WO2023168444A1 - Single-stranded splint strands and methods of use - Google Patents

Single-stranded splint strands and methods of use Download PDF

Info

Publication number
WO2023168444A1
WO2023168444A1 PCT/US2023/063736 US2023063736W WO2023168444A1 WO 2023168444 A1 WO2023168444 A1 WO 2023168444A1 US 2023063736 W US2023063736 W US 2023063736W WO 2023168444 A1 WO2023168444 A1 WO 2023168444A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
molecules
sequencing
universal
molecule
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2023/063736
Other languages
English (en)
French (fr)
Inventor
William Light
Ryan Kelley
Junhua Zhao
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Element Biosciences Inc
Original Assignee
Element Biosciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Element Biosciences Inc filed Critical Element Biosciences Inc
Priority to KR1020247033040A priority Critical patent/KR20240173217A/ko
Priority to IL315324A priority patent/IL315324A/en
Priority to CN202380038013.5A priority patent/CN119487205A/zh
Priority to CA3254619A priority patent/CA3254619A1/en
Priority to EP23717778.7A priority patent/EP4486912A1/en
Priority to AU2023229094A priority patent/AU2023229094A1/en
Priority to JP2024552476A priority patent/JP2025509201A/ja
Publication of WO2023168444A1 publication Critical patent/WO2023168444A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6806Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1065Preparation or screening of tagged libraries, e.g. tagged microorganisms by STM-mutagenesis, tagged polynucleotides, gene tags
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1068Template (nucleic acid) mediated chemical library synthesis, e.g. chemical and enzymatical DNA-templated organic molecule synthesis, libraries prepared by non ribosomal polypeptide synthesis [NRPS], DNA/RNA-polymerase mediated polypeptide synthesis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6853Nucleic acid amplification reactions using modified primers or templates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869Methods for sequencing
    • C12Q1/6874Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2525/00Reactions involving modified oligonucleotides, nucleic acids, or nucleotides
    • C12Q2525/10Modifications characterised by
    • C12Q2525/191Modifications characterised by incorporating an adaptor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00Reactions of nucleic acids characterised by
    • C12Q2531/10Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/125Rolling circle
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2535/00Reactions characterised by the assay type for determining the identity of a nucleotide base or a sequence of oligonucleotides
    • C12Q2535/125Allele specific primer extension
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/162Helper probe

Definitions

  • the present disclosure relates to, preparing and sequencing polynucleotides from libraries of covalently closed circular molecules. Improvements in next generation sequencing technology have greatly increased sequencing speed and data output, resulting in the high sample throughput of current sequencing platforms. Efficient preparation of closed circular library molecules having target sequences is important for downstream amplification and sequencing workflows. Another aspect of increasing sequencing throughput is the addition of unique index sequences to DNA fragments during library preparation, which allows large number of libraries to be pooled an sequenced simultaneously during each sequencing run. Accordingly, there is a need for alternative methods for producing and sequencing a circular library molecules containing target sequences and unique index sequences, which are compatible for downstream next generation sequencing technologies. Provided herein are compositions, methods and kits addressing this need. SUMMARY
  • the disclosure provides a library-splint complex (300) comprising: (i) a singlestranded nucleic acid library molecule (100) which includes a sequence of interest (110) flanked on one side by at least a first left universal adaptor sequence (120) and flanked on the other side by at least a first right universal adaptor sequence (130); and (ii) a single-stranded splint strand (200) which includes a first region (210) having a universal binding sequence for the first left universal adaptor sequence (120) of the library molecule, and the single-stranded splint strand further comprises a second region (220) having a universal binding sequence for the first right universal adaptor sequence (130) of the library molecule, thereby circularizing the library molecule to generate a library-splint complex (300) having a nick between the 5’ end of the library molecule and the 3’ end of the library molecule.
  • the nucleic acid library molecule (100) further comprises: a second left universal adaptor sequence (140). In some embodiments, the nucleic acid library molecule (100) further comprises: a second right universal adaptor sequence (150). In some embodiments, the nucleic acid library molecule (100) further comprises: a first left sample index sequence (160). In some embodiments, the nucleic acid library molecule (100) further comprises: a first right sample index sequence (170). In some embodiments, the nucleic acid library molecule (100) further comprises: a first left unique identification sequence (180). In some embodiments, the nucleic acid library molecule (100) further comprises: a first right unique identification sequence (190).
  • the nucleic acid library molecule (100) further comprises any one or any combination of two or more of: (i) a second left universal adaptor sequence (1 0); (ii) a second right universal adaptor sequence (150); (iii) a first left index sequence (160); (iv) a first right index sequence (170); (v) a first left unique identification sequence (180); and/or (vi) a first right unique identification sequence (190).
  • the first left universal adaptor sequence (120) and/or the second left universal adaptor sequence (140) comprises: (i) a universal binding sequence for a forward sequencing primer; (ii) a universal binding sequence for a reverse sequencing primer; (iii) a universal binding sequence for an first surface primer; (iv) a universal binding sequence for an second surface primer; (v) a universal binding sequence for a forward amplification primer; (vi) a universal binding sequence for a reverse amplification primer; and/or (vii) a universal binding sequence for a compaction oligonucleotide.
  • the first right universal adaptor sequence (130) and/or the second right universal adaptor sequence (150) comprises: (i) a universal binding sequence for a forward sequencing primer; (ii) a universal binding sequence for a reverse sequencing primer; (iii) a universal binding sequence for an first surface primer; (iv) a universal binding sequence for an second surface primer; (v) a universal binding sequence for a forward amplification primer; (vi) a universal binding sequence for a reverse amplification primer; and/or (vii) a universal binding sequence for a compaction oligonucleotide.
  • the disclosure provides a method for generating a plurality of covalently closed circular library molecules (400) comprising: a) providing a plurality of single-stranded nucleic acid library molecules (100) wherein individual library molecules in the plurality include a sequence of interest (110) flanked on one side by at least a first left universal adaptor sequence (120) and flanked on the other side by at least a first right universal adaptor sequence (130); b) providing a plurality of single-stranded splint strands (200) wherein individual single-stranded splint strands (200) in the plurality comprise a first region (210) that is capable of hybridizing with the at least a first left universal adaptor sequence (120) of an individual library molecule, and a second region (220) that is capable of hybridizing with the at least a first right universal adaptor sequence (130) of the individual library molecule; c) hybridizing the plurality of single-stranded splint strands (200) with
  • the method further comprises: (e) distributing the plurality of covalently closed circular library molecules (400) onto a support having a plurality of surface primers immobilized on the support, under a condition suitable for hybridizing individual covalently closed circular library molecules (400) to individual immobilized surface primers thereby immobilizing the plurality of covalently closed circular library molecules (400) to the support.
  • the method further comprises: (f) contacting the plurality of immobilized covalently closed circular library molecules (400) with a plurality of stranddisplacing polymerases and a plurality of nucleotides, under a condition suitable to conduct a rolling circle amplification reaction on the support using the plurality of surface primers as immobilized amplification primers and the plurality of covalently closed circular library molecules (400) as template molecules, thereby generating a plurality of immobilized nucleic acid concatemer molecules.
  • the method further comprises: sequencing the plurality of immobilized nucleic acid concatemer molecules.
  • the sequencing comprises: a) contacting the plurality of immobilized concatemer molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of the soluble sequencing primers, wherein the contacting is conducted under a condition suitable to form a plurality of complexed polymerases each comprising a sequencing polymerase bound to a nucleic acid duplex wherein the nucleic acid duplex comprises a concatemer molecule hybridized to a soluble sequencing primer; b) contacting the plurality of complexed sequencing polymerases with a plurality of nucleotides under a condition suitable for binding at least one nucleotide to a complexed sequencing polymerase, wherein the plurality of nucleotides comprises at least one nucleotide analog labeled with a fluorophore and having a removable chain terminating moiety
  • the sequencing comprises: a) contacting the plurality of immobilized concatemer molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of the soluble sequencing primers, wherein the contacting is conducted under a condition suitable to form a plurality of first complexed polymerases each comprising a sequencing polymerase bound to a nucleic acid duplex wherein the nucleic acid duplex comprises a concatemer molecule hybridized to a soluble sequencing primer; b) contacting the plurality of complexed sequencing polymerases with a plurality of detectably labeled multivalent molecules to form a plurality of multivalent-complexed polymerases, under a condition suitable for binding complementary nucleotide units of the multivalent molecules to at least two of the plurality of first complexed polymerases thereby forming a plurality of multivalent-complexed polymerases, and the condition inhibits incorporation of the complementary nucleotide
  • the sequencing further comprises: e) dissociating the plurality of multivalent-complexed polymerases and removing the plurality of first sequencing polymerases and their bound multivalent molecules, and retaining the plurality of nucleic acid duplexes; f) contacting the plurality of the retained nucleic acid duplexes of step (e) with a plurality of second sequencing polymerases, wherein the contacting is conducted under a condition suitable for binding the plurality of second sequencing polymerases to the plurality of the retained nucleic acid duplexes, thereby forming a plurality of second complexed polymerases each comprising a second sequencing polymerase bound to a retained nucleic acid duplex; g) contacting the plurality of second complexed polymerases with a plurality of nucleotides, wherein the contacting is conducted under a condition suitable for binding complementary nucleotides from the plurality of nucleotides to at least two of the second complexe
  • the sequencing further comprises: h) detecting the complementary nucleotides which are incorporated into the sequencing primers of the nucleotide-complexed polymerases. In some embodiments, the sequencing further comprises: h) detecting the complementary nucleotides which are incorporated into the sequencing primers of the nucleotide-complexed polymerases; and i) identifying the nucleo-bases of the complementary nucleotides which are incorporated into the sequencing primers of the nucleotide-complexed polymerases.
  • the disclosure provides a method for forming at least one avidity complex, comprising: a) binding a first universal nucleic acid primer, a first DNA polymerase, and a first multivalent molecule to a first portion of the concatemer molecules of claim 16, thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule binds to the first DNA polymerase; and b) binding a second universal nucleic acid primer, a second DNA polymerase, and the first multivalent molecule to a second portion of the same concatemer template molecule thereby forming a second binding complex, wherein a second nucleotide unit of the first multivalent molecule binds to the second DNA polymerase, wherein the first and second binding complexes which include the same multivalent molecule forms an avidity complex, wherein the first multivalent molecule comprises a core attached to multiple nucleotide arms and each nucleotide arm is attached to a nucleotide unit, and
  • the disclosure provides a method for sequencing by forming at least one avidity complex, comprising: a) binding a first universal nucleic acid primer, a first DNA polymerase, and a first multivalent molecule to a first portion of the concatemer molecules of claim 16, thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule binds to the first DNA polymerase; b) binding a second universal nucleic acid primer, a second DNA polymerase, and the first multivalent molecule to a second portion of the same concatemer template molecule thereby forming a second binding complex, wherein a second nucleotide unit of the first multivalent molecule binds to the second DNA polymerase, wherein the first and second binding complexes which include the same multivalent molecule forms an avidity complex, wherein the first multivalent molecule comprises a core attached to multiple nucleotide arms and each nucleotide arm is attached to a nucleotide unit,
  • the nucleic acid library molecule (100) further comprises: a second left universal adaptor sequence (140). In some embodiments, the nucleic acid library molecule (100) further comprises: a second right universal adaptor sequence (150). In some embodiments, the nucleic acid library molecule (100) further comprises: a first left sample index sequence (160). In some embodiments, the nucleic acid library molecule (100) further comprises: a first right sample index sequence (170). In some embodiments, the nucleic acid library molecule (100) further comprises: a first left unique identification sequence (180). In some embodiments, the nucleic acid library molecule (100) further comprises: a first right unique identification sequence (190).
  • the nucleic acid library molecule (100) further comprises any one or any combination of two or more of: (i) a second left universal adaptor sequence (1 0); (ii) a second right universal adaptor sequence (150); (iii) a first left index sequence (160); (iv) a first right index sequence (170); (v) a first left unique identification sequence (180); and/or (vi) a first right unique identification sequence (190).
  • the first left universal adaptor sequence (120) and/or the second left universal adaptor sequence (140) comprises: (i) a universal binding sequence for a forward sequencing primer; (ii) a universal binding sequence for a reverse sequencing primer; (iii) a universal binding sequence for an first surface primer; (iv) a universal binding sequence for an second surface primer; (v) a universal binding sequence for a forward amplification primer; (vi) a universal binding sequence for a reverse amplification primer; and/or (vii) a universal binding sequence for a compaction oligonucleotide.
  • the balanced diversity of step b) is 25-75% of each of the nucleo-bases A, G, C and T/U that are detected and imaged in each of the first, second and third sequencing cycles.
  • the method further comprises: d) sequencing the universal sample index sequence of the plurality of immobilized template molecules; e) sequencing the insert sequence region of the plurality of immobilized template molecules; and f) assigning the insert sequence of a given template molecule obtained in step (b) with the universal sample index sequence from the same given template molecule obtained in step (a), thereby identifying the sample source of the given insert sequence.
  • the plurality of nucleic acid template molecules further comprise a second sample index which comprises a second universal sample index sequence which identifies the sample source of the insert sequence and the second sample index lacks a random sequence.
  • the method further comprises: g) sequencing the 3-mer random sequence of the plurality of immobilized template molecules to obtain a balanced diversity of nucleo-bases of A, G, C and T/U that are detected and imaged in each of the first, second and third sequencing cycles to generate a map of the locations of the plurality of immobilized template molecules; h) sequencing the first universal sample index sequence of the plurality of immobilized template molecules; i) sequencing the second universal sample index sequence of the plurality of immobilized template molecules; j) sequencing the insert sequence region of the plurality of immobilized template molecules; and k) assigning the insert sequence of a given template molecule obtained in step (c) with the first and second universal sample index sequences from the same given template molecule obtained in steps (a) and (b), thereby identifying the sample source of the given insert sequence.
  • the disclosure provides a method for sequencing nucleic acid molecules, comprising: a) providing a plurality of nucleic acid template molecules immobilized at random locations on a support, wherein individual immobilized template molecules comprise an insert sequence region and one sample index, wherein each sample index comprises a 3- mer random sequence joined to a universal sample index sequence which identifies the sample source of the insert sequence, wherein the universal sample index sequence comprises 3-20 nucleotides, wherein different immobilized template molecules have a different 3-mer random sequence and the same universal sample index sequence, and wherein the immobilized template molecules have different insert sequences; b) conducting four cycles of polymerase-mediated sequencing reactions of the 3-mer random sequence and the first base position of the universal sample index sequence of the plurality of immobilized template molecules using a plurality of detectably labeled nucleotide reagents comprising a mixture of different types of nucleo-bases A, G, C and T/U, wherein the nucleotide reagents comprise a different
  • the method further comprises: a) sequencing the remaining base positions of the universal sample index sequence of the plurality of immobilized template molecules; b) sequencing the insert sequence region of the plurality of immobilized template molecules; and c) assigning the insert sequence of a given template molecule obtained in step (b) with the universal sample index sequence from the same given template molecule obtained in step (a), thereby identifying the sample source of the given insert sequence.
  • the plurality of nucleic acid template molecules further comprise a second sample index which comprises a second universal sample index sequence which identifies the sample source of the insert sequence and the second sample index lacks a random sequence.
  • the method further comprises: a) sequencing the 3-mer random sequence and the first base position of the universal sample index sequence of the plurality of immobilized template molecules to obtain a balanced diversity of nucleo-bases of A, G, C and T/U that are detected and imaged in each of the first, second, third and fourth sequencing cycles to generate a map of the locations of the plurality of immobilized template molecules; b) sequencing the remaining base positions of the first universal sample index sequence of the plurality of immobilized template molecules; c) sequencing the second universal sample index sequence of the plurality of immobilized template molecules; d) sequencing the insert sequence region of the plurality of immobilized template molecules; and e) assigning the insert sequence of a given template molecule obtained in step (c) with the first and second universal sample index sequences from the same given template molecule obtained in steps (a) and (b), thereby identifying the sample source of the given insert sequence.
  • the support comprises a glass or plastic substrate. In some embodiments, the support is configured on a flowcell channel, a flow cell, or a capillary lumen. In some embodiments, the support is passivated with at least one hydrophilic polymer coating having a water contact angle of not more than 45 degrees.
  • the at least one hydrophilic polymer coating comprises a molecule selected from a group consisting of polyethylene glycol (PEG), poly(vinyl alcohol) (PVA), poly(vinyl pyridine), poly(vinyl pyrrolidone) (PVP), poly(acrylic acid) (PAA), polyacrylamide, poly(N-isopropylacrylamide) (PNIPAM), poly(methyl methacrylate) (PMA), poly(2-hydroxylethyl methacrylate) (PHEMA), poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA), polyglutamic acid (PGA), poly-lysine, poly-glucoside, streptavidin, and dextran.
  • PEG polyethylene glycol
  • PVA poly(vinyl alcohol)
  • PVP poly(vinyl pyridine)
  • PVP poly(vinyl pyrrolidone)
  • PAA poly(acrylic acid)
  • PIPAM polyacrylamide
  • PMA poly(N-
  • the at least one hydrophilic polymer coating comprises branched hydrophilic polymer molecules having at least four branches. In some embodiments, the at least one hydrophilic polymer coating comprises polymer molecules having a molecular weight of at least 1000 Daltons.
  • the immobilized template molecules comprise a plurality of immobilized concatemer molecules having tandem repeat sequences of the insert sequence and the one sample index. In some embodiments, the immobilized template molecules comprise a plurality of different clustered template molecules having one copy of the insert sequence and one copy of the one sample index, wherein the clustered template molecules are generated via bridge amplification.
  • the density of the immobilized nucleic acid template molecules positioned at random locations on the support is 10 4 - 10 8 per mm 2 .
  • the sample source of the insert sequences is genomic DNA, double-stranded cDNA or cell free circulating DNA.
  • the detectably labeled nucleotide reagents comprise nucleotides each comprising an aromatic nucleo-base, a five carbon sugar moiety, 1-10 phosphate groups, and a fluorophore. In some embodiments, the detectably labeled nucleotide reagents comprise nucleotides each comprising an aromatic nucleo-base, a five carbon sugar moiety having a chain terminating group at the 3’ carbon sugar position, 1-10 phosphate groups, and a fluorophore.
  • the detectably labeled nucleotide reagents comprise multivalent molecules each comprising (1) a core, (2) a plurality of nucleotide arms, and (3) at least one fluorophore, wherein individual nucleotide arms comprise (i) a core attachment moiety, (ii) a spacer comprising a PEG moiety, (iii) a linker, and (iv) a nucleotide unit, wherein the core is attached to the plurality of nucleotide arms, wherein the spacer is attached to the linker, wherein the linker is attached to the nucleotide unit.
  • the detectably labeled nucleotide reagents that are bound to the immobilized template molecules comprise individual immobilized template molecules hybridized to a sequencing primer to form a duplex, and the duplex is bound to a polymerase to form a complexed polymerase, and the complexed polymerase is bound to a detectably labeled nucleotide reagent.
  • the complexed polymerase is bound to a detectably labeled nucleotide reagent under a condition suitable for binding the detectably labeled nucleotide reagent to the complexed polymerase and incorporating the detectably labeled nucleotide into the hybridized sequencing primer, wherein the detectably labeled nucleotide reagent comprises an aromatic nucleo-base, a five carbon sugar moiety, 1-10 phosphate groups, and a fluorophore.
  • the complexed polymerase is bound to a detectably labeled nucleotide reagent under a condition suitable for binding the detectably labeled nucleotide reagent to the complexed polymerase and incorporating the detectably labeled nucleotide into the hybridized sequencing primer, wherein the detectably labeled nucleotide reagent comprises an aromatic nucleo-base, a five carbon sugar moiety having a chain terminating group at the 3’ carbon sugar position, 1-10 phosphate groups, and a fluorophore.
  • the complexed polymerase is bound to a detectably labeled nucleotide reagent under a condition suitable for binding the detectably labeled nucleotide reagent to the complexed polymerase and the condition is suitable for inhibiting nucleotide incorporation
  • the detectably labeled nucleotide reagent comprises a multivalent molecule which includes (1) a core, (2) a plurality of nucleotide arms, and (3) at least one fluorophore, wherein individual nucleotide arms comprise (i) a core attachment moiety, (ii) a spacer comprising a PEG moiety, (iii) a linker, and (iv) a nucleotide unit, wherein the core is attached to the plurality of nucleotide arms, wherein the spacer is attached to the linker, wherein the linker is attached to the nucleotide unit.
  • the immobilized template molecule comprises an immobilized concatemer molecule which is hybridized to a plurality of sequencing primers to form at least a first and second duplex on the same concatemer molecule, wherein the first and duplex is bound to a first polymerase and the second duplex is bound to a second polymerase to form first and second complexed polymerases
  • the method comprises: a) contacting a plurality of multivalent molecules to the first and second complexed polymerases on the same concatemer template molecule, wherein individual multivalent molecules include (1) a core, (2) a plurality of nucleotide arms, and (3) at least one fluorophore, wherein individual nucleotide arms comprise (i) a core attachment moiety, (ii) a spacer comprising a PEG moiety, (iii) a linker, and (iv) a nucleotide unit, wherein the core is attached to the plurality of nucleotide
  • the disclosure provides a method for sequencing nucleic acid molecules, comprising: a) providing a first plurality of library molecules each molecule in the plurality comprising (i) an insert sequence region derived from a first sample source, (ii) a first sample index having a 3-mer random sequence joined to a first universal sample index sequence, and (iii) a second sample index having a second universal sample index sequence which lacks a random sequence, wherein the combination of the first and second universal sample index sequences uniquely identifies a first sample source of the insert sequence, wherein different first library molecules have a different 3-mer random sequence and have a different insert sequence; b) providing a second plurality of library molecules each molecule in the plurality comprising (i) an insert sequence region derived from a second sample source, (ii) a third sample index having a 3-mer random sequence joined to a third universal sample index sequence, and (iii) a fourth sample index having a fourth universal sample index sequence which lacks a random sequence, wherein the combination
  • the method further comprises: g) sequencing the first universal sample index sequences of the plurality of immobilized template molecules; h) sequencing the second universal sample index sequences of the plurality of immobilized template molecules; i) sequencing the insert sequence regions of the plurality of immobilized template molecules derived from the first library molecules; and j) assigning the insert sequence of a given template molecule obtained in step (c) with the first and second universal sample index sequences from the same given template molecule thereby identifying the first sample source of the given insert sequence.
  • the method further comprises: g) sequencing the third universal sample index sequences of the plurality of immobilized template molecules; h) sequencing the fourth universal sample index sequences of the plurality of immobilized template molecules; i) sequencing the insert sequence regions of the plurality of immobilized template molecules derived from the second library molecules; and j) assigning the insert sequence of a given template molecule obtained in step (c) with the third and fourth universal sample index sequences from the same given template molecule thereby identifying the second sample source of the given insert sequence.
  • the disclosure provides a method for sequencing nucleic acid molecules, comprising: a) providing a first plurality of library molecules each molecule in the plurality comprising (i) an insert sequence region derived from a first sample source, (ii) a first sample index having a 3-mer random sequence joined to a first universal sample index sequence, and (iii) a second sample index having a second universal sample index sequence which lacks a random sequence, wherein the combination of the first and second universal sample index sequences uniquely identifies a first sample source of the insert sequence, wherein the first universal sample index sequence comprises 3-20 nucleotides, wherein different first library molecules have a different 3-mer random sequence and have a different insert sequence; b) providing a second plurality of library molecules each molecule in the plurality comprising (i) an insert sequence region derived from a second sample source, (ii) a third sample index having a 3-mer random sequence joined to a third universal sample index sequence, and (iii) a fourth sample index having a
  • the method further comprises: g) sequencing the remaining base positions of the first universal sample index sequences of the plurality of immobilized template molecules; h) sequencing the second universal sample index sequences of the plurality of immobilized template molecules; i) sequencing the insert sequence regions of the plurality of immobilized template molecules derived from the first library molecules; and j) assigning the insert sequence of a given template molecule obtained in step (c) with the first and second universal sample index sequences from the same given template molecule thereby identifying the first sample source of the given insert sequence.
  • the method further comprises: g) sequencing the remaining base positions of the third universal sample index sequences of the plurality of immobilized template molecules; h) sequencing the fourth universal sample index sequences of the plurality of immobilized template molecules; i) sequencing the insert sequence regions of the plurality of immobilized template molecules derived from the second library molecules; and j) assigning the insert sequence of a given template molecule obtained in step (c) with the third and fourth universal sample index sequences from the same given template molecule thereby identifying the second sample source of the given insert sequence.
  • the method further comprises: a) sequencing the remaining base positions of the universal sample index sequence of the plurality of immobilized template molecules; b) sequencing the insert sequence region of the plurality of immobilized template molecules; and c) assigning the insert sequence of a given template molecule obtained in step (b) with the universal sample index sequence from the same given template molecule obtained in step (a), thereby identifying the sample source of the given insert sequence.
  • the plurality of nucleic acid template molecules further comprise a second sample index which comprises a second universal sample index sequence which identifies the sample source of the insert sequence and the second sample index lacks a random sequence.
  • the method further comprises: a) sequencing the 3-mer random sequence and the first base position of the universal sample index sequence of the plurality of immobilized template molecules to obtain a balanced diversity of nucleo-bases of A, G, C and T/U that are detected and imaged in each of the first, second, third and fourth sequencing cycles to generate a map of the locations of the plurality of immobilized template molecules; b) sequencing the remaining base positions of the first universal sample index sequence of the plurality of immobilized template molecules; c) sequencing the second universal sample index sequence of the plurality of immobilized template molecules; d) sequencing the insert sequence region of the plurality of immobilized template molecules; and e) assigning the insert sequence of a given template molecule obtained in step (c) with the first and second universal sample index sequences from the same given template molecule obtained in steps (a) and (b), thereby identifying the sample source of the given insert sequence.
  • the support comprises a glass or plastic substrate.
  • the support is configured on a flowcell channel, a flow cell, or a capillary lumen.
  • the support is passivated with at least one hydrophilic polymer coating having a water contact angle of not more than 45 degrees.
  • the at least one hydrophilic polymer coating comprises a molecule selected from a group consisting of polyethylene glycol (PEG), poly(vinyl alcohol) (PVA), poly(vinyl pyridine), poly(vinyl pyrrolidone) (PVP), poly(acrylic acid) (PAA), polyacrylamide, poly(N-isopropylacrylamide) (PNIPAM), poly(methyl methacrylate) (PMA), poly(2-hydroxylethyl methacrylate) (PHEMA), poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA), polyglutamic acid (PGA), poly-lysine, poly-glucoside, streptavidin, and dextran.
  • PEG polyethylene glycol
  • PVA poly(vinyl alcohol)
  • PVP poly(vinyl pyridine)
  • PVP poly(vinyl pyrrolidone)
  • PAA poly(acrylic acid)
  • PIPAM polyacrylamide
  • PMA poly(N-
  • the at least one hydrophilic polymer coating comprises branched hydrophilic polymer molecules having at least four branches. In some embodiments, the at least one hydrophilic polymer coating comprises polymer molecules having a molecular weight of at least 1000 Daltons.
  • the immobilized template molecules comprise a plurality of immobilized concatemer molecules having tandem repeat sequences of the insert sequence and the one sample index. In some embodiments, the immobilized template molecules comprise a plurality of different clustered template molecules having one copy of the insert sequence and one copy of the one sample index, wherein the clustered template molecules are generated via bridge amplification. [0052] In some embodiments, the density of the immobilized nucleic acid template molecules positioned at random locations on the support is 10 4 - 10 8 per mm 2 . In some embodiments, the sample source of the insert sequences is genomic DNA, double-stranded cDNA or cell free circulating DNA.
  • the detectably labeled nucleotide reagents comprise nucleotides each comprising an aromatic nucleo-base, a five carbon sugar moiety, 1-10 phosphate groups, and a fluorophore. In some embodiments, the detectably labeled nucleotide reagents comprise nucleotides each comprising an aromatic nucleo-base, a five carbon sugar moiety having a chain terminating group at the 3’ carbon sugar position, 1-10 phosphate groups, and a fluorophore.
  • the detectably labeled nucleotide reagents comprise multivalent molecules each comprising (1) a core, (2) a plurality of nucleotide arms, and (3) at least one fluorophore, wherein individual nucleotide arms comprise (i) a core attachment moiety, (ii) a spacer comprising a PEG moiety, (iii) a linker, and (iv) a nucleotide unit, wherein the core is attached to the plurality of nucleotide arms, wherein the spacer is attached to the linker, wherein the linker is attached to the nucleotide unit.
  • the detectably labeled nucleotide reagents that are bound to the immobilized template molecules comprise individual immobilized template molecules hybridized to a sequencing primer to form a duplex, and the duplex is bound to a polymerase to form a complexed polymerase, and the complexed polymerase is bound to a detectably labeled nucleotide reagent.
  • the complexed polymerase is bound to a detectably labeled nucleotide reagent under a condition suitable for binding the detectably labeled nucleotide reagent to the complexed polymerase and incorporating the detectably labeled nucleotide into the hybridized sequencing primer, wherein the detectably labeled nucleotide reagent comprises an aromatic nucleo-base, a five carbon sugar moiety, 1-10 phosphate groups, and a fluorophore.
  • the complexed polymerase is bound to a detectably labeled nucleotide reagent under a condition suitable for binding the detectably labeled nucleotide reagent to the complexed polymerase and incorporating the detectably labeled nucleotide into the hybridized sequencing primer, wherein the detectably labeled nucleotide reagent comprises an aromatic nucleo-base, a five carbon sugar moiety having a chain terminating group at the 3’ carbon sugar position, 1-10 phosphate groups, and a fluorophore.
  • the complexed polymerase is bound to a detectably labeled nucleotide reagent under a condition suitable for binding the detectably labeled nucleotide reagent to the complexed polymerase and the condition is suitable for inhibiting nucleotide incorporation
  • the detectably labeled nucleotide reagent comprises a multivalent molecule which includes (1) a core, (2) a plurality of nucleotide arms, and (3) at least one fluorophore, wherein individual nucleotide arms comprise (i) a core attachment moiety, (ii) a spacer comprising a PEG moiety, (iii) a linker, and (iv) a nucleotide unit, wherein the core is attached to the plurality of nucleotide arms, wherein the spacer is attached to the linker, wherein the linker is attached to the nucleotide unit.
  • the immobilized template molecule comprises an immobilized concatemer molecule which is hybridized to a plurality of sequencing primers to form at least a first and second duplex on the same concatemer molecule, wherein the first and duplex is bound to a first polymerase and the second duplex is bound to a second polymerase to form first and second complexed polymerases
  • the method comprises: a) contacting a plurality of multivalent molecules to the first and second complexed polymerases on the same concatemer template molecule, wherein individual multivalent molecules include (1) a core, (2) a plurality of nucleotide arms, and (3) at least one fluorophore, wherein individual nucleotide arms comprise (i) a core attachment moiety, (ii) a spacer comprising a PEG moiety, (iii) a linker, and (iv) a nucleotide unit, wherein the core is attached to the plurality of nucleotide
  • the disclosure provides a method for generating a plurality of library-splint complexes (300) comprising: a) providing a plurality of single-stranded nucleic acid library molecules (100) wherein individual library molecules in the plurality comprise regions arranged in a 5’ to 3’ order: (i) a first left universal adaptor sequence (120) having a binding sequence for a second surface primer; (ii) a second left universal adaptor sequence (140) having a binding sequence for a first sequencing primer; (iii) a sequence of interest (110); (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer; and (v) a first right universal adaptor sequence (130) having a binding sequence for a first surface primer; b) providing a plurality of single-stranded splint strands (200) wherein individual single-stranded splint strands (200) in the plurality comprise regions arranged in a 5’ to 3
  • the plurality of single-stranded nucleic acid library molecules (100) further comprise a first left index sequence (160) and/or a first right index sequence (170). In some embodiments, the plurality of single-stranded nucleic acid library molecules (100) further comprise a first left unique identification sequence (180) and/or a first right unique identification sequence (190).
  • the method further comprises: d) ligating the nicks in the individual library-splint complexes (300) thereby generating a plurality of covalently closed circular library molecules (400).
  • the method further comprises: e) contacting the plurality of covalently closed circular library molecules (400) with at least one exonuclease enzyme to remove the plurality of single-stranded splint strands (200) and retaining the plurality of covalently closed circular library molecules (400).
  • the individual covalently closed circular library molecules (400) in the plurality comprise a first right universal adaptor sequence (130) having a binding sequence for a first surface primer
  • the method further comprises: f) distributing the plurality of covalently closed circular library molecules (400) onto a support having a plurality of said first surface primers immobilized on the support, under a condition suitable for hybridizing individual covalently closed circular library molecules (400) to individual immobilized second surface primers thereby immobilizing the plurality of covalently closed circular library molecules (400) to the support.
  • the method further comprises: g) contacting the plurality of immobilized covalently closed circular library molecules (400) with a plurality of stranddisplacing polymerases and a plurality of nucleotides, under a condition suitable to conduct a rolling circle amplification reaction on the support using the plurality of first surface primers as immobilized amplification primers and the plurality of covalently closed circular library molecules (400) as template molecules, thereby generating a plurality of immobilized nucleic acid concatemer molecules.
