcN) and P-(l,4)-linked-N-acetyl-D-glucosamine (GlcNAc) i.e., chitosan having a degree of deacetylation from about 75 to about 100% (e.g., 93%), as measured by NMR;
  • a linear heteropolysaccharide containing P-(l,4)-linked-D-glucosamine (GlcN) and P-(l,4)-linked-N-acetyl-D-glucosamine (GlcNAc) i.e., chitin
  • GlcN P-(l,4)-linked-D-glucosamine
  • GlcNAc P-(l,4)-linked-N-acetyl-D-glucosamine
  • the composition is in the form of a film.
  • the composition is advantageously transparent in the visible region of the electromagnetic spectrum to allow for monitoring of cell culture.
  • the composition advantageously maintains the undifferentiation of the neural stem cells (e.g., as well as collagen compositions).
  • chitosan refers to a linear heteropolysaccharide containing both P-(l,4)-linked-D-glucosamine (GlcN) and P-(l,4)-linked-N-acetyl-D- glucosamine (GlcNAc) monomers and having a degree of deacetylation about 75 to about 100% (e.g., about 93%, such as 93.41%), as measured by !ll NMR.
  • chitin refers to a linear heteropolysaccharide structure containing both P-(l,4)-linked-D-glucosamine (GlcN) and P-(l,4)-linked-N-acetyl-D-glucosamine (GlcNAc) monomers and having a degree of deacetylation of about 0 to about 15% (e.g., about 4%, such as 3.62%), as measured
  • FIGS. 9A and 9B The chemical structures and representative f! NMR spectra of chitosan and chitin are shown in FIGS. 9A and 9B, respectively.
  • the chemical structure of chitosan and its NMR spectrum indicating the monomer D-glucosamine (GlcN) with deacetylated amine NFh and the monomer A-acetyl-D-glucosamine (9A) and the NMR spectrum of chitin polymer, with a higher peak from A-acetyl groups (9B).
  • films comprising chitin and chitosan are provided.
  • the film comprises:
  • chitin in an amount from 0 to about 90 percent by weight based on the total weight of the film, wherein the chitin has a degree of deacetylation from about 0 to about 15 percent, as measured by !H NMR;
  • chitosan in an amount from about 10 to about 100 percent by weight based on the total weight of the film, wherein the chitosan has a degree of deacetylation from about 75 to about 100 percent, as measured by 1 H NMR, and wherein the film has a degree of deacetylation from about 75 to about 100 percent.
  • the film includes from about 0 to about 15 percent chitin. In certain embodiments, the chitin has a degree of deacetylation of about 4 percent.
  • the film includes from about 85 about 100 percent chitosan. In certain embodiments, the chitosan has a degree of deacetylation of about 93 percent.
  • the film has a degree of deacetylation from about 85 to about 100 percent.
  • the film includes from about 0 to about 15 percent chitin and the chitin has a degree of deacetylation of about 4 percent; about 85 about 100 percent chitosan and the chitosan has a degree of deacetylation of about 93 percent; and the film has a degree of deacetylation from about 85 to about 100 percent.
  • the film has a degree of deacetylation from about 75 to about 100 percent, and in other embodiments, the film has a degree of deacetylation from about 85 to about 100 percent (e.g., 85 percent). In a further embodiment, the film has a degree of deacetylation greater than about 14 percent (e.g., from about 14 to about 93 percent).
  • the film has a degree of deacetylation of about 90 to about 100 percent.
  • the film comprises 100 percent chitosan.
  • the degree of deacetylation of chitosan is from about 78 (e.g., 78.39) to about 94 (e.g., 93.41) %, which promotes neural stem cell adhesion, proliferation, and maintenance of multipotency.
  • medical grade chitosan is commercially available and has the degree of deacetylation 98.3 ⁇ 0.1%, which has a higher DD than the chitosan in the methods described herein.
  • Representative films of the disclosure have thicknesses from about 50 pm to about 1 mm; water contact angles from about 35 to about 60°, and elastic modulus from about 25 to about 40 MPa.
  • the chitin has a molecular weight from about 1 to about 500 kDa (e.g., from about 1 to about 250 kDa).
  • the chitosan has a molecular weight from about 1 to about 500 kDa (e.g., from about 1 to about 250 kDa).
  • the disclosure provides methods for culturing cells, comprising introducing cells to be cultured onto a chitin/chitosan film described herein and culturing the cells introduced into the film.
  • the cells are neuron stem cells, human induced pluripotent cells (hiPSC)-derived neural progenitor cells, or neuron cells.
  • the cells are stem cells (e.g., human neural stem cells).
  • the cultured cells are human neural stem cells and the film comprises chitosan having a degree of deacetylation from about 94 to about 98%. In other of these embodiments, the cells are human neural stem cells and film comprises 100 percent chitosan.
  • the disclosure provides methods for fabricating chitin/chitosan films.
  • the method comprises:
  • the film includes from about 0 to about 15 percent chitin.
  • the film includes from about 85 to about 100 percent chitosan.
  • the film has a degree of deacetylation from about 75 to about 100 percent.
  • the film includes from about 0 to about 15 percent chitin, from about 85 to about 100 percent chitosan, and the film has a degree of deacetylation from about 75 to about 100 percent.
  • chitin is present in the film in an amount from 0 to about 90 percent by weight based on the total weight of the film, wherein the chitin has a degree of deacetylation of about 3 percent as measured by ll NMR.
  • chitosan is present in the film in an amount from about 10 to about 100 percent by weight based on the total weight of the film, wherein the chitosan has a degree of deacetylation of about 94 percent as measured by 1 H NMR.
  • the film has a degree of deacetylation from about 15 to about 94 percent.
  • chitin is present in the film in an amount from 0 to about 90 percent by weight based on the total weight of the film, and the chitin has a degree of deacetylation of about 3 percent as measured by ll NMR; chitosan is present in the film in an amount from about 10 to about 100 percent by weight based on the total weight of the film, and the chitosan has a degree of deacetylation of about 94 percent as measured by H NMR; and the film has a degree of deacetylation from about 15 to about 94 percent.
  • chitin and chitosan solutions can include from about 0.1 to about 1.0% by weight chitin or chitosan, respectively. Higher concentrations of chitosan and chitin are not very soluble and lower concentrations do not provide strong and useful films.
  • the amount of chitin in the chitin solution is about 0.3 percent by weight and the amount of chitosan in the chitosan solution is about 0.3 percent by weight based on the total weight of the film (e.g., 0.3 percent chitosan in formic acid and 0.3 percent chitosan in formic acid, and both are mixed to form chitosan/chitin film based on their weight ratio, as described herein).
  • Films with chitosan-to-chitin ratio of 100%, 80%, 60%, 40%, 20% and 10% are denoted by R100, R80, R60, R40, R20 and R10.
  • the chitin and chitosan solutions are dichloroacetic acid, trichloroacetic acid, potassium hydroxide, phosphoric acid, or formic acid solutions. In one embodiment, the chitin and chitosan solutions are formic acid solutions.
  • neutralizing the dried film comprises neutralizing with a basic solution (e.g., ammonium hydroxide, deionized water, and methanol).
  • a basic solution e.g., ammonium hydroxide, deionized water, and methanol.
  • the film a chitin/chitosan film as described herein.
  • DD of chitosan and chitin were determined by ! H NMR analysis as shown in FIGS. 9A and 9B.
  • X H-NMR 300 MHz, 2.5% DC1/D 2 O, 25°C, ⁇ 5: 1.95 (s, H- Acetyl of GluNAc), 3.03 (s, H-2 of GlcN), 4.50 (s, H-l of GlcNAc), 4.80 (s, H-l of GlcN), 2.75 - 4.15 (m, H-2/6).
  • Uniform films were made by dissolving and blending pure chitosan and chitin powder. Films of varying overall DD were made by changing chitosan-to-chitin ratio of the polymer blends (FIG. 1C and Table 1) so the overall DD could be calculated based on the DD of pure chitosan and chitin. A film of any DD could be made by this approach with batch-to-batch consistency.
  • Another major advantage of this blending approach is the avoidance of sourcing chitosan and chitin supplied at different DD or employing additional chemical treatments.
  • Manufacturers have made products from various sources of raw materials, such as marine crustaceans, insects, or fungi, which could result in different levels of product purity.
  • raw materials such as marine crustaceans, insects, or fungi
  • the source of raw materials and processing procedures adopted by different suppliers would likely invoke inconsistent biochemical properties. Elemental analysis showed residual minerals and proteins in chitosan after extraction; the presence of trace heavy metals and endotoxins in some products limits the interpretation of pharmacological investigations.
  • the surface of the films was characterized in terms of transparency, hydrophilicity, roughness, zeta potential, and elastic modulus.
  • the surface physiochemical properties affect the adhesion and expansion of stem cells.
  • the films were neutralized by an ammonia hydroxide-methanol solution, a mild base neutralization buffer that does not incur further deacetylation.
  • formic acid used in fabrication procedures is considered volatile and usually evaporates without leaving residue, the neutralization step avoided undesired dissolution in acidic aqueous solutions introduced by acid residue with the addition of water during any characterization procedures.
  • FIGS. 10A and 10B Surface features of the samples were examined optically and under scanning electron microscope (SEM: FIGS. 10A and 10B).
  • the films exhibited flat and smooth surface texture throughout different chitosan/chitin ratios at low magnification and minor textured features as the content of chitosan decreased.
  • the films were transparent for real-time observation of the cells.
  • the surface hydrophilicity (FIG. IOC) was evaluated with a goniometer to determine the contact angle of a water droplet immediately after contact ( ⁇ 60 seconds). The contact angle increases as the ratio of chitosan to chitin increases, suggesting a decrease in hydrophilicity with increasing DD.
  • the monomer GluNAc is generally considered more hydrophobic than a GluN unit.
  • a number of studies showed that the hydrophilicity of chitosan decreases with DD or has no association with DD. However, in these studies, the samples did not contain chitin and DD was between 50 - 95%.
  • the hydrophilicity and wettability are not only influenced by the quantity of GluN and GluNAc monomers, but also by polymer chain packing, crystallinity, and distribution of the GluN and GluNAc.
  • An early study shows hydrophilicity (determined by swelling) of chitosan decreased as DD increased from 70 to 95% due to an increase in crystallinity of GluN of chitosan.
  • the films described herein are made of a mixture of chitosan of high DD and chitin of low DD.
  • Water contact angle analysis demonstrated that the surface wettability increased with the reduction of DD, likely due to a slight increase in roughness when more chitin was involved. This likely resulted in the formation of micro- to nanoscopic clusters of chitin which has inherited high crystallinity.
  • FIG. 12A shows representative elastic modulus mapping, suggesting a general increase in elastic modulus with a reduction in DD.
  • FIG. 12B presents the elastic moduli of dried chitosan/chitin films.
  • the elastic modulus increased as the chitosan content decreased from R100 to R80. However, no further increase in modulus was found on films R80 to R20.
  • the initial increase in local elastic moduli from R100 to R80 may be attributed to chitin’s more rigid polymer chain and the overall higher degree of crystallinity in the film.
  • a similar increase in modulus with decreasing DD was found in the hydrated films as shown in FIG. 12B.
  • the moduli for hydrated samples decreased by 3 orders of magnitude, especially for the R100 surface, which displayed 11 kPa forward and 20 kPa backward.
  • the range of hydrated samples corresponds to human soft tissue with elastic moduli ranging from hundreds to thousands of pascals.
  • a significant increase in moduli was found with a rise in chitin content, especially from R20 with 73 kPa to RIO with 255 kPa. The more distinct differences between R20 and RIO were presented in contact angle analysis as well.
  • the surface properties including wettability, topography, zeta potential, and mechanical elastic modulus, indicated that the chitosan/chitin films fabricated at varying DD were transparent, uniform films.
  • the physiochemical properties are suitable for consistent hNSC studies to investigate the influence of DD on chitosan-based culture substrates.
  • FIG. 13A The influence of DD of chitosan/chitin films on the adhesion and proliferation of hNSCs compared to cells cultured on Geltrex and collagen was examined.
  • the viability data was presented relative to Geltrex-coated surface since it was the standard culture substrate for hNSC-H14 cell line.
  • Geltrex provides the microenvironment to support proliferative NSC cell status (FIG. 13B).
  • DD higher DD is generally preferable for hNSC adhesion and survival.
  • the interaction between hNSCs and chitosan films could be mostly electrostatic in nature, similar to many other adherent mammalian cells.
  • the chitosan/chitin films with higher DD provided a greater number of protonated amine groups (-NH3 + ) under physiological pH, as indicated by zeta potential analysis. Positively charged substrates foster initial cell adhesion through electrostatic interactions on the films.
  • chitin with mostly A-acetylglucosamine as monomers, does not provide a similar interaction.
  • the prolonged adhesion status of adherent NSCs may require specific binding ligands on culture substrates, regulating cell polarity, migration, and proliferation through various cell transmembrane receptor-mediated pathways, such as MAPK signaling, which is required for hNSC maintenance.
  • This microenvironment could be found on Geltrex- coated surfaces as it provides a mixture of native mouse ECM proteins and is rich in laminin, entactin, collagen IV, and other glycoproteins and proteoglycans which stimulate a broad classes of integrin subunits.
  • chitosan could promote expression of integrin a6 by keratinocyte stem cells at a similar level to hyaluronic acid and natural glycosaminoglycans, such as chondroitin sulfate and heparin sulfate proteoglycans. Additionally, the positive charge on chitosan could influence electrostatic-mediated integrin interactions. Many integrin-binding motifs on natural ECM components are acidic peptides, of which the smaller basic or acidic residues could fit into different integrin domains.
  • chitosan could interact with and induce conformational changes of integrin aVp3 on human epithelial colorectal adenocarcinoma cells, thereby disrupting tight junctions. These effects could contribute to hNSC adhesion and survival despite the lack of natural ECM proteins such as collagen or laminin.
  • FIG. 14A Analysis of cell proliferation marker Ki67 (FIG. 14A) also supports the above findings, suggesting higher proliferation on films with higher DD.
  • Film R100 maintained the highest Ki67 + positive population among all chitosan/chitin films, presenting a higher to comparable percentage of proliferative population as the collagen substrates.
  • the undifferentiated proliferation characterized by Ki67 + /SOX2 + also showed that R100 was superior in maintenance of hNSC among all films (FIG. 14B). Indeed, the expression of SOX2 was recognized as necessary for NSC self-renewal and proliferating neural progenitors.
  • Immunofluorescence microscopy shows the expression of intermediate filament protein nestin in R100 is similar to those in collagen, with all cells displaying stained nestin.
  • SOX1 and PAX6 the expression on R100 and collagen appeared to be translocated to both nucleus and cytoplasm, different from nuclear localization in Geltrex.
  • the nuclear translocation of SOX1, SOX2, and PAX6 indicates their function as transcription factors to support NSC long-term self-renewal and potency. Nuclear localization of the transcription factors is often associated with multipotent lineages, while cytoplasmic restricted expression suggests differentiated phenotypes.
  • the NSC proteins were highly expressed in cells sustained in culture for all conditions, the cytoplasmic SOX1 and PAX6 were discernible in films with lower DD (R40, R20, and RIO), suggesting a possible loss of multipotency. Additionally, the fluorescence intensity indicated the expression of the proteins was not uniform in low DD conditions, reflecting loss of positive population in flow cytometry analysis, whereas R100 and collagen present even distributions of NSC marker proteins similar to Geltrex.
  • the cells harvested from the substrate made of pure chitosan with 94% DD demonstrated the ability of neuronal differentiation. The results demonstrated that the pure chitosan at R100 with high DD at 94% promoted similar multipotent hNSC phenotype and proliferation capacity to the ones grown on collagen substrates.
  • Adhesion-mediated signaling maintains morphological polarity of hNSCs on a substrate and regulates proliferation, multipotency and neurogenesis.
  • Integrins are heterodimeric transmembrane glycoproteins that could be activated by a variety of ECM molecules. Human integrin family comprises 24 different members by combining 18 kinds of a subunits and 8 kinds of P subunits. Integrins not only serve as cell-ECM adhesion regulators, but also mediate anchorage-dependent signaling, including FAK, PI3K, ERK, and PAK, which stimulate cell cycle progression, survival, and migration.
  • the cells formed aggregates due to lack of bioactive substrates in a plain polystyrene well. In the non-coat condition, the integrin expression was supported by ligands secreted by the cells that promoted aggregation. The cells did not proliferate nor survive well based on qualitative observation.
  • the integrins a5, aV, P3, P5, P6, and P8 are receptors of RGD peptide; integrins a3, a6, a7 and P4 are laminin receptors; integrin pi could bind to ligands on various ECM proteins including fibronectin, laminin, and collagen. Activation of a6 and pi associated with laminin promoted adhesion and symmetric proliferation of neural stem cells. Additionally, integrins a2, a4, a5, pi and P8 support neural stem cell polarity and proliferation in the native niche.
  • the present disclosure provides an effective method to consistently fabricate chitosan-based thin films with a wide range of degrees of deacetylation.
  • This approach avoided additional intensive chemical treatments and accordingly extra characterization procedures to generate samples of varied DD; instead, the DD of the culture substrate is controlled merely through adjusting the polymer ratio of chitosan to chitin.
  • the resulting films were uniform, consistent, and transparent.
  • the DD variation allows the investigation of hNSC response to chitosan/chitin materials of different DD.
  • the results described herein provide insights in the widely used chitosan/chitin-based materials for biomedical applications, in which the effect of DD was sparsely investigated, especially regarding the interaction with hNSCs.
  • Chitosan films of high DD maintained significant populations of proliferative, multipotent hNSCs as determined by immuno staining of NSC marker proteins SOX1, SOX2, nestin, and PAX6. These are supported by the activation of a specific set of integrin subunits that mediate hNSC cellular signaling.
  • low DD led to a decrease in expression of these proteins and loss of cell attachment, promoting the formation of cell spheroids.
  • the expression of NSC transcription factors was found to highly correlate with proliferation marker Ki67 and with the increase in cell number.
  • All scaffolds were prepared by lyophilizing polymer solutions in multiwell plates and sliced into 800 pm thickness. Prior to lyophilization, the polymer solutions were homogenized in a Thinky mixer (ARM300, Thinky USA, Madison Hills, CA) at 2000 rpm for 3 minutes for 3-5 times, followed by mixing in a blender for 5 minutes twice. The solutions were further mixed in the Thinky mixer until they were homogeneous, bubbles removed; and then casted in 24-well plates for lyophilization.
  • the pure chitosan scaffolds were prepared by dissolving medical grade chitosan (degree of deacetylation 98.3+ 0.1%, Matexcel, Cat.
  • the CHA (4CHA) scaffold was prepared similarly by blending 4 wt% chitosan solution with 1 wt% hyaluronic acid sodium salt (Streptococcus equi, Millipore Sigma, Cat. 53747, 1500-1800 kDa).
  • the chitosan scaffolds were named according to their polymer concentration as xCS, where x represents 6, 4, 2, 1, or 0.5 wt%.
  • each scaffold was examined using SEM, before and after the degradation study.
  • SEM SEM
  • the lyophilized scaffolds were sectioned into 400 pm thickness slices with vibratome and attached on SEM pin stubs by carbon conductive adhesive tape (NEM Tape, Nisshin EM. Co. Ltd. Tokyo, Japan).
  • the samples were imaged using a TM3000 tabletop SEM (Hitachi, Tokyo, Japan) operating at 5 kV.
  • 6-8 images were used for measuring pore diameter with ImageJ to acquire 50 different measurements for each condition.
  • the change in size (height and diameter) of the scaffolds and the weight were measured before and after scaffold hydration. After taking the measurement, the dry scaffolds were neutralized in a solution prepared by mixing ammonium hydroxide solution with methanol, washed in DI water, and then immersed in PBS. The dimensions and weight were measured again. The swelling behavior was represented as change in weight (as foldincrease after absorbing water), changes in volume (%), and corresponding change in density.
  • the elastic moduli were assessed by Nanosurf FlexAFM (Nanosurf AG, Switzerland). A series of 16 x 16 force-distance curves were made in a region of 1.5 x 1.5 nm. Measurements of 3 different random spots on each scaffold were taken under ambient conditions using a contact mode AFM probe (Contact-G from BudgetSensor) with spring constant 0.2 N/m and 13 kHz resonance frequency. The hydrated scaffold slices were fixed to an aluminum holder with double- sided tap mounted on the AFM stage with magnets. The mean elastic modulus was calculated applying Hertz contact model on the forcedistance curve implemented in ANA control and analysis software (Automated Nanomechanical Analysis, Nanosurf AG, Switzerland) and Scanning Probe Image Processor software (SPIP; Image Metrology, Denmark). Mappings of elastic modulus were processed with ANA software.
  • ANA control and analysis software Automated Nanomechanical Analysis, Nanosurf AG, Switzerland
  • SPIP Scanning Probe Image Processor software
  • the scaffolds were immersed in Neurobasal medium under stir and placed in a 37°C incubator supplied with 4% CO2 atmosphere.
  • the scaffolds were sampled every 7 days; weight was measured after flash frozen in liquid N2 and lyophilized. The incubation continued up to 35 days. The samples from day 35 were imaged with SEM as described above.
  • Human neural stem cells hNSC-H14 (WB0195), derived from the NIH-approved hESC-H14 (WA14), were obtained from WiCell Research Institute (Madison, WI, USA). The cells were expanded and cultured according to the WiCell NSC protocol. Briefly, the cells were cultured on Geltrex-coated tissue culture dishes as a monolayer and supplied with fresh medium every other day. Human recombinant basic fibroblast growth factor (bFGF, Gibco) and epidermal growth factor (EGF) were supplied every day at 20 ng/mL.
  • bFGF basic fibroblast growth factor
  • EGF epidermal growth factor
  • the NSC culture medium contains Neurobasal medium (Gibco) supplemented with bFGF, EGF, B27, N2, MEM NEAA, heparin, and GlutaMAX. Cells were passaged every 3-5 days and dissociated with Versene when > 90% confluent. The cells used in the experiments were at P32-P42.
  • the human ReNcell VM cell line was purchased from EMD MilliporeSigma (Cat. SCC008, Burlington, MA) and cultivated in the paired ReNcell NSC maintenance medium (Cat. SCM005) according to the manufacture’s protocol. The medium was supplemented with 20 ng/mL bFGF and 20 ng/mL EGF added freshly when changing medium.
  • the standard 2D cultures of ReNcell were on laminin-coated tissue culture plates, following manufacture’s protocol.
  • the cells used in the experiments were at P4-P8. Cells were maintained in a humidified incubator with 5% CO2 at 37°C. Prior to cell plating, the hydrated scaffolds were further sterilized in 70% ethanol, and rinsed in PBS. The scaffolds were either stored in PBS or immersed in Neurobasal medium for at least 30 minutes before cell plating.
  • Morphological features of the cells were monitored with a Nikon TE300 inverted microscope (Nikon, Tokyo, Japan) after incubation with Calcein AM at 1 pM and ethidium homodimer-1 at 4 pM in culture medium for 15 minutes.
  • cells were dissociated from the scaffolds into single cells using Accutase.
  • the collected cells were stained with LIVE/DEAD fixable yellow dead cell stain kit (1:4000, Invitrogen; Carlsbad, CA) before being fixed in 2% paraformaldehyde for 10 minutes.
  • LIVE/DEAD fixable yellow dead cell stain kit (1:4000, Invitrogen; Carlsbad, CA) before being fixed in 2% paraformaldehyde for 10 minutes.
  • the cells Prior to staining, the cells were permeabilized in 0.5 %N/N Triton-X 100, washed and then resuspended in PhosFlow PermWash Buffer I (BD Bioscience, San Jose, CA). Fluorophore-conjugated antibodies were added at a ratio suggested by the supplier in 100 pL cell suspension.
  • TBR1 Reverse GACGGCGATGAACTGAGTCT (SEQ ID NOG)
  • CDH1 Reverse CGTACATGTCAGCCAGCTTC (SEQ ID NO:20)
  • Chitin (Millipore Sigma, Burlington, MA) and chitosan (MW 100-200 kDa; MarkNature®, Qingdao, China) solutions were prepared separately by dissolving the powder in formic acid both at 0.3% w/w, respectively.
  • the two solutions were mixed at chitosan/chitin mass ratio of 100/0, 80/20, 60/40, 40/60, 20/80, and 10/90 to generate mixtures with a DD gradient.
  • Each mixture was vortexed for 30 seconds to form homogenous mixing.
  • Each mixture was casted into a tissue culture plasticware at 3 mL for a 35 mm Petri dish or 0.3 mL/well for 48-well plates.
  • IH2-H6 represents the integral of the proton on the monomer hexose rings.
  • In-Acetyi represents the integral of protons on the acetylated units, GlcNAc.
  • the DD of the films were calculated based on the mixing ratio of chitosan to chitin.
  • the chitin and chitosan polymer chains were approximated as simple stacking of GlcN and GlcNAc molecules.
  • the chitosan/chitin mixing mass ratio was converted to the molar ratio of GlcN (161.2 g/mol) to GlcNAc (203.2 g/mol) taking into account the molecular weight of the monomers.
  • the DD of films was finally defined as the percentage of GlcN molecules to the total number of molecules of GlcN + GlcNAc.
  • the surface wettability of the films was characterized by water contact angle analysis using a contact angle goniometry (Rame-Hart instrument, Succasunna, NJ, USA). To prepare the samples for analysis, films were first cast onto microscope glass slides following the same protocol as described above. The contact angle was measured immediately after carefully placing a droplet of 5 pL DI water on the film coated glass slide using micropipette. Five measurements at random locations throughout the surface for each chitosan/chitin film were taken.
  • the surface charge of the chitosan/chitin films was evaluated via zeta potential analysis on an electrokinetic analyzer SurPASS 3 (Anton Paar GmBH, Graz, Austria). For each measurement, a piece of the sample was fixed on the sample holder Adjustable Gap Cell (with a cross-section of 20 mm x 10 mm) using double-sided adhesive tape. The distance between the sample pieces was adjusted to 110 + 10 pm. A 1 mM KC1 electrolyte solution was used, and the pH was automatically adjusted with 0.05 M NaOH and 0.05 M HC1. The pH dependence of the zeta potential was determined in the range of pH 6-9. The pressure was in the range of 200-600 mbar.
  • AFM Atomic Force Microscopy All AFM measurements in this work were performed using a Nanosurf EasyScan atomic force microscope (Nanosurf AG, Switzerland). Scanning probe microscopy was performed via force modulation mode to monitor the topography of the sample simultaneously with nanomechanical measurements. An optical microscope was combined with the AFM to be able to control tip and sample positioning. The measurements were performed under both ambient and aqueous environment conditions using a silicon nitride (ContAl-G) tip with nominal spring constant of 0.2 N/m and 13 kHz resonance frequency. The spring constant of cantilevers probe used for the force measurements was calibrated by thermal tuning for thermal noise response.
  • ContAl-G silicon nitride
  • the deflection sensitivity of the probes was obtained by taking the average of at least 10 force curves on a mica substrate in buffer.
  • the Petri dishes with film samples were fixed to an aluminum holder with double-sided tape mounted on the AFM stage with magnets. Prior to analysis, the samples equilibrated in buffer solution at room temperature for hours to extinguish thermal drift.
  • the images were processed with Scanning Probe Image Processor software (SPIP; Image Metrology, Denmark). Contrast-enhanced images were obtained by applying a correlation averaging procedure to analyze repeating molecular units and by applying a low-pass filter.
  • Human neural stem cells hNSC-H14 (WB0195), derived from the NIH-approved hESC-H14 (WA14), were obtained from WiCell Research Institute (Madison, WI, USA). The cells were expanded and cultured following WiCell NSC protocol. Briefly, the cells were cultured on Geltrex-coated tissue culture dishes as a monolayer and supplied with fresh medium every other day. Human recombinant basic fibroblast growth factor (bFGF, Gibco) and epidermal growth factor (EGF) were supplied every day at 20 ng/mE.
  • bFGF basic fibroblast growth factor
  • EGF epidermal growth factor
  • the NSC culture medium contains Neurobasal medium (Gibco) supplemented with bFGF, EGF, B27, N2, MEM NEAA, heparin, and GlutaMAX. Cells were passaged every 3-5 days and dissociated with Accutase. Cells were maintained in a humidified incubator with 5% CO2 at 37°C.
  • Neurobasal medium Gibco
  • the viability was proportional to metabolic activity determined by alamarBlue reagents incubated with cells and consistent with visual monitoring of the surviving population under microscope.
  • the cells were monitored with phase contrast microscopy acquired using a Nikon TE300 (Nikon, Tokyo, Japan) inverted microscope.
  • a Human Neural Stem Cell ICC kit (Cat. A24354, Thermo Fisher Scientific, Waltham, MA, USA) was used to characterize NSC marker protein expression (SOX1, SOX2, nestin, PAX6) following the manufacturer’s protocol. Briefly, the cells were cultured as described above but on coated glass slides. After 5 days, the cells were rinsed with PBS, fixed with cold 4% paraformaldehyde for 10 minutes at room temperature, permeabilized for 10 minutes, blocked for 1 hour, and stained with primary antibodies at 4°C overnight. Cells were then incubated with secondary antibodies for 1 hour at room temperature, washed three times and stained with DAPI before being mounted in Prolong Gold antifade reagent (Invitrogen; Carlsbad, CA). Fluorescence images were acquired using a Nikon TE300 (Nikon, Tokyo, Japan) inverted microscope.
  • Cells were dissociated from the films with Accutase, washed in PBS, fixed in 4% paraformaldehyde for 15 minutes, permeabilized in 0.1 %N/N Triton-X 100 in PBS, and then washed with PhosFlow PermWash Buffer (BD Bioscience, San Jose, CA). The cells were resuspended in 100 pL cell PermWash Buffer, incubated with fluorophore-conjugated antibodies for 30 minutes on ice in dark, washed with PermWash Buffer, and resuspended in 0.3 mL Cell Staining Buffer (BioLegend; San Diego, CA).
  • RNA samples were analyzed on a LSRII flow cytometer (BD Bioscience) and analyzed using the FlowJo software (Tree Star, Ashland, OR).
  • the antibody Alexa Fluor® 488 anti- Ki67 (350508) and isotype controls were purchased from BioLegend and used as suggested by the supplier.
  • the antibody PE anti-nestin (BDB561230) and Alexa Fluor® 647 anti-SOX2 (BDB560302) were purchased from BD Bioscience and used as suggested by the supplier (BD Bioscience). Integrin expression analysis by real-time quantitative PCR (RT-qPCR)
  • RNA was Total RNA extracted using RNeasy Mini Kit (Qiagen, Valencia, CA) and cDNA was generated from RNA using iScript cDNA Synthesis Kit (Bio-Rad, Hercules, CA). Selected genes were amplified using SsoAdvanced SYBR Green Supermix (Bio-Rad) in a Bio-Rad CFX96 Real-Time PCR Detection System using Bio-Rad CFX Manager software with thermal cycles at 95 °C for 3 minutes at followed by 40 cycles of 95 °C for 15 seconds, 58°C for 40 seconds, and 72°C for 30 seconds.
  • the mRNA gene expression was analyzed in Bio-Rad CFX Manager software and presented in fold changes ( ⁇ standard error of means) relative to Geltrex controls calculated using Cq values for each gene normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH) of each sample.
  • GPDH glyceraldehyde-3-phosphate dehydrogenase

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Polymers & Plastics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Materials Engineering (AREA)
  • Manufacturing & Machinery (AREA)
  • Biochemistry (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Neurosurgery (AREA)
  • Microbiology (AREA)
  • Neurology (AREA)
  • Molecular Biology (AREA)
  • General Engineering & Computer Science (AREA)
  • Developmental Biology & Embryology (AREA)
  • Materials For Medical Uses (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Les lésions traumatiques du système nerveux central et les maladies neurodégénératives entraînent souvent la perte permanente de tissu neuronal, une invalidité à vie, la morbidité, et un effet dévastateur sur la vie des patients et de leurs familles. L'invention concerne des échafaudages de chitosane poreux et des films minces de chitosane utiles pour l'adhésion, l'entretien et la prolifération de cellules souches neurales, ainsi que des procédés d'utilisation et de fabrication desdits échafaudages et films minces.
PCT/US2023/064698 2022-03-21 2023-03-20 Échafaudages et films minces de chitosane pour l'expansion de cellules souches neurales humaines WO2023183769A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202263322135P 2022-03-21 2022-03-21
US63/322,135 2022-03-21
US202263359551P 2022-07-08 2022-07-08
US63/359,551 2022-07-08

Publications (1)

Publication Number Publication Date
WO2023183769A1 true WO2023183769A1 (fr) 2023-09-28

Family

ID=88102157

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/064698 WO2023183769A1 (fr) 2022-03-21 2023-03-20 Échafaudages et films minces de chitosane pour l'expansion de cellules souches neurales humaines

Country Status (1)

Country Link
WO (1) WO2023183769A1 (fr)

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4301067A (en) * 1979-06-05 1981-11-17 Kureha Kagaku Kogyo Kabushiki Kaisha Chitin containing poly-ion complex
US20060089584A1 (en) * 2001-06-14 2006-04-27 Mcadams Staci A Compositions, assemblies, and methods applied during or after a dental procedure to ameliorate fluid loss and/or promote healing, using a hydrophilic polymer sponge structure such as chistosan
WO2009150651A1 (fr) * 2008-06-11 2009-12-17 Chi2Gel Ltd. Mélanges de chitosans formant un hydrogel injectable
US20110076254A1 (en) * 2009-09-28 2011-03-31 University Of Washington Porous scaffolds for stem cell renewal
WO2020186021A1 (fr) * 2019-03-13 2020-09-17 Virginia Commonwealth University Procédé de formation de structures souples et biodégradables à partir de biopolymères de chitine de faible poids moléculaire
US20210147813A1 (en) * 2018-04-03 2021-05-20 University Of Central Florida Research Foundation, Inc. Drug screening platform using biomaterial scaffolds

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4301067A (en) * 1979-06-05 1981-11-17 Kureha Kagaku Kogyo Kabushiki Kaisha Chitin containing poly-ion complex
US20060089584A1 (en) * 2001-06-14 2006-04-27 Mcadams Staci A Compositions, assemblies, and methods applied during or after a dental procedure to ameliorate fluid loss and/or promote healing, using a hydrophilic polymer sponge structure such as chistosan
WO2009150651A1 (fr) * 2008-06-11 2009-12-17 Chi2Gel Ltd. Mélanges de chitosans formant un hydrogel injectable
US20110076254A1 (en) * 2009-09-28 2011-03-31 University Of Washington Porous scaffolds for stem cell renewal
US20210147813A1 (en) * 2018-04-03 2021-05-20 University Of Central Florida Research Foundation, Inc. Drug screening platform using biomaterial scaffolds
WO2020186021A1 (fr) * 2019-03-13 2020-09-17 Virginia Commonwealth University Procédé de formation de structures souples et biodégradables à partir de biopolymères de chitine de faible poids moléculaire

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BAHRAMI S. BAHRAM, SOHEILA S. KORDESTANI, HAMID MIRZADEH, PARVIN MANSOORI: "Poly (vinyl alcohol) -Chitosan Blends: Preparation, Mechanical and Physical Properties ", IRANIAN POLYMER JOURNAL, vol. 12, no. 2, 2 December 2003 (2003-12-02), pages 139 - 146, XP093096788 *
CZECHOWSKA-BISKUP RENATA, JAROSIŃSKA DIANA, ROKITA BOŻENA, ULAŃSKI PIOTR, ROSIAK JANUSZ M: "DETERMINATION OF DEGREE OF DEACETYLATION OF CHITOSAN - COMPARISION OF METHODS", PROGRESS ON CHEMISTRY AND APPLICATION OF CHITIN AND ITS DERIVATIVES, 1 January 2012 (2012-01-01), XP093096790 *
FERNANDES, SCM ET AL.: "Transparent chitosan films reinforced with a high content of nanofibrillated cellulose", CARBOHYDRATE POLYMERS., vol. 81, 2 March 2010 (2010-03-02), pages 394 - 401, XP027038164 *
LAVERTU M., XIA Z., SERREQI A.N., BERRADA M., RODRIGUES A., WANG D., BUSCHMANN M.D., GUPTA AJAY: "A validated 1H NMR method for the determination of the degree of deacetylation of chitosan", JOURNAL OF PHARMACEUTICAL AND BIOMEDICAL ANALYSIS, ELSEVIER B.V., AMSTERDAM, NL, vol. 32, no. 6, 1 August 2003 (2003-08-01), AMSTERDAM, NL , pages 1149 - 1158, XP093096784, ISSN: 0731-7085, DOI: 10.1016/S0731-7085(03)00155-9 *

Similar Documents

Publication Publication Date Title
Frampton et al. Fabrication and optimization of alginate hydrogel constructs for use in 3D neural cell culture
Tsai et al. Enhancement of human adipose-derived stem cell spheroid differentiation in an in situ enzyme-crosslinked gelatin hydrogel
AU2016320395B2 (en) Injectable macroporous hydrogels
Bozza et al. Neural differentiation of pluripotent cells in 3D alginate-based cultures
Wang et al. Development of hyaluronic acid-based scaffolds for brain tissue engineering
US9994826B2 (en) Methods for culturing undifferentiated cells using sustained release compositions
EP3733834B1 (fr) Matériau d'échafaudage pour cultures de cellules souches et procédé de culture de cellules souches l'utilisant
Belli et al. Towards a 3D culture of mouse ovarian follicles
US20140271616A1 (en) Compositions And Methods For Mesenchymal And/Or Chondrogenic Differentiation Of Stem Cells
WO2015119642A1 (fr) Amélioration du devenir endothélial de cellules souches pluripotentes humaines par une faible pression d'oxygène
Manini et al. Synthetic mycomelanin thin films as emergent bio-inspired interfaces controlling the fate of embryonic stem cells
Jiang et al. Brain microenvironment responsive and pro‐angiogenic extracellular vesicle‐hydrogel for promoting neurobehavioral recovery in type 2 diabetic mice after stroke
WO2023183769A1 (fr) Échafaudages et films minces de chitosane pour l'expansion de cellules souches neurales humaines
EP2958987B1 (fr) Prodédé de stockage ou de conservation de cellules souches humaines vivantes en stase
Lai Effect of chemical composition on corneal cellular response to photopolymerized materials comprising 2-hydroxyethyl methacrylate and acrylic acid
KR20110008013A (ko) 재건된 각막 및 점막
Yang et al. Effects of chitosan/collagen substrates on the behavior of rat neural stem cells
WO2018043153A1 (fr) Support de culture cellulaire, kit de préparation de support de culture cellulaire, et procédé de production de tissu hybride gel/cellule utilisant un support de culture cellulaire et kit de préparation de support de culture cellulaire
US11648320B2 (en) Non-covalently assembled biomatrix layer
TWI597064B (zh) 幾丁聚醣－生物性高分子混摻組合物及其用途
Chang et al. 3D chitosan scaffolds support expansion of human neural stem cells in chemically defined condition
US20110076254A1 (en) Porous scaffolds for stem cell renewal
Tan et al. Oriented artificial niche provides physical-biochemical stimulations for rapid nerve regeneration
CN117511851B (zh) 水凝胶支架在细胞培育肉制备中的应用
IT201900003377A1 (it) Induzione geometrica di pluripotenza

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23775817

Country of ref document: EP

Kind code of ref document: A1