WO2023167563A1 - Composition containing n-carbamyl-l-glutamic acid for treatment of inflammatory diseases - Google Patents

Abstract

The present invention relates to a method for biosynthesizing N-carbamyl-L-glutamic acid and a novel use thereof for the prevention or treatment of inflammatory diseases. The invention also relates to a composition for the prevention, amelioration or treatment of inflammatory bowel disease, which contains N-carbamyl-L-glutamic acid as an active ingredient, thereby minimizing the side effects of existing treatments for inflammatory bowel disease and securing stability.

Description

Composition for treating inflammatory diseases containing N-carbamyl-L-glutamic acid

[Mutual Citation with Related Applications]

This application claims the benefit of priority based on Korean Patent Application No. 10-2022-0027575 filed on March 03, 2022, and all contents disclosed in the Korean Patent Application Document are included as part of this specification.

[Technical field]

It relates to a method for biosynthesis of N-carbamyl-L-glutamic acid and its use for treatment of inflammatory diseases.

N-carbamyl-L-glutamic acid (NCG) is a metabolically stable analogue of N-acetylglutamate that activates carbamyl phosphatase-1, the first enzyme involved in the urea cycle. am. NCG is nontoxic to animals and infants and readily penetrates cells and mitochondria. NCG intake has been reported to increase the length of villi or the depth of crypts in the jejunum of immature baby animals. In fact, studies have reported that NCG is used as an important feed additive for dairy cows, beef cattle, and newborn pigs to increase milk production, increase pregnancy rate, reduce morbidity and mortality, and increase birth weight and growth rate.

On the other hand, the large intestine is an organ present at the highest end of the digestive system and is known to play a role in absorbing water, vitamins, minerals, and the like. In the large intestine, various diseases such as colon cancer, colon polyps, irritable bowel syndrome, ulcerative colitis, and Crohn's disease are induced due to genetic and environmental factors.

Among them, ulcerative colitis is a chronic inflammatory bowel disease that causes excessive inflammation in the large intestine, resulting in symptoms such as diarrhea, lower abdominal pain, abdominal distension, and bloody stools. Ulcerative colitis is classified into chronic and acute according to the duration of onset, and into infectious and non-infectious according to the cause. In this disease, inflammation first occurs in the rectal area, the barrier collapses, pathogenic bacteria and intestinal bacteria invade the body, and the immune response occurs excessively, extending its scope to the first half of the large intestine. Ulcerative colitis patients have a 10 to 20 times higher risk of colorectal cancer than normal patients, and the risk increases as the duration of the disease and the area of the site increase. Although the incidence rate is increasing in Asian countries including Korea, ulcerative colitis is a disease that cannot be cured after onset. Ulcerative colitis patient groups are largely divided into mild, moderate, and severe stages, and standard treatment for each stage is required. Although 5-aminoslicylic acid (5-ASA) preparations are used for the treatment of mild and moderate patients with ulcerative colitis, 20 to 40% of patients have no therapeutic effect or side effects occur, so new treatments and usage methods development is needed Until now, research on the cause of onset and treatment has been conducted using various animal models, but the cause of onset of inflammatory bowel disease, especially ulcerative colitis, has various and complex characteristics, making it difficult to develop a cure. Therefore, it is necessary to develop an alternative treatment that can overcome the side effects and limitations of existing treatments.

Under this background, the present inventors searched for an alternative therapeutic agent to overcome the limitations of existing inflammatory bowel disease therapeutic agents. As a result, NCG can be biosynthesized using Lactobacillus reuteri DS0384, and NCG is effective as a therapeutic agent for ulcerative colitis. It was confirmed that the present invention was completed.

One object of the present invention is to provide a method for biosynthesizing N-carbamyl-L-glutamic acid.

Another object of the present invention is to provide a novel use of N-carbamyl-L-glutamic acid for prevention or treatment of inflammatory bowel disease. In addition, to provide a composition for the prevention, improvement, or treatment of inflammatory bowel disease, including N-carbamyl-L-glutamic acid as an active ingredient, minimizing side effects and securing stability of conventional inflammatory bowel disease treatments.

In addition, another object of the present invention is to provide a suitable usage method using the composition.

In order to achieve the above object, the present invention provides a method for producing N-carbamyl-L-glutamic acid, including culturing the Lactobacillus reuteri DS0384 strain.

In addition, a composition for preventing, improving or treating inflammatory diseases comprising N-carbamyl-L-glutamic acid as an active ingredient is provided. The composition may be a pharmaceutical composition, health functional food composition or feed composition.

In the present invention, there is an advantage that N-carbamyl-L-glutamic acid, which had to be produced by conventional chemical methods, can be biosynthesized by culturing Lactobacillus reuteri DS0384 strain. In addition, by culturing the strain under optimized conditions, it is possible to efficiently produce N-carbamyl-L-glutamic acid, which is an active ingredient.

In addition, for the first time, it has been shown that N-carbamyl-L-glutamic acid has a therapeutic effect on inflammatory bowel disease by improving histological lesions and reducing inflammatory markers in inflammatory bowel disease animal models. identified. In addition, it was confirmed that the incidence of inflammatory bowel disease was reduced in an animal model administered with N-carbamyl-L-glutamic acid, thereby having a preventive effect against inflammatory bowel disease.

Therefore, the composition comprising N-carbamyl-L-glutamic acid as an active ingredient of the present invention can be usefully used as pharmaceuticals, foods, and feeds for the prevention, improvement, or treatment of ulcerative colitis among inflammatory bowel diseases, and thus the related industry very useful for

In addition, in the present invention, an appropriate usage method capable of exhibiting a therapeutic effect on inflammatory bowel disease is identified, and the therapeutic effect of N-carbamyl-L-glutamic acid on inflammatory bowel disease is confirmed by using the composition or administration method of the present invention. can be maximized.

Panel a of Figure 1 shows B. longum, Lactobacillus gasseri (L. gasseri), Lactobacillus curvatus (L. curvatus), Lactobacillus rhamnosus (L. rhamnosus) and the present invention. After processing the culture medium of Lactobacillus reuteri DS0384 (L. reuteri) strain into intestinal organoids, morphological changes in intestinal organoids were confirmed under a microscope (upper data, Bright field, BF) and immunofluorescence staining of the mature intestinal tract. It is the result (lower data) shown by comparing the expression of the marker protein. Scale bars are 500 μm in black and 100 μm in white. Panel b of FIG. 1 shows B. longum, Lactobacillus gasseri, L. curvatus, L. rhamnosus and Lactobacillus reuteri. After treating the culture medium of strain DS0384 (L. reuteri) to intestinal organoids, the changes in the size of intestinal organoids (left panel) and the budding structure of intestinal organoids were analyzed to confirm the morphological changes of intestinal organoids. It is a graph comparing by checking the number (right panel). Panel c of FIG. 1 shows mature intestinal marker genes (CDX2, DPP4, OLFM4, DEFA5, CREB3L3, KRT20, LYZ, LCT, SLC5A1 and MUC13 in intestinal organoids treated with the Lactobacillus reuteri DS0384 (L. reuteri) strain of the present invention ) It is a graph comparing the expression level of the control group by qRT-PCR.

Panel a of FIG. 2 shows intestinal organoids treated with cultures of DS0191, DS0195, DS0333, DS0354 and Lactobacillus reuteri DS0384 strains classified as Lactobacillus reuteri, and then morphological changes in intestinal organoids were confirmed under a microscope. The result (upper data, Bright field, BF) and the result (lower data) shown by comparing the expression of the mature intestinal marker protein through immunofluorescence staining. Scale bars are 500 μm in black and 100 μm in white. Panel b of FIG. 2 is a graph comparing the expression levels of mature intestinal marker genes (CDX2, DPP4, OLFM4, DEFA5, CREB3L3, KRT20, LYZ, LCT, SLC5A1 and MUC13) by qRT-PCR.

Panel a of FIG. 3 is a result of microscopically confirming the morphological changes of intestinal organoids after treating the culture solution of DSP007, DS0337, KCTC3594 and Lactobacillus reuteri DS0384 strains of the present invention classified as Lactobacillus reuteri to intestinal organoids ( Upper data, Bright field, BF) and immunofluorescence staining show the results of comparing the expression of mature intestinal marker proteins (lower data). Scale bars are 500 μm in black and 100 μm in white. Panel b of FIG. 3 is a graph comparing the expression levels of mature intestinal marker genes (CDX2, DPP4, OLFM4, DEFA5, CREB3L3, KRT20, LYZ, LCT, SLC5A1 and MUC13) by qRT-PCR.

Figure 4 shows the morphological changes of intestinal organoids (scale bar: 500 μm, Upper panel) and a graph comparing the expression patterns of intestinal maturation marker genes in intestinal organoids treated with the culture solution of the Lactobacillus reuteri strain obtained for each culture time by qRT-PCR (middle panel). In addition, in order to confirm the morphological change of the intestinal organoid, a graph comparing the size change of the intestinal organoid by surface area and the number of budding structures of the intestinal organoid is compared (lower panel).

5 is a heat map showing metabolites contained in the Lactobacillus reuteri DS0384 strain culture medium using capillary electrophoresis mass spectrometry, and 14 metabolites not appearing in the KCTC3594 strain are marked in red.

Panel a of FIG. 6 shows the intestinal maturation and intestinal development effects of 7 metabolites that are differentially included in the culture medium of the Lactobacillus reuteri DS0384 strain compared to the same strain, and the morphological changes of intestinal organoids are examined under a microscope. The results confirmed by (upper data, Bright field, BF) and the results shown by comparing the expression of mature intestinal marker proteins through immunofluorescence staining (lower data), and panel b of FIG. 6 shows mature intestinal marker genes (CDX2, DPP4, OLFM4, DEFA5, CREB3L3, KRT20, LYZ, LCT, SLC5A1 and MUC13) gene expression patterns were confirmed through qRT-PCR and compared.

