WO2023177132A1 - Biomarker for diagnosis of pre-diabetes and diabetes, and use thereof - Google Patents

Biomarker for diagnosis of pre-diabetes and diabetes, and use thereof Download PDF

Info

Publication number
WO2023177132A1
WO2023177132A1 PCT/KR2023/003008 KR2023003008W WO2023177132A1 WO 2023177132 A1 WO2023177132 A1 WO 2023177132A1 KR 2023003008 W KR2023003008 W KR 2023003008W WO 2023177132 A1 WO2023177132 A1 WO 2023177132A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
diabetes
polynucleotide consisting
polynucleotide
expression level
Prior art date
Application number
PCT/KR2023/003008
Other languages
French (fr)
Korean (ko)
Inventor
조호찬
배윤위
박재형
유지홍
Original Assignee
계명대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 계명대학교 산학협력단 filed Critical 계명대학교 산학협력단
Publication of WO2023177132A1 publication Critical patent/WO2023177132A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • This relates to biomarkers for diagnosing pre-diabetes and diabetes and their uses.
  • Diabetes is a type of metabolic disease in which insulin secretion is insufficient or normal function is not achieved. It is characterized by hyperglycemia, which increases the concentration of glucose in the blood. Hyperglycemia causes various symptoms and signs and excretes glucose in the urine. . In Korea, one in five people over the age of 65 were found to be diabetic, and including fasting blood sugar disorders called pre-diabetes, half of the elderly population (47.4%) was estimated to be diabetic or imminent. In addition, it is estimated that 2 out of 10 adults in their 30s or older (20%) in Korea are patients with pre-diabetes, which is nearly twice the potential population of diabetic patients (12.4%), so the number of diabetic patients is expected to increase further. Diabetes is a trigger for almost all cardiovascular diseases, including heart disease and stroke, and is the biggest cause of chronic renal failure requiring dialysis and retinal disease causing blindness, so its seriousness is emerging.
  • pre-diabetes is a stage in which the blood sugar level is between a normal person and a diabetic patient. Based on fasting blood sugar, normal is 99 mg/dL or less, diabetes is 126 mg/dL or more, and the range in between, that is, 100 ⁇ 125 mg/dL is classified as pre-diabetes. Pre-diabetes cannot be clearly diagnosed as diabetes, but the probability of developing diabetes is known to be 5 to 17 times higher than that of normal people.
  • pre-diabetes markers include HbA1C, fructosamin, and glycated albumin, which are used to diagnose diabetes (Metab Syndr Relat Disord. 2014 Jun 1; 12(5): 258-268.), which are specific markers for pre-diabetes. Therefore, specificity and sensitivity are low, and in certain clinical conditions (acute and intermittent hyperglycemia), pre-diabetes diagnosis may not be possible, so research on markers specific to pre-diabetes is minimal.
  • diabetes can be diagnosed through the results of glycated hemoglobin, glucose tolerance test, fasting and random blood sugar tests, but no method has yet been studied to predict the risk of normal or pre-diabetes transitioning to diabetes, and new diabetes is not yet available.
  • Predict the occurrence of diabetes by establishing diagnosis and biomarkers, and develop biomarkers for diagnosing pre-diabetes and/or diabetes by analyzing changes according to the stage of diabetes in not only previously known miRNAs but also small RNAs through bioinformatics methods. It is necessary.
  • the present inventors collected blood from subjects corresponding to the normal group, pre-diabetic patient group, and diabetic patient group, isolated exosome RNA from it, and then analyzed exosomes through NGS analysis. As a result of comparing and analyzing the expression levels of piRNA, a biomarker that can be used as an indicator of the risk of developing diabetes in a group of pre-diabetic patients or that is easy to diagnose diabetes was discovered. Based on this, the present invention was completed.
  • the present invention is a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 3, and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 4.
  • the purpose is to provide a marker composition for diagnosing pre-diabetes or diabetes comprising one or more polynucleotides selected from the group.
  • the present invention provides a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 3, and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 4.
  • Another object is to provide a composition for diagnosing pre-diabetes or diabetes, which includes an agent for measuring the expression level of one or more polynucleotides selected from the group.
  • Another object of the present invention is to provide a kit for diagnosing pre-diabetes or diabetes, including the diagnostic composition.
  • the present invention provides a polynucleotide consisting of a base sequence of SEQ ID NO: 1, a polynucleotide consisting of a base sequence of SEQ ID NO: 2, a polynucleotide consisting of a base sequence of SEQ ID NO: 3, and a base of SEQ ID NO: 4 in a biological sample derived from a subject.
  • Another purpose is to provide an information provision method for diagnosing pre-diabetes or diabetes, which includes measuring the expression level of one or more polynucleotides selected from the group consisting of polynucleotides consisting of sequences.
  • the present invention provides a polynucleotide consisting of the base sequence of SEQ ID NO: 1, a polynucleotide consisting of the base sequence of SEQ ID NO: 2, a polynucleotide consisting of the base sequence of SEQ ID NO: 3, and SEQ ID NO:
  • a marker composition for diagnosing pre-diabetes or diabetes comprising one or more polynucleotides selected from the group consisting of polynucleotides with a base sequence of 4.
  • the present invention provides a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 3, and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 4.
  • a composition for diagnosing pre-diabetes or diabetes including an agent for measuring the expression level of one or more polynucleotides selected from the group.
  • the agent may be one or more selected from the group consisting of sense or antisense primers, aptamers, antibodies, and peptides that specifically bind to the polynucleotide.
  • the present invention provides a kit for diagnosing pre-diabetes or diabetes, including the diagnostic composition.
  • the present invention provides a polynucleotide consisting of a base sequence of SEQ ID NO: 1, a polynucleotide consisting of a base sequence of SEQ ID NO: 2, a polynucleotide consisting of a base sequence of SEQ ID NO: 3, and a base of SEQ ID NO: 4 in a biological sample derived from a subject.
  • a method of providing information for diagnosing pre-diabetes or diabetes including the step of measuring the expression level of one or more polynucleotides selected from the group consisting of polynucleotides consisting of sequences.
  • the biological sample may include blood, plasma, serum, tissue, cells, lymph fluid, bone marrow fluid, saliva, ocular fluid, semen, brain extract, spinal fluid, synovial fluid, thymic fluid, ascites fluid, amniotic fluid, It may be one or more selected from the group consisting of urine, tissue fluid, and cell culture fluid.
  • the expression level of the polynucleotide is determined by next-generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), and real-time polymerase chain reaction (Real-time polymerase chain reaction).
  • NGS next-generation sequencing
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription polymerase chain reaction
  • Real-time polymerase chain reaction Real-time polymerase chain reaction
  • -time PCR quantitative polymerase chain reaction
  • qPCR quantitative polymerase chain reaction
  • Competitive RT-PCR competitive reverse transcription polymerase chain reaction
  • RT-qPCR real-time quantitative polymerase chain reaction
  • inverse polymerase chain reaction inverse polymerase chain reaction
  • RNase RPA protection assays
  • the method is used to measure the expression level of the measured polynucleotide into a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and SEQ ID NO: It may further include comparing the expression level of one or more polynucleotides selected from the group consisting of a polynucleotide with the base sequence of SEQ ID NO: 3 and a polynucleotide with the base sequence of SEQ ID NO: 4.
  • the method is to measure the expression level of the measured polynucleotide by using a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a sequence of normal people and pre-diabetic patients. It may further include comparing the expression level of one or more polynucleotides selected from the group consisting of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4.
  • the method determines that if the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is lower than that of a normal person and lower than that of a diabetic patient, the subject is pre-diabetic.
  • the subject is determined to be in the pre-diabetic stage; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is lower than that of normal people and lower than that of diabetic patients, the subject is determined to be in the pre-diabetic stage; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is lower than that of normal people and higher than that of diabetic patients, the step of determining that the subject is pre-diabetic may be further included.
  • the method determines that the subject is diabetic when the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is lower than that of a normal person and higher than that of a pre-diabetic patient.
  • the subject is determined to have diabetes; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is lower than that of a normal person and higher than that of a pre-diabetic patient, the subject is determined to have diabetes; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is lower than that of normal people and lower than that of pre-diabetic patients, the step of determining that the subject has diabetes may be further included.
  • piRNA hsa-piR-31447, hsa-piR-33226, hsa-piR-36246, and hsa-piR-49124 markers were discovered.
  • pre-diabetes and/or diabetes can be diagnosed accurately and quickly using the four piRNA markers, and the piRNA can be usefully used as a biomarker for diagnosing pre-diabetes and/or diabetes.
  • Figure 1 is a diagram showing the results of comparative analysis of the expression levels of piRNAs in exosomes isolated from the plasma of normal (HV) and pre-diabetic (Pre-DM) subjects.
  • Figure 2 is a diagram showing the results of comparative analysis of the expression levels of piRNAs in exosomes isolated from the plasma of pre-diabetic (Pre-DM) and diabetic (DM) subjects.
  • Pre-DM pre-diabetic
  • DM diabetic
  • FIG. 3 is a diagram showing the results of comparative analysis of the expression levels of piRNAs in exosomes isolated from the plasma of normal group (HV) and diabetic group (DM) subjects.
  • FIG 4 is a diagram showing the results of multidimensional scaling (MDS) analysis for the normal group (HV), pre-diabetic group (Pre-DM), and diabetic group (DM).
  • MDS multidimensional scaling
  • Figure 5 is a diagram showing the results of measuring and comparing the expression levels of piRNAs between the normal group (HV), pre-diabetic group (Pre-DM), and diabetic group (DM).
  • HV normal group
  • Pre-DM pre-diabetic group
  • DM diabetic group
  • the present inventors completed the present invention by discovering biomarkers that show specific expression changes in pre-diabetes and diabetes compared to normal.
  • the present invention is a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 3, and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 4.
  • a marker composition for diagnosing pre-diabetes or diabetes comprising one or more polynucleotides selected from the group.
  • the present invention provides a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 3, and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 4.
  • a composition for diagnosing pre-diabetes or diabetes including an agent for measuring the expression level of one or more polynucleotides selected from the group.
  • the present invention provides a kit for diagnosing pre-diabetes or diabetes, including the diagnostic composition.
  • diagnosis used in the present invention broadly refers to judging the actual condition of a patient's disease in all aspects. The contents of the judgment include the name of the disease, etiology, type, severity, detailed conditions of the disease, and the presence or absence of complications. In the present invention, diagnosis may mean determining the level of pre-diabetes and/or progression of diabetes.