  • the plurality of nucleotides comprises dATP, dGTP, dCTP, dTTP and/or dUTP.
  • the plurality of immobilized first surface capture primers on the support are located at pre-determined or random locations on the support.
  • the plurality of immobilized second surface capture primers on the support are in fluid communication with each to permit flowing a solution of reagents (e.g., enzymes, nucleotides, divalent cations, and the like) onto the support so that the plurality of immobilized first surface primers can be essentially simultaneously reacted with the reagents in a massively parallel manner.
  • the density of the plurality of immobilized nucleic acid concatemer molecules on the support is 10 4 - 10 8 per mm 2 .
  • the method further comprises: a) sequencing the plurality of immobilized concatemers, wherein the sequencing comprises: b) contacting the plurality of immobilized concatemer molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of the soluble sequencing primers, wherein the contacting is conducted under a condition suitable to form a plurality of complexed polymerases each comprising a sequencing polymerase bound to a nucleic acid duplex wherein the nucleic acid duplex comprises a concatemer molecule hybridized to a soluble sequencing primer; c) contacting the plurality of complexed sequencing polymerases with a plurality of nucleotides under a condition suitable for binding at least one nucleotide to a complexed sequencing polymerase, wherein the plurality of nucleotides comprises at least one nucleotide analog labeled with a fluorophore and having a removable chain terminating moiety at the sugar 3’
  • the plurality of nucleotides comprise a removable chain terminating moiety at the 3’ sugar group, wherein the removable chain terminating moiety comprises an alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, azido group, O-azidomethyl group, amine group, amide group, keto group, isocyanate group, phosphate group, thio group, disulfide group, carbonate group, urea group, or silyl group, and wherein the removable chain terminating moiety is cleavable with a chemical compound to generate an extendible 3 ’OH moiety on the sugar group.
  • the removable chain terminating moiety comprises an alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, azido group, O-azidomethyl group, amine group, amide group, keto group, isocyanate group,
  • the plurality of nucleotides comprise one type of nucleotide selected from a group consisting of dATP, dGTP, dCTP, dTTP and dUTP. In some embodiments, the plurality of nucleotides comprise a mixture of any combination of two or more types of nucleotides selected from a group consisting of dATP, dGTP, dCTP, dTTP and/or dUTP.
  • the method further comprises: sequencing the plurality of immobilized concatemers, wherein the sequencing comprises: a) contacting the plurality of immobilized concatemer molecules with (i) a plurality of sequencing polymerases and (ii) a plurality of the soluble universal sequencing primers, wherein the contacting is conducted under a condition suitable to form a plurality of first complexed polymerases each comprising a sequencing polymerase bound to a nucleic acid duplex wherein the nucleic acid duplex comprises a concatemer molecule hybridized to a soluble sequencing primer; b) contacting the plurality of complexed sequencing polymerases with a plurality of detectably labeled multivalent molecules to form a plurality of multivalent-complexed polymerases, under a condition suitable for binding complementary nucleotide units of the multivalent molecules to at least two of the plurality of first complexed polymerases thereby forming a plurality of multivalent-complexed
  • the method further comprises: e) dissociating the plurality of multivalent-complexed polymerases and removing the plurality of first sequencing polymerases and their bound multivalent molecules, and retaining the plurality of nucleic acid duplexes; f) contacting the plurality of the retained nucleic acid duplexes of step (e) with a plurality of second sequencing polymerases, wherein the contacting is conducted under a condition suitable for binding the plurality of second sequencing polymerases to the plurality of the retained nucleic acid duplexes, thereby forming a plurality of second complexed polymerases each comprising a second sequencing polymerase bound to a retained nucleic acid duplex; g) contacting the plurality of second complexed polymerases with a plurality of nucleotides comprising at least one nucleotide analog having a removable chain terminating moiety at the sugar 3’ position, wherein the contacting is conducted under a condition suitable for
  • the method further comprises: h) detecting the complementary nucleotides which are incorporated into the sequencing primers of the nucleotide-complexed polymerases. In some embodiments, the method further comprises: h) detecting the complementary nucleotides which are incorporated into the sequencing primers of the nucleotide-complexed polymerases; and i) identifying the nucleo-bases of the complementary nucleotides which are incorporated into the sequencing primers of the nucleotide-complexed polymerases.
  • the disclosure provides a method for sequencing by forming at least one avidity complex, comprising: a) binding a first universal sequencing primer, a first sequencing polymerase, and a first detectably labeled multivalent molecule to a first portion of a concatemer molecule of claim 16, thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule binds to the first sequencing polymerase; b) binding a second universal sequencing primer, a second sequencing polymerase, and the first detectably labeled multivalent molecule to a second portion of the same concatemer molecule thereby forming a second binding complex, wherein a second nucleotide unit of the first multivalent molecule binds to the second sequencing polymerase, wherein the first and second binding complexes which include the same multivalent molecule forms an avidity complex, wherein the first detectably labeled multivalent molecule comprises a core attached to multiple nucleotide arms and each nucleotide arm is attached
  • the plurality of nucleotide arms attached to the core of the individual multivalent molecules have the same type of a nucleotide unit, and wherein the types of nucleotide unit is selected from a group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
  • the plurality of multivalent molecules comprise a mixture of any combination of two or more types of multivalent molecules each type having nucleotide units selected from a group consisting of dATP, dGTP, dCTP, dTTP and/or dUTP.
  • the plurality of nucleotides comprise a removable chain terminating moiety at the 3’ sugar group, wherein the removable chain terminating moiety comprises an alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, azido group, O-azidomethyl group, amine group, amide group, keto group, isocyanate group, phosphate group, thio group, disulfide group, carbonate group, urea group, or silyl group, and wherein the removable chain terminating moiety is cleavable with a chemical compound to generate an extendible 3 ’OH moiety on the sugar group.
  • the removable chain terminating moiety comprises an alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, azido group, O-azidomethyl group, amine group, amide group, keto group, isocyanate group,
  • the plurality of nucleotides comprise one type of nucleotide selected from a group consisting of dATP, dGTP, dCTP, dTTP and dUTP. In some embodiments, the plurality of nucleotides comprise a mixture of any combination of two or more types of nucleotides selected from a group consisting of dATP, dGTP, dCTP, dTTP and/or dUTP.
  • the support comprises a glass or plastic substrate. In some embodiments, the support is passivated with at least one hydrophilic polymer coating having a water contact angle of no more than 45 degrees.
  • the at least one hydrophilic polymer coating comprises a molecule selected from a group consisting of polyethylene glycol (PEG), poly(vinyl alcohol) (PVA), poly(vinyl pyridine), poly(vinyl pyrrolidone) (PVP), poly(acrylic acid) (PAA), polyacrylamide, poly(N-isopropylacrylamide) (PNIPAM), poly(methyl methacrylate) (PMA), poly(2-hydroxylethyl methacrylate) (PHEMA), poly(oligo(ethylene glycol) methyl ether methacrylate) (POEGMA), polyglutamic acid (PGA), poly-lysine, poly-glucoside, streptavidin, and dextran.
  • PEG polyethylene glycol
  • PVA poly(vinyl alcohol)
  • PVP poly(vinyl pyridine)
  • PVP poly(vinyl pyrrolidone)
  • PAA poly(acrylic acid)
  • PIPAM polyacrylamide
  • PMA poly(N-
  • FIG. 1 is a schematic showing an exemplary linear single stranded library molecule (100) hybridizing with a single-stranded splint molecule/ strand (200) thereby circularizing the library molecule to form a library-splint complex (300) with a nick.
  • the library molecule (100) comprises a sequence of interest (110) flanked on one side by a first left universal adaptor sequence (120) and flanked on the other side by a first right universal adaptor sequence (130).
  • the single-stranded splint strand (200) comprises a first region (210) that hybridizes with a sequence on one end of the linear single stranded library molecule, and a second region (220) that hybridizes with a sequence on the other end of the linear single stranded library molecule.
  • FIG. 2 is a schematic showing an exemplary linear single stranded library molecule (100) hybridizing with a single-stranded splint molecule/ strand (200) thereby circularizing the library molecule to form a library-splint complex (300) with a nick.
  • the library molecule (100) comprises a sequence of interest (110) flanked on one side by a first left universal adaptor sequence (120) and a second left universal adaptor sequence (140), and flanked on the other side by a second right universal adaptor sequence (150) and a first right universal adaptor sequence (130).
  • the single-stranded splint strand (200) comprises a first region (210) that hybridizes with a sequence on one end of the linear single stranded library molecule, and a second region (220) that hybridizes with a sequence on the other end of the linear single stranded library molecule.
  • FIG. 3 is a schematic showing an exemplary linear single stranded library molecule (100) hybridizing with a single-stranded splint molecule/ strand (200) thereby circularizing the library molecule to form a library-splint complex (300) with a nick.
  • the exemplary library molecule (100) comprises: a first left universal adaptor sequence (120); an optional first left unique identification sequence (180); a first left index sequence (160); a second left universal adaptor sequence (1 0); a sequence of interest (110); a second right universal adaptor sequence (150); a first right index sequence (170); and a first right universal adaptor sequence (130).
  • the single-stranded splint strand (200) comprises a first region (210) that hybridizes with a sequence on one end of the linear single stranded library molecule, and a second region (220) that hybridizes with a sequence on the other end of the linear single stranded library molecule.
  • FIG. 4 is a schematic showing an exemplary linear single stranded library molecule (100) hybridizing with a single-stranded splint molecule/ strand (200) thereby circularizing the library molecule to form a library-splint complex (300) with a nick.
  • the exemplary library molecule (100) comprises: a first left universal adaptor sequence (120); a first left index sequence (160); a second left universal adaptor sequence (140); a sequence of interest (110); a second right universal adaptor sequence (150); a first right index sequence (170); an optional first right unique identification sequence (190); and a first right universal adaptor sequence (130).
  • the single-stranded splint strand (200) comprises a first region (210) that hybridizes with a sequence on one end of the linear single stranded library molecule, and a second region (220) that hybridizes with a sequence on the other end of the linear single stranded library molecule.
  • FIG. 5 is a schematic showing an exemplary linear single stranded library molecule (100) hybridizing with a single-stranded splint molecule/ strand (200) thereby circularizing the library molecule to form a library-splint complex (300) with a nick.
  • the library molecule (100) comprises: a first left universal adaptor sequence (120); a first left junction adaptor sequence (125); a first left index sequence (160); a second left junction adaptor sequence (165); a second left universal adaptor sequence (140); a third left junction adaptor sequence (145); a sequence of interest (110); a third right junction adaptor sequence (155); a second right universal adaptor sequence (150); a second right junction adaptor sequence (175); a first right index sequence (170); a first right junction adaptor sequence (135); an optional first right unique identification sequence (190); and a first right universal adaptor sequence (130).
  • the single-stranded splint strand (200) comprises a first region (210) that hybridizes with a sequence on one end of the linear single stranded library molecule, and a second region (220) that hybridizes with a sequence on the other end of the linear single stranded library molecule.
  • the library-splint complex (300) does not show any of the junction adaptors.
  • the library-splint complex (300) can include any one or any combination of two or more of the junction adaptors that are present in the library molecule (100).
  • FIG. 6 shows three schematics of exemplary covalently closed circular library molecules, each hybridized to a single-stranded splint strand (200).
  • the top schematic (A) shows a covalently closed circular library molecule (400) having a sequence of interest (110), a first right universal adaptor sequence (130), and a first left universal adaptor sequence (120).
  • the middle schematic (B) shows a covalently closed circular library molecule (400) having a sequence of interest (110), a second right universal adaptor sequence (150), a first right universal adaptor sequence (130), a first left universal adaptor sequence (120), and a second left universal adaptor sequence (140).
  • the bottom schematic (C) shows a covalently closed circular library molecule (400) having a sequence of interest (110), a second right universal adaptor sequence (150), a first right index sequence (170), a first right universal adaptor sequence (130), a first left universal adaptor sequence (120), an optional first left unique identification sequence (180), a first left index sequence (160) and a second left universal adaptor sequence (140).
  • FIG. 7 is a schematic showing an exemplary library-splint complex undergoing a ligation reaction to close the nick to form a covalently closed circular library molecule (400) which is hybridized to a single-stranded splint strand (200), where the single-stranded splint strand (200) is used as an amplification primer to conduct a rolling circle amplification reaction.
  • the dotted line represents the nascent extension product.
  • FIG. 8 shows the nucleotide sequences of an exemplary single-stranded splint molecule/strand (200).
  • the exemplary single-stranded splint strand comprises a first region (210; SEQ ID NO: 193), a second region (220; SEQ ID NO: 194).
  • FIG. 9A-9F is Table 1 (6 sheets) which lists the sequences of exemplary first left index sequences (160), and first right index sequences (170) having a short random sequence (e.g., NNN).
  • FIG. 10 is a schematic of exemplary Y-shaped adaptors each having a doublestranded annealed region which includes a terminal end that is blunt-ended, or the terminal end can have a 5’ or 3’ overhang region.
  • FIG. 10 also shows an exemplary Y-shaped adaptor having a mismatched portion with different lengths.
  • FIG. 11 is a schematic exemplary Y-shaped adaptors having a first strand comprising a binding sequence for a first sequencing primer and a binding sequence for a first surface primer.
  • FIG. 11 also shows exemplary Y-shape adaptors having a second strand comprising a binding sequence for a second sequencing primer and a binding sequence for a second surface primer.
  • the first strand optionally includes a first sample index sequence.
  • the second strand optionally includes a second sample index sequence.
  • FIG. 12 is a schematic is a schematic exemplary Y-shaped adaptors having a first strand comprising a binding sequence for a first sequencing primer and a binding sequence for a first surface primer.
  • FIG. 12 also shows exemplary Y-shape adaptors having a second strand comprising a binding sequence for a second sequencing primer and a binding sequence for a second surface primer.
  • the first strand optionally includes a first sample index sequence with a short random sequence (e.g., NNN).
  • the second strand optionally includes a second sample index sequence with a short random sequence (e.g., NNN).
  • FIG. 13 is a schematic showing an exemplary library preparation workflow in which a nucleic acid fragment is ligated at both ends to Y-shaped adaptors.
  • the Y-shaped adaptors include a first strand comprising a binding sequence for a first sequencing primer, a first sample index sequence, and a binding sequence for a first surface primer.
  • the Y-shape adaptors include a second strand comprising a binding sequence for a second sequencing primer, a second sample index sequence, and a binding sequence for a second surface primer.
  • FIG. 14 is a schematic showing an exemplary library preparation workflow in which a nucleic acid fragment is ligated at both ends to Y-shaped adaptors.
  • the Y-shaped adaptors include a first strand comprising a binding sequence for a first sequencing primer, a first sample index sequence with a short random sequence (e.g., NNN), and a binding sequence for a first surface primer.
  • the Y-shape adaptors include a second strand comprising a binding sequence for a second sequencing primer, a second sample index sequence, and a binding sequence for a second surface primer.
  • FIG. 15 is a schematic showing an exemplary library preparation workflow in which a nucleic acid fragment is ligated at both ends to Y-shaped adaptors to generate an adaptor-insert-adaptor molecule.
  • the Y-shaped adaptors include a first strand comprising a binding sequence for a first sequencing primer.
  • the Y-shape adaptors include a second strand comprising a binding sequence for a second sequencing primer.
  • the adaptor-insert-adaptor molecule is subjected to a first primer extension reaction using a first tailed PCR primer carrying a binding sequence for a first surface primer to generate a first extension product.
  • the first extension product is subjected to a second primer extension reaction using a second tailed PCR primer carrying a binding sequence for a second surface primer to generate a second extension product.
  • FIG. 16 is a schematic showing an exemplary library preparation workflow in which a nucleic acid fragment is ligated at both ends to Y-shaped adaptors to generate an adaptor-insert-adaptor molecule.
  • the Y-shaped adaptors include a first strand comprising a binding sequence for a first sequencing primer.
  • the Y-shape adaptors include a second strand comprising a binding sequence for a second sequencing primer.
  • the adaptor-insert-adaptor molecule is subjected to a first primer extension reaction using a first tailed PCR primer carrying a binding sequence for a first surface primer, a first sample index sequence, and a binding sequence for a first surface primer, to generate a first extension product.
  • the first extension product is subjected to a second primer extension reaction using a second tailed PCR primer carrying a binding sequence for a second surface primer, a second sample index sequence, and a binding sequence for a second surface primer, to generate a second extension product.
  • FIG. 17 is a schematic showing an exemplary library preparation workflow in which a nucleic acid fragment is ligated at both ends to Y-shaped adaptors to generate an adaptor-insert-adaptor molecule.
  • the Y-shaped adaptors include a first strand comprising a binding sequence for a first sequencing primer.
  • the Y-shape adaptors include a second strand comprising a binding sequence for a second sequencing primer.
  • the adaptor-insert-adaptor molecule is subjected to a first primer extension reaction using a first tailed PCR primer carrying a binding sequence for a first surface primer, a first sample index sequence having a short random sequence (e.g., NNN), and a binding sequence for a first surface primer, to generate a first extension product.
  • the first extension product is subjected to a second primer extension reaction using a second tailed PCR primer carrying a binding sequence for a second surface primer, a second sample index sequence, and a binding sequence for a second surface primer, to generate a second extension product.
  • FIG. 18 is a schematic of an exemplary low binding support comprising a glass substrate and alternating layers of hydrophilic coatings which are covalently or non- covalently adhered to the glass, and which further comprises chemically-reactive functional groups that serve as attachment sites for oligonucleotide primers (e.g., capture oligonucleotides).
  • the support can be made of any material such as glass, plastic or a polymer material.
  • FIG. 19 is a schematic of various exemplary configurations of multivalent molecules.
  • Left (Class I) schematics of multivalent molecules having a “starbursf ’ or “helter-skelter” configuration.
  • Center (Class II) a schematic of a multivalent molecule having a dendrimer configuration.
  • Right (Class III) a schematic of multiple multivalent molecules formed by reacting streptavidin with 4-arm or 8-arm PEG-NHS with biotin and dNTPs. Nucleotide units are designated ‘N’, biotin is designated ‘B’, and streptavidin is designated ‘ SA’ .
  • FIG. 20 is a schematic of an exemplary multivalent molecule comprising a generic core attached to a plurality of nucleotide-arms.
  • FIG. 21 is a schematic of an exemplary multivalent molecule comprising a dendrimer core attached to a plurality of nucleotide-arms.
  • FIG. 23 is a schematic of an exemplary nucleotide-arm comprising a core attachment moiety, spacer, linker and nucleotide unit.
  • FIG. 24 shows the chemical structure of an exemplary spacer (top), and the chemical structures of various exemplary linkers, including an 11 -atom Linker, 16-atom Linker, 23-atom Linker and an N3 Linker (bottom).
  • FIG. 25 shows the chemical structures of various exemplary linkers, including Linkers 1-9.
  • FIG. 26 shows the chemical structures of various exemplary linkers joined/attached to nucleotide units.
  • FIG. 27 shows the chemical structures of various exemplary linkers joined/attached to nucleotide units.
  • FIG. 28 shows the chemical structures of various exemplary linkers joined/ attached to nucleotide units.
  • FIG. 29 shows the chemical structures of various exemplary linkers joined/ attached to nucleotide units.
  • FIG. 30 shows the chemical structure of an exemplary biotinylated nucleotide-arm.
  • the nucleotide unit is connected to the linker via a propargyl amine attachment at the 5 position of a pyrimidine base or the 7 position of a purine base.
  • FIG. 31 is a graph showing the nucleotide base diversity of a right sample index sequence (170) including universal right sample index and the 3-mer random sequence (NNN). The graph shows a nucleotide diversity of the 3-mer random sequence (NNN) of approximately 30% for A and T base calls, and approximately 20% for C and G base calls.
  • FIG. 32 is a graph showing the nucleotide base diversity of a left sample index sequence (160) which lacks a 3-mer random sequence (NNN). The graph shows a nucleotide diversity of approximately 40% for A and T base calls, approximately 15% for C base calls, and approximately 5% for G base calls.
  • the term “and/or” as used in a phrase such as “A, B, and/or C” is intended to encompass each of the following aspects: “A, B, and C”; “A, B, or C”; “A or C”; “A or B”; “B or C”; “A and B”; “B and C”; “A and C”; “A” (A alone); “B” (B alone); and “C” (C alone).
  • the terms “about” and “approximately” refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined, i.e., the limitations of the measurement system.
  • “about” or “approximately” can mean within one or more than one standard deviation per the practice in the art.
  • “about” or “approximately” can mean a range of up to 10% (i.e., ⁇ 10%) or more depending on the limitations of the measurement system.
  • about 5 mg can include any number between 4.5 mg and 5.5 mg.
  • the terms can mean up to an order of magnitude or up to 5-fold of a value.
  • the meaning of “about” or “approximately” should be assumed to be within an acceptable error range for that particular value or composition.
  • the ranges and/or subranges can include the endpoints of the ranges and/or subranges.
  • polypeptide and “protein” and other related terms used herein are used interchangeably and refer to a polymer of amino acids and are not limited to any particular length. Polypeptides may comprise natural and non-natural amino acids. Polypeptides include recombinant or chemically-synthesized forms. Polypeptides also include precursor molecules that have not yet been subjected to post-translation modification such as proteolytic cleavage, cleavage due to ribosomal skipping, hydroxylation, methylation, lipidation, acetylation, SUMOylation, ubiquitination, glycosylation, phosphorylation and/or disulfide bond formation.
  • post-translation modification such as proteolytic cleavage, cleavage due to ribosomal skipping, hydroxylation, methylation, lipidation, acetylation, SUMOylation, ubiquitination, glycosylation, phosphorylation and/or disulfide bond formation.
  • proteins encompass native and artificial proteins, protein fragments and polypeptide analogs (such as muteins, variants, chimeric proteins and fusion proteins) of a protein sequence as well as post-translationally, or otherwise covalently or non- covalently, modified proteins.
  • the term “cellular biological sample” refers to a single cell, a plurality of cells, a tissue, an organ, an organism, or section of any of these cellular biological samples.
  • the cellular biological sample can be extracted (e.g., biopsied) from an organism, or obtained from a cell culture grown in liquid or in a culture dish.
  • the cellular biological sample comprises a sample that is fresh, frozen, fresh frozen, or archived (e.g., formalin-fixed paraffin-embedded; FFPE).
  • the cellular biological sample can be embedded in a wax, resin, epoxy or agar.
  • the cellular biological sample can be fixed, for example in any one or any combination of two or more of acetone, ethanol, methanol, formaldehyde, paraformaldehyde- Triton or glutaraldehyde.
  • the cellul r biological sample can be sectioned or non-sectioned.
  • the cellular biological sample can be stained, de-stained or non-stained.
  • the nucleic acids of interest can be extracted from cells or cellular biological samples using any of a number of techniques known to those of skill in the art.
  • a typical DNA extraction procedure comprises (i) collection of the cell sample or tissue sample from which DNA is to be extracted, (ii) disruption of cell membranes (i.e., cell lysis) to release DNA and other cytoplasmic components, (iii) treatment of the lysed sample with a concentrated salt solution to precipitate proteins, lipids, and RNA, followed by centrifugation to separate out the precipitated proteins, lipids, and RNA, and (iv) purification of DNA from the supernatant to remove detergents, proteins, salts, or other reagents used during the cell membrane lysis.
  • a variety of suitable commercial nucleic acid extraction and purification kits are consistent with the disclosure herein. Examples include, but are not limited to, the QIAamp kits (for isolation of genomic DNA from human samples) and DNAeasy kits (for isolation of genomic DNA from animal or plant samples) from Qiagen (Germantown, MD), or the Maxwell® and ReliaPrepTM series of kits from Promega (Madison, WI).
  • polymerase and its variants, as used herein, comprises an enzyme comprising a domain that binds a nucleotide (or nucleoside) where the polymerase can form a complex having a template nucleic acid and a complementary nucleotide.
  • the polymerase can have one or more activities including, but not limited to, base analog detection activities, DNA polymerization activity, reverse transcriptase activity, DNA binding, strand displacement activity, and nucleotide binding and recognition.
  • a polymerase can be any enzyme that can catalyze polymerization of nucleotides (including analogs thereof) into a nucleic acid strand. Typically but not necessarily such nucleotide polymerization can occur in a template-dependent fashion.
  • a polymerase comprises one or more active sites at which nucleotide binding and/or catalysis of nucleotide polymerization can occur.
  • a polymerase includes other enzymatic activities, such as for example, 3' to 5' exonuclease activity or 5' to 3' exonuclease activity.
  • a polymerase has strand displacing activity.
  • a polymerase can include without limitation naturally occurring polymerases and any subunits and truncations thereof, mutant polymerases, variant polymerases, recombinant, fusion or otherwise engineered polymerases, chemically modified polymerases, synthetic molecules or assemblies, and any analogs, derivatives or fragments thereof that retain the ability to catalyze nucleotide polymerization (e.g., catalytically active fragment).
  • the polymerase includes catalytically inactive polymerases, catalytically active polymerases, reverse transcriptases, and other enzymes comprising a nucleotide binding domain.
  • a polymerase can be isolated from a cell, or generated using recombinant DNA technology or chemical synthesis methods.
  • a polymerase can be expressed in prokaryote, eukaryote, viral, or phage organisms. In some embodiments, a polymerase can be post-translationally modified proteins or fragments thereof. A polymerase can be derived from a prokaryote, eukaryote, virus or phage. A polymerase comprises DNA-directed DNA polymerase and RNA-directed DNA polymerase. [0119] The term “strand displacing” refers to the ability of a polymerase to locally separate strands of double-stranded nucleic acids and synthesize a new strand in a template-based manner.
  • Strand displacing polymerases displace a complementary strand from a template strand and catalyze new strand synthesis.
  • Strand displacing polymerases include mesophilic and thermophilic polymerases.
  • Strand displacing polymerases include wild type enzymes, and variants including exonuclease minus mutants, mutant versions, chimeric enzymes and truncated enzymes. Examples of strand displacing polymerases include phi29 DNA polymerase, large fragment of Bst DNA polymerase, large fragment of Bsu DNA polymerase (exo-), Bea DNA polymerase (exo-), KI enow fragment of E.
  • the phi29 DNA polymerase can be wild type phi29 DNA polymerase (e.g., MagniPhi from Expedeon), or variant EquiPhi29 DNA polymerase (e.g., from Thermo Fisher Scientific), or chimeric QualiPhi DNA polymerase (e.g., from 4basebio).
  • wild type phi29 DNA polymerase e.g., MagniPhi from Expedeon
  • variant EquiPhi29 DNA polymerase e.g., from Thermo Fisher Scientific
  • chimeric QualiPhi DNA polymerase e.g., from 4basebio
  • nucleic acid refers to polymers of nucleotides and are not limited to any particular length.
  • Nucleic acids include recombinant and chemically- synthesized forms. Nucleic acids can be isolated. Nucleic acids include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), analogs of the DNA or RNA generated using nucleotide analogs (e.g., peptide nucleic acids and non-naturally occurring nucleotide analogs), and chimeric forms containing DNA and RNA.
  • Nucleic acids can be single-stranded or double-stranded. Nucleic acids comprise polymers of nucleotides, where the nucleotides include natural or non-natural bases and/or sugars. Nucleic acids comprise naturally-occurring internucleosidic linkages, for example phosphdiester linkages. Nucleic acids comprise non-natural internucleoside linkages, including phosphorothioate, phosphorothiolate, or peptide nucleic acid (PNA) linkages. In some embodiments, nucleic acids comprise a one type of polynucleotides or a mixture of two or more different types of polynucleotides.
  • operably linked and “operably joined” or related terms as used herein refers to juxtaposition of components.
  • the juxtapositioned components can be linked together covalently.
  • two nucleic acid components can be enzymatically ligated together where the linkage that joins together the two components comprises phosphodiester linkage.
  • a first and second nucleic acid component can be linked together, where the first nucleic acid component can confer a function on a second nucleic acid component.
  • linkage between a primer binding sequence and a sequence of interest forms a nucleic acid library molecule having a portion that can bind to a primer.
  • a transgene e.g., a nucleic acid encoding a polypeptide or a nucleic acid sequence of interest
  • a transgene can be ligated to a vector where the linkage permits expression or functioning of the transgene sequence contained in the vector.
  • a transgene is operably linked to a host cell regulatory sequence (e.g., a promoter sequence) that affects expression of the transgene.
  • the vector comprises at least one host cell regulatory sequence, including a promoter sequence, enhancer, transcription and/or translation initiation sequence, transcription and/or translation termination sequence, polypeptide secretion signal sequences, and the like.
  • the host cell regulatory sequence controls expression of the level, timing and/or location of the transgene.
  • the terms “linked”, “joined”, “attached”, “appended” and variants thereof comprise any type of fusion, bond, adherence or association between any combination of compounds or molecules that is of sufficient stability to withstand use in the particular procedure.
  • the procedure can include but are not limited to: nucleotide binding; nucleotide incorporation; deblocking (e.g., removal of chain-terminating moiety); washing; removing; flowing; detecting; imaging and/or identifying.
  • Such linkage can comprise, for example, covalent, ionic, hydrogen, dipole-dipole, hydrophilic, hydrophobic, or affinity bonding, bonds or associations involving van der Waals forces, mechanical bonding, and the like.
  • such linkage occurs intramolecularly, for example linking together the ends of a singlestranded or double-stranded linear nucleic acid molecule to form a circular molecule.
  • such linkage can occur between a combination of different molecules, or between a molecule and a non-molecule, including but not limited to: linkage between a nucleic acid molecule and a solid surface; linkage between a protein and a detectable reporter moiety; linkage between a nucleotide and detectable reporter moiety; and the like.
  • linkages can be found, for example, in Hermanson, G., “Bioconjugate Techniques”, Second Edition (2008); Aslam, M., Dent, A., “Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences”, London: Macmillan (1998); Aslam, M., Dent, A., “Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences”, London: Macmillan (1998).
  • primer refers to an oligonucleotide that is capable of hybridizing with a DNA and/or RNA polynucleotide template to form a duplex molecule.
  • Primers can be single-stranded along their entire length or have single-stranded and double-stranded portions. Primers comprise natural nucleotides and/or nucleotide analogs. Primers can be recombinant nucleic acid molecules. Primers may have any length, but typically range from 4-50 nucleotides. A typical primer comprises a 5’ end and 3’ end.
  • adaptor refers to oligonucleotides that can be operably linked (appended) to a target polynucleotide, where the adaptor confers a function to the cojoined adaptor-target molecule.
  • Adaptors comprise DNA, RNA, chimeric DNA/RNA, or analogs thereof.
  • Adaptors can include at least one ribonucleoside residue.
  • Adaptors can be single-stranded, double-stranded, or have single-stranded and/or double-stranded portions.
  • Adaptors can be configured to be linear, stem-looped, hairpin, or Y-shaped forms. Adaptors can be any length, including 4-100 nucleotides or longer.
  • Adaptors can include at least one unique identification sequence (e.g., a molecular tag) that can be used to uniquely identify a nucleic acid molecule to which the adaptor is appended.
  • the unique identification sequence comprises 2-12 or more nucleotides having a known sequence.
  • the unique identification sequence comprises a known random sequence where a nucleotide at each position is randomly selected from nucleotides having a base A, G, C, T or U.
  • Adaptors can include at least one restriction enzyme recognition sequence, including any one or any combination of two or more selected from a group consisting of type I, type II, type III, type IV, type Hs or type IIB.
  • universal sequence refers to a sequence in a nucleic acid molecule that is common among two or more polynucleotide molecules.
  • an adaptor having a universal sequence can be operably joined to a plurality of polynucleotides so that the population of co-joined molecules carry the same universal adaptor sequence.
  • Examples of universal adaptor sequences include an amplification primer sequence, a sequencing primer sequence or a capture primer sequence (e.g., soluble or immobilized capture primers).
  • nucleic acid incorporation comprises polymerization of one or more nucleotides into the terminal 3’ OH end of a nucleic acid strand, resulting in extension of the nucleic acid strand. Nucleotide incorporation can be conducted with natural nucleotides and/or nucleotide analogs. Typically, but not necessarily, nucleotide incorporation occurs in a template-dependent fashion.
  • nucleotides refers to a molecule comprising an aromatic base, a five carbon sugar (e.g., ribose or deoxyribose), and at least one phosphate group. Canonical or non-canonical nucleotides are consistent with use of the term.
  • the nucleotide comprises a monophosphate, diphosphate, or triphosphate, or corresponding phosphate analog.
  • nucleoside refers to a molecule comprising an aromatic base and a sugar. Nucleotides and nucleosides can be non-labeled or labeled with a detectable reporter moiety.
  • Exemplary bases include, but are not limited to, purines and pyrimidines such as: 2-aminopurine, 2,6-diaminopurine, adenine (A), ethenoadenine, N 6 -A 2 - isopentenyladenine (6iA), N 6 -A 2 -isopentenyl-2-methylthioadenine (2ms6iA), N 6 - methyladenine, guanine (G), isoguanine, N 2 -dimethylguanine (dmG), 7-methylguanine (7mG), 2-thiopyrimidine, 6-thioguanine (6sG), hypoxanthine and O 6 -methylguanine; 7- deaza-purines such as 7-deazaadenine (7-deaza-A) and 7-deazaguanine (7-deaza-G); pyrimidines such as cytosine (C), 5-propynylcytosine, isocytosine, thymine
  • Nucleotides typically comprise a sugar moiety, such as carbocyclic moiety (Ferraro and Gotor 2000 Chem. Rev. 100: 4319-48), acyclic moieties (Martinez, et al., 1999 Nucleic Acids Research 27: 1271-1274; Martinez, et al., 1997 Bioorganic & Medicinal Chemistry Letters vol. 7: 3013-3016), and other sugar moieties (Joeng, et al., 1993 J. Med. Chem. 36: 2627-2638; Kim, et al., 1993 J. Med. Chem. 36: 30-7; Eschenmosser 1999 Science 284:2118-2124; and U.S. Pat. No.
  • nucleotides comprise a chain of one, two or three phosphorus atoms where the chain is typically attached to the 5’ carbon of the sugar moiety via an ester or phosphoramide linkage.
  • the nucleotide is an analog having a phosphorus chain in which the phosphorus atoms are linked together with intervening O, S, NH, methylene or ethylene.
  • the phosphorus atoms in the chain include substituted side groups including O, S or BEN
  • the chain includes phosphate groups substituted with analogs including phosphoramidate, phosphorothioate, phosphordithioate, and O-methylphosphoroamidite groups.
  • the term “rolling circle amplification” generally refers to an amplification method that employs a circularized nucleic acid template molecule containing a target sequence of interest, an amplification primer binding sequence, and optionally one or more adaptor sequences such as a sequencing primer binding sequence and/or a sample index sequence.
  • the rolling circle amplification reaction can be conducted under isothermal amplification conditions, and includes the circularized nucleic acid template molecule, an amplification primer, a strand-displacing polymerase and a plurality of nucleotides, to generate a concatemer containing tandem repeat sequences of the circular template molecule and any adaptor sequences present in the original circularized nucleic acid template molecule.
  • the concatemer can self-collapse to form a nucleic acid nanoball.
  • the shape and size of the nanoball can be further compacted by including a pair of inverted repeat sequences in the circular template molecule, or by conducting the rolling circle amplification reaction with one or more compaction oligonucleotides.
  • One of the advantages of using rolling circle amplification to generate clonal amplicons for a sequencing workflow is that the repeat copies of the target sequence in the nanoball can be simultaneously sequenced to increase signal intensity.
  • the rolling circle amplification reaction can be conducted in the presence of a plurality of compaction oligonucleotides having at least four consecutive guanines.
  • the rolling circle amplification reaction generates concatemers comprising repeat copies of the universal binding sequence for the compaction oligonucleotide.
  • At least one compaction oligonucleotide can form a guanine tetrad and hybridize to the universal binding sequences for the compaction oligonucleotide, and the resulting concatemer can fold to form an intramolecular G-quadruplex structure.
  • the concatemers can self-collapse to form compact nanoballs. Formation of the guanine tetrads and G-quadruplexes in the nanoballs may increase the stability of the nanoballs to retain their compact size and shape which can withstand repeated flows of reagents for conducting any of the sequencing workflows described herein.
  • reporter moiety refers to a compound that generates, or causes to generate, a detectable signal.
  • a reporter moiety is sometimes called a “label”. Any suitable reporter moiety may be used, including luminescent, photoluminescent, electroluminescent, bioluminescent, chemiluminescent, fluorescent, phosphorescent, chromophore, radioisotope, electrochemical, mass spectrometry, Raman, hapten, affinity tag, atom, or an enzyme.
  • a reporter moiety generates a detectable signal resulting from a chemical or physical change (e.g., heat, light, electrical, pH, salt concentration, enzymatic activity, or proximity events).
  • a proximity event includes two reporter moieties approaching each other, or associating with each other, or binding each other. It is well known to one skilled in the art to select reporter moieties so that each absorbs excitation radiation and/or emits fluorescence at a wavelength distinguishable from the other reporter moieties to permit monitoring the presence of different reporter moieties in the same reaction or in different reactions. Two or more different reporter moieties can be selected having spectrally distinct emission profiles, or having minimal overlapping spectral emission profiles. Reporter moieties can be linked (e.g., operably linked) to nucleotides, nucleosides, nucleic acids, enzymes (e.g., polymerases or reverse transcriptases), or support (e.g., surfaces).
  • a reporter moiety comprises a fluorescent label or a fluorophore.
  • fluorescent moieties which may serve as fluorescent labels or fluorophores include, but are not limited to fluorescein and fluorescein derivatives such as carboxyfluorescein, tetrachlorofluorescein, hexachlorofluorescein, carboxynapthofluorescein, fluorescein isothiocyanate, NHS-fluorescein, iodoacetamidofluorescein, fluorescein maleimide, SAMSA-fluorescein, fluorescein thiosemicarbazide, carbohydrazinomethylthioacetyl-amino fluorescein, rhodamine and rhodamine derivatives such as TRITC, TMR, lissamine rhodamine, Texas Red, rhodamine B, rhodamine 6G, rhodamine 10, NHS-
  • Cyanine dyes may exist in either sulfonated or non-sulfonated forms, and consist of two indolenin, benzo-indolium, pyridium, thiozolium, and/or quinolinium groups separated by a polymethine bridge between two nitrogen atoms.
  • cyanine fluorophores include, for example, Cy3, (which may compri se 1 - [6 - (2 , 5 -dioxopyrrolidin- 1 -yloxy)-6-oxohexyl] -2-(3 - ⁇ 1 - [6 - (2 , 5 -dioxopyrrolidin- 1 - yloxy)-6-oxohexyl]-3,3-dimethyl-l,3-dihydro-2H-indol-2-ylidene ⁇ prop-l-en-l-yl)-3,3- dimethyl-3H-indolium or l-[6-(2,5-dioxopyrrolidin-l-yloxy)-6-oxohexyl]-2-(3- ⁇ l-[6-(2,5- dioxopyrrolidin-l-yloxy)-6-oxohexyl]-3,3-dimethyl-5-
  • the reporter moiety can be a FRET pair, such that multiple classifications can be performed under a single excitation and imaging step.
  • FRET may comprise excitation exchange (Forster) transfers, or electron-exchange (Dexter) transfers.
  • support refers to a substrate that is designed for deposition of biological molecules or biological samples for assays and/or analyses.
  • biological molecules to be deposited onto a support include nucleic acids (e.g., DNA, RNA), polypeptides, saccharides, lipids, a single cell or multiple cells.
  • biological samples include but are not limited to saliva, phlegm, mucus, blood, plasma, serum, urine, stool, sweat, tears and fluids from tissues or organs.
  • the support is solid, semi-solid, or a combination of both. In some embodiments, the support is porous, semi-porous, non-porous, or any combination of porosity. In some embodiments, the support can be substantially planar, concave, convex, or any combination thereof. In some embodiments, the support can be cylindrical, for example comprising a capillary or interior surface of a capillary.
  • the surface of the support can be substantially smooth.
  • the support can be regularly or irregularly textured, including bumps, etched, pores, three-dimensional scaffolds, or any combination thereof.
  • the support comprises a bead having any shape, including spherical, hemi-spherical, cylindrical, barrel -shaped, toroidal, disc-shaped, rod-like, conical, triangular, cubical, polygonal, tubular or wire-like.
  • the support can be fabricated from any material, including but not limited to glass, fused-silica, silicon, a polymer (e.g., polystyrene (PS), macroporous polystyrene (MPPS), polymethylmethacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE), cyclic olefin polymers (COP), cyclic olefin copolymers (COC), polyethylene terephthalate (PET)), or any combination thereof.
  • a polymer e.g., polystyrene (PS), macroporous polystyrene (MPPS), polymethylmethacrylate (PMMA), polycarbonate (PC), polypropylene (PP), polyethylene (PE), high density polyethylene (HDPE), cyclic olefin polymers (COP), cyclic olefin copolymers (COC), polyethylene terephthalate (PET)
  • the present disclosure provides a plurality (e.g., two or more) of nucleic acid template molecules immobilized to a support.
  • the immobilized plurality of nucleic acid template molecules have the same sequence or have different sequences.
  • individual nucleic acid template molecules in the plurality of nucleic acid template molecules are immobilized to a different site on the support.
  • two or more individual nucleic acid template molecules in the plurality of nucleic acid templates are immobilized to a site on the support.
  • array refers to a support comprising a plurality of sites located at predetermined locations on the support to form an array of sites.
  • the sites can be discrete and separated by interstitial regions.
  • the pre-determined sites on the support can be arranged in one dimension in a row or a column, or arranged in two dimensions in rows and columns.
  • the plurality of pre-determined sites is arranged on the support in an organized fashion.
  • the plurality of pre-determined sites is arranged in any organized pattern, including rectilinear, hexagonal patterns, grid patterns, patterns having reflective symmetry, patterns having rotational symmetry, or the like. The pitch between different pairs of sites can be that same or can vary.
  • the support comprises at least 10 2 sites, at least 10 3 sites, at least 10 4 sites, at least 10 5 sites, at least 10 6 sites, at least 10 7 sites, at least 10 8 sites, at least 10 9 sites, at least IO 10 sites, at least 10 11 sites, at least 10 12 sites, at least 10 13 sites, at least 10 14 sites, at least 10 15 sites, or more, where the sites are located at pre-determined locations on the support.
  • a plurality of pre-determined sites on the support e.g., 10 2 - 10 15 sites or more
  • the nucleic acid template molecules that are immobilized at a plurality of pre-determined sites by hybridization to immobilized surface capture primers, or the nucleic acid template molecules are covalently attached to the surface capture primers.
  • the nucleic acid template molecules that are immobilized at a plurality of pre-determined sites for example immobilized at 10 2 - 10 15 sites or more.
  • the immobilized nucleic acid template molecules are clonally-amplified to generate immobilized nucleic acid clusters at the plurality of predetermined sites.
  • individual immobilized nucleic acid clusters comprise linear clusters, or comprise single-stranded or double-stranded concatemers.
  • a support comprising a plurality of sites located at random locations on the support is referred to herein as a support having randomly located sites thereon.
  • the location of the randomly located sites on the support are not pre-determined.
  • the plurality of randomly-located sites is arranged on the support in a disordered and/or unpredictable fashion.
  • the support comprises at least 10 2 sites, at least 10 3 sites, at least 10 4 sites, at least 10 5 sites, at least 10 6 sites, at least 10 7 sites, at least 10 8 sites, at least 10 9 sites, at least IO 10 sites, at least 10 11 sites, at least 10 12 sites, at least 10 13 sites, at least 10 14 sites, at least 10 15 sites, or more, where the sites are randomly located on the support.
  • a plurality of randomly located sites on the support e.g., 10 2 - 10 15 sites or more
  • the nucleic acid template molecules are immobilized at a plurality of randomly located sites by hybridization to immobilized surface capture primers, or the nucleic acid template molecules are covalently attached to the surface capture primers.
  • the nucleic acid templates that are immobilized at a plurality of randomly located sites for example immobilized at 10 2 - 10 15 sites or more.
  • the immobilized nucleic acid templates are clonally-amplified to generate immobilized nucleic acid clusters at the plurality of randomly located sites.
  • individual immobilized nucleic acid clusters comprise linear clusters, or comprise single-stranded or double-stranded concatemers.
  • the plurality of immobilized surface capture primers on the support are in fluid communication with each other to permit flowing a solution of reagents (e.g., nucleic acid template molecules, soluble primers, enzymes, nucleotides, divalent cations, buffers, and the like) onto the support so that the plurality of immobilized surface capture primers on the support can be essentially simultaneously reacted with the reagents in a massively parallel manner.
  • reagents e.g., nucleic acid template molecules, soluble primers, enzymes, nucleotides, divalent cations, buffers, and the like
  • the fluid communication of the plurality of immobilized surface capture primers can be used to conduct nucleic acid amplification reactions (e.g., RCA, MDA, PCR and bridge amplification) essentially simultaneously on the plurality of immobilized surface capture primers.
  • nucleic acid amplification reactions e.g., RCA, MDA, PCR and bridge amplification
  • the plurality of immobilized nucleic acid clusters on the support are in fluid communication with each other to permit flowing a solution of reagents (e.g., enzymes, nucleotides, divalent cations, and the like) onto the support so that the plurality of immobilized nucleic acid clusters on the support can be essentially simultaneously reacted with the reagents in a massively parallel manner.
  • reagents e.g., enzymes, nucleotides, divalent cations, and the like
  • the fluid communication of the plurality of immobilized nucleic acid clusters can be used to conduct nucleotide binding assays and/or conduct nucleotide polymerization reactions (e.g., primer extension or sequencing) essentially simultaneously on the plurality of immobilized nucleic acid clusters, and optionally to conduct detection and imaging for massively parallel sequencing.
  • nucleotide binding assays e.g., primer extension or sequencing
  • nucleotide polymerization reactions e.g., primer extension or sequencing
  • the term “immobilized” and related terms refer to nucleic acid molecules that are attached to a support through covalent bond or non-covalent interaction, or attached to a coating on the support, or buried within a matrix formed by a coating on the support, where the nucleic acid molecules include surface capture primers, nucleic acid template molecules and extension products of capture primers. Extension products of capture primers includes nucleic acid concatemers (e.g., nucleic acid clusters).
  • the nucleic acid molecules can be immobilized at pre-determined or random locations on the support.
  • the nucleic acid molecules can be immobilized at pre-determined or random locations on or within a coating passivated on the support.
  • the term “immobilized” and related terms refer to enzymes (e.g., polymerases) that are attached to a support through covalent bond or non-covalent interaction, or attached to a coating on the support, or buried within a matrix formed by a coating on the support.
  • the enzymes can be immobilized at pre-determined or random locations on the support.
  • the enzymes can be immobilized at pre-determined or random locations on or within a coating passivated on the support.
  • one or more nucleic acid template molecules are immobilized on the support, for example immobilized at the sites on the support.
  • the one or more nucleic acid template molecules are clonally-amplified.
  • the one or more nucleic acid template molecules are clonally-amplified off the support (e.g., in-solution) and then deposited onto the support and immobilized on the support.
  • the clonal amplification reaction of the one or more nucleic acid template molecules is conducted on the support resulting in immobilization on the support.
  • the one or more nucleic acid template molecules are clonally-amplified (e.g., in solution or on the support) using a nucleic acid amplification reaction, including any one or any combination of polymerase chain reaction (PCR), multiple displacement amplification (MDA), transcription-mediated amplification (TMA), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), real-time SDA, bridge amplification, isothermal bridge amplification, rolling circle amplification (RCA), circle-to-circle amplification, helicase-dependent amplification, recombinase-dependent amplification, and/or single-stranded binding (SSB) proteindependent amplification.
  • PCR polymerase chain reaction
  • MDA multiple displacement amplification
  • TMA transcription-mediated amplification
  • NASBA nucleic acid sequence-based amplification
  • SDA strand displacement amplification
  • bridge amplification isothermal bridge amplification
  • surface primer refers to single-stranded oligonucleotides that are immobilized to a support and comprise a sequence that can hybridize to at least a portion of a nucleic acid template molecule.
  • Surface capture primers can be used to immobilize template molecules to a support via hybridization.
  • Surface capture primers can be immobilized to a support in a manner that resists primer removal during flowing, washing, aspirating, and changes in temperature, pH, salts, chemical and/or enzymatic conditions.
  • the 5’ end of a surface capture primer can be immobilized to a support or to a coating on the support (or embedded in a coating on the support).
  • an interior portion or the 3’ end of a surface capture primer can be immobilized to a support.
  • the sequence of surface capture primers can be wholly or partially complementary along their length to at least a portion of the nucleic acid template molecule.
  • a support can include a plurality of immobilized surface capture primers having the same sequence, or having two or more different sequences.
  • Surface capture primers can be any length, for example 4-50 nucleotides, or 50-100 nucleotides, or 100-150 nucleotides, or longer lengths.
  • a surface capture primer can have a terminal 3’ nucleotide having a sugar 3’ OH moiety which is extendible for nucleotide polymerization (e.g., polymerase catalyzed polymerization).
  • a surface capture primer can have a terminal 3’ nucleotide having the 3’ sugar position linked to a chain-terminating moiety that inhibits nucleotide polymerization.
  • the 3’ chain-terminating moiety can be removed (e.g., de-blocked) to convert the 3’ end to an extendible 3’ OH end using a de-blocking agent.
  • chain terminating moi eties include alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, amine group, amide group, keto group, isocyanate group, phosphate group, thio group, disulfide group, carbonate group, urea group, or silyl group.
  • Azide type chain terminating moieties including azide, azido and azidomethyl groups.
  • deblocking agents include a phosphine compound, such as Tris(2-carboxyethyl)phosphine (TCEP) and bis-sulfo triphenyl phosphine (BS-TPP), for chain-terminating groups azide, azido and azidomethyl groups.
  • TCEP Tris(2-carboxyethyl)phosphine
  • BS-TPP bis-sulfo triphenyl phosphine
  • de-blocking agents examples include tetrakis(triphenylphosphine)palladium(0) (Pd(PPh3)4) with piperidine, or with 2,3-Dichloro- 5,6-dicyano-l,4-benzo-quinone (DDQ), for chain-terminating groups alkyl, alkenyl, alkynyl and allyl.
  • Examples of a de-blocking agent includes Pd/C for chain-terminating groups aryl and benzyl.
  • de-blocking agents include phosphine, beta-mercaptoethanol or dithiothritol (DTT), for chain-terminating groups amine, amide, keto, isocyanate, phosphate, thio and disulfide.
  • de-blocking agents examples include potassium carbonate (K2CO3) in MeOH, triethylamine in pyridine, and Zn in acetic acid (AcOH), for carbonate chainterminating groups.
  • de-blocking agents include tetrabutylammonium fluoride, pyridine-HF, with ammonium fluoride, and triethylamine trihydrofluoride, for chainterminating groups urea and silyl.
  • sequencing refers to a method for obtaining nucleotide sequence information from a nucleic acid molecule, typically by determining the identity of at least some nucleotides (including their nucleobase components) within the nucleic acid molecule.
  • sequence information of a given region of a nucleic acid molecule includes identifying each and every nucleotide within a region that is sequenced.
  • sequencing information determines only some of the nucleotides a region, while the identity of some nucleotides remains undetermined or incorrectly determined. Any suitable method of sequencing may be used.
  • sequencing can include label-free or ion based sequencing methods.
  • sequencing can include labeled or dye-containing nucleotide or fluorescent based nucleotide sequencing methods. In some embodiments, sequencing can include polony-based sequencing or bridge sequencing methods. In some embodiments, the sequencing employs polymerases and multivalent molecules for generating at least one avidity complex, wherein individual multivalent molecules comprise a plurality of nucleotide units tethered to a core. In some embodiments, the sequencing employs polymerases and free nucleotides for performing sequencing-by-synthesis. In some embodiments, the sequencing employs a ligase enzyme and a plurality of sequence-specific oligonucleotides for performing sequence-by-ligation. DETAILED DESCRIPTION
  • compositions comprising nucleic acid singlestranded splint strands, including kits, and methods that employ the single-stranded splint strands.
  • the single-stranded splint strands (200) can be used in a one-pot, multi-enzyme reaction to circularize linear library molecules (e.g., see FIGS. 1-5).
  • the single-stranded splint strand (200) comprises a first region (210) that hybridizes with a sequence on one end of the linear single stranded library molecule, and a second region (220) that hybridizes with a sequence on the other end of the linear single stranded library molecule.
  • the two regions of the single-stranded splint strands e.g., (210) and (220) are designed to increase the efficiency of circularizing linear nucleic acid molecules.
  • the single-strand splint strands and the methods that employ them offer the advantage of providing high efficiency circularization with as little as 0.25 pmol library molecules.
  • the methods described herein can be performed manually or adapted for automation because the annealing and multi -enzyme reactions can be conducted in a single reaction vessel (one-pot) by combining some enzymatic reactions (e.g., phosphorylation and ligation) and by adding subsequent enzymes (e.g., exonucleases) without intervening alcohol precipitations or organic extractions.
  • enzymatic reactions e.g., phosphorylation and ligation
  • subsequent enzymes e.g., exonucleases
  • the present disclosure provides nucleic acid single-stranded splint strands (200), comprising a first region (210) that hybridizes with a sequence on one end of the linear single stranded library molecule, and a second region (220) that hybridizes with a sequence on the other end of the linear single stranded library molecule.
  • the two regions of the singlestranded splint strands e.g., (210) and (220)
  • the first region of the single-stranded splint strand (210) is hybridized to one end of the library molecule
  • the second region of the single-stranded splint strand (220) is hybridized to the other end of the library molecule, thereby circularizing the library molecule to generate a library-splint complex (300) which includes a nick (e.g., see FIGS. 1-5).
  • the nick can be enzymatically ligated to generate a covalently closed circular molecule (400) in which the terminal ends of the library molecule are covalently joined.
  • the end sequences of the linear nucleic acid library molecule comprise at least first and second universal adaptor sequences, respectively.
  • the first and second universal adaptor sequences of the linear library molecule comprise binding sequences for immobilized first and second capture primers on a support, respectively.
  • the first region of the single-stranded splint strand (210) includes a first universal adaptor sequence which comprises a universal binding sequence for a forward or reverse sequencing primer, a universal binding sequence for a first or second surface primer, a universal binding sequence for a forward or reverse amplification primer, or a universal binding sequence for a compaction oligonucleotide.
  • the second region of the single-stranded splint strand (220) includes a second universal adaptor sequence which comprises a universal binding sequence for a forward or reverse sequencing primer, a universal binding sequence for a first or second surface primer, a universal binding sequence for a forward or reverse amplification primer or a universal binding sequence for a compaction oligonucleotide.
  • the single-stranded splint strands (200) comprise one or more phosphorothioate linkage at their 5’ and/or 3’ ends to confer exonuclease resistance. In some embodiments, the single-stranded splint strands (200) comprise one or more phosphorothioate linkage at an internal position to confer endonuclease resistance. In some embodiments, the single-stranded splint strands (200) comprise one or more 2’-O- methylcytosine bases at their 5’ and/or 3’ ends, or at an internal position.
  • the 5’ end of the single-stranded splint strand (200) is phosphorylated or nonphosphorylated.
  • the 3’ end of the single-stranded splint strand (200) comprises a terminal 3’ OH group or a terminal 3’ blocking group.
  • the first region of the single-stranded splint strand (210) includes a universal binding sequence for a first left universal adaptor sequence (120) of a library molecule, where the first region (210) comprises the sequence 5’-ACCCTGAAAGTACGTGCATTACATG -3’ (S EQ ID NO: 193) (e g., FIGS. 7A- 7C).
  • the first left universal adaptor sequence (120) in the library molecule comprises the sequence 5’ - CATGTAATGCACGTACTTTCAGGGT -3’ (SEQ ID NO: 199).
  • the second region of the single-stranded splint strand (220) includes a universal binding sequence for a first right universal adaptor sequence (130) of a library molecule, where the second region (220) comprises the sequence
  • the first right universal adaptor sequence (130) in the library molecule comprises the sequence 5’-AGTCGTCGCAGCCTCACCTGATC-3’ (SEQ ID NO:200).
  • the single-stranded splint strand (200) comprises the sequence
  • the first region of the single-stranded splint strand (210) includes a universal binding sequence for a first left universal adaptor sequence (120) of a library molecule, where the first region (210) comprises the sequence
  • the second region of the single-stranded splint strand (220) includes a universal binding sequence for a first right universal adaptor sequence (130) of a library molecule, where the second region (220) comprises the sequence
  • the single-stranded splint strand comprises the sequence 5’ - TCGGTGGTCGCCGTATCATTCAAGCAGAAGACGGCATACGA -3’ (SEQ ID NO: 198).
  • the present disclosure provides a library-splint complex (300) comprising: (i) a single-stranded nucleic acid library molecule (100) which includes a sequence of interest (110) flanked on one side by at least a first left universal adaptor sequence (120) and flanked on the other side by at least a first right universal adaptor sequence (130); and (ii) a singlestranded splint strand (200) includes a first region (210) that hybridizes with a sequence on one end of the linear single stranded library molecule, and a second region (220) that hybridizes with a sequence on the other end of the linear single stranded library molecule.
  • the first region of the single-stranded splint strand (210) is hybridized to the at least first left universal adaptor sequence (120) of the library molecule, and a second region of the single-stranded splint strand (220) is hybridized to the at least first right universal sequence (130) of the library molecule, thereby circularizing the library molecule to generate a library-splint complex (300) (e.g., see FIGS. 1-5).
  • the first region of the single-stranded splint strand (210) comprises a first universal adaptor sequence which can hybridize to a first universal binding sequence at one end of a linear nucleic acid library molecule (e.g., see FIGS. 1-5).
  • the first region of the single-stranded splint strand (210) includes a first universal adaptor sequence which comprises a universal binding sequence for a forward or reverse sequencing primer, a universal binding sequence for a first or second surface primer, a universal binding sequence for a forward or reverse amplification primer, a universal binding sequence for a compaction oligonucleotide.
  • the single-stranded splint strand (200) can be 20-150 nucleotides in length, or 60-100 nucleotides in length, or 70-90 nucleotides in length, or 60-80 nucleotides in length.
  • the single-stranded splint strands (200) comprise one or more phosphorothioate linkage at the 5’ and/or 3’ ends to confer exonuclease resistance.
  • the single-stranded splint strands (200) comprise one or more phosphorothioate linkage at an internal position to confer endonuclease resistance.
  • the single-stranded splint strands (200) comprise one or more 2’-O- methylcytosine bases at the 5’ and/or 3’ end, or at an internal position.
  • the 5’ end of the single-stranded splint strand (200) is phosphorylated or lacks a phosphate group.
  • the 3’ end of the single-stranded splint strand (200) includes a terminal 3’ OH group or a terminal 3’ blocking group.
  • the second region of the single-stranded splint strand (220) comprises a second universal adaptor sequence which can hybridize to a second universal binding sequence at the other end of the linear nucleic acid library molecule (e.g., see FIGS. 1-5).
  • the second region of the single-stranded splint strand (220) includes a second universal adaptor sequence which comprises a universal binding sequence for a forward or reverse sequencing primer, a universal binding sequence for a first or second surface primer, a universal binding sequence for a forward or reverse amplification primer, or a universal binding sequence for a compaction oligonucleotide.
  • the first region of the single-stranded splint strand (210) is hybridized to the at least first left universal adaptor sequence (120) of the library molecule, and a second region of the single-stranded splint strand (220) is hybridized to the at least first right universal sequence (130) of the library molecule, thereby circularizing the library molecule to generate a library-splint complex (300).
  • the librarysplint complex (300) comprises a nick between the 5’ end of the library molecule and the 3’ end of the library molecule (e.g., see FIGS. 1-5). In some embodiments, the nick is enzymatically ligatable.
  • the first region of the single-stranded splint strand (210) can hybridize to a sense or anti-sense strand of a double-stranded nucleic acid library molecule.
  • the second region of the single-stranded splint strand (220) can hybridize to a sense or anti-sense strand of a double-stranded nucleic acid library molecule.
  • the double-stranded nucleic acid library molecule can be denatured to generate the single-stranded sense and anti-sense library strands.
  • the single-stranded library molecule (100) can be a sense or anti-sense strand.
  • the first region of the single-stranded splint strand (210) does not hybridize to the sequence of interest (110)
  • the second region of the single-stranded splint strand (220) does not hybridize to the sequence of interest (110).
  • the 5’ end of the singlestranded library molecule (100) is phosphorylated or lacks a phosphate group.
  • the 3’ end of the single-stranded library molecule includes a terminal 3’ OH group or a terminal 3’ blocking group.
  • the nucleic acid library molecule (100) further comprises a second left universal adaptor sequence (140). In some embodiments, the nucleic acid library molecule (100) further comprises a second right universal adaptor sequence (150). Exemplary library-splint complexes (300) are shown in FIGS. 1-5. In some embodiments, the nucleic acid library molecule (100) can further comprise additional left and/or right universal adaptor sequences.
  • the nucleic acid library molecule (100) further comprises a first left index sequence (160). In some embodiments, the nucleic acid library molecule (100) further comprises a first right index sequence (170). The first right index sequence (170) can be 3-20 nucleotides in length. In some embodiments, the first left index sequence (160) comprises a sample index sequence. The first left index sequence (160) can be 3-20 nucleotides in length. In some embodiments, the first right index sequence (170) comprises another sample index sequence. The sequences of the left and right sample index sequences (e.g., (160) and (170)) can be the same or different from each other. The sample index sequences can be used to distinguish sequences of interest obtained from different sample sources in a multiplex assay. Exemplary library-splint complexes (300) are shown in FIGS. 1-5.
  • the first right index sequence (170) can include a short random sequence (e.g., NNN) or lack the short random sequence.
  • the short random sequence can be 3-20 nucleotides in length.
  • the nucleic acid library molecule (100) further comprises at least one junction adaptor sequence located between any of the universal adaptor sequences described herein (e.g., see FIG. 5).
  • a first left junction adaptor sequence (125) can be located between the first left universal adaptor sequence (120) and the first left index sequence (160).
  • a second left junction adaptor sequence (165) can be located between the first left index sequence (160) and the second left universal adaptor sequence (140).
  • a third junction adaptor sequence (145) can be located between the second left universal adaptor sequence (140) and the sequence-of-interest (110).
  • a first right junction adaptor sequence (135) can be located between the first right universal sequence (130) and the first right index sequence (170).
  • a second right junction adaptor sequence (175) can be located between the first right index sequence (170) and the second right universal adaptor sequence (150).
  • a third right junction adaptor sequence (155) can be located between the second right universal adaptor sequence (150) and the sequence-of-interest (110).
  • Any of the junction adaptor sequences comprise any sequence and can be 3-60 nucleotides in length.
  • Any of the junction adaptor sequences comprise a universal sequence or a unique sequence.
  • Any of the junction adaptor sequences comprise a random sequence (e.g., NNN) having 3-20 nucleotides.
  • Any of the junction adaptor sequences comprise a binding sequence for an amplification primer, a sequencing primer or a compaction oligonucleotide.
  • junction adaptor sequences comprise a binding sequence for an immobilized surface primer (e.g., capture primer). Any of the junction adaptor sequences comprise a sample index sequence. Any of the junction adaptor sequences comprise a unique identification sequence. Any of the junction adaptor sequences, particularly junction adaptor sequence (145) comprises a Tn5 transposon-end sequence 5’- AGATGTGTATAAGAGACAG -3’ (SEQ ID NO:209). Any of the junction adaptor sequences, particularly junction adaptor sequence (155) comprises a Tn5 transposonend sequence 5’- CTGTCTCTTATACACATCT -3’ (SEQ ID NO:210).
  • the Tn5 transposonend sequences can be introduced into the library molecule (100) via a transposase-mediated reaction which includes contacting double-stranded input DNA (e.g., genomic DNA) with a Tn-5 type transposase enzyme, and a double-stranded oligonucleotide comprising the Tn transposon-end sequence (SEQ ID NO: 209) linked to a universal adaptor sequence or a sample index sequence under a condition that is suitable to form a transposon synaptic complex.
  • the Tn transposon-end sequence (SEQ ID NO:209) can be located 5’ or 3’ relative to the universal adaptor sequence or a sample index sequence.
  • Multiplex workflows are enabled by preparing sample-indexed libraries using one or both index sequences (e.g., left and/or right index sequences).
  • the first left index sequences (160) and/or first right index sequences (170) can be employed to prepare separate sample- indexed libraries using input nucleic acids isolated from different sources.
  • the sample- indexed libraries can be pooled together to generate a multiplex library mixture, and the pooled libraries can be circularized, amplified and/or sequenced.
  • the sequences of the insert region along with the first left index sequence (160) and/or first right index sequence (170) can be used to identify the source of the input nucleic acids.
  • any number of sample-indexed libraries can be pooled together, for example 2-10, or 10-50, or 50-100, or 100-200, or more than 200 sample-indexed libraries can be pooled.
  • Exemplary nucleic acid sources include naturally-occurring, recombinant, or chemically-synthesized sources.
  • Exemplary nucleic acid sources include single cells, a plurality of cells, tissue, biological fluid, environmental sample or whole organism.
  • Exemplary nucleic acid sources include fresh, frozen, fresh-frozen or archived sources (e.g., formalin-fixed paraffin- embedded; FFPE). The skilled artisan will recognize that the nucleic acids can be isolated from many other sources.
  • the nucleic acid library molecules can be prepared in singlestranded or double-stranded form.
  • the nucleic acid library molecule (100) further comprises: an optional first left unique identification sequence (180). In some embodiments, the nucleic acid library molecule (100) further comprises an optional first right unique identification sequence (190). In some embodiments, the first left unique identification sequence (180) and the first right unique identification sequence (190) each comprise a sequence that is used to uniquely identify an individual sequence of interest (e.g., insert sequence) to which the unique adaptors are appended in a population of other sequence of interest molecules. In some embodiments, the first left unique identification sequence (180) and/or the first right unique identification sequence (190) can be used for molecular tagging.
  • the unique identification sequence (180) and/or (190) comprises 2-12 or more nucleotides having a known sequence.
  • the unique identification sequence comprises a known random sequence where a nucleotide at each position is randomly selected from nucleotides having a base A, G, C, T or U.
  • the unique identification sequences (180) and/or (190) can be used for molecular tagging procedures. Exemplary library-splint complexes (300) are shown in FIGS. 1-5.
  • the nucleic acid library molecule (100) comprises any one or any combination of two or more: a first left universal adaptor sequence (120); a second left universal adaptor sequence (140); a first left index sequence (160); a first left unique identification sequence (180); a first right universal adaptor sequence (130); a second right universal adaptor sequence (150); a first right index sequence (170); and/or a first right unique identification sequence (190).
  • FIGS. 1-5 shows some exemplary library-splint complexes (300).
  • the first left universal adaptor sequence (120) and/or the second left universal adaptor sequence (140) comprises: a universal binding sequence for a forward or reverse sequencing primer; a universal binding sequence for a first or second surface primer; a universal binding sequence for a forward or reverse amplification primer; and/or a universal binding sequence for a compaction oligonucleotide.
  • the nucleic acid library molecule (100) can further comprise additional left universal adaptor sequences.
  • the first right universal adaptor sequence (130) and/or the second right universal adaptor sequence (150) comprises: a universal binding sequence for a forward or reverse sequencing primer; a universal binding sequence for a first or second surface primer; a universal binding sequence for a forward or reverse amplification primer; and/or a universal binding sequence for a compaction oligonucleotide.
  • the nucleic acid library molecule (100) can further comprise additional right universal adaptor sequences.
  • an exemplary library-splint complex (300) comprises: (a) single-stranded nucleic acid library molecule (100); and (b) a single-stranded splint strand (200).
  • the single-stranded nucleic acid library molecule (100) comprises components arranged in a 5’ to 3’ order: (i) a first left universal adaptor sequence (120) having a binding sequence for a second surface primer; (ii) a second left universal adaptor sequence (140) having a binding sequence for a first sequencing primer; (iii) a sequence of interest (110); (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer; and (v) a first right universal adaptor sequence (130) having a binding sequence for a first surface primer.
  • the single-stranded splint strand (200) comprises components arranged in a 5’ to 3’ order: a first region (210); and a second region (220).
  • portions of the single-stranded splint strand (200) are hybridized to portions of the library molecule (100) thereby circularizing the library molecule to generate a library-splint complex (300), such that the first region (210) of the single-stranded splint strand is hybridized to the binding sequence for the second surface primer (120), and the second region (220) of the single-stranded splint strand is hybridized to the binding sequence for the first surface primer (130).
  • the library-splint complex (300) comprises a nick between the 5’ end of the library molecule and the 3’ end of the library molecule, where the nick is enzymatically ligatable. Exemplary library-splint complexes (300) are shown in FIGS. 1-5.
  • any of the library-splint complexes (300) described herein comprise a plurality of library-splint complexes (300), wherein the sequence of interest (110) of individual library-splint complexes in the plurality comprise the same sequence of interest or different sequences of interest.
  • the first left universal adaptor sequence (120) in the library molecules comprise the sequence 5’- CATGTAATGCACGTACTTTCAGGGT -3’ (SEQ ID NO: 199).
  • the first left universal adaptor sequence (120) in the library molecules comprise the sequence 5’- AATGATACGGCGACCACCGA-3’ (SEQ ID NO:203).
  • the second left universal adaptor sequence (140) in the library molecules comprise the sequence 5’- CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT -3’ (SEQ ID NO:201).
  • the second left universal adaptor sequence (140) in the library molecules comprise the sequence 5’- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3’ (SEQ ID NO:205).
  • the second left universal adaptor sequence (1 0) in the library molecules comprise the sequence 5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3’ (SEQ ID NO:206).
  • the second right universal adaptor sequence (150) in the library molecules comprise the sequence
  • the second right universal adaptor sequence (150) in the library molecules comprise the sequence
  • the second right universal adaptor sequence (150) in the library molecules comprise the sequence
  • the first right universal adaptor sequence (130) in the library molecules comprise the sequence 5’- AGTCGTCGCAGCCTCACCTGATC -3’ (SEQ ID NO:200).
  • the first right universal adaptor sequence (130) in the library molecules comprise the sequence 5’- TCGTATGCCGTCTTCTGCTTG -3’ (SEQ ID NO:204).
  • the first region of the single-stranded splint strand (210) includes a universal binding sequence for a first left universal adaptor sequence (120) of a library molecule, where the first region (210) comprises the sequence
  • the second region of the single-stranded splint strand (220) includes a universal binding sequence for a first right universal adaptor sequence (130) of a library molecule, where the second region (220) comprises the sequence
  • the single-stranded splint strand (200) comprises the sequence
  • the first region of the single-stranded splint strand (210) includes a universal binding sequence for a first left universal adaptor sequence (120) of a library molecule, where the first region (210) comprises the sequence 5’- TCGGTGGTCGCCGTATCATT -3’ (SEQ ID NO: 196).
  • the second region of the single-stranded splint strand (220) includes a universal binding sequence for a first right universal adaptor sequence (130) of a library molecule, where the second region (220) comprises the sequence 5’- CAAGCAGAAGACGGCATACGA -3’ (SEQ ID NO: 197).
  • the single-stranded splint strand (200) comprises the sequence
  • the present disclosure provides a reaction mixture comprising a plurality of any of the library-splint complexes (300) described herein.
  • the reaction mixture comprises a plurality of any of the library-splint complexes (300) described herein, and a T4 polynucleotide kinase.
  • the reaction mixture comprises a plurality of any of the library-splint complexes (300) described herein, and a ligase enzyme.
  • the reaction mixture comprises a plurality of any of the library-splint complexes (300) described herein, and a T4 polynucleotide kinase and a ligase enzyme.
  • the ligase enzyme comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.
  • the present disclosure provides a covalently closed circular library molecule (400) comprising: a sequence of interest (110), at least a first left universal adaptor sequence (120), and at least a first right universal adaptor sequence (130). Exemplary covalently closed circular library molecules are shown in FIGS. 6A-C.
  • the covalently closed circular library molecule (400) further comprises a second left universal adaptor sequence (140).
  • the covalently close circular molecule (400) further comprises a second right universal adaptor sequence (150).
  • the covalently close circular molecule (400) further comprise additional left and/or right universal adaptor sequences.
  • the covalently close circular molecule (400) further comprises a first left index sequence (160) and/or a first right index sequence (170).
  • the first left index sequence (160) can be 3-20 nucleotides in length.
  • the first right index sequence (170) can be 3-20 nucleotides in length.
  • the sample index sequences can be used to distinguish sequences of interest obtained from different sample sources in a multiplex assay.
  • a list of exemplary first left index sequences (160) and first right index sequences (170) is provided in Table 1 at FIGS. 9A-9F.
  • the first right index sequence (170) and/or the first left index sequence (160) can include a short random sequence (e.g., NNN) or lack the short random sequence.
  • the short random sequence can be 3-20 nucleotides in length.
  • Multiplex workflows are enabled by preparing sample-indexed libraries using one or both index sequences (e.g., left and/or right index sequences).
  • the first left index sequences (160) and/or first right index sequences (170) can be employed to prepare separate sample- indexed libraries using input nucleic acids isolated from different sources.
  • the sample- indexed libraries can be pooled together to generate a multiplex library mixture, and the pooled libraries can be circularized, amplified and/or sequenced.
  • the sequences of the insert region along with the first left index sequence (160) and/or first right index sequence (170) can be used to identify the source of the input nucleic acids.
  • any number of sample-indexed libraries can be pooled together, for example 2-10, or 10-50, or 50-100, or 100-200, or more than 200 sample-indexed libraries can be pooled.
  • Exemplary nucleic acid sources include naturally-occurring, recombinant, or chemically-synthesized sources.
  • Exemplary nucleic acid sources include single cells, a plurality of cells, tissue, biological fluid, environmental sample or whole organism.
  • Exemplary nucleic acid sources include fresh, frozen, fresh-frozen or archived sources (e.g., formalin-fixed paraffin- embedded; FFPE). The skilled artisan will recognize that the nucleic acids can be isolated from many other sources.
  • the nucleic acid library molecules can be prepared in singlestranded or double-stranded form.
  • the covalently close circular molecule (400) further comprises an optional first left unique identification sequence (180) and/or an optional first right unique identification sequence (190).
  • the first left unique identification sequence (180) and the first right unique identification sequence (190) each comprise a sequence that is used to uniquely identify an individual sequence of interest (e.g., insert sequence) to which the unique adaptors are appended in a population of other sequence of interest molecules (e.g., molecular tagging).
  • the covalently close circular molecule (400) comprises any one or any combination of two or more: a first left universal adaptor sequence (120); a second left universal adaptor sequence (140); a first left index sequence (160); a first left unique identification sequence (180); a first right universal adaptor sequence (130); a second right universal adaptor sequence (150); a first right index sequence (170); and/or a first right unique identification sequence (190).
  • the first left index sequence (160) comprises a sample index sequence.
  • the first right index sequence (170) comprises another sample index sequence.
  • the sequences of the right and left sample index sequences e.g., (170) and (160)
  • the sample index sequences can be used to distinguish sequences of interest obtained from different sample sources in a multiplex assay.
  • the first left unique identification sequence (180) and the first right unique identification sequence (190) each comprise a sequence that is used to uniquely identify an individual sequence of interest (e.g., insert sequence) to which the unique adaptors are appended in a population of other sequence of interest molecules.
  • the first left unique identification sequence (180) and/or the first right unique identification sequence (190) can be used for molecular tagging.
  • the unique identification sequence comprises 2-12 or more nucleotides having a known sequence.
  • the unique identification sequence (180) and/or (190) comprises a known random sequence where a nucleotide at each position in the unique identification sequence is randomly selected from nucleotides having a nucleo-base A, G, C, T or U.
  • the unique identification sequences (180) and/or (190) can be used for molecular tagging procedures. Exemplary covalently closed circular library molecules are shown in FIGS. 6A-6C.
  • the first left universal adaptor sequence (120) and/or the second left universal adaptor sequence (140) comprises: a universal binding sequence for a forward or reverse sequencing primer; a universal binding sequence for a first or second surface primer; a universal binding sequence for a forward or reverse amplification primer; and/or a universal binding sequence for a compaction oligonucleotide.
  • the covalently close circular molecule (400) can further comprise additional left universal adaptor sequences.
  • the first right universal adaptor sequence (130) and/or the second right universal adaptor sequence (150) comprises: a universal binding sequence for a forward or reverse sequencing primer; a universal binding sequence for a first or second surface primer; a universal binding sequence for a forward or reverse amplification primer; and/or a universal binding sequence for a compaction oligonucleotide.
  • the covalently close circular molecule (400) can further comprise additional right universal adaptor sequences.
  • the covalently close circular molecule (400) further comprises at least one junction adaptor sequence located between any of the universal adaptor sequences described herein (e.g., see FIG. 5).
  • a first left junction adaptor sequence (125) can be located between the first left universal adaptor sequence (120) and the first left index sequence (160).
  • a second left junction adaptor sequence (165) can be located between the first left index sequence (160) and the second left universal adaptor sequence (140).
  • a third junction adaptor sequence (145) can be located between the second left universal adaptor sequence (140) and the sequence-of-interest (110).
  • a first right junction adaptor sequence (135) can be located between the first right universal sequence (130) and the first right index sequence (170).
  • a second right junction adaptor sequence (175) can be located between the first right index sequence (170) and the second right universal adaptor sequence (150).
  • a third right junction adaptor sequence (155) can be located between the second right universal adaptor sequence (150) and the sequence-of-interest (110).
  • Any of the junction adaptor sequences comprise any sequence and can be 3-60 nucleotides in length.
  • Any of the junction adaptor sequences comprise a universal sequence or a unique sequence.
  • Any of the junction adaptor sequences comprise a random sequence (e.g., NNN) having 3-20 nucleotides.
  • Any of the junction adaptor sequences comprise a binding sequence for an amplification primer, a sequencing primer or a compaction oligonucleotide.
  • junction adaptor sequences comprise a binding sequence for an immobilized surface primer (e.g., capture primer). Any of the junction adaptor sequences comprise a sample index sequence. Any of the junction adaptor sequences comprise a unique identification sequence. Any of the junction adaptor sequences, particularly junction adaptor sequence (145) comprises a Tn5 transposon-end sequence 5’- AGATGTGTATAAGAGACAG -3’ (SEQ ID NO:209). Any of the junction adaptor sequences, particularly junction adaptor sequence (155) comprises a Tn5 transposon-end sequence 5’- CTGTCTCTTATACACATCT -3’ (SEQ ID NO:210).
  • the Tn5 transposon-end sequences can be introduced into the library molecule (100) via a transposase-mediated reaction which includes contacting double-stranded input DNA (e.g., genomic DNA) with a Tn-5 type transposase enzyme, and a double-stranded oligonucleotide comprising the Tn transposon-end sequence (SEQ ID NO:209) linked to a universal adaptor sequence or a sample index sequence under a condition that is suitable to form a transposon synaptic complex.
  • the Tn transposon-end sequence can be located 5’ or 3’ relative to the universal adaptor sequence or a sample index sequence.
  • an exemplary covalently closed circular molecule (400) comprises: (i) a first left universal adaptor sequence (120) having a binding sequence for a second surface primer (120); (ii) a second left universal adaptor sequence (140) having a binding sequence for a first sequencing primer; (iii) a sequence of interest (110); (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer; (v) a first right universal adaptor sequence (130) having a binding sequence for a first surface primer (130); and (vi) optionally the covalently closed circular molecule (400) is hybridized to the single-stranded splint strand (200) (e.g., see FIGS. 6A- 6C).
  • the first and second regions (210 and 220, respectively) of the single-stranded splint strand do not hybridize to the sequence of interest (110).
  • any of the covalently closed circular molecules (400) described herein comprise a plurality of covalently closed circular molecules (400), wherein the sequence of interest (110) of individual covalently closed circular molecules (400) in the plurality comprise the same sequence of interest or different sequences of interest.
  • the first left universal adaptor sequence (120) in the covalently closed circular molecules comprise the sequence 5’- CATGTAATGCACGTACTTTCAGGGT -3’ (SEQ ID NO: 199).
  • the first left universal adaptor sequence (120) in the covalently closed circular molecules comprise the sequence 5’- AATGATACGGCGACCACCGA-3’ (SEQ ID NO:203).
  • the second left universal adaptor sequence (140) in the covalently closed circular molecules comprise the sequence 5’- CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT -3’ (SEQ ID NO:201).
  • the second left universal adaptor sequence (140) in the covalently closed circular molecules comprise the sequence 5’- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3’ (SEQ ID NO:205).
  • the second left universal adaptor sequence (140) in the covalently closed circular molecules comprise the sequence 5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3’ (SEQ ID NO:206).
  • the second right universal adaptor sequence (150) in the covalently closed circular molecules comprise the sequence
  • the second right universal adaptor sequence (150) in the covalently closed circular molecules comprise the sequence
  • the second right universal adaptor sequence (150) in the covalently closed circular molecules comprise the sequence
  • the first right universal adaptor sequence (130) in the covalently closed circular molecules comprise the sequence 5’- AGTCGTCGCAGCCTCACCTGATC -3’ (SEQ ID NO:200).
  • the first right universal adaptor sequence (130) in the covalently closed circular molecules comprise the sequence 5’- TCGTATGCCGTCTTCTGCTTG -3’ (SEQ ID NO:204).
  • the first region of the single-stranded splint strand (210) includes a universal binding sequence for a first left universal adaptor sequence (120) of a library molecule, where the first region (210) comprises the sequence
  • the second region of the single-stranded splint strand (220) includes a universal binding sequence for a first right universal adaptor sequence (130) of a library molecule, where the second region (220) comprises the sequence
  • the single-stranded splint strand (200) comprises the sequence
  • the first region of the single-stranded splint strand (210) includes a universal binding sequence for a first left universal adaptor sequence (120) of a library molecule, where the first region (210) comprises the sequence 5’- TCGGTGGTCGCCGTATCATT -3’ (SEQ ID NO: 196).
  • the second region of the single-stranded splint strand (220) includes a universal binding sequence for a first right universal adaptor sequence (130) of a library molecule, where the second region (220) comprises the sequence 5’- CAAGCAGAAGACGGCATACGA -3’ (SEQ ID NO: 197).
  • the single-stranded splint strand (200) comprises the sequence
  • the present disclosure provides a reaction mixture comprising a plurality of any of the covalently closed circular molecules (400) described herein and at least one exonuclease enzyme.
  • the exonuclease enzyme comprises any one or any combination of two or more of exonuclease I, thermolabile exonuclease I and/or T7 exonuclease.
  • the present disclosure provides at least one kit for circularizing linear nucleic acid library molecules to form a plurality of library-splint complexes (300) each with a nick.
  • the kit can be used to circularize single-stranded linear nucleic acid library molecules having a sequence of interest (110) flanked on one side by at least a first left universal adaptor sequence (120) and flanked on the other side by at least a first right universal adaptor sequence (130).
  • the circularized library molecules can be converted to covalently closed circular molecules which can be subjected to a rolling circle amplification (RCA) reaction to generate nucleic acid concatemers.
  • the concatemers can be immobilized to a support.
  • the immobilized concatemers can be subjected to massively parallel sequencing reactions.
  • kits comprising nucleic acid single-stranded splint strands (200), each comprising a first region (210) and a second region (220).
  • the first region (210) comprises a first universal adaptor sequence which can hybridize to the first universal binding sequence at one end of the linear nucleic acid library molecule.
  • the second region (220) comprises a second universal adaptor sequence which can hybridize to the second universal binding sequence at the other end of the linear nucleic acid library molecule.
  • the first region of the single-stranded splint strand (210) includes a first universal adaptor sequence which comprises a universal binding sequence for a forward or reverse sequencing primer, a universal binding sequence for a first or second surface primer, a universal binding sequence for a forward or reverse amplification primer, or a universal binding sequence for a compaction oligonucleotide.
  • the second region of the single-stranded splint strand (220) includes a second universal adaptor sequence which comprises a universal binding sequence for a forward or reverse sequencing primer, a universal binding sequence for a first or second surface primer, a universal binding sequence for a forward or reverse amplification primer, or a universal binding sequence for a compaction oligonucleotide.
  • the single-stranded splint strand (200) can be 20-150 nucleotides in length, or 60-100 nucleotides in length, or 70-90 nucleotides in length, or 60-80 nucleotides in length.
  • the single-stranded splint strands (200) comprise one or more phosphorothioate linkage at the 5’ and/or 3’ ends to confer exonuclease resistance. In some embodiments, the single-stranded splint strands (200) comprise one or more phosphorothioate linkage at an internal position to confer endonuclease resistance. In some embodiments, the single-stranded splint strands (200) comprise one or more 2’-O-methylcytosine bases at the 5’ and/or 3’ end, or at an internal position. In some embodiments, the 5’ end of the single-stranded splint strand (200) is phosphorylated or nonphosphorylated. In some embodiments, the 3’ end of the single-stranded splint strand (200) comprises a terminal 3’ OH group or a terminal 3’ blocking group.
  • the kit includes a single-stranded splint strand (200) having a first region (210) comprising the sequence 5’- ACCCTGAAAGTACGTGCATTACATG -3’ (SEQ ID NO: 193).
  • the kit includes a single-stranded splint strand (200) having a second region (220) comprising the sequence 5’- GATCAGGTGAGGCTGCGACGACT -3’ (SEQ ID NO: 194).
  • the kit includes a single-stranded splint strand (200) which comprises the sequence
  • the kit further comprises an adaptor having a left universal adaptor sequence (120) for use in preparing a plurality of library molecules, where the library molecules will comprise the sequence 5’- CATGTAATGCACGTACTTTCAGGGT -3’ (SEQ ID NO: 199) which can bind a surface primer.
  • the adaptor having a left universal adaptor sequence (120) also includes a sample index sequence (160).
  • the adaptor can be a single-stranded adaptor (e.g., PCR primer), double-stranded adaptor, bubble adaptor, or Y-shaped adaptor. For example see FIGS. 12 A, B and C.
  • the kit further comprises an adaptor having a right universal adaptor sequence (130) for use in preparing a plurality of library molecules, where the library molecules will comprise the sequence 5’- AGTCGTCGCAGCCTCACCTGATC -3’ (SEQ ID NO:200) which can bind a surface primer.
  • the adaptor having a right universal adaptor sequence (130) also includes a sample index sequence (170).
  • the adaptor can be a single-stranded adaptor (e.g., PCR primer), double-stranded adaptor, bubble adaptor, or Y-shaped adaptor. For example see FIGS. 12 A, B and C.
  • the kit further comprises an adaptor having a left universal adaptor sequence (140) for use in preparing a plurality of library molecules, where the library molecules will comprise the sequence
  • the adaptor having a left universal adaptor sequence (140) also includes a sample index sequence (160).
  • the adaptor can be a single-stranded adaptor (e.g., PCR primer), double-stranded adaptor, bubble adaptor, or Y- shaped adaptor. For example see FIGS. 12 A, B and C.
  • the kit further comprises an adaptor having a right universal adaptor sequence (150) for use in preparing a plurality of library molecules, where the library molecules will comprise the sequence
  • the adaptor having a right universal adaptor sequence (150) also includes a sample index sequence (170).
  • the adaptor can be a single-stranded adaptor (e.g., PCR primer), double-stranded adaptor, bubble adaptor, or Y- shaped adaptor. For example see FIGS. 12 A, B and C.
  • the kit includes a single-stranded splint strand (200) having a first region (210) comprising the sequence 5’ - TCGGTGGTCGCCGTATCATT -3’ (SEQ ID NO: 196).
  • the kit includes a single-stranded splint strand (200) having a second region (220) comprising the sequence 5’- CAAGCAGAAGACGGCATACGA -3’ (SEQ ID NO: 197).
  • the kit includes a single-stranded splint strand (200) which comprises the sequence 5’- TCGGTGGTCGCCGTATCATTCAAGCAGAAGACGGCATACGA -3’ (SEQ ID NO: 198).
  • the kit further comprises an adaptor having a left universal adaptor sequence (120) for use in preparing a plurality of library molecules, where the library molecules will comprise the sequence 5’- AATGATACGGCGACCACCGA -3’ (SEQ ID NO:203) which can bind a surface primer.
  • the adaptor having a left universal adaptor sequence (120) also includes a sample index sequence (160).
  • the adaptor can be a single-stranded adaptor (e.g., PCR primer), double-stranded adaptor, bubble adaptor, or Y-shaped adaptor.
  • the kit further comprises an adaptor having a right universal adaptor sequence (130) for use in preparing a plurality of library molecules, where the library molecules will comprise the sequence 5’- TCGTATGCCGTCTTCTGCTTG -3’ (SEQ ID NO:204) which can bind a surface primer.
  • the adaptor having a right universal adaptor sequence (130) also includes a sample index sequence (170).
  • the adaptor can be a single-stranded adaptor (e.g., PCR primer), double-stranded adaptor, bubble adaptor, or Y-shaped adaptor.
  • the kit further comprises an adaptor having a left universal adaptor sequence (140) for use in preparing a plurality of library molecules, where the library molecules will comprise the sequence
  • the adaptor having a left universal adaptor sequence (140) also includes a sample index sequence (160).
  • the adaptor can be a singlestranded adaptor (e.g., PCR primer), double-stranded adaptor, bubble adaptor, or Y-shaped adaptor.
  • the kit further comprises an adaptor having a right universal adaptor sequence (150) for use in preparing a plurality of library molecules, where the library molecules will comprise the sequence
  • the adaptor having a right universal adaptor sequence (150) also includes a sample index sequence (170).
  • the adaptor can be a single-stranded adaptor (e.g., PCR primer), double-stranded adaptor, bubble adaptor, or Y- shaped adaptor.
  • the kit further comprises an adaptor having a left universal adaptor sequence (140) for use in preparing a plurality of library molecules, where the library molecules will comprise the sequence
  • the adaptor having a left universal adaptor sequence (140) also includes a sample index sequence (160).
  • the adaptor can be a singlestranded adaptor (e.g., PCR primer), double-stranded adaptor, bubble adaptor, or Y-shaped adaptor.
  • the kit further comprises an adaptor having a right universal adaptor sequence (150) for use in preparing a plurality of library molecules, where the library molecules will comprise the sequence
  • the adaptor having a right universal adaptor sequence (150) also includes a sample index sequence (170).
  • the adaptor can be a single-stranded adaptor (e.g., PCR primer), double-stranded adaptor, bubble adaptor, or Y- shaped adaptor.
  • the kit further comprises a plurality of sample indexes including a plurality of first left indexes (160) and/or a plurality of first right index sequence (170).
  • the first left index sequences (160) can be 3-20 nucleotides in length.
  • the first right index sequences (170) can be 3-20 nucleotides in length.
  • the kit can include separate containers or wells of a multi-well plate (e.g., 96-well plate) holding individual first left index (160) or individual first right index (170).
  • the kit can include separate containers or wells of a multi-well plate holding a pair of individual first left index (160) and individual first right index (170).
  • the kit comprises a plurality of tailed PCR primers comprising first left indexes sequences (160).
  • the tailed PCR primers can include: (i) a first left universal adaptor sequence (120) having a binding sequence for a second surface primer; (ii) a first left index sequence (160); and (iii) a second left universal adaptor sequence (140) having a binding sequence for a first or second sequencing primer.
  • the first left index sequence (160) can also include a random sequence (e.g., NNN). See for example FIG. 17.
  • the kit comprises a plurality of tailed PCR primers comprising first right indexes sequences (170).
  • the tailed PCR primers can include: (i) a first right universal adaptor sequence (130) having a binding sequence for a first surface primer; (ii) a first right index sequence (170); and (iii) a second right universal adaptor sequence (150) having a binding sequence for a first or second sequencing primer.
  • the first right index sequence (170) can also include a random sequence (e.g., NNN). See for example FIG. 17.
  • the kit comprises nucleic acid single-stranded splint strands (200) and further comprises a T4 polynucleotide kinase.
  • the kit further comprises a ligase enzyme, wherein the ligase enzyme comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.
  • the kit further comprises at least one endonuclease, which comprises any one or any combination of two or more of exonuclease I, thermolabile exonuclease I and/or T7 exonuclease.
  • the kit comprises at least one buffer for hybridizing the plurality of the single-stranded splint strands (200) and the plurality of nucleic acid library molecules (100).
  • the kit comprises one buffer for conducting multiple enzymatic reactions in a single reaction vessel, including any combination of (i) phosphorylating the 5’ ends of the single-stranded splint strands (200), (ii) ligating the nick in the library-splint complex (300), and/or (iii) exonuclease digestion of the single-stranded splint strand (200) from the covalently closed circular molecule (400).
  • the kit comprises one or more containers that contain any of the single-stranded splint strands (200) described herein.
  • the kit can further comprise one or more containers that contain a T4 polynucleotide kinase, at least one ligase and/or at least one exonuclease.
  • the kit can comprise any of these components in any combination and can be contained in a single container, or can be contained in separate container, or any combination thereof.
  • the kit can include instructions for use of the kit for conducting reactions for circularizing linear nucleic acid library molecules to form a plurality of library-splint complexes (300) each with a nick.
  • the kit can include instructions for use of the kit for generating covalently closed circular library molecules (400) by ligating the nicks in the library-splint complexes (300).
  • the present disclosure provides a library preparation kit for preparing a plurality of linear library molecules by joining both ends of fragmented target nucleic acids (e.g., insert regions (110)) to Y-shaped adaptors to generate a plurality of adaptor-insert-adaptor constructs, and appending additional adaptor sequences to the adaptor-insert-adaptor constructs by conducting primer extension or PCR reactions using a first and second tailed PCR primers (e.g., FIG. 17).
  • the resulting linear library molecules can be circularized to form covalently closed circular molecule using any of the single-stranded splint molecules described herein (e.g., FIGS. 3 and 4).
  • the library preparation kit comprises Y-shaped adaptors.
  • the Y-shaped adaptors comprise a first and second nucleic acid strand, where a portion of the two strands are fully complementary to each other and are annealed together and another portion of the two strands are not complementary to each other and are mismatched.
  • the ligating end of the Y-shaped adaptors comprise the annealed portion that forms a blunt end or an overhang end (e.g., 5’ or 3’ overhang end).
  • the first strand of the Y-shaped adaptor comprises an oligonucleotide having the sequence 5’- TGTCGGAAGGTGTGCAGGCTACCGCTTGTCAACT-3’ (SEQ ID N0:211).
  • the second strand of the Y-shaped adaptor comprises an oligonucleotide having the sequence
  • the library preparation kit comprises first tailed PCR primers comprising the sequence 5’ - GATCAGGTGAGGCTGCGACGACTNNNNNNNNNNNN AGTTGACAAGCGGTAGCCTGCACACCTTCCGACAT-3’ (SEQ ID NO:213) wherein the 12 base N-sequence represents the right sample index sequence (170).
  • the first nine ‘Ns’ in the 12 base N-sequence comprise the universal sample index sequence of the right sample index.
  • the last three ‘NNN’ (underlined) in the 12 base N-sequence comprises the 3-mer random sequence this is designed to provide nucleotide diversity and color balance in each sequencing cycle.
  • the library preparation kit comprises second tailed PCR primers comprising the sequence 5’- CATGTAATGCACGTACTTTCAGGGTNNNNNNNNNN CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT-3’ (SEQ ID NO:214) wherein the 10 base N-sequence represents the left sample index sequence (160).
  • the 10 base N-sequence comprises the universal sample index sequence of the left sample index.
  • the present disclosure provides methods for forming a plurality of library-splint complexes (300) comprising: (a) providing a plurality of single-stranded nucleic acid library molecules (100) wherein individual library molecules in the plurality include a sequence of interest (110) flanked on one side by at least a first left universal adaptor sequence (120) and flanked on the other side by at least a first right universal adaptor sequence (130) (e.g., see FIGS. 1-5).
  • the methods for forming a plurality of library-splint complexes (300) further comprise step (b): providing a plurality of single-stranded splint strands (200) wherein individual single-stranded splint strands (200) in the plurality comprise a first region (210) that is capable of hybridizing with the at least a first left universal adaptor sequence (120) of an individual library molecule, and a second region (220) that is capable of hybridizing with the at least a first right universal adaptor sequence (130) of an individual library molecule.
  • Exemplary single-stranded splint strands (200) are shown in FIGS. 1-5.
  • the single-stranded splint strand (200) can be 20-150 nucleotides in length, or 60-100 nucleotides in length, or 70-90 nucleotides in length, or 60-80 nucleotides in length.
  • the methods for forming a plurality of library-splint complexes (300) further comprise step (c): hybridizing the plurality of single-stranded splint strands (200) with plurality of single-stranded nucleic acid library molecules (100).
  • the hybridizing is conducted under a condition suitable for hybridizing individual library molecules with individual single-stranded splint strands such that the first region of one of the singlestranded splint strands (210) anneals to the at least first left universal adaptor sequence (120) of the library molecule, and such that the second region of the single-stranded splint strand (220) anneals to the at least first right universal sequence (130) of the library molecule, thereby circularizing individual library molecules to form a plurality of library-splint complexes (300).
  • the library-splint complex (300) comprises a nick between the terminal 5’ and 3’ ends of the library molecule (e.g., FIGS. 1-5).
  • the nick is enzymatically ligatable.
  • the first region of the single-stranded splint strand (210) comprises a first universal adaptor sequence which can hybridize to a first universal binding sequence at one end of a linear nucleic acid library molecule (120).
  • the first region of the single-stranded splint strand (210) includes a first universal adaptor sequence which comprises a universal binding sequence for a forward or reverse sequencing primer, a universal binding sequence for a first or second surface primer, a universal binding sequence for a forward or reverse amplification primer, or a universal binding sequence for a compaction oligonucleotide.
  • the second region of the single-stranded splint strand (220) comprises a second universal adaptor sequence which can hybridize to a second universal binding sequence at the other end of the linear nucleic acid library molecule.
  • the second region of the single-stranded splint strand (220) includes a second universal adaptor sequence which comprises a universal binding sequence for a forward or reverse sequencing primer, a universal binding sequence for a first or second surface primer, a universal binding sequence for a forward or reverse amplification primer, or a universal binding sequence for a compaction oligonucleotide.
  • the single-stranded splint strands (200) comprise one or more phosphorothioate linkage at their 5’ and/or 3’ ends to confer exonuclease resistance. In some embodiments, the single-stranded splint strands (200) comprise one or more phosphorothioate linkage at an internal position to confer endonuclease resistance. In some embodiments, the single-stranded splint strands (200) comprise one or more 2’-O- methylcytosine bases at their 5’ and/or 3’ ends, or at an internal position.
  • the 5’ end of the single-stranded splint strand (200) is phosphorylated or nonphosphorylated.
  • the 3’ end of the single-stranded splint strand (200) comprises a terminal 3’ OH group or a terminal 3’ blocking group.
  • the first region of the single-stranded splint strand (210) can hybridize to a sense or anti-sense strand of a double-stranded nucleic acid library molecule.
  • the second region of the single-stranded splint strand (220) can hybridize to a sense or anti-sense strand of a double-stranded nucleic acid library molecule.
  • the double-stranded nucleic acid library molecule can be denatured to generate the singlestranded sense and anti-sense library strands.
  • the double-stranded nucleic acid library molecule can be denatured to generate the single-stranded nucleic acid library molecules (100) of step (a).
  • the first and second regions (210 and 220, respectively) of the singlestranded splint strand do not hybridize to the sequence of interest (110).
  • the nucleic acid library molecule (100) further comprises a second left universal adaptor sequence (140). In some embodiments, the nucleic acid library molecule (100) further comprises a second right universal adaptor sequence (150). In some embodiments, the nucleic acid library molecule (100) can further comprise additional left and/or right universal adaptor sequences.
  • the nucleic acid library molecule (100) further comprises a first left index sequence (160) and/or a first right index sequence (170).
  • the first left index sequence (160) comprises a sample index sequence.
  • the first left index sequence (160) can be 3-20 nucleotides in length.
  • the first right index sequence (170) comprises another sample index sequence.
  • the first right index sequence (170) can be 3-20 nucleotides in length.
  • the sequences of the left and right sample index sequences e.g., (160) and (170) can be the same or different from each other.
  • the first left index sequences (160) and/or first right index sequences (170) can be employed to prepare separate sample- indexed libraries using input nucleic acids isolated from different sources.
  • the sample- indexed libraries can be pooled together to generate a multiplex library mixture, and the pooled libraries can be circularized, amplified and/or sequenced.
  • the sequences of the insert region along with the first left index sequence (160) and/or first right index sequence (170) can be used to identify the source of the input nucleic acids.
  • any number of sample-indexed libraries can be pooled together, for example 2-10, or 10-50, or 50-100, or 100-200, or more than 200 sample-indexed libraries can be pooled.
  • Exemplary nucleic acid sources include naturally-occurring, recombinant, or chemically-synthesized sources.
  • Exemplary nucleic acid sources include single cells, a plurality of cells, tissue, biological fluid, environmental sample or whole organism.
  • Exemplary nucleic acid sources include fresh, frozen, fresh-frozen or archived sources (e.g., formalin-fixed paraffin- embedded; FFPE). The skilled artisan will recognize that the nucleic acids can be isolated from many other sources.
  • the nucleic acid library molecules can be prepared in singlestranded or double-stranded form.
  • the nucleic acid library molecule (100) further comprises: an optional first left unique identification sequence (180) and/or an optional first right unique identification sequence (190).
  • the first left unique identification sequence (180) and the first right unique identification sequence (190) each comprise a sequence that is used to uniquely identify an individual sequence of interest (e.g., insert sequence) to which the unique adaptors are appended in a population of other sequence of interest molecules.
  • the first left unique identification sequence (180) and/or the first right unique identification sequence (190) can be used for molecular tagging.
  • the nucleic acid library molecule (100) comprises any one or any combination and in any order of two or more: a first left universal adaptor sequence (120); a second left universal adaptor sequence (140); a first left index sequence (160); a first left unique identification sequence (180); a first right universal adaptor sequence (130); a second right universal adaptor sequence (150); a first right index sequence (170); and/or a first right unique identification sequence (190).
  • the first left universal adaptor sequence (120) and/or the second left universal adaptor sequence (1 0) comprises: a universal binding sequence for a forward or reverse sequencing primer; a universal binding sequence for a first or second surface primer; a universal binding sequence for a forward or reverse amplification primer; and/or a universal binding sequence for a compaction oligonucleotide.
  • the nucleic acid library molecule (100) can further comprise additional left universal adaptor sequences.
  • the first right universal adaptor sequence (130) and/or the second right universal adaptor sequence (150) comprises: a universal binding sequence for a forward or reverse sequencing primer; a universal binding sequence for a first or second surface primer; a universal binding sequence for a forward or reverse amplification primer; and/or a universal binding sequence for a compaction oligonucleotide.
  • the nucleic acid library molecule (100) can further comprise additional right universal adaptor sequences.
  • the nucleic acid library molecule (100) further comprises at least one junction adaptor sequence located between any of the universal adaptor sequences described herein (e.g., see FIG. 5).
  • a first left junction adaptor sequence (125) can be located between the first left universal adaptor sequence (120) and the first left index sequence (160).
  • a second left junction adaptor sequence (165) can be located between the first left index sequence (160) and the second left universal adaptor sequence (140).
  • a third junction adaptor sequence (145) can be located between the second left universal adaptor sequence (140) and the sequence-of-interest (110).
  • a first right junction adaptor sequence (135) can be located between the first right universal sequence (130) and the first right index sequence (170).
  • a second right junction adaptor sequence (175) can be located between the first right index sequence (170) and the second right universal adaptor sequence (150).
  • a third right junction adaptor sequence (155) can be located between the second right universal adaptor sequence (150) and the sequence-of-interest (110).
  • Any of the junction adaptor sequences comprise any sequence and can be 3-60 nucleotides in length.
  • Any of the junction adaptor sequences comprise a universal sequence or a unique sequence.
  • Any of the junction adaptor sequences comprise a random sequence (e.g., NNN) having 3-20 nucleotides.
  • junction adaptor sequences comprise a binding sequence for an amplification primer, a sequencing primer or a compaction oligonucleotide. Any of the junction adaptor sequences comprise a binding sequence for an immobilized surface primer (e.g., capture primer). Any of the junction adaptor sequences comprise a sample index sequence. Any of the junction adaptor sequences comprise a unique identification sequence. Any of the junction adaptor sequences, particularly junction adaptor sequence (145) comprises a Tn5 transposon-end sequence 5’- AGATGTGTATAAGAGACAG -3’ (SEQ ID NO:209).
  • junction adaptor sequences particularly junction adaptor sequence (155) comprises a Tn5 transposonend sequence 5’- CTGTCTCTTATACACATCT -3’ (SEQ ID NO:210).
  • the Tn5 transposonend sequences can be introduced into the library molecule (100) via a transposase-mediated reaction which includes contacting double-stranded input DNA (e.g., genomic DNA) with a Tn-5 type transposase enzyme, and a double-stranded oligonucleotide comprising the Tn transposon-end sequence (SEQ ID NO: 209) linked to a universal adaptor sequence or a sample index sequence under a condition that is suitable to form a transposon synaptic complex.
  • the Tn transposon-end sequence can be located 5’ or 3’ relative to the universal adaptor sequence or a sample index sequence.
  • the present disclosure provides methods for forming a plurality of library-splint complexes (300) comprising: (a) providing a plurality of single-stranded splint strands (200) wherein individual single-stranded splint strands (200) comprises regions arranged in a 5’ to 3’ order (i) a first region (210) having a universal binding sequence that hybridizes with a sequence on one end of the linear single stranded library molecule (e.g., 120), and (ii) a second region (220) having a universal binding sequence that hybridizes with a sequence on the other end of the linear single stranded library molecule (e.g., 130).
  • the methods for forming a plurality of library-splint complexes (300) further comprises step (b): hybridizing the plurality of single-stranded splint strands (200) with a plurality of single-stranded nucleic acid library molecules (100) wherein individual library molecules comprise regions arranged in a 5’ to 3’ order: (i) a first left universal adaptor sequence (120) having a binding sequence for a second surface primer; (ii) a second left universal adaptor sequence (140) having a binding sequence for a first or second sequencing primer; (iii) a sequence of interest (110); (iv) a second right universal adaptor sequence (150) having a binding sequence for a second or first sequencing primer; and (v) a first right universal adaptor sequence (130) having a binding sequence for a first surface primer, wherein the hybridizing is conducted under a condition suitable to hybridize the single-stranded splint strand (200) to the library molecule (100) thereby circularizing
  • the plurality of single-stranded nucleic acid library molecules (100) further comprise a first left index sequence (160) and/or a first right index sequence (170) (e.g., see FIGS. 3 and 4).
  • the sequences of the first left index (160) and the first right index (170) are the same or different from each other.
  • the first left index sequence (160) can be 3-20 nucleotides in length.
  • the first right index sequence (170) can be 3-20 nucleotides in length.
  • the first left index sequence (160) and/or the first right index sequence (170) can include a short random sequence (e.g., NNN).
  • the short random sequence can be 3-20 nucleotides in length.
  • a list of exemplary first left index sequences (160) and first right index sequences (170) is provided in Table 1 at FIGS. 9A-9F.
  • the plurality of singlestranded nucleic acid library molecules (100) further comprise a first left unique identification sequence (180) and/or a first right unique identification sequence (190) which can be used for molecular tagging (e.g., see FIGS. 3 and 4).
  • the first left universal adaptor sequence (120) in the library molecules comprise the sequence 5’ - CATGTAATGCACGTACTTTCAGGGT -3’ (SEQ ID NO: 199).
  • the first left universal adaptor sequence (120) in the library molecules comprise the sequence 5’- AATGATACG GCGACCACCGA -3’ (SEQ ID NO:203).
  • the second left universal adaptor sequence (140) in the library molecules comprise the sequence 5’- CGTGCTGGATTGGCTCACCAGACACCTTCCGACAT -3’ (SEQ ID NO:201).
  • the second left universal adaptor sequence (140) in the library molecules comprise the sequence 5’- ACACTCTTTCCCTACACGACGCTCTTCCGATCT -3’ (SEQ ID NO:205).
  • the second left universal adaptor sequence (140) in the library molecules comprise the sequence 5’- TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG -3’ (SEQ ID NO:206).
  • the second right universal adaptor sequence (150) in the library molecules comprise the sequence
  • the second right universal adaptor sequence (150) in the library molecules comprise the sequence
  • the second right universal adaptor sequence (150) in the library molecules comprise the sequence
  • the first right universal adaptor sequence (130) in the library molecules comprise the sequence 5’- AGTCGTCGCAGCCTCACCTGATC -3’ (SEQ ID NO:200).
  • the first region of the single-stranded splint strand (210) includes a universal binding sequence for a first left universal adaptor sequence (120) of a library molecule, where the first region (210) comprises the sequence 5’- ACCCTGAAAGTACGTGCATTACATG -3’ (SEQ ID NO: 193).
  • the second region of the single-stranded splint strand (220) includes a universal binding sequence for a first right universal adaptor sequence (130) of a library molecule, where the second region (220) comprises the sequence 5’- GATCAGGTGAGGCTGCGACGACT -3’ (SEQ ID NO: 194).
  • the single-stranded splint strand (200) comprises the sequence
  • the first region of the single-stranded splint strand (210) includes a universal binding sequence for a first left universal adaptor sequence (120) of a library molecule, where the first region (210) comprises the sequence 5’- TCGGTGGTCGCCGTATCATT -3’ (SEQ ID NO: 196).
  • the second region of the single-stranded splint strand (220) includes a universal binding sequence for a first right universal adaptor sequence (130) of a library molecule, where the second region (220) comprises the sequence 5’- CAAGCAGAAGACGGCATACGA -3’ (SEQ ID NO: 197).
  • any of the methods for forming a plurality of library-splint complexes (300) described herein can further comprises at least one enzymatic reaction, including a phosphorylation reaction, ligation reaction and/or exonuclease reaction.
  • the enzymatic reactions can be conducted sequentially or essentially simultaneously.
  • the enzymatic reactions can be conducted in a single reaction vessel.
  • a first enzymatic reaction can be conducted in a first reaction vessel, then transferred to a second reaction vessel where the second enzymatic reaction is conducted, then transferred to a third reaction vessel where the third enzymatic reaction is conducted.
  • any of the methods for forming a plurality of library-splint complexes (300) described herein further comprise conducting separate and sequential phosphorylation and ligation reactions which are conducted in separate reaction vessels.
  • the methods for forming a plurality of library-splint complexes (300) further comprise step (cl): contacting in a first reaction vessel the plurality of the singlestranded splint strands (200) and the plurality of the single-stranded nucleic acid library molecules (100) with a T4 polynucleotide kinase enzyme under a condition suitable to phosphorylate the 5’ ends of the plurality of single-stranded splint strands (200) and/or the plurality of single-stranded nucleic acid library molecules (100); and transferring the phosphorylation reaction to a second reaction vessel.
  • the methods for forming a plurality of library-splint complexes (300) further comprise step (dl): contacting in the second reaction vessel the plurality of phosphorylated single-stranded splint strands (200) and the plurality of phosphorylated single-stranded nucleic acid library molecules (100) with a ligase, under a condition suitable to enzymatically ligate the nicks, thereby generating a plurality of covalently closed circular library molecules (400) each hybridized to a singlestranded splint strand (200).
  • the ligase enzyme comprises T7 DNA ligase, T3 ligase, T4 ligase, or Taq ligase.
  • any of the methods for forming a plurality of library-splint complexes (300) described herein further comprise conducting sequential phosphorylation and ligation reactions which are conducted sequentially in the same reaction vessel.
  • the methods for forming a plurality of library-splint complexes (300) further comprise step (c2): contacting in a first reaction vessel the plurality of the single-stranded splint strands (200) and the plurality of the single-stranded nucleic acid library molecules (100) with a T4 polynucleotide kinase enzyme under a condition suitable to phosphorylate the 5’ ends of the plurality of single-stranded splint strands (200) and the plurality of singlestranded nucleic acid library molecules (100).
  • any of the methods for forming a plurality of library-splint complexes (300) described herein further comprise conducting essentially simultaneous phosphorylation and ligation reactions which are conducted together in the same reaction vessel.
  • the methods for forming a plurality of library-splint complexes (300) further comprise step (c3): contacting in a first reaction vessel the plurality of the single-stranded splint strands (200) and the plurality of the single-stranded nucleic acid library molecules (100) with a (i) T4 polynucleotide kinase enzyme and (ii) a ligase enzyme, under a condition suitable to phosphorylate the 5’ ends of the plurality of single-stranded splint strands (200) and the plurality of single-stranded nucleic acid library molecules (100), and the conditions are suitable to enzymatically ligate the nicks, thereby generating a plurality
  • the present disclosure provides methods for conducting rolling circle amplification reaction on the covalently closed circular library molecules (400).
  • the rolling circle amplification reaction can be conducted after the phosphorylation and ligation reactions, or after the ligation reaction.
  • the rolling circle amplification reaction can be conducted on covalently closed circular library molecules (400) that are hybridized to the single-stranded splint strands (200).
  • the rolling circle amplification reaction can be conducted on covalently closed circular library molecules (400) that are no longer hybridized to the single-stranded splint strands (200), for example following the exonuclease reaction.
  • the methods for conducting rolling circle amplification reaction on a plurality of covalently closed circular library molecules which lack hybridized single-stranded splint strands (200), and wherein individual covalently closed circular library molecules (400) in the plurality comprise a universal binding sequence for a first surface primer comprise step (a): distributing the plurality of covalently closed circular library molecules (400) onto a support having a plurality of the first surface primers immobilized on the support, under a condition suitable for hybridizing individual covalently closed circular library molecules (400) to individual immobilized first surface primers thereby immobilizing the plurality of covalently closed circular library molecules (400) to the support.
  • the plurality of the first surface primers immobilized on the support comprise the sequence 5’- GATCAGGTGAGGCTGCGACGACT -3’ (SEQ ID NO: 194).
  • the plurality of the first surface primers immobilized on the support comprise the sequence 5’- CAAGCAGAAGACGGCATACGA -3’ (SEQ ID NO: 197).
  • the plurality of nucleotides comprises any combination of two or more of dATP, dGTP, dCTP, dTTP and/or dUTP.
  • individual immobilized concatemers are covalently joined to individual first surface primers.
  • individual covalently closed circular library molecules (400) in the plurality comprise universal binding sequences for a first and second surface primer (e.g., (130) and (120) respectively) so that the rolling circle amplification reaction generates concatemer molecules having multiple tandem copies of universal binding sequences for first and second surface primers.
  • the support further comprises a plurality of second surface primers.
  • the plurality of the second surface primers immobilized on the support comprise the sequence 5’ - CATGTAATGCACGTACTTTCAGGGT -3’ (SEQ ID NO: 199 or a complementary sequence thereof).
  • the plurality of the second surface primers immobilized on the support comprise the sequence 5’- AATGATACGGCGACCACCGA -3’ (SEQ ID NO:203 or a complementary sequence thereof).
  • Individual second surface primers can hybridize to a portion of the concatemer molecules having a universal binding sequence for the second surface primer.
  • the immobilized second surface primers serve to pin down at least one portion of the concatemer molecules to the support.
  • the immobilized second surface primers have a non-extendible 3’ end and cannot be used for amplification.
  • the immobilized concatemers can be subjected to sequencing reactions.
  • the plurality of covalently closed circular library molecules (400) can be distributed onto a support that is coated with one or more compounds to produce a passivated layer on the support (e.g., FIG. 18).
  • the passivated layer forms a porous or semi-porous layer.
  • one or more types of surface primers, concatemer template molecules and/or polymerases can be attached to the passivated layer for immobilization to the support.
  • the support comprises a low nonspecific binding surface that enable improved nucleic acid hybridization and amplification performance on the support.
  • the support may comprise one or more layers of a covalently or non-covalently attached low-binding, chemical modification layers, e.g., silane layers, polymer films, and one or more covalently or non-covalently attached oligonucleotides that can be used for immobilizing a plurality of nucleic acid concatemer molecules to the support.
  • the support can comprise a functionalized polymer coating layer covalently bound at least to a portion of the support via a chemical group on the support, a primer grafted to the functionalized polymer coating, and a water- soluble protective coating on the primer and the functionalized polymer coating.
  • the functionalized polymer coating comprises a poly(N-(5- azidoacetamidylpentyl)acrylamide-co-acrylamide (PAZAM).
  • the support comprises a surface coating having at least one hydrophilic polymer coating layer and at least one layer of a plurality of oligonucleotides.
  • the hydrophilic polymer coating layer can comprise polyethylene glycol (PEG).
  • the hydrophilic polymer coating layer can comprise branched PEG having at least 4 branches.
  • the low nonspecific binding coating has a degree of hydrophilicity which can be measured as a water contact angle, where the water contact angle is no more than 45 degrees.
  • the density of the covalently closed circular library molecules (400) immobilized to the support or immobilized to the coating on the support is about 10 2 - 10 6 per mm 2 , or about 10 6 - 10 9 per mm 2 , or about 10 9 - 10 12 per mm 2 .
  • the plurality of covalently closed circular library molecules (400) are immobilized to the support or immobilized to the coating on the support at pre-determined sites on the support (or the coating on the support), or immobilized to the coating on the support at random sites on the support (or the coating on the support).
  • the high efficiency hybridization buffer comprises: (i) the first polar aprotic solvent comprises acetonitrile at 25- 50% by volume of the hybridization buffer; (ii) the second polar aprotic solvent comprises formamide at 5-10% by volume of the hybridization buffer; (iii) the pH buffer system comprises 2-(A-morpholino)ethanesulfonic acid (MES) at a pH of 5-6.5; and (iv) the crowding agent comprises polyethylene glycol (PEG) at 5-35% by volume of the hybridization buffer.
  • the high efficiency hybridization buffer further comprises betaine.
  • the methods for conducting rolling circle amplification reaction on a plurality of covalently closed circular library molecules (400) which lack hybridized single-stranded splint strands (200), wherein individual covalently closed circular library molecules (400) in the plurality comprise a universal binding sequence for a forward amplification primer and a universal binding sequence for a first surface primer comprises: (a) hybridizing in solution a plurality of covalently closed circular library molecules and a plurality of soluble forward amplification primers; and (b) conducting a first rolling circle amplification reaction by contacting the plurality of covalently closed circular library molecules (400) with a plurality of strand-displacing polymerases and a plurality of nucleotides, under a condition suitable to conduct a rolling circle amplification reaction in solution using the plurality of forward amplification primers and the plurality of covalently closed circular library molecules (400) as template molecules, thereby generating a plurality of nucleic acid
  • the methods for conducting rolling circle amplification reaction further comprises step (d): contacting the immobilized plurality of concatemer molecules with a plurality of strand-displacing polymerases and a plurality of nucleotides, under a condition suitable to conduct a second rolling circle amplification reaction on the support using the plurality of covalently closed circular library molecules (400) as template molecules, thereby extending the plurality of immobilized nucleic acid concatemer molecules.
  • the first and/or the second rolling circle amplification reactions can be conducted with a plurality of nucleotides which comprise any combination of two or more of dATP, dGTP, dCTP, dTTP and/or dUTP.
  • individual immobilized concatemers are hybridized to individual first surface primers.
  • individual covalently closed circular library molecules (400) in the plurality comprise universal binding sequences for a first and second surface primer (e.g., (130) and (120) respectively) so that the in-solution rolling circle amplification reaction generates concatemer molecules having multiple tandem copies of universal binding sequences for first and second surface primers.
  • the support further comprises a plurality of second surface primers.
  • the immobilized second surface primers serve to pin down at least one portion of the concatemer molecules to the support.
  • the immobilized second surface primers have a non-extendible 3’ end and cannot be used for amplification.
  • the immobilized concatemers can be subjected to sequencing reactions.
  • the plurality of the first surface primers immobilized on the support comprise the sequence 5’- CAAGCAGAAGACGGCATACGA -3’ (SEQ ID NO: 197).
  • Individual first surface primers can hybridize to a covalently closed circular library molecule (400) having a universal binding sequence for the first surface primer.
  • the immobilized second surface primers serve to pin down at least one portion of the concatemer molecules to the support.
  • the immobilized second surface primers have a non-extendible 3’ end and cannot be used for amplification.
  • the immobilized concatemers can be subjected to sequencing reactions.
  • the plurality of concatemer molecules of step (c) can be distributed onto a support that is coated with one or more compounds to produce a passivated layer on the support (e.g., FIG. 18).
  • the passivated layer forms a porous or semi-porous layer.
  • the one or more types of surface primers, concatemer template molecules and/or polymerases can be attached to the passivated layer for immobilization to the support.
  • the support comprises a low nonspecific binding surface that enable improved nucleic acid hybridization and amplification performance on the support.
  • the support may comprise one or more layers of a covalently or non-covalently attached low-binding, chemical modification layers, e.g., silane layers, polymer films, and one or more covalently or non-covalently attached oligonucleotides that can be used for immobilizing a plurality of nucleic acid concatemer molecules to the support.
  • the support can comprise a functionalized polymer coating layer covalently bound at least to a portion of the support via a chemical group on the support, a primer grafted to the functionalized polymer coating, and a water- soluble protective coating on the primer and the functionalized polymer coating.
  • the density of the concatemer molecules immobilized to the support or immobilized to the coating on the support is about 10 2 - 10 6 per mm 2 , or about 10 6 - 10 9 per mm 2 , or about 10 9 - 10 12 per mm 2 .
  • the plurality of the concatemer molecules are immobilized to the support or immobilized to the coating on the support at predetermined sites on the support (or the coating on the support), or immobilized to the coating on the support at random sites on the support (or the coating on the support).
  • the distributing of step (c) can be conducted in the presence of a high-efficiency hybridization buffer which comprises: (i) a first polar aprotic solvent having a dielectric constant that is no greater than 40 and having a polarity index of 4-9; (ii) a second polar aprotic solvent having a dielectric constant that is no greater than 115 and is present in the hybridization buffer formulation in an amount effective to denature doublestranded nucleic acids; (iii) a pH buffer system that maintains the pH of the hybridization buffer formulation in a range of about 4-8; and (iv) a crowding agent in an amount sufficient to enhance or facilitate molecular crowding.
  • a high-efficiency hybridization buffer which comprises: (i) a first polar aprotic solvent having a dielectric constant that is no greater than 40 and having a polarity index of 4-9; (ii) a second polar aprotic solvent having a dielectric constant that is no greater than 115 and is present in the hybridization buffer
  • the high efficiency hybridization buffer comprises: (i) the first polar aprotic solvent comprises acetonitrile at 25- 50% by volume of the hybridization buffer; (ii) the second polar aprotic solvent comprises formamide at 5-10% by volume of the hybridization buffer; (iii) the pH buffer system comprises 2-( r -morpholino)ethanesulfonic acid (MES) at a pH of 5-6.5; and (iv) the crowding agent comprises polyethylene glycol (PEG) at 5-35% by volume of the hybridization buffer.
  • the high efficiency hybridization buffer further comprises betaine.
  • the methods for conducting rolling circle amplification reaction further comprises step (b): distributing the plurality of concatemer molecules which are hybridized to their covalently closed circular library molecule (400) onto a support having a plurality of the first surface primers immobilized thereon, under a condition suitable for hybridizing at least a portion of the concatemers to the plurality of the immobilized first surface primers thereby immobilizing the plurality of concatemer molecules.
  • the plurality of immobilized concatemer molecules are still hybridized to their covalently closed circular library molecules (400).
  • the first and/or the second rolling circle amplification reactions can be conducted with a plurality of nucleotides which comprise any combination of two or more of dATP, dGTP, dCTP, dTTP and/or dUTP.
  • individual immobilized concatemers are hybridized to individual first surface primers.
  • individual covalently closed circular library molecules (400) in the plurality comprise universal binding sequences for a first and second surface primer (e.g., (130) and (120) respectively) so that the in-solution rolling circle amplification reaction generates concatemer molecules having multiple tandem copies of universal binding sequences for first and second surface primers.
  • the support further comprises a plurality of second surface primers.
  • the immobilized second surface primers serve to pin down at least one portion of the concatemer molecules to the support.
  • the immobilized second surface primers have a non-extendible 3’ end and cannot be used for amplification.
  • the immobilized concatemers can be subjected to sequencing reactions.
  • the plurality of the second surface primers immobilized on the support comprise the sequence 5’- AATGATACGGCGACCACCGA -3’ (SEQ ID NO:203 or a complementary sequence thereof). Individual second surface primers can hybridize to a portion of the concatemer molecules having a universal binding sequence for the second surface primer.
  • the immobilized second surface primers serve to pin down at least one portion of the concatemer molecules to the support.
  • the immobilized second surface primers have a non-extendible 3’ end and cannot be used amplification.
  • the immobilized concatemers can be subjected to sequencing reactions.
  • the support may comprise one or more layers of a covalently or non-covalently attached low-binding, chemical modification layers, e.g., silane layers, polymer films, and one or more covalently or non-covalently attached oligonucleotides that can be used for immobilizing a plurality of nucleic acid concatemer molecules to the support.
  • the support can comprise a functionalized polymer coating layer covalently bound at least to a portion of the support via a chemical group on the support, a primer grafted to the functionalized polymer coating, and a water-soluble protective coating on the primer and the functionalized polymer coating.
  • the functionalized polymer coating comprises a poly(N-(5-azidoacetamidylpentyl)acrylamide-co-acrylamide (PAZAM).
  • the support comprises a surface coating having at least one hydrophilic polymer coating layer and at least one layer of a plurality of oligonucleotides.
  • the hydrophilic polymer coating layer can comprise polyethylene glycol (PEG).
  • the hydrophilic polymer coating layer can comprise branched PEG having at least 4 branches.
  • the low non-specific binding coating has a degree of hydrophilicity which can be measured as a water contact angle, where the water contact angle is no more than 45 degrees.
  • the density of the concatemer molecules immobilized to the support or immobilized to the coating on the support is about 10 2 - 10 6 per mm 2 , or about 10 6 - 10 9 per mm 2 , or about 10 9 - 10 12 per mm 2 .
  • the plurality of the concatemer molecules are immobilized to the support or immobilized to the coating on the support at pre-determined sites on the support (or the coating on the support), or immobilized to the coating on the support at random sites on the support (or the coating on the support).
  • the distributing of step (b) can be conducted in the presence of a high-efficiency hybridization buffer which comprises: (i) a first polar aprotic solvent having a dielectric constant that is no greater than 40 and having a polarity index of 4-9; (ii) a second polar aprotic solvent having a dielectric constant that is no greater than 115 and is present in the hybridization buffer formulation in an amount effective to denature doublestranded nucleic acids; (iii) a pH buffer system that maintains the pH of the hybridization buffer formulation in a range of about 4-8; and (iv) a crowding agent in an amount sufficient to enhance or facilitate molecular crowding.
  • a high-efficiency hybridization buffer which comprises: (i) a first polar aprotic solvent having a dielectric constant that is no greater than 40 and having a polarity index of 4-9; (ii) a second polar aprotic solvent having a dielectric constant that is no greater than 115 and is present in the hybridization buffer
  • the high efficiency hybridization buffer comprises: (i) the first polar aprotic solvent comprises acetonitrile at 25- 50% by volume of the hybridization buffer; (ii) the second polar aprotic solvent comprises formamide at 5-10% by volume of the hybridization buffer; (iii) the pH buffer system comprises 2-(A-morpholino)ethanesulfonic acid (MES) at a pH of 5-6.5; and (iv) the crowding agent comprises polyethylene glycol (PEG) at 5-35% by volume of the hybridization buffer.
  • the high efficiency hybridization buffer further comprises betaine.
  • the present disclosure provides methods for sequencing any of the immobilized concatemer molecules described herein. Any of the methods for conducting rolling circle amplification reaction described herein can be used to generate a plurality of concatemer molecules immobilized to a support, and the immobilized concatemers can be subjected to sequencing reactions.
  • the sequencing reactions employ detectably labeled nucleotide analogs.
  • the sequencing reactions employ a two- stage sequencing reaction comprising binding detectably labeled multivalent molecules, and incorporating nucleotide analogs.
  • the sequencing reactions employ non-labeled nucleotide analogs.
  • concatemer molecule and template molecule are used interchangeably.
  • the tandem repeat unit comprises: (i) a first left universal adaptor sequence (120) having a binding sequence for a second surface primer, (ii) a second left universal adaptor sequence (140) having a binding sequence for a first sequencing primer, (iii) a sequence-of-interest (110), (iv) a second right universal adaptor sequence (150) having a binding sequence for a second sequencing primer, (v) a first right universal adaptor sequence (130) having a binding sequence for a first surface primer, and (vii) a first left index sequence (160) and/or a first right index sequence (170) (e.g., see FIGS. 3 and 4).
  • the tandem repeat unit further comprises a first left unique identification sequence (180) and/or a first right unique identification sequence (190).
  • the sequencing reaction employs detectably labeled nucleotides and/or detectably labeled multivalent molecules (e.g., having nucleotide units)
  • the signals emitted by the nucleotides or nucleotide units that participate in the parallel sequencing reactions along the concatemer yields an increased signal intensity for each concatemer.
  • Multiple portions of a given concatemer can be simultaneously sequenced.
  • a plurality of binding complexes can form along a particular concatemer molecule, each binding complex comprising a sequencing polymerase bound to a multivalent molecule wherein the plurality of binding complexes remain stable without dissociation resulting in increased persistence time which increases signal intensity and reduces imaging time.
  • the present disclosure provides methods for sequencing any of the immobilized concatemer molecules described herein, the methods comprising step (a): contacting a sequencing polymerase to (i) a nucleic acid concatemer molecule and (ii) a nucleic acid sequencing primer, wherein the contacting is conducted under a condition suitable to bind the sequencing polymerase to the nucleic acid concatemer molecule which is hybridized to the nucleic acid primer, wherein the nucleic acid concatemer molecule hybridized to the nucleic acid primer forms the nucleic acid duplex.
  • the sequencing polymerase comprises a recombinant mutant sequencing polymerase that can bind and incorporate nucleotide analogs.
  • the sequencing primer comprises a 3’ extendible end.
  • the plurality of nucleic acid concatemer molecules and/or the plurality of nucleic acid primers are in solution or are immobilized to a support. In some embodiments, when the plurality of nucleic acid concatemer molecules and/or the plurality of nucleic acid primers are immobilized to a support, the binding with the first sequencing polymerase generates a plurality of immobilized first complexed polymerases. In some embodiments, the plurality of nucleic acid concatemer molecules and/or nucleic acid primers are immobilized to 10 2 - 10 15 different sites on a support.
  • the methods for sequencing further comprise step (d): repeating the incorporating at least one nucleotide into the 3’ end of the extendible primer of steps (b) and (c) at least once.
  • the plurality of nucleotides comprises a plurality of nucleotides labeled with detectable reporter moiety.
  • the detectable reporter moiety comprises a fluorophore.
  • the fluorophore is attached to the nucleotide base.
  • the fluorophore is attached to the nucleotide base with a linker which is cleavable/removable from the base.
  • the first stage comprises step (a): contacting a plurality of a first sequencing polymerase to (i) a plurality of nucleic acid concatemer molecules and (ii) a plurality of nucleic acid sequencing primers, wherein the contacting is conducted under a condition suitable to bind the plurality of first sequencing polymerases to the plurality of nucleic acid concatemer molecules and the plurality of nucleic acid primers thereby forming a plurality of first complexed polymerases each comprising a first sequencing polymerase bound to a nucleic acid duplex wherein the nucleic acid duplex comprises a nucleic acid concatemer molecule hybridized to a nucleic acid primer.
  • the first polymerase comprises a recombinant mutant sequencing polymerase.
  • the sequencing primer comprises a 3’ extendible end.
  • the methods for sequencing further comprise step (b): contacting the plurality of first complexed polymerases with a plurality of multivalent molecules to form a plurality of multivalent-complexed polymerases (e.g., binding complexes).
  • individual multivalent molecules in the plurality of multivalent molecules comprise a core attached to multiple nucleotide arms and each nucleotide arm is attached to a nucleotide (e.g., nucleotide unit) (e.g., FIGS. 19-23).
  • the methods for sequencing further comprise step (d): identifying the nucleo-base of the complementary nucleotide units that are bound to the plurality of first complexed polymerases, thereby determining the sequence of the concatemer molecule.
  • the multivalent molecules are labeled with a detectable reporter moiety that corresponds to the particular nucleotide units attached to the nucleotide arms to permit identification of the complementary nucleotide units (e.g., nucleotide base adenine, guanine, cytosine, thymine or uracil) that are bound to the plurality of first complexed polymerases.
  • the fluorophore is attached to the nucleotide base with a linker which is cleavable/removable from the base or is not removable from the base.
  • at least one of the nucleotides in the plurality is not labeled with a detectable reporter moiety.
  • a particular detectable reporter moiety e.g., fluorophore
  • a particular detectable reporter moiety that is attached to the nucleotide can correspond to the nucleotide base (e.g., dATP, dGTP, dCTP, dTTP or dUTP) to permit detection and identification of the nucleotide base.
  • the first sequencing polymerase comprises any wild type or mutant polymerase described herein.
  • the second sequencing polymerase comprises any wild type or mutant polymerase described herein.
  • the concatemer template molecule comprises tandem repeat sequences of a sequence of interest and at least one universal sequencing primer binding site.
  • the first and second nucleic acid primers can bind to a sequencing primer binding site along the concatemer template molecule. Exemplary multivalent molecules are shown in FIGS. 19-23.
  • the method for preparing a multiplex mixture of sequences- of-interest isolated from a plurality of sample sources further comprises step (e): pooling together the population of covalently closed circular library molecules (400) from the separate compartments to generate a multiplex mixture of covalently closed circular library molecules (400) which comprise the multiplex mixture of sequences-of-interest isolated from a plurality of sample sources.
  • the number of populations of single-stranded nucleic acid library molecules (100) of step (a) can be 2-10, or 10-50, or 50-100, or 100-250, or more than 250 different population of single-stranded nucleic acid library molecules (100).
  • any number of different populations of covalently closed circular library molecules (400) can be pooled together in step (e), for example 2-10, or 10-50, or 50-100, or 100-200, or more than 200 different populations of covalently closed circular library molecules (400) can be pooled together.
  • the method for preparing a multiplex mixture of sequences- of-interest isolated from a plurality of sample sources further comprises step (e): contacting the populations of library-splint complexes (300) in the compartment of step (d) with a ligase, under a condition suitable to enzymatically ligate the nick, thereby generating a population of covalently closed circular library molecules (400) each hybridized to a single-stranded splint strand (200) thereby generating a multiplex mixture of covalently closed circular library molecules (400) which comprise the multiplex mixture of sequences-of-interest isolated from a plurality of sample sources (e.g., see FIGS. 6A-6C).
  • the plurality of nucleic acid concatemer molecules can be distributed onto a support, the method comprising: distributing the plurality of concatemer molecules onto a support having a plurality of first surface primers immobilized thereon, under a condition suitable for hybridizing at least a portion of the concatemers to at least a portion of the plurality of the immobilized first surface primers thereby immobilizing the plurality of concatemer molecules; and contacting the immobilized plurality of concatemer molecules (which are hybridized to a covalently closed circular library molecule (400)) with a plurality of strand-displacing polymerases and a plurality of nucleotides, under a condition suitable to conduct a rolling circle amplification reaction on the support using the plurality of covalently closed circular library molecules (400) as template molecules, thereby extending the plurality of immobilized nucleic acid concatemer molecules, wherein the plurality of nucleotides comprises dATP, dGTP,
  • any of the multivalent mixtures of covalently closed circular library molecules (400) described herein can be subjected to an in-solution rolling circle amplification reaction, the method comprising: conducting a rolling circle amplification reaction by contacting the population of covalently closed circular library molecules (400) which are hybridized to the single-stranded splint strand (200) with a plurality of stranddisplacing polymerases and a plurality of nucleotides, under a condition suitable to conduct a rolling circle amplification reaction thereby generating a plurality of concatemer molecules, wherein the plurality of nucleotides comprises dATP, dGTP, dCTP, dTTP and/or dUTP.
  • the 3’ ends of the single-stranded splint strands (200) are extendible.
  • any of the multiplex immobilized concatemer molecules described herein can be sequenced using a two-stage sequencing method, wherein the first stage comprises: (a) binding the plurality of immobilized nucleic acid concatemer molecules with a plurality of sequencing primers, a plurality of a first sequencing polymerase, and a plurality of detectably labeled multivalent molecules, under a condition suitable to bind individual concatemer molecules to a sequencing primer, a first sequencing polymerase, and a detectably labeled multivalent molecule (e.g., forming a plurality of multivalent-complexed polymerases), where the suitable conditions inhibit polymerase-catalyzed incorporation of the nucleotide unit of the detectably labeled multivalent molecule; (b) detecting the bound detectably labeled multivalent molecule; and (c) identifying the nucleo-base of the detectably labeled multivalent molecule.
  • the first stage comprises: (a) binding the plurality of immobilized nucleic
  • individual detectably labeled multivalent molecules comprise a core attached to multiple nucleotide arms and each nucleotide arm is attached to a nucleotide (e.g., nucleotide unit) (e.g., see FIGS. 19-23).
  • at least one of the multivalent molecules in the plurality of multivalent molecules is labeled with a detectable reporter moiety. Any portion of the multivalent molecule can be labeled including the core, nucleotide arm or nucleo-base.
  • the detectable reporter moiety comprises a fluorophore.
  • the second stage of the two-stage sequencing method comprises: (d) removing the plurality of first sequencing polymerases and the plurality of bound multivalent molecules from the plurality of immobilized nucleic acid concatemer molecules and retaining the immobilized concatemer molecules each hybridized to a sequencing primer (nucleic acid duplex); and (e) contacting the retained immobilized concatemer molecules and hybridized sequencing primers with a plurality of second polymerases and a plurality of nucleotides under a condition suitable for incorporating the nucleotides into the 3’ end of the sequencing primers. Sequencing methods that employ the two-stage methods are described in detail above.
  • the nucleotide diversity of a population of immobilized template molecules refers to the relative proportion of nucleotides A, G, C and T that are present in each sequencing cycle.
  • An optimal high diversity library will generally include sequence-of-interest (insert) regions having approximately equal proportions of all four nucleotides bases (e.g., A, G, C and T/U) represented in each cycle of a sequencing run.
  • a low diversity library will generally include sequence-of-interest (insert) regions having a high proportion of certain nucleotides and low proportion of other nucleotides.
  • An alternative method to overcome the challenges of sequencing low diversity library molecules is to prepare libraries having at least one sample index sequence comprising a short random sequence (e.g., 3-mer random sequence, NNN) linked directly to a universal sample index sequence, where the short random sequence provides nucleotide diversity and color balance.
  • Table 1 at FIGS. 9A-9F, provides a list of exemplary right index sequences (170) having a short random sequence (e.g., NNN) and a universal sample index sequence.
  • the length of the sequenced sample index region is relatively short (e.g., less than 30 nucleotides in length) so that de-hybridization of the product of the sequenced sample index region is more complete.
  • gentler de-hybridization conditions can be used to remove most or all of the product of the sequenced sample index region which reduces the level of residual signals from any sequencing products remaining hybridized to the template molecules.
  • the sequence-of-interest region is typically much longer than the sample index region (e.g., more than 100 nucleotides in length).
  • the product of the sequenced sequence-of-interest region must be subjected to harsher de-hybridization conditions to remove any products remaining hybridized to the template molecules which may damage the template molecules.
  • the short random sequence (e.g., NNN) comprises 3-20 nucleotides, or 3-10 nucleotides, or 3-8 nucleotides, or 3-6 nucleotides, or 3-5 nucleotides, or 3-4 nucleotides.
  • Exemplary sample index sequence that include a short random sequence NNN linked directly to a universal sample index sequence include but are not limited to: NNNGTAGGAGCC (SEQ ID NO: 97); NNNCCGCTGCTA (SEQ ID NO: 98); NNNAACAACAAG (SEQ ID NO: 99); NNNGGTGGTCTA (SEQ ID NO: 100); NNNTTGGCCAAC (SEQ ID NO: 101); NNNCAGGAGTGC (SEQ ID NO: 105); and NNNATCACACTA (SEQ ID NO: 106).
  • the universal sample index can be any length and have any sequence that can be used to distinguish sequences of interest obtained from different sample sources in a multiplex assay.
  • sequencing the random sequence (e.g., NNN) using labeled multivalent molecules provides a balanced ratio of fluorescent colors that correspond to the nucleo-bases adenine, cytosine, guanine, thymine and/or uracil in each cycle of a sequencing run.
  • sequencing the random sequence (e.g., NNN) and at least a portion of the universal sample index sequence using labeled multivalent molecules provides a balanced ratio of fluorescent colors that correspond to nucleo-bases adenine, cytosine, guanine, thymine and/or uracil (e.g., see FIG. 31).
  • the labeled multivalent molecules emit fluorescent signals during the sequencing reactions.
  • the computer system can be configured to detect phasing and pre-phasing while sequencing the random sequence (e.g., NNN) and the universal sample index sequence, and the insert region (110) .
  • the balanced ratio of fluorescent colors provided by the random sequence (e.g., NNN) at each sequencing cycle can improve the quality of the data which is processed from the fluorescent images captured by the detector, and can in turn improve the capability by the computer system to determine the location of the immobilized template molecules on the flowcell, and the color and intensity, all of which can improve base calling accuracy and quality scores of the sequenced insert region (110).
  • a short random sequence e.g., NNN
  • the methods for sequencing further comprise step (e): hybridizing the retained immobilized template molecules with a third plurality of soluble sequencing primers that hybridize to the universal binding sequence for a second surface primer (120) and sequencing the left sample index sequence (160) thereby generating a second plurality of sample index extension products that are hybridized to the immobilized template molecules, wherein the second plurality of sample index extension products are complementary to the left sample index sequence (160) having a left universal sample index sequence.
  • the methods for sequencing further comprise step (fl): assigning the sequence of (i) the insert region (110) to (ii) the right sample index sequence (170) having a short random sequence (e.g., NNN) linked directly to a right universal sample index sequence, thereby identifying the insert region as being obtained from a first source.
  • the methods for sequencing further comprise step (f2): assigning the sequence of (i) the insert region (110) to (ii) the right sample index sequence (170) having a short random sequence (e.g., NNN) linked directly to a right universal sample index sequence, and (iii) the left sample index sequence (160), thereby identifying the insert region as being obtained from a first source.
  • the methods for sequencing further comprise step (c): hybridizing the template molecules with a second plurality of soluble sequencing primers that hybridize to the universal binding sequence for a reverse sequencing primer (150) and sequencing the right sample index sequence (170) including sequencing the short random sequence (e.g., NNN) and the right universal sample index sequence thereby generating a first plurality of sample index extension products that are hybridized to the immobilized template molecules, wherein the first plurality of sample index extension products are complementary to the right sample index sequence having a short random sequence (e.g., NNN) linked directly to a right universal sample index sequence (170).
  • a short random sequence e.g., NNN
  • the methods for sequencing further comprise step (b): removing the plurality of insert extension products and retaining the immobilized template molecules.
  • the sequences of the first 3-5 bases of the insert region (110) of a population of library molecules may provide enough sequence diversity for improved base-calling accuracy.
  • the left sample index (160) comprises a left universal sample index sequence.
  • the left sample index (160) comprises a second random sequence (e.g., NNN) and a left universal sample index sequence.
  • sequencing the right sample index region (170), including the first random sequence (e.g., NNN) and right universal sample index sequence may provide enough nucleotide diversity so that sequencing the left sample index (160) can be omitted.
  • the method further comprises: (a) sequencing the universal sample index sequence of the plurality of immobilized template molecules; (b) sequencing the insert sequence region of the plurality of immobilized template molecules; and (c) assigning the insert sequence of a given template molecule obtained in step (b) with the universal sample index sequence from the same given template molecule obtained in step (a), thereby identifying the sample source of the given insert sequence.
  • the present disclosure provides methods for sequencing nucleic acids comprising:
  • the support comprises a glass or plastic substrate.
  • the support is configured on a flowcell channel, a flow cell, or a capillary lumen.
  • the support is passivated with at least one hydrophilic polymer coating having a water contact angle of not more than 45 degrees.
  • the at least one hydrophilic polymer coating comprises branched hydrophilic polymer molecules having at least four branches. In some embodiments, the at least one hydrophilic polymer coating comprises polymer molecules having a molecular weight of at least 1000 Daltons.
  • the immobilized template molecules comprise a plurality of immobilized concatemer molecules having tandem repeat sequences of the insert sequence and the one sample index. In some embodiments, the immobilized template molecules comprise a plurality of different clustered template molecules having one copy of the insert sequence and one copy of the one sample index, wherein the clustered template molecules are generated via bridge amplification.
  • the detectably labeled nucleotide reagents comprise multivalent molecules each comprising (1) a core, (2) a plurality of nucleotide arms, and (3) at least one fluorophore, wherein individual nucleotide arms comprise (i) a core attachment moiety, (ii) a spacer comprising a PEG moiety, (iii) a linker, and (iv) a nucleotide unit, wherein the core is attached to the plurality of nucleotide arms, wherein the spacer is attached to the linker, wherein the linker is attached to the nucleotide unit.
  • the balanced diversity of step (e) is about 5-85%, or about 5-60%, or about 10-50%, or about 15- 55%, or about 25-75% of each of the nucleo-bases A, G, C and T/U that are detected and imaged in each of the first, second and third sequencing cycles.
  • Enzymatic fragmentation procedures can be conducted under conditions suitable to generate randomly or non-randomly fragmented nucleic acid molecules.
  • restriction endonuclease enzyme digestion can be conducted to completion to generate non- randomly fragmented nucleic acid molecule.
  • partial or incomplete restriction enzyme digestion can be conducted to generate randomly-fragmented nucleic acid molecules.
  • Enzymatic fragmentation using restriction endonuclease enzymes includes any one or any combination of two or more restriction enzymes selected from a group consisting of type I, type II, type Ils, type IIB, type III, or type IV restriction enzymes.
  • Enzymatic fragmentation includes digestion of the nucleic acid with a rare-cutting restriction enzyme, comprising Not I, Asc I, Bae I, AspC I, Pac I, Fse I, Sap I, Sfi I or Psr I. Enzymatic fragmentation include use of any combination of a nicking restriction endonuclease, endonuclease and/or exonuclease. Enzymatic fragmentation can be achieved by conducting a nick translation reaction.
  • a rare-cutting restriction enzyme comprising Not I, Asc I, Bae I, AspC I, Pac I, Fse I, Sap I, Sfi I or Psr I.
  • Enzymatic fragmentation include use of any combination of a nicking restriction endonuclease, endonuclease and/or exonuclease. Enzymatic fragmentation can be achieved by conducting a nick translation reaction.
  • a library molecule (100) can be generated by employing a ligation reaction and primer extension reaction.
  • the library molecule can be generated by joining the first and second ends of a double-stranded insert region (110) to a double-stranded Y-shaped adaptor (e.g., forked adaptor) having a portion that is annealed and another portion that is mismatched.
  • the Y-shaped adaptor can include an annealed portion that forms a blunt end or an overhang end (e.g., 5’ or 3’ overhang end) (e.g., see FIGS. 10A-D).
  • the double-stranded recombinant molecule can be subjected to a denaturing condition to generate single-stranded recombinant molecules.
  • An additional universal adaptor sequence can be appended to the recombinant molecule by conducting a primer extension reaction using tailed primers (e.g., tailed PCR primers), by contacting/hybridizing the single-stranded recombinant molecules with a first tailed primer having a 5’ region carrying a first right universal adaptor sequence (130), an internal region comprising a right sample index sequence (170), and a 3’ region that is complementary to at least a portion of the second right universal adaptor sequence (150).
  • tailed primers e.g., tailed PCR primers
  • the present disclosure provides methods for preparing nucleic acid library molecules (100) using Y-shaped adaptors.
  • the prepared nucleic acid library molecules can be hybridized to any of the single-stranded splint strands described herein to generate any of the library-splint complexes (300) and covalently closed circular library molecules (400) described herein.
  • the covalently closed circular library molecules can be distributed onto a support and subjected to a rolling circle amplification reaction to generate a plurality of immobilized concatemers which can be sequenced.
  • the library preparation methods comprise step (a): providing a plurality of doublestranded nucleic acid Y-shaped adaptors, wherein individual double-stranded adaptors comprise a first and second oligonucleotide strand hybridized together, wherein both the first and second oligonucleotide strands comprise a complementary region and a mismatched region, thereby forming a Y-shaped adaptor having a double-stranded annealed portion and a mismatched portion having two single strands (e.g., FIGS. 10A-10D, 11 A-l ID and 12A- 12D; the top strand is the first oligonucleotide and the bottom strand is the second oligonucleotide).
  • the double-stranded annealed region includes a terminal end that is blunt-ended, or the terminal end can have a 5’ or 3’ overhang region (e.g., see FIGS. 10A-10C).
  • the first and second oligonucleotide strands of the mismatched portion can be the same length or different lengths (e.g., see FIG. 10D).
  • the first strand of the double-stranded annealed region of the Y-shaped adaptors comprise at least a portion of a binding sequence for the first sequencing primer (e.g., a reverse or forward sequencing primer) (1st SeqP; (150)) or a complementary sequence thereof.
  • the second strand of the double-stranded annealed region of the Y-shaped adaptors comprise at least a portion of a binding sequence for the second sequencing primer (e.g., a forward or reverse sequencing primer) (2nd SeqP; (140)) or a complementary sequence thereof.
  • the library preparation methods further comprise step (b): providing a plurality of nucleic acid fragments.
  • the plurality of nucleic acid fragments can have the same sequence or have different sequences.
  • the plurality of nucleic acid fragments comprise doublestranded nucleic acid molecules.
  • the plurality of nucleic acid fragments can be generated by fragmenting target polynucleotides (e.g., genomic DNA) from at least one sample of polynucleotides.
  • the target polynucleotides can be fragmented using mechanical force, enzymatic (e.g., restriction endonuclease) or chemical fragmentation methods.
  • the library preparation methods further comprise step (d): contacting the plurality of double-stranded nucleic acid Y-shaped adaptors of step (a) and the plurality of nucleic acid fragments of step (c) with a ligase enzyme under a condition suitable to ligate a Y-shaped adaptor to both ends of individual nucleic acid fragments to generate a plurality of adaptorinsert-adaptor library molecules, wherein the adaptors in the adaptor-insert-adaptor library molecules comprise a double-stranded annealed region and a mismatched region (e.g., FIGS. 13-17).
  • the ligase comprises T4 DNA ligase.
  • the sequencing order includes: (1) sequencing the first sample index sequence (170) (with the short random sequence NNN if present); (2) sequencing the second sample index sequence (160); and (3) sequencing a portion or full length insert region (110).
  • the sequencing order includes: (1) sequencing 3-5 bases of the insert region (110); (2) sequencing the first sample index sequence (170) (with the short random sequence NNN if present); (3) sequencing the second sample index sequence (160);
  • the supports comprise a substrate (or support structure), one or more layers of a covalently or non-covalently attached low-binding, chemical modification layers, e.g., silane layers, polymer films, and one or more covalently or non-covalently attached primer sequences that may be used for tethering single-stranded target nucleic acid(s) to the support surface.
  • a substrate or support structure
  • chemical modification layers e.g., silane layers, polymer films
  • primer sequences e.g., primer sequences
  • the formulation of the surface e.g., the chemical composition of one or more layers, the coupling chemistry used to cross-link the one or more layers to the support surface and/or to each other, and the total number of layers, may be varied such that non-specific binding of proteins, nucleic acid molecules, and other hybridization and amplification reaction components to the support surface is minimized or reduced relative to a comparable monolayer.
  • the formulation of the surface may be varied such that non-specific hybridization on the support surface is minimized or reduced relative to a comparable monolayer.
  • the formulation of the surface may be varied such that non-specific amplification on the support surface is minimized or reduced relative to a comparable monolayer.
  • ATMS 3 -Aminopropyl) trimethoxysilane
  • APTES (3 -Aminopropyl) tri ethoxy silane
  • PEG-silanes e.g., comprising molecular weights of IK, 2K, 5K, 10K, 20K, etc.
  • amino-PEG silane i.e.,
  • Examples of preferred polymers that may be used to create one or more layers of low non-specific binding material in any of the disclosed surfaces include, but are not limited to, polyethylene glycol (PEG) of various molecular weights and branching structures, streptavidin, polyacrylamide, polyester, dextran, poly-lysine, and poly-lysine copolymers, or any combination thereof.
  • PEG polyethylene glycol
  • conjugation chemistries that may be used to graft one or more layers of material (e.g.
  • modified surfaces disclosed herein exhibit nonspecific protein binding of less than 0.5 molecule / pm 2 following contact with a 1 pM solution of Cy3 labeled streptavidin (GE Amersham) in phosphate buffered saline (PBS) buffer for 15 minutes, followed by 3 rinses with deionized water.
  • Some modified surfaces disclosed herein exhibit nonspecific binding of Cy3 dye molecules of less than 0.25 molecules per pm 2 .
  • images were collected on an Olympus 1X83 microscope (Olympus Corp., Center Valley, PA) with a total internal reflectance fluorescence (TIRF) objective (100X, 1.5 NA, Olympus), a CCD camera (e.g., an Olympus EM-CCD monochrome camera, Olympus XM-10 monochrome camera, or an Olympus DP80 color and monochrome camera), an illumination source (e.g., an Olympus 100W Hg lamp, an Olympus 75W Xe lamp, or an Olympus U-HGLGPS fluorescence light source), and excitation wavelengths of 532 nm or 635 nm.
  • TIRF total internal reflectance fluorescence
  • the degree of change in the fluorescence used to assess the quality of the surface may be less than 1%, 2%, 3%, 4%, 5%, 10%, 15%, 20%, or 25% over 5 cycles, 10 cycles, 20 cycles, 30 cycles, 40 cycles, 50 cycles, 60 cycles, 70 cycles, 80 cycles, 90 cycles, 100 cycles, 200 cycles, 300 cycles, 400 cycles, 500 cycles, 600 cycles, 700 cycles, 800 cycles, 900 cycles, or 1,000 cycles of repeated exposure to solvent changes and/or changes in temperature (or any combination of these percentages as measured over this range of cycles).
  • the tethered adaptor and/or primer sequences may range in length from about 10 nucleotides to about 100 nucleotides. In some embodiments, the tethered adaptor and/or primer sequences may be at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90, or at least 100 nucleotides in length. In some embodiments, the tethered adaptor and/or primer sequences may be at most 100, at most 90, at most 80, at most 70, at most 60, at most 50, at most 40, at most 30, at most 20, or at most 10 nucleotides in length.
  • the length of the tethered adaptor and/or primer sequences may range from about 20 nucleotides to about 80 nucleotides.
  • the length of the tethered adaptor and/or primer sequences may have any value within this range, e.g., about 24 nucleotides.
  • the resultant surface density of primers on the low binding support surfaces of the present disclosure may range from about 100 primer molecules per pm 2 to about 100,000 primer molecules per pm 2 . In some embodiments, the resultant surface density of primers on the low binding support surfaces of the present disclosure may range from about 100,000 primer molecules per pm 2 to about 10 15 primer molecules per pm 2 . In some embodiments, the surface density of primers may be at least 1,000, at least 10,000, at least 100,000, or at least 10 15 primer molecules per pm 2 . In some embodiments, the surface density of primers may be at most 10,000, at most 100,000, at most 1,000,000, or at most 10 15 primer molecules per pm 2 .
  • the number of covalent bonds between a branched polymer molecule of the layer being deposited and molecules of the previous layer may range from about one covalent linkage per molecule to about 32 covalent linkages per molecule.
  • the number of covalent bonds between a branched polymer molecule of the new layer and molecules of the previous layer may be at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 14, at least 16, at least 18, at least 20, at least 22, at least 24, at least 26, at least 28, at least 30, or at least 32 covalent linkages per molecule.
  • Fluorescence imaging may be performed using any of a variety of fluorophores, fluorescence imaging techniques, and fluorescence imaging instruments known to those of skill in the art.
  • suitable fluorescence dyes that may be used (e.g., by conjugation to nucleotides, oligonucleotides, or proteins) include, but are not limited to, fluorescein, rhodamine, coumarin, cyanine, and derivatives thereof, including the cyanine derivatives Cyanine dye-3 (Cy3), Cyanine dye-5 (Cy5), Cyanine dye-7 (Cy7), etc.
  • SNR signal-to-noise ratio
  • a polar aprotic solvent as described herein may further contain no ionizable hydrogen in the molecule.
  • polar solvents or polar aprotic solvents may be preferably substituted in the context of the presently disclosed compositions with a strong polarizing functional groups such as nitrile, carbonyl, thiol, lactone, sulfone, sulfite, and carbonate groups so that the underlying solvent molecules have a dipole moment.
  • Polar solvents and polar aprotic solvents can be present in both aliphatic and aromatic or cyclic form.
  • the polar solvent is acetonitrile.
  • the percentage by volume of organic solvent may be at most 20%, at most 15%, at most 10%, at most 9%, at most 8%, at most 7%, at most 6%, at most 5%, at most 4%, at most 3%, at most 2%, or at most 1%. Any of the lower and upper values described in this paragraph may be combined to form a range included within the present disclosure, for example, the percentage by volume of organic solvent may range from about 4% to about 15%. Those of skill in the art will recognize that the percentage by volume of organic solvent may have any value within this range, e.g., about 7.5%.
  • the use of optimized buffer formulations disclosed herein yield relative hybridization rates that range from about 2x to about 20x faster than that for a conventional hybridization protocol.
  • the relative hybridization rate may be at least 2x, at least 3x, at least 4x, at least 5x, at least 6x, at least 7x, at least 8x, at least 9x, at least lOx, at least 12x, at least 14x, at least 16x, at least 18x, or at least 20x that for a conventional hybridization protocol.
  • the percentage by volume of molecular crowding or volume exclusion agent may range from about 5% to about 35%.
  • the percentage by volume of molecular crowding or volume exclusion agent may have any value within this range, e.g., about 12.5%.
  • the cleavable linker on the nucleotide base comprises a cleavable moiety comprising an alkyl group, alkenyl group, alkynyl group, allyl group, aryl group, benzyl group, azide group, amine group, amide group, keto group, isocyanate group, phosphate group, thio group, disulfide group, carbonate group, urea group, or silyl group.
  • the cleavable moieties urea and silyl are cleavable with tetrabutylammonium fluoride, pyridine- HF, with ammonium fluoride, or with triethylamine trihydrofluoride.
  • the cleavable linker on the nucleotide base comprises cleavable moiety including an azide, azido or azidomethyl group.
  • the cleavable moieties azide, azido and azidomethyl group are cleavable/removable with a phosphine compound.
  • the phosphine compound comprises a derivatized tri-alkyl phosphine moiety or a derivatized tri -aryl phosphine moiety.
  • the phosphine compound comprises Tris(2-carboxyethyl)phosphine (TCEP) or bis-sulfo triphenyl phosphine (BS-TPP) or Tri(hydroxyproyl)phosphine (THPP).
  • the cleaving agent comprises 4-dimethylaminopyridine (4-DMAP).
  • the chain terminating moiety (e.g., at the sugar 2’ and/or sugar 3’ position) and the cleavable linker on the nucleotide base have the same or different cleavable moieties.
  • the chain terminating moiety (e.g., at the sugar 2’ and/or sugar 3’ position) and the detectable reporter moiety linked to the base are chemically cleavable/removable with the same chemical agent.
  • a multivalent molecule comprises a core attached to multiple nucleotide arms, and wherein the multiple nucleotide arms have the same type of nucleotide unit which is selected from a group consisting of dATP, dGTP, dCTP, dTTP and dUTP.
  • the nucleotide unit comprises a chain of one, two or three phosphorus atoms where the chain is typically attached to the 5’ carbon of the sugar moiety via an ester or phosphoramide linkage.
  • at least one nucleotide unit is a nucleotide analog having a phosphorus chain in which the phosphorus atoms are linked together with intervening O, S, NH, methylene or ethylene.
  • the phosphorus atoms in the chain include substituted side groups including O, S or BH3.
  • the chain includes phosphate groups substituted with analogs including phosphoramidate, phosphorothioate, phosphordithioate, and O-methylphosphoroamidite groups.
  • the multivalent molecule comprises a core attached to multiple nucleotide arms, and wherein individual nucleotide arms comprise a nucleotide unit which is a nucleotide analog having a chain terminating moiety (e.g., blocking moiety) at the sugar 2’ position, at the sugar 3’ position, or at the sugar 2’ and 3’ position.
  • the nucleotide unit comprises a chain terminating moiety (e.g., blocking moiety) at the sugar 2’ position, at the sugar 3’ position, or at the sugar 2’ and 3’ position.
  • the chain terminating moieties amine, amide, keto, isocyanate, phosphate, thio, disulfide are cleavable with phosphine or with a thiol group including beta-mercaptoethanol or dithiothritol (DTT).
  • the chain terminating moiety carbonate is cleavable with potassium carbonate (K2CO3) in MeOH, with triethylamine in pyridine, or with Zn in acetic acid (AcOH).
  • the present disclosure provides said method wherein the contacting is performed under a condition that stabilizes the binding complex when the nucleotide or nucleotide unit is complementary to a next base of the template nucleic acid, and destabilizes the binding complex when the nucleotide or nucleotide unit is not complementary to the next base of the template nucleic acid.
  • Genomic DNA was fragmented using enzymatic FRAGMENTASE ULTRA (from New England Biolabs). A range of input amounts of genomic DNA were tested, including 1 ng/uL to 1000 ng/uL. At the lowest range, as little as 1 ng of genomic DNA has been tested.
  • the fragmenting reaction included 7 uL of FRAGMENTASE reaction buffer, 2 uL of FRAGMENTASE enzyme, 26 uL genomic DNA. The fragmenting reaction was incubated at 37 °C for 15 minutes, and heated killed at 65 °C for 30 minutes. The average fragmented DNA was approximately 250 bp. The fragmented DNA was treated with enzymatic endrepair and A-tailing reactions.
  • Linear library molecules were prepared by adaptor ligation and PCR using tailed primers.
  • the resulting library molecules contained regions arranged in a 5’ to 3’ order: (i) a first left universal adaptor sequence (120) having a binding sequence for a second surface primer; (ii) a left sample index sequence (160); (iii) a second left universal adaptor sequence (140) having a binding sequence for a sequencing primer; (iv) a sequence of interest (110); (v) a second right universal adaptor sequence (150) having a binding sequence for a sequencing primer; (vi) a right sample index sequence comprising a short random sequence (e.g., NNN); and (v) a first right universal adaptor sequence (130) having a binding sequence for a first surface primer.
  • a first left universal adaptor sequence 120 having a binding sequence for a second surface primer
  • a left sample index sequence 160
  • a second left universal adaptor sequence 140
  • a sequence of interest 110
  • the hybridization reaction included: 30 uL of linear library molecules (16.7 nM), 14 uL single-stranded splint strands (77 nM) in duplex buffer (100 mM potassium acetate, 30 mM HEPES pH 7.5). The hybridization reaction was conducted in a thermocycler: 95 °C for 5 minutes, 37 °C for 5 minutes, hold at 37 °C.
  • the single-stranded splint strands were degraded by adding 1 uL of thermolabile Exonuclease I (20,000 units/mL) and luL of T7 Exonuclease (10,000 units/mL).
  • the degradation reaction was conducted in a thermocycler: 37 °C for 10 minutes, 80 °C for 2 minutes, and hold at 4 °C.
  • the yield of the covalently closed circular library molecules were quantified by quantitative PCR or single-stranded Qubit. For an input of approximately 100 ng of genomic DNA to prepare the linear library, the yield was measured to be approximately 50-100 fmol of covalently closed circular molecules (data not shown). As little as 12 fmol of covalently closed circular molecules has been successfully used for on-support rolling circle amplification to generate immobilized concatemer template molecules for sequencing (data not shown).
  • the first stage sequencing reaction was suitable for forming a plurality of avidity complexes on the concatemer template molecules (e.g., polonies).
  • the first stage sequencing reaction comprised: (a) binding a first nucleic acid primer, a first polymerase, and a first multivalent molecule to a first portion of a concatemer template molecule thereby forming a first binding complex, wherein a first nucleotide unit of the first multivalent molecule was bound to the first polymerase; and (b) binding a second nucleic acid primer, a second polymerase, and the first multivalent molecule to a second portion of the same concatemer template molecule thereby forming a second binding complex, wherein a second nucleotide unit of the first multivalent molecule was bound to the second polymerase, wherein the first and second binding complexes which included the same multivalent molecule formed a first avidity complex.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Plant Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2023/063736 2022-03-04 2023-03-03 Single-stranded splint strands and methods of use Ceased WO2023168444A1 (en)

Priority Applications (7)

Application Number Priority Date Filing Date Title
KR1020247033040A KR20240173217A (ko) 2022-03-04 2023-03-03 단일-가닥 스플린트 가닥 및 사용 방법
IL315324A IL315324A (en) 2022-03-04 2023-03-03 Single-stranded splint strands and methods of use
CN202380038013.5A CN119487205A (zh) 2022-03-04 2023-03-03 单链夹板链和使用方法
CA3254619A CA3254619A1 (en) 2022-03-04 2023-03-03 SINGLE-STRIP SPLINTS AND METHODS OF USE
EP23717778.7A EP4486912A1 (en) 2022-03-04 2023-03-03 Single-stranded splint strands and methods of use
AU2023229094A AU2023229094A1 (en) 2022-03-04 2023-03-03 Single-stranded splint strands and methods of use
JP2024552476A JP2025509201A (ja) 2022-03-04 2023-03-03 一本鎖スプリント鎖及び使用方法

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202263316790P 2022-03-04 2022-03-04
US63/316,790 2022-03-04
US17/725,042 US12359193B2 (en) 2022-03-04 2022-04-20 Single-stranded splint strands and methods of use
US17/725,042 2022-04-20

Publications (1)

Publication Number Publication Date
WO2023168444A1 true WO2023168444A1 (en) 2023-09-07

Family

ID=86052491

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2023/063736 Ceased WO2023168444A1 (en) 2022-03-04 2023-03-03 Single-stranded splint strands and methods of use

Country Status (9)

Country Link
US (2) US12359193B2 (https=)
EP (1) EP4486912A1 (https=)
JP (1) JP2025509201A (https=)
KR (1) KR20240173217A (https=)
CN (1) CN119487205A (https=)
AU (1) AU2023229094A1 (https=)
CA (1) CA3254619A1 (https=)
IL (1) IL315324A (https=)
WO (1) WO2023168444A1 (https=)

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2025120579A1 (en) 2023-12-07 2025-06-12 Element Biosciences, Inc. Compositions and methods for sequencing multiple regions of a template molecule using read-capping nucleotide analogs
US12331356B2 (en) 2018-11-14 2025-06-17 Element Biosciences, Inc. Multipart reagents having increased avidity for polymerase binding
WO2025147667A1 (en) 2024-01-05 2025-07-10 Element Biosciences, Inc. Target probe complexes and analyte detection complexes for in situ detecting and identifying target analytes
US12359193B2 (en) 2022-03-04 2025-07-15 Element Biosciences, Inc. Single-stranded splint strands and methods of use
US12365892B2 (en) 2022-09-12 2025-07-22 Element Biosciences, Inc. Double-stranded splint adaptors with universal long splint strands and methods of use
US12371743B2 (en) 2022-03-04 2025-07-29 Element Biosciences, Inc. Double-stranded splint adaptors and methods of use
WO2025163526A1 (en) 2024-01-30 2025-08-07 Element Biosciences, Inc. Method for improving nucleic acid sequencing quality by eliminating nucleic acids with deaminated bases from library and method for sequencing in which complexes of primers, polymerases and labelled probes are bound to concatemers
US12391929B2 (en) 2019-05-24 2025-08-19 Element Biosciences, Inc. Polymerase-nucleotide conjugates for sequencing by trapping
WO2025196727A1 (en) 2024-03-22 2025-09-25 Element Biosciences, Inc. Macromolecular multivalent conjugates and related uses
WO2025196731A1 (en) 2024-03-22 2025-09-25 Element Biosciences, Inc. Polymeric multivalent conjugates and related uses
WO2025196650A1 (en) 2024-03-19 2025-09-25 Element Biosciences, Inc. Flow cell devices and use thereof
WO2025212654A1 (en) 2024-04-02 2025-10-09 Element Biosciences, Inc. Library molecule titration for tunable surface density in polony sequencing
WO2025212655A1 (en) 2024-04-02 2025-10-09 Element Biosciences, Inc. Multiple priming for on-support nucleic acid amplification
WO2025226876A1 (en) * 2024-04-24 2025-10-30 Watchmaker Genomics, Inc. Sequencing library normalization methods
US12469162B2 (en) 2020-08-31 2025-11-11 Element Biosciences, Inc. Primary analysis in next generation sequencing
WO2025240909A1 (en) 2024-05-17 2025-11-20 Element Biosciences, Inc. Hybridization-based capture and enrichment of target nucleic acid sequences
US12505571B2 (en) 2020-08-31 2025-12-23 Element Biosciences, Inc. Primary analysis in next generation sequencing
US12540350B2 (en) 2022-08-15 2026-02-03 Element Biosciences, Inc. Spatially resolved surface capture of nucleic acids
WO2026073147A1 (en) 2024-09-30 2026-04-02 Element Biosciences, Inc. Nucleic acid sequencing systems
US12606819B2 (en) 2022-07-05 2026-04-21 Element Biosciences, Inc. PCR-free library preparation using double-stranded splint adaptors and methods of use
US12612660B2 (en) 2021-07-21 2026-04-28 Element Biosciences, Inc. Optical systems for nucleic acid sequencing and methods thereof
US12618108B2 (en) 2025-01-10 2026-05-05 Element Biosciences, Inc. Flow cell devices and optical systems for nucleic acid sequencing

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3597772A1 (en) 2013-04-17 2020-01-22 Agency For Science, Technology And Research Method for generating extended sequence reads
US12421545B2 (en) 2022-08-15 2025-09-23 Element Biosciences, Inc. Compositions and methods for preparing nucleic acid nanostructures using compaction oligonucleotides
WO2025250742A1 (en) * 2024-05-30 2025-12-04 Aclarity Genomics, Inc. Amplification of macromolecules
WO2026080904A2 (en) 2024-10-11 2026-04-16 Element Biosciences, Inc. Systems and methods for performing dna sequencing

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5558991A (en) 1986-07-02 1996-09-24 E. I. Du Pont De Nemours And Company DNA sequencing method using acyclonucleoside triphosphates
CN108203847A (zh) * 2016-12-16 2018-06-26 深圳华大智造科技有限公司 用于二代测序质量评估的文库、试剂及应用
US10246744B2 (en) 2016-08-15 2019-04-02 Omniome, Inc. Method and system for sequencing nucleic acids
US10731141B2 (en) 2018-09-17 2020-08-04 Omniome, Inc. Engineered polymerases for improved sequencing
US20200308576A1 (en) * 2017-09-14 2020-10-01 Roche Sequencing Solutions, Inc. Novel method for generating circular single-stranded dna libraries
US11220707B1 (en) * 2021-06-17 2022-01-11 Element Biosciences, Inc. Compositions and methods for pairwise sequencing

Family Cites Families (101)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5374637A (en) 1989-03-22 1994-12-20 Janssen Pharmaceutica N.V. N-(3-hydroxy-4-piperidinyl)(dihydrobenzofuran, dihydro-2H-benzopyran or dihydrobenzodioxin)carboxamide derivatives
US5846717A (en) 1996-01-24 1998-12-08 Third Wave Technologies, Inc. Detection of nucleic acid sequences by invader-directed cleavage
SE9400522D0 (sv) 1994-02-16 1994-02-16 Ulf Landegren Method and reagent for detecting specific nucleotide sequences
US5750341A (en) * 1995-04-17 1998-05-12 Lynx Therapeutics, Inc. DNA sequencing by parallel oligonucleotide extensions
US5700642A (en) 1995-05-22 1997-12-23 Sri International Oligonucleotide sizing using immobilized cleavable primers
US5854033A (en) 1995-11-21 1998-12-29 Yale University Rolling circle replication reporter systems
US7432048B2 (en) 1996-11-29 2008-10-07 Third Wave Technologies, Inc. Reactions on a solid surface
US6284497B1 (en) 1998-04-09 2001-09-04 Trustees Of Boston University Nucleic acid arrays and methods of synthesis
US6235502B1 (en) 1998-09-18 2001-05-22 Molecular Staging Inc. Methods for selectively isolating DNA using rolling circle amplification
ATE509272T1 (de) 2001-11-09 2011-05-15 3Dbiosurfaces Technologies Llc Substrate mit hochliegendem oberflächenbereich für mikroarrays sowie verfahren zur herstellung davon
US20040110153A1 (en) 2002-12-10 2004-06-10 Affymetrix, Inc. Compleixity management of genomic DNA by semi-specific amplification
US6977153B2 (en) 2002-12-31 2005-12-20 Qiagen Gmbh Rolling circle amplification of RNA
US20090186343A1 (en) 2003-01-28 2009-07-23 Visigen Biotechnologies, Inc. Methods for preparing modified biomolecules, modified biomolecules and methods for using same
EP1725572B1 (de) 2003-11-05 2017-05-31 AGCT GmbH Makromolekulare nukleotidverbindungen und methoden zu deren anwendung
EP1701785A1 (en) 2004-01-07 2006-09-20 Solexa Ltd. Modified molecular arrays
US7462452B2 (en) 2004-04-30 2008-12-09 Pacific Biosciences Of California, Inc. Field-switch sequencing
SE0401270D0 (sv) 2004-05-18 2004-05-18 Fredrik Dahl Method for amplifying specific nucleic acids in parallel
CA2579150C (en) 2004-09-17 2014-11-25 Pacific Biosciences Of California, Inc. Apparatus and method for analysis of molecules
US7170050B2 (en) 2004-09-17 2007-01-30 Pacific Biosciences Of California, Inc. Apparatus and methods for optical analysis of molecules
US7989166B2 (en) 2005-04-12 2011-08-02 In Situ Rcp A/S Circle probes and their use in the identification of biomolecules
EP3257949A1 (en) 2005-06-15 2017-12-20 Complete Genomics Inc. Nucleic acid analysis by random mixtures of non-overlapping fragments
GB0514936D0 (en) 2005-07-20 2005-08-24 Solexa Ltd Preparation of templates for nucleic acid sequencing
US7405281B2 (en) 2005-09-29 2008-07-29 Pacific Biosciences Of California, Inc. Fluorescent nucleotide analogs and uses therefor
GB0522310D0 (en) 2005-11-01 2005-12-07 Solexa Ltd Methods of preparing libraries of template polynucleotides
WO2007120208A2 (en) * 2005-11-14 2007-10-25 President And Fellows Of Harvard College Nanogrid rolling circle dna sequencing
US9328378B2 (en) 2006-07-31 2016-05-03 Illumina Cambridge Limited Method of library preparation avoiding the formation of adaptor dimers
US8932994B2 (en) 2006-08-24 2015-01-13 Illumina, Inc. Method for retaining even coverage of short insert libraries
US7910354B2 (en) 2006-10-27 2011-03-22 Complete Genomics, Inc. Efficient arrays of amplified polynucleotides
US7862999B2 (en) 2007-01-17 2011-01-04 Affymetrix, Inc. Multiplex targeted amplification using flap nuclease
WO2008093098A2 (en) 2007-02-02 2008-08-07 Illumina Cambridge Limited Methods for indexing samples and sequencing multiple nucleotide templates
EP2176421A1 (en) 2007-07-12 2010-04-21 IN Situ RCP A/S Padlock probe amplification methods
US9388457B2 (en) 2007-09-14 2016-07-12 Affymetrix, Inc. Locus specific amplification using array probes
US8716190B2 (en) 2007-09-14 2014-05-06 Affymetrix, Inc. Amplification and analysis of selected targets on solid supports
US7968702B2 (en) 2008-03-13 2011-06-28 Pacific Biosciences Of California, Inc. Labeled reactants and their uses
US20100035252A1 (en) * 2008-08-08 2010-02-11 Ion Torrent Systems Incorporated Methods for sequencing individual nucleic acids under tension
US7862344B2 (en) 2008-08-08 2011-01-04 Tyco Electronics Corporation Electrical connector having reversed differential pairs
US9080211B2 (en) 2008-10-24 2015-07-14 Epicentre Technologies Corporation Transposon end compositions and methods for modifying nucleic acids
US8486630B2 (en) * 2008-11-07 2013-07-16 Industrial Technology Research Institute Methods for accurate sequence data and modified base position determination
US8252910B2 (en) 2008-11-19 2012-08-28 Pacific Biosciences Of California, Inc. Modular nucleotide compositions and uses therefor
EP2607496B1 (en) 2008-12-23 2014-07-16 Illumina, Inc. Methods useful in nucleic acid sequencing protocols
WO2010117420A2 (en) 2009-03-30 2010-10-14 Pacific Biosciences Of California, Inc. Fret-labeled compounds and uses therefor
EP2419537B1 (en) 2009-04-13 2014-01-29 Somagenics, Inc. Methods and compositions for detection of small rnas
US20120003657A1 (en) 2010-07-02 2012-01-05 Samuel Myllykangas Targeted sequencing library preparation by genomic dna circularization
US9777320B2 (en) 2010-08-25 2017-10-03 Pacific Biosciences Of California, Inc. Molecular adaptors for dye conjugates
US9029103B2 (en) 2010-08-27 2015-05-12 Illumina Cambridge Limited Methods for sequencing polynucleotides
WO2012103545A1 (en) 2011-01-28 2012-08-02 Illumina, Inc. Oligonucleotide replacement for di-tagged and directional libraries
US20120196279A1 (en) 2011-02-02 2012-08-02 Pacific Biosciences Of California, Inc. Methods and compositions for nucleic acid sample preparation
US9365897B2 (en) 2011-02-08 2016-06-14 Illumina, Inc. Selective enrichment of nucleic acids
LT2825672T (lt) 2012-03-13 2019-06-10 Swift Biosciences, Inc. Būdai ir kompozicijos, skirti valdomam pagal dydį substrato polinukleotidų homopolimeriniam uodegų formavimui su nukleorūgščių polimeraze
US10072260B2 (en) 2012-12-06 2018-09-11 Agilent Technologies, Inc. Target enrichment of randomly sheared genomic DNA fragments
US9822408B2 (en) 2013-03-15 2017-11-21 Nugen Technologies, Inc. Sequential sequencing
US20140336063A1 (en) 2013-05-09 2014-11-13 Life Technologies Corporation Windowed Sequencing
WO2014196863A1 (en) 2013-06-07 2014-12-11 Keygene N.V. Method for targeted sequencing
US9957291B2 (en) 2013-08-05 2018-05-01 Pacific Biosciences Of California, Inc. Protected fluorescent reagent compounds
EP3126524B1 (en) 2014-04-04 2020-07-22 Affymetrix, Inc. Improved compositions and methods for molecular inversion probe assays
EP4170044B1 (en) 2014-06-06 2026-03-11 Cornell University Method for identification and enumeration of nucleic acid sequence, expression, copy, or dna methylation changes, using combined nuclease, ligase, polymerase, and sequencing reactions
US11091810B2 (en) 2015-01-27 2021-08-17 BioSpyder Technologies, Inc. Focal gene expression profiling of stained FFPE tissues with spatial correlation to morphology
WO2016058517A1 (en) 2014-10-14 2016-04-21 Bgi Shenzhen Co., Limited Mate pair library construction
AU2016269785B2 (en) 2015-05-29 2019-02-28 Illumina Cambridge Limited Enhanced utilization of surface primers in clusters
US10077470B2 (en) 2015-07-21 2018-09-18 Omniome, Inc. Nucleic acid sequencing methods and systems
CN113321943A (zh) 2015-11-20 2021-08-31 加利福尼亚太平洋生物科学股份有限公司 标记的核苷酸类似物、反应混合物以及测序方法和系统
EP3376996B1 (en) 2015-11-20 2022-09-07 Pacific Biosciences of California, Inc. Protected dye-labeled reagents
US20170283864A1 (en) 2016-03-31 2017-10-05 Agilent Technologies, Inc. Use of transposase and y adapters to fragment and tag dna
WO2017177017A1 (en) * 2016-04-07 2017-10-12 Omniome, Inc. Methods of quantifying target nucleic acids and identifying sequence variants
CN109844133A (zh) 2016-08-15 2019-06-04 安可济控股有限公司 检测罕见序列变体的组合物和方法
CN110249059B (zh) 2017-01-20 2021-04-13 欧姆尼欧美公司 核酸的等位基因特异性捕获
CN110612351B (zh) 2017-03-20 2023-08-11 Illumina公司 用于制备核酸文库的方法和组合物
AU2018261332B2 (en) 2017-05-01 2024-12-05 Illumina, Inc. Optimal index sequences for multiplex massively parallel sequencing
EP3622089B1 (en) 2017-05-08 2024-07-17 Illumina, Inc. Method for sequencing using universal short adapters for indexing of polynucleotide samples
EP3692166A1 (en) 2017-10-06 2020-08-12 H. Hoffnabb-La Roche Ag Circularization methods for single molecule sequencing sample preparation
ES2937927T3 (es) 2018-01-29 2023-04-03 St Jude Childrens Res Hospital Inc Método para la amplificación de ácidos nucleicos
CN111801427B (zh) * 2018-02-05 2023-12-05 豪夫迈·罗氏有限公司 用于单分子的单链环状dna模板的产生
SG11202007686VA (en) 2018-02-12 2020-09-29 10X Genomics Inc Methods characterizing multiple analytes from individual cells or cell populations
CN120905352A (zh) 2018-04-02 2025-11-07 埃努梅拉分子股份有限公司 用于对核酸分子进行计数的方法、系统和组合物
EP3814530B1 (en) 2018-06-29 2026-01-07 Illumina, Inc. Flow cells
US20200149095A1 (en) 2018-11-14 2020-05-14 Element Biosciences, Inc. Low binding supports for improved solid-phase dna hybridization and amplification
US10768173B1 (en) 2019-09-06 2020-09-08 Element Biosciences, Inc. Multivalent binding composition for nucleic acid analysis
JP7587425B2 (ja) 2018-12-18 2024-11-20 イルミナ ケンブリッジ リミテッド 単一表面プライマーを使用したペアエンドシーケンシングのための方法および組成物
US11293061B2 (en) * 2018-12-26 2022-04-05 Illumina Cambridge Limited Sequencing methods using nucleotides with 3′ AOM blocking group
US20200347443A1 (en) 2019-05-01 2020-11-05 Element Biosciences, Inc. Nucleic acid hybridization methods
KR20240094019A (ko) 2019-09-23 2024-06-24 엘리먼트 바이오사이언스, 인크. 세포적으로 처리가능한 핵산 서열분석 방법
CA3173798A1 (en) * 2020-03-03 2021-09-10 Pacific Biosciences Of California, Inc. Methods and compositions for sequencing double stranded nucleic acids
WO2021236792A1 (en) 2020-05-20 2021-11-25 Element Biosciences, Inc. Methods for paired-end sequencing library preparation
CN116323974A (zh) 2020-07-31 2023-06-23 元素生物科学公司 多路复用covid-19锁式测定
US12359193B2 (en) 2022-03-04 2025-07-15 Element Biosciences, Inc. Single-stranded splint strands and methods of use
US12371743B2 (en) 2022-03-04 2025-07-29 Element Biosciences, Inc. Double-stranded splint adaptors and methods of use
CA3196800A1 (en) 2020-10-30 2022-05-05 Element Biosciences, Inc. Reagents for massively parallel nucleic acid sequencing
WO2022232308A1 (en) 2021-04-27 2022-11-03 Singular Genomics Systems, Inc. High density sequencing and multiplexed priming
US20220356519A1 (en) 2021-05-10 2022-11-10 Pacific Biosciences Of California, Inc. Single-molecule seeding and amplification on a surface
WO2022266470A1 (en) 2021-06-17 2022-12-22 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
US11859241B2 (en) 2021-06-17 2024-01-02 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
US20230193354A1 (en) 2021-06-17 2023-06-22 Element Biosciences, Inc. Compositions and methods for pairwise sequencing
IL309440A (en) 2021-06-18 2024-02-01 Element Biosciences Inc Engineered polymerases
US20220403351A1 (en) 2021-06-18 2022-12-22 Element Biosciences, Inc. Engineered polymerases
WO2023114392A1 (en) 2021-12-16 2023-06-22 Ultima Genomics, Inc. Systems and methods for sequencing with multi-priming
US11788075B2 (en) 2022-02-18 2023-10-17 Element Biosciences, Inc. Engineered polymerases with reduced sequence-specific errors
US12606819B2 (en) 2022-07-05 2026-04-21 Element Biosciences, Inc. PCR-free library preparation using double-stranded splint adaptors and methods of use
US12421545B2 (en) 2022-08-15 2025-09-23 Element Biosciences, Inc. Compositions and methods for preparing nucleic acid nanostructures using compaction oligonucleotides
EP4573213A1 (en) 2022-08-15 2025-06-25 Element Biosciences, Inc. Spatially resolved surface capture of nucleic acids
AU2023343187A1 (en) 2022-09-12 2025-03-13 Element Biosciences, Inc. Double-stranded splint adaptors with universal long splint strands and methods of use
WO2025024465A1 (en) 2023-07-24 2025-01-30 Element Biosciences, Inc. On-support circularization and amplification for generating immobilized nucleic acid concatemer molecules

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5558991A (en) 1986-07-02 1996-09-24 E. I. Du Pont De Nemours And Company DNA sequencing method using acyclonucleoside triphosphates
US10246744B2 (en) 2016-08-15 2019-04-02 Omniome, Inc. Method and system for sequencing nucleic acids
CN108203847A (zh) * 2016-12-16 2018-06-26 深圳华大智造科技有限公司 用于二代测序质量评估的文库、试剂及应用
US20200308576A1 (en) * 2017-09-14 2020-10-01 Roche Sequencing Solutions, Inc. Novel method for generating circular single-stranded dna libraries
US10731141B2 (en) 2018-09-17 2020-08-04 Omniome, Inc. Engineered polymerases for improved sequencing
US11220707B1 (en) * 2021-06-17 2022-01-11 Element Biosciences, Inc. Compositions and methods for pairwise sequencing

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
ASLAM, M.DENT, A.: "Bioconjugation: Protein Coupling Techniques for the Biomedical Sciences", 1998, MACMILLAN
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1992, GREENE PUBLISHING ASSOCIATES
ESCHENMOSSER, SCIENCE, vol. 284, 1999, pages 2118 - 2124
FASMAN: "Practical Handbook of Biochemistry and Molecular Biology", 1989, CRC PRESS, pages: 385 - 394
FERRAROGOTOR, CHEM. REV., vol. 100, 2000, pages 4319 - 48
HERMANSON, G.: "Bioconjugate Techniques", 2008
JOENG ET AL., J. MED. CHEM., vol. 36, 1993, pages 2627 - 2638
KOROSTIN DMITRIY ET AL: "Comparative analysis of novel MGISEQ-2000 sequencing platform vs Illumina HiSeq 2500 for whole-genome sequencing", PLOS ONE, vol. 15, no. 3, 16 March 2020 (2020-03-16), pages e0230301, XP093055601, Retrieved from the Internet <URL:https://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0230301&type=printable> DOI: 10.1371/journal.pone.0230301 *
LAKOWICZ: "Principles of Fluorescence Spectroscopy", 1999, PLENUM PRESS
MARTINEZ ET AL., BIOORGANIC & MEDICINAL CHEMISTRY LETTERS, vol. 7, 1997, pages 3013 - 3016
MARTINEZ ET AL., NUCLEIC ACIDS RESEARCH, vol. 27, 1999, pages 1271 - 1274
See also references of EP4486912A1

Cited By (22)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12331356B2 (en) 2018-11-14 2025-06-17 Element Biosciences, Inc. Multipart reagents having increased avidity for polymerase binding
US12391929B2 (en) 2019-05-24 2025-08-19 Element Biosciences, Inc. Polymerase-nucleotide conjugates for sequencing by trapping
US12505571B2 (en) 2020-08-31 2025-12-23 Element Biosciences, Inc. Primary analysis in next generation sequencing
US12469162B2 (en) 2020-08-31 2025-11-11 Element Biosciences, Inc. Primary analysis in next generation sequencing
US12612660B2 (en) 2021-07-21 2026-04-28 Element Biosciences, Inc. Optical systems for nucleic acid sequencing and methods thereof
US12359193B2 (en) 2022-03-04 2025-07-15 Element Biosciences, Inc. Single-stranded splint strands and methods of use
US12371743B2 (en) 2022-03-04 2025-07-29 Element Biosciences, Inc. Double-stranded splint adaptors and methods of use
US12606819B2 (en) 2022-07-05 2026-04-21 Element Biosciences, Inc. PCR-free library preparation using double-stranded splint adaptors and methods of use
US12540350B2 (en) 2022-08-15 2026-02-03 Element Biosciences, Inc. Spatially resolved surface capture of nucleic acids
US12365892B2 (en) 2022-09-12 2025-07-22 Element Biosciences, Inc. Double-stranded splint adaptors with universal long splint strands and methods of use
WO2025120579A1 (en) 2023-12-07 2025-06-12 Element Biosciences, Inc. Compositions and methods for sequencing multiple regions of a template molecule using read-capping nucleotide analogs
WO2025147667A1 (en) 2024-01-05 2025-07-10 Element Biosciences, Inc. Target probe complexes and analyte detection complexes for in situ detecting and identifying target analytes
WO2025163526A1 (en) 2024-01-30 2025-08-07 Element Biosciences, Inc. Method for improving nucleic acid sequencing quality by eliminating nucleic acids with deaminated bases from library and method for sequencing in which complexes of primers, polymerases and labelled probes are bound to concatemers
WO2025196650A1 (en) 2024-03-19 2025-09-25 Element Biosciences, Inc. Flow cell devices and use thereof
WO2025196731A1 (en) 2024-03-22 2025-09-25 Element Biosciences, Inc. Polymeric multivalent conjugates and related uses
WO2025196727A1 (en) 2024-03-22 2025-09-25 Element Biosciences, Inc. Macromolecular multivalent conjugates and related uses
WO2025212655A1 (en) 2024-04-02 2025-10-09 Element Biosciences, Inc. Multiple priming for on-support nucleic acid amplification
WO2025212654A1 (en) 2024-04-02 2025-10-09 Element Biosciences, Inc. Library molecule titration for tunable surface density in polony sequencing
WO2025226876A1 (en) * 2024-04-24 2025-10-30 Watchmaker Genomics, Inc. Sequencing library normalization methods
WO2025240909A1 (en) 2024-05-17 2025-11-20 Element Biosciences, Inc. Hybridization-based capture and enrichment of target nucleic acid sequences
WO2026073147A1 (en) 2024-09-30 2026-04-02 Element Biosciences, Inc. Nucleic acid sequencing systems
US12618108B2 (en) 2025-01-10 2026-05-05 Element Biosciences, Inc. Flow cell devices and optical systems for nucleic acid sequencing

Also Published As

Publication number Publication date
EP4486912A1 (en) 2025-01-08
IL315324A (en) 2024-10-01
CN119487205A (zh) 2025-02-18
US20260071207A1 (en) 2026-03-12
US20230279382A1 (en) 2023-09-07
JP2025509201A (ja) 2025-04-11
CA3254619A1 (en) 2023-09-07
KR20240173217A (ko) 2024-12-10
US12359193B2 (en) 2025-07-15
AU2023229094A1 (en) 2024-10-03

Similar Documents

Publication Publication Date Title
US12359193B2 (en) Single-stranded splint strands and methods of use
US12371743B2 (en) Double-stranded splint adaptors and methods of use
US12365892B2 (en) Double-stranded splint adaptors with universal long splint strands and methods of use
US12606819B2 (en) PCR-free library preparation using double-stranded splint adaptors and methods of use
US12421545B2 (en) Compositions and methods for preparing nucleic acid nanostructures using compaction oligonucleotides
US20230392144A1 (en) Compositions and methods for reducing base call errors by removing deaminated nucleotides from a nucleic acid library
US20250019760A1 (en) Compositions and methods for sequencing multiple regions of a template molecule using enzyme-based reagents
WO2025163526A1 (en) Method for improving nucleic acid sequencing quality by eliminating nucleic acids with deaminated bases from library and method for sequencing in which complexes of primers, polymerases and labelled probes are bound to concatemers
WO2025120579A1 (en) Compositions and methods for sequencing multiple regions of a template molecule using read-capping nucleotide analogs
WO2025191535A1 (en) Partially double-stranded splint adaptors and methods of use
HK40122940A (zh) 单链夹板链和使用方法

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23717778

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2024552476

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: AU2023229094

Country of ref document: AU

ENP Entry into the national phase

Ref document number: 2023229094

Country of ref document: AU

Date of ref document: 20230303

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2023717778

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2023717778

Country of ref document: EP

Effective date: 20241004

WWE Wipo information: entry into national phase

Ref document number: 11202406021W

Country of ref document: SG

WWE Wipo information: entry into national phase

Ref document number: 202380038013.5

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 202380038013.5

Country of ref document: CN