Figure 7 shows the result of microscopically confirming the morphological changes of intestinal organoids (left data, Bright field, BF) and immunofluorescence staining that NCG promotes intestinal maturation and intestinal development at a level similar to that of the culture medium of Lactobacillus reuteri DS0384 strain. This is the result (data on the right) shown by comparing the expression of the mature intestinal marker protein through . Figure 8 shows that NCG promotes intestinal maturation and intestinal development at a level similar to that of the culture medium of Lactobacillus reuteri DS0384 strain. ) A graph confirming the number of structures (upper panel) and a result of comparing the expression patterns of intestinal maturation markers by qRT-PCR (lower panel).

Figure 9a is a schematic diagram of an intestinal organoid experiment to confirm the protective efficacy of NCG from ulcerative colitis. Representative pro-inflammatory cytokines (Ifnγ, Tnfα; I/T) of ulcerative colitis were treated to induce intestinal organoids similar to intestinal inflammation. It shows an experiment in which the phenotype of intestinal organoid epithelial cells was observed by simultaneous treatment with NCG.

9B shows morphological changes of normal intestinal organoids, colitis-like intestinal organoids, and NCG-treated intestinal organoids in an experiment to confirm the intestinal protective effect of NCG against ulcerative colitis.

9C is a comparison of changes in the size of intestinal organoids (left panel) and changes in the number of germinated structures (right panel) in order to confirm morphological changes in colitis-like intestinal organoids and NCG-treated intestinal organoids. it is a graph

9D shows goblet cells secreting mucin through histological morphology analysis (H&E staining) and mucin staining (Alcian Blue-Periodic Acid Schiff staining; AB-PAS staining) of colitis-like intestinal organoids and NCG-treated intestinal organoids. This is the result of confirming the intestinal function.

FIG. 9e confirms through immunofluorescence staining that the barrier function (ZO-1) is restored and intestinal stem cell proliferating cells (Ki67) are not reduced compared to colitis-like intestinal organoids through NCG co-treatment (left panel). ). A graph comparing the expression ratio of intestinal epithelial structure (ECAD) marker to barrier structure (ZO-1) (middle panel) and a graph comparing the number of Ki67 marker-expressing cells in each micrograph (right panel) ).

FIG. 9F shows, at the gene level, pro-inflammatory cytokines (IL-1β, IL-6, IL-8, TNFα), intestinal epithelial cells and structures (VIL1, EPCAM, KRT20), barrier structures (CLAUDIN), and goblet cells (MUC2). ), and the expression patterns of Panes cells (LYZ) were confirmed and compared through qRT-PCR.

Figure 10a is a schematic diagram of an experiment to confirm the efficacy of NCG preventing or protecting the intestines from ulcerative colitis. An experiment in which the disease phenotype was observed by inducing ulcerative colitis after treatment with NCG to confirm the efficacy of preventing or protecting the intestine from ulcerative colitis is shown.

Figure 10b shows the weight loss rate of a normal group, an ulcerative colitis control group, and an NCG-treated experimental group in an experiment to confirm the efficacy of NCG for preventing ulcerative colitis or protecting the intestines.

10c is a result showing the length and fecal shape of the large intestine of a normal group, an ulcerative colitis control group, and an NCG experimental group in an experiment to confirm the efficacy of NCG for preventing or protecting the intestine from ulcerative colitis.

Figure 10d is a graph showing changes in the length of the large intestine by a normal group, an ulcerative colitis control group, and NCG treatment in an experiment to confirm the efficacy of preventing or protecting the intestines from NCG ulcerative colitis.

Figure 10e shows the results of histological analysis of a normal group, an ulcerative colitis control group, and an NCG experimental group in an experiment to confirm the efficacy of NCG for preventing or protecting the intestine from ulcerative colitis.

Figure 11a is a schematic diagram of an experiment to confirm the therapeutic efficacy of NCG for ulcerative colitis, showing an experiment in which a mouse model induced with ulcerative colitis was treated with NCG for 10 days and the disease phenotype was observed.

Figure 11b shows the weight loss rate of a normal group, an ulcerative colitis control group, and an NCG treatment experimental group in an experiment to demonstrate the efficacy of NCG enteritis treatment.

11c is a photograph confirming the length and fecal shape of the large intestine of a normal group, an ulcerative colitis control group, and an NCG experimental group in an experiment to demonstrate the efficacy of NCG for treating enteritis.

Figure 11d is a graph showing changes in the length of the large intestine by NCG treatment in a normal group, an ulcerative colitis control group, and an experiment to demonstrate the efficacy of NCG for treating enteritis.

12a shows the histological changes of the intestine by H&E staining of an experimental group treated with NCG at each concentration in an experiment to demonstrate the efficacy of NCG for treating enteritis.

Figure 12b is a graph quantifying histological morphology analysis of a cross-section of the large intestine in an experiment to show the efficacy of NCG enteritis treatment.

Figure 12c is an experiment to show the efficacy of NCG enteritis treatment, mucin staining (Alcian Blue-Periodic Acid Schiff staining; AB-PAS staining) confirms the reduction of mucin-secreting goblet cells and intestinal functionality.

12D shows the results of MUC2 immunofluorescence staining, and it was confirmed that goblet cells appeared at a level similar to that of the normal group in the 100 mM NCG-treated group compared to the ulcerative colitis control group.

13 confirms that the intestinal barrier functionality is restored through 100 and 200 mM NCG treatment compared to the ulcerative colitis control group. Through immunofluorescence staining of intestinal barrier structural proteins ZO-1 and CLDN1 and intestinal epithelial structural protein ECAD, it was confirmed that the NCG experimental group recovered the intestinal epithelial structure and barrier function compared to the colitis control group.

Figure 14a confirms the inflammatory markers (inflammatory cytokines, immune cell infiltration) of the normal group, the ulcerative control group, and the NCG treatment experimental group. It shows the result of immunofluorescence staining to confirm secretion and infiltration of immune cells (myeloid cells; CD11b+, macrophages; F4/80+).

14b is a diagram confirming the expression of pro-inflammatory cytokines (Il-6, Il-1β, Tnfα, Il-17a) and the nitric oxide indicator iNos at the gene level.

Figure 15a confirms that DSS-induced inflammatory bowel disease is alleviated to the level of the normal group through 100 mM NCG treatment at the gene level. From RNA sequencing data, the Spearman's correlation coefficient of the genomes of the normal group, ulcerative colitis control group, and NCG experimental group It shows the result of analyzing a total of 21,823 genes by comparative analysis through correlation. Red indicates the highest similarity between samples, and blue indicates the lowest similarity between samples.

15B is an analysis of the main components of differentially expressed genes (2-fold change) among the normal group, the ulcerative colitis control group, and the NCG experimental group, and shows the difference between each gene group through a PCA plot.

15c shows data compared in gene expression levels of a normal group, an ulcerative colitis control group, and a 100 mM NCG experimental group as a pattern graph and a heat map.

15D shows the results of GOterm analysis (biological process) of a total of 238 genes whose expression is decreased in the colitis control group (PBS) group compared to the normal group and whose expression is increased to the level of the normal group through 100 mM NCG treatment.

15E is a heat map representation of data comparing expression levels of genes involved in the Wnt signaling pathway.

FIG. 15F shows the results of comparing mRNA expression levels of major genes (Fzd7, Tcf7, Ror1, and Axin2) among genes involved in the Wnt signaling pathway through qPCR.

15g is a result of comparing the expression of intestinal stem cell proliferation marker (Ki-67) through immunofluorescence chemical staining.

15H shows the result of measuring the expression level of the Cps1 gene through RNAseq, and shows that NCG does not affect the expression level of Cps1, which is one of the indicators of ulcerative colitis.

Figure 16a is a schematic diagram of an experiment to confirm the effect of NCG in the normal group, showing an experiment in which PBS or NCG was orally administered to the normal group for 10 days, and clinical symptoms were observed and analyzed in the normal group.

Figure 16b shows the change in body weight of the normal group and the 100 mM NCG treated experimental group in an experiment to confirm the effect of NCG in the normal group.

16c is a photograph confirming the length and fecal shape of the large intestine of the normal group and the 100 mM NCG treated experimental group in an experiment to confirm the effect of NCG in the normal group.

16d shows the histological morphology of the intestine by H&E staining in the normal group and the 100 mM NCG treated experimental group in an experiment to confirm the effect of NCG in the normal group, and it was confirmed that the crypt and villous structure were maintained similarly to the normal group. .

Figure 16e is an experiment to confirm the effect of NCG in the normal group, the increase and decrease of mucin-secreting goblet cells and intestinal functionality were confirmed through AB-PAS staining of the normal group and the 100 mM NCG treated experimental group, similar to the normal group. In the experimental group treated with 100 mM NCG, it was confirmed that the goblet cell morphology and mucin secretion function were maintained.

Figure 16f compares the expression of pro-inflammatory cytokines (Il-6, Il-1β, Tnfα, Ifnγ, Il-17a) and inflammation-related enzymes (iNos) at the gene level in an experiment to confirm the effect of NCG in the normal group. it did

Hereinafter, the present invention will be described in detail.

One. Novel production method of N-carbamyl-L-glutamic acid

One aspect of the present invention provides a method for producing N-carbamyl-L-glutamic acid comprising the steps of culturing the Lactobacillus reuteri DS0384 strain in a medium.

The N-carbamyl-L-glutamic acid (N-carbamyl-L-glutamic acid, NCG) is a metabolically stable form of N-acetylglutamate that activates carbamyl phosphate synthetase-1, the first enzyme involved in the urea cycle. As an analog, it has a structure of the following chemical formula.

[chemical formula]

The Lactobacillus reuteri may be strain DS0384, and may be deposited at the Korea Research Institute of Bioscience and Biotechnology (KCTC) on April 6, 2020 under accession number KCTC 14164BP. The Lactobacillus reuteri DS0384 strain is a microorganism classified in the genus Lactobacillus, and may be a microorganism that is not toxic or does not cause disease in humans or non-human animals, and is beneficial to the health of humans or non-human animals in the intestine. It can act as a beneficial bacteria. In addition, the Lactobacillus reuteri DS0384 strain may have an activity to promote intestinal development or intestinal maturation and restore intestinal damage.