  • pre-diabetes refers to a stage in which the blood sugar level is between a normal person and a diabetic patient. Based on fasting blood sugar level, normal is 99 mg/dL or less and diabetes is 126 mg/dL or more. , Pre-diabetes refers to the interval in between, that is, the stage showing a fasting blood sugar level of 100 to 125 mg/dL.
  • the present inventors discovered a total of four piRNAs (hsa-piR-31447, hsa-piR-33226, hsa-piR-36246, and hsa-piR-49124) as biomarkers for diagnosing pre-diabetes or diabetes.
  • the hsa-piR-31447 may be a polynucleotide consisting of the base sequence of SEQ ID NO: 1
  • the hsa-piR-33226 may be a polynucleotide consisting of the base sequence of SEQ ID NO: 2
  • the hsa- piR-36246 may be a polynucleotide consisting of the base sequence of SEQ ID NO: 3
  • hsa-piR-49124 may be a polynucleotide consisting of the base sequence of SEQ ID NO: 4.
  • subjects corresponding to the normal group, pre-diabetes group, and diabetes group were recruited, exosomes were isolated from their blood, and the expression level of piRNA in the exosomes was compared and analyzed (Example 1).
  • piRNAs that differed in each of (1) normal group and pre-diabetic group, (2) pre-diabetic group and diabetes group, and (3) normal group and diabetes group were analyzed, and the results of piRNAs expression level were determined.
  • the normal group, pre-diabetic group, and diabetic group showed sequential patterns in two dimensions.
  • the expression level decreases and then increases from normal to pre-diabetes and diabetes (hsa-piR-31447, hsa-piR-36246), or the expression level increases and then decreases from normal to pre-diabetes and diabetes (hsa-piR-33226).
  • piRNAs whose expression level decreased from normal to pre-diabetes and diabetes were finally selected. It was confirmed that the selected piRNAs actually showed significant expression differences between the normal group and the pre-diabetic group (see Examples 2 and 3).
  • the agent may be a sense or antisense primer, aptamer, antibody, or peptide that specifically binds to the polynucleotide, but is not limited thereto.
  • primer used in the present invention refers to a short gene sequence that serves as the starting point for DNA synthesis and an oligonucleotide synthesized for use in diagnosis, DNA sequencing, etc.
  • the primers can generally be synthesized and used in a length of 15 to 30 base pairs, but may vary depending on the purpose of use, and can be modified by methylation, capping, etc. by known methods.
  • the term “Aptamer” refers to a small single-stranded nucleic acid (DNA or RNA) fragment that has the property of binding with high affinity and specificity to various types of substances, from low-molecular compounds to proteins. , for example, may be a single-stranded nucleic acid fragment consisting of 10 to 60 nucleotides.
  • antibody refers to a substance that specifically binds to an antigen and causes an antigen-antibody reaction, including chimeric antibodies, humanized antibodies, human antibodies, synthetic antibodies, and/or affinity antibodies. It may be a mature antibody.
  • peptide refers to a polymer composed of two or more amino acids linked by amide bonds (or peptide bonds).
  • the diagnostic kit of the present invention consists of one or more different component compositions, solutions, or devices suitable for the analysis method.
  • the kit of the present invention contains genomic DNA derived from a sample to be analyzed, a primer set specific for the marker gene of the present invention, an appropriate amount of DNA polymerase, dNTP mixture, PCR buffer solution, and water. It may be a kit containing:
  • the PCR buffer solution may contain KCl, Tris-HCl, and MgCl2.
  • components necessary for performing electrophoresis that can confirm the amplification of the PCR product may be additionally included in the kit of the present invention.
  • the kit of the present invention may be a kit containing essential elements required to perform RT-PCR.
  • the RT-PCR kit contains test tubes or other suitable containers, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, and DEPC.
  • dNTPs deoxynucleotides
  • enzymes such as Taq-polymerase and reverse transcriptase
  • DNase DNase
  • RNase inhibitors RNase inhibitors
  • DEPC deoxynucleotides
  • -Can include DEPC-water, sterilized water, etc. It may also include a pair of primers specific to the gene used as a quantitative control.
  • the present invention provides a polynucleotide consisting of a base sequence of SEQ ID NO: 1, a polynucleotide consisting of a base sequence of SEQ ID NO: 2, a polynucleotide consisting of a base sequence of SEQ ID NO: 3, and a base of SEQ ID NO: 4 in a biological sample derived from a subject.
  • a method of providing information for diagnosing pre-diabetes or diabetes including the step of measuring the expression level of one or more polynucleotides selected from the group consisting of polynucleotides consisting of sequences.
  • the biological samples include blood, plasma, serum, tissue, cells, lymph fluid, bone marrow fluid, saliva, ocular fluid, semen, brain extract, spinal fluid, joint fluid, thymic fluid, ascites fluid, amniotic fluid, urine, cell tissue fluid, and cell culture fluid. It may be one or more selected from the group consisting of, but is not limited to this.
  • the polynucleotide may be present in exosomes in the biological sample.
  • the expression level of the polynucleotide is determined by conventional methods known in the art, such as next-generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription-polymerase chain reaction (RT-PCR), and real-time polymerase chain reaction (Real-time polymerase chain reaction).
  • NGS next-generation sequencing
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription-polymerase chain reaction
  • Real-time polymerase chain reaction Real-time polymerase chain reaction
  • time PCR quantitative polymerase chain reaction
  • qPCR quantitative polymerase chain reaction
  • Competitive RT-PCR competitive reverse transcription polymerase chain reaction
  • RT-qPCR real-time quantitative polymerase chain reaction
  • inverse polymerase chain reaction inverse polymerase chain reaction
  • RNase protection inverse polymerase chain reaction
  • the method is to measure the expression level of the polynucleotide in a normal person and a diabetic patient using a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a nucleotide sequence of SEQ ID NO: 3. It may further include comparing the expression level of one or more polynucleotides selected from the group consisting of a polynucleotide consisting of and a polynucleotide consisting of the base sequence of SEQ ID NO: 4.
  • the method is to measure the expression level of the polynucleotide in a normal person and a pre-diabetic patient using a polynucleotide consisting of the base sequence of SEQ ID NO: 1, a polynucleotide consisting of the base sequence of SEQ ID NO: 2, and a base of SEQ ID NO: 3. It may further include comparing the expression level of one or more polynucleotides selected from the group consisting of a polynucleotide consisting of the sequence and a polynucleotide consisting of the base sequence of SEQ ID NO: 4.
  • the method determines that the subject is pre-diabetic when the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is lower than that of a normal person and lower than that of a diabetic patient; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is higher than that of normal people and higher than that of diabetic patients, the subject is determined to be in the pre-diabetic stage; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is lower than that of normal people and lower than that of diabetic patients, the subject is determined to be in the pre-diabetic stage; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is lower than that of normal people and higher than that of diabetic patients, the step of determining that the subject is
  • the method determines that the subject has diabetes when the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is lower than that of a normal person and higher than that of a pre-diabetic patient; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is lower than that of a normal person and lower than that of a pre-diabetic patient, the subject is determined to have diabetes; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is lower than that of a normal person and higher than that of a pre-diabetic patient, the subject is determined to have diabetes; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is lower than that of normal people and lower than that of pre-diabetic patients, the step of determining
  • the present invention provides a polynucleotide consisting of a base sequence of SEQ ID NO: 1, a polynucleotide consisting of a base sequence of SEQ ID NO: 2, a polynucleotide consisting of a base sequence of SEQ ID NO: 3, and a base of SEQ ID NO: 4 in a biological sample derived from a subject.
  • a method for diagnosing pre-diabetes or diabetes is provided, which includes measuring or detecting the expression level of one or more polynucleotides selected from the group consisting of polynucleotides consisting of sequences.
  • the method may further include obtaining a biological sample from a subject or human patient.
  • the present inventors studied 20 people in the normal group (HV, fasting blood sugar 95 or less, HbA1c 5.5 or less) and the pre-diabetes group (Pre-DM, fasting blood sugar 100-125, 20 subjects (HbA1c 5.8-6.3 or less) and 20 subjects in the diabetes group (DM, HbA1c 6.5 or more) were recruited.
  • the standards for dividing each group were based on the standards of the American Diabetes Association, and in order to clearly distinguish between patient groups and find more accurate markers, new standards were applied excluding the boundary part (American Diabetes Association standards; normal (fasting blood sugar less than 100, HbA1c less than 5.7) Pre-diabetes (fasting blood sugar 100-125, HbA1c 5.8-6.4) Diabetes (fasting blood sugar more than 126, HbA1c more than 6.5).
  • Plasma samples were collected from the normal group, pre-diabetic group, and diabetic group to find biomarkers showing differences between groups. For this purpose, plasma was provided from subjects in each group above.
  • Exosomes were isolated from the plasma samples collected from the subjects in each group in Example 1-1 using Exoquick (SBI, USA), and total RNA was extracted from the isolated exosomes using the Qiagen miRNeasy kit. was extracted, and the amount of total extracted RNA was measured using an Agilent RNA Bioanalyzer according to the manufacturer's instructions.
  • Macrogen created a library using the Takara SMARTer smRNA for illumina kit and then performed next generation sequencing (NGS) with Hiseq 2500 to generate piRNA (piwi-interacting RNA). Detected.
  • NGS next generation sequencing
  • the present inventors collected piRNA from each subject according to the method of Examples 1-1 and 1-2 above in order to identify piRNAs with different expression levels in blood-derived exosomes of 20 normal subjects and 20 pre-diabetic subjects. Exosomes were isolated from plasma and NGS analysis was performed on the extracted total RNA. As a result of the analysis, 394 piRNAs were detected, and the expression levels of the detected piRNAs were compared.
  • the present inventors performed NGS analysis on total RNA in exosomes obtained in the same manner as above to identify piRNAs with different expression levels in blood-derived exosomes of 20 pre-diabetics and 20 diabetics. It was carried out. As a result of the analysis, 394 piRNAs were detected, and the expression levels of the detected piRNAs were compared.
  • the present inventors performed NGS analysis on total RNA in exosomes obtained in the same manner as above to identify piRNAs with different expression levels in blood-derived exosomes of 20 normal and 20 diabetic groups. As a result of the analysis, 394 piRNAs were detected, and the expression levels of the detected piRNAs were compared.
  • the expression level decreases from normal to pre-diabetes and diabetes and then increases (hsa-piR-31447, hsa-piR-36246), or the expression level increases from normal to pre-diabetes and diabetes.
  • piRNAs that increased and then decreased hsa-piR-33226 or whose expression level decreased from normal to pre-diabetic and diabetic (hsa-piR-49124) were finally selected, and the piRNA sequences are shown in [Table 2] below. same.
  • sequence number piRNA order SEQ ID NO: 1 hsa-piR-31447 AGGGGCUGAAUGAAAAUGGCCUUUCUGAAC SEQ ID NO: 2 hsa-piR-33226 CCUCGAACUCCCUGACCUCAGGUGAUCCACC SEQ ID NO: 3 hsa-piR-36246 GGGGGUUAUAGCUCAGUGGGUAGAGCAU SEQ ID NO: 4 hsa-piR-49124 UGAGGGUUCGAGUCCCUUCGUGGUCGCC
  • HV normal group
  • Pre-DM fasting blood sugar 100-125, HbA1c 5.8-6.3 or less
  • DM diabetic group

