WO2023182583A1 - 헤마토코쿠스 플루비알리스 유래의 제라닐제라닐 피로포스페이트 신타아제를 포함하는 카로티노이드 또는 이를 전구체로 하는 물질 생산 미생물 및 이를 이용한 카로티노이드 또는 레티노이드 생산방법 - Google Patents

헤마토코쿠스 플루비알리스 유래의 제라닐제라닐 피로포스페이트 신타아제를 포함하는 카로티노이드 또는 이를 전구체로 하는 물질 생산 미생물 및 이를 이용한 카로티노이드 또는 레티노이드 생산방법 Download PDF

Info

Publication number
WO2023182583A1
WO2023182583A1 PCT/KR2022/011049 KR2022011049W WO2023182583A1 WO 2023182583 A1 WO2023182583 A1 WO 2023182583A1 KR 2022011049 W KR2022011049 W KR 2022011049W WO 2023182583 A1 WO2023182583 A1 WO 2023182583A1
Authority
WO
WIPO (PCT)
Prior art keywords
microorganism
seq
yarrowia
dna
carotenoid
Prior art date
Application number
PCT/KR2022/011049
Other languages
English (en)
French (fr)
Inventor
이동필
박혜민
이베드로
김재응
Original Assignee
씨제이제일제당 (주)
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 씨제이제일제당 (주) filed Critical 씨제이제일제당 (주)
Publication of WO2023182583A1 publication Critical patent/WO2023182583A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/16—Yeasts; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
    • C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
    • C12N15/815—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts for yeasts other than Saccharomyces
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
    • C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
    • C12Y205/01029—Geranylgeranyl diphosphate synthase (2.5.1.29)

Definitions

  • the present application relates to a microorganism of the genus Yarrowia that expresses geranylgeranyl pyrophosphate synthase derived from Haematococcus pluvialis and has the ability to produce carotenoids or substances containing them as precursors; Method for producing carotenoids or substances using them as precursors; Compositions for producing carotenoids or substances containing them as precursors; and the use of the Yarrowia genus microorganism or its culture for producing carotenoids or substances containing the same as precursors.
  • Carotenoids and retinoids exert various functions in plants and animals, and are used in a variety of industrial fields such as food and feed.
  • carotenoids such as beta-carotene are substances reported to have functions such as eliminating free radicals, being the parent of vitamin A in animals, strengthening the immune system of vertebrates, and reducing the risk of lung cancer
  • retinoids are substances chemically related to retinol, vitamin A. It is also used in cosmetics and as a treatment for skin diseases.
  • carotenoids eg, beta-carotene
  • retinoids eg, retinol
  • squalene C30
  • C30 squalene (C30) may be produced as a by-product. Therefore, the discovery of geranylgeranyl pyrophosphate synthase, which contributes to the efficient production of carotenoids or retinoids, is essential to increase their production and reduce squalene produced in the competitive pathway.
  • the problem to be solved by this application is to provide a microorganism that produces a carotenoid containing geranylgeranyl pyrophosphate synthase derived from Haematococcus pluvialis or a material containing the same as a precursor, and a method and use of the carotenoid or retinoid production using the same. will be.
  • One object of the present application is to provide a microorganism of the Yarrowia genus that expresses geranylgeranyl pyrophosphate synthase derived from Haematococcus pluvialis and has the ability to produce carotenoids or substances containing them as precursors.
  • Another object of the present application is to provide a method for producing carotenoids or substances using them as precursors using the Yarrowia microorganisms.
  • Another object of the present application is to provide a composition for producing carotenoids containing the Yarrowia genus microorganism or a culture thereof or a material using the same as a precursor.
  • Another object of the present application is to provide a use for producing carotenoids or substances containing the same as precursors of the Yarrowia genus microorganisms.
  • the present application can effectively increase the production of carotenoids and substances containing them as precursors by introducing the geranylgeranyl pyrophosphate synthase gene derived from Haematococcus pluvialis into Yarrowia microorganisms.
  • Figure 1 is a diagram showing the results of flask evaluation of strains containing GGPP synthase genes derived from various microorganisms.
  • Figure 2 is a diagram showing the results of flask evaluation of Mb.BCO introduced strain.
  • One aspect of the present application is a Yarrow that expresses geranylgeranyl pyrophosphate synthase derived from Haematococcus pluvialis and has the ability to produce carotenoids or substances containing them as precursors. Provides microorganisms in the stomach.
  • “Geranylgeranyl pyrophosphate synthase” is an enzyme that can catalyze the synthesis of geranylgeranyl pyrophosphate (GGPP).
  • the substrate of the geranel geranyl pyrophosphate synthase may be isopentenyl pyrophosphate (IPP) and dimethylallyl pyrophosphate (DMAPP).
  • the geranylgeranyl pyrophosphate synthase may also be named 'GGS', 'GGPPS', 'GGPS', 'GGPPS1', or 'polypeptide having geranylgeranyl pyrophosphate synthase activity'.
  • the microorganism of the present application is a microorganism of the Yarrowia genus that contains or expresses the geranylgeranyl pyrophosphate synthase protein derived from Haematococcus pluvialis, a foreign protein, and produces carotenoids or substances containing them as precursors. It may be that it has the ability.
  • the amino acid sequence of the GGPPS protein of the present application may be a protein sequence having geranylgeranyl pyrophosphate synthase activity encoded by the GGPPS gene.
  • the amino acid sequence can be obtained from various databases such as GenBank of NCBI, a known database, but is not limited thereto.
  • the GGPPS protein of the present application may be derived from Haematococcus pluvialis and is included in the present application as long as it has the same sequence or activity.
  • the GGPPS protein of the present application may include, have, consist of, or consist essentially of SEQ ID NO: 103 or an amino acid sequence having at least 80% homology or identity thereto. there is.
  • GGPPS protein of the present application is described as a protein containing SEQ ID NO: 103, but there are additions of meaningless sequences before and after the amino acid sequence of SEQ ID NO: 103, mutations that may occur naturally, or silent mutations thereof. ) is not excluded, and it is clear to those skilled in the art that if it has the same or corresponding activity as a protein containing the above amino acid sequence, it corresponds to the GGPPS protein of the present application.
  • the GGPPS protein of the present application contains the amino acid sequence of SEQ ID NO: 103, or is at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91% of the amino acid sequence of SEQ ID NO: 103. %, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology or identity.
  • it is an amino acid sequence that has the homology or identity and shows efficacy corresponding to the protein, it is obvious that it is included within the scope of the present application even if some of the sequences have amino acid sequences deleted, modified, substituted, or added.
  • polypeptide or protein comprising an amino acid sequence described in a specific sequence number
  • polypeptide or protein composed of an amino acid sequence described in a specific sequence number or ‘polypeptide or protein having an amino acid sequence described in a specific sequence number’.
  • a protein with an amino acid sequence in which part of the sequence is deleted, modified, substituted, conservatively substituted, or added can also be used in the present application. is self-explanatory. For example, addition of sequences that do not change the function of the protein, mutations that may occur naturally, silent mutations or conservative substitutions at the N-terminus, interior, and/or C-terminus of the amino acid sequence. This is the case.
  • conservative substitution means replacing one amino acid with another amino acid having similar structural and/or chemical properties. These amino acid substitutions may generally occur based on similarities in the polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or amphipathic nature of the residues. Typically, conservative substitutions may have little or no effect on the activity of the polypeptide.
  • the term 'homology' or 'identity' refers to the degree of identity or similarity between two given amino acid sequences or base sequences and can be expressed as a percentage.
  • the terms homology and identity can often be used interchangeably.
  • sequence homology or identity of a conserved polynucleotide or polypeptide is determined by standard alignment algorithms, and may be used with a default gap penalty established by the program used.
  • Substantially homologous or identical sequences generally include the entire sequence, or a portion corresponding to at least about 50%, 60%, 70%, 80%, or 90% of the full-length, and intermediate or Hybridization is possible under highly stringent conditions. It is obvious that hybridization also includes hybridization of polynucleotides with polynucleotides containing common codons or codons taking codon degeneracy into account.
  • Whether any two polynucleotide or polypeptide sequences have homology, similarity, or identity can be determined, for example, by Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: It can be determined using a known computer algorithm such as the "FASTA” program using default parameters as in 2444. Or, as performed in the Needleman program in the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later), It can be determined using the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol.
  • a GAP program can be defined as the total number of symbols in the shorter of the two sequences divided by the number of similarly aligned symbols (i.e., nucleotides or amino acids).
  • the default parameters for the GAP program are (1) a binary comparison matrix (containing values 1 for identity and 0 for non-identity) and Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation , pp. 353-358 (1979), Gribskov et al (1986) Nucl. Acids Res. 14: Weighted comparison matrix of 6745 (or EDNAFULL (EMBOSS version of NCBI NUC4.4) permutation matrix); (2) a penalty of 3.0 for each gap and an additional 0.10 penalty for each symbol in each gap (or a gap opening penalty of 10 and a gap extension penalty of 0.5); and (3) no penalty for end gaps.
  • protein expression may be by introducing a gene (polynucleotide) encoding a protein into a microorganism or by injection of a protein, but is not limited thereto.
  • the microorganism of the present application may be one into which a geranylgeranyl pyrophosphate synthase gene derived from Haematococcus pluvialis has been introduced.
  • the introduction of the geranylgeranyl pyrophosphate synthase gene may include additionally enhancing its activity after the introduction.
  • ‘geranylgeranyl pyrophosphate synthase gene’ refers to ‘ ggs ’, ‘ ggpps ’, ‘ ggps ’, ‘GGS gene’, ‘GGPPS gene’, ‘GGPS gene’. ‘Gene encoding geranylgeranyl pyrophosphate synthase’, ‘polynucleotide encoding geranylgeranyl pyrophosphate synthase’, or ‘polynucleotide encoding a polypeptide having geranylgeranyl pyrophosphate synthase activity. 'Can be used interchangeably with '.
  • sequence of the geranylgeranyl pyrophosphate synthase gene can be obtained from various databases such as GenBank of NCBI, a known database, but is not limited thereto.
  • the geranylgeranyl pyrophosphate synthase gene derived from Haematococcus pluvialis may include, have, or consist of the base sequence of SEQ ID NO: 1, but is not limited thereto. .
  • the geranylgeranyl pyrophosphate synthase gene consisting of the base sequence of SEQ ID NO: 1 may be codon-optimized to be suitable for Yarrowia genus microorganisms or, more specifically, Yarrowia lipolytica.
  • polynucleotide is a DNA strand of a certain length or more, which is a polymer of nucleotides in which nucleotide monomers are connected in a long chain by covalent bonds.
  • the polynucleotide or gene is within a range that does not change the amino acid sequence of the polypeptide due to codon degeneracy or in consideration of the preferred codon in the organism in which the geranylgeranyl pyrophosphate synthase polypeptide is to be expressed. Various modifications may be made to the coding region.
  • the polynucleotide or gene may include, for example, the base sequence of SEQ ID NO: 1, and has 80% or more homology or identity, 90% or more, 95% or more, 96% or more, 97% or more, or 98% or more. , or 99% or more of the base sequence, but is not limited thereto.
  • polynucleotide or gene of the present application is a probe that can be prepared from a known gene sequence, for example, a complementary sequence for all or part of the base sequence and hydrided under strict conditions to obtain the amino acid of SEQ ID NO: 103. Any sequence that codes for a sequence may be included without limitation.
  • the “stringent condition” refers to conditions that enable specific hybridization between polynucleotides. These conditions are specifically described in the literature (e.g., J. Sambrook et al., supra). For example, among polynucleotides with high homology or identity, 40% or more, specifically 90% or more, more specifically 95% or more, 96% or more, 97% or more, 98% or more, more specifically 99% or more.
  • washing conditions of normal southern hybridization such as 60°C, 1 ⁇ SSC, 0.1% SDS. , specifically 60°C, 0.1 ⁇ SSC, 0.1% SDS, more specifically at a salt concentration and temperature equivalent to 68°C, 0.1 ⁇ SSC, 0.1% SDS, to list the conditions for washing once, specifically 2 to 3 times. You can.
  • Hybridization requires that two nucleic acids have complementary sequences, although mismatches between bases may be possible depending on the stringency of hybridization.
  • the term “complementary” is used to describe the relationship between nucleotide bases that are capable of hybridizing to each other. For example, with respect to DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Accordingly, the polynucleotides of the present application may also include substantially similar nucleic acid sequences as well as isolated nucleic acid fragments that are complementary to the entire sequence.
  • polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step at a Tm value of 55°C and using the conditions described above. Additionally, the Tm value may be 60°C, 63°C, or 65°C, but is not limited thereto and may be appropriately adjusted by a person skilled in the art depending on the purpose.
  • the appropriate stringency to hybridize a polynucleotide depends on the length of the polynucleotide and the degree of complementarity, variables that are well known in the art (see Sambrook et al., supra, 9.50-9.51, 11.7-11.8).
  • the microorganism of the present application encodes the geranylgeranyl pyrophosphate synthase gene derived from Haematococcus pluvialis or the geranylgeranyl pyrophosphate synthase derived from Haematococcus pluvialis of the present application. It may contain a vector containing a polynucleotide.
  • the vector of the present application may include a DNA preparation containing the base sequence of a polynucleotide encoding the target polypeptide operably linked to a suitable expression control region (or expression control sequence) to enable expression of the target polypeptide in a suitable host.
  • the expression control region may include a promoter capable of initiating transcription, an optional operator sequence for regulating such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating termination of transcription and translation.
  • the vector After transformation into a suitable host cell, the vector can replicate or function independently of the host genome and can be integrated into the genome itself.
  • the vector used in this application is not particularly limited, and any vector known in the art can be used.
  • Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in a natural or recombinant state.
  • pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, and Charon21A can be used as phage vectors or cosmid vectors, and pDZ-based, pBR-based, and pUC-based plasmid vectors can be used.
  • pBluescriptII series, pGEM series, pTZ series, pCL series, and pET series can be used.
  • pDZ, pDC, pDCM2 (Korean Patent Publication No. 10-2020-0136813), pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, and pIMR53 vectors can be used.
  • a polynucleotide encoding a target polypeptide can be inserted into a chromosome using a vector for intracellular chromosome insertion. Insertion of the polynucleotide into the chromosome may be accomplished by any method known in the art, for example, homologous recombination, but is not limited thereto.
  • a selection marker may be additionally included to confirm whether the chromosome has been inserted. The selection marker is used to select cells transformed with a vector, that is, to confirm the insertion of the target nucleic acid molecule, and to display selectable phenotypes such as drug resistance, auxotrophy, resistance to cytotoxic agents, or expression of surface polypeptides. Markers that provide may be used. In an environment treated with a selective agent, only cells expressing the selection marker survive or show other expression traits, so transformed cells can be selected.
  • the term “transformation” refers to introducing a vector containing a polynucleotide encoding a target polypeptide into a host cell or microorganism so that the polypeptide encoding the polynucleotide can be expressed within the host cell.
  • the transformed polynucleotide can include both of these, regardless of whether it is inserted into the chromosome of the host cell or located outside the chromosome.
  • the polynucleotide includes DNA and/or RNA encoding the polypeptide of interest.
  • the polynucleotide can be introduced in any form as long as it can be introduced and expressed into a host cell.
  • the polynucleotide can be introduced into the host cell in the form of an expression cassette, which is a genetic structure containing all elements necessary for self-expression.
  • the expression cassette may typically include a promoter, a transcription termination signal, a ribosome binding site, and a translation termination signal that are operably linked to the polynucleotide.
  • the expression cassette may be in the form of an expression vector capable of self-replication.
  • the polynucleotide may be introduced into the host cell in its own form and operably linked to a sequence required for expression in the host cell, but is not limited thereto.
  • operably linked means that the polynucleotide sequence is functionally linked to a promoter sequence that initiates and mediates transcription of the polynucleotide encoding the target polypeptide of the present application.
  • the geranylgeranyl pyrophosphate synthase activity may be enhanced in the Yarrowia genus microorganisms expressing GGPPS derived from Haematococcus pluvialis of the present application compared to the Yarrowia genus microorganisms that do not express it, It is not limited to this.
  • geranylzera compared to the Yarrowia genus microorganism into which the GGPPS gene from Haematococcus pluvialis has not been introduced.
  • Nyl pyrophosphate synthase activity may be enhanced, but is not limited thereto.
  • the Yarrowia genus microorganism into which the geranylgeranyl pyrophosphate synthase encoded by the GGPPS gene derived from Haematococcus pluvialis of the present application is introduced is Xanthophyllomyces dendrorhous Geranylgeranyl pyrophosphate synthase encoded by crtE or its mutant gene crtEM1 , the BTS1 gene derived from Saccharomyces cerevisiae , or the GGS1 gene derived from Yarrowia lipolytica Geranylgeranyl pyrophosphate synthase activity may be enhanced compared to the introduced Yarrowia genus microorganism, but is not limited to this.
  • microorganism of the genus Yarrowia or "strain of the genus Yarrowia” includes both wild-type microorganisms of the genus Yarrowia and microorganisms of the genus Yarrowia that have undergone natural or artificial genetic modification, and include either foreign genes inserted or endogenous genes.
  • the microorganism of the present application is a microorganism containing any one or more of the GGPPS protein of the present application, a GGPS gene or polynucleotide encoding the GGPPS protein, or a vector containing the gene or polynucleotide; Microorganisms modified to express GGPPS protein or GGPPS gene derived from Haematococcus pluvialis of the present application; Microorganisms (e.g., recombinant strains) expressing the GGPPS protein or GGPPS gene derived from Haematococcus pluvialis of the present application; Alternatively, it may be a strain (e.g., a recombinant strain) having GGPPS activity derived from Haematococcus pluvialis of the present application, but is not limited thereto.
  • a strain e.g., a recombinant strain
  • the strains of the present application are microorganisms that naturally have the ability to produce geranyl geranyl pyrophosphate synthase, or carotenoids or substances containing the same as precursors; or a GGPPS protein, gene, or polynucleotide derived from Haematococcus pluvialis of the present application, or a vector containing the same, in a parent strain that does not have the ability to produce geranylgeranyl pyrophosphate synthase, or carotenoids or substances that are precursors thereof. It may be a microorganism that has been introduced and has an enhanced or given ability to produce geranylgeranyl pyrophosphate synthase and carotenoids or substances that are precursors thereof, but is not limited thereto.
  • the strain of the present application is transformed with a GGPPS protein, gene, polynucleotide, or vector containing the same derived from Haematococcus pluvialis of the present application, and can produce or produce carotenoids or substances containing them as precursors. It can contain all microorganisms with increased activity.
  • the strain of the present application expresses GGPPS derived from Haematococcus pluvialis of the present application in a natural wild-type microorganism or a microorganism that produces carotenoids or substances as precursors thereof, thereby producing carotenoids or substances as precursors thereof. It may be a recombinant strain with increased production capacity.
  • the recombinant strain with increased production ability of the carotenoid or its precursor is a natural wild-type microorganism or a geranylgeranyl pyrophosphate synthase unmodified microorganism (i.e., a wild-type geranylgeranyl pyrophosphate synthase gene (SEQ ID NO: 11)
  • a wild-type geranylgeranyl pyrophosphate synthase gene SEQ ID NO: 11
  • Production of carotenoids or substances as precursors thereof compared to microorganisms of the genus Yarrowia containing or microorganisms of the genus Yarrowia in which the geranylgeranyl pyrophosphate synthase gene (SEQ ID NO: 1) derived from Haematococcus pluvialis is not introduced It may be a microorganism with increased activity, but is not limited thereto.
  • the strain of the present application with an increased ability to produce carotenoids or precursors thereof does not contain GGPPS (eg, SEQ ID NO: 103) derived from Haematococcus pluvialis; Microorganisms of the Yarrowia genus , including CrtE or its variant CrtEM1 from It may be a microorganism with an increased production capacity of carotenoids or substances containing the same as precursors, but is not limited thereto.
  • the unmodified microorganism which is the target strain for comparing the increase in production ability of the carotenoid or a substance containing it as a precursor, may be strain CC08-1023, but is not limited thereto.
  • the recombinant strain with increased production ability may have an increased beta-carotene or retinol production ability of about 0.001% or more or 0.01% or more compared to the beta-carotene or retinol production ability of the parent strain or unmodified microorganism before mutation.
  • it is not limited thereto, as long as it has a + value increase compared to the production capacity of the unmodified microorganism.
  • the term "about” is a range that includes ⁇ 0.5, ⁇ 0.4, ⁇ 0.3, ⁇ 0.2, ⁇ 0.1, etc., and includes all values in a range that are equivalent or similar to the value that appears after the term "about.” Not limited.
  • non-modified microorganism does not exclude strains containing mutations that may occur naturally in microorganisms, and is either a wild-type strain or a natural strain itself, or a strain that has a genetic mutation caused by natural or artificial factors. It may refer to the strain before change.
  • the unmodified microorganism may refer to a strain in which GGPPS from Haematococcus pluvialis described herein is not expressed or is introduced.
  • non-modified microorganism may be used interchangeably with “pre-transformed strain”, “pre-transformed microorganism”, “non-mutated strain”, “non-modified strain”, “non-mutated microorganism” or “reference microorganism”.
  • the microorganism of the present application may be of the genus Yarrowia, specifically Yarrowia lipolytica , but is not limited thereto.
  • Modification of part or all of the polynucleotide in the microorganism of the present application is (a) homologous recombination using a vector for chromosome insertion into the microorganism or genome editing using engineered nuclease (e.g., CRISPR-Cas9) and/or (b) It may be induced by, but is not limited to, light and/or chemical treatment, such as ultraviolet rays and radiation.
  • the method of modifying part or all of the gene may include a method using DNA recombination technology.
  • a nucleotide sequence or vector containing a nucleotide sequence homologous to the gene of interest is injected into the microorganism to cause homologous recombination, thereby causing deletion of part or all of the gene.
  • the injected nucleotide sequence or vector may include, but is not limited to, a dominant selection marker.
  • the microorganisms of the present application include lycopene cyclase/phytoene synthase (crtYB), phytoene desaturase (crtI), and beta-carotene 15, 15'-oxygenase (beta-carotene). It may be a microorganism of the Yarrowia genus that has been modified to contain a polynucleotide encoding a 15,15'-oxygenase (BLH) protein.
  • the microorganism of the present application is modified to further include polynucleotides encoding lycopene cyclase/phytoene synthase (crtYB) and phytoene desaturase (crtI) proteins, and these proteins It may be an active microorganism or a microorganism with enhanced protein activity.
  • the lycopene cyclase/phytoene synthase or phytoene desaturase may be a protein derived from Xanthophyllomyces dendrorhous , but is not limited thereto.
  • the polynucleotide encoding the lycopene cyclase/phytoene synthase or phytoene desaturase has a base sequence registered in the National Center for Biotechnology Information Search database (NCBI) (GenBank: AY177204.1 or GenBank). : It may have or be included based on AY177424.1).
  • the polynucleotide encoding the lycopene cyclase/phytoene synthase or phytoene desaturase may have or include SEQ ID NO: 71 or SEQ ID NO: 72, respectively.
  • the polynucleotide has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, And it has or includes a base sequence that is less than 100%, or has at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97% homology or identity with the sequence of SEQ ID NO: 71 or SEQ ID NO: 72. It may consist of or essentially consist of more than 98% of the base sequence, and less than 100% of the base sequence, but is not limited thereto.
  • the microorganism of the present application is modified to further include a polynucleotide encoding beta-carotene 15,15'-oxygenase (BLH) protein, and is a microorganism or these proteins that exhibit these protein activities. It may be a microorganism with enhanced activity, but is not limited thereto.
  • the beta-carotene 15, 15'-oxygenase may be a protein derived from uncultured marine bacterium 66A03, but is not limited thereto.
  • the polynucleotide encoding the beta-carotene 15, 15'-oxygenase may have or include an amino acid sequence (Q4PNI0) registered in UniProtKB (UniProt Knowledgebase).
  • the polynucleotide encoding the beta-carotene 15, 15'-oxygenase may have or include the sequence of SEQ ID NO: 13.
  • various modifications may be made to the coding region of the polynucleotide within the range of not changing the amino acid sequence.
  • the polynucleotide has 80% or more, 85% or more, 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, and less than 100% homology or identity with the sequence of SEQ ID NO: 13.
  • the term “enhancement” of polypeptide activity means that the activity of the polypeptide is increased compared to the intrinsic activity.
  • the enhancement may be used interchangeably with terms such as activation, up-regulation, overexpression, and increase.
  • activation, enhancement, upregulation, overexpression, and increase may include showing an activity that it did not originally have, or showing improved activity compared to the intrinsic activity or activity before modification.
  • intrinsic activity refers to the activity of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before the change in trait when the trait changes due to genetic mutation due to natural or artificial factors.
  • “Enhanced,” “upregulated,” “overexpressed,” or “increased” in the activity of a polypeptide compared to its intrinsic activity means the activity and/or concentration (expression) of a specific polypeptide originally possessed by the parent strain or unmodified microorganism before the transformation. It means an improvement compared to the amount).
  • the enhancement can be achieved by introducing a foreign polypeptide or gene, or by enhancing the activity and/or concentration (expression amount) of the endogenous polypeptide. Whether the activity of the polypeptide is enhanced can be confirmed by increasing the activity level of the polypeptide, the expression level, or the amount of product released from the polypeptide.
  • Enhancement of the activity of the polypeptide can be done by applying various methods well known in the art, and is not limited as long as the activity of the target polypeptide can be enhanced compared to that of the microorganism before modification.
  • genetic engineering and/or protein engineering well known to those skilled in the art, which are routine methods of molecular biology, may be used, but are not limited thereto (e.g., Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012, etc.).
  • modification of the polynucleotide sequence encoding the polypeptide to enhance the polypeptide activity e.g., modification of the polynucleotide sequence of the polypeptide gene to encode a polypeptide modified to enhance the activity of the polypeptide;
  • the increase in the intracellular copy number of the polynucleotide encoding the polypeptide is achieved by the introduction into the host cell of a vector capable of replicating and functioning independently of the host to which the polynucleotide encoding the polypeptide is operably linked. It may be possible. Alternatively, this may be achieved by introducing one or two or more copies of the polynucleotide encoding the polypeptide into the chromosome of the host cell.
  • the introduction into the chromosome may be performed by introducing a vector capable of inserting the polynucleotide into the chromosome of the host cell into the host cell, but is not limited to this.
  • the vector is the same as described above.
  • the expression control region is not particularly limited thereto, but may include a promoter, an operator sequence, a sequence encoding a ribosome binding site, and a sequence that regulates the termination of transcription and translation.
  • the original promoter may be replaced with a strong promoter, but the method is not limited thereto.
  • Examples of known strong promoters include CJ1 to CJ7 promoters (US Patent US 7662943 B2), lac promoter, trp promoter, trc promoter, tac promoter, lambda phage PR promoter, PL promoter, tet promoter, gapA promoter, SPL7 promoter, SPL13. (sm3) promoter (US Patent US 10584338 B2), O2 promoter (US Patent US 10273491 B2), tkt promoter, yccA promoter, TEFINt promoter, etc., but is not limited thereto.
  • the base sequence modification encoding the start codon or 5'-UTR region of the gene transcript encoding the polypeptide is, for example, a base sequence encoding another start codon with a higher polypeptide expression rate than the internal start codon. It may be a substitution, but is not limited thereto.
  • the modification of the amino acid sequence or polynucleotide sequence of 4) and 5) includes deletion, insertion, non-conservative or conservative substitution of the amino acid sequence of the polypeptide or the polynucleotide sequence encoding the polypeptide to enhance the activity of the polypeptide.
  • the combination of these may result in a mutation in the sequence, or a replacement with an amino acid sequence or polynucleotide sequence improved to have stronger activity, or an amino acid sequence or polynucleotide sequence improved to increase activity, but is not limited thereto.
  • the replacement may be specifically performed by inserting a polynucleotide into a chromosome by homologous recombination, but is not limited thereto.
  • the vector used at this time may additionally include a selection marker to check whether chromosome insertion has occurred. The selection marker is as described above.
  • Introduction of a foreign polynucleotide showing the activity of the polypeptide may be introduction into the host cell of a foreign polynucleotide encoding a polypeptide showing the same/similar activity as the polypeptide. There are no restrictions on the origin or sequence of the foreign polynucleotide as long as it exhibits the same/similar activity as the polypeptide.
  • the method used for the introduction can be performed by appropriately selecting a known transformation method by a person skilled in the art, and by expressing the introduced polynucleotide in the host cell, a polypeptide can be produced and its activity can be increased.
  • Codon optimization of the polynucleotide encoding the polypeptide is codon optimization of the native polynucleotide to increase transcription or translation within the host cell, or optimized transcription and translation of the foreign polynucleotide within the host cell. It may be that the codons have been optimized to allow this.
  • Analyzing the tertiary structure of a polypeptide and selecting exposed sites to modify or chemically modify the sequence information for example, by comparing the sequence information of the polypeptide to be analyzed with a database storing the sequence information of known proteins to determine the degree of sequence similarity. Accordingly, a template protein candidate may be determined, the structure confirmed based on this, and an exposed site to be modified or chemically modified may be selected and modified or modified.
  • Such enhancement of polypeptide activity means that the activity or concentration of the corresponding polypeptide is increased based on the activity or concentration of the polypeptide expressed in the wild type or unmodified microbial strain, or the amount of the product produced from the polypeptide is increased. However, it is not limited to this.
  • the microorganism of the present application may have enhanced GGPPS activity by introducing a GGPPS gene derived from Haematococcus pluvialis, but is not limited thereto.
  • the microorganism of the present application may have the ability to produce carotenoids or substances containing them as precursors.
  • rotenoid refers to tetraterpene or a derivative thereof that gives colors such as yellow in fruits and vegetables.
  • the carotenoids include xanthophyll, carotene, alpha-carotene, beta-carotene, gamma-carotene, phytoene, and phyto. Consists of phytofluene, neurosporene, lutein, lycopene, Zeaxanthin, Capsanthin, Canthaxanthin, and Astaxanthin It may be any one or more selected from the group, but is not limited thereto.
  • the substance containing the carotenoid as a precursor may be a retinoid, but is not limited thereto.
  • retinoid refers to the vitamin A group or a group of compounds chemically related thereto.
  • the retinoid may be any one selected from the group consisting of retinol, retinal, retinoic acid, and retinyl ester, but is not limited thereto.
  • the microorganism of the present application may have a reduced by-product production ability, but is not limited thereto.
  • by-products may refer to all substances excluding these when producing carotenoids or substances using them as precursors.
  • a representative by-product generated during beta-carotene production may be squalene.
  • squalene is an unsaturated hydrocarbon (C 30 H 50 ), which is also used in the biosynthesis of steroid hormones, vitamin D, etc.
  • the microorganism of the present application may have reduced by-products produced in the beta-carotene production pathway, and may have specifically reduced squalene production, but is not limited thereto.
  • Another aspect of the present application provides a method for producing carotenoids or substances using them as precursors, which includes culturing the Yarrowia genus microorganisms of the present application in a medium.
  • microorganisms, carotenoids, and substances that make them precursors are the same as described in other embodiments.
  • the term "culturing” means growing the Yarrowia genus microorganism of the present application under appropriately controlled environmental conditions.
  • the culture process can be carried out according to appropriate media and culture conditions known in the art. This culture process can be easily adjusted and used by a person skilled in the art depending on the strain selected. Specifically, the culture may be batch, continuous, and/or fed-batch, but is not limited thereto.
  • the Yarrowia genus microorganisms of the present application can be cultured under aerobic conditions in a typical medium containing appropriate carbon sources, nitrogen sources, phosphorus, inorganic compounds, amino acids and/or vitamins, etc., while controlling temperature, pH, etc.
  • the culture temperature can be maintained at 20 to 35°C, specifically 25 to 35°C, and the culture temperature can be maintained at about 10 to 160 hours, about 20 hours to 130 hours, about 24 hours to 120 hours, and about 36 hours to 120 hours. , can be cultured for about 48 hours to 120 hours, about 48 hours, about 72 hours, or about 120 hours, but is not limited thereto.
  • Carotenoids produced by the culture of the present application or substances containing them as precursors may be secreted into the medium or remain in microorganisms.
  • the method for producing carotenoids or substances containing them as precursors of the present application includes the steps of preparing microorganisms of the Yarrowia genus of the present application, preparing a medium for culturing the microorganisms, or a combination thereof (regardless of order, in any order ), for example, may be additionally included before the culturing step.
  • the method for producing carotenoids or a material containing the same as a precursor of the present application includes the step of recovering the carotenoid or a material containing the same as a precursor from the medium according to the Yarrowia genus microorganism culture (medium on which the culture was performed) or the Yarrowia genus microorganism of the present application. may additionally be included.
  • the recovering step may be additionally included after the culturing step.
  • the recovery may be to collect the desired retinol using a suitable method known in the art according to the microorganism culture method of the present application, such as a batch, continuous, or fed-batch culture method.
  • a suitable method known in the art such as a batch, continuous, or fed-batch culture method.
  • centrifugation, filtration, crystallization, treatment with a protein precipitant (salting out) extraction, cell disruption, ultrasonic disruption, ultrafiltration, dialysis, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography.
  • Various chromatographies such as chromatography and affinity chromatography, HPLC, or a combination of these methods can be used, and the desired retinol can be recovered from the medium or microorganisms using a suitable method known in the art.
  • the method for producing carotenoids or substances using them as precursors of the present application may additionally include a purification step.
  • the purification can be performed using a suitable method known in the art.
  • the recovery step and the purification step may be performed sequentially (or continuously) regardless of the order, or simultaneously. Alternatively, it may be performed integrated into one step, but is not limited thereto.
  • the method for producing carotenoids of the present application may further include the step of converting beta-carotene produced by the microorganism of the present application into carotenoids other than beta-carotene.
  • the converting step may be additionally included after the culturing step or the recovering step.
  • the conversion step can be performed using a suitable method known in the art.
  • the conversion may be performed chemically or using enzymes, but is not limited thereto.
  • the method for producing retinoids of the present application may further include the step of converting retinol produced by the Yarrowia genus microorganisms of the present application into retinoids other than retinol.
  • the converting step may be additionally included after the culturing step or the recovering step.
  • the conversion step can be performed using a suitable method known in the art.
  • the conversion may be performed using retinol acyltransferase, but is not limited thereto.
  • the retinoid other than retinol may be any one selected from the group consisting of retinal, retinoic acid, and retinyl ester, but is not limited thereto as long as it is included in the retinoid.
  • Another aspect of the present application provides a composition for producing carotenoids or substances containing the same as precursors containing the Yarrowia genus microorganism or its culture of the present application.
  • microorganisms, carotenoids, or substances containing the same as precursors are the same as described in other embodiments.
  • composition of the present application may further include any suitable excipients commonly used, and such excipients may be, for example, preservatives, wetting agents, dispersants, suspending agents, buffers, stabilizers or isotonic agents, but are not limited thereto. That is not the case.
  • Another aspect of the present application provides the use of the microorganism of the present application or its culture for producing carotenoids or substances containing the same as precursors.
  • microorganisms, carotenoids, or substances containing the same as precursors are the same as described in other embodiments.
  • Example 1-1 X. dendrorhous Production of crtYB-crtI insertion strain
  • lycopene cyclase/phytoene synthase derived from
  • phytoene desaturase crtI
  • crtYB a polynucleotide with SEQ ID No. 71 was secured based on the base sequence registered in NCBI (National Center for Biotechnology Information Search database) (GenBank: AY177204.1), and for crtI, the base sequence registered in NCBI ( The polynucleotide of SEQ ID NO: 72 was secured based on GenBank: AY177424.1).
  • the polynucleotide sequences of crtYB and crtI were synthesized by Macrogen in the form of TEFINtp-crtYB-CYC1t (SEQ ID NO. 73) and TEFINtp-crtI-CYC1t (SEQ ID NO. 74), and the selection marker was URA3 of Y.
  • a cassette inserted into the MHY1 (YALI0B21582g) gene position was designed using the gene (SEQ ID NO: 75).
  • SEQ ID NO: 75 Using the synthesized crtYB, crtI genes and KCCM12972P genomic DNA as a template, SEQ ID NO: 76 and SEQ ID NO: 77, SEQ ID NO: 78 and SEQ ID NO: 79, SEQ ID NO: 80 and SEQ ID NO: 81, SEQ ID NO: 82 and SEQ ID NO: 83, SEQ ID NO: 84 and Each PCR was performed using primers of SEQ ID NO: 85, and SEQ ID NO: 86 and SEQ ID NO: 87. PCR conditions were denaturation 95°C, 1 min; Annealing 55°C, 1 min; And the polymerization reaction was repeated 35 times at 72°C for 3 minutes. The resulting five DNA fragments were produced as one cassette through overlap extension PCR.
  • the cassette produced in this way was introduced into strain KCCM12972P by the heat shock method ( D.-C. Chen et al., Appl Microbiol Biotechnol, 1997 ), and then colonies formed on solid medium (YLMM1) that did not contain uracil were obtained. did. Colonies with confirmed cassette insertion in the genome using primers of SEQ ID NO: 88 and SEQ ID NO: 89 were spotted on 5-FOA solid medium and cultured at 30°C for 3 days, and colonies grown on 5-FOA solid medium were obtained to obtain URA3 The marker was recovered.
  • the cassette prepared in this way was introduced into the strain prepared in Example 1-1 by the heat shock method, and then colonies formed on solid medium (YLMM1) that did not contain uracil were obtained. Colonies in which cassette insertion was confirmed using the primers of SEQ ID NO: 101 and SEQ ID NO: 102 were spotted on 5-FOA solid medium and cultured at 30°C for 3 days. URA3 marker was obtained by obtaining colonies grown on 5-FOA solid medium. recovered. Accordingly, the final platform strain produced was named CC08-1023.
  • Glucose 20 g/L Yeast nitrogen base without amino acids 6.7 g/L, Yeast Synthetic Drop-out Medium Supplements without uracil 2 g/L, agar 15 g/L
  • Glucose 20 g/L Yeast nitrogen base without amino acids 6.7 g/L, Yeast Synthetic Drop-out Medium Supplements without uracil 2 g/L, Uracil 50 ⁇ g/mL, 5-fluorooorotinic acid (5-FOA) 1 g/L, agar 15 g/L
  • GGPPS genes Four types of GGPP synthase genes (hereinafter referred to as GGPPS genes) from different origins were introduced into the genome of strain CC08-1023 prepared in Example 1 as follows.
  • Example 2-1 Haematococcus pluvialis Origin GGPPS insertion production
  • Hp.GGPPS1 GGPPS1 gene derived from Haematococcus pluvialils into the Yarrowia lipolytica chromosome
  • Hp.GGPPS1 is based on the nucleotide sequence (GenBank: APX64485.1) registered in NCBI (National Center for Biotechnology Information Search database). Codon optimization was performed to be suitable for Y.
  • lipolytica through http://atgme.org (SEQ ID NO: 1), and a gene was synthesized in the form of TEFINtp-codon optimized Hp.GGPPS1-CYC1t through Macrogen (sequence Number 4), a cassette inserted into the LIG4 (YALI0D21384g) gene was designed using the URA3 gene (SEQ ID NO: 5) of Y. lipolytica as a selection marker.
  • the synthesized Hp.GGPPS1 gene and KCCM12972P genomic DNA were used as templates, and as shown in Table 3 below, SEQ ID NO: 15 and SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18, SEQ ID NO: 19 and SEQ ID NO: 20, SEQ ID NO: 21, and SEQ ID NO: 22, using primers of SEQ ID NO: 23 and SEQ ID NO: 24, SEQ ID NO: 25 and SEQ ID NO: 26, and SEQ ID NO: 27 and SEQ ID NO: 28, respectively, left homologous region, TEFINt promoter, Hp.GGPPS1 ORF, CYC1 terminator, URA3, repeat PCR of the region, and right homologous region fragment was performed. PCR conditions were denaturation 95°C, 1 min; Annealing 55°C, 1 min; And the polymerization reaction was repeated 35 times at 72°C for 2 minutes. The resulting DNA fragments were produced as one cassette through overlap extension PCR.
  • the cassette prepared in this way was introduced into strain CC08-1023 by heat shock method, and then colonies formed on solid medium (YLMM1) that did not contain uracil were obtained. Colonies in which cassette insertion was confirmed in the genome using primers of SEQ ID NO: 29 and SEQ ID NO: 30 were plated on 5-FOA solid medium and cultured at 30°C for 3 days, and colonies formed on 5-FOA solid medium were obtained to obtain URA3 The marker was removed.
  • Example 2-2 Xanthophyllomyces dendrorhous Production of crtE mutant gene insertion strain
  • crtEM1 (SEQ ID NO: 6, Hong et al ., Applied Microbiology and Biotechnology, 2019 Jan;103(1):211-223) into the Yarrowia lipolytica chromosome, TEFINtp- through Macrogen.
  • a gene was synthesized in the form of crtEM1-TDH3t (SEQ ID NO: 8), and a cassette inserted into the LIG4 (YALI0D21384g) gene was designed using the URA3 gene (SEQ ID NO: 5) of Y. lipolytica as a selection marker.
  • the synthesized crtEM1 DNA and KCCM12972P genomic DNA were used as templates, and as shown in Table 4, SEQ ID NO: 31 and SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 34, SEQ ID NO: 35 and SEQ ID NO: 36, SEQ ID NO: 37 and SEQ ID NO: 38, SEQ ID NO: Left homologous region, TEFINt promoter, crtEM1 ORF, TDH3 terminator, URA3, repeat region, and right homologous region using primers of SEQ ID NO: 39 and 40, SEQ ID NO: 41 and 42, and SEQ ID NO: 43 and SEQ ID NO: 44, respectively. PCR of the fragment was performed.
  • PCR conditions were denaturation 95°C, 1 min; Annealing 55°C, 1 min; And the polymerization reaction was repeated 35 times at 72°C for 2 minutes.
  • the resulting DNA fragments were produced as one cassette through overlap extension PCR.
  • the cassette produced in this way was introduced into strain CC08-1023 by heat shock method, and then colonies formed on solid medium (YLMM1) that did not contain uracil were obtained. Colonies in which cassette insertion was confirmed in the genome using primers of SEQ ID NO: 45 and SEQ ID NO: 46 were plated on 5-FOA solid medium and cultured at 30°C for 3 days, and colonies formed on 5-FOA solid medium were obtained to obtain URA3 The marker was removed.
  • BTS1 is a polynucleotide of SEQ ID NO: 9 based on the base sequence (YPL069C) registered in KEGG (Kyoto Encyclopedia of Genes and Genomes). was secured.
  • a gene was synthesized in the form of TEFINtp-Sc.BTS1-TDH3t (SEQ ID NO: 10).
  • a cassette inserted into the LIG4 (YALI0D21384g) gene was designed using the URA3 gene (SEQ ID NO: 5) of Y. lipolytica .
  • the synthesized Sc.BTS1 DNA and KCCM12972P genomic DNA were used as templates, and as shown in Table 5, SEQ ID NO: 31 and SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 47, SEQ ID NO: 48 and SEQ ID NO: 49, SEQ ID NO: 50, and SEQ ID NO: 38, Left homologous region, TEFINt promoter, Sc.BTS1 ORF, TDH3 terminator, URA3, repeat region, and PCR of the right homologous region fragment was performed. PCR conditions were denaturation 95°C, 1 min; Annealing 55°C, 1 min; And the polymerization reaction was repeated 35 times at 72°C for 2 minutes. The resulting DNA fragments were produced as one cassette through overlap extension PCR.
  • the cassette produced in this way was introduced into strain CC08-1023 by heat shock method, and then colonies formed on solid medium (YLMM1) that did not contain uracil were obtained. Colonies in which cassette insertion was confirmed in the genome using primers of SEQ ID NO: 45 and SEQ ID NO: 46 were plated on 5-FOA solid medium and cultured at 30°C for 3 days, and colonies formed on 5-FOA solid medium were obtained to obtain URA3 The marker was removed.
  • Example 2-4 Yarrowia lipolytica Production of derived GGS1 insertion strain
  • GGS1 is a polynucleotide of SEQ ID NO: 11 based on the base sequence (YALI0D17050g) registered in KEGG (Kyoto Encyclopedia of Genes and Genomes). was secured.
  • a gene was synthesized in the form of TEFINtp-Yl.GGS1-TDH3t (SEQ ID NO: 12) using the Yl.GGS1 polynucleotide.
  • a cassette inserted into the LIG4 (YALI0D21384g) gene was designed using the URA3 gene (SEQ ID NO: 5) of Y. lipolytica .
  • the synthesized Yl.GGS1 gene and KCCM12972P genomic DNA were used as templates, and as shown in Table 6, SEQ ID NO: 31 and SEQ ID NO: 32, SEQ ID NO: 33 and SEQ ID NO: 51, SEQ ID NO: 52 and SEQ ID NO: 53, SEQ ID NO: 54, and SEQ ID NO: 38, Using primers of SEQ ID NO: 39 and SEQ ID NO: 40, SEQ ID NO: 41 and SEQ ID NO: 42, and SEQ ID NO: 43 and SEQ ID NO: 44, respectively, left homologous region, TEFINt promoter, Yl.GGS1 ORF, TDH3 terminator, URA3, repeat region, and PCR of the right homologous region fragment was performed. PCR conditions were denaturation 95°C, 1 min; Annealing 55°C, 1 min; And the polymerization reaction was repeated 35 times at 72°C for 2 minutes. The resulting DNA fragments were produced as one cassette through overlap extension PCR.
  • the cassette produced in this way was introduced into strain CC08-1023 by heat shock method, and then colonies formed on solid medium (YLMM1) that did not contain uracil were obtained. Colonies in which cassette insertion was confirmed in the genome using primers of SEQ ID NO: 45 and SEQ ID NO: 46 were plated on 5-FOA solid medium and cultured at 30°C for 3 days, and colonies formed on 5-FOA solid medium were obtained to obtain URA3 The marker was removed.
  • Flask evaluation was performed on a total of 5 species, including the strains obtained in Examples 2-1 to 2-4 and the parent strain CC08-1023 obtained in Example 1.
  • the strain was inoculated to an initial OD of 2 in a 250 ml corner-baffle flask containing 20 ml of YPD (Yeast extract-Peptone-Dextrose) medium and cultured at 30°C for 48 hours with shaking at 200 rpm. After completion of the culture, 1 ml of the culture medium was centrifuged and the supernatant was removed.
  • the composition of the YPD medium is as follows.
  • the beta-carotene concentration in CC08-1023 (parent strain), Hp.GGPPS1 introduced strain, crtEM1 introduced strain, Sc.BTS1 introduced strain, and Yl.GGS1 introduced strain was each 5.49 mg/ L, 58.73mg/L, 40.58mg/L, 5.21mg/L, and 49.22mg/L.
  • Hp.GGPPS1 when Hp.GGPPS1 was introduced, beta-carotene increased by 53.24mg/L compared to the parent strain, showing the effect of increasing beta-carotene. was confirmed to be the best.
  • the squalene concentration was measured to be 313.24 mg/L, 200.31 mg/L, 235.27 mg/L, 253.28 mg/L, and 221.22 mg/L, respectively, and similarly, when Hp.GGPPS1 was introduced, the squalene concentration was significantly higher in strain CC08-1023. It was confirmed that the squalene production reduction effect was the best, with a decrease of 112.93 mg/L.
  • Hp.GGPPS1 is most effective as a GGPP synthase in Yarrowia microorganisms.
  • geranylgeranyl pyrophosphate synthase from the closely related Saccharomyces cerevisiae, Yarrowia lipolytica and When geranylgeranyl pyrophosphate synthase from the unrelated Haematococcus pluvialis was introduced, the effect was remarkable.
  • Mb.BCO beta-carotene 15,15'oxygenase
  • a gene was synthesized in the form of TEFINtp-codon optimized Mb.BCO-CYC1t (SEQ ID NO: 14).
  • a cassette inserted into the KU70 (YALI0C08701g) gene was designed using the URA3 gene (SEQ ID NO: 5) of Y. lipolytica .
  • the cassettes prepared in this way were introduced into the strains prepared in Examples 2-1 to 2-4 by the heat shock method, and then colonies formed on a solid medium (YLMM1) that did not contain uracil were obtained. Colonies in which cassette insertion was confirmed in the genome using primers of SEQ ID NO: 69 and SEQ ID NO: 70 were plated on 5-FOA solid medium and cultured at 30°C for 3 days, and colonies formed on 5-FOA solid medium were obtained to obtain URA3 The marker was removed.
  • Example 5 Comparative evaluation of retinol production capacity of beta-carotene 15,15'oxygenase (BCO) gene transfection strains
  • Flask evaluation was performed on a total of 5 species, including the strain obtained in Example 4 and the parent strain CC08-1023 obtained in Example 1.
  • the strain was inoculated to an initial OD of 2 in a 250 ml corner-baffle flask containing 20 ml of YPD (Yeast extract-Peptone-Dextrose) medium and 0.05% butylated hydroxytoluene, and cultured at 30°C for 48 hours with shaking at 200 rpm. After completion of the culture, 1 ml of the culture medium was centrifuged and the supernatant was removed.
  • YPD Yeast extract-Peptone-Dextrose
  • retinol was not measured in the strain introducing Mb.BCO into the CC08-1023 strain.
  • Hp.GGPPS1, crtEM1, Sc.BTS1, and Yl,GGS1 were introduced respectively, and then Mb.BCO was introduced in four strains, 8.44 mg/L, 2.78 mg/L, and 0 mg/L, respectively.
  • L, and retinol concentrations of 4.35 mg/L were measured.
  • the beta-carotene concentration was 3.68mg/L, 0.35mg.L, 2.47mg/L, 3.58mg/L, and 0.98mg/L in the five strains above, respectively, indicating a low beta-carotene concentration as beta-carotene is converted to retinol. Confirmed.
  • the squalene concentration in the five strains was measured to be 309.88 mg/L, 202.18 mg/L, 282.19 mg/L, 306.34 mg/L, and 269.18 mg/L, respectively.
  • Hp.GGPPS1 has excellent effects on beta-carotene production, squalene reduction, and retinol production.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Botany (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

본 출원은 헤마토코쿠스 플루비알리스(Haematococcus pluvialis) 유래의 제라닐제라닐 피로포스페이트 신타아제(Geranylgeranyl pyrophosphate synthase)를 발현하는, 카로티노이드 또는 이를 전구체로 하는 물질의 생산능을 갖는 야로위아 속 미생물; 이를 이용한 카로티노이드 또는 이를 전구체로 하는 물질 생산방법; 카로티노이드 또는 이를 전구체로 하는 물질 생산용 조성물; 및 상기 야로위아 속 미생물 또는 이의 배양물의 카로티노이드 또는 이를 전구체로 하는 물질 생산 용도에 관한 것이다.

Description

헤마토코쿠스 플루비알리스 유래의 제라닐제라닐 피로포스페이트 신타아제를 포함하는 카로티노이드 또는 이를 전구체로 하는 물질 생산 미생물 및 이를 이용한 카로티노이드 또는 레티노이드 생산방법
본 출원은 헤마토코쿠스 플루비알리스(Haematococcus pluvialis) 유래의 제라닐제라닐 피로포스페이트 신타아제(Geranylgeranyl pyrophosphate synthase)를 발현하는, 카로티노이드 또는 이를 전구체로 하는 물질의 생산능을 갖는 야로위아 속 미생물; 이를 이용한 카로티노이드 또는 이를 전구체로 하는 물질 생산방법; 카로티노이드 또는 이를 전구체로 하는 물질 생산용 조성물; 및 상기 야로위아 속 미생물 또는 이의 배양물의 카로티노이드 또는 이를 전구체로 하는 물질 생산 용도에 관한 것이다.
카로티노이드 및 레티노이드는 식물 및 동물에서 다양한 기능을 발휘함에 따라, 식품, 사료 등 다방면의 산업 분야에서 이용되고 있다. 그 중에서도 베타카로틴과 같은 카로티노이드는 자유라디칼 제거, 동물에서 비타민 A의 모체, 척추동물의 면역시스템 증강, 및 폐암 위험성 감소와 같은 기능이 보고된 물질이며, 레티노이드는 비타민 A인 레티놀과 화학적으로 연관된 물질군으로서 화장품, 피부질환 치료제 등으로도 사용되기도 한다.
그러나, 이러한 장점에도 불구하고, 카로티노이드(예를 들어, 베타카로틴) 및 레티노이드(예를 들어, 레티놀)은 동물의 체내에서 합성되지 않거나 합성량이 부족하다. 또한, 변이된 미생물을 이용하여 산업적 생산을 도모하더라도(미국등록특허 제7745170호), 여전히 이들을 고순도로 생산하는 것이 어려운 실정이다.
일 예로, 카로티노이드 또는 레티노이드를 생산하는 미생물을 제작하는 과정에서 스쿠알렌(C30) 등이 부산물로 함께 생산될 수 있다. 그러므로, 카로티노이드 또는 레티노이드를 효율적으로 생산하는 데에 기여하는 제라닐제라닐 피로포스페이트 신타아제 발굴이 이들의 생성량 증대 및 경쟁경로에서 생성되는 스쿠알렌 감소를 위해 필수적이다.
본 출원의 해결하고자 하는 과제는 헤마토코쿠스 플루비알리스 유래의 제라닐제라닐 피로포스페이트 신타아제를 포함하는 카로티노이드 또는 이를 전구체로 하는 물질 생산 미생물 및 이를 이용한 카로티노이드 또는 레티노이드 생산방법 및 용도를 제공하는 것이다.
본 출원의 하나의 목적은 헤마토코쿠스 플루비알리스 유래의 제라닐제라닐 피로포스페이트 신타아제를 발현하는, 카로티노이드 또는 이를 전구체로 하는 물질의 생산능을 갖는 야로위아 속 미생물을 제공하는 것이다.
본 출원의 다른 하나의 목적은 상기 야로위아 속 미생물을 이용한 카로티노이드 또는 이를 전구체로 하는 물질 생산방법을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 야로위아 속 미생물 또는 이의 배양물을 포함하는 카로티노이드 또는 이를 전구체로 하는 물질 생산용 조성물을 제공하는 것이다.
본 출원의 또 다른 하나의 목적은 상기 야로위아 속 미생물의 카로티노이드 또는 이를 전구체로 하는 물질 생산 용도를 제공하는 것이다.
본 출원은 Haematococcus pluvialis 유래 제라닐제라닐 피로포스페이트 신타아제 유전자를 야로위아 속 미생물에 도입함으로써 카로티노이드 및 이를 전구체로 하는 물질의 생산을 효과적으로 증가시킬 수 있다.
도 1은 여러 미생물 유래의 GGPP synthase 유전자 도입주 플라스크 평가 결과를 나타낸 도이다.
도 2는 Mb.BCO 도입주 플라스크 평가 결과 결과를 나타낸 도이다.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 출원에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 출원에서 개시된 다양한 요소들의 모든 조합이 본 출원의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 출원의 범주가 제한된다고 볼 수 없다. 또한, 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 출원이 속하는 기술 분야의 수준 및 본 출원의 내용이 보다 명확하게 설명된다.
본 출원의 일 양태는 헤마토코쿠스 플루비알리스(Haematococcus pluvialis) 유래의 제라닐제라닐 피로포스페이트 신타아제(Geranylgeranyl pyrophosphate synthase)를 발현하는, 카로티노이드 또는 이를 전구체로 하는 물질의 생산능을 갖는, 야로위아 속 미생물을 제공한다.
본 출원에서 "제라닐제라닐 피로포스페이트 신타아제(Geranylgeranyl pyrophosphate synthase)"는 제라닐제라닐 피로포스페이트(Geranylgeranyl pyrophosphate; GGPP)의 합성을 촉매할 수 있는 효소이다. 상기 제라넬제라닐 피로포스페이트 신타아제의 기질은 이소펜테닐 피로포스페이트(isopentenyl pyrophosphate; IPP) 및 디메틸알릴 피로포스페이트(dimethylallyl pyrophosphate; DMAPP)일 수 있다. 상기 제라닐제라닐 피로포스페이트 신타아제는 'GGS', 'GGPPS', 'GGPS', 'GGPPS1' 또는 '제라닐제라닐 피로포스페이트 신타아제 활성을 갖는 폴리펩티드'로도 명명될 수 있다.
일 구현 예로, 본 출원의 미생물은 외래 단백질인 헤마토코쿠스 플루비알리스 유래의 제라닐제라닐 피로포스페이트 신타아제 단백질을 포함하거나 발현하는 야로위아 속 미생물로서, 카로티노이드 또는 이를 전구체로 하는 물질의 생산능을 갖는 것일 수 있다.
본 출원의 GGPPS 단백질의 아미노산 서열은 GGPPS 유전자에 의해 코딩되는 제라닐제라닐 피로포스페이트 신타아제 활성을 갖는 단백질 서열일 수 있다. 상기 아미노산 서열은 공지의 데이터 베이스인 NCBI의 GenBank 등 다양한 데이터 베이스에서 그 서열을 얻을 수 있으나, 이에 제한되지 않는다.
일 구현 예로, 본 출원의 GGPPS 단백질은 헤마토코쿠스 플루비알리스(Haematococcus pluvialis) 유래일 수 있고, 이와 동일한 서열 또는 활성을 갖는 한 본 출원에 포함된다.
일 구현 예로, 본 출원의 GGPPS 단백질은 서열번호 103 또는 이와 80% 이상의 상동성 또는 동일성을 갖는 아미노산 서열을 포함하거나, 가지거나, 이루어지거나, 상기 아미노산 서열로 필수적으로 이루어지는(essentially consisting of) 것일 수 있다.
또한, 본 출원의 GGPPS 단백질의 일 구현 예를 서열번호 103를 포함하는 단백질로 기재하였으나, 서열번호 103의 아미노산 서열 앞뒤로의 무의미한 서열 추가 또는 자연적으로 발생할 수 있는 돌연변이, 또는 이의 잠재성 돌연변이(silent mutation)를 제외하는 것이 아니며, 상기 아미노산 서열을 포함하는 단백질과 서로 동일 또는 상응하는 활성을 가지는 경우라면 본 출원의 GGPPS 단백질에 해당됨은 당업자에게 자명하다.
구체적으로, 본 출원의 GGPPS 단백질은 서열번호 103의 아미노산 서열을 포함하거나, 또는 서열번호 103의 아미노산 서열과 적어도 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 또는 99% 상동성 또는 동일성을 가지는 아미노산 서열을 포함할 수 있다. 또한, 상기 상동성 또는 동일성을 가지며, 상기 단백질에 상응하는 효능을 나타내는 아미노산 서열이라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 가지더라도 본 출원의 범위 내에 포함됨은 자명하다.
본 출원에서 '특정 서열번호로 기재된 아미노산 서열을 포함하는 폴리펩티드 또는 단백질', '특정 서열번호로 기재된 아미노산 서열로 이루어진 폴리펩티드 또는 단백질' 또는 '특정 서열번호로 기재된 아미노산 서열을 갖는 폴리펩티드 또는 단백질'라고 기재되어 있더라도, 해당 서열번호의 아미노산 서열로 이루어진 폴리펩티드와 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환, 보존적 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원에서 사용될 수 있음은 자명하다. 예를 들어, 상기 아미노산 서열 N-말단, 내부, 그리고/또는 C-말단에 단백질의 기능을 변경하지 않는 서열 추가, 자연적으로 발생할 수 있는 돌연변이, 이의 잠재성 돌연변이 (silent mutation) 또는 보존적 치환을 가지는 경우이다.
상기 "보존적 치환(conservative substitution)"은 한 아미노산을 유사한 구조적 및/또는 화학적 성질을 갖는 또 다른 아미노산으로 치환시키는 것을 의미한다. 이러한 아미노산 치환은 일반적으로 잔기의 극성, 전하, 용해도, 소수성, 친수성 및/또는 양친매성(amphipathic nature)에서의 유사성에 근거하여 발생할 수 있다. 통상적으로, 보존적 치환은 폴리펩티드의 활성에 거의 영향을 미치지 않거나 또는 영향을 미치지 않을 수 있다.
본 출원에서 용어, '상동성 (homology)' 또는 '동일성 (identity)'은 두 개의 주어진 아미노산 서열 또는 염기 서열 상호간 동일 또는 유사한 정도를 의미하며 백분율로 표시될 수 있다. 용어 상동성 및 동일성은 종종 상호교환적으로 이용될 수 있다.
보존된(conserved) 폴리뉴클레오티드 또는 폴리펩티드의 서열 상동성 또는 동일성은 표준 배열 알고리즘에 의해 결정되며, 사용되는 프로그램에 의해 확립된 디폴트 갭 페널티가 함께 이용될 수 있다. 실질적으로, 상동성을 갖거나(homologous) 또는 동일한(identical) 서열은 일반적으로 서열 전체 또는 전체-길이의 적어도 약 50%, 60%, 70%, 80% 또는 90%에 해당하는 일부분과 중간 또는 높은 엄격한 조건(stringent conditions)에서 하이브리드할 수 있다. 하이브리드화에는 폴리뉴클레오티드에서 일반 코돈 또는 코돈 축퇴성을 고려한 코돈을 함유하는 폴리뉴클레오티드와의 하이브리드화 역시 포함됨이 자명하다.
임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는, 예를 들어, Pearson et al (1988) [Proc. Natl. Acad. Sci. USA 85]: 2444에서와 같은 디폴트 파라미터를 이용하여 "FASTA" 프로그램과 같은 공지의 컴퓨터 알고리즘을 이용하여 결정될 수 있다. 또는, EMBOSS 패키지의 니들만 프로그램(EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277)(버전 5.0.0 또는 이후 버전)에서 수행되는 바와 같은, 니들만-운치(Needleman-Wunsch) 알고리즘(Needleman and Wunsch, 1970, J. Mol. Biol. 48: 443-453)이 사용되어 결정될 수 있다(GCG 프로그램 패키지 (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.,] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.,] Academic Press, San Diego,1994, 및 [CARILLO ETA/.](1988) SIAM J Applied Math 48: 1073을 포함한다). 예를 들어, 국립 생물공학 정보 데이터베이스 센터의 BLAST, 또는 ClustalW를 이용하여 상동성, 유사성 또는 동일성을 결정할 수 있다.
폴리뉴클레오티드 또는 폴리펩티드의 상동성, 유사성 또는 동일성은, 예를 들어, Smith and Waterman, Adv. Appl. Math (1981) 2:482 에 공지된 대로, 예를 들면, Needleman et al. (1970), J Mol Biol. 48:443과 같은 GAP 컴퓨터 프로그램을 이용하여 서열 정보를 비교함으로써 결정될 수 있다. 요약하면, GAP 프로그램은 두 서열 중 더 짧은 것에서의 기호의 전체 수로, 유사한 배열된 기호(즉, 뉴클레오티드 또는 아미노산)의 수를 나눈 값으로 정의할 수 있다. GAP 프로그램을 위한 디폴트 파라미터는 (1) 이진법 비교 매트릭스(동일성을 위해 1 그리고 비-동일성을 위해 0의 값을 함유함) 및 Schwartz and Dayhoff, eds., Atlas Of Protein Sequence And Structure, National Biomedical Research Foundation, pp. 353-358 (1979)에 의해 개시된 대로, Gribskov et al(1986) Nucl. Acids Res. 14: 6745의 가중된 비교 매트릭스 (또는 EDNAFULL (NCBI NUC4.4의 EMBOSS 버전) 치환 매트릭스); (2) 각 갭을 위한 3.0의 페널티 및 각 갭에서 각 기호를 위한 추가의 0.10 페널티 (또는 갭 개방 패널티 10, 갭 연장 패널티 0.5); 및 (3) 말단 갭을 위한 무 페널티를 포함할 수 있다.
또한, 임의의 두 폴리뉴클레오티드 또는 폴리펩티드 서열이 상동성, 유사성 또는 동일성을 갖는지 여부는 정의된 엄격한 조건하에서 써던 혼성화 실험에 의해 서열을 비교함으로써 확인할 수 있으며, 정의되는 적절한 혼성화 조건은 해당 기술 범위 내이고, 당업자에게 잘 알려진 방법(예컨대, J. Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M. Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York)으로 결정될 수 있다.
본 출원에서 단백질의 발현은 미생물 내로 단백질을 코딩하는 유전자(폴리뉴클레오티드)를 도입하거나 또는 단백질의 주입에 의한 것일 수 있으나, 이에 제한되지 않는다.
일 구현 예로, 본 출원의 미생물은 헤마토코쿠스 플루비알리스(Haematococcus pluvialis) 유래의 제라닐제라닐 피로포스페이트 신타아제 유전자가 도입된 것일 수 있다. 또한, 제라닐제라닐 피로포스페이트 신타아제 유전자 도입은 상기 도입 후 추가적으로 이의 활성을 강화하는 것도 포함할 수 있다.
본 출원에서, 제라닐제라닐 피로포스페이트 신타아제 유전자'는 'ggs', 'ggpps', 'ggps', 'GGS 유전자', 'GGPPS 유전자', 'GGPS 유전자'. '제라닐제라닐 피로포스페이트 신타아제를 코딩하는 유전자', '제라닐제라닐 피로포스페이트 신타아제를 코딩하는 폴리뉴클레오티드', 또는 '제라닐제라닐 피로포스페이트 신타아제 활성을 갖는 폴리펩티드를 코딩하는 폴리뉴클레오티드'와 혼용되어 사용될 수 있다.
상기 제라닐제라닐 피로포스페이트 신타아제 유전자는 공지의 데이터 베이스인 NCBI의 GenBank 등 다양한 데이터 베이스에서 그 서열을 얻을 수 있으나, 이에 제한되지 않는다.
일 구현 예로, 헤마토코쿠스 플루비알리스(Haematococcus pluvialis) 유래의 제라닐제라닐 피로포스페이트 신타아제 유전자는 서열번호 1의 염기서열을 포함하거나, 가지거나, 또는 이루어지는 것일 수 있으나, 이에 제한되지 않는다.
일 구현 예로, 서열번호 1의 염기서열로 구성되는 제라닐제라닐 피로포스페이트 신타아제 유전자는 야로위아 속 미생물 또는 보다 구체적으로 야로위아 리폴리티카에 적합하도록 코돈 최적화된 것일 수 있다.
본 출원에서 용어, "폴리뉴클레오티드"는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 길게 사슬모양으로 이어진 뉴클레오티드의 중합체(polymer)로 일정한 길이 이상의 DNA 가닥이다.
상기 폴리뉴클레오티드 또는 유전자는 코돈의 축퇴성(degeneracy)으로 인하여 또는 상기 제라닐제라닐 피로포스페이트 신타아제 폴리펩티드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 폴리펩티드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 상기 폴리뉴클레오티드 또는 유전자는 예를 들면 서열번호 1의 염기서열을 포함할 수 있으며, 이와 상동성 또는 동일성이 80% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 또는 99% 이상인 염기서열로 이루어질 수 있으나, 이에 제한되지 않는다.
또한, 본 출원의 폴리뉴클레오티드 또는 유전자는 공지의 유전자 서열로부터 제조될 수 있는 프로브, 예를 들면, 상기 염기 서열의 전체 또는 일부에 대한 상보 서열과 엄격한 조건 하에 하이드리드화하여, 서열번호 103의 아미노산 서열을 코딩하는 서열이라면 제한없이 포함될 수 있다. 상기 "엄격한 조건(stringent condition)"이란 폴리뉴클레오티드 간의 특이적 혼성화를 가능하게 하는 조건을 의미한다. 이러한 조건은 문헌(예컨대, J. Sambrook et al., 상동)에 구체적으로 기재되어 있다. 예를 들어, 상동성 또는 동일성이 높은 폴리뉴클레오티드끼리, 40% 이상, 구체적으로 90% 이상, 보다 구체적으로 95% 이상, 96% 이상, 97% 이상, 98% 이상, 더욱 구체적으로 99% 이상의 상동성 또는 동일성을 갖는 폴리뉴클레오티드끼리 하이브리드화하고, 그보다 상동성 또는 동일성이 낮은 폴리뉴클레오티드끼리 하이브리드화하지 않는 조건, 또는 통상의 써던 하이브리드화(southern hybridization)의 세척 조건인 60℃, 1ХSSC, 0.1% SDS, 구체적으로 60℃, 0.1ХSSC, 0.1% SDS, 보다 구체적으로 68℃, 0.1ХSSC, 0.1% SDS에 상당하는 염 농도 및 온도에서, 1회, 구체적으로 2회 내지 3회 세정하는 조건을 열거할 수 있다.
혼성화는 비록 혼성화의 엄격도에 따라 염기 간의 미스매치(mismatch)가 가능할지라도, 두 개의 핵산이 상보적 서열을 가질 것을 요구한다. 용어, "상보적"은 서로 혼성화가 가능한 뉴클레오티드 염기 간의 관계를 기술하는데 사용된다. 예를 들면, DNA에 관하여, 아데닌은 티민에 상보적이며 시토신은 구아닌에 상보적이다. 따라서, 본 출원의 폴리뉴클레오티드는 또한 실질적으로 유사한 핵산 서열뿐만 아니라 전체 서열에 상보적인 단리된 핵산 단편을 포함할 수 있다.
구체적으로, 상동성 또는 동일성을 가지는 폴리뉴클레오티드는 55℃ 의 Tm 값에서 혼성화 단계를 포함하는 혼성화 조건을 사용하고 상술한 조건을 사용하여 탐지할 수 있다. 또한, 상기 Tm 값은 60℃, 63℃ 또는 65℃일 수 있으나, 이에 제한되는 것은 아니고 그 목적에 따라 당업자에 의해 적절히 조절될 수 있다.
폴리뉴클레오티드를 혼성화하는 적절한 엄격도는 폴리뉴클레오티드의 길이 및 상보성 정도에 의존하고 변수는 해당기술분야에 잘 알려져 있다(Sambrook et al., supra, 9.50-9.51, 11.7-11.8 참조).
일 구현 예로, 본 출원의 미생물은 본 출원의 헤마토코쿠스 플루비알리스 유래의 제라닐제라닐 피로포스페이트 신타아제 유전자 또는 헤마토코쿠스 플루비알리스 유래의 제라닐제라닐 피로포스페이트 신타아제를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 포함할 수 있다.
본 출원의 벡터는 적합한 숙주 내에서 목적 폴리펩티드를 발현시킬 수 있도록 적합한 발현조절영역(또는 발현조절서열)에 작동 가능하게 연결된 상기 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 염기서열을 포함하는 DNA 제조물을 포함할 수 있다. 상기 발현조절영역은 전사를 개시할 수 있는 프로모터, 그러한 전사를 조절하기 위한 임의의 오퍼레이터 서열, 적합한 mRNA 리보좀 결합부위를 코딩하는 서열, 및 전사 및 해독의 종결을 조절하는 서열을 포함할 수 있다. 벡터는 적당한 숙주세포 내로 형질전환된 후, 숙주 게놈과 무관하게 복제되거나 기능할 수 있으며, 게놈 그 자체에 통합될 수 있다.
본 출원에서 사용되는 벡터는 특별히 한정되지 않으며, 당업계에 알려진 임의의 벡터를 이용할 수 있다. 통상 사용되는 벡터의 예로는 천연 상태이거나 재조합된 상태의 플라스미드, 코스미드, 바이러스 및 박테리오파지를 들 수 있다. 예를 들어, 파지 벡터 또는 코스미드 벡터로서 pWE15, M13, MBL3, MBL4, IXII, ASHII, APII, t10, t11, Charon4A, 및 Charon21A 등을 사용할 수 있으며, 플라스미드 벡터로서 pDZ계, pBR계, pUC계, pBluescriptII계, pGEM계, pTZ계, pCL계 및 pET계 등을 사용할 수 있다. 구체적으로는 pDZ, pDC, pDCM2(대한민국 공개특허공보 제10-2020-0136813호), pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC, pIMR53 벡터 등을 사용할 수 있다.
일례로 세포 내 염색체 삽입용 벡터를 통해 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 염색체 내로 삽입할 수 있다. 상기 폴리뉴클레오티드의 염색체 내로의 삽입은 당업계에 알려진 임의의 방법, 예를 들면, 상동재조합(homologous recombination)에 의하여 이루어질 수 있으나, 이에 한정되지는 않는다. 상기 염색체 삽입 여부를 확인하기 위한 선별 마커(selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 벡터로 형질전환된 세포를 선별, 즉 목적 핵산 분자의 삽입 여부를 확인하기 위한 것으로, 약물 내성, 영양 요구성, 세포 독성제에 대한 내성 또는 표면 폴리펩티드의 발현과 같은 선택가능 표현형을 부여하는 마커들이 사용될 수 있다. 선택제(selective agent)가 처리된 환경에서는 선별 마커를 발현하는 세포만 생존하거나 다른 표현 형질을 나타내므로, 형질전환된 세포를 선별할 수 있다.
본 출원에서 용어 "형질전환"은 표적 폴리펩티드를 코딩하는 폴리뉴클레오티드를 포함하는 벡터를 숙주세포 혹은 미생물 내에 도입하여 숙주세포 내에서 상기 폴리뉴클레오티드가 코딩하는 폴리펩티드가 발현할 수 있도록 하는 것을 의미한다. 형질전환된 폴리뉴클레오티드는 숙주세포 내에서 발현될 수 있기만 한다면, 숙주세포의 염색체 내에 삽입되어 위치하거나 염색체 외에 위치하거나 상관없이 이들 모두를 포함할 수 있다. 또한, 상기 폴리뉴클레오티드는 목적 폴리펩티드를 코딩하는 DNA 및/또는 RNA를 포함한다. 상기 폴리뉴클레오티드는 숙주세포 내로 도입되어 발현될 수 있는 것이면, 어떠한 형태로도 도입될 수 있다. 예를 들면, 상기 폴리뉴클레오티드는 자체적으로 발현되는데 필요한 모든 요소를 포함하는 유전자 구조체인 발현 카세트(expression cassette)의 형태로 숙주세포에 도입될 수 있다. 상기 발현 카세트는 통상 상기 폴리뉴클레오티드에 작동 가능하게 연결되어 있는 프로모터(promoter), 전사 종결신호, 리보좀 결합부위 및 번역 종결신호를 포함할 수 있다. 상기 발현 카세트는 자체 복제가 가능한 발현 벡터 형태일 수 있다. 또한, 상기 폴리뉴클레오티드는 그 자체의 형태로 숙주세포에 도입되어 숙주세포에서 발현에 필요한 서열과 작동 가능하게 연결되어 있는 것일 수도 있으며, 이에 제한되지 않는다.
또한, 상기에서 용어 "작동 가능하게 연결"된 것이란 본 출원의 목적 폴리펩티드를 코딩하는 폴리뉴클레오티드의 전사를 개시 및 매개하도록 하는 프로모터 서열과 상기 폴리뉴클레오티드 서열이 기능적으로 연결되어 있는 것을 의미한다.
일 구현 예로, 본 출원의 헤마토코쿠스 플루비알리스 유래 GGPPS를 발현하는 야로위아 속 미생물에서 이를 발현하지 않는 야로위아 속 미생물에 비해 제라닐제라닐 피로포스페이트 신타아제 활성이 강화된 것일 수 있으나, 이에 제한되지 않는다.
일 구현 예로, 본 출원의 헤마토코쿠스 플루비알리스 유래의 GGPPS 유전자가 도입된 야로위아 속 미생물에서 헤마토코쿠스 플루비알리스 유래의 GGPPS 유전자가 도입되지 않은 야로위아 속 미생물에 비해 제라닐제라닐 피로포스페이트 신타아제 활성이 강화된 것일 수 있으나, 이에 제한되지 않는다.
일 구현 예로, 본 출원의 헤마토코쿠스 플루비알리스 유래의 GGPPS 유전자에 의해 코딩되는 제라닐제라닐 피로포스페이트 신타아제가 도입된 야로위아 속 미생물은 크산토필마로마이세스 덴드로로스(Xanthophyllomyces dendrorhous) 유래의 crtE 또는 이의 변이 유전자 crtEM1, 사카로마이세스 세레비지에(Saccharomyces cerevisiae) 유래의 BTS1 유전자, 또는 야로위아 리폴리티카(Yarrowia lipolytica) 유래 GGS1 유전자에 의해 코딩되는 제라닐제라닐 피로포스페이트 신타아제가 도입된 야로위아 속 미생물에 비해 제라닐제라닐 피로포스페이트 신타아제 활성이 강화된 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, "야로위아 속 미생물" 또는 "야로위아 속 균주"는 야로위아 속 야생형 미생물이나 자연적 또는 인위적으로 유전적 변형이 일어난 야로위아 속 미생물을 모두 포함하며, 외부 유전자가 삽입되거나 내재적 유전자의 활성이 강화되거는 등의 원인으로 인해서 특정 기작이 강화된 야로위아 속 미생물로서, 카로티노이드 또는 이를 전구체로 하는 물질의 생산을 위하여 헤마토코쿠스 플루비알리스 유래의 GGPPS 유전자를 포함하는 야로위아 속 미생물일 수 있다.
본 출원의 미생물은 본 출원의 GGPPS 단백질, 상기 GGPPS 단백질을 코딩하는 GGPS 유전자 또는 폴리뉴클레오티드, 또는 상기 유전자 또는 폴리뉴클레오티드를 포함하는 벡터 중 어느 하나 이상을 포함하는 미생물; 본 출원의 헤마토코쿠스 플루비알리스 유래의 GGPPS 단백질 또는 GGPPS 유전자를 발현하도록 변형된 미생물; 본 출원의 헤마토코쿠스 플루비알리스 유래의 GGPPS 단백질 또는 GGPPS 유전자를 발현하는 미생물(예컨대, 재조합 균주); 또는 본 출원의 헤마토코쿠스 플루비알리스 유래의 GGPPS 활성을 갖는 균주 (예컨대, 재조합 균주)일 수 있으나, 이에 제한되지 않는다.
본 출원의 균주는 자연적으로 제라닐제라닐 피로포스페이트 신타아제, 또는 카로티노이드 또는 이를 전구체로 하는 물질의 생산능을 가지고 있는 미생물; 또는 제라닐제라닐 피로포스페이트 신타아제, 또는 카로티노이드 또는 이를 전구체로 하는 물질의 생산능이 없는 모균주에 본 출원의 헤마토코쿠스 플루비알리스 유래의 GGPPS 단백질, 유전자, 폴리뉴클레오티드, 또는 이를 포함하는 벡터가 도입되어 제라닐제라닐 피로포스페이트 신타아제 및 카로티노이드 또는 이를 전구체로 하는 물질의 생산능이 강화되거나 부여된 미생물일 수 있으나 이에 제한되지 않는다.
일 예로, 본 출원의 균주는 본 출원의 헤마토코쿠스 플루비알리스 유래의 GGPPS 단백질, 유전자, 폴리뉴클레오티드, 또는 이를 포함하는 벡터로 형질전환되어, 카로티노이드 또는 이를 전구체로 하는 물질을 생산할 수 있거나 생산능이 증가된 미생물을 모두 포함할 수 있다. 예를 들어, 본 출원의 균주는 천연의 야생형 미생물 또는 카로티노이드 또는 이를 전구체로 하는 물질을 생산하는 미생물에 본 출원의 헤마토코쿠스 플루비알리스 유래의 GGPPS가 발현되어, 카로티노이드 또는 이를 전구체로 하는 물질 생산능이 증가된 재조합 균주일 수 있다. 상기 카로티노이드 또는 이를 전구체로 하는 물질 생산능이 증가된 재조합 균주는, 천연의 야생형 미생물 또는 제라닐제라닐 피로포스페이트 신타아제 비변형 미생물 (즉, 야생형 제라닐제라닐 피로포스페이트 신타아제 유전자(서열번호 11)를 포함하는 야로위아 속 미생물 또는 헤마토코쿠스 플루비알리스 유래의 제라닐제라닐 피로포스페이트 신타아제 유전자(서열번호 1)가 도입되지 않는 야로위아 속 미생물)에 비하여 카로티노이드 또는 이를 전구체로 하는 물질 생산능이 증가된 미생물일 수 있으나, 이에 제한되는 것은 아니다.
일 예로, 본 출원의 카로티노이드 또는 이를 전구체로 하는 물질 생산능이 증가된 균주는 헤마토코쿠스 플루비알리스 유래의 GGPPS(일 예로, 서열번호 103)를 포함하지 않거나; 크산토필마로마이세스 덴드로로스 유래의 CrtE 또는 이의 변이형 CrtEM1, 사카로마이세스 세레비지에(Saccharomyces cerevisiae) 유래의 BTS1, 또는 야로위아 리폴리티카(Yarrowia lipolytica) GGS1을 포함하는 야로위아 속 미생물과 비교하여 카로티노이드 또는 이를 전구체로 하는 물질의 생산능이 증가된 미생물일 수 있으나, 이에 제한되지 않는다. 그 예로, 상기 카로티노이드 또는 이를 전구체로 하는 물질 생산능의 증가 여부를 비교하는 대상 균주인, 비변형 미생물은 CC08-1023균주 일 수 있으나, 이에 제한되지 않는다.
일 예로, 상기 생산능이 증가된 재조합 균주는 변이 전 모균주 또는 비변형 미생물의 베타카로틴 또는 레티놀 생산능에 비하여 약 0.001% 이상 또는 0.01% 이상 베타카로틴 또는 레티놀 생산능이 높아진 것일 수 있으나, 변이 전 모균주 또는 비변형 미생물의 생산능에 비해 +값의 증가량을 갖는 한, 이에 제한되지 않는다. 상기 용어 "약(about)"은 ±0.5, ±0.4, ±0.3, ±0.2, ±0.1 등을 모두 포함하는 범위로, 약 이란 용어 뒤에 나오는 수치와 동등하거나 유사한 범위의 수치를 모두 포함하나, 이에 제한되지 않는다.
본 출원에서 용어, "비변형 미생물"은 미생물에 자연적으로 발생할 수 있는 돌연변이를 포함하는 균주를 제외하는 것이 아니며, 야생형 균주 또는 천연형 균주 자체이거나, 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화되기 전 균주를 의미할 수 있다. 예를 들어, 상기 비변형 미생물은 본 명세서에 기재된 헤마토코쿠스 플루비알리스 유래의 GGPPS가 발현되지 않거나 도입되기 전의 균주를 의미할 수 있다. 상기 "비변형 미생물"은 "변형 전 균주", "변형 전 미생물", "비변이 균주", "비변형 균주", "비변이 미생물" 또는 "기준 미생물"과 혼용될 수 있다.
본 출원의 미생물은 야로위아 속일 수 있고, 구체적으로는 야로위아 리폴리티카(Yarrowia lipolytica)일 수 있으나, 이에 제한되지 않는다.
본 출원의 미생물에서 폴리뉴클레오티드의 일부 또는 전체의 변형은 (a) 미생물 내 염색체 삽입용 벡터를 이용한 상동 재조합 또는 유전자가위 (engineered nuclease, e.g., CRISPR-Cas9)을 이용한 유전체 교정 및/또는 (b) 자외선 및 방사선 등과 같은 빛 및/또는 화학물질 처리에 의해 유도될 수 있으나 이에 제한되지 않는다. 상기 유전자 일부 또는 전체의 변형 방법에는 DNA 재조합 기술에 의한 방법이 포함될 수 있다. 예를 들면, 목적 유전자와 상동성이 있는 뉴클레오티드 서열을 포함하는 뉴클레오티드 서열 또는 벡터를 상기 미생물에 주입하여 상동 재조합(homologous recombination)이 일어나게 함으로써 유전자 일부 또는 전체의 결손이 이루어질 수 있다. 상기 주입되는 뉴클레오티드 서열 또는 벡터는 우성 선별 마커를 포함할 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 미생물은 라이코펜 사이클라제/파이토엔 신타아제(lycopene cyclase/phytoene synthase, crtYB), 파이토엔 디새튜라아제(phytoene desaturase, crtI) 및 베타카로틴 15, 15'-옥시게나제(beta-carotene 15,15'-oxygenase; BLH) 단백질을 코딩하는 폴리뉴클레오티드를 포함하도록 변형된 야로위아 속 미생물일 수 있다.
본 출원의 미생물은 라이코펜 사이클라제/파이토엔 신타아제(lycopene cyclase/phytoene synthase, crtYB) 및 파이토엔 디새튜라아제(phytoene desaturase, crtI) 단백질을 코딩하는 폴리뉴클레오티드를 더 포함하도록 변형되어, 이들 단백질 활성을 나타내는 미생물 또는 이들 단백질 활성이 강화된 미생물일 수 있다. 상기 라이코펜 사이클라제/파이토엔 신타아제 또는 파이토엔 디새튜라아제는 크산토필로마이세스 덴드로하우스(Xanthophyllomyces dendrorhous) 유래의 단백질일 수 있으나 이에 제한되지 않는다. 일 구현 예로 상기 라이코펜 사이클라제/파이토엔 신타아제 또는 파이토엔 디새튜라아제를 코딩하는 폴리뉴클레오티드는 각각 NCBI(National Center for Biotechnology Information Search database)에 등록되어 있는 염기서열(GenBank: AY177204.1 또는 GenBank: AY177424.1)에 근거하여 가지거나 포함하는 것일 수 있다. 일 구현 예로 상기 라이코펜 사이클라제/파이토엔 신타아제 또는 파이토엔 디새튜라아제를 코딩하는 폴리뉴클레오티드는 각각 서열번호 71 또는 서열번호 72를 가지거나 포함하는 것일 수 있다. 상기 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy) 또는 본 출원의 폴리펩티드를 발현시키고자 하는 미생물에서 선호되는 코돈을 고려하여, 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 상기 폴리뉴클레오티드는 서열번호 71 또는 서열번호 72의 서열과 상동성 또는 동일성이 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열을 가지거나 포함하거나, 또는 서열번호 71 또는 서열번호 72의 서열과 상동성 또는 동일성이 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열로 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다.
본 출원의 미생물은 베타카로틴 15, 15'-옥시게나제(beta-carotene 15,15'-oxygenase; BLH) 단백질을 코딩하는 폴리뉴클레오티드를 더 포함하도록 변형되어, 이들 단백질 활성을 나타내는 미생물 또는 이들 단백질 활성이 강화된 미생물일 수 있으나, 이에 제한되지 않는다. 상기 베타카로틴 15, 15'-옥시게나제는 해양세균 66A03(Uncultured marine bacterium 66A03) 유래의 단백질일 수 있으나, 이에 제한되지 않는다. 일 구현 예로 상기 베타카로틴 15, 15'-옥시게나제를 코딩하는 폴리뉴클레오티드는 UniProtKB(UniProt Knowledgebase)에 등록되어 있는 아미노산 서열(Q4PNI0)에 근거하여 가지거나 포함하는 것일 수 있다. 일 구현 예로 상기 베타카로틴 15, 15'-옥시게나제를 코딩하는 폴리뉴클레오티드는 서열번호 13의 서열을 가지거나 포함하는 것일 수 있다. 상기 폴리뉴클레오티드는 코돈의 축퇴성(degeneracy) 또는 본 출원의 폴리펩티드를 발현시키고자 하는 미생물에서 선호되는 코돈을 고려하여, 아미노산 서열을 변화시키지 않는 범위 내에서 코딩 영역에 다양한 변형이 이루어질 수 있다. 구체적으로, 상기 폴리뉴클레오티드는 서열번호 13의 서열과 상동성 또는 동일성이 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열을 가지거나 포함하거나, 또는 서열번호 13의 서열과 상동성 또는 동일성이 80% 이상, 85% 이상, 90% 이상, 95% 이상, 96% 이상, 97% 이상, 98% 이상, 및 100% 미만인 염기서열로 이루어지거나 필수적으로 이루어질 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어, 폴리펩티드 활성의 "강화"는, 폴리펩티드의 활성이 내재적 활성에 비하여 증가되는 것을 의미한다. 상기 강화는 활성화(activation), 상향조절(up-regulation), 과발현(overexpression), 증가(increase) 등의 용어와 혼용될 수 있다. 여기서 활성화, 강화, 상향조절, 과발현, 증가는 본래 가지고 있지 않았던 활성을 나타내게 되는 것, 또는 내재적 활성 또는 변형 전 활성에 비하여 향상된 활성을 나타내게 되는 것을 모두 포함할 수 있다. 상기 "내재적 활성"은 자연적 또는 인위적 요인에 의한 유전적 변이로 형질이 변화하는 경우, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성을 의미한다. 이는 "변형 전 활성"과 혼용되어 사용될 수 있다. 폴리펩티드의 활성이 내재적 활성에 비하여 "강화", "상향조절", "과발현" 또는 "증가"한다는 것은, 형질 변화 전 모균주 또는 비변형 미생물이 본래 가지고 있던 특정 폴리펩티드의 활성 및/또는 농도(발현량)에 비하여 향상된 것을 의미한다.
상기 강화는 외래의 폴리펩티드 또는 유전자를 도입하거나, 내재적인 폴리펩티드의 활성 강화 및/또는 농도(발현량)를 통해 달성할 수 있다. 상기 폴리펩티드의 활성의 강화 여부는 해당 폴리펩티드의 활성 정도, 발현량 또는 해당 폴리펩티드로부터 배출되는 산물의 양의 증가로부터 확인할 수 있다.
상기 폴리펩티드의 활성의 강화는 당해 분야에 잘 알려진 다양한 방법의 적용이 가능하며, 목적 폴리펩티드의 활성을 변형전 미생물보다 강화시킬 수 있는 한, 제한되지 않는다. 구체적으로, 분자생물학의 일상적 방법인 당업계의 통상의 기술자에게 잘 알려진 유전자 공학 및/또는 단백질 공학을 이용한 것일 수 있으나, 이로 제한되지 않는다(예컨대, Sitnicka et al. Functional Analysis of Genes. Advances in Cell Biology. 2010, Vol. 2. 1-16, Sambrook et al. Molecular Cloning 2012 등).
구체적으로, 본 출원의 폴리펩티드 활성의 강화는
1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가;
2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역을 활성이 강력한 서열로 교체;
3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열의 변형;
4) 폴리펩티드 활성이 강화되도록 상기 폴리펩티드의 아미노산 서열의 변형;
5) 폴리펩티드 활성이 강화되도록 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열의 변형 (예를 들어, 폴리펩티드의 활성이 강화되도록 변형된 폴리펩티드를 코딩하도록 상기 폴리펩티드 유전자의 폴리뉴클레오티드 서열의 변형);
6) 폴리펩티드의 활성을 나타내는 외래 폴리펩티드 또는 이를 코딩하는 외래 폴리뉴클레오티드의 도입;
7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화;
8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식; 또는
9) 상기 1) 내지 8) 중 선택된 2 이상의 조합일 수 있으나, 이에, 특별히 제한되는 것은 아니다.
보다 구체적으로,
상기 1) 폴리펩티드를 코딩하는 폴리뉴클레오티드의 세포 내 카피수 증가는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 작동가능하게 연결된, 숙주와 무관하게 복제되고 기능할 수 있는 벡터의 숙주세포 내로의 도입에 의해 달성되는 것일 수 있다. 또는, 해당 폴리펩티드를 코딩하는 폴리뉴클레오티드가 숙주세포 내의 염색체 내에 1 카피 또는 2 카피 이상 도입에 의해 달성되는 것일 수 있다. 상기 염색체 내에 도입은 숙주세포 내의 염색체 내로 상기 폴리뉴클레오티드를 삽입시킬 수 있는 벡터가 숙주세포 내에 도입됨으로써 수행될 수 있으나, 이에 제한되지 않는다. 상기 벡터는 전술한 바와 같다.
상기 2) 폴리펩티드를 코딩하는 염색체상의 유전자 발현조절영역(또는 발현조절서열)을 활성이 강력한 서열로 교체는, 예를 들면, 상기 발현조절영역의 활성을 더욱 강화하도록 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 가지는 서열로의 교체일 수 있다. 상기 발현조절영역은, 특별히 이에 제한되지 않으나 프로모터, 오퍼레이터 서열, 리보좀 결합 부위를 코딩하는 서열, 그리고 전사 및 해독의 종결을 조절하는 서열 등을 포함할 수 있다. 일 예로, 본래의 프로모터를 강력한 프로모터로 교체시키는 것일 수 있으나, 이에 제한되지 않는다.
공지된 강력한 프로모터의 예에는 CJ1 내지 CJ7 프로모터(미국등록특허 US 7662943 B2), lac 프로모터, trp 프로모터, trc 프로모터, tac 프로모터, 람다 파아지 PR 프로모터, PL 프로모터, tet 프로모터, gapA 프로모터, SPL7 프로모터, SPL13(sm3) 프로모터(미국등록특허 US 10584338 B2), O2 프로모터(미국등록특허 US 10273491 B2), tkt 프로모터, yccA 프로모터, TEFINt 프로모터 등이 있으나, 이에 제한되지 않는다.
상기 3) 폴리펩티드를 코딩하는 유전자 전사체의 개시코돈 또는 5'-UTR 지역을 코딩하는 염기서열 변형은, 예를 들면, 내재적 개시코돈에 비해 폴리펩티드 발현율이 더 높은 다른 개시코돈을 코딩하는 염기 서열로 치환하는 것일 수 있으나, 이에 제한되지 않는다.
상기 4) 및 5)의 아미노산 서열 또는 폴리뉴클레오티드 서열의 변형은, 폴리펩티드의 활성을 강화하도록 상기 폴리펩티드의 아미노산 서열 또는 상기 폴리펩티드를 코딩하는 폴리뉴클레오티드 서열을 결실, 삽입, 비보존적 또는 보존적 치환 또는 이들의 조합으로 서열상의 변이 발생, 또는 더욱 강한 활성을 갖도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열 또는 활성이 증가하도록 개량된 아미노산 서열 또는 폴리뉴클레오티드 서열로의 교체일 수 있으나, 이에 한정되는 것은 아니다. 상기 교체는 구체적으로 상동재조합에 의하여 폴리뉴클레오티드를 염색체내로 삽입함으로써 수행될 수 있으나, 이에 제한되지 않는다. 이때 사용되는 벡터는 염색체 삽입 여부를 확인하기 위한 선별 마커 (selection marker)를 추가로 포함할 수 있다. 상기 선별 마커는 전술한 바와 같다.
상기 6) 폴리펩티드의 활성을 나타내는 외래 폴리뉴클레오티드의 도입은, 상기 폴리펩티드와 동일/유사한 활성을 나타내는 폴리펩티드를 코딩하는 외래 폴리뉴클레오티드의 숙주세포 내 도입일 수 있다. 상기 외래 폴리뉴클레오티드는 상기 폴리펩티드와 동일/유사한 활성을 나타내는 한 그 유래나 서열에 제한이 없다. 상기 도입에 이용되는 방법은 공지된 형질전환 방법을 당업자가 적절히 선택하여 수행될 수 있으며, 숙주 세포 내에서 상기 도입된 폴리뉴클레오티드가 발현됨으로써 폴리펩티드가 생성되어 그 활성이 증가될 수 있다.
상기 7) 폴리펩티드를 암호화하는 폴리뉴클레오티드의 코돈 최적화는, 내재 폴리뉴클레오티드가 숙주세포 내에서 전사 또는 번역이 증가하도록 코돈 최적화한 것이거나, 또는 외래 폴리뉴클레오티드가 숙주세포 내에서 최적화된 전사, 번역이 이루어지도록 이의 코돈을 최적화한 것일 수 있다.
상기 8) 폴리펩티드의 삼차구조를 분석하여 노출 부위를 선택하여 변형하거나 화학적으로 수식하는 것은, 예를 들어 분석하고자 하는 폴리펩티드의 서열정보를 기지 단백질들의 서열정보가 저장된 데이터베이스와 비교함으로써 서열의 유사성 정도에 따라 주형 단백질 후보를 결정하고 이를 토대로 구조를 확인하여, 변형하거나 화학적으로 수식할 노출 부위를 선택하여 변형 또는 수식하는 것일 수 있다.
이와 같은 폴리펩티드 활성의 강화는, 상응하는 폴리펩티드의 활성 또는 농도 발현량이 야생형이나 변형 전 미생물 균주에서 발현된 폴리펩티드의 활성 또는 농도를 기준으로 하여 증가되거나, 해당 폴리펩티드로부터 생산되는 산물의 양의 증가되는 것일 수 있으나, 이에 제한되는 것은 아니다.
일 구현 예로, 본 출원의 미생물은 헤마토코쿠스 플루비알리스 유래의 GGPPS 유전자를 도입함으로써 GGPPS 활성이 강화된 것일 수 있으나, 이에 제한되지 않는다.
본 출원의 미생물은 카로티노이드 또는 이를 전구체로 하는 물질 생산능을 갖는 것일 수 있다.
본 출원에서 용어 "카로티노이드"는 과일 및 야채에서 노란색 등의 색을 내게 하는 테트라테르펜(tetraterpene) 또는 이의 유도체를 의미한다.
일 구현 예로, 상기 카로티노이드는 크산토필(xanthophyll), 카로틴(carotene), 알파카로틴(alpha-carotene), 베타카로틴(beta-carotene), 감마카로틴(gamma-carotene), 피토엔(phytoene), 피토플루엔(phytofluene), 뉴로스포렌(neurosporene), 루테인(lutein), 라이코펜(lycopene), 제아잔틴(Zeaxanthin), 캡산틴(Capsanthin), 칸타잔틴(Canthaxanthin), 및 아스타잔틴(Astaxanthin)으로 구성되는 군에서 선택되는 어느 하나 이상일 수 있으나, 이에 제한되지 않는다.
일 구현 예로, 상기 카로티노이드를 전구체로 하는 물질은 레티노이드일 수 있으나, 이에 제한되지 않는다.
본 출원에서 용어 "레티노이드"는 화학적으로 비타민 A군 또는 이와 화학적으로 연관된 화합물군을 의미한다.
일 구현 예로, 상기 레티노이드는 레티놀, 레티날, 레티노산, 및 레티닐 에스터로 구성되는 군에서 선택되는 어느 하나일 수 있으나, 이에 제한되지 않는다.
일 구현 예로, 본 출원의 미생물은 부산물 생산능이 감소된 것일 수 있으나, 이에 제한되지 않는다.
본 출원에서 부산물은 카로티노이드 또는 이를 전구체로 하는 물질 생산 시, 이들을 제외한 모든 물질을 의미할 수 있다. 일 예로, 베타카로틴 생산 시 발생하는 대표적인 부산물은 스쿠알렌일 수 있다.
본 출원에서 "스쿠알렌"은 불포화 탄화수소(C30H50)로서, 스테로이드 호르몬, 비타민 D 등의 생합성에도 이용되는 물질이다. 본 출원의 미생물은 베타카로틴 생산 경로에서 생성되는 부산물을 감소시킨 것일 수 있으며, 구체적으로 스쿠알렌 생산을 감소시킨 것일 수 있으나, 이에 제한되지 않는다.
본 출원의 다른 하나의 양태는 본 출원의 야로위아 속 미생물을 배지에서 배양하는 단계를 포함하는 카로티노이드 또는 이를 전구체로 하는 물질 생산방법을 제공한다.
상기 미생물, 카로티노이드, 이를 전구체로 하는 물질은 다른 양태에서 설명한 바와 같다.
본 출원에서, 용어 "배양"은 본 출원의 야로위아 속 미생물을 적당히 조절된 환경 조건에서 생육시키는 것을 의미한다. 본 출원에서, 배양과정은 당업계에 알려진 적당한 배지와 배양조건에 따라 이루어질 수 있다. 이러한 배양 과정은 선택되는 균주에 따라 당업자가 용이하게 조정하여 사용할 수 있다. 구체적으로 상기 배양은 회분식, 연속식 및/또는 유가식일 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 야로위아 속 미생물을 적당한 탄소원, 질소원, 인원, 무기화합물, 아미노산 및/또는 비타민 등을 함유한 통상의 배지 내에서 호기성 조건 하에서 온도, pH 등을 조절하면서 배양할 수 있다.
본 출원의 배양에서 배양온도는 20 내지 35℃ 구체적으로는 25 내지 35℃를 유지할 수 있고, 약 10 내지 160 시간, 약 20 시간 내지 130 시간, 약 24 시간 내지 120 시간, 약 36 시간 내지 120 시간, 약 48시간 내지 120시간, 약 48 시간, 약 72 시간, 또는 약 120 시간 동안 배양할 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 배양에 의하여 생산된 카로티노이드 또는 이를 전구체로 하는 물질은 배지 중으로 분비되거나 미생물 내에 잔류할 수 있다.
본 출원의 카로티노이드 또는 이를 전구체로 하는 물질 생산방법은, 본 출원의 야로위아 속 미생물을 준비하는 단계, 상기 미생물을 배양하기 위한 배지를 준비하는 단계, 또는 이들의 조합(순서에 무관, in any order)을, 예를 들어, 상기 배양하는 단계 이전에, 추가로 포함할 수 있다.
본 출원의 카로티노이드 또는 이를 전구체로 하는 물질 생산방법은, 상기 야로위아 속 미생물 배양에 따른 배지(배양이 수행된 배지) 또는 본 출원의 야로위아 속 미생물로부터 카로티노이드 또는 이를 전구체로 하는 물질을 회수하는 단계를 추가로 포함할 수 있다. 상기 회수하는 단계는 상기 배양하는 단계 이후에 추가로 포함될 수 있다.
상기 회수는 본 출원의 미생물의 배양 방법, 예를 들어 회분식, 연속식 또는 유가식 배양 방법 등에 따라 당해 기술 분야에 공지된 적합한 방법을 이용하여 목적하는 레티놀을 수집(collect)하는 것일 수 있다. 예를 들어, 원심분리, 여과, 결정화 단백질 침전제에 의한 처리(염석법), 추출, 세포 파쇄, 초음파 파쇄, 한외여과, 투석법, 분자체 크로마토그래피(겔여과), 흡착크로마토그래피, 이온교환 크로마토그래피, 친화도 크로마토그래피 등의 각종 크로마토그래피, HPLC 또는 이들의 방법을 조합하여 사용될 수 있으며, 당해 분야에 공지된 적합한 방법을 이용하여 배지 또는 미생물로부터 목적하는 레티놀을 회수할 수 있다.
또한, 본 출원의 카로티노이드 또는 이를 전구체로 하는 물질 생산방법은, 추가적으로 정제 단계를 포함할 수 있다. 상기 정제는 당해 기술분야에 공지된 적합한 방법을 이용하여, 수행할 수 있다. 일 예에서, 본 출원의 카로티노이드 또는 이를 전구체로 하는 물질 생산방법이 회수 단계와 정제 단계를 모두 포함하는 경우, 상기 회수 단계와 정제 단계는 순서에 상관없이 이시적(또는 연속적)으로 수행되거나, 동시에 또는 하나의 단계로 통합되어 수행될 수 있으나, 이에 제한되는 것은 아니다.
본 출원의 카로티노이드의 생산방법은 본 출원의 미생물이 생산한 베타카로틴을 베타카로틴 이외의 카로티노이드로 전환하는 단계를 추가로 포함할 수 있다. 본 출원의 카로티노이드 생산방법에 있어서, 상기 전환하는 단계는 상기 배양하는 단계 또는 상기 회수하는 단계 이후에 추가로 포함될 수 있다. 상기 전환하는 단계는 당해 기술분야에 공지된 적합한 방법을 이용하여 수행할 수 있다. 예컨데, 상기 전환은 화학적으로, 또는 효소를 이용하여 수행할 수 있으나, 이에 제한되지 않는다.
본 출원의 레티노이드의 생산방법은 본 출원의 야로위아 속 미생물이 생산한 레티놀을 레티놀 이외의 레티노이드로 전환하는 단계를 추가로 포함할 수 있다. 본 출원의 레티노이드 생산방법에 있어서, 상기 전환하는 단계는 상기 배양하는 단계 또는 상기 회수하는 단계 이후에 추가로 포함될 수 있다. 상기 전환하는 단계는 당해 기술분야에 공지된 적합한 방법을 이용하여 수행할 수 있다. 예컨데, 상기 전환은 레티놀 아실트렌스퍼라아제(retinol acyltransferase)를 이용하여 수행할 수 있으나, 이에 제한되지 않는다.
일 구현 예로, 상기 레티놀 이외의 레티노이드는 레티날, 레티노산, 및 레티닐 에스터로 구성되는 군에서 선택되는 어느 하나일 수 있으나, 레티노이드에 포함되는 한 이에 제한되지 않는다.
본 출원의 또 다른 하나의 양태는 본 출원의 야로위아 속 미생물 또는 이의 배양물을 포함하는 카로티노이드 또는 이를 전구체로 하는 물질의 생산용 조성물을 제공한다.
상기 미생물, 카로티노이드, 또는 이를 전구체로 하는 물질은 다른 양태에서 설명한 바와 같다.
본 출원의 조성물은 통상 사용되는 임의의 적합한 부형제를 추가로 포함할 수 있으며, 이러한 부형제는, 예를 들어 보존제, 습윤제, 분산제, 현탁화제, 완충제, 안정화제 또는 등장화제 등일 수 있으나, 이에 한정되는 것은 아니다.
본 출원의 또 다른 하나의 양태는 본 출원의 미생물 또는 이의 배양물의 카로티노이드 또는 이를 전구체로 하는 물질의 생산 용도를 제공한다.
상기 미생물, 카로티노이드, 또는 이를 전구체로 하는 물질은 다른 양태에서 설명한 바와 같다.
이하 본 출원을 실시예에 의해 보다 상세하게 설명한다. 그러나 하기 실시예는 본 출원을 예시하기 위한 바람직한 실시양태에 불과한 것이며 따라서, 본 출원의 권리범위를 이에 한정하는 것으로 의도되지는 않는다. 한편, 본 명세서에 기재되지 않은 기술적인 사항들은 본 출원의 기술 분야 또는 유사 기술 분야에서 숙련된 통상의 기술자이면 충분히 이해하고 용이하게 실시할 수 있다.
실시예 1. 카로티노이드 또는 이를 전구체로 하는 물질의 생산용 플랫폼 균주 제작
실시예 1-1. X. dendrorhous 유래 crtYB-crtI 삽입주 제작
카로티노이드 또는 이를 전구체로 하는 물질의 생산을 위한 플랫폼 균주 제작을 위해 고지방 효모인 야로위아 리폴리티카(Yarrowia lipolytica) CC08-0125(기탁번호 KCCM12972P) 균주의 게놈에 Xanthophyllomyces dendrorhous 유래 lycopene cyclase/phytoene synthase (crtYB)와 phytoene desaturase(crtI) 유전자를 삽입하였다.
crtYB의 경우 NCBI(National Center for Biotechnology Information Search database)에 등록되어 있는 염기서열(GenBank: AY177204.1)에 근거하여 서열번호 71의 폴리뉴클레오티드를 확보하였고, crtI의 경우 NCBI에 등록되어 있는 염기서열(GenBank: AY177424.1)에 근거하여 서열번호 72의 폴리뉴클레오티드를 확보하였다. crtYB와 crtI의 폴리뉴클레오티드 서열은 마크로젠社를 통해 TEFINtp-crtYB-CYC1t(서열번호 73), TEFINtp-crtI-CYC1t(서열번호 74)의 형태로 유전자를 합성하였으며, 선별 마커로는 Y. lipolytica의 URA3 유전자(서열번호 75)를 이용하여 MHY1(YALI0B21582g) 유전자 위치에 삽입되는 카세트를 디자인하였다. 합성된 crtYB, crtI 유전자 및 KCCM12972P 게놈 DNA를 주형으로 하고 서열번호 76 및 서열번호 77, 서열번호 78 및 서열번호 79, 서열번호 80 및 서열번호 81, 서열번호 82 및 서열번호 83, 서열번호 84 및 서열번호 85, 및 서열번호 86 및 서열번호 87의 프라이머를 이용하여 각각의 PCR을 수행하였다. PCR 조건은 변성 95°C, 1분; 어닐링 55°C, 1분; 및 중합반응 72°C, 3분을 35회 반복 수행하였다. 그 결과로 얻어진 5개의 DNA 단편은 overlap extension PCR을 통해 하나의 카세트로 제작하였다.
이렇게 제작된 카세트를 열충격법 (D.-C. Chen et al., Appl Microbiol Biotechnol, 1997) 으로 KCCM12972P 균주에 도입한 후, 우라실(uracil)이 포함되지 않은 고체배지(YLMM1)에서 형성된 콜로니를 획득하였다. 서열번호 88 및 서열번호 89의 프라이머를 이용하여 게놈 내에 카세트 삽입이 확인된 콜로니들을 5-FOA 고체배지에 spotting하여 30°C에서 3일간 배양하였고, 5-FOA 고체 배지에서 자란 콜로니를 획득함으로써 URA3 마커를 회수하였다.
서열번호 서열(5'- 3') PCR 산물
76 GTGCGCTTCTCTCGTCTCGGTAACCCTGTC Homology left arm
77 ATGCGCCGCCAACCCGGTCTCTGGGGTGTGGTGGATGGGGTGTG
78 CACACCCCATCCACCACACCCCAGAGACCGGGTTGGCGGCGCAT TEFINtp-crtYB-CYC1t
79 CGCCGCCAACCCGGTCTCTTGAAGACGAAAGGGCCTCCG
80 CGGAGGCCCTTTCGTCTTCAAGAGACCGGGTTGGCGGCG TEFINtp-crtI-CYC1t
81 GACGAGTCAGACAGGAGGCATCAGACAGATACTCGTCGCG
82 CGCGACGAGTATCTGTCTGATGCCTCCTGTCTGACTCGTC URA3
83 ATGACGAGTCAGACAGGAGGCATGGTGGTATTGTGACTGGGGAT
84 ATCCCCAGTCACAATACCACCATGCCTCCTGTCTGACTCGTCAT Repeat region
85 CGGCGTCCTTCTCGTAGTCCGCTTTTGGTGGTGAAGAGGAGACT
86 AGTCTCCTCTTCACCACCAAAAGCGGACTACGAGAAGGACGCCG Homology right arm
87 CCACTCGTCACCAACAGTGCCGTGTGTTGC
88 TCGTACGTCTATACCAACAGATGG Forward
89 CGCATACACACACACTGCCGGGGG Reverse
실시예 1-2. HMGR 강화주 제작
앞서 실시예 1-1에서 제작된 균주의 하이드록시메틸글루타릴 리덕테이즈(3-hydroxy-3-methylglutaryl-CoA reductase, HMGR)유전자의 native 프로모터(서열번호 90) 부위를 TEFINt 프로모터로 교체하기 위한 카세트를 디자인하였고, KCCM12972P 게놈 DNA를 주형으로 하고 서열번호 91 및 서열번호 92, 서열번호 93 및 서열번호 94, 서열번호 95 및 서열번호 96, 서열번호 97 및 서열번호 98, 및 서열번호 99 및 서열번호 100의 프라이머를 이용하여 각각의 PCR을 수행하였다. PCR 조건은 변성 95°C, 1분; 어닐링 55°C, 1분; 및 중합반응 72°C, 1분 30초를 35회 반복 수행하였다. 그 결과로 얻어진 5개의 DNA 단편은 overlap extension PCR을 통해 하나의 카세트로 제작하였다.
이렇게 제작된 카세트를 열충격법으로 실시예 1-1에서 제작한 균주에 도입한 후, 우라실이 포함되지 않은 고체배지(YLMM1)에서 형성된 콜로니를 획득하였다. 서열번호 101 및 서열번호 102의 프라이머를 이용하여 카세트 삽입이 확인된 콜로니들을 5-FOA 고체배지에 spotting하여 30°C에서 3일간 배양하였고, 5-FOA 고체 배지에서 자란 콜로니를 획득함으로써 URA3 마커를 회수하였다. 이에 따라 최종적으로 제작된 플랫폼 균주를 CC08-1023으로 명명하였다.
< Yarrowia lipolytica minimal media1 (YLMM1)>
포도당 20 g/L, 아미노산을 포함하지 않는 효모 질소 염기(Yeast nitrogen base without amino acids) 6.7 g/L, 우라실을 포함하지 않는 효모 합성 드롭 아웃 배지 보충물 (Yeast Synthetic Drop-out Medium Supplements without uracil) 2 g/L, 한천(agar) 15 g/L
<5-Fluoroorotic Acid (5-FOA)>
포도당 20 g/L, 아미노산을 포함하지 않는 효모 질소 염기(Yeast nitrogen base without amino acids) 6.7 g/L, 우라실을 포함하지 않는 효모 합성 드롭 아웃 배지 보충물 (Yeast Synthetic Drop-out Medium Supplements without uracil) 2 g/L, 우라실(Uracil) 50 μg/mL, 5-플루오로 오로틴산(5-FOA) 1 g/L, 한천(agar) 15 g/L
서열번호 서열(5'- 3') PCR 산물
91 GACAATGCCTCGAGGAGGTTTAAAAGTAACT Homology left arm
92 GCGCCGCCAACCCGGTCTCTCTGTGTTAGTCGGATGATAGG
93 CCTATCATCCGACTAACACAGAGAGACCGGGTTGGCGGCGC TEFINt promoter
94 GACGAGTCAGACAGGAGGCACTGCGGTTAGTACTGCAAAAAG
95 CTTTTTGCAGTACTAACCGCAGTGCCTCCTGTCTGACTCGTC URA3
96 ATGCGCCGCCAACCCGGTCTCTTGGTGGTATTGTGACTGGGGAT
97 ATCCCCAGTCACAATACCACCAAGAGACCGGGTTGGCGGCGCAT Repeat region
98 CTTTCCAATAGCTGCTTGTAGCTGCGGTTAGTACTGCAAAA
99 TTTTGCAGTACTAACCGCAGCTACAAGCAGCTATTGGAAAG Homology right arm
100 GCTTAATGTGATTGATCTCAAACTTGATAG
101 GCTGTCTCTGCGAGAGCACGTCGA Forward
102 GGTTCGCACAACTTCTCGGGTGGC Reverse
실시예 2. 헤마토코쿠스 플루비알리스( Haematococcus pluvialis ) 유래의 제라닐제라닐 피로포스페이트 산타아제(Geranylgeranyl pyrophosphate synthase; GGPP synthase) 유전자 삽입주 제작
각기 다른 유래의 GGPP synthase 유전자(이하, GGPPS 유전자) 4종을 실시예 1에서 제작한 균주 CC08-1023의 게놈에 다음과 같이 각각 도입하였다.
실시예 2-1. Haematococcus pluvialis 유래 GGPPS 삽입주 제작
Yarrowia lipolytica 염색체 상에 Haematococcus pluvialils 유래 GGPPS1 유전자(이하, Hp.GGPPS1)를 삽입하기 위해 Hp.GGPPS1은 NCBI(National Center for Biotechnology Information Search database)에 등록되어 있는 염기서열(GenBank: APX64485.1)에 근거하여 http://atgme.org를 통해 Y. lipolytica에 적합하도록 코돈 최적화를 진행하였고(서열번호 1), 마크로젠社를 통해 TEFINtp-코돈 최적화된 Hp.GGPPS1-CYC1t의 형태로 유전자를 합성하였으며(서열번호 4), 선별 마커로는 Y. lipolytica 의 URA3 유전자(서열번호 5)를 이용하여 LIG4(YALI0D21384g) 유전자 위치에 삽입되는 카세트를 디자인 하였다. 합성된 Hp.GGPPS1 유전자 및 KCCM12972P genomic DNA를 주형으로 하고, 하기 표 3과 같이 서열번호 15 및 서열번호 16, 서열번호 17 및 서열번호 18, 서열번호 19 및 서열번호 20, 서열번호 21 및 서열번호 22, 서열번호 23 및 서열번호 24, 서열번호 25 및 서열번호 26, 및 서열번호 27 및 서열번호 28의 프라이머를 이용하여 각각 left homologous region, TEFINt promoter, Hp.GGPPS1 ORF, CYC1 terminator, URA3, repeat region, 및 right homologous region 단편의 PCR을 수행하였다. PCR 조건은 변성 95°C, 1분; 어닐링 55°C, 1분; 및 중합반응 72°C, 2분을 35회 반복 수행하였다. 그 결과로 얻어진 DNA 단편들은 overlap extension PCR을 통해 하나의 카세트로 제작하였다.
이렇게 제작된 카세트를 열충격법으로 CC08-1023 균주에 도입한 후, 우라실(uracil)이 포함되지 않은 고체배지(YLMM1)에서 형성된 콜로니를 획득하였다. 서열번호 29 및 서열번호 30의 프라이머를 이용하여 게놈 내에 카세트 삽입이 확인된 콜로니들을 5-FOA 고체배지에 도말하여 30°C에서 3일간 배양하였고, 5-FOA 고체 배지에서 형성된 콜로니를 획득함으로써 URA3 마커를 제거하였다.
서열번호 서열(5'- 3')
15 CATCATTTCAAAAGAGGGAACAGC
16 CGCCGCCAACCCGGTCTCTGTGTTTGGCGGTGTGAGTTGTC
17 GACAACTCACACCGCCAAACACAGAGACCGGGTTGGCGGCG
18 CGGTTGTGCATGGCTCGGATCTGCGGTTAGTACTGCAAAAAGTGC
19 GCACTTTTTGCAGTACTAACCGCAGATCCGAGCCATGCACAACCG
20 AACTAATTACATGActcgaGCTAGTTCTTTCGGTAGCCGA
21 TCGGCTACCGAAAGAACTAGCtcgagTCATGTAATTAGTT
22 gacgagtcagacaggaggcaGCAAATTAAAGCCTTCGAGC
23 GCTCGAAGGCTTTAATTTGCtgcctcctgtctgactcgtc
24 AACTAATTACATGActcgaGtggtggtattgtgactgggg
25 ccccagtcacaataccaccaCtcgagTCATGTAATTAGTT
26 CCATATGGAGTGTTATTTGAAGGGGCAAATTAAAGCCTTCGAGC
27 GCTCGAAGGCTTTAATTTGCCCCTTCAAATAACACTCCATATGG
28 CCGATACAGTGTCCAAGTACG
29 GAGTGTCTGAAGACAAGGCTTC
30 GACGACAATGCTGAGCTCCG
실시예 2-2. Xanthophyllomyces dendrorhous 유래 crtE 변이 유전자 삽입주 제작
Yarrowia lipolytica 염색체 상에 Xanthophyllomyces dendrorhous 유래 crtE 변이 유전자 crtEM1 (서열번호 6, Hong et al., Applied Microbiology and Biotechnology, 2019 Jan;103(1):211-223)를 삽입하기 위해 , 마크로젠社를 통해 TEFINtp-crtEM1-TDH3t의 형태로 유전자를 합성하였으며(서열번호 8), 선별 마커로는 Y. lipolytica의 URA3 유전자(서열번호 5)를 이용하여 LIG4(YALI0D21384g) 유전자 위치에 삽입되는 카세트를 디자인 하였다.
합성된 crtEM1 DNA와 KCCM12972P genomic DNA를 주형으로 하고 표 4와 같이 서열번호 31 및 서열번호 32, 서열번호 33 및 서열번호 34, 서열번호 35 및 서열번호 36, 서열번호 37 및 서열번호 38, 서열번호 39 및 서열번호 40, 서열번호 41 및 서열번호 42, 및 서열번호 43 및 서열번호 44의 프라이머를 이용하여 각각 left homologous region, TEFINt promoter, crtEM1 ORF, TDH3 terminator, URA3, repeat region, 및 right homologous region 단편의 PCR을 수행하였다.
PCR 조건은 변성 95°C, 1분; 어닐링 55°C, 1분; 및 중합반응 72°C, 2분을 35회 반복 수행하였다. 그 결과로 얻어진 DNA 단편들은 overlap extension PCR을 통해 하나의 카세트로 제작하였다.
이렇게 제작된 카세트를 열충격법으로 CC08-1023균주에 도입한 후, 우라실이 포함되지 않은 고체배지(YLMM1)에서 형성된 콜로니를 획득하였다. 서열번호 45 및 서열번호 46의 프라이머를 이용하여 게놈 내에 카세트 삽입이 확인된 콜로니들을 5-FOA 고체배지에 도말하여 30°C에서 3일간 배양하였고, 5-FOA 고체 배지에서 형성된 콜로니를 획득함으로써 URA3 마커를 제거하였다.
서열번호 서열(5'- 3')
31 CATCATTTCAAAAGAGGGAACAGC
32 CGCCGCCAACCCGGTCTCTGTGTTTGGCGGTGTGAGTTGTC
33 GACAACTCACACCGCCAAACACAGAGACCGGGTTGGCGGCG
34 CTGTGAGGATGTTCGCGTAATCCTGCGGTTAGTACTGCAAAAAGTGC
35 GCACTTTTTGCAGTACTAACCGCAGGATTACGCGAACATCCTCACAG
36 CTTCGCTCTTGATCTTCGGATAGTCACAGAGGGATATCGGCTAG
37 CTAGCCGATATCCCTCTGTGACTATCCGAAGATCAAGAGCGAAG
38 GACGAGTCAGACAGGAGGCAGTCTTGGAACGGTGAAAAAGCCTGC
39 GCAGGCTTTTTCACCGTTCCAAGACTGCCTCCTGTCTGACTCGTC
40 CGCTCTTGATCTTCGGATAGTGGTGGTATTGTGACTGGGGA
41 TCCCCAGTCACAATACCACCACTATCCGAAGATCAAGAGCG
42 CATATGGAGTGTTATTTGAAGGGGTCTTGGAACGGTGAAAAAGCCTGC
43 GCAGGCTTTTTCACCGTTCCAAGACCCCTTCAAATAACACTCCATATG
44 CCGATACAGTGTCCAAGTACG
45 GAGTGTCTGAAGACAAGGCTTC
46 GACGACAATGCTGAGCTCCG
실시예 2-3. Saccharomyces cerevisiae 유래 BTS1 삽입주 제작
Yarrowia lipolytica 염색체 상에 Saccharomyces cerevisiae 유래 BTS1 유전자(이하, Sc.BTS1)를 삽입하기 위해 BTS1은 KEGG(Kyoto Encyclopedia of Genes and Genomes)에 등록되어 있는 염기서열(YPL069C)에 근거하여 서열번호 9의 폴리뉴클레오티드를 확보하였다. 상기 BTS1의 폴리뉴클레오티드를 이용하여 TEFINtp-Sc.BTS1-TDH3t(서열번호 10)의 형태로 유전자를 합성하였다. 선별 마커로는 Y. lipolytica의 URA3 유전자(서열번호 5)를 이용하여 LIG4(YALI0D21384g) 유전자 위치에 삽입되는 카세트를 디자인 하였다.
합성된 Sc.BTS1 DNA 및 KCCM12972P genomic DNA를 주형으로 하고 표 5와 같이 서열번호 31 및 서열번호 32, 서열번호 33 및 서열번호 47, 서열번호 48 및 서열번호 49, 서열번호 50 및 서열번호 38, 서열번호 39 및 서열번호 40, 서열번호 41 및 서열번호 42, 서열번호 43 및 서열번호 44의 프라이머를 이용하여 각각 left homologous region, TEFINt promoter, Sc.BTS1 ORF, TDH3 terminator, URA3, repeat region, 및 right homologous region 단편의 PCR을 수행하였다. PCR 조건은 변성 95°C, 1분; 어닐링 55°C, 1분; 및 중합반응 72°C, 2분을 35회 반복 수행하였다. 그 결과로 얻어진 DNA 단편들은 overlap extension PCR을 통해 하나의 카세트로 제작하였다.
이렇게 제작된 카세트를 열충격법으로 CC08-1023균주에 도입한 후, 우라실이 포함되지 않은 고체배지(YLMM1)에서 형성된 콜로니를 획득하였다. 서열번호 45 및 서열번호 46의 프라이머를 이용하여 게놈 내에 카세트 삽입이 확인된 콜로니들을 5-FOA 고체배지에 도말하여 30°C에서 3일간 배양하였고, 5-FOA 고체 배지에서 형성된 콜로니를 획득함으로써 URA3 마커를 제거하였다.
서열번호 서열(5'- 3')
47 CAGCTCATCTATCTTGGCCTCCTGCGGTTAGTACTGCAAAAAGTGC
48 GCACTTTTTGCAGTACTAACCGCAGGAGGCCAAGATAGATGAGCTG
49 CTTCGCTCTTGATCTTCGGATAGTCACAATTCGGATAAGTGGTCTATTATATATAAC
50 GTTATATATAATAGACCACTTATCCGAATTGTGACTATCCGAAGATCAAGAGCGAAG
실시예 2-4. Yarrowia lipolytica 유래 GGS1 삽입주 제작
Yarrowia lipolytica 염색체 상에 Yarrowia lipolytica 유래 GGS1 유전자(이하, Yl.GGS1)를 삽입하기 위해 GGS1은 KEGG(Kyoto Encyclopedia of Genes and Genomes)에 등록되어 있는 염기서열(YALI0D17050g)에 근거하여 서열번호 11의 폴리뉴클레오티드를 확보하였다. 상기 Yl.GGS1의 폴리뉴클레오티드를 이용하여 TEFINtp-Yl.GGS1-TDH3t(서열번호 12)의 형태로 유전자를 합성하였다. 선별 마커로는 Y. lipolytica의 URA3 유전자(서열번호 5)를 이용하여 LIG4(YALI0D21384g) 유전자 위치에 삽입되는 카세트를 디자인 하였다.
합성된 Yl.GGS1 유전자 및 KCCM12972P genomic DNA를 주형으로 하고 표 6과 같이 서열번호 31 및 서열번호 32, 서열번호 33 및 서열번호 51, 서열번호 52 및 서열번호 53, 서열번호 54 및 서열번호 38, 서열번호 39 및 서열번호 40, 서열번호 41 및 서열번호 42, 및 서열번호 43 및 서열번호 44의 프라이머를 이용하여 각각 left homologous region, TEFINt promoter, Yl.GGS1 ORF, TDH3 terminator, URA3, repeat region, 및 right homologous region 단편의 PCR을 수행하였다. PCR 조건은 변성 95°C, 1분; 어닐링 55°C, 1분; 및 중합반응 72°C, 2분을 35회 반복 수행하였다. 그 결과로 얻어진 DNA 단편들은 overlap extension PCR을 통해 하나의 카세트로 제작하였다.
이렇게 제작된 카세트를 열충격법으로 CC08-1023균주에 도입한 후, 우라실이 포함되지 않은 고체배지(YLMM1)에서 형성된 콜로니를 획득하였다. 서열번호 45 및 서열번호 46의 프라이머를 이용하여 게놈 내에 카세트 삽입이 확인된 콜로니들을 5-FOA 고체배지에 도말하여 30°C에서 3일간 배양하였고, 5-FOA 고체 배지에서 형성된 콜로니를 획득함으로써 URA3 마커를 제거하였다.
서열번호 서열(5'- 3')
51 CTTGAAATCCGCGCTGTTATAATCCTGCGGTTAGTACTGCAAAAAGTGC
52 GCACTTTTTGCAGTACTAACCGCAGGATTATAACAGCGCGGATTTCAAG
53 CTTCGCTCTTGATCTTCGGATAGTCACTGCGCATCCTCAAAGTAC
54 GTACTTTGAGGATGCGCAGTGACTATCCGAAGATCAAGAGCGAAG
실시예 3. GGPP synthase 도입주 기반 베타카로틴 생산능 비교 평가
실시예 2-1 내지 2-4에서 확보한 균주와 실시예 1에서 확보한 모균주 CC08-1023를 포함하여 총 5종에 대해 플라스크 평가를 진행하였다. 상기 균주를 YPD(Yeast extract-Peptone-Dextrose) 배지 20ml을 포함하는 250ml 코너-바플 플라스크에 초기 OD 2가 되도록 접종하고 30℃에서 48시간 동안, 200rpm으로 진탕 배양하였다. 배양을 종료한 후, 배양액 1 ml을 원심 분리하여 상등액을 제거하였다. 상기 YPD 배지 조성은 다음과 같다.
< YPD liquid media >
4% 포도당, 1% yeast extract, 2% peptone의 비율로 0.1M 포스페이트 완충액(sodium phosphate buffer)(pH 7.0)에 녹인다.
그 다음으로, DMSO(Dimethyl sulfoxide, sigma 社, CAS number 67-68-5) 0.5ml을 첨가하고 55℃에서 10분 동안 진탕(agitation, 2,000rpm)하여 세포를 파쇄하였다. 추가로 아세톤(sigma社, CAS number 67-64-1) 0.5ml을 첨가하고 45℃에서 15분동안 진탕(agitation, 2,000rpm)하여 베타카로틴과 스쿠알렌 추출을 진행하였으며, HPLC 설비로 농도 분석을 하였다. 분석된 베타카로틴 및 스쿠알렌 농도를 측정한 결과를 도 1에 표시하였다.
그 결과, 도 1에서 나타난 바와 같이, CC08-1023(모균주), Hp.GGPPS1 도입주, crtEM1 도입주, Sc.BTS1 도입주, 및 Yl.GGS1 도입주에서의 베타카로틴 농도는 각각 5.49mg/L, 58.73mg/L, 40.58mg/L, 5.21mg/L, 및 49.22mg/L로 측정되었으며, 특히 Hp.GGPPS1를 도입하였을 때 베타카로틴이 모균주 대비 53.24mg/L 증가하여 베타카로틴 증가효과가 가장 우수함을 확인하였다.
추가적으로 스쿠알렌 농도는 각각 313.24mg/L, 200.31mg/L, 235.27mg/L, 253.28mg/L, 및 221.22mg/L로 측정되었으며, 유사하게 Hp.GGPPS1이 도입되었을 때 스쿠알렌 농도가 CC08-1023 균주 대비 112.93mg/L 감소하여 스쿠알렌 생산 저감 효과가 가장 우수함을 확인하였다.
이러한 결과를 바탕으로 야로위아 속 미생물에서는 Hp.GGPPS1이 GGPP synthase로써의 효과가 가장 우수하다는 것을 확인하였다. 놀랍게도, 근연관계를 갖는 사카로마이세스 세레비지에, 야로위아 리폴리티카, 및 크산토필마로마이세스 덴드로로스 유래의 제라닐제라닐 피로포스페이트 신타아제를 도입하였을 때에는 효과가 미미하였으나, 상대적으로 근연관계가 없는 헤마토코쿠스 플루비알리스 유래의 제라닐제라닐 피로포스페이트 신타아제를 도입하였을 때에는 효과가 현저하였다.
실시예 4. Beta-carotene 15,15'oxygenase(BCO) 유전자 도입주 제작
Yarrowia lipolytica 염색체 상에 해양세균 66A03(Uncultured marine bacterium 66A03) 유래 beta-carotene 15,15'oxygenase(이하, Mb.BCO) 유전자를 삽입하기 위해 Mb.BCO는 UniProtKB(UniProt Knowledgebase)에 등록되어 있는 아미노산 서열(Q4PNI0)에 근거하여 http://atgme.org를 통해 Yarrowia lipolytica에 적합하도록 코돈 최적화한 폴리뉴클레오티드 서열(서열번호 13)을 확보하였다. 상기 Mb.BCO 의 폴리뉴클레오티드를 이용하여 TEFINtp-코돈 최적화된 Mb.BCO-CYC1t(서열번호 14)의 형태로 유전자를 합성하였다. 선별 마커로는 Y. lipolytica의 URA3 유전자(서열번호 5)를 이용하여 KU70(YALI0C08701g) 유전자 위치에 삽입되는 카세트를 디자인 하였다. 합성된 Mb.BCO 및 KCCM12972P genomic DNA를 주형으로 하고 표 7과 같이 서열번호 55 및 서열번호 56, 서열번호 57 및 서열번호 58, 서열번호 59 및 서열번호 60, 서열번호 61 및 서열번호 62, 서열번호 63 및 서열번호 64, 서열번호 65 서열번호 66, 및 서열번호 67 및 서열번호 68의 프라이머를 이용하여 각각 left homologous region, TEFINt promoter, Mb.BCO ORF, CYC1 terminator, URA3, repeat region, 및 right homologous region PCR을 수행하였다. PCR 조건은 변성 95°C, 1분; 어닐링 55°C, 1분; 및 중합반응 72°C, 2분을 35회 반복 수행하였다. 그 결과로 얻어진 DNA 단편들은 overlap extension PCR을 통해 하나의 카세트로 제작하였다.
이렇게 제작된 카세트를 열충격법으로 실시예 2-1 내지 2-4에서 제작한 균주에 각각 도입한 후, 우라실이 포함되지 않은 고체배지(YLMM1)에서 형성된 콜로니를 획득하였다. 서열번호 69와 서열번호 70의 프라이머를 이용하여 게놈 내에 카세트 삽입이 확인된 콜로니들을 5-FOA 고체배지에 도말하여 30°C에서 3일간 배양하였고, 5-FOA 고체 배지에서 형성된 콜로니를 획득함으로써 URA3 마커를 제거하였다.
서열번호 서열(5'- 3')
55 GGCGTTTCAGGTGGTTGCGTGAGTG
56 GACACAAATGCGCCGCCAACCCGGTCTCTGCGGCGGTTCGTGGTTCGTGTTTC
57 GAAACACGAACCACGAACCGCCGCAGAGACCGGGTTGGCGGCGCATTTGTGTC
58 CAGTCGATCAGCATCAGGCCCTGCGGTTAGTACTGCAAAA
59 TTTTGCAGTACTAACCGCAGGGCCTGATGCTGATCGACTG
60 AACTAATTACATGActcgaGCTAGTTCTTGATCTTGATTC
61 GAATCAAGATCAAGAACTAGCtcgagTCATGTAATTAGTT
62 gacgagtcagacaggaggcaGCAAATTAAAGCCTTCGAGCGTCCC
63 GGGACGCTCGAAGGCTTTAATTTGCtgcctcctgtctgactcgtc
64 AACTAATTACATGActcgaGtggtggtattgtgactgggg
65 ccccagtcacaataccaccaCtcgagTCATGTAATTAGTT
66 GCAGCAGTCATACATGTTCTGAGGCAAATTAAAGCCTTCGAGCGTCCC
67 GGGACGCTCGAAGGCTTTAATTTGCCTCAGAACATGTATGACTGCTGC
68 CTACTTTGTGCAGATTGAGGCCAAG
69 GTCGTCTGTCTTCTCTTCAG
70 CCACCAAGATGGGCAAGAAG
실시예 5. Beta-carotene 15,15'oxygenase(BCO) 유전자 도입주 레티놀 생산능 비교평가
실시예 4에서 확보한 균주 및 실시예 1에서 확보한 모균주 CC08-1023을 포함하여 총 5종에 대해 플라스크 평가를 진행하였다. 상기 균주를 YPD(Yeast extract-Peptone-Dextrose) 배지 20ml 및 butylated hydroxytoluene 0.05%을 포함하는 250ml 코너-바플 플라스크에 초기 OD 2가 되도록 접종하고 30℃에서 48시간 동안, 200rpm으로 진탕 배양하였다. 배양을 종료한 후, 배양액 1 ml를 원심분리하여 상등액을 제거하였다. 그 다음으로 DMSO(Dimethyl sulfoxide, sigma社) 0.5ml을 넣고 55℃에서 10분 동안 진탕(agitation 2,000rpm)하여 세포를 파쇄하였다. 추가로 아세톤(sigma社) 0.5ml을 첨가하고 45℃에서 15분동안 진탕(agitation, 2,000rpm)하여 레티놀, 레티날, 베타카로틴, 및 스쿠알렌 추출을 진행하였고, HPLC 설비로 각각을 농도 분석하였다. 분석된 레티놀, 레티날, 베타카로틴, 및 스쿠알렌 농도를 측정한 결과를 도 2에 표시하였다.
그 결과, 도 2에서와 같이, CC08-1023 균주에 Mb.BCO를 도입한 균주에서는 레티놀이 측정되지 않았다. 이와 달리 CC08-1023을 기반으로 Hp.GGPPS1, crtEM1, Sc.BTS1, 및 Yl,GGS1를 각각 도입한 후에 Mb.BCO를 도입한 균주 4종에서 각각 8.44mg/L, 2.78mg/L, 0mg/L, 및 4.35mg/L의 레티놀 농도가 측정되었다.
베타카로틴 농도는 상기 균주 5종에서 각각 3.68mg/L, 0.35mg.L, 2.47mg/L, 3.58mg/L, 및 0.98mg/L로 베타카로틴이 레티놀로 전환되어 낮은 베타카로틴 농도를 나타냄을 확인하였다. 또한, 상기 균주 5종에서 스쿠알렌 농도는 각각 309.88mg/L, 202.18mg/L, 282.19mg/L, 306.34mg/L, 및 269.18mg/L로 측정하였다.
이러한 결과를 바탕으로 GGPP 생합성 강화가 레티놀 생산능 증대에 긍정적인 효과가 있음이 확인되었다.
또한, 상기 결과를 통해, Hp.GGPPS1는 베타카로틴 생산, 스쿠알렌 감소, 및 레티놀 생산에 우수한 효과가 있음을 검증하였다.
이상의 설명으로부터, 본 출원이 속하는 기술분야의 당업자는 본 출원이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 출원의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 출원의 범위에 포함되는 것으로 해석되어야 한다.
본 출원의 서열번호에 따른 각각의 서열은 하기 표 8과 같다.
서열번호 명칭 서열 종류
1 Codon optimized Hp.GGPPS1 ORF atgatccgag ccatgcacaa ccgagccccc accccccgaa cccgagtgtc tcacccccga 60
tctcaccgag ccctggccca cgtgtctgcc gtggccaccg ccggccaggt ggccgaggtg 120
cactctgccc ccgccttcga cttcgagatg tacatgcgag accgagccga gatggtgaac 180
aaggccctgg acgccgccct gccctctcga taccccgagg tgctggtgga ctctatgcga 240
tactctgtgc tggccggcgg caagcgagtg cgacccgccc tgaccctggc cgcctgtgac 300
ctggtgggcg gcgacatggc caccgccctg cccaccgcct gtgccatgga gatgatccac 360
accatgtctc tgatccacga cgacctgccc gccatggaca acgacgactt ccgacgaggc 420
cgacccacca accacaaggt gtacggcgag gacatcgcca tcctggccgg cgacgccctg 480
ctgtctttcg ccttcgagca catcgcccga gacaccaagg gcgtgcccgc cgacgccgtg 540
ctgaaggtga tcatggagct gggccgagcc gtgggcgccc agggcctgtc tgccggccag 600
gccgtggaca tcaagtctga gggccaggag gtgggcctgg aggtgctgga gtacatccac 660
caccacaaga ccgccgccct gctggaggcc gccgtggtgt gtggcgccct ggtgggcggc 720
gccgacaccg ccaccgtgga gaagctgcga aagtacgccc tgaacatcgg cctggccttc 780
caggtgatcg acgacatcct ggacgtgacc cagaccaccg agaccctggg caagaccgcc 840
gccaaggacc tggccgtgaa caagaccacc taccccaagc tgctgggcct ggaggcctct 900
cgaaaggtgg ccgacgacct gatccgagag gccatcgccc agctggacga gttcgagccc 960
gcccgaaagg cccccatggt ggccctggcc cacctgatcg gctaccgaaa gaactag		 DNA
2 TEFINtp agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac 60
cccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca 120
aacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta 180
cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac 240
gcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa 300
aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca 360
cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag 420
aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg 480
acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca g		 DNA
3 CYC1t ctcgagtcat gtaattagtt atgtcacgct tacattcacg ccctcccccc acatccgctc 60
taaccgaaaa ggaaggagtt agacaacctg aagtctaggt ccctatttat ttttttatag 120
ttatgttagt attaagaacg ttatttatat ttcaaatttt tctttttttt ctgtacagac 180
gcgtgtacgc atgtaacatt atactgaaaa ccttgcttga gaaggttttg ggacgctcga 240
aggctttaat ttgc		 DNA
4 TEFINtp-codon optimized Hp.GGPPS1-CYC1t agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac 60
cccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca 120
aacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta 180
cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac 240
gcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa 300
aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca 360
cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag 420
aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg 480
acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca gatccgagcc 540
atgcacaacc gagcccccac cccccgaacc cgagtgtctc acccccgatc tcaccgagcc 600
ctggcccacg tgtctgccgt ggccaccgcc ggccaggtgg ccgaggtgca ctctgccccc 660
gccttcgact tcgagatgta catgcgagac cgagccgaga tggtgaacaa ggccctggac 720
gccgccctgc cctctcgata ccccgaggtg ctggtggact ctatgcgata ctctgtgctg 780
gccggcggca agcgagtgcg acccgccctg accctggccg cctgtgacct ggtgggcggc 840
 DNA
　 　 gacatggcca ccgccctgcc caccgcctgt gccatggaga tgatccacac catgtctctg 900
atccacgacg acctgcccgc catggacaac gacgacttcc gacgaggccg acccaccaac 960
cacaaggtgt acggcgagga catcgccatc ctggccggcg acgccctgct gtctttcgcc 1020
ttcgagcaca tcgcccgaga caccaagggc gtgcccgccg acgccgtgct gaaggtgatc 1080
atggagctgg gccgagccgt gggcgcccag ggcctgtctg ccggccaggc cgtggacatc 1140
aagtctgagg gccaggaggt gggcctggag gtgctggagt acatccacca ccacaagacc 1200
gccgccctgc tggaggccgc cgtggtgtgt ggcgccctgg tgggcggcgc cgacaccgcc 1260
accgtggaga agctgcgaaa gtacgccctg aacatcggcc tggccttcca ggtgatcgac 1320
gacatcctgg acgtgaccca gaccaccgag accctgggca agaccgccgc caaggacctg 1380
gccgtgaaca agaccaccta ccccaagctg ctgggcctgg aggcctctcg aaaggtggcc 1440
gacgacctga tccgagaggc catcgcccag ctggacgagt tcgagcccgc ccgaaaggcc 1500
cccatggtgg ccctggccca cctgatcggc taccgaaaga actagctcga gtcatgtaat 1560
tagttatgtc acgcttacat tcacgccctc cccccacatc cgctctaacc gaaaaggaag 1620
gagttagaca acctgaagtc taggtcccta tttatttttt tatagttatg ttagtattaa 1680
gaacgttatt tatatttcaa atttttcttt tttttctgta cagacgcgtg tacgcatgta 1740
acattatact gaaaaccttg cttgagaagg ttttgggacg ctcgaaggct ttaatttgc		 　
5 URA3 tgcctcctgt ctgactcgtc attgccgcct ttggagtacg actccaacta tgagtgtgct 60
tggatcactt tgacgataca ttcttcgttg gaggctgtgg gtctgacagc tgcgttttcg 120
gcgcggttgg ccgacaacaa tatcagctgc aacgtcattg ctggctttca tcatgatcac 180
atttttgtcg gcaaaggcga cgcccagaga gccattgacg ttctttctaa tttggaccga 240
tagccgtata gtccagtcta tctataagtt caactaactc gtaactatta ccataacata 300
tacttcactg ccccagataa ggttccgata aaaagttctg cagactaaat ttatttcagt 360
ctcctcttca ccaccaaaat gccctcctac gaagctcgag ctaacgtcca caagtccgcc 420
tttgccgctc gagtgctcaa gctcgtggca gccaagaaaa ccaacctgtg tgcttctctg 480
gatgttacca ccaccaagga gctcattgag cttgccgata aggtcggacc ttatgtgtgc 540
atgatcaaga cccatatcga catcattgac gacttcacct acgccggcac tgtgctcccc 600
ctcaaggaac ttgctcttaa gcacggtttc ttcctgttcg aggacagaaa gttcgcagat 660
attggcaaca ctgtcaagca ccagtacaag aacggtgtct accgaatcgc cgagtggtcc 720
gatatcacca acgcccacgg tgtacccgga accggaatca ttgctggcct gcgagctggt 780
gccgaggaaa ctgtctctga acagaagaag gaggacgtct ctgactacga gaactcccag 840
tacaaggagt tcctggtccc ctctcccaac gagaagctgg ccagaggtct gctcatgctg 900
gccgagctgt cttgcaaggg ctctctggcc actggcgagt actccaagca gaccattgag 960
cttgcccgat ccgaccccga gtttgtggtt ggcttcattg cccagaaccg acctaagggc 1020
gactctgagg actggcttat tctgaccccc ggggtgggtc ttgacgacaa gggagacgct 1080
ctcggacagc agtaccgaac tgttgaggat gtcatgtcta ccggaacgga tatcataatt 1140
gtcggccgag gtctgtacgg ccagaaccga gatcctattg aggaggccaa gcgataccag 1200
aaggctggct gggaggctta ccagaagatt aactgttaga ggttagacta tggatatgtc 1260
atttaactgt gtatatagag agcgtgcaag tatggagcgc ttgttcagct tgtatgatgg 1320
tcagacgacc tgtctgatcg agtatgtatg atactgcaca acctgtgtat ccgcatgatc 1380
tgtccaatgg ggcatgttgt tgtgtttctc gatacggaga tgctgggtac aagtagctaa 1440
tacgattgaa ctacttatac ttatatgagg cttgaagaaa gctgacttgt gtatgactta 1500
ttctcaacta catccccagt cacaatacca cca		 DNA
6 Codon optimized crtEM1 ORF atggattacg cgaacatcct cacagcaatt ccactcgagt ttactcctca ggatgatatc 60
gtgctccttg aaccgtatca ctacctagga aagaaccctg gaaaagaaat tcgatcacaa 120
ctcatcgagg ctttcaacta ttggttggat gtcaagaagg aggatctcga ggtcatccag 180
aacgttgttg gcatgctaca taccgctagc ttattaatgg acgatgtgga ggattcatcg 240
gtcctcaggc gtgggtcgcc tgtagcccat ctaatttacg ggattccgca gacaataaac 300
actgcaaact acgtctactt tctggcttat caagagatct tcaagcttcg cccaacaccg 360
atacccatgc ctgtaattcc tccttcatct gcttcgcttc aatcaaccgt ctcctctgca 420
tcctcctcct cctcggcctc gtctgaaaac gggggcacgt catctcctaa ttcgcagatt 480
ccgttctcga aagatacgta tcttgataaa gtgatcacag acgagatgct ttccctccat 540
agagggcaag gcctggagct attctggaga gatagtctga cgtgtcctag cgaagaggaa 600
tatgtgaaaa tggttcttgg aaagacggga ggtttgttcc gtatagcggt cagattgatg 660
atggcaaagt cagaatgtga catagacttt gtccagcttg tcaacttgat ctcaatatac 720
ttccagatca gggatgacta tatgaacctt cagtcttctg agtatgccca tattaagaat 780
tttgcagagg acctcacaga aggaaaattc agttttccca ctatccactc gattcgtgcc 840
aacccctcat cgagactcgt catcaatacg ttgcagaaga aatcgacctc tcctgagatc 900
cttcaccact gtgtaaacta catgcgcaca gaaacccact cattcgaata tactcaggaa 960
gtcctcaaca ccttgtcagg tgcactcgag agagaactag gaaggcttca aggagagttc 1020
gcagaagcta actcaaagat tgatcttgga gacgtagagt cggaaggaag aacggggaag 1080
aacgtcaaat tggaagcgat cctgaaaaag ctagccgata tccctctgtg a		 DNA
7 TDH3t ctatccgaag atcaagagcg aagcaagttg taagtccagg acatgtttcc cgcccacgcg 60
agtgatttat aacacctctc ttttttgaca cccgctcgcc ttgaaattca tgtcacataa 120
attatagtca acgacgtttg aataacttgt cttgtagttc gatgatgatc atatgattac 180
attaatagta attactgtat ttgatatata tactaattac aatagtacat attagaacat 240
acaatagtta gtgccgtgaa gtggcttaaa ataccgcgag tcgattacgt aatattatat 300
ataatgtcaa agtggggtcc cagagccgaa gaaggtgctt ttcttgaaga tcccagtgta 360
ttggacaagt atatctgtct ctatgattgt ttttccaggt gaaaatgttg aacaaagtgt 420
ctactggagt ttgtaagcgc tggtgcgact ggggccactt ttaaaacccg ccttagcagg 480
ctttttcacc gttccaagac		 DNA
8 TEFINtp-codon optimized crtEM1-TDH3t agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac 60
cccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca 120
aacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta 180
cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac 240
gcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa 300
aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca 360
cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag 420
aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg 480
acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca ggattacgcg 540
aacatcctca cagcaattcc actcgagttt actcctcagg atgatatcgt gctccttgaa 600
ccgtatcact acctaggaaa gaaccctgga aaagaaattc gatcacaact catcgaggct 660
ttcaactatt ggttggatgt caagaaggag gatctcgagg tcatccagaa cgttgttggc 720
atgctacata ccgctagctt attaatggac gatgtggagg attcatcggt cctcaggcgt 780
gggtcgcctg tagcccatct aatttacggg attccgcaga caataaacac tgcaaactac 840
gtctactttc tggcttatca agagatcttc aagcttcgcc caacaccgat acccatgcct 900
gtaattcctc cttcatctgc ttcgcttcaa tcaaccgtct cctctgcatc ctcctcctcc 960
tcggcctcgt ctgaaaacgg gggcacgtca tctcctaatt cgcagattcc gttctcgaaa 1020
gatacgtatc ttgataaagt gatcacagac gagatgcttt ccctccatag agggcaaggc 1080
ctggagctat tctggagaga tagtctgacg tgtcctagcg aagaggaata tgtgaaaatg 1140
gttcttggaa agacgggagg tttgttccgt atagcggtca gattgatgat ggcaaagtca 1200
gaatgtgaca tagactttgt ccagcttgtc aacttgatct caatatactt ccagatcagg 1260
gatgactata tgaaccttca gtcttctgag tatgcccata ttaagaattt tgcagaggac 1320
ctcacagaag gaaaattcag ttttcccact atccactcga ttcgtgccaa cccctcatcg 1380
agactcgtca tcaatacgtt gcagaagaaa tcgacctctc ctgagatcct tcaccactgt 1440
gtaaactaca tgcgcacaga aacccactca ttcgaatata ctcaggaagt cctcaacacc 1500
ttgtcaggtg cactcgagag agaactagga aggcttcaag gagagttcgc agaagctaac 1560
tcaaagattg atcttggaga cgtagagtcg gaaggaagaa cggggaagaa cgtcaaattg 1620
 DNA
　 　 gaagcgatcc tgaaaaagct agccgatatc cctctgtgac tatccgaaga tcaagagcga 1680
agcaagttgt aagtccagga catgtttccc gcccacgcga gtgatttata acacctctct 1740
tttttgacac ccgctcgcct tgaaattcat gtcacataaa ttatagtcaa cgacgtttga 1800
ataacttgtc ttgtagttcg atgatgatca tatgattaca ttaatagtaa ttactgtatt 1860
tgatatatat actaattaca atagtacata ttagaacata caatagttag tgccgtgaag 1920
tggcttaaaa taccgcgagt cgattacgta atattatata taatgtcaaa gtggggtccc 1980
agagccgaag aaggtgcttt tcttgaagat cccagtgtat tggacaagta tatctgtctc 2040
tatgattgtt tttccaggtg aaaatgttga acaaagtgtc tactggagtt tgtaagcgct 2100
ggtgcgactg gggccacttt taaaacccgc cttagcaggc tttttcaccg ttccaagac		 　
9 Sc.BTS1 ORF atggaggcca agatagatga gctgatcaat aatgatcctg tttggtccag ccaaaatgaa 60
agcttgattt caaaacctta taatcacatc cttttgaaac ctggcaagaa ctttagacta 120
aatttaatag ttcaaattaa cagagttatg aatttgccca aagaccagct ggccatagtt 180
tcgcaaattg ttgagctctt gcataattcc agccttttaa tcgacgatat agaagataat 240
gctcccttga gaaggggaca gaccacttct cacttaatct tcggtgtacc ctccactata 300
aacaccgcaa attatatgta tttcagagcc atgcaacttg tatcgcagct aaccacaaaa 360
gagcctttgt atcataattt gattacgatt ttcaacgaag aattgatcaa tctacatagg 420
ggacaaggct tggatatata ctggagagac tttctgcctg aaatcatacc tactcaggag 480
atgtatttga atatggttat gaataaaaca ggcggccttt tcagattaac gttgagactc 540
atggaagcgc tgtctccttc ctcacaccac ggccattcgt tggttccttt cataaatctt 600
ctgggtatta tttatcagat tagagatgat tacttgaatt tgaaagattt ccaaatgtcc 660
agcgaaaaag gctttgctga ggacattaca gaggggaagt tatcttttcc catcgtccac 720
gcccttaact tcactaaaac gaaaggtcaa actgagcaac acaatgaaat tctaagaatt 780
ctcctgttga ggacaagtga taaagatata aaactaaagc tgattcaaat actggaattc 840
gacaccaatt cattggccta caccaaaaat tttattaatc aattagtgaa tatgataaaa 900
aatgataatg aaaataagta tttacctgat ttggcttcgc attccgacac cgccaccaat 960
ttacatgacg aattgttata tataatagac cacttatccg aattgtga		 DNA
10 TEFINtp-Sc.BTS1-TDH3t agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac 60
cccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca 120
aacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta 180
cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac 240
gcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa 300
aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca 360
cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag 420
aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg 480
acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca ggaggccaag 540
atagatgagc tgatcaataa tgatcctgtt tggtccagcc aaaatgaaag cttgatttca 600
aaaccttata atcacatcct tttgaaacct ggcaagaact ttagactaaa tttaatagtt 660
caaattaaca gagttatgaa tttgcccaaa gaccagctgg ccatagtttc gcaaattgtt 720
gagctcttgc ataattccag ccttttaatc gacgatatag aagataatgc tcccttgaga 780
aggggacaga ccacttctca cttaatcttc ggtgtaccct ccactataaa caccgcaaat 840
tatatgtatt tcagagccat gcaacttgta tcgcagctaa ccacaaaaga gcctttgtat 900
cataatttga ttacgatttt caacgaagaa ttgatcaatc tacatagggg acaaggcttg 960
gatatatact ggagagactt tctgcctgaa atcataccta ctcaggagat gtatttgaat 1020
atggttatga ataaaacagg cggccttttc agattaacgt tgagactcat ggaagcgctg 1080
tctccttcct cacaccacgg ccattcgttg gttcctttca taaatcttct gggtattatt 1140
tatcagatta gagatgatta cttgaatttg aaagatttcc aaatgtccag cgaaaaaggc 1200
tttgctgagg acattacaga ggggaagtta tcttttccca tcgtccacgc ccttaacttc 1260
actaaaacga aaggtcaaac tgagcaacac aatgaaattc taagaattct cctgttgagg 1320
acaagtgata aagatataaa actaaagctg attcaaatac tggaattcga caccaattca 1380
ttggcctaca ccaaaaattt tattaatcaa ttagtgaata tgataaaaaa tgataatgaa 1440
aataagtatt tacctgattt ggcttcgcat tccgacaccg ccaccaattt acatgacgaa 1500
ttgttatata taatagacca cttatccgaa ttgtgactat ccgaagatca agagcgaagc 1560
aagttgtaag tccaggacat gtttcccgcc cacgcgagtg atttataaca cctctctttt 1620		 DNA
　 　 ttgacacccg ctcgccttga aattcatgtc acataaatta tagtcaacga cgtttgaata 1680
acttgtcttg tagttcgatg atgatcatat gattacatta atagtaatta ctgtatttga 1740
tatatatact aattacaata gtacatatta gaacatacaa tagttagtgc cgtgaagtgg 1800
cttaaaatac cgcgagtcga ttacgtaata ttatatataa tgtcaaagtg gggtcccaga 1860
gccgaagaag gtgcttttct tgaagatccc agtgtattgg acaagtatat ctgtctctat 1920
gattgttttt ccaggtgaaa atgttgaaca aagtgtctac tggagtttgt aagcgctggt 1980
gcgactgggg ccacttttaa aacccgcctt agcaggcttt ttcaccgttc caagac		 　
11 Yl.GGS1 ORF atggattata acagcgcgga tttcaaggag atatggggca aggccgccga caccgcgctg 60
ctgggaccgt acaactacct cgccaacaac cggggccaca acatcagaga acacttgatc 120
gcagcgttcg gagcggttat caaggtggac aagagcgatc tcgagaccat ttcgcacatc 180
accaagattt tgcataactc gtcgctgctt gttgatgacg tggaagacaa ctcgatgctc 240
cgacgaggcc tgccggcagc ccattgtctg tttggagtcc cccaaaccat caactccgcc 300
aactacatgt actttgtggc tctgcaggag gtgctcaagc tcaagtctta tgatgccgtc 360
tccattttca ccgaggaaat gatcaacttg catagaggtc agggtatgga tctctactgg 420
agagaaacac tcacttgccc ctcggaagac gagtatctgg agatggtggt gcacaagacc 480
ggtggactgt ttcggctggc tctgagactt atgctgtcgg tggcatcgaa acaggaggac 540
catgaaaaga tcaactttga tctcacacac cttaccgaca cactgggagt catttaccag 600
attctggatg attacctcaa cctgcagtcc acggaattga ccgagaacaa gggattctgc 660
gaagatatca gcgaaggaaa gttttcgttt ccgctgattc acagcatacg caccaacccg 720
gataaccacg agattctcaa cattctcaaa cagcgaacaa gcgacgcttc actcaaaaag 780
tacgccgtgg actacatgag aacagaaacc aagagtttcg actactgcct caagaggata 840
caggccatgt cactcaaggc aagttcgtac attgatgatc tagcagcagc tggccacgat 900
gtctccaagc tacgagccat tttgcattat tttgtgtcca cctctgactg tgaggagaga 960
aagtactttg aggatgcgca gtga		 DNA
12 TEFINtp-Yl.GGS1-TDH3t agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac 60
cccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca 120
aacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta 180
cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac 240
gcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa 300
aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca 360
cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag 420
aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg 480
acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca ggattataac 540
agcgcggatt tcaaggagat atggggcaag gccgccgaca ccgcgctgct gggaccgtac 600
aactacctcg ccaacaaccg gggccacaac atcagagaac acttgatcgc agcgttcgga 660
gcggttatca aggtggacaa gagcgatctc gagaccattt cgcacatcac caagattttg 720
cataactcgt cgctgcttgt tgatgacgtg gaagacaact cgatgctccg acgaggcctg 780
ccggcagccc attgtctgtt tggagtcccc caaaccatca actccgccaa ctacatgtac 840
tttgtggctc tgcaggaggt gctcaagctc aagtcttatg atgccgtctc cattttcacc 900
gaggaaatga tcaacttgca tagaggtcag ggtatggatc tctactggag agaaacactc 960
acttgcccct cggaagacga gtatctggag atggtggtgc acaagaccgg tggactgttt 1020
cggctggctc tgagacttat gctgtcggtg gcatcgaaac aggaggacca tgaaaagatc 1080
aactttgatc tcacacacct taccgacaca ctgggagtca tttaccagat tctggatgat 1140
tacctcaacc tgcagtccac ggaattgacc gagaacaagg gattctgcga agatatcagc 1200
gaaggaaagt tttcgtttcc gctgattcac agcatacgca ccaacccgga taaccacgag 1260
attctcaaca ttctcaaaca gcgaacaagc gacgcttcac tcaaaaagta cgccgtggac 1320
tacatgagaa cagaaaccaa gagtttcgac tactgcctca agaggataca ggccatgtca 1380
ctcaaggcaa gttcgtacat tgatgatcta gcagcagctg gccacgatgt ctccaagcta 1440
cgagccattt tgcattattt tgtgtccacc tctgactgtg aggagagaaa gtactttgag 1500		 DNA
　 　 gatgcgcagt gactatccga agatcaagag cgaagcaagt tgtaagtcca ggacatgttt 1560
cccgcccacg cgagtgattt ataacacctc tcttttttga cacccgctcg ccttgaaatt 1620
catgtcacat aaattatagt caacgacgtt tgaataactt gtcttgtagt tcgatgatga 1680
tcatatgatt acattaatag taattactgt atttgatata tatactaatt acaatagtac 1740
atattagaac atacaatagt tagtgccgtg aagtggctta aaataccgcg agtcgattac 1800
gtaatattat atataatgtc aaagtggggt cccagagccg aagaaggtgc ttttcttgaa 1860
gatcccagtg tattggacaa gtatatctgt ctctatgatt gtttttccag gtgaaaatgt 1920
tgaacaaagt gtctactgga gtttgtaagc gctggtgcga ctggggccac ttttaaaacc 1980
cgccttagca ggctttttca ccgttccaag ac		 　
13 Codon optimized Mb.BCO ORF atgggcctga tgctgatcga ctggtgtgcc ctggccctgg tggtgttcat cggcctgccc 60
cacggcgccc tggacgccgc catctctttc tctatgatct cttctgccaa gcgaatcgcc 120
cgactggccg gcatcctgct gatctacctg ctgctggcca ccgccttctt cctgatctgg 180
taccagctgc ccgccttctc tctgctgatc ttcctgctga tctctatcat ccacttcggc 240
atggccgact tcaacgcctc tccctctaag ctgaagtggc cccacatcat cgcccacggc 300
ggcgtggtga ccgtgtggct gcccctgatc cagaagaacg aggtgaccaa gctgttctct 360
atcctgacca acggccccac ccccatcctg tgggacatcc tgctgatctt cttcctgtgt 420
tggtctatcg gcgtgtgtct gcacacctac gagaccctgc gatctaagca ctacaacatc 480
gccttcgagc tgatcggcct gatcttcctg gcctggtacg ccccccccct ggtgaccttc 540
gccacctact tctgtttcat ccactctcga cgacacttct ctttcgtgtg gaagcagctg 600
cagcacatgt cttctaagaa gatgatgatc ggctctgcca tcatcctgtc ttgtacctct 660
tggctgatcg gcggcggcat ctacttcttc ctgaactcta agatgatcgc ctctgaggcc 720
gccctgcaga ccgtgttcat cggcctggcc gccctgaccg tgccccacat gatcctgatc 780
gacttcatct tccgacccca ctcttctcga atcaagatca agaactag		 DNA
14 TEFINtp-codon optimized Mb.BCO-CYC1t agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac 60
cccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca 120
aacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta 180
cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac 240
gcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa 300
aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca 360
cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag 420
aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg 480
acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca gggcctgatg 540
ctgatcgact ggtgtgccct ggccctggtg gtgttcatcg gcctgcccca cggcgccctg 600
gacgccgcca tctctttctc tatgatctct tctgccaagc gaatcgcccg actggccggc 660
atcctgctga tctacctgct gctggccacc gccttcttcc tgatctggta ccagctgccc 720
gccttctctc tgctgatctt cctgctgatc tctatcatcc acttcggcat ggccgacttc 780
aacgcctctc cctctaagct gaagtggccc cacatcatcg cccacggcgg cgtggtgacc 840
gtgtggctgc ccctgatcca gaagaacgag gtgaccaagc tgttctctat cctgaccaac 900
ggccccaccc ccatcctgtg ggacatcctg ctgatcttct tcctgtgttg gtctatcggc 960
gtgtgtctgc acacctacga gaccctgcga tctaagcact acaacatcgc cttcgagctg 1020
atcggcctga tcttcctggc ctggtacgcc ccccccctgg tgaccttcgc cacctacttc 1080
tgtttcatcc actctcgacg acacttctct ttcgtgtgga agcagctgca gcacatgtct 1140
tctaagaaga tgatgatcgg ctctgccatc atcctgtctt gtacctcttg gctgatcggc 1200
ggcggcatct acttcttcct gaactctaag atgatcgcct ctgaggccgc cctgcagacc 1260
gtgttcatcg gcctggccgc cctgaccgtg ccccacatga tcctgatcga cttcatcttc 1320
cgaccccact cttctcgaat caagatcaag aactagctcg agtcatgtaa ttagttatgt 1380
cacgcttaca ttcacgccct ccccccacat ccgctctaac cgaaaaggaa ggagttagac 1440
aacctgaagt ctaggtccct atttattttt ttatagttat gttagtatta agaacgttat 1500
ttatatttca aatttttctt ttttttctgt acagacgcgt gtacgcatgt aacattatac 1560
tgaaaacctt gcttgagaag gttttgggac gctcgaaggc tttaatttgc		 DNA
15 primer catcatttca aaagagggaa cagc DNA
16 primer cgccgccaac ccggtctctg tgtttggcgg tgtgagttgt c DNA
17 primer gacaactcac accgccaaac acagagaccg ggttggcggc g DNA
18 primer cggttgtgca tggctcggat ctgcggttag tactgcaaaa agtgc DNA
19 primer gcactttttg cagtactaac cgcagatccg agccatgcac aaccg DNA
20 primer aactaattac atgactcgag ctagttcttt cggtagccga DNA
21 primer tcggctaccg aaagaactag ctcgagtcat gtaattagtt DNA
22 primer gacgagtcag acaggaggca gcaaattaaa gccttcgagc DNA
23 primer gctcgaaggc tttaatttgc tgcctcctgt ctgactcgtc DNA
24 primer aactaattac atgactcgag tggtggtatt gtgactgggg DNA
25 primer ccccagtcac aataccacca ctcgagtcat gtaattagtt DNA
26 primer ccatatggag tgttatttga aggggcaaat taaagccttc gagc DNA
27 primer gctcgaaggc tttaatttgc cccttcaaat aacactccat atgg DNA
28 primer ccgatacagt gtccaagtac g DNA
29 primer gagtgtctga agacaaggct tc DNA
30 primer gacgacaatg ctgagctccg DNA
31 primer catcatttca aaagagggaa cagc DNA
32 primer cgccgccaac ccggtctctg tgtttggcgg tgtgagttgt c DNA
33 primer gacaactcac accgccaaac acagagaccg ggttggcggc g DNA
34 primer ctgtgaggat gttcgcgtaa tcctgcggtt agtactgcaa aaagtgc DNA
35 primer gcactttttg cagtactaac cgcaggatta cgcgaacatc ctcacag DNA
36 primer cttcgctctt gatcttcgga tagtcacaga gggatatcgg ctag DNA
37 primer ctagccgata tccctctgtg actatccgaa gatcaagagc gaag DNA
38 primer gacgagtcag acaggaggca gtcttggaac ggtgaaaaag cctgc DNA
39 primer gcaggctttt tcaccgttcc aagactgcct cctgtctgac tcgtc DNA
40 primer cgctcttgat cttcggatag tggtggtatt gtgactgggg a DNA
41 primer tccccagtca caataccacc actatccgaa gatcaagagc g DNA
42 primer catatggagt gttatttgaa ggggtcttgg aacggtgaaa aagcctgc DNA
43 primer gcaggctttt tcaccgttcc aagacccctt caaataacac tccatatg DNA
44 primer ccgatacagt gtccaagtac g DNA
45 primer gagtgtctga agacaaggct tc DNA
46 primer gacgacaatg ctgagctccg DNA
47 primer cagctcatct atcttggcct cctgcggtta gtactgcaaa aagtgc DNA
48 primer gcactttttg cagtactaac cgcaggaggc caagatagat gagctg DNA
49 primer cttcgctctt gatcttcgga tagtcacaat tcggataagt ggtctattat atataac DNA
50 primer gttatatata atagaccact tatccgaatt gtgactatcc gaagatcaag agcgaag DNA
51 primer cttgaaatcc gcgctgttat aatcctgcgg ttagtactgc aaaaagtgc DNA
52 primer gcactttttg cagtactaac cgcaggatta taacagcgcg gatttcaag DNA
53 primer cttcgctctt gatcttcgga tagtcactgc gcatcctcaa agtac DNA
54 primer gtactttgag gatgcgcagt gactatccga agatcaagag cgaag DNA
55 primer ggcgtttcag gtggttgcgt gagtg DNA
56 primer gacacaaatg cgccgccaac ccggtctctg cggcggttcg tggttcgtgt ttc DNA
57 primer gaaacacgaa ccacgaaccg ccgcagagac cgggttggcg gcgcatttgt gtc DNA
58 primer cagtcgatca gcatcaggcc ctgcggttag tactgcaaaa DNA
59 primer ttttgcagta ctaaccgcag ggcctgatgc tgatcgactg DNA
60 primer aactaattac atgactcgag ctagttcttg atcttgattc DNA
61 primer gaatcaagat caagaactag ctcgagtcat gtaattagtt DNA
62 primer gacgagtcag acaggaggca gcaaattaaa gccttcgagc gtccc DNA
63 primer gggacgctcg aaggctttaa tttgctgcct cctgtctgac tcgtc DNA
64 primer aactaattac atgactcgag tggtggtatt gtgactgggg DNA
65 primer ccccagtcac aataccacca ctcgagtcat gtaattagtt DNA
66 primer gcagcagtca tacatgttct gaggcaaatt aaagccttcg agcgtccc DNA
67 primer gggacgctcg aaggctttaa tttgcctcag aacatgtatg actgctgc DNA
68 primer ctactttgtg cagattgagg ccaag DNA
69 primer gtcgtctgtc ttctcttcag DNA
70 primer ccaccaagat gggcaagaag DNA
71 crtYB atgacggctc tcgcatatta ccagatccat ctgatctata ctctcccaat tcttggtctt 60
ctcggcctgc tcacttcccc gattttgaca aaatttgaca tctacaaaat atcgatcctc 120
gtatttattg cgtttagtgc aaccacacca tgggactcat ggatcatcag aaatggcgca 180
tggacatatc catcagcgga gagtggccaa ggcgtgtttg gaacgtttct agatgttcca 240
tatgaagagt acgctttctt tgtcattcaa accgtaatca ccggcttggt ctacgtcttg 300
gcaactaggc accttctccc atctctcgcg cttcccaaga ctagatcgtc cgccctttct 360
ctcgcgctca aggcgctcat ccctctgccc attatctacc tatttaccgc tcaccccagc 420
ccatcgcccg acccgctcgt gacagatcac tacttctaca tgcgggcact ctccttactc 480
atcaccccac ctaccatgct cttggcagca ttatcaggcg aatatgcttt cgattggaaa 540		 DNA
　 　 agtggccgag caaagtcaac tattgcagca atcatgatcc cgacggtgta tctgatttgg 600
gtagattatg ttgctgtcgg tcaagactct tggtcgatca acgatgagaa gattgtaggg 660
tggaggcttg gaggtgtact acccattgag gaagctatgt tcttcttact gacgaatcta 720
atgattgttc tgggtctgtc tgcctgcgat catactcagg ccctatacct gctacacggt 780
cgaactattt atggcaacaa aaagatgcca tcttcatttc ccctcattac accgcctgtg 840
ctctccctgt tttttagcag ccgaccatac tcttctcagc caaaacgtga cttggaactg 900
gcagtcaagt tgttggagga aaagagccgg agcttttttg ttgcctcggc tggatttcct 960
agcgaagtta gggagaggct ggttggacta tacgcattct gccgggtgac tgatgatctt 1020
atcgactctc ctgaagtatc ttccaacccg catgccacaa ttgacatggt ctccgatttt 1080
cttaccctac tatttgggcc cccgctacac ccttcgcaac ctgacaagat cctttcttcg 1140
cctttacttc ctccttcgca cccttcccga cccacgggaa tgtatcccct cccgcctcct 1200
ccttcgctct cgcctgccga gctcgttcaa ttccttaccg aaagggttcc cgttcaatac 1260
catttcgcct tcaggttgct cgctaagttg caagggctga tccctcgata cccactcgac 1320
gaactcctta gaggatacac cactgatctt atctttccct tatcgacaga ggcagtccag 1380
gctcggaaga cgcctatcga gaccacagct gacttgctgg actatggtct atgtgtagca 1440
ggctcagtcg ccgagctatt ggtctatgtc tcttgggcaa gtgcaccaag tcaggtccct 1500
gccaccatag aagaaagaga agctgtgtta gtggcaagcc gagagatggg aactgccctt 1560
cagttggtga acattgctag ggacattaaa ggggacgcaa cagaagggag attttaccta 1620
ccactctcat tctttggtct tcgggatgaa tcaaagcttg cgatcccgac tgattggacg 1680
gaacctcggc ctcaagattt cgacaaactc ctcagtctat ctccttcgtc cacattacca 1740
tcttcaaacg cctcagaaag cttccggttc gaatggaaga cgtactcgct tccattagtc 1800
gcctacgcag aggatcttgc caaacattct tataagggaa ttgaccgact tcctaccgag 1860
gttcaagcgg gaatgcgagc ggcttgcgcg agctacctac tgatcggccg agagatcaaa 1920
gtcgtttgga aaggagacgt cggagagaga aggacagttg ccggatggag gagagtacgg 1980
aaagtcttga gtgtggtcat gagcggatgg gaagggcagt aa		 　
72 crtI atgggaaaag aacaagatca ggataaaccc acagctatca tcgtgggatg tggtatcggt 60
ggaatcgcca ctgccgctcg tcttgctaaa gaaggtttcc aggtcacggt gttcgagaag 120
aacgactact ccggaggtcg atgctcttta atcgagcgag atggttatcg attcgatcag 180
gggcccagtt tgctgctctt gccagatctc ttcaagcaga cattcgaaga tttgggagag 240
aagatggaag attgggtcga tctcatcaag tgtgaaccca actatgtttg ccacttccac 300
gatgaagaga ctttcactct ttcaaccgac atggcgttgc tcaagcggga agtcgagcgt 360
tttgaaggca aagatggatt tgatcggttc ttgtcgttta tccaagaagc ccacagacat 420
tacgagcttg ctgtcgttca cgtcctgcag aagaacttcc ctggcttcgc agcattctta 480
cggctacagt tcattggcca aatcctggct cttcacccct tcgagtctat ctggacaaga 540
gtttgtcgat atttcaagac cgacagatta cgaagagtct tctcgtttgc agtgatgtac 600
atgggtcaaa gcccatacag tgcgcccgga acatattcct tgctccaata caccgaattg 660
accgagggca tctggtatcc gagaggaggc ttttggcagg ttcctaatac tcttcttcag 720
atcgtcaagc gcaacaatcc ctcagccaag ttcaatttca acgctccagt ttcccaggtt 780
cttctctctc ctgccaagga ccgagcgact ggtgttcgac ttgaatccgg cgaggaacat 840
cacgccgatg ttgtgattgt caatgctgac ctcgtttacg cctccgagca cttgattcct 900
gacgatgcca gaaacaagat tggccaactg ggtgaagtca agagaagttg gtgggctgac 960
ttagttggtg gaaagaagct caagggaagt tgcagtagtt tgagcttcta ctggagcatg 1020
gaccgaatcg tggacggtct gggcggacac aatatcttct tggccgagga cttcaaggga 1080
tcattcgaca caatcttcga ggagttgggt ctcccagccg atccttcctt ttacgtgaac 1140
gttccctcgc gaatcgatcc ttctgccgct cccgaaggca aagatgctat cgtcattctt 1200
gtgccgtgtg gccatatcga cgcttcgaac cctcaagatt acaacaagct tgttgctcgg 1260
gcaaggaagt ttgtgatcca cacgctttcc gccaagcttg gacttcccga ctttgaaaaa 1320
atgattgtgg cagagaaggt tcacgatgct ccctcttggg agaaagaatt caacctcaag 1380
gacggaagca tcttgggact ggctcacaac tttatgcaag ttcttggttt caggccgagc 1440
accagacatc ccaagtatga caagttgttc tttgtcgggg cttcgactca tcccggaact 1500		 DNA
　 　 ggggttccca tcgtcttggc tggagccaag ttaactgcca accaagttct cgaatccttt 1560
gaccgatccc cagctccaga tcccaatatg tcactctccg taccatatgg aaaacctctc 1620
aaatcaaatg gaacgggtat cgattctcag gtccagctga agttcatgga tttggagaga 1680
tgggtatacc ttttggtgtt gttgattggg gccgtgatcg ctcgatccgt tggtgttctt 1740
gctttctga		 　
73 TEFINtp-crtYB-CYC1t agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac 60
cccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca 120
aacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta 180
cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac 240
gcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa 300
aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca 360
cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag 420
aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg 480
acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca gacggctctc 540
gcatattacc agatccatct gatctatact ctcccaattc ttggtcttct cggtctgctc 600
acttccccga ttttgacaaa atttgacatc tacaaaatat cgatcctcgt atttattgcg 660
tttagtgcaa ccacaccatg ggactcatgg atcatcagaa atggcgcatg gacatatcca 720
tcagcggaga gtggccaagg cgtgtttgga acgtttctag atgttccata tgaagagtac 780
gctttctttg tcattcaaac cgtaatcacc ggcttggtct acgtcttggc aactaggcac 840
cttctcccat ctctcgcgct tcccaagact agatcgtccg ccctttctct cgcgctcaag 900
gcgctcatcc ctctgcccat tatctaccta tttaccgctc accccagccc atcgcccgac 960
ccgctcgtga cagatcacta cttctacatg cgggcactct ccttactcat caccccacct 1020
accatgctct tggcagcatt atcaggcgaa tatgctttcg attggaaaag tggccgagca 1080
aagtcaacta ttgcagcaat catgatcccg acggtgtatc tgatttgggt agattatgtt 1140
gctgtcggtc aagactcttg gtcgatcaac gatgagaaga ttgtagggtg gaggcttgga 1200
ggtgtactac ccattgagga agctatgttc ttcttactga cgaatctaat gattgttctg 1260
ggtctgtctg cctgcgatca tactcaggcc ctatacctgc tacacggtcg aactatttat 1320		 DNA
　 　 ggcaacaaaa agatgccatc ttcatttccc ctcattacac cgcctgtgct ctccctgttt 1380
tttagcagcc gaccatactc ttctcagcca aaacgtgact tggaactggc agtcaagttg 1440
ttggaggaaa agagccggag cttttttgtt gcctcggctg gatttcctag cgaagttagg 1500
gagaggctgg ttggactata cgcattctgc cgggtgactg atgatcttat cgactctcct 1560
gaagtatctt ccaacccgca tgccacaatt gacatggtct ccgattttct taccctacta 1620
tttgggcccc cgctacaccc ttcgcaacct gacaagatcc tttcttcgcc tttacttcct 1680
ccttcgcacc cttcccgacc cacgggaatg tatcccctcc cgcctcctcc ttcgctctcg 1740
cctgccgagc tcgttcaatt ccttaccgaa agggttcccg ttcaatacca tttcgccttc 1800
aggttgctcg ctaagttgca agggctgatc cctcgatacc cactcgacga actccttaga 1860
ggatacacca ctgatcttat ctttccttta tcgacagagg cagtccaggc tcggaagacg 1920
cctatcgaga ccacagctga cttgctggac tatggtctat gtgtagcagg ctcagtcgcc 1980
gagctattgg tctatgtctc ttgggcaagt gcaccaagtc aggtccctgc caccatagaa 2040
gaaagagaag ctgtgttagt ggcaagccga gagatgggaa ctgcccttca gttggtgaac 2100
attgctaggg acattaaagg ggacgcaaca gaagggagat tttacctacc actctcattc 2160
tttggtcttc gggatgaatc aaagcttgcg atcccgactg attggacgga acctcggcct 2220
caagatttcg acaaactcct cagtctatct ccttcgtcca cattaccatc ttcaaacgcc 2280
tcagaaagct tccggttcga atggaagacg tactcgcttc cattagtcgc ctacgcagag 2340
gatcttgcca aacattctta taagggaatt gaccgacttc ctaccgaggt tcaagcggga 2400
atgcgagcgg cttgcgcgag ctacctactg atcggccgag agatcaaagt cgtttggaaa 2460
ggagacgtcg gagagagaag gacagttgcc ggatggagga gagtacggaa agtcttgagt 2520
gtggtcatga gcggatggga agggcagtaa ctcgagtcat gtaattagtt atgtcacgct 2580
tacattcacg ccctcccccc acatccgctc taaccgaaaa ggaaggagtt agacaacctg 2640
aagtctaggt ccctatttat ttttttatag ttatgttagt attaagaacg ttatttatat 2700
ttcaaatttt tctttttttt ctgtacagac gcgtgtacgc atgtaacatt atactgaaaa 2760
ccttgcttga gaaggttttg ggacgctcga aggctttaat ttgc		 　
74 TEFINtp-crtI-CYC1t agagaccggg ttggcggcgc atttgtgtcc caaaaaacag ccccaattgc cccaattgac 60
cccaaattga cccagtagcg ggcccaaccc cggcgagagc ccccttctcc ccacatatca 120
aacctccccc ggttcccaca cttgccgtta agggcgtagg gtactgcagt ctggaatcta 180
cgcttgttca gactttgtac tagtttcttt gtctggccat ccgggtaacc catgccggac 240
gcaaaataga ctactgaaaa tttttttgct ttgtggttgg gactttagcc aagggtataa 300
aagaccaccg tccccgaatt acctttcctc ttcttttctc tctctccttg tcaactcaca 360
cccgaaatcg ttaagcattt ccttctgagt ataagaatca ttcaaaatgg tgagtttcag 420
aggcagcagc aattgccacg ggctttgagc acacggccgg gtgtggtccc attcccatcg 480
acacaagacg ccacgtcatc cgaccagcac tttttgcagt actaaccgca gggaaaagaa 540
caagatcagg ataaacccac agctatcatc gtgggatgtg gtatcggtgg aatcgccact 600
gccgctcgtc ttgctaaaga aggtttccag gtcacggtgt tcgagaagaa cgactactcc 660
ggaggtcgat gctctttaat cgagcgagat ggttatcgat tcgatcaggg gcccagtttg 720
ctgctcttgc cagatctctt caagcagaca ttcgaagatt tgggagagaa gatggaagat 780
tgggtcgatc tcatcaagtg tgaacccaac tatgtttgcc acttccacga tgaagagact 840
ttcactcttt caaccgacat ggcgttgctc aagcgggaag tcgagcgttt tgaaggcaaa 900
gatggatttg atcggttctt gtcgtttatc caagaagccc acagacatta cgagcttgct 960
gtcgttcacg tcctgcagaa gaacttccct ggcttcgcag cattcttacg gctacagttc 1020
attggccaaa tcctggctct tcaccccttc gagtctatct ggacaagagt ttgtcgatat 1080
ttcaagaccg acagattacg aagagtcttc tcgtttgcag tgatgtacat gggtcaaagc 1140
ccatacagtg cgcccggaac atattccttg ctccaataca ccgaattgac cgagggcatc 1200
tggtatccga gaggaggctt ttggcaggtt cctaatactc ttcttcagat cgtcaagcgc 1260
aacaatccct cagccaagtt caatttcaac gctccagttt cccaggttct tctctctcct 1320
gccaaggacc gagcgactgg tgttcgactt gaatccggcg aggaacatca cgccgatgtt 1380
gtgattgtca atgctgacct cgtttacgcc tccgagcact tgattcctga cgatgccaga 1440
aacaagattg gccaactggg tgaagtcaag agaagttggt gggctgactt agttggtgga 1500
aagaagctca agggaagttg cagtagtttg agcttctact ggagcatgga ccgaatcgtg 1560		 DNA
　 　 gacggtctgg gcggacacaa tatcttcttg gccgaggact tcaagggatc attcgacaca 1620
atcttcgagg agttgggtct cccagccgat ccttcctttt acgtgaacgt tccctcgcga 1680
atcgatcctt ctgccgctcc cgaaggcaaa gatgctatcg tcattcttgt gccgtgtggc 1740
catatcgacg cttcgaaccc tcaagattac aacaagcttg ttgctcgggc aaggaagttt 1800
gtgatccaca cgctttccgc caagcttgga cttcccgact ttgaaaaaat gattgtggca 1860
gagaaggttc acgatgctcc ctcttgggag aaagaattca acctcaagga cggaagcatc 1920
ttgggactgg ctcacaactt tatgcaagtt cttggtttca ggccgagcac cagacatccc 1980
aagtatgaca agttgttctt tgtcggggct tcgactcatc ccggaactgg ggttcccatc 2040
gtcttggctg gagccaagtt aactgccaac caagttctcg aatcctttga ccgatcccca 2100
gctccagatc ccaatatgtc actctccgta ccatatggaa aacctctcaa atcaaatgga 2160
acgggtatcg attctcaggt ccagctgaag ttcatggatt tggagagatg ggtatacctt 2220
ttggtattgt tgattggggc cgtgatcgct cgatccgttg gtgttcttgc tttctgactc 2280
gagtcatgta attagttatg tcacgcttac attcacgccc tccccccaca tccgctctaa 2340
ccgaaaagga aggagttaga caacctgaag tctaggtccc tatttatttt tttatagtta 2400
tgttagtatt aagaacgtta tttatatttc aaatttttct tttttttctg tacagacgcg 2460
tgtacgcatg taacattata ctgaaaacct tgcttgagaa ggttttggga cgctcgaagg 2520
ctttaatttg c		 　
75 URA3 tgcctcctgt ctgactcgtc attgccgcct ttggagtacg actccaacta tgagtgtgct 60
tggatcactt tgacgataca ttcttcgttg gaggctgtgg gtctgacagc tgcgttttcg 120
gcgcggttgg ccgacaacaa tatcagctgc aacgtcattg ctggctttca tcatgatcac 180
atttttgtcg gcaaaggcga cgcccagaga gccattgacg ttctttctaa tttggaccga 240
tagccgtata gtccagtcta tctataagtt caactaactc gtaactatta ccataacata 300
tacttcactg ccccagataa ggttccgata aaaagttctg cagactaaat ttatttcagt 360
ctcctcttca ccaccaaaat gccctcctac gaagctcgag ctaacgtcca caagtccgcc 420
tttgccgctc gagtgctcaa gctcgtggca gccaagaaaa ccaacctgtg tgcttctctg 480
gatgttacca ccaccaagga gctcattgag cttgccgata aggtcggacc ttatgtgtgc 540
atgatcaaga cccatatcga catcattgac gacttcacct acgccggcac tgtgctcccc 600
ctcaaggaac ttgctcttaa gcacggtttc ttcctgttcg aggacagaaa gttcgcagat 660
attggcaaca ctgtcaagca ccagtacaag aacggtgtct accgaatcgc cgagtggtcc 720
gatatcacca acgcccacgg tgtacccgga accggaatca ttgctggcct gcgagctggt 780
gccgaggaaa ctgtctctga acagaagaag gaggacgtct ctgactacga gaactcccag 840
tacaaggagt tcctggtccc ctctcccaac gagaagctgg ccagaggtct gctcatgctg 900
gccgagctgt cttgcaaggg ctctctggcc actggcgagt actccaagca gaccattgag 960
cttgcccgat ccgaccccga gtttgtggtt ggcttcattg cccagaaccg acctaagggc 1020
gactctgagg actggcttat tctgaccccc ggggtgggtc ttgacgacaa gggagacgct 1080
ctcggacagc agtaccgaac tgttgaggat gtcatgtcta ccggaacgga tatcataatt 1140
gtcggccgag gtctgtacgg ccagaaccga gatcctattg aggaggccaa gcgataccag 1200
aaggctggct gggaggctta ccagaagatt aactgttaga ggttagacta tggatatgtc 1260
atttaactgt gtatatagag agcgtgcaag tatggagcgc ttgttcagct tgtatgatgg 1320
tcagacgacc tgtctgatcg agtatgtatg atactgcaca acctgtgtat ccgcatgatc 1380
tgtccaatgg ggcatgttgt tgtgtttctc gatacggaga tgctgggtac aagtagctaa 1440
tacgattgaa ctacttatac ttatatgagg cttgaagaaa gctgacttgt gtatgactta 1500
ttctcaacta catccccagt cacaatacca cca		 DNA
76 primer gtgcgcttct ctcgtctcgg taaccctgtc DNA
77 primer atgcgccgcc aacccggtct ctggggtgtg gtggatgggg tgtg DNA
78 primer cacaccccat ccaccacacc ccagagaccg ggttggcggc gcat DNA
79 primer cgccgccaac ccggtctctt gaagacgaaa gggcctccg DNA
80 primer cggaggccct ttcgtcttca agagaccggg ttggcggcg DNA
81 primer gacgagtcag acaggaggca tcagacagat actcgtcgcg DNA
82 primer cgcgacgagt atctgtctga tgcctcctgt ctgactcgtc DNA
83 primer atgacgagtc agacaggagg catggtggta ttgtgactgg ggat DNA
84 primer atccccagtc acaataccac catgcctcct gtctgactcg tcat DNA
85 primer cggcgtcctt ctcgtagtcc gcttttggtg gtgaagagga gact DNA
86 primer agtctcctct tcaccaccaa aagcggacta cgagaaggac gccg DNA
87 primer ccactcgtca ccaacagtgc cgtgtgttgc DNA
88 primer tcgtacgtct ataccaacag atgg DNA
89 primer cgcatacaca cacactgccg gggg DNA
90 HMGR native promoter tccacacgtc gttctttttt ccttagcctt ttttgcagtg cgcgtgtccc aaaccccagc 60
tctacacacc agcacaaaca aagttaagct cagggttgtc gttgaggtcg cttactgtag 120
tcagtgctcg tatggttcgt tcaattttcg ccaaaaatcg ttttgccttt gtatcttggg 180
aataacatca actgtggttc ttcaacaggc ctaaggaacg aaacaagccg gaccaagatc 240
aggttcaagg tgagtactga gaaggaatag aaggcctaaa ggcgcaaacc gacaggtggc 300
aacagctcca caccgaccac gaaggccacg aaatcaaggg gtcctaaagt tagtctttgt 360
ggcctcgacg gtcagcgaaa acgcgagacc acaacgcgat cagaaccagg acctaaacaa 420
cacaggacgg ggtcacaata ggcttgaaca gcaagtacaa gctgtgatct ctctatattt 480
gattctcaaa ccacccctga ctacttcagc gcctctgtga cacagccccc ctatcatccg 540
actaacacag		 DNA
91 primer gacaatgcct cgaggaggtt taaaagtaac t DNA
92 primer gcgccgccaa cccggtctct ctgtgttagt cggatgatag g DNA
93 primer cctatcatcc gactaacaca gagagaccgg gttggcggcg c DNA
94 primer gacgagtcag acaggaggca ctgcggttag tactgcaaaa ag DNA
95 primer ctttttgcag tactaaccgc agtgcctcct gtctgactcg tc DNA
96 primer atgcgccgcc aacccggtct cttggtggta ttgtgactgg ggat DNA
97 primer atccccagtc acaataccac caagagaccg ggttggcggc gcat DNA
98 primer ctttccaata gctgcttgta gctgcggtta gtactgcaaa a DNA
99 primer ttttgcagta ctaaccgcag ctacaagcag ctattggaaa g DNA
100 primer gcttaatgtg attgatctca aacttgatag DNA
101 primer gctgtctctg cgagagcacg tcga DNA
102 primer ggttcgcaca acttctcggg tggc DNA
103 Hp.GGPP MIRAMHNRAP TPRTRVSHPR SHRALAHVSA VATAGQVAEV HSAPAFDFEM YMRDRAEMVN 60
KALDAALPSR YPEVLVDSMR YSVLAGGKRV RPALTLAACD LVGGDMATAL PTACAMEMIH 120
TMSLIHDDLP AMDNDDFRRG RPTNHKVYGE DIAILAGDAL LSFAFEHIAR DTKGVPADAV 180
LKVIMELGRA VGAQGLSAGQ AVDIKSEGQE VGLEVLEYIH HHKTAALLEA AVVCGALVGG 240
ADTATVEKLR KYALNIGLAF QVIDDILDVT QTTETLGKTA AKDLAVNKTT YPKLLGLEAS 300
RKVADDLIRE AIAQLDEFEP ARKAPMVALA HLIGYRKN		 단백질
Figure PCTKR2022011049-appb-img-000001

Claims (13)

  1. 헤마토코쿠스 플루비알리스(Haematococcus pluvialis) 유래의 제라닐제라닐 피로포스페이트 신타아제(Geranylgeranyl pyrophosphate synthase)를 발현하는, 카로티노이드 또는 이를 전구체로 하는 물질의 생산능을 갖는, 야로위아 속 미생물.
  2. 제1항에 있어서, 상기 제라닐제라닐 피로포스페이트 신타아제는 서열번호 103의 아미노산 서열로 이루어진 것인, 야로위아 속 미생물.
  3. 제1항에 있어서, 상기 제라닐제라닐 피로포스페이트 신타아제는 서열번호 1의 염기서열로 이루어진 폴리뉴클레오티드에 의해 코딩되는 것인, 야로위아 속 미생물.
  4. 제1항에 있어서, 상기 야로위아 속 미생물은 야로위아 리폴리티카인 것인, 야로위아 속 미생물.
  5. 제1항에 있어서, 상기 카로티노이드를 전구체로 하는 물질은 레티노이드인 것인, 야로위아 속 미생물.
  6. 제1항에 있어서, 상기 카로티노이드는 베타카로틴인 것인, 야로위아 속 미생물.
  7. 제5항에 있어서, 상기 레티노이드는 레티놀인 것인, 야로위아 속 미생물.
  8. 제1항에 있어서, 상기 야로위아 속 미생물은 부산물 생산능이 감소된 것인, 야로위아 속 미생물.
  9. 제8항에 있어서, 상기 부산물은 스쿠알렌인 것인, 야로위아 속 미생물.
  10. 제1항 내지 제9항 중 어느 한 항에 따른 야로위아 속 미생물을 배지에서 배양하는 단계; 및 상기 야로위아 속 미생물 또는 배지로부터 카로티노이드 또는 이를 전구체로 하는 물질을 회수하는 단계를 포함하는, 카로티노이드 또는 이를 전구체로 하는 물질 생산방법.
  11. 제10항에 있어서, 상기 야로위아 속 미생물이 생산한 베타카로틴을 베타카로틴 이외의 카로티노이드로 전환하는 단계; 또는
    상기 야로위아 속 미생물이 생산한 레티놀을 레티놀 이외의 레티노이드로 전환하는 단계를 추가로 포함하는 것인, 카로티노이드 또는 이를 전구체로 하는 물질 생산방법.
  12. 제1항 내지 제9항 중 어느 한 항의 야로위아 속 미생물 또는 이의 배양물을 포함하는 카로티노이드 또는 이를 전구체로 하는 물질 생산용 조성물.
  13. 헤마토코쿠스 플루비알리스유래의 제라닐제라닐 피로포스페이트 신타아제를 발현하는, 카로티노이드 또는 이를 전구체로 하는 물질의 생산능을 갖는, 야로위아 속 미생물의 카로티노이드 또는 이를 전구체로 하는 물질 생산 용도.
PCT/KR2022/011049 2022-03-23 2022-07-27 헤마토코쿠스 플루비알리스 유래의 제라닐제라닐 피로포스페이트 신타아제를 포함하는 카로티노이드 또는 이를 전구체로 하는 물질 생산 미생물 및 이를 이용한 카로티노이드 또는 레티노이드 생산방법 WO2023182583A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020220036258A KR20230138333A (ko) 2022-03-23 2022-03-23 헤마토코쿠스 플루비알리스 유래의 제라닐제라닐 피로포스페이트 신타아제를 포함하는 카로티노이드 또는 이를 전구체로 하는 물질 생산 미생물 및 이를 이용한 카로티노이드 또는 레티노이드 생산방법
KR10-2022-0036258 2022-03-23

Publications (1)

Publication Number Publication Date
WO2023182583A1 true WO2023182583A1 (ko) 2023-09-28

Family

ID=88101186

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/011049 WO2023182583A1 (ko) 2022-03-23 2022-07-27 헤마토코쿠스 플루비알리스 유래의 제라닐제라닐 피로포스페이트 신타아제를 포함하는 카로티노이드 또는 이를 전구체로 하는 물질 생산 미생물 및 이를 이용한 카로티노이드 또는 레티노이드 생산방법

Country Status (2)

Country Link
KR (1) KR20230138333A (ko)
WO (1) WO2023182583A1 (ko)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120060603A (ko) * 2010-12-02 2012-06-12 아주대학교산학협력단 아젤라잔틴ａ 대사회로의 구축 및 대장균을 통한 아젤라잔틴ａ의 합성
KR20150099787A (ko) * 2012-12-20 2015-09-01 디에스엠 아이피 어셋츠 비.브이. 카로틴 수산화효소 및 이의 카로티노이드 생산에 있어서의 용도
KR20200034867A (ko) * 2018-09-21 2020-04-01 한국생산기술연구원 베타카로틴을 생산하는 미생물 및 이를 이용한 베타카로틴의 생산방법
KR20200066752A (ko) * 2018-11-30 2020-06-11 (주)바이오스플래시 바이오레티놀을 생산하는 미생물 및 이를 이용한 바이오레티놀의 생산방법

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20120060603A (ko) * 2010-12-02 2012-06-12 아주대학교산학협력단 아젤라잔틴ａ 대사회로의 구축 및 대장균을 통한 아젤라잔틴ａ의 합성
KR20150099787A (ko) * 2012-12-20 2015-09-01 디에스엠 아이피 어셋츠 비.브이. 카로틴 수산화효소 및 이의 카로티노이드 생산에 있어서의 용도
KR20200034867A (ko) * 2018-09-21 2020-04-01 한국생산기술연구원 베타카로틴을 생산하는 미생물 및 이를 이용한 베타카로틴의 생산방법
KR20200066752A (ko) * 2018-11-30 2020-06-11 (주)바이오스플래시 바이오레티놀을 생산하는 미생물 및 이를 이용한 바이오레티놀의 생산방법

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE PROTEIN ANONYMOUS : "chloroplast geranylgeranyl diphosphate synthase [Haematococcus lacustris] ", XP093095492, retrieved from NCBI *

Also Published As

Publication number Publication date
KR20230138333A (ko) 2023-10-05

Similar Documents

Publication Publication Date Title
WO2019027267A2 (ko) Atp 포스포리보실 전이효소 변이체 및 이를 이용한 l-히스티딘 생산방법
WO2022163933A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163917A1 (ko) 신규한 단백질 변이체 및 이를 이용한 l-발린 생산 방법
WO2023182583A1 (ko) 헤마토코쿠스 플루비알리스 유래의 제라닐제라닐 피로포스페이트 신타아제를 포함하는 카로티노이드 또는 이를 전구체로 하는 물질 생산 미생물 및 이를 이용한 카로티노이드 또는 레티노이드 생산방법
WO2023182582A1 (ko) 두날리엘라 살리나 유래의 제라닐제라닐 피로포스페이트 신타아제를 포함하는 카로티노이드 또는 이를 전구체로 하는 물질 생산 미생물 및 이를 이용한 카로티노이드 또는 레티노이드 생산방법
WO2022154181A1 (ko) 신규한 1,4-알파-글루칸-분지 효소 변이체 및 이를 이용한 imp 생산 방법
WO2022154178A1 (ko) 신규한 혐기성 코프로포르피리노겐 iii 옥시다제 변이체 및 이를 이용한 imp 생산 방법
WO2022163920A1 (ko) 신규한 시스테인 설피네이트 디설피나제 변이체 및 이를 이용한 l-발린 생산 방법
WO2022154177A1 (ko) 신규한 3d-(3,5/4)-트리하이드록시사이클로헥세인-1,2-다이온 아실하이드롤라아제 변이체 및 이를 이용한 imp 생산 방법
WO2022154190A1 (ko) 신규한 포스포노아세테이트 하이드롤라제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163935A1 (ko) 신규한 글루코사민-6-포스페이트 디아미나제 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022231371A1 (ko) 신규한 5-(카르복시아미노)이미다졸리보뉴클레오티드합성효소 변이체 및 이를 이용한 imp 생산 방법
WO2022231370A1 (ko) 신규한 2중기능성 포스포리보실아미노이미다졸카르복사미드 포밀트랜스퍼라아제/imp 사이클로하이드롤라아제 변이체 및 이를 이용한 imp 생산 방법
WO2022215796A1 (ko) 신규한 전사 조절자 변이체 및 이를 이용한 l-발린 생산 방법
WO2022215800A1 (ko) 신규한 분지쇄아미노산 투과효소 변이체 및 이를 이용한 l-발린 생산 방법
WO2024128787A1 (ko) 키틴 트랜스글리코실레이즈의 활성이 약화된, 레티노이드 생산능을 갖는 미생물 및 이를 이용한 레티노이드 생산 방법
WO2024205308A1 (ko) Snq2 단백질의 활성이 강화된, 레티노이드 생산능을 갖는 미생물 및 이를 이용한 레티노이드 생산 방법
WO2023287256A1 (ko) 신규한 베타-카로틴 15,15 -옥시게네이즈 변이체 및 이를 이용한 레티노이드 생산방법
WO2022154189A1 (ko) 신규한 피토엔 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154188A1 (ko) 신규한 폴리케타이드 신타제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163929A1 (ko) 신규한 펩티딜-디펩티다제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022163930A1 (ko) 신규한 2-숙시닐-5-엔도피루빌-6-하이드록시-3-사이클로헥센-1-카복실레이트 신타아제 변이체 및 이를 이용한 xmp 또는 gmp 생산 방법
WO2022154184A1 (ko) 신규한 셀레니드, 물 디키나제 변이체 및 이를 이용한 imp 생산 방법
WO2022163937A1 (ko) 신규한 abc 트랜스포터 atp-결합 단백질 변이체 및 이를 이용한 l-글루탐산 생산 방법
WO2022163938A1 (ko) 신규한 리보뉴클레아제 p 변이체 및 이를 이용한 l-글루탐산 생산 방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22933755

Country of ref document: EP

Kind code of ref document: A1

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112024019498

Country of ref document: BR