In a specific embodiment of the present invention, the development of the small intestine and large intestine is achieved even when mice are given oral gavage with a culture solution containing cells of the Lactobacillus reuteri DS0384 strain or a culture solution containing metabolites produced by the strain. It was confirmed that the expression of the mature intestinal marker gene was increased. In particular, the Lactobacillus reuteri DS0384 strain exhibited an intestinal maturation promoting effect that was not shown in other lactic acid bacteria, and was related to intestinal maturation even when compared to the case of treating 7 types of microbial cultures classified as Lactobacillus reuteri. It was confirmed that the expression level of genes and proteins was significantly higher, or the expression of intestinal maturation-related marker genes, which were not increased in other microbial culture medium treatment groups, was increased (FIGS. 1 to 3).

As the Lactobacillus reuteri DS0384 strain is cultured, the culture solution of the Lactobacillus reuteri DS0384 strain contains N-carbamyl-L-glutamic acid, a metabolite produced by the strain.

In a specific example of the present invention, it was confirmed that N-carbamyl-L-glutamic acid was included among 14 metabolites present only in the culture medium of Lactobacillus reuteri DS0384 among five homologous Lactobacillus reuteri strains. In addition, as a result of comparing the intestinal maturation and development promoting effect and intestinal damage recovery effect using N-carbamyl-L-glutamic acid among metabolites present only in the culture medium of Lactobacillus reuteri DS0384 strain, N-carbamyl-L-glutamic acid It was found that N-carbamyl-L-glutamic acid was the active ingredient showing the effect of promoting intestinal maturation and development of the culture medium of the Lactobacillus reuteri DS0384 strain, since only this has the effect of promoting intestinal maturation and development at the same level as the culture medium ( 5 and 6).

The culture medium refers to the culture medium itself obtained by culturing the strain, the culture supernatant obtained by removing the strain therefrom, and their filtrate, concentrate or dried product, "culture supernatant", "conditioned culture medium" Or it may be used interchangeably with "conditioned medium". Specifically, the culture medium is obtained by culturing the Lactobacillus reuteri DS0384, and may be the culture medium itself containing the cells of the strain, or the culture supernatant obtained by removing the cells therefrom, and also their filtrate, It can be a concentrate or dry matter. The culture medium from which the cells are removed may contain components produced and secreted by the Lactobacillus reuteri DS0384 strain, such as metabolites, and thus may have intestinal development or intestinal maturation activity, and preventive or therapeutic activity of inflammatory diseases.

The filtrate is obtained by removing solid particles suspended from the culture solution of Lactobacillus reuteri DS0384 to obtain only the water-soluble supernatant excluding the precipitate, and the particles are filtered out using a filter such as cotton or nylon, such as a filter of 0.2 μm to 5 μm, or Freezing filtration, centrifugation, etc. may be used, but is not limited thereto.

The concentrate increases the solid concentration of the culture solution, and may be a concentrate of the culture solution containing the lactic acid bacteria cells or a concentrate of the culture supernatant from which the lactic acid bacteria cells are removed. The concentrate may be concentrated by vacuum concentration, plate type concentration, thin film concentration, etc., but is not limited thereto. The content of the culture medium included in the composition of the present invention may be appropriately adjusted according to the concentration of the concentrate.

The culturing may be performed in a medium for culturing a Lactobacillus strain in general. The medium may contain components essential for the growth of the Lactobacillus reuteri DS0384 strain. For example, it may include components such as glucose, amino acid, yeast extract, proteus peptone, polysorbate 80, ammonium citrate, magnesium sulfate, dipotassium phosphate, and sodium acetate, but is not limited thereto, and the Lactobacillus reuteri DS0384 strain It can be included without limitation as long as it is a component that can help the growth of. The pH of the medium may be adjusted to the range of pH 5 to 7.

The culturing may be performed for 3 hours or more, 5 hours or more, 7 hours or more, 10 hours or more, 13 hours or more, 15 hours or more, 18 hours or more, 20 hours or more, 24 hours or more, specifically 18 hours or more It can be.

In a specific example of the present invention, when the Lactobacillus reuteri DS0384 strain was cultured for 18 hours or more, it was confirmed that the intestinal maturation and development promotion effect was excellent (FIG. 4).

The method for producing the N-carbamyl-L-glutamic acid may further include separating the culture solution of the strain.

The step of separating the culture medium of the strain refers to the step of separating the cells of the strain cultured in the medium and the metabolites produced by the strain. Obtaining only the culture supernatant excluding the precipitate by removing solid particles floating in the culture itself cultured in the medium, and centrifuging or filtering the strain and its culture medium. Concentrating the culture supernatant obtained by the separation steps may be included.

The method for producing N-carbamyl-L-glutamic acid may further include purifying N-carbamyl-L-glutamic acid from the culture medium of the strain.

The purification is a method of purifying a conventional microbial culture solution by removing impurities from a mixture of a strain and a culture solution or a culture solution separated from the strain, and separating N-carbamyl-L-glutamic acid into functional raw materials or raw materials. is available. Product stability and production efficiency may be increased through the purification process. For example, chromatography or the like can be used, but is not limited thereto, and includes methods commonly used in microbial culture solution purification processes.

Through the present invention, N-carbamyl-L-glutamic acid, which had to be produced by conventional chemical methods, can be biosynthesized by culturing Lactobacillus reuteri strains, and safe physiological activity produced as metabolites by Lactobacillus reuteri strains, which are beneficial intestinal bacteria NCG, a substance, can be efficiently produced.

2. New uses of N-carbamyl-L-glutamic acid

Another aspect of the present invention provides a composition for preventing or treating inflammatory diseases comprising N-carbamyl-L-glutamic acid as an active ingredient.

The N-carbamyl-L-glutamic acid (N-carbamyl-L-glutamic acid, NCG) is as described above in the section “ 1. Novel production method of N-carbamyl-L-glutamic acid ”.

In the present invention, the term "inflammatory disease" refers to the pathological condition of an abscess formed in the body by bacterial invasion. Inflammatory diseases include, for example, inflammatory bowel disease, osteoarthritis, rheumatoid arthritis, gout, ankylosing spondylitis, tendonitis, and tenosynovitis. , rheumatoid fever, lupus, fibromyalgia (fibromyalgia), psoriatic arthritis, asthma, dermatitis, may be an acute chronic inflammatory disease, such as atopy, may be specifically inflammatory bowel disease. It is not limited thereto and may include all inflammatory pathological conditions appearing throughout the body.

In the present invention, the term "intestine" refers to the region of the digestive tract extending from the stomach to the anus. In humans and other mammals, the intestine consists of two regions: the small intestine (in humans, it is further subdivided into duodenum, empty intestine, and stone intestine) and the large intestine (in humans, it is further subdivided into cecum and colon); It may have a complex intestine, and in the present invention, the intestine may include all of them.

In the present invention, the term "inflammatory bowel disease" is a chronic disease of unknown cause in which the intestine becomes inflamed, and collectively refers to all chronic digestive diseases in which intestinal inflammation lasts for several months or more and becomes chronic. The inflammatory bowel disease may be ulcerative colitis, Crohn's disease or Behcet's enteritis. However, regardless of the cause of inflammation, it can include any disease in which abnormal chronic inflammation occurs in the intestine. Ulcerative colitis is characterized by inflammation of the mucous membrane of the large intestine extending from the rectum to the proximal large intestine, and Crohn's disease can occur throughout the gastrointestinal tract from the mouth to the anus. Behcet's disease is an inflammatory disease that chronically manifests in various organs throughout the body. However, it is not limited thereto, and includes all diseases in which abnormal chronic inflammation in the intestinal tract repeats improvement and recurrence. Symptoms of the inflammatory bowel disease include diarrhea, mucous stool, abdominal pain, weight loss, rectal bleeding, anal pain, constipation, abdominal mass, fever, and the like. In addition, symptoms such as increased expression of inflammatory markers and increased expression of carbamyl phosphate synthetase-1 (Cps1) may appear.

The N-carbamyl-L-glutamic acid has an effect of preventing, improving or treating inflammatory bowel disease.

In the present invention, the term "prevention" refers to any action that suppresses or delays the onset of a disease or adverse condition by administering a composition to a subject.

In the present invention, the term "treatment" may be any action that improves the symptoms of a disease or negative condition that has been caused by administering a composition to a subject.

In the present invention, the term "improvement" refers to all actions including improvement, suppression, or delay of symptoms, and may be used interchangeably with the prevention or treatment.

In a specific embodiment of the present invention, as a result of simultaneous administration of pro-inflammatory cytokines and N-carbamyl-L-glutamic acid to intestinal organoids, morphological changes in intestinal epithelium and intestinal organoids, which are representative indicators of intestinal epithelial damage, compared to colitis control groups. It was confirmed that there was little change in nodoid germination, no cell necrosis occurred histologically, intestinal structure and intestinal stem cells were maintained, and expression of inflammatory markers (inflammatory cytokines) was reduced, suggesting that NCG has a preventive effect on colitis or It was confirmed that there was an effect of protecting the intestine (FIGS. 9a to 9f).

In an animal model in which ulcerative colitis was induced after first administration of N-carbamyl-L-glutamic acid, the shape of feces, which is an important clinical marker of inflammatory bowel disease, was in the form of lumps, and the degree of weight loss and occult blood in feces compared to the control group. Histologically, cell necrosis did not occur, the inflammatory response was reduced, and the crypt and villous structures were maintained. Through this, it was confirmed that N-carbamyl-L-glutamic acid prevents inflammatory bowel disease and has intestinal protective effects (FIG. 10a to 10e).