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Pathology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention relates to a biomarker for the diagnosis of pre-diabetes and diabetes, and a use thereof, and more specifically, to: a composition and a kit for the diagnosis of pre-diabetes or diabetes, the composition and kit comprising an agent for measuring the expression level of at least one selected from among four piRNAs; and a method for diagnosing pre-diabetes or diabetes by using the marker. The present inventors analyzed the expression level of piRNA contained in exosomes isolated from the blood of a normal group, a pre-diabetic patient group, and a diabetic patient group, and thus, found four piRNA (hsa-piR-31447, hsa-piR-33226, hsa-piR-36246, and hsa-piR-49124) markers capable of distinguishing the normal group, the pre-diabetic patient group, and the diabetic patient group. Also, it was confirmed that using the four piRNA markers makes it possible to diagnose pre-diabetes and/or diabetes accurately and rapidly, and thus the piRNA can be effectively used as a biomarker for the diagnosis of pre-diabetes and/or diabetes.

Description

당뇨 전단계 및 당뇨병 진단용 바이오마커 및 이의 용도Biomarkers for diagnosing pre-diabetes and diabetes and their uses
당뇨 전단계 및 당뇨병 진단용 바이오마커 및 이의 용도에 관한 것이다.This relates to biomarkers for diagnosing pre-diabetes and diabetes and their uses.
당뇨병은 인슐린의 분비량이 부족하거나 정상적인 기능이 이루어지지 않는 등의 대사질환의 일종으로, 혈중 포도당의 농도가 높아지는 고혈당을 특징으로 하며, 고혈당으로 인하여 여러 증상 및 징후를 일으키고 소변에서 포도당을 배출하게 된다. 국내 기준 65세 이상 인구 다섯 명 중 한 명이 당뇨로 조사되었으며, 당뇨 전단계로 불리는 공복 혈당 장애까지 합치면 노년 인구의 절반(47.4%)이 당뇨이거나 당뇨병 임박으로 집계되었다. 또한, 국내 30대 이상 성인 10명 중 2명(20%)이 당뇨 전단계 환자로 당뇨병 환자(12.4%)의 2배에 가까운 잠재 집단이 있는 것으로 집계되어 당뇨 환자는 더욱더 늘어날 것으로 예측된다. 당뇨병은 심장병 뇌졸중 등 거의 모든 심혈관 질환 발생의 방아쇠 역할을 하며, 투석 생활을 해야 하는 만성 신부전증이나 실명을 유발하는 망막 질환의 최대 원인이므로 이에 따른 심각성이 대두되고 있다.Diabetes is a type of metabolic disease in which insulin secretion is insufficient or normal function is not achieved. It is characterized by hyperglycemia, which increases the concentration of glucose in the blood. Hyperglycemia causes various symptoms and signs and excretes glucose in the urine. . In Korea, one in five people over the age of 65 were found to be diabetic, and including fasting blood sugar disorders called pre-diabetes, half of the elderly population (47.4%) was estimated to be diabetic or imminent. In addition, it is estimated that 2 out of 10 adults in their 30s or older (20%) in Korea are patients with pre-diabetes, which is nearly twice the potential population of diabetic patients (12.4%), so the number of diabetic patients is expected to increase further. Diabetes is a trigger for almost all cardiovascular diseases, including heart disease and stroke, and is the biggest cause of chronic renal failure requiring dialysis and retinal disease causing blindness, so its seriousness is emerging.
한편, 당뇨 전단계(Pre-diabetes)는 혈당 수준이 정상인과 당뇨 환자 사이에 있는 단계로, 공복혈당 기준으로 정상은 99㎎/dL 이하, 당뇨병은 126㎎/dL 이상이며 그 사이 구간, 즉 100~125㎎/dL를 당뇨 전단계로 구분하고 있다. 당뇨 전단계는 당뇨라고 명확히 진단할 수는 없지만 당뇨로 발전할 수 있는 확률은 정상인보다 5배에서 최대 17배 정도나 높은 것으로 알려져 있다. Meanwhile, pre-diabetes is a stage in which the blood sugar level is between a normal person and a diabetic patient. Based on fasting blood sugar, normal is 99 mg/dL or less, diabetes is 126 mg/dL or more, and the range in between, that is, 100~ 125 mg/dL is classified as pre-diabetes. Pre-diabetes cannot be clearly diagnosed as diabetes, but the probability of developing diabetes is known to be 5 to 17 times higher than that of normal people.
기존에 알려져 있는 당뇨 전단계 마커로는 당뇨진단에 쓰이는 HbA1C, fructosamin, glycated albumin 등이 사용되고 있는데(Metab Syndr Relat Disord. 2014 Jun 1; 12(5): 258-268.), 이는 당뇨 전단계 특이적인 마커가 아니므로 특이성이나 민감도가 떨어지고 특정 임상적인 조건(acute and intermittent hyperglycemia)에서는 당뇨 전단계 진단이 불가한 경우도 있어 당뇨 전단계 특이적인 마커에 대한 연구가 미미하다.Previously known pre-diabetes markers include HbA1C, fructosamin, and glycated albumin, which are used to diagnose diabetes (Metab Syndr Relat Disord. 2014 Jun 1; 12(5): 258-268.), which are specific markers for pre-diabetes. Therefore, specificity and sensitivity are low, and in certain clinical conditions (acute and intermittent hyperglycemia), pre-diabetes diagnosis may not be possible, so research on markers specific to pre-diabetes is minimal.
현재 당화혈색소, 당부하검사, 공복 및 임의혈당 검사 결과를 통해 당뇨병을 진단할 수는 있으나, 정상 및 당뇨 전단계가 당뇨병으로 이행될 위험도를 미리 예측할 수 있는 방법은 아직까지 연구되지 않았으며, 새로운 당뇨병 진단, 바이오마커의 수립으로 당뇨병 발생을 예측하고, 기존에 알려진 miRNA 뿐만 아니라 small RNA들의 당뇨 진행단계에 따른 변화를 생물정보학 방법을 통해 분석함으로써 당뇨 전단계 및/또는 당뇨병 진단을 위한 바이오마커의 개발이 필요한 실정이다.Currently, diabetes can be diagnosed through the results of glycated hemoglobin, glucose tolerance test, fasting and random blood sugar tests, but no method has yet been studied to predict the risk of normal or pre-diabetes transitioning to diabetes, and new diabetes is not yet available. Predict the occurrence of diabetes by establishing diagnosis and biomarkers, and develop biomarkers for diagnosing pre-diabetes and/or diabetes by analyzing changes according to the stage of diabetes in not only previously known miRNAs but also small RNAs through bioinformatics methods. It is necessary.
상기와 같은 종래의 문제점을 해결하기 위하여, 본 발명자들은 정상군, 당뇨 전단계 환자군, 당뇨 환자군에 해당하는 대상자들로부터 혈액을 채취하고 이로부터 엑소좀(exosome) RNA를 분리한 후 NGS 분석을 통해 엑소좀 piRNA의 발현수준을 비교분석한 결과, 당뇨 전단계 환자군에서 당뇨 발생 위험 지표로 사용되거나 당뇨병 진단에 용이한 바이오마커를 발견하였는바, 이에 기초하여 본 발명을 완성하였다.In order to solve the above conventional problems, the present inventors collected blood from subjects corresponding to the normal group, pre-diabetic patient group, and diabetic patient group, isolated exosome RNA from it, and then analyzed exosomes through NGS analysis. As a result of comparing and analyzing the expression levels of piRNA, a biomarker that can be used as an indicator of the risk of developing diabetes in a group of pre-diabetic patients or that is easy to diagnose diabetes was discovered. Based on this, the present invention was completed.
이에, 본 발명은 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드를 포함하는 당뇨 전단계 또는 당뇨병 진단용 마커 조성물을 제공하는 것을 목적으로 한다.Accordingly, the present invention is a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 3, and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 4. The purpose is to provide a marker composition for diagnosing pre-diabetes or diabetes comprising one or more polynucleotides selected from the group.
또한, 본 발명은 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준을 측정하는 제제를 포함하는 당뇨 전단계 또는 당뇨병 진단용 조성물을 제공하는 것을 다른 목적으로 한다.In addition, the present invention provides a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 3, and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 4. Another object is to provide a composition for diagnosing pre-diabetes or diabetes, which includes an agent for measuring the expression level of one or more polynucleotides selected from the group.
또한, 본 발명은 상기 진단용 조성물을 포함하는 당뇨 전단계 또는 당뇨병 진단용 키트를 제공하는 것을 다른 목적으로 한다.Another object of the present invention is to provide a kit for diagnosing pre-diabetes or diabetes, including the diagnostic composition.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준을 측정하는 단계를 포함하는, 당뇨 전단계 또는 당뇨병 진단을 위한 정보제공방법을 제공하는 것을 또 다른 목적으로 한다.In addition, the present invention provides a polynucleotide consisting of a base sequence of SEQ ID NO: 1, a polynucleotide consisting of a base sequence of SEQ ID NO: 2, a polynucleotide consisting of a base sequence of SEQ ID NO: 3, and a base of SEQ ID NO: 4 in a biological sample derived from a subject. Another purpose is to provide an information provision method for diagnosing pre-diabetes or diabetes, which includes measuring the expression level of one or more polynucleotides selected from the group consisting of polynucleotides consisting of sequences.
그러나 본 발명이 이루고자 하는 기술적 과제는 이상에서 언급한 과제에 제한되지 않으며, 언급되지 않은 또 다른 과제들은 아래의 기재로부터 당업자에게 명확하게 이해될 수 있을 것이다.However, the technical problem to be achieved by the present invention is not limited to the problems mentioned above, and other problems not mentioned will be clearly understood by those skilled in the art from the description below.
상기와 같은 본 발명의 목적을 달성하기 위하여, 본 발명은 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드를 포함하는 당뇨 전단계 또는 당뇨병 진단용 마커 조성물을 제공한다.In order to achieve the object of the present invention as described above, the present invention provides a polynucleotide consisting of the base sequence of SEQ ID NO: 1, a polynucleotide consisting of the base sequence of SEQ ID NO: 2, a polynucleotide consisting of the base sequence of SEQ ID NO: 3, and SEQ ID NO: Provided is a marker composition for diagnosing pre-diabetes or diabetes, comprising one or more polynucleotides selected from the group consisting of polynucleotides with a base sequence of 4.
또한, 본 발명은 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준을 측정하는 제제를 포함하는 당뇨 전단계 또는 당뇨병 진단용 조성물을 제공한다.In addition, the present invention provides a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 3, and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 4. Provided is a composition for diagnosing pre-diabetes or diabetes, including an agent for measuring the expression level of one or more polynucleotides selected from the group.
본 발명의 다른 구현예로, 상기 제제는 상기 폴리뉴클레오티드에 특이적으로 결합하는 센스 또는 안티센스 프라이머, 앱타머, 항체 및 펩티드로 이루어진 군에서 선택되는 하나 이상일 수 있다.In another embodiment of the present invention, the agent may be one or more selected from the group consisting of sense or antisense primers, aptamers, antibodies, and peptides that specifically bind to the polynucleotide.
또한, 본 발명은 상기 진단용 조성물을 포함하는, 당뇨 전단계 또는 당뇨병 진단용 키트를 제공한다.Additionally, the present invention provides a kit for diagnosing pre-diabetes or diabetes, including the diagnostic composition.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준을 측정하는 단계를 포함하는, 당뇨 전단계 또는 당뇨병 진단을 위한 정보제공방법을 제공한다.In addition, the present invention provides a polynucleotide consisting of a base sequence of SEQ ID NO: 1, a polynucleotide consisting of a base sequence of SEQ ID NO: 2, a polynucleotide consisting of a base sequence of SEQ ID NO: 3, and a base of SEQ ID NO: 4 in a biological sample derived from a subject. Provided is a method of providing information for diagnosing pre-diabetes or diabetes, including the step of measuring the expression level of one or more polynucleotides selected from the group consisting of polynucleotides consisting of sequences.
본 발명의 다른 구현예로, 상기 생물학적 시료는 혈액, 혈장, 혈청, 조직, 세포, 림프액, 골수액, 타액, 안구액, 정액, 뇌 추출물, 척수액, 관절액, 흉선액, 복수액, 양막액, 소변, 세포 조직액 및 세포 배양액으로 이루어진 군에서 선택되는 하나 이상일 수 있다.In another embodiment of the present invention, the biological sample may include blood, plasma, serum, tissue, cells, lymph fluid, bone marrow fluid, saliva, ocular fluid, semen, brain extract, spinal fluid, synovial fluid, thymic fluid, ascites fluid, amniotic fluid, It may be one or more selected from the group consisting of urine, tissue fluid, and cell culture fluid.
본 발명의 또 다른 구현예로, 상기 폴리뉴클레오티드의 발현수준은 차세대 염기서열 분석(NGS), 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 실시간 중합효소연쇄반응(Real-time PCR), 정량적 중합효소연쇄반응(qPCR), 경쟁적 역전사 중합효소연쇄반응(Competitive RT-PCR), 실시간 정량중합효소연쇄반응(RT-qPCR), 역 중합효소 연쇄반응(Inverse PCR) 및 RNase 보호분석법(RNase RPA)으로 이루어진 군에서 선택되는 하나 이상의 방법을 통해 측정될 수 있다.In another embodiment of the present invention, the expression level of the polynucleotide is determined by next-generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription polymerase chain reaction (RT-PCR), and real-time polymerase chain reaction (Real-time polymerase chain reaction). -time PCR), quantitative polymerase chain reaction (qPCR), competitive reverse transcription polymerase chain reaction (Competitive RT-PCR), real-time quantitative polymerase chain reaction (RT-qPCR), inverse polymerase chain reaction (Inverse PCR) and RNase It can be measured using one or more methods selected from the group consisting of protection assays (RNase RPA).
본 발명의 또 다른 구현예로, 상기 방법은 상기 측정된 폴리뉴클레오티드의 발현 수준을 정상인 및 당뇨병 환자의 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준과 비교하는 단계를 더 포함할 수 있다.In another embodiment of the present invention, the method is used to measure the expression level of the measured polynucleotide into a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and SEQ ID NO: It may further include comparing the expression level of one or more polynucleotides selected from the group consisting of a polynucleotide with the base sequence of SEQ ID NO: 3 and a polynucleotide with the base sequence of SEQ ID NO: 4.
본 발명의 또 다른 구현예로, 상기 방법은 상기 측정된 폴리뉴클레오티드의 발현 수준을 정상인 및 당뇨 전단계 환자의 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준과 비교하는 단계를 더 포함할 수 있다.In another embodiment of the present invention, the method is to measure the expression level of the measured polynucleotide by using a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a sequence of normal people and pre-diabetic patients. It may further include comparing the expression level of one or more polynucleotides selected from the group consisting of a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 and a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4.
본 발명의 또 다른 구현예로, 상기 방법은 상기 측정된 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨병 환자보다 발현 수준이 적은 경우, 피검체는 당뇨 전단계로 판정하고; 상기 측정된 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 많고, 당뇨병 환자보다 발현 수준이 많은 경우, 피검체는 당뇨 전단계로 판정하고; 상기 측정된 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨병 환자보다 발현 수준이 적은 경우, 피검체는 당뇨 전단계로 판정하고; 상기 측정된 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨병 환자보다 발현 수준이 많은 경우, 피검체를 당뇨 전단계로 판정하는 단계를 더 포함할 수 있다.In another embodiment of the present invention, the method determines that if the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is lower than that of a normal person and lower than that of a diabetic patient, the subject is pre-diabetic. ; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is higher than that of normal people and higher than that of diabetic patients, the subject is determined to be in the pre-diabetic stage; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is lower than that of normal people and lower than that of diabetic patients, the subject is determined to be in the pre-diabetic stage; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is lower than that of normal people and higher than that of diabetic patients, the step of determining that the subject is pre-diabetic may be further included.
본 발명의 또 다른 구현예로, 상기 방법은 상기 측정된 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨 전단계 환자보다 발현 수준이 많은 경우, 피검체는 당뇨병으로 판정하고; 상기 측정된 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨 전단계 환자보다 발현 수준이 적은 경우, 피검체는 당뇨병으로 판정하고; 상기 측정된 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨 전단계 환자보다 발현 수준이 많은 경우, 피검체는 당뇨병으로 판정하고; 상기 측정된 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨 전단계 환자보다 발현 수준이 적은 경우, 피검체를 당뇨병으로 판정하는 단계를 더 포함할 수 있다.In another embodiment of the present invention, the method determines that the subject is diabetic when the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is lower than that of a normal person and higher than that of a pre-diabetic patient. ; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is lower than that of a normal person and lower than that of a pre-diabetic patient, the subject is determined to have diabetes; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is lower than that of a normal person and higher than that of a pre-diabetic patient, the subject is determined to have diabetes; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is lower than that of normal people and lower than that of pre-diabetic patients, the step of determining that the subject has diabetes may be further included.
본 발명자들은 정상군, 당뇨 전단계 환자군, 당뇨 환자군의 혈액에서 분리한 엑소좀(exosome) 내에 포함된 piRNA의 발현 수준을 분석한 결과, 정상군, 당뇨 전단계 환자군 및 당뇨 환자군을 구별할 수 있는 4개의 piRNA(hsa-piR-31447, hsa-piR-33226, hsa-piR-36246 및 hsa-piR-49124) 마커를 발굴하였다. 또한, 상기 4개의 piRNA 마커를 이용하면, 당뇨 전단계 및/또는 당뇨병을 정확하고 신속하게 진단이 가능하다는 것을 확인하였는 바, 상기 piRNA를 당뇨 전단계 및/또는 당뇨병 진단을 위한 바이오마커로 유용하게 이용할 수 있다.As a result of analyzing the expression level of piRNA contained in exosomes isolated from the blood of the normal group, pre-diabetic patient group, and diabetic patient group, the present inventors found four groups that can distinguish the normal group, pre-diabetic patient group, and diabetic patient group. piRNA (hsa-piR-31447, hsa-piR-33226, hsa-piR-36246, and hsa-piR-49124) markers were discovered. In addition, it has been confirmed that pre-diabetes and/or diabetes can be diagnosed accurately and quickly using the four piRNA markers, and the piRNA can be usefully used as a biomarker for diagnosing pre-diabetes and/or diabetes. there is.
도 1은 정상군(HV) 및 당뇨 전단계(Pre-DM) 대상자들의 혈장에서 분리한 엑소좀 내 piRNAs의 발현 수준을 비교분석한 결과를 나타내는 도이다.Figure 1 is a diagram showing the results of comparative analysis of the expression levels of piRNAs in exosomes isolated from the plasma of normal (HV) and pre-diabetic (Pre-DM) subjects.
도 2는 당뇨 전단계(Pre-DM) 및 당뇨군(DM) 대상자들의 혈장에서 분리한 엑소좀 내 piRNAs의 발현 수준을 비교분석한 결과를 나타내는 도이다.Figure 2 is a diagram showing the results of comparative analysis of the expression levels of piRNAs in exosomes isolated from the plasma of pre-diabetic (Pre-DM) and diabetic (DM) subjects.
도 3은 정상군(HV) 및 당뇨군(DM) 대상자들의 혈장에서 분리한 엑소좀 내 piRNAs의 발현 수준을 비교분석한 결과를 나타내는 도이다.Figure 3 is a diagram showing the results of comparative analysis of the expression levels of piRNAs in exosomes isolated from the plasma of normal group (HV) and diabetic group (DM) subjects.
도 4는 정상군(HV), 당뇨 전단계(Pre-DM) 및 당뇨군(DM)에 대하여 다차원척도법(MDS) 분석을 실시한 결과를 나타내는 도이다.Figure 4 is a diagram showing the results of multidimensional scaling (MDS) analysis for the normal group (HV), pre-diabetic group (Pre-DM), and diabetic group (DM).
도 5는 정상군(HV), 당뇨 전단계(Pre-DM) 및 당뇨군(DM) 간의 piRNAs의 발현 수준을 측정하여 비교한 결과를 나타내는 도이다.Figure 5 is a diagram showing the results of measuring and comparing the expression levels of piRNAs between the normal group (HV), pre-diabetic group (Pre-DM), and diabetic group (DM).
본 발명자들은 당뇨 전단계 및/또는 당뇨병 진단을 위한 바이오마커를 발굴하기 위해 예의 연구한 결과, 정상 대비 당뇨 전단계 및 당뇨병에서 특이적인 발현 변화를 나타내는 바이오마커를 발견함으로써 본 발명을 완성하였다.As a result of intensive research to discover biomarkers for diagnosing pre-diabetes and/or diabetes, the present inventors completed the present invention by discovering biomarkers that show specific expression changes in pre-diabetes and diabetes compared to normal.
이에, 본 발명은 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드를 포함하는 당뇨 전단계 또는 당뇨병 진단용 마커 조성물을 제공한다.Accordingly, the present invention is a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 3, and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 4. Provided is a marker composition for diagnosing pre-diabetes or diabetes comprising one or more polynucleotides selected from the group.
또한, 본 발명은 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준을 측정하는 제제를 포함하는 당뇨 전단계 또는 당뇨병 진단용 조성물을 제공한다.In addition, the present invention provides a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 2, a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 3, and a polynucleotide consisting of a nucleotide sequence of SEQ ID NO: 4. Provided is a composition for diagnosing pre-diabetes or diabetes, including an agent for measuring the expression level of one or more polynucleotides selected from the group.
또한, 본 발명은 상기 진단용 조성물을 포함하는 당뇨 전단계 또는 당뇨병 진단용 키트를 제공한다.Additionally, the present invention provides a kit for diagnosing pre-diabetes or diabetes, including the diagnostic composition.
본 발명에서 사용되는 용어, “진단(diagnosis)”이란 넓은 의미로는 환자의 병의 실태를 모든 면에 걸쳐서 판단하는 것을 의미한다. 판단의 내용은 병명, 병인, 병형, 경중, 병상의 상세한 양태, 및 합병증의 유무 등이다. 본 발명에서 진단은 당뇨 전단계 및/또는 당뇨병의 진행 수준 등을 판단하는 것일 수 있다.The term “diagnosis” used in the present invention broadly refers to judging the actual condition of a patient's disease in all aspects. The contents of the judgment include the name of the disease, etiology, type, severity, detailed conditions of the disease, and the presence or absence of complications. In the present invention, diagnosis may mean determining the level of pre-diabetes and/or progression of diabetes.
본 발명에서 사용되는 용어, “당뇨 전단계(Pre-diabetes)”는 혈당 수준이 정상인과 당뇨병 환자 사이에 있는 단계로, 공복혈당 기준으로 정상은 99㎎/dL 이하, 당뇨병은 126㎎/dL 이상이며, 당뇨 전단계는 그 사이 구간, 즉 100~125㎎/dL의 공복혈당을 나타내는 단계를 의미한다.The term “pre-diabetes” used in the present invention refers to a stage in which the blood sugar level is between a normal person and a diabetic patient. Based on fasting blood sugar level, normal is 99 mg/dL or less and diabetes is 126 mg/dL or more. , Pre-diabetes refers to the interval in between, that is, the stage showing a fasting blood sugar level of 100 to 125 mg/dL.
본 발명자들은 실시예를 통해 당뇨 전단계 또는 당뇨병 진단용 바이오마커로서, 총 4개의 piRNA들(hsa-piR-31447, hsa-piR-33226, hsa-piR-36246 및 hsa-piR-49124)을 발굴하였다.Through examples, the present inventors discovered a total of four piRNAs (hsa-piR-31447, hsa-piR-33226, hsa-piR-36246, and hsa-piR-49124) as biomarkers for diagnosing pre-diabetes or diabetes.
본 발명에 있어서, 상기 hsa-piR-31447은 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드일 수 있고, 상기 hsa-piR-33226은 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드일 수 있고, 상기 hsa-piR-36246은 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드일 수 있고, 상기 hsa-piR-49124는 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드일 수 있다.In the present invention, the hsa-piR-31447 may be a polynucleotide consisting of the base sequence of SEQ ID NO: 1, and the hsa-piR-33226 may be a polynucleotide consisting of the base sequence of SEQ ID NO: 2, and the hsa- piR-36246 may be a polynucleotide consisting of the base sequence of SEQ ID NO: 3, and hsa-piR-49124 may be a polynucleotide consisting of the base sequence of SEQ ID NO: 4.
보다 구체적으로, 본 발명의 일실시예에서는 정상군, 당뇨 전단계군 및 당뇨군에 해당하는 대상자들을 모집하고 이들의 혈액에서 엑소좀을 분리하여 엑소좀 내 piRNA의 발현 수준을 비교 분석하였다(실시예 1 참조).More specifically, in one embodiment of the present invention, subjects corresponding to the normal group, pre-diabetes group, and diabetes group were recruited, exosomes were isolated from their blood, and the expression level of piRNA in the exosomes was compared and analyzed (Example 1).
본 발명의 다른 실시예에서는, 각각 (1) 정상군 및 당뇨 전단계군, (2) 당뇨 전단계군 및 당뇨군, (3) 정상군 및 당뇨군에서 차이가 있는 piRNAs를 분석하였으며, piRNAs 발현 수준 결과를 이용하여 다차원척도법으로 분석한 결과 2차원 상에서 정상군, 당뇨 전단계군 및 당뇨군이 순차적인 패턴을 보이는 것을 확인하였다. In another embodiment of the present invention, piRNAs that differed in each of (1) normal group and pre-diabetic group, (2) pre-diabetic group and diabetes group, and (3) normal group and diabetes group were analyzed, and the results of piRNAs expression level were determined. As a result of analysis using multidimensional scaling, it was confirmed that the normal group, pre-diabetic group, and diabetic group showed sequential patterns in two dimensions.
또한, 정상에서 당뇨 전단계 및 당뇨로 갈수록 발현량이 감소하다가 증가(hsa-piR-31447, hsa-piR-36246)하거나, 정상에서 당뇨 전단계 및 당뇨로 갈수록 발현량이 증가하다가 감소(hsa-piR-33226)하거나, 정상에서 당뇨 전단계 및 당뇨로 갈수록 발현량이 감소(hsa-piR-49124)하는 piRNAs를 최종적으로 선별하였다. 선별된 piRNAs는 실제로 정상군과 당뇨 전단계군 간에 유의한 발현 차이를 나타내는 것을 확인하였다(실시예 2 내지 3 참조).In addition, the expression level decreases and then increases from normal to pre-diabetes and diabetes (hsa-piR-31447, hsa-piR-36246), or the expression level increases and then decreases from normal to pre-diabetes and diabetes (hsa-piR-33226). Alternatively, piRNAs whose expression level decreased from normal to pre-diabetes and diabetes (hsa-piR-49124) were finally selected. It was confirmed that the selected piRNAs actually showed significant expression differences between the normal group and the pre-diabetic group (see Examples 2 and 3).
본 발명에 있어서, 상기 제제는 상기 폴리뉴클레오티드에 특이적으로 결합하는 센스 또는 안티센스 프라이머, 앱타머, 항체 및 펩티드일 수 있으나, 이에 제한되는 것은 아니다.In the present invention, the agent may be a sense or antisense primer, aptamer, antibody, or peptide that specifically binds to the polynucleotide, but is not limited thereto.
본 발명에서 사용되는 용어, “프라이머(primer)”란 DNA 합성의 기시점이 되는 짧은 유전자 서열로써, 진단, DNA 시퀀싱 등에 이용할 목적으로 합성된 올리고뉴클레오티드를 의미한다. 상기 프라이머들은 통상적으로 15 내지 30 염기쌍의 길이로 합성하여 사용할 수 있으나, 사용 목적에 따라 달라질 수 있으며, 공지된 방법으로 메틸화, 캡화 등으로 변형시킬 수 있다.The term “primer” used in the present invention refers to a short gene sequence that serves as the starting point for DNA synthesis and an oligonucleotide synthesized for use in diagnosis, DNA sequencing, etc. The primers can generally be synthesized and used in a length of 15 to 30 base pairs, but may vary depending on the purpose of use, and can be modified by methylation, capping, etc. by known methods.
본 발명에서 사용되는 용어, “앱타머(Aptamer)”란 저분자 화합물로부터 단백질까지 다양한 종류의 물질에 높은 친화성과 특이성으로 결합할 수 있는 특성을 가지는 작은 단일 가닥 핵산(DNA 혹은 RNA) 조각을 의미하며, 예를 들어, 10 내지 60 뉴클레오티드로 이루어진 단일 가닥 핵산 조각일 수 있다.As used in the present invention, the term “Aptamer” refers to a small single-stranded nucleic acid (DNA or RNA) fragment that has the property of binding with high affinity and specificity to various types of substances, from low-molecular compounds to proteins. , for example, may be a single-stranded nucleic acid fragment consisting of 10 to 60 nucleotides.
본 발명에서 사용되는 용어, “항체(antibody)”란 항체는 항원과 특이적 결합을 하여 항원-항체 반응을 일으키는 물질을 의미하며, 키메라 항체, 인간화 항체, 인간 항체, 합성 항체 및/또는 친화도 성숙 항체일 수 있다.As used in the present invention, the term “antibody” refers to a substance that specifically binds to an antigen and causes an antigen-antibody reaction, including chimeric antibodies, humanized antibodies, human antibodies, synthetic antibodies, and/or affinity antibodies. It may be a mature antibody.
본 발명에서 사용되는 용어, “펩티드(peptide)”는 아마이드 결합 (또는 펩티드 결합)으로 연결된 2개 이상의 아미노산으로 이루어진 폴리머를 의미한다.As used in the present invention, the term “peptide” refers to a polymer composed of two or more amino acids linked by amide bonds (or peptide bonds).
본 발명의 진단용 키트는 분석 방법에 적합한 한 종류 또는 그 이상의 다른 구성성분 조성물, 용액 또는 장치로 구성된다.The diagnostic kit of the present invention consists of one or more different component compositions, solutions, or devices suitable for the analysis method.
예컨대, 본 발명의 키트는 PCR을 수행하기 위해, 분석하고자 하는 시료로부터 유래된 게놈 DNA, 본 발명의 마커 유전자에 대해 특이적인 프라이머 세트, 적당량의 DNA 중합 효소, dNTP 혼합물, PCR 완충용액 및 물을 포함하는 키트일 수 있다. 상기 PCR 완충용액은 KCl, Tris-HCl 및 MgCl2를 함유할 수 있다. 이외에 PCR 산물의 증폭 여부를 확인할 수 있는 전기영동 수행에 필요한 구성 성분들이 본 발명의 키트에 추가로 포함될 수 있다.For example, in order to perform PCR, the kit of the present invention contains genomic DNA derived from a sample to be analyzed, a primer set specific for the marker gene of the present invention, an appropriate amount of DNA polymerase, dNTP mixture, PCR buffer solution, and water. It may be a kit containing: The PCR buffer solution may contain KCl, Tris-HCl, and MgCl2. In addition, components necessary for performing electrophoresis that can confirm the amplification of the PCR product may be additionally included in the kit of the present invention.
또한, 본 발명의 키트는 RT-PCR을 수행하기 위해 필요한 필수 요소를 포함하는 키트일 수 있다. RT-PCR 키트는 마커 유전자에 대한 특이적인 각각의 프라이머 쌍 외에도 테스트 튜브 또는 다른 적절한 컨테이너, 반응 완충액, 데옥시뉴클레오티드(dNTPs), Taq-폴리머레이즈 및 역전사 효소와 같은 효소, DNase, RNase 억제제, DEPC-수(DEPC-water), 멸균수 등을 포함할 수 있다. 또한 정량 대조군으로 사용되는 유전자에 특이적인 프라이머 쌍을 포함할 수 있다. Additionally, the kit of the present invention may be a kit containing essential elements required to perform RT-PCR. In addition to each primer pair specific for the marker gene, the RT-PCR kit contains test tubes or other suitable containers, reaction buffer, deoxynucleotides (dNTPs), enzymes such as Taq-polymerase and reverse transcriptase, DNase, RNase inhibitors, and DEPC. -Can include DEPC-water, sterilized water, etc. It may also include a pair of primers specific to the gene used as a quantitative control.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준을 측정하는 단계를 포함하는, 당뇨 전단계 또는 당뇨병 진단을 위한 정보제공방법을 제공한다.In addition, the present invention provides a polynucleotide consisting of a base sequence of SEQ ID NO: 1, a polynucleotide consisting of a base sequence of SEQ ID NO: 2, a polynucleotide consisting of a base sequence of SEQ ID NO: 3, and a base of SEQ ID NO: 4 in a biological sample derived from a subject. Provided is a method of providing information for diagnosing pre-diabetes or diabetes, including the step of measuring the expression level of one or more polynucleotides selected from the group consisting of polynucleotides consisting of sequences.
상기 생물학적 시료는 혈액, 혈장, 혈청, 조직, 세포, 림프액, 골수액, 타액, 안구액, 정액, 뇌 추출물, 척수액, 관절액, 흉선액, 복수액, 양막액, 소변, 세포 조직액 및 세포 배양액으로 이루어진 군에서 선택되는 하나 이상일 수 있으나, 이에 제한되는 것은 아니다.The biological samples include blood, plasma, serum, tissue, cells, lymph fluid, bone marrow fluid, saliva, ocular fluid, semen, brain extract, spinal fluid, joint fluid, thymic fluid, ascites fluid, amniotic fluid, urine, cell tissue fluid, and cell culture fluid. It may be one or more selected from the group consisting of, but is not limited to this.
상기 폴리뉴클레오티드는 상기 생물학적 시료 내 엑소좀에 존재할 수 있다.The polynucleotide may be present in exosomes in the biological sample.
상기 폴리뉴클레오티드의 발현 수준은 당업계에 알려진 통상적인 방법으로 차세대 염기서열 분석(NGS), 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 실시간 중합효소연쇄반응(Real-time PCR), 정량적 중합효소연쇄반응(qPCR), 경쟁적 역전사 중합효소연쇄반응(Competitive RT-PCR), 실시간 정량중합효소연쇄반응(RT-qPCR), 역 중합효소 연쇄반응(Inverse PCR) 및 RNase 보호분석법(RNase RPA)으로 이루어진 군에서 선택되는 하나 이상의 방법을 통해 측정될 수 있으나, 이에 제한되지 않는다.The expression level of the polynucleotide is determined by conventional methods known in the art, such as next-generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription-polymerase chain reaction (RT-PCR), and real-time polymerase chain reaction (Real-time polymerase chain reaction). time PCR), quantitative polymerase chain reaction (qPCR), competitive reverse transcription polymerase chain reaction (Competitive RT-PCR), real-time quantitative polymerase chain reaction (RT-qPCR), inverse polymerase chain reaction (Inverse PCR), and RNase protection. It may be measured using one or more methods selected from the group consisting of analysis methods (RNase RPA), but is not limited thereto.
본 발명에 있어서, 상기 방법은 상기 측정된 폴리뉴클레오티드의 발현 수준을 정상인 및 당뇨병 환자의 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준과 비교하는 단계를 더 포함할 수 있다.In the present invention, the method is to measure the expression level of the polynucleotide in a normal person and a diabetic patient using a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a nucleotide sequence of SEQ ID NO: 3. It may further include comparing the expression level of one or more polynucleotides selected from the group consisting of a polynucleotide consisting of and a polynucleotide consisting of the base sequence of SEQ ID NO: 4.
본 발명에 있어서, 상기 방법은 상기 측정된 폴리뉴클레오티드의 발현 수준을 정상인 및 당뇨 전단계 환자의 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준과 비교하는 단계를 더 포함할 수 있다.In the present invention, the method is to measure the expression level of the polynucleotide in a normal person and a pre-diabetic patient using a polynucleotide consisting of the base sequence of SEQ ID NO: 1, a polynucleotide consisting of the base sequence of SEQ ID NO: 2, and a base of SEQ ID NO: 3. It may further include comparing the expression level of one or more polynucleotides selected from the group consisting of a polynucleotide consisting of the sequence and a polynucleotide consisting of the base sequence of SEQ ID NO: 4.
본 발명에 있어서, 상기 방법은 상기 측정된 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨병 환자보다 발현 수준이 적은 경우, 피검체는 당뇨 전단계로 판정하고; 상기 측정된 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 많고, 당뇨병 환자보다 발현 수준이 많은 경우, 피검체는 당뇨 전단계로 판정하고; 상기 측정된 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨병 환자보다 발현 수준이 적은 경우, 피검체는 당뇨 전단계로 판정하고; 상기 측정된 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨병 환자보다 발현 수준이 많은 경우, 피검체를 당뇨 전단계로 판정하는 단계를 더 포함할 수 있다.In the present invention, the method determines that the subject is pre-diabetic when the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is lower than that of a normal person and lower than that of a diabetic patient; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is higher than that of normal people and higher than that of diabetic patients, the subject is determined to be in the pre-diabetic stage; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is lower than that of normal people and lower than that of diabetic patients, the subject is determined to be in the pre-diabetic stage; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is lower than that of normal people and higher than that of diabetic patients, the step of determining that the subject is pre-diabetic may be further included.
본 발명에 있어서, 상기 방법은 상기 측정된 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨 전단계 환자보다 발현 수준이 많은 경우, 피검체는 당뇨병으로 판정하고; 상기 측정된 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨 전단계 환자보다 발현 수준이 적은 경우, 피검체는 당뇨병으로 판정하고; 상기 측정된 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨 전단계 환자보다 발현 수준이 많은 경우, 피검체는 당뇨병으로 판정하고; 상기 측정된 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨 전단계 환자보다 발현 수준이 적은 경우, 피검체를 당뇨병으로 판정하는 단계를 더 포함할 수 있다.In the present invention, the method determines that the subject has diabetes when the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is lower than that of a normal person and higher than that of a pre-diabetic patient; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is lower than that of a normal person and lower than that of a pre-diabetic patient, the subject is determined to have diabetes; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is lower than that of a normal person and higher than that of a pre-diabetic patient, the subject is determined to have diabetes; If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is lower than that of normal people and lower than that of pre-diabetic patients, the step of determining that the subject has diabetes may be further included.
또한, 본 발명은 피검체 유래의 생물학적 시료에서 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준을 측정하거나 검출하는 단계를 포함하는 당뇨 전단계 또는 당뇨병 진단 방법을 제공한다.In addition, the present invention provides a polynucleotide consisting of a base sequence of SEQ ID NO: 1, a polynucleotide consisting of a base sequence of SEQ ID NO: 2, a polynucleotide consisting of a base sequence of SEQ ID NO: 3, and a base of SEQ ID NO: 4 in a biological sample derived from a subject. A method for diagnosing pre-diabetes or diabetes is provided, which includes measuring or detecting the expression level of one or more polynucleotides selected from the group consisting of polynucleotides consisting of sequences.
본 발명의 일구현예로, 상기 방법은 피검체 또는 인간 환자로부터 생물학적 시료를 얻는 단계를 더 포함할 수 있다.In one embodiment of the present invention, the method may further include obtaining a biological sample from a subject or human patient.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail through examples. However, these examples are for illustrative purposes only and the scope of the present invention is not limited to these examples.
실시예Example
실시예 1. 실험준비 및 실험방법Example 1. Experimental preparation and experimental method
1-1. 분석 대상 모집1-1. Recruitment of analysis subjects
본 발명자들은 당뇨 전단계 및 당뇨병 진단을 위한 바이오마커를 발굴하기 위해, 각각 정상군(HV, 공복혈당 95이하, HbA1c 5.5 이하) 20명, 당뇨-전단계군(Pre-DM, 공복혈당 100-125, HbA1c 5.8-6.3 이하) 20명 및 당뇨군(DM, HbA1c 6.5 이상) 20명의 대상자들을 모집하였다. 이때 각 군을 나누는 기준은 미국 당뇨병 학회 기준을 참고하였으며, 환자군간 구분을 명확히 하여 좀 더 정확한 마커를 찾기 위해 경계부분을 제외한 새로운 기준을 적용하였다 (미국 당뇨병 학회 기준; 정상 (공복혈당 100미만, HbA1c 5.7미만) 당뇨 전단계 (공복혈당 100-125, HbA1c 5.8-6.4) 당뇨 (공복혈당 126이상, HbA1c 6.5 이상)). 상기 정상군, 당뇨-전단계군, 당뇨군으로부터 혈장 샘플을 채취하여 그룹 간 차이를 나타내는 생체지표를 찾고자 하였다. 이를 위해, 상기 각 군의 대상자들로부터 혈장을 제공받았다.To discover biomarkers for diagnosing pre-diabetes and diabetes, the present inventors studied 20 people in the normal group (HV, fasting blood sugar 95 or less, HbA1c 5.5 or less) and the pre-diabetes group (Pre-DM, fasting blood sugar 100-125, 20 subjects (HbA1c 5.8-6.3 or less) and 20 subjects in the diabetes group (DM, HbA1c 6.5 or more) were recruited. At this time, the standards for dividing each group were based on the standards of the American Diabetes Association, and in order to clearly distinguish between patient groups and find more accurate markers, new standards were applied excluding the boundary part (American Diabetes Association standards; normal (fasting blood sugar less than 100, HbA1c less than 5.7) Pre-diabetes (fasting blood sugar 100-125, HbA1c 5.8-6.4) Diabetes (fasting blood sugar more than 126, HbA1c more than 6.5). Plasma samples were collected from the normal group, pre-diabetic group, and diabetic group to find biomarkers showing differences between groups. For this purpose, plasma was provided from subjects in each group above.
1-2. 혈장으로부터 RNA 분리 및 서열분석 수행1-2. Isolate RNA from plasma and perform sequencing
상기 실시예 1-1에서 각 군의 대상자들로부터 채취한 혈장 샘플에 대하여 Exoquick(SBI, USA)을 사용해 엑소좀(exosome)을 분리하였고, 상기 분리된 엑소좀으로부터 Qiagen miRNeasy kit을 이용하여 총 RNA를 추출하였으며, 추출된 총 RNA의 양은 Agilent RNA Bioanalyzer를 이용해 제조사의 지시에 따라 측정하였다. Exosomes were isolated from the plasma samples collected from the subjects in each group in Example 1-1 using Exoquick (SBI, USA), and total RNA was extracted from the isolated exosomes using the Qiagen miRNeasy kit. was extracted, and the amount of total extracted RNA was measured using an Agilent RNA Bioanalyzer according to the manufacturer's instructions.
이후 상기 분리된 RNA를 이용하여 마크로젠사에서 Takara SMARTer smRNA for illumina kit를 사용하여 라이브러리를 제작한 후 Hiseq 2500으로 차세대 염기서열 분석(NGS: next generation sequencing)을 실시하여 piRNA(piwi-interacting RNA)를 검출하였다. Afterwards, using the isolated RNA, Macrogen created a library using the Takara SMARTer smRNA for illumina kit and then performed next generation sequencing (NGS) with Hiseq 2500 to generate piRNA (piwi-interacting RNA). Detected.
실시예 2. 당뇨 전단계 및 당뇨병 진단용 piRNA 발굴Example 2. Discovery of piRNA for diagnosis of pre-diabetes and diabetes
2-1. 정상군 vs. 당뇨 전단계의 발현수준에 차이가 있는 piRNA 분석2-1. Normal group vs. Analysis of piRNAs with differences in expression levels in pre-diabetes
먼저, 본 발명자들은 상기 정상군 20명과 당뇨 전단계 20명의 혈액 유래 엑소좀에서 발현수준의 차이가 나는 piRNA를 동정하기 위하여, 상기 실시예 1-1 및 1-2의 방법에 따라 각 대상자들에서 채취한 혈장으로부터 엑소좀을 분리하고 추출된 총 RNA에 대한 NGS 분석을 실시하였다. 분석 결과 394개의 piRNAs가 검출되었으며, 나아가 상기 검출된 piRNAs의 발현수준을 비교하였다. First, the present inventors collected piRNA from each subject according to the method of Examples 1-1 and 1-2 above in order to identify piRNAs with different expression levels in blood-derived exosomes of 20 normal subjects and 20 pre-diabetic subjects. Exosomes were isolated from plasma and NGS analysis was performed on the extracted total RNA. As a result of the analysis, 394 piRNAs were detected, and the expression levels of the detected piRNAs were compared.
그 결과, 도 1a에 나타낸 바와 같이 394개의 piRNAs 중에 정상군(HV)에 비해 당뇨 전단계 (Pre-DM)에서 2배 이상(p < 0.05) 발현이 감소하는 piRNA가 30개, 발현이 증가하는 piRNA가 41개로 나타났다. 또한, 상기 유의한 발현 변화를 보이는 piRNAs의 발현수준에 따른 산점도(scatter plot) 결과를 도 1b에 나타내었다. As a result, as shown in Figure 1a, among 394 piRNAs, there were 30 piRNAs whose expression decreased by more than 2 times (p < 0.05) in the pre-diabetic stage (Pre-DM) compared to the normal group (HV), and piRNAs whose expression increased. appeared in 41 cases. In addition, the scatter plot results according to the expression levels of piRNAs showing significant expression changes are shown in Figure 1b.
2-2. 당뇨 전단계 vs. 당뇨군의 발현수준에 차이가 있는 piRNA 분석2-2. Pre-diabetes vs. Analysis of piRNAs with differences in expression levels in the diabetes group
상기 결과에 더하여, 본 발명자들은 상기 당뇨 전단계 20명과 당뇨군 20명의 혈액 유래 엑소좀에서 발현수준의 차이가 나는 piRNA를 동정하기 위하여, 상기와 동일한 방법으로 얻은 엑소좀 내 총 RNA에 대한 NGS 분석을 실시하였다. 분석 결과 394개의 piRNA가 검출되었으며, 나아가 상기 검출된 piRNAs의 발현수준을 비교하였다. In addition to the above results, the present inventors performed NGS analysis on total RNA in exosomes obtained in the same manner as above to identify piRNAs with different expression levels in blood-derived exosomes of 20 pre-diabetics and 20 diabetics. It was carried out. As a result of the analysis, 394 piRNAs were detected, and the expression levels of the detected piRNAs were compared.
그 결과, 도 2a에 나타낸 바와 같이 394개의 piRNAs 중에 당뇨 전단계에 비해 당뇨군에서 2배 이상(p < 0.05) 발현이 감소하는 piRNA가 17개, 발현이 증가하는 piRNA가 22개로 나타났다. 또한, 상기 유의한 발현 변화를 보이는 piRNAs의 발현수준에 따른 산점도(scatter plot) 결과를 도 2b에 나타내었다. As a result, as shown in Figure 2a, among 394 piRNAs, there were 17 piRNAs whose expression decreased by more than twofold (p < 0.05) in the diabetic group compared to the pre-diabetic group, and 22 piRNAs whose expression increased. In addition, the scatter plot results according to the expression levels of piRNAs showing significant expression changes are shown in Figure 2b.
2-3. 정상군 vs. 당뇨군의 발현수준에 차이가 있는 piRNA 분석2-3. Normal group vs. Analysis of piRNAs with differences in expression levels in the diabetes group
또한, 본 발명자들은 정상군 20명과 당뇨군 20명의 혈액 유래 엑소좀에서 발현수준의 차이가 나는 piRNA를 동정하기 위하여, 상기와 동일한 방법으로 얻은 엑소좀 내 총 RNA에 대한 NGS 분석을 실시하였다. 분석 결과 394개의 piRNAs가 검출되었으며, 나아가 상기 검출된 piRNAs의 발현수준을 비교하였다. In addition, the present inventors performed NGS analysis on total RNA in exosomes obtained in the same manner as above to identify piRNAs with different expression levels in blood-derived exosomes of 20 normal and 20 diabetic groups. As a result of the analysis, 394 piRNAs were detected, and the expression levels of the detected piRNAs were compared.
그 결과, 도 3a에 나타낸 바와 같이 394개의 piRNAs 중에 정상군(HV)에 비해 당뇨군(DM)에서 2배 이상(p < 0.05) 발현이 감소하는 piRNA가 40개, 발현이 증가하는 piRNA가 62개로 나타났다. 또한, 상기 유의한 발현 변화를 보이는 piRNAs의 발현수준에 따른 산점도(scatter plot) 결과를 도 3b에 나타내었다. As a result, as shown in Figure 3a, among 394 piRNAs, there were 40 piRNAs whose expression decreased by more than twofold (p < 0.05) in the diabetic group (DM) compared to the normal group (HV), and 62 piRNAs whose expression increased. Appeared as a dog. In addition, the scatter plot results according to the expression levels of piRNAs showing significant expression changes are shown in Figure 3b.
2-4. 정상군 vs. 당뇨 전단계 vs. 당뇨군의 발현수준에 차이가 있는 piRNA 분석2-4. Normal group vs. Pre-diabetes vs. Analysis of piRNAs with differences in expression levels in the diabetes group
나아가 정상군, 당뇨 전단계 및 당뇨군에 대하여 다차원척도법(MDS: Multidimensional scaling)을 통해 개별 샘플에 대한 변화량을 도출하여 이를 시각화하여 분석하였다. 그 결과, 도 4에 나타낸 바와 같이 정상군과 당뇨군에서 각각 나타나는 2차원 상의 공간적 위치가 두개의 그룹으로 확연하게 구분되어 나타났으며, 대체적으로 정상군, 당뇨 전단계 및 당뇨군이 순차적인 패턴을 보이는 것을 확인하였다. 또한, 상기 실시예 2-1 내지 2-3의 결과를 통해 얻은 분석 결과로서, 발현수준의 변화가 나타나는 piRNAs를 분류하였다. 구체적으로 하기 [표 1]에 나타낸 바와 같이, 정상에서 당뇨 전단계 및 당뇨로 발현량이 갈수록 감소하다가 증가(hsa-piR-31447, hsa-piR-36246)하거나, 정상에서 당뇨 전단계 및 당뇨로 갈수록 발현량이 증가하다가 감소(hsa-piR-33226)하거나, 정상에서 당뇨 전단계 및 당뇨로 갈수록 발현량이 감소(hsa-piR-49124)하는 piRNAs를 최종적으로 선별하였으며, piRNA의 서열은 하기 [표 2]에 나타낸 바와 같다.Furthermore, for the normal group, pre-diabetes, and diabetes groups, the amount of change for each individual sample was derived through multidimensional scaling (MDS), and this was visualized and analyzed. As a result, as shown in Figure 4, the two-dimensional spatial locations in the normal and diabetic groups were clearly divided into two groups, and in general, the normal, pre-diabetic, and diabetic groups showed sequential patterns. Confirmed what was visible. In addition, as a result of the analysis obtained through the results of Examples 2-1 to 2-3, piRNAs showing changes in expression level were classified. Specifically, as shown in [Table 1] below, the expression level decreases from normal to pre-diabetes and diabetes and then increases (hsa-piR-31447, hsa-piR-36246), or the expression level increases from normal to pre-diabetes and diabetes. piRNAs that increased and then decreased (hsa-piR-33226) or whose expression level decreased from normal to pre-diabetic and diabetic (hsa-piR-49124) were finally selected, and the piRNA sequences are shown in [Table 2] below. same.
piRNApiRNA Pre-DM/HVPre-DM/HV DM/Pre-DMDM/Pre-DM DM/HVDM/HV ANOVAANOVA
hsa-piR-31447hsa-piR-31447 -12.75-12.75 9.009.00 -1.42-1.42 0.00060.0006
hsa-piR-33226hsa-piR-33226 2.122.12 -2.27-2.27 -1.07-1.07 0.00630.0063
hsa-piR-36246hsa-piR-36246 -2.27-2.27 2.032.03 -1.12-1.12 0.01810.0181
hsa-piR-49124hsa-piR-49124 -2.00-2.00 -2.04-2.04 -4.09-4.09 <0.0001<0.0001
서열번호sequence number piRNApiRNA 서열order
서열번호 1SEQ ID NO: 1 hsa-piR-31447hsa-piR-31447 AGGGGCUGAAUGAAAAUGGCCUUUCUGAACAGGGGCUGAAUGAAAAUGGCCUUUCUGAAC
서열번호 2SEQ ID NO: 2 hsa-piR-33226hsa-piR-33226 CCUCGAACUCCUGACCUCAGGUGAUCCACCCCUCGAACUCCCUGACCUCAGGUGAUCCACC
서열번호 3SEQ ID NO: 3 hsa-piR-36246hsa-piR-36246 GGGGGUAUAGCUCAGUGGGUAGAGCAUGGGGGUUAUAGCUCAGUGGGUAGAGCAU
서열번호 4SEQ ID NO: 4 hsa-piR-49124hsa-piR-49124 UGAGGGUUCGAGUCCCUUCGUGGUCGCCUGAGGGUUCGAGUCCCUUCGUGGUCGCC
실시예 3. 당뇨 전단계 및 당뇨병 진단 마커의 진단 성능 확인Example 3. Confirmation of diagnostic performance of pre-diabetes and diabetes diagnostic markers
정상군(HV, 공복혈당 95이하, HbA1c 5.5 이하) 20명, 당뇨-전단계군(Pre-DM, 공복혈당 100-125, HbA1c 5.8-6.3 이하) 20명 및 당뇨군(DM, HbA1c 6.5 이상) 20명의 대상자들로부터 실시예 2-4에서 발굴된 당뇨 전단계 및 당뇨병 진단 마커 4개의 발현량을 비교하였다.Normal group (HV, fasting blood sugar 95 or less, HbA1c 5.5 or less) 20 people, pre-diabetes group (Pre-DM, fasting blood sugar 100-125, HbA1c 5.8-6.3 or less) 20 people, and diabetic group (DM, HbA1c 6.5 or more) The expression levels of four pre-diabetes and diabetes diagnostic markers discovered in Examples 2-4 were compared among 20 subjects.
그 결과, 정상군, 당뇨 전단계 및 당뇨군에서 4개의 마커들 간의 구별이 가능하다는 것을 확인함으로써, 당뇨 전단계 및 당뇨병 진단이 가능하다는 것을 확인하였다(도 5).As a result, it was confirmed that it was possible to distinguish between the four markers in the normal group, pre-diabetes, and diabetes groups, confirming that diagnosis of pre-diabetes and diabetes was possible (FIG. 5).
전술한 본 발명의 설명은 예시를 위한 것이며, 본 발명이 속하는 기술분야의 통상의 지식을 가진 자는 본 발명의 기술적 사상이나 필수적인 특징을 변경하지 않고서 다른 구체적인 형태로 쉽게 변형이 가능하다는 것을 이해할 수 있을 것이다. 그러므로 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적이 아닌 것으로 이해해야만 한다.The description of the present invention described above is for illustrative purposes, and those skilled in the art will understand that the present invention can be easily modified into other specific forms without changing the technical idea or essential features of the present invention. will be. Therefore, the embodiments described above should be understood in all respects as illustrative and not restrictive.

Claims (12)

  1. 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드를 포함하는 당뇨 전단계 또는 당뇨병 진단용 마커 조성물.One selected from the group consisting of a polynucleotide consisting of the base sequence of SEQ ID NO: 1, a polynucleotide consisting of the base sequence of SEQ ID NO: 2, a polynucleotide consisting of the base sequence of SEQ ID NO: 3, and a polynucleotide consisting of the base sequence of SEQ ID NO: 4 A marker composition for diagnosing pre-diabetes or diabetes comprising the above polynucleotide.
  2. 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준을 측정하는 제제를 포함하는 당뇨 전단계 또는 당뇨병 진단용 조성물.One selected from the group consisting of a polynucleotide consisting of the base sequence of SEQ ID NO: 1, a polynucleotide consisting of the base sequence of SEQ ID NO: 2, a polynucleotide consisting of the base sequence of SEQ ID NO: 3, and a polynucleotide consisting of the base sequence of SEQ ID NO: 4 A composition for diagnosing pre-diabetes or diabetes, comprising an agent for measuring the expression level of the above polynucleotide.
  3. 청구항 2에 있어서, 상기 제제는 상기 폴리뉴클레오티드에 특이적으로 결합하는 센스 또는 안티센스 프라이머, 앱타머, 항체 및 펩티드로 이루어진 군에서 선택되는 하나 이상인, 조성물.The composition of claim 2, wherein the agent is at least one selected from the group consisting of a sense or antisense primer, aptamer, antibody, and peptide that specifically binds to the polynucleotide.
  4. 청구항 2의 조성물을 포함하는, 당뇨 전단계 또는 당뇨병 진단용 키트.A kit for diagnosing pre-diabetes or diabetes, comprising the composition of claim 2.
  5. 피검체 유래의 생물학적 시료에서 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준을 측정하는 단계를 포함하는, 당뇨 전단계 또는 당뇨병 진단을 위한 정보제공방법.In a biological sample derived from a subject, a polynucleotide consisting of the base sequence of SEQ ID NO: 1, a polynucleotide consisting of the base sequence of SEQ ID NO: 2, a polynucleotide consisting of the base sequence of SEQ ID NO: 3, and a polynucleotide consisting of the base sequence of SEQ ID NO: 4 A method of providing information for diagnosing pre-diabetes or diabetes, comprising measuring the expression level of one or more polynucleotides selected from the group consisting of.
  6. 청구항 5에 있어서, 상기 생물학적 시료는 혈액, 혈장, 혈청, 조직, 세포, 림프액, 골수액, 타액, 안구액, 정액, 뇌 추출물, 척수액, 관절액, 흉선액, 복수액, 양막액, 소변, 세포 조직액 및 세포 배양액으로 이루어진 군에서 선택되는 하나 이상인, 정보제공방법.The method of claim 5, wherein the biological sample includes blood, plasma, serum, tissue, cells, lymph fluid, bone marrow fluid, saliva, ocular fluid, semen, brain extract, spinal fluid, synovial fluid, thymic fluid, ascites fluid, amniotic fluid, urine, and cells. A method of providing information, which is at least one selected from the group consisting of tissue fluid and cell culture fluid.
  7. 청구항 5에 있어서, 상기 폴리뉴클레오티드는 상기 생물학적 시료 내 엑소좀에 존재하는 것인, 정보제공방법.The method of claim 5, wherein the polynucleotide is present in exosomes in the biological sample.
  8. 청구항 5에 있어서, 상기 폴리뉴클레오티드의 발현 수준은 차세대 염기서열 분석(NGS), 중합효소연쇄반응(PCR), 역전사 중합효소연쇄반응(RT-PCR), 실시간 중합효소연쇄반응(Real-time PCR), 정량적 중합효소연쇄반응(qPCR), 경쟁적 역전사 중합효소연쇄반응(Competitive RT-PCR), 실시간 정량중합효소연쇄반응(RT-qPCR), 역 중합효소 연쇄반응(Inverse PCR) 및 RNase 보호분석법(RNase RPA)으로 이루어진 군에서 선택되는 하나 이상의 방법을 통해 측정되는 것인, 정보제공방법.The method of claim 5, wherein the expression level of the polynucleotide is determined by next-generation sequencing (NGS), polymerase chain reaction (PCR), reverse transcription-polymerase chain reaction (RT-PCR), and real-time polymerase chain reaction (Real-time PCR). , quantitative polymerase chain reaction (qPCR), competitive reverse transcription polymerase chain reaction (Competitive RT-PCR), real-time quantitative polymerase chain reaction (RT-qPCR), inverse polymerase chain reaction (Inverse PCR), and RNase protection assay (RNase An information provision method that is measured through one or more methods selected from the group consisting of (RPA).
  9. 청구항 5에 있어서, 상기 측정된 폴리뉴클레오티드의 발현 수준을 정상인 및 당뇨병 환자의 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준과 비교하는 단계를 더 포함하는, 정보제공방법.The method of claim 5, wherein the measured expression level of the polynucleotide is a polynucleotide consisting of the base sequence of SEQ ID NO: 1, a polynucleotide consisting of the base sequence of SEQ ID NO: 2, and a polynucleotide consisting of the base sequence of SEQ ID NO: 3 in normal people and diabetic patients A method of providing information, further comprising comparing the expression level of one or more polynucleotides selected from the group consisting of nucleotides and polynucleotides having the base sequence of SEQ ID NO: 4.
  10. 청구항 5에 있어서, 상기 측정된 폴리뉴클레오티드의 발현 수준을 정상인 및 당뇨 전단계 환자의 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드, 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드 및 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드로 이루어진 군에서 선택되는 하나 이상의 폴리뉴클레오티드의 발현 수준과 비교하는 단계를 더 포함하는, 정보제공방법.The method of claim 5, wherein the measured expression level of the polynucleotide is a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1, a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2, and a nucleotide sequence of SEQ ID NO: 3 in normal people and pre-diabetic patients. A method of providing information, further comprising comparing the expression level of one or more polynucleotides selected from the group consisting of a polynucleotide and a polynucleotide having the base sequence of SEQ ID NO: 4.
  11. 청구항 9에 있어서, In claim 9,
    상기 측정된 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨병 환자보다 발현 수준이 적은 경우, 피검체는 당뇨 전단계로 판정하고;If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is lower than that of normal people and lower than that of diabetic patients, the subject is determined to be in the pre-diabetic stage;
    상기 측정된 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 많고, 당뇨병 환자보다 발현 수준이 많은 경우, 피검체는 당뇨 전단계로 판정하고;If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is higher than that of normal people and higher than that of diabetic patients, the subject is determined to be in the pre-diabetic stage;
    상기 측정된 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨병 환자보다 발현 수준이 적은 경우, 피검체는 당뇨 전단계로 판정하고;If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is lower than that of normal people and lower than that of diabetic patients, the subject is determined to be in the pre-diabetic stage;
    상기 측정된 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨병 환자보다 발현 수준이 많은 경우, 피검체를 당뇨 전단계로 판정하는 단계를 더 포함하는, 정보제공방법.If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is lower than that of normal people and higher than that of diabetic patients, the method of providing information further includes determining that the subject is in a pre-diabetic stage.
  12. 청구항 10에 있어서,In claim 10,
    상기 측정된 서열번호 1의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨 전단계 환자보다 발현 수준이 많은 경우, 피검체는 당뇨병으로 판정하고;If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 is lower than that of a normal person and higher than that of a pre-diabetic patient, the subject is determined to have diabetes;
    상기 측정된 서열번호 2의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨 전단계 환자보다 발현 수준이 적은 경우, 피검체는 당뇨병으로 판정하고;If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 2 is lower than that of a normal person and lower than that of a pre-diabetic patient, the subject is determined to have diabetes;
    상기 측정된 서열번호 3의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨 전단계 환자보다 발현 수준이 많은 경우, 피검체는 당뇨병으로 판정하고;If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 3 is lower than that of a normal person and higher than that of a pre-diabetic patient, the subject is determined to have diabetes;
    상기 측정된 서열번호 4의 염기 서열로 이루어진 폴리뉴클레오티드의 발현 수준이 정상인보다 적고, 당뇨 전단계 환자보다 발현 수준이 적은 경우, 피검체를 당뇨병으로 판정하는 단계를 더 포함하는, 정보제공방법.If the measured expression level of the polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 4 is lower than that of a normal person and lower than that of a pre-diabetic patient, the method of providing information further includes determining that the subject has diabetes.
PCT/KR2023/003008 2022-03-14 2023-03-06 Biomarker for diagnosis of pre-diabetes and diabetes, and use thereof WO2023177132A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020220031310A KR20230134245A (en) 2022-03-14 2022-03-14 Biomarkers for prediabetes and diabetes diagnosis and uses thereof
KR10-2022-0031310 2022-03-14

Publications (1)

Publication Number Publication Date
WO2023177132A1 true WO2023177132A1 (en) 2023-09-21

Family

ID=88023954

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2023/003008 WO2023177132A1 (en) 2022-03-14 2023-03-06 Biomarker for diagnosis of pre-diabetes and diabetes, and use thereof

Country Status (2)

Country Link
KR (1) KR20230134245A (en)
WO (1) WO2023177132A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110046209A1 (en) * 2008-05-02 2011-02-24 The Brigham And Women's Hospital, Inc. RNA-Induced Translational Silencing and Cellular Apoptosis
KR20210095071A (en) * 2020-01-22 2021-07-30 계명대학교 산학협력단 Biomarker for early diagnosing diabetes or diagnosing diabetic complications and use thereof
KR20210095287A (en) * 2020-01-22 2021-08-02 계명대학교 산학협력단 Biomarker for early diagnosing diabetes or diagnosing diabetes and use thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110046209A1 (en) * 2008-05-02 2011-02-24 The Brigham And Women's Hospital, Inc. RNA-Induced Translational Silencing and Cellular Apoptosis
KR20210095071A (en) * 2020-01-22 2021-07-30 계명대학교 산학협력단 Biomarker for early diagnosing diabetes or diagnosing diabetic complications and use thereof
KR20210095287A (en) * 2020-01-22 2021-08-02 계명대학교 산학협력단 Biomarker for early diagnosing diabetes or diagnosing diabetes and use thereof

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
JIA SHANSHAN, ZHANG QIANG, WANG YU, WANG YANFU, LIU DAN, HE YIWEN, WEI XIAOWEI, GU HUI, MA WEI, LUO WENTING, YUAN ZHENGWEI: "PIWI-interacting RNA sequencing profiles in maternal plasma-derived exosomes reveal novel non-invasive prenatal biomarkers for the early diagnosis of nonsyndromic cleft lip and palate", EBIOMEDICINE, ELSEVIER BV, NL, vol. 65, 1 March 2021 (2021-03-01), NL , pages 103253, XP093092741, ISSN: 2352-3964, DOI: 10.1016/j.ebiom.2021.103253 *
VINASCO-SANDOVAL TATIANA, MOREIRA FABIANO CORDEIRO, F. VIDAL AMANDA, PINTO PABLO, RIBEIRO-DOS-SANTOS ANDRÉ M., CRUZ REBECCA L. S.,: "Global Analyses of Expressed Piwi-Interacting RNAs in Gastric Cancer", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 21, no. 20, pages 7656, XP093092739, DOI: 10.3390/ijms21207656 *

Also Published As

Publication number Publication date
KR20230134245A (en) 2023-09-21

Similar Documents

Publication Publication Date Title
JP6523375B2 (en) How to assess liver involvement
US11767565B2 (en) Use of detection reagent for detecting methylation of genes associated with colorectal cancer, and kit
CN112852957B (en) Early diagnosis marker for Hirschmannia and application thereof
KR20200002241A (en) Biomarker microRNA-26b or microRNA-4449 for diagnosing obesity and use thereof
WO2022186592A1 (en) Biomarker for diagnosing pre-diabetes or predicting onset of diabetic complications and use thereof
WO2022031072A1 (en) Pancreatic cancer diagnostic composition to be used in buffy coat sample
CN112708673B (en) Application of PRDM9 transposon fusion as congenital megacolon disease marker
KR102492149B1 (en) MicroRNA-1246 for diagnosing of ovarian cancer and use thereof
WO2023177132A1 (en) Biomarker for diagnosis of pre-diabetes and diabetes, and use thereof
KR102178919B1 (en) Biomarker microRNAs for diagnosing diabetic nephropathy and use thereof
US20050112558A1 (en) Prognostic PCR assay for severe acute respiratory syndrome (SARS)
KR102165841B1 (en) Biomarker microRNA let-7b or microRNA-664a for diagnosing diabetes and use thereof
WO2018143574A1 (en) Composition for diagnosing obesity and use thereof
WO2022025387A1 (en) Biomarker for diagnosing nonalcoholic steatohepatitis using microrna combination
KR20220040834A (en) Multiplex LAMP composition for diagnosis of COVID-19 comprising molecular beacon probe
KR102110050B1 (en) Biomarker microRNA-423 or microRNA-424 for diagnosing diabetes and use thereof
WO2024049247A1 (en) Novel biomarker for parkinson&#39;s disease, and use thereof
WO2024035082A1 (en) Biomarker composition for diagnosing small cell lung cancer, containing exosome-derived mirnas as active ingredient
WO2021006449A1 (en) Composition for diagnosing diabetic nephropathy
WO2024128688A1 (en) Novel biomarkers for diagnosis or prognosis of interstitial cystitis and use thereof
CN116694642B (en) Unstable angina pectoris biomarker, detection method, application and kit thereof
WO2023214617A1 (en) Early diagnosis method and diagnosis kit for cancer using measurement of interferon gamma gene in exosomes
US11718880B2 (en) Marker and diagnosis method for noninvasive diagnosis of myocardial infarction
WO2023008673A1 (en) Machine learning-based complex marker for determining nonalcoholic steatohepatitis, and use thereof
WO2013082288A1 (en) Glucorticoid receptor gene nr3c1 methylation in irritable bowel syndrome and other stress disorders

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23771011

Country of ref document: EP

Kind code of ref document: A1