The N-carbamyl-L-glutamic acid has a therapeutic effect on inflammatory bowel disease. Inflammatory bowel disease treatment is all that improves the negative conditions such as weight loss, occult blood in feces, watery feces, and destruction of the structure of crypts and villi in the intestine, which are representative clinical symptoms of inflammatory bowel disease. It means (FIG. 11b to 11c, FIG. 12, FIG. 13).

The N-carbamyl-L-glutamic acid has an activity to reduce the expression of inflammatory markers. The inflammatory markers may be proinflammatory cytokines, inflammation-related enzymes, and infiltration of immune cells. The pro-inflammatory cytokine may be TNFα, IFNγ, Il-6, Il-8, Il-1β, IL-17, etc., and the inflammation-related indicator may be iNOs that produce nitric oxide. In addition, infiltration of immune cells such as bone marrow cells or macrophages may be reduced.

In a specific example of the present invention, when intestinal organoids were co-treated with pro-inflammatory cytokines and NCG, the expression of IL-1β, IL-6, IL-8, and TNFα decreased compared to the control group (Figs. 9a to 9f). ), and expression levels of pro-inflammatory cytokines (Il-6, Il-1β, Tnfα, Il-17a) and iNos, which are representative inflammatory markers in ulcerative colitis animal models, were also reduced in the 100 or 200 mM NCG treated experimental group. , The infiltration of immune cells (myeloid cells; CD11b+, macrophages; F4/80+) was reduced, confirming that there was a therapeutic effect on inflammatory bowel disease (FIG. 14).

The N-carbamyl-L-glutamic acid has an activity to restore barrier functionality. Restoring the barrier function may mean restoring the intestine to its original state by increasing the surface area of the intestine damaged by inflammation, or reducing damage by protecting the intestine from damage. In addition, the restoration of the barrier function may be by increasing the expression of genes or protein markers related to the function or proliferation of the intestinal barrier or the expression of goblet cells and Panes cells in the intestinal mucus layer in the damaged intestine. The barrier function marker is ZO-1 protein or CLDN1 protein, intestinal epithelial structural protein (ECAD), intestinal epithelial cell and structural genes (VIL1, EPCAM, KRT20), barrier structural gene (CLAUDIN), goblet cell marker gene (MUC2) , Panes cell marker gene (LYZ), and the proliferation marker may be barrier proliferation marker Ki67 protein, but is not limited thereto.

In a specific example of the present invention, in colitis intestinal organoids treated with NCG, intestinal epithelial cells and structures (VIL1, EPCAM, KRT20), barrier structures (CLAUDIN), goblet cells (MUC2), Panes cells ( LYZ) was confirmed to increase (FIG. 9f). In addition, it was confirmed that the expression of barrier function-related proteins (ZO-1, CLDN1) and intestinal epithelial structural protein (ECAD) increased to a similar degree to the normal group in colitis animal models administered with 100 and 200 mM NCG. It was confirmed that the intestinal structure was clearly restored (FIG. 13). In addition, it was confirmed that the expression of Ki67 protein, an intestinal stem cell proliferation marker, increased (FIG. 15g). Through this, NCG restores the intestinal epithelial structure and barrier function to ulcerative colitis, and promotes the proliferation of intestinal stem cells By doing so, it was confirmed that there is a therapeutic effect on inflammatory bowel disease.

The N-carbamyl-L-glutamic acid is characterized by activating the Wnt signaling pathway. The Wnt signaling pathway is a pathway that performs various and important functions related to cell proliferation, differentiation, death, migration, and survival within cells, and plays a role in regulating the immune response in cancer or inflammatory diseases, although the exact mechanism has not been elucidated. N-carbamyl-L-glutamic acid can exhibit a therapeutic effect on inflammatory diseases by activating the Wnt signaling pathway and regulating the immune response in inflammatory diseases. Among the Wnt signaling pathways, genes whose expression is increased may be Fzd7, Tcf7, Ror1, and Axin2.

On the other hand, the N-carbamyl-L-glutamic acid is characterized by not affecting the expression of CPS1 in inflammatory bowel disease. Carbamyl phosphate synthase-1 (Cps1) is the first enzyme involved in the mitochondrial urea cycle. It is mainly expressed in intestinal epithelial cells and hepatocytes. The protein detoxifies ammonia and de novo arginine with other enzymes in the urea cycle. ) serves as a source of supply. It is known that expression of Cps1 is increased in dysplastic tissues of inflammatory bowel diseases such as ulcerative colitis or gastrointestinal cancers. N-carbamyl-L-glutamic acid is a metabolic analogue of N-acetylglutamate that activates Cps1, but N-carbamyl-L-glutamic acid at this concentration does not affect the expression or activity of Cps1 in inflammatory bowel disease. there is.

In a specific embodiment of the present invention, Cps1, whose expression is increased in patients with ulcerative colitis, was confirmed to have no change in expression level when treated with NCG, and therefore, the therapeutic effect of NCG on inflammatory bowel disease is not related to Cps1 was confirmed (Fig. 15h).

In addition, as a result of bioinformatic analysis of genes whose expression was increased or decreased compared to the control group in the ulcerative colitis animal model, the main mechanism for preventing or treating inflammatory bowel disease by N-carbamyl-L-glutamic acid was the Wnt signaling pathway , and it was confirmed that the expression of major genes (Fzd7, Tcf7, Ror1, Axin2) of the Wnt signaling pathway increased (FIGS. 15a to 15f).

The N-carbamyl-L-glutamic acid is characterized by no toxicity and excellent stability. Since N-carbamyl-L-glutamic acid is produced by the beneficial microorganism Lactobacillus reuteri strain or is chemically identical thereto, it can be stably used as an alternative treatment for existing inflammatory bowel disease without side effects. In a specific embodiment of the present invention, as a result of administering N-carbamyl-L-glutamic acid to a normal group, histological changes including the length of the large intestine, crypts and villi structures, and significant changes in the expression level of inflammatory markers, barrier function, etc. It was confirmed that there was no toxicity and no side effects (FIGS. 16a to 16f).

When the N-carbamyl-L-glutamic acid is included in the composition at an appropriate concentration, the preventive, ameliorative, or therapeutic activity of N-carbamyl-L-glutamic acid for inflammatory bowel disease may be increased. For example, a lower limit of any one selected from the group consisting of 1 mM, 5 mM, 10 mM, 20 mM, 30 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, 100 mM; And 150 mM, 200 mM, 250 mM, 300 mM, 350 mM, 400 mM, may be included in a concentration range selected from the upper limit of any one selected from the group consisting of 500 mM, specifically, 1 mM to 300 mM, 20 The therapeutic activity for inflammatory bowel disease with N-carbamyl-L-glutamic acid can be maximized when it is included at 250 mM to 250 mM, 50 mM to 300 mM, 50 mM to 250 mM, and 100 to 200 mM.

In a specific embodiment of the present invention, as a result of oral administration of NCG (0, 1, 10, 100, 200, 250, 500 mM) by concentration to an ulcerative colitis animal model weighing 20 to 25 g, different concentrations (1, 10 .

As described above, the composition of the present invention contains N-carbamyl-L-glutamic acid, which has excellent preventive, ameliorative, or therapeutic effects on inflammatory diseases, particularly inflammatory bowel diseases, as an active ingredient, and is a safe ingredient without side effects, thereby treating inflammatory diseases. can be usefully used as

The composition may be a pharmaceutical composition, health functional food composition or feed composition.

The pharmaceutical composition of the present invention is prepared in unit dosage form by formulation using a pharmaceutically acceptable carrier and/or excipient according to a method that can be easily performed by those skilled in the art. Or it may be prepared by putting it in a multi-dose container. At this time, the formulation may be in the form of a solution, suspension or emulsion in an oil or aqueous medium, or may be in the form of an extract, powder, granule, tablet, capsule or gel (eg, hydrogel), and may additionally contain a dispersing agent or stabilizer. can

In addition, the N-carbamyl-L-glutamic acid contained in the pharmaceutical composition may be incorporated into a pharmaceutically acceptable carrier such as a colloidal suspension, powder, saline solution, lipid, liposome, microspheres, or nano-spherical particles. can be transported They may be complexed with or associated with the delivery vehicle and are known in the art such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation reagents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancing substances or fatty acids. It can be delivered in vivo using known delivery systems.

In addition, pharmaceutically acceptable carriers include lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia, rubber, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, poly vinylpyridone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propyl hydroxybenzoate, talc, magnesium stearate, and mineral oil, but are not limited thereto. In addition to the above components, lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, and the like may be further included. Suitable pharmaceutically acceptable carriers and agents are described in detail in Remington's Pharmaceutical Sciences, 19th ed., 1995.

The pharmaceutical composition can be administered orally or parenterally during clinical administration and can be used in the form of a general pharmaceutical preparation. That is, the pharmaceutical composition of the present invention can be administered in various oral and parenteral formulations at the time of actual clinical administration, and when formulated, commonly used fillers, extenders, binders, wetting agents, disintegrants, Or prepared using an excipient. Solid preparations for oral administration include tablets, pills, powders, granules, capsules, etc. These solid preparations contain at least one excipient such as starch, calcium carbonate, sucrose or lactose in a herbal extract or fermented herbal medicine. , gelatin, etc. are mixed and prepared. In addition to simple excipients, lubricants such as magnesium styrate and talc are also used. Liquid formulations for oral administration include suspensions, internal solutions, emulsions, syrups, etc. In addition to water and liquid paraffin, which are commonly used simple diluents, various excipients such as wetting agents, sweeteners, aromatics, and preservatives may be included. there is. Formulations for parenteral administration include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories. Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspending agents. As a base for the suppository, Witepsol, Macrogol, Tween 61, cacao butter, laurin paper, glycerol, gelatin, and the like may be used.

The pharmaceutical composition may be used alone or in combination with methods using surgery, radiation therapy, hormone therapy, chemotherapy, and biological response modifiers for the prevention or improvement of inflammatory diseases.

The concentration of the active ingredient included in the pharmaceutical composition may be determined in consideration of the purpose of treatment, the condition of the patient, the required period, and the like, and is not limited to a specific range of concentration. The pharmaceutical composition of the present invention is administered in a pharmaceutically effective amount. In the present invention, "pharmaceutically effective amount" means an amount sufficient to treat a disease with a reasonable benefit / risk ratio applicable to medical treatment, and the effective dose level is the type of patient's disease, severity, activity of the drug, It may be determined according to factors including sensitivity to the drug, time of administration, route of administration and excretion rate, duration of treatment, drugs used concurrently, and other factors well known in the medical field. The pharmaceutical composition may be administered as an individual therapeutic agent, or may be administered in combination with other therapeutic agents for intestinal developmental disorders, may be administered simultaneously, separately, or sequentially with conventional therapeutic agents, and may be administered single or multiple times. It is important to administer the amount that can obtain the maximum effect with the minimum amount without side effects in consideration of all the above factors, which can be easily determined by those skilled in the art.

When N-carbamyl-L-glutamic acid contained in the pharmaceutical composition of the present invention is administered to a patient at an appropriate concentration, the preventive, ameliorative, or therapeutic effect of N-carbamyl-L-glutamic acid on inflammatory bowel disease is maximized. can make it For example, NCG per 25 g of body weight is selected from the group consisting of 1 mM, 5 mM, 10 mM, 20 mM, 30 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM and 100 mM N-carbamyl-L-glutamic acid. lower limit of either; And when administered in a concentration range selected from the upper limit of any one selected from the group consisting of 150 mM, 200 mM, 250 mM, 300 mM, 350 mM, 400 mM, 500 mM, specifically 1 mM to 300 mM, 20 mM to 250 mM, 50 mM to 300 mM, 50 mM to 250 mM, and 100 to 200 mM, the therapeutic effect of N-carbamyl-L-glutamic acid on inflammatory diseases can be maximized.

The effective amount of the pharmaceutical composition of the present invention may vary depending on the patient's age, sex, condition, body weight, absorption of the active ingredient in the body, inactivation rate, excretion rate, disease type, concomitant drug, administration route, obesity It may increase or decrease according to severity, gender, weight, age, etc. For example, a group consisting of 1 mM, 5 mM, 10 mM, 20 mM, 30 mM, 50 mM, 60 mM, 70 mM, 80 mM, 90 mM, 100 mM N-carbamyl-L-glutamic acid per 25 g of patient weight per day Any one lower limit selected from; And when administered in a concentration range selected from the upper limit of any one selected from the group consisting of 150 mM, 200 mM, 250 mM, 300 mM, 350 mM, 400 mM, 500 mM, specifically 1 mM to 300 mM, 20 mM to 250 mM, 50 mM to 300 mM, 50 mM to 250 mM, 100 to 200 mM. In addition, according to the judgment of the doctor or pharmacist, it may be administered several times a day at regular time intervals, for example, 2 to 3 times a day.

In a specific embodiment of the present invention, administration of different concentrations (0, 1, 10, 250, 500 mM) when 200 μl of NCG per 20 to 25 g of body weight is orally administered in an ulcerative colitis animal model at a concentration of 100 to 200 mM It was confirmed that the preventive and therapeutic effects for inflammatory bowel disease were superior to those of inflammatory bowel disease.

Another aspect of the present invention provides a kit comprising the pharmaceutical composition.

Specifically, (1) a pharmaceutical composition for treating inflammatory diseases by administering a therapeutically effective amount of N-carbamyl-L-glutamic acid, and (2) 0.001 mM to 0.001 mM to 25 g of N-carbamyl-L-glutamic acid per 25 g of patient weight. A kit including a package insert instructing administration at a concentration of 300 mM is provided.

The formulation of the pharmaceutical composition, administration method, dosage and description of the concentration of the active ingredient contained in the composition are the same as those described above. The packaging insert contains instructions for the dosage described above. The kit of the present invention may be attached with a packaging insert having instructions such as precautions in the form instructed by a government agency regulating the manufacture, use, or sale of drugs or biological products.

Another aspect of the present invention provides a method for preventing or treating an inflammatory disease comprising administering the pharmaceutical composition to a subject.

The subject may be a human or a non-human animal, and the subject may be a human or non-human animal in an early or middle stage of an inflammatory disease, particularly an inflammatory bowel disease.

The formulation of the pharmaceutical composition, administration method, dosage and description of the concentration of the active ingredient contained in the composition are the same as those described above.

The health functional food composition of the present invention can prevent or improve inflammatory diseases of humans or non-human animals.

When using the health functional food composition as a food additive, the health functional food composition may be added as it is or used together with other foods or food ingredients, and may be appropriately used according to conventional methods. The amount of the active ingredient can be appropriately used depending on the purpose of its use (prevention or improvement). In general, when preparing food or beverage, the health functional food composition of the present invention is added in an amount of 15 parts by weight or less, preferably 10 parts by weight or less, based on the raw material. However, in the case of long-term intake for health purposes, the amount may be less than the above range, and since there is no problem in terms of safety, the active ingredient may be used in an amount above the above range.

There is no particular limitation on the type of health functional food. Foods to which the health functional food composition can be added may be probiotics preparations, such as meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, gum, dairy products including ice cream, and various There are soups, beverages, tea drinks, alcoholic beverages, vitamin complexes, and fermented foods, and includes all health foods in a conventional sense. In particular, the fermented food may be yogurt (hard type, soft type, drink type), fermented milk such as lactic acid bacteria beverage, cheese or butter, but is not limited thereto, and any fermented microorganisms or lactic acid bacteria are produced by fermentation. It can include food and even products.

In addition, the health functional food composition may be prepared as a food, particularly a functional food. The functional food includes ingredients commonly added during food preparation, and includes, for example, proteins, carbohydrates, fats, nutrients, and seasonings. For example, when prepared as a drink, natural carbohydrates or flavoring agents may be included as additional ingredients in addition to active ingredients. The natural carbohydrates are monosaccharides (eg, glucose, fructose, etc.), disaccharides (eg, maltose, sucrose, etc.), oligosaccharides, polysaccharides (eg, dextrins, cyclodextrins, etc.) or sugar alcohols (eg, maltose, sucrose, etc.) , xylitol, sorbitol, erythritol, etc.) are preferred. As the flavoring agent, natural flavoring agents (eg, thaumatin, stevia extract, etc.) and synthetic flavoring agents (eg, saccharin, aspartame, etc.) may be used.

In addition to the health functional food composition, various nutrients, vitamins, electrolytes, flavors, colorants, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonic acid It may further contain a carbonation agent used in beverages and the like. The ratio of the components to be added is not very important, but is generally selected in the range of 0.01 to 0.1 parts by weight based on 100 parts by weight of the health functional food composition.

The feed composition of the present invention can prevent or improve inflammatory diseases in animals other than humans, and can be added as a feed additive composition for this purpose. The feed additives correspond to supplementary feeds under the Feed Management Act.

In the present invention, the term "feed" means any natural or artificial diet, one meal, etc., or a component of the one meal for an animal to eat, ingest, and digest, or suitable therefor, and the animal is an animal other than a human. . The type of feed is not particularly limited, and feeds commonly used in the art may be used. Non-limiting examples of the feed include vegetable feeds such as grains, root fruits, food processing by-products, algae, fibers, pharmaceutical by-products, oils and fats, starches, meal or grain by-products; Animal feed such as proteins, inorganic materials, oils, mineral oils, oils, single cell proteins, zooplankton, or food may be mentioned. These may be used alone or in combination of two or more.

Hereinafter, the present invention will be described in detail by examples.

However, the following examples specifically illustrate the present invention, and the content of the present invention is not limited by the following examples.

[Example 1]

Confirmation of intestinal maturation promoting effect of N-carbamyl-L-glutamic acid among the metabolites of Lactobacillus reuteri strains

[1-1] Differentiation of human intestinal organoids

Intestinal organoids were prepared by differentiating human pluripotent stem cells. For the differentiation of human pluripotent stem cells, a method known in the art (Nature 470, 105-109 (2011)) was used. Specifically, for the induction of true endoderm in human pluripotent stem cells (H9 (WA09); WiCell Research Institute, Madison, WI, USA), fetal bovine serum for 3 days with 100 ng/ml of Activin A (FBS, Thermo Scientific)) was treated with the stem cells, and the fetal bovine serum was treated while increasing the concentration to 0%, 0.2%, and 2%, respectively. For the formation of hindgut spheroids, 500 ng/ml of FGF4, 3 μM of CHIR 99021, and 2% fetal bovine serum were additionally cultured for 4 days using a differentiation medium. Spheroids formed by induction of differentiation are inserted into the dome of Matrigel, and in a three-dimensional culture environment, 1× B27 supplement (B27 supplement, Invitrogen), 100 ng/ml EGF (R&D Systems), 100 ng/ml Noggin (R&D Systems ), and cultured in a culture medium containing 500 ng/ml R-spondin1 (R-spondin1, R&D Systems), and subcultured once every 10 days and used for experiments.

[1-2] Comparison of intestinal maturation and intestinal development effects of Lactobacillus reuteri strains

The intestinal organoids differentiated according to Example [1-1] were treated with several species of lactic acid bacteria and the same strain of Lactobacillus reuteri, and the maturation of the intestinal organoids was confirmed.

A total of 5 types of lactic acid bacteria were treated to confirm each effect, morphological changes were confirmed in the intestinal organoids treated with the lactic acid bacteria culture medium, and the expression of markers related to intestinal maturation was examined using immunocytochemistry (ICC) and qRT. -Confirmed through PCR. Lactic acid bacteria used were Bifidobacterium longum DS0431 (B. longum DS0431, isolated from feces of newborns), Lactobacillus gasseri DS0444 (L. gasseri DS0444, isolated from breast milk), Lactobacillus curvatus AB70 (L. curvatus AB70, female isolated from genital organs), Lactobacillus rhamnosus DS0979 (L. rhamnosus DS0979, isolated from breast milk) and Lactobacillus reuteri DS0384 (L. reuteri DS0384, isolated from newborn feces) strains of the present invention were used. Five types of lactic acid bacteria, including the Lactobacillus reuteri DS0384 strain, were cultured in MRS medium for 36 hours at 37°C under anaerobic conditions.

The culture solution of the five microbial strains cultured was centrifuged at 12,000 rpm for 10 minutes using a centrifuge, and only the supernatant was collected. The collected supernatant was pasteurized for 30 minutes on a heat block preheated to 65 ° C., and impurities were removed by filtering with a 0.22 μm syringe filter unit. The culture solution isolated in this way was treated by diluting 1/100 in the culture medium of the intestinal organoid, and subcultured twice for a total of 20 days, and changes in the intestinal organoid were observed.

First, the morphological changes of the intestinal organoids were confirmed by checking the size change of the intestinal organoids and the number of budding structures. Specifically, the size of 6 organoids for each lactic acid bacteria treatment group was measured and compared through photographs taken by observing intestinal organoids under a microscope, and the number of budding structures was 6 organoids for each lactic acid bacteria treatment group. For each organoid, the number of budding structures generated was confirmed.

As a result, compared to the case of processing the culture solution of the other four types of lactic acid bacteria, when the culture solution of the Lactobacillus reuteri DS0384 strain of the present invention was treated, larger intestinal organoids were observed and more germination structures were formed. (Data above in Fig. 1 a, Fig. 1 b). The surface area of organoids in the control group was measured as 0.30±0.02 ㎟, 0.27±0.06 ㎟ for the Bifidobacterium longum strain culture solution treatment group, 0.24±0.05 ㎟ for Lactobacillus gasseri, and 0.56±0.08 for Lactobacillus curvatus. ㎟, 0.41±0.10 ㎟ for Lactobacillus rhamnosus, and 1.10±0.07 ㎟ for the Lactobacillus reuteri DS0384 strain culture treatment group, indicating that the organoid size in the Lactobacillus curvatus and Lactobacillus reuteri DS0384 strain culture treatment group was measured. In particular, the organoid surface area increased the most in the Lactobacillus reuteri DS0384 strain culture solution treatment group (left panel of FIG. 1 b). As a result of measuring the number of germination structures, in the control group 3.17 ± 0.52, Bifidobacterium longum 2.33 ± 0.61, Lactobacillus gasseri 2.50 ± 0.37, Lactobacillus curvatus 8.83 ± 0.96, Lactobacillus rhamnosus 4.33 ± 0.78, and Lactobacillus reuteri DS0384 strain was determined to form 19.67 ± 2.20 sprouting structures. The number of germination significantly increased in the Lactobacillus curvatus and Lactobacillus reuteri DS0384 strain culture medium treatment groups, and among them, it was confirmed that the greatest increase was observed in the Lactobacillus reuteri DS0384 strain culture medium treatment group (right panel in FIG. 1 b).

In addition, the expression level of the mature intestinal marker protein expressed in the mature intestine was confirmed by immunofluorescence staining. OLFM4, a mature intestinal stem cell marker, DEFA5, a mature Paneth cell marker, KRT20, a mature intestinal structural protein marker, and MUC13, a mucus-producing cell marker, were targeted as marker proteins.

Specifically, intestinal organoids treated with 5 types of lactic acid bacteria cultures as described above were fixed in 4% PFA (paraformaldehyde), cryoprotected with 10-30% sucrose solution, treated with OCT solution, and frozen. The frozen intestinal organoid tissue was cut into 10-20 μm thick slices with a microtome, treated with PBS containing 0.1% Triton X-100, permeabilized through the slices, and then treated with 4% bovine serum (BSA). It was blocked for 1 hour with PBS containing albumin). Anti-OLFM4 antibody (ab85046, abcam, Cambridge, MA, USA), anti-DEFA5 antibody (ab90802, abcam), anti-KRT20 antibody (ab76126, abcam) and anti- MUC13 antibody (ab124654, abcam) was diluted at 1:100 and reacted overnight at 4°C, followed by secondary antibody, anti-goat IgG Alexa Fluor 488, A21467, Invitrogen, anti- Rabbit antibody (anti-rabbit IgG Alexa Fluor 594, A21442, Invitrogen) and anti-mouse antibody (anti-mouse IgG Alexa Fluor 594, A21203, Invitrogen) were diluted 1:200 each and reacted at room temperature for 1 hour to obtain DAPI After staining the nuclei with staining, they were observed under a fluorescence microscope.

As a result, the expression of proteins related to intestinal maturation was not observed in the group treated with the other four types of lactic acid bacteria culture, whereas the OFLM4, DEFA5, KRT20 and MUC13 protein were stained, confirming that the proteins that appear during intestinal maturation were expressed and produced (data below in a of FIG. 1).

Furthermore, the expression level of mature intestinal marker genes in each lactic acid bacteria culture medium-treated intestinal organoid was confirmed by qRT-PCR. Mature intestinal marker genes were targeted: CDX2, DPP4, OLFM4, DEFA5, CREB3L3, KRT20, LYZ, LCT, SLC5A1 and MIC13 genes. RNA was isolated and extracted from the cultured intestinal organoids using the RNeasy kit (Qiagen) according to the manufacturer's protocol, and cDNA was synthesized by reverse transcription of mRNA using a cDNA synthesis kit (Superscript IV cDNA synthesis system, Invitrogen). qRT-PCR was performed on the synthesized cDNA with a PCR machine (7500 Fast Real-time PCR system, Invitrogen) using primers according to Table 1 below.

As a result, when the culture solution of the Lactobacillus reuteri DS0384 strain of the present invention was treated, the expression level of all 10 intestinal maturation marker genes including the CDX2 gene increased several to several thousand times compared to the control group, and a significant increase was confirmed. (c in Fig. 1).

sequence number	sequence name	Sequence (5' -> 3')
One	GAPDH forward primer		GAAGGTGAAGGTCGGAGTC
2	GAPDH reverse primer		GAAGATGGTGATGGGATTTC
3	CDX2 forward primer		CTGGAGCTGGAGAAGGAGTTTC
4	CDX2 reverse primer		ATTTTAACCTGCCTCTCAGAGAGC
5	DPP4 forward primers		CAAATTGAAGCAGCCAGACA
6	DPP4 reverse primer		GGAGTTGGGAGACCCATGTA
7	OLFM4 forward primers		ACCTTTCCCGTGGACAGAGT
8	OLFM4 reverse primer		TGGACATATTCCCTCACTTTGGA
9	DEFA5 forward primer		CCTTTGCAGGAAATGGACTC
10	DEFA5 reverse primer	GGACTCACGGGTAGCACAAC
11	CREB3L3 forward primer	ATCTCCTGTTTGACCGGCAG
12	CREB3L3 reverse primer	GTCGTCAGAGTCGGGGTTTG
13	KRT20 forward primer	TGGCCTACACAAGCATCTGG
14	KRT20 reverse primer		TAACTGGCTGCTGTAACGGG
15	LYZ forward primer		AAAACCCCAGGAGCAGTTAAT
16	LYZ reverse primer		CAACCCTCTTTGCACAAGCT
17	LCT forward primer		GGCAGTCTGGGAGTTTTAGG
18	LCT reverse primer	ATGCCAAAATGAGGCAAGTC
19	SLC5A1 forward primer		GTGCAGTCAGCACAAAGTGG
20	SLC5A1 reverse primer	ATGCACATCCGGAATGGGTT
21	MUC13 forward primers	CGGATGACTGCCTCAATGGT
22	MUC13 reverse primer	AAAGACGCTCCCTTCTGCTC

In view of the above experimental results, among various types of lactic acid bacteria isolated from feces, breast milk, or female genital organs of newborns, the Lactobacillus reuteri DS0384 strain of the present invention exhibits intestinal effects when treated with human intestinal organoids. It was confirmed to significantly increase the expression of genes and proteins related to maturation, and it can be seen that it actually promotes intestinal development and maturation, such as increasing the size of intestinal organoids and inducing the formation of germination structures. .

[1-3] Confirmation of differences in the intestinal organoid maturation promoting effect of strain Lactobacillus reuteri DS0384

Through the above Example [1-2], it was confirmed that the Lactobacillus reuteri DS0384 strain was superior in promoting intestinal maturation and development compared to lactic acid bacteria belonging to other species. Accordingly, the DS0384 strain of the present invention was compared with other strains classified as the same species, and the difference in the maturation promoting effect of intestinal organoids was compared and tested.

In order to compare with the Lactobacillus reuteri DS0384 strain of the present invention, among the microorganisms equally classified as Lactobacillus reuteri, the effects of treating the intestinal organoid with cultures of DS0191, DS0195, DS0333, and DS0354 strains and treating the DS0384 strain culture solution compared with Experiments were conducted using the same method as in Example [1-2], and morphological changes of intestinal organoids were confirmed after treatment with the culture medium, and the expression levels of proteins and genes used as mature intestinal markers were measured by immunofluorescence staining and qRT. -Confirmed through PCR.

As a result, other strains of Lactobacillus reuteri also had an effect of promoting the development of intestinal organoids to some extent, but it was confirmed that the structure of intestinal organoids was most developed when the culture solution of the DS0384 strain of the present invention was treated (Fig. 2). Upper data in a), immunofluorescence staining results also confirmed the expression of OLFM4 and DEFA5 proteins only in the culture medium treated group of the DS0384 strain of the present invention (lower data in a of FIG. 2). Even in the results of confirming the expression level of the marker gene confirmed through qRT-PCR, unlike the fact that the expression of all eight genes in the DS0384 strain culture medium treatment group of the present invention significantly increased compared to the control group, some genes in the other Reuteri strain culture medium treatment group It showed no increase in expression (Fig. 2b). In particular, it was confirmed that the DS0384 strain culture medium-treated group showed markedly increased expression levels of OLFM4 and DEFA5 genes, unlike other Reuteri strain-treated groups. The OLFM4 gene is expressed at high levels in the human small intestine and large intestine, and is known to be closely related to the development and differentiation of the intestine because it corresponds to a marker gene expressed in intestinal stem cells in particular. The DEFA5 gene is a gene encoding DEFA5 (Defensin alpha 5) protein, which is abundantly present on the surface of the intestine, and is expressed at a high level in mature Paneth cells, and thus is used as a marker. Therefore, the DS0384 strain of the present invention, which exhibits an increased expression level of the OLFM4 gene and the DEFA5 gene, unlike other microbial strain culture solution treatment groups, can promote intestinal maturation and development in a different way than other strains, thereby promoting maturation It was confirmed that the effect appeared more markedly.

In addition to the results of comparison experiments with the four reuteri strains identified above, the effects of the Lactobacillus reuteri DS0384 strain were re-examined through additional comparison experiments with the Lactobacillus reuteri DSP007, DS0337 and KCTC3594 strains. Intestinal organoids were treated in the same manner, and morphological changes, marker proteins, and expression levels of genes were confirmed by immunofluorescence staining and qRT-PCR.

As a result, unlike the Lactobacillus reuteri DSP007, DS0337, and KCTC3594 culture medium-treated groups, intestinal organoids showed little morphological maturation, the present invention DS0384 strain culture medium-treated group showed conspicuous maturation of intestinal organoids, and immunofluorescence In the staining results, the expression of OLFM4, DEFA5, KRT20 and MUC13 proteins was found only in the DS0384 strain culture solution treatment group (Fig. 3a). In the qRT-PCR results, the expression of 10 mature intestinal marker genes was significantly increased in the DS0384 strain culture medium-treated group compared to the control group, whereas the expression levels in the other 3 reuteri strain-treated groups were significantly increased compared to the control group. It was found that it appeared significantly less than the treatment group and even less than the control group (FIG. 3 b).

From the above experimental results, in particular, the lactic acid bacteria strains classified as other species from Reuteri did not show the effect of promoting intestinal maturation, and the DS0384 strain showed an effect of promoting intestinal maturation compared to the culture solution treatment groups of other strains belonging to Lactobacillus reuteri. It was found to be remarkably excellent, and it was found that the culture medium of strain Lactobacillus reuteri DS0384 had a specific active component related to intestinal maturation or intestinal development.

[1-4] Optimization of culture conditions of Lactobacillus reuteri DS0384 strain

In order to confirm the intestinal maturation promoting effect according to the culture conditions of the Lactobacillus reuteri DS0384 strain, the intestinal maturation promoting effect was confirmed in the culture medium obtained by varying the culture time in the same manner as in Example [1-2].

Specifically, while culturing the Lactobacillus reuteri DS0384 strain of the present invention for 6 hours, 12 hours, 18 hours and 24 hours, the intestinal organoids were treated using the culture solution obtained for each time, and the morphological change of the intestinal organoids and Together, the expression levels of 10 intestinal maturation marker genes including the CDX2 gene were measured by qRT-PCR in the same manner as in Example [1-2].

As a result, when the culture solution of the Lactobacillus reuteri DS0384 strain was treated, not only the morphological changes of the intestinal organoids were clearly observed, but also the expression levels of the 10 kinds of intestinal maturation marker genes were remarkable in the culture solution treatment group of the DS0384 strain. It was confirmed that it increased (Fig. 4). In particular, the expression level of the mature intestinal marker gene was significantly increased in the intestinal organoids treated with the culture solution obtained by culturing the DS0384 strain culture solution for more than 18 hours (cultivation for 18 hours or 24 hours).

Judging from the above experimental results, it was once again confirmed that the Lactobacillus reuteri DS0384 strain or its embryonic acid is superior to other Lactobacillus reuteri strains in promoting intestinal maturation. Alternatively, it was found that the intestinal maturation promoting effect was more excellent in the culture medium obtained after culturing for 24 hours, and the metabolites produced by culturing the DS0384 strain increased.

[1-5] Metabolome analysis of strain Lactobacillus reuteri DS0384

In order to determine specific active components presumed to be present in the culture solution of the Lactobacillus reuteri DS0384 strain, metabolomic analysis was performed in the culture solution.

Metabolome analysis of the culture solution of the Lactobacillus reuteri DS0384 strain was performed using capillary electrophoresis mass spectrometry (CE-TOFMS). Specifically, to perform ionic metabolomic analysis, 80 μL of culture supernatant of strains Lactobacillus reuteri DS0384, KCTC3594 and DS0195 was mixed with 20 μL of Mili-Q-water containing an internal standard (1 mM), followed by the manufacturer's instructions. Capillary electrophoretic mass spectrometry was performed according to

As a result of mass spectrometry, a total of 275 peaks were detected, 189 peaks in positive ion mode and 86 peaks in negative ion mode. Each peak was analyzed according to the HMT database based on peak information including m/z (mass-to-charge ratio) value, peak area and migration time, and the area of each peak was normalized to the amount of the internal standard and sample to produce each metabolite. The relative amount of was measured. Metabolites detected through peak analysis were mapped with metabolic pathways using VATED software.

As a result of this analysis, it was confirmed that 14 more metabolites were detected in the culture solution of DS0384 compared to other Lactobacillus reuteri strains (FIG. 5).

[1-6] Confirmation of intestinal maturation promoting effect of N-carbamyl-L-glutamic acid

In order to identify physiologically active metabolites related to intestinal maturation or development, through the metabolomic analysis of Example [1-5], differential among 14 metabolites contained more in the culture medium of DS0384 compared to the culture medium of other Reuteri strains. After selecting 7 components that were abundantly contained in the intestinal organoids and treating them, the maturation of the intestinal organoids was confirmed.

The same method as in Example [1-2] using 7 metabolites (succinic acid, histidine, xanthine, CMP, 6-ACA, NCG, and SCMC) included in differentially high amounts among the 14 metabolites As a result, it was confirmed that the intestinal organoid has an effect of promoting intestinal maturation and intestinal development.

Seven metabolites were synthesized according to the manufacturer's instructions (Sigma-Aldrich, St. Louis, MO, USA). Succinic acid (1 mM), histidine (100 μM), xanthine (14 μM), CMP (1 mg/mL), 6-ACA (30 μM), NCG (1 mM), and SCMC (10 μM) are human intestinal organoids Aged culture medium was added and the medium was changed daily. Human intestinal organoids treated with each metabolite were subcultured for two generations. Then, in the same manner as in Example [1-2], each metabolite-treated organoid was cut into 10 μm sections to prepare a sample, and the marker proteins in the sample were OLFM4, a mature intestinal stem cell marker, and mature Samples were treated with primary antibodies targeting DEFA5, a Paneth cell marker, KRT20, a mature intestinal structural protein marker, and MUC13, a mucus-producing cell marker, and incubated overnight at 4°C. Thereafter, the secondary antibody was treated and reacted at room temperature for 1 hour, and the nuclei were stained with DAPI staining and observed under a fluorescence microscope.

As a result, as shown in FIG. 6 , in the case of N-carbamyl-L-glutamic acid (NCG), the development of intestinal organoid germination structures and the expression of markers were significantly increased compared to the other 6 metabolites. In addition, as shown in FIGS. 7 and 8, NCG exhibited the highest level of intestinal development and maturation, similar to the experimental group treated with the culture medium. Through this, it was found that N-carbamyl-L-glutamic acid (NCG) was a major physiologically active component exhibiting intestinal development and maturation effects in the culture medium of DS0384.

[Example 2]

[2-1] Production of colitis intestinal organoids

In order to confirm whether N-carbamyl-L-glutamic acid has a therapeutic effect on inflammatory bowel disease, colitis intestinal organoids were first prepared.

On day 10 of culture of the intestinal organoids differentiated according to Example [1-1], pro-inflammatory cytokines (125 ng/ml IFNγ and 125 ng/ml TNFα) were treated for 3 days to induce colitis in the intestinal organoids. caused

Pro-inflammatory cytokines and NCG were simultaneously treated to confirm whether NCG has an intestinal protective effect against inflammation. Morphological changes were observed in normal intestinal organoids, colitis intestinal organoids, and 1 mM NCG-treated intestinal organoids in the same manner as in Example 3, and intestinal functional changes were confirmed through histological changes and mucin staining. Immunofluorescent staining was performed to confirm barrier functionality (ZO-1) and intestinal stem cell proliferation (Ki-67), followed by fluorescence microscopy. Indicators of inflammation such as IL-1β, IL-6, IL-8, and TNFα, and intestinal epithelial structure (VIL1, EPCAM, KRT20), barrier function (CLAUDIN), intestinal goblet cells (MUC2), Panes cells (LYZ) The expression pattern of was confirmed through qRT-PCR.

[2-2] Construction of an animal model for ulcerative colitis

In order to confirm whether N-carbamyl-L-glutamic acid has a therapeutic effect on inflammatory bowel disease, an ulcerative colitis animal model was prepared.

Specifically, the experiment was conducted by classifying 5-7 week old, 20-25 g (more than 20 g) male C57BL/6J mice (DBL, Eumseong, Korea) into a normal group, a control group, and an experimental group. The normal group was a group without any treatment, and ulcerative colitis was induced in the control and experimental groups by mixing 2 to 2.5% DSS in drinking water.

After DSS administration, the change in weight gain rate during the 3-day period (days 4 to 6) when the initial symptoms appear is observed, and the standard deviation of the average weight increase and decrease for each day is calculated for each set, and mice that exceed the lower limit of standard deviation more than twice were excluded from the analysis. Mice that rapidly induced early symptoms (mice that fell outside the lower limit of standard deviation more than twice) belonged to the group that should be mostly excluded from the IACUC criteria (humane measures for mice with weight loss of 20% or more). Additionally, since mice that deviate from the standard deviation during the initial DSS-induced symptomatic period (days 4 to 6) cause large intra-group variability. In order to secure statistical significance, it consisted of three or more sets of repeated experiments for each condition (n>6 per group), and all experiments were performed by the Institutional Animal Care and Use Committee of KRIBB (Approval No: KRIBB-AEC-21245) ( Institutional Animal Care and Use Committee (IACUC).

Clinical symptoms of ulcerative colitis were measured daily for a total of 15 days from the time DSS or drinking water was administered to the time the mice were humanely euthanized and the intestines separated, which are important markers of intestinal inflammatory disease, such as weight change, fecal shape, and occult blood in feces. It was measured and evaluated.

[Example 3]

Method for histological analysis of ulcerative colitis

[3-1] Tissue specimen preparation

A midline incision was made in the abdomen of the mouse, and the entire alimentary tract was removed. The length of the large intestine was measured in the separated digestive tract tissue, and samples were collected by dividing the excised large intestine into two parts (proximal colon and distal colon), fixed in 10% formalin, and then frozen after adding sucrose as a cryoprotectant. Thereafter, the slices were cut into 10 μm thick at -20 ° C to produce tissue slices.

[3-2] Histological staining and lesion evaluation method

For histological analysis, frozen tissue sections were adhered to a slide glass, stained with hematoxylin for 3 to 5 minutes, washed with running water, and then stained with eosin. Thereafter, dehydration was performed by passing through ethanol (Ethanol) by concentration, and then washed and sealed using xylene. Histological lesions were observed on the slides using an optical microscope (BX53F, Olympus, Japan). Histological lesions were quantified after observing the reduction of inflammatory response, mitigation of immune cell infiltration, mitigation of goblet cell reduction, and maintenance of crypt and villous structures based on the criteria shown in Table 2 below.

histological features	score	explanation
Loss of epithelium	0	doesn't exist
	One	0-5% dissipation
	2	5-10% dissipation
	3	Loss of more than 10%
	Crypt damage	0	doesn't exist
		One	0-10% damage
		2	10-20% damage
3		Over 20% damage
Depletion of goblet cells	0	doesn't exist
	One	Mild
	2	Moderate
	3	Severe
Infiltration of inflammatory cells	0	doesn't exist
	One	Mild
	2	Moderate
	3	Severe

[3-3] mucin staining (AB-PAS staining)

Mature functional goblet cells were observed in intestinal organoids and animal model intestinal tissues using an AB-PAS staining technique that stains mucin secreted from mature goblet cells. Tissue sections having a thickness of 10 μm prepared as described above were adhered to slide glass, and then stained using the Alcian Blue PAS Stain Kit. Thereafter, dehydration was performed by passing through ethanol (Ethanol) by concentration, and then washed and sealed using xylene. Mucin mucin was observed in intestinal tissue using an optical microscope (BX53F, Olympus, Japan).

[3-4] Tissue immunofluorescence staining

First, a tissue specimen prepared in the same manner as in Example [3-1] was adhered to a slide, and then permeabilized with PBS containing 0.1% Triton X-100 for immunofluorescence staining. After washing three times with PBS containing Tween 20, blocking with 4% BSA, the tissue was reacted with the primary antibody overnight at 4°C. Thereafter, the secondary antibody was reacted for 1 hour at room temperature. Primary antibodies used are shown in Table 3 below. DAPI was added to visualize the nucleus. The slides were observed under an EVOS FL Auto2 (ThermoFisher) and Axiovert 200M microscope (Carl Zeiss, Gottingen, Germany) or a fluorescence microscope (IX51, Olympus, Japan).

antibody	Catalog No.	company	dilution
anti-E-cadherin	AF648	R&D	1:200
anti-E-Cadherin	610182	BD Biosciences	1:200
anti-ZO-1	61-7300	Thermo Fisher Scientific	1:200
anti-Claudin-1	ab15098	abcam	1:200
anti-TNFα	ab6671	abcam	1:200
anti-IL-17	ab79056	abcam	1:200
anti-IFNγ	ab9657	abcam	1:100
anti-iNOS	ab49999	abcam	1:200
anti-CD11b	ab133357	abcam	1:200
anti-F4/80	ab6640	abcam	1:50
anti-Ki67	ab15580	abcam	1:500
anti-Ki67	AB9260	Chemicon	1:200
anti-Mucin2	sc-7314	Santa Cruz	1:50

[Example 4]

Methods for genetic analysis of ulcerative colitis

[4-1] Quantitative real-time RT-PCR (qRT-PCR)

Total RNA was extracted from cells using the easy-BLUE™ kit (iNtRON Biotechnology) and reverse transcribed using TOPscript™ RT DryMIX (dT18) (Enzynomics). qRT-PCR was performed using a known method on a 7500 Fast Real-time PCR system (Applied Biosystems, Foster City, CA, USA) (Cho et al., Oncotarget 6, 23837-23844, 2015). All experiments were repeated three times, and the CT value of each target gene was calculated using the software provided by the manufacturer. Primers used for analysis of colitis intestinal organoids are shown in Table 4, and primers used for analysis of ulcerative colitis animal models are shown in Table 5 below.

sequence number	sequence name	Sequence (5' -> 3')
One	GAPDH forward primer		GAAGGTGAAGGTCGGAGTC
2	GAPDH reverse primer	GAAGATGGTGATGGGATTTC
23	CLAUDIN forward primer	CCGTTGGCATGAAGTGTATG
24	CLAUDIN reverse primer		CATTGACTGGGGTCATAGGG
25	EPCAM forward primers	TAAGGCCAAGCAGTGCAAC
26	EPCAM reverse primer	GCGTTGTGATCTCCTTCTGA
27	IL-1β forward primer	AATCTGTACCTGTCCTGCGTGTT
28	IL-1β reverse primer	TGGGTAATTTTTGGGATCTACACT
29	IL-6 forward primer		CTCCTTCTCCACAAGCGCC
30	IL-6 reverse primer	AAGGCAGCAGGCAACACC
31	IL-8 forward primer	AGTTTTTGAAGAGGGCTGAGA
32	IL-8 reverse primer	TGCTTGAAGTTTCACTGGCATC
13	KRT20 forward primer	TGGCCTACACAAGCATCTGG
14	KRT20 reverse primer		TAACTGGCTGCTGTAACGGG
15	LYZ forward primer		AAAACCCCAGGAGCAGTTAAT
16	LYZ reverse primer	CAACCCTCTTTGCACAAGCT
33	MUC2 forward primers	TGTAGGCATCGCTCTTCTCA
34	MUC2 reverse primer	GACACCATCTACCTCACCCG
35	TNFα forward primer	GGAGAAGGGTGACCGACTCA
36	TNFα reverse primer	CTGCCCAGACTCGGCAA
37	VIL1 forward primer	AGCCAGATCACTGCTGAGGT
38	VIL1 reverse primer	TGGACAGGTGTTCCTCCTTC

sequence number	sequence name	Sequence (5' -> 3')
39	β-actin forward primer	AGC CAT GTA CGT AGC CAT CC
40	β-actin reverse primer	CTC TCA GCT GTG GTG GTG AA
41	Tnfα forward primer	GAA CTG GCA GAA GAG GCA CT
42	Tnfα reverse primer	AGG GTC TGG GCC ATA GAA CT
43	IL-6 forward primer	AGT TGC CTT CTT GGG ACT GA
44	IL-6 reverse primer	CAG AAT TGC CAT TGC ACA AC
45	Il-1β forward primer	GCC CAT CCT CTG TGA CTC AT
46	Il-1β reverse primer	AGG CCA CAG GTA TTT TGT CG
47	Il-17a forward primer	GCT CCA GAA GGC CCT CAG A
48	Il-17a reverse primer	AGC TTT CCC TCC GCA TTG A
49	Ifnγ forward primer	GGC CAT CAG CAA CAA CAT AAG CGT
50	Ifnγ reverse primer	ACC TGT GGG TTG TTG ACC T
51	iNos forward primer	CGA GGA GCA GGT GGA AGA CT
52	iNos reverse primer	TGG AAC TCT GGG CTG TCA GA
53	Fzd7 forward primer	GAC CAA GCC ATT CCT CCG TG
54	Fzd7 reverse primer	CAG GTA GGG AGC AGT AGG GTA
55	Tcf7 forward primer	AGC TTT CTC CAC TCT ACG AAC A
56	Tcf7 reverse primer	AAT CCA GAG AGA TCG GGG GTC
57	Ror1 forward primer	TGA GCC GAT GAA TAA CAT CAC AA
58	Ror1 reverse primer	CAG GTG CAT CAT TCT TGA ACC A
59	Axin2 forward primers	TGA CTC TCC TTC CAG ATC CCA
60	Axin2 reverse primer	TGC CCA CAC TAG GCT GAC A

[4-2] RNA sequencing and RNA quantification

For RNA sequencing and quantification, RNA samples were prepared with an RNA Integrity Number (RIN) of 7.5 or higher using the Agilent 2100 Bioanalyzer system (Agilent Biotechnologies, Palo Alto, USA). The mRNA library was prepared using the Illumina TruSeq kit, and sequencing was performed using Illumina HiSeq2500 machines (Illumina, San Diego, CA, USA). Sequencing quality was determined using the FastQC package, and read lengths of 50 bases or less were excluded. After that, mapping was performed through HISAT2 (v2.0.5), and human genome information used hg19. Differentially expressed genes (DEGs) were analyzed between samples using Cuffquant and Cuffnorm (Cufflinks v2.2.1).

[4-3] Bioinformatic analysis

Bioinformatic analysis was performed using IPA analysis software (Ingenuity systems, Redwood City, CA, USA), PANTHER (Protein ANalysis Through Evolutionary Relationships, http://www.pantherdb.org) database, and DAVID Bioinformatics Resource 6.7 (http://www.pantherdb.org). david.abcc.ncifcrf.gov). Hierarchical clustering and heat map analysis was performed using MeV v 4.9.0 software.

[4-4] Statistical analysis

All experimental results described herein are expressed as mean ± standard error of the mean (s.e.m.), and all experiments were repeated at least three times. P values were determined using a two-tailed t-test or one-tailed ANOVA. All analyzes of statistical significance were calculated relative to normal or control groups unless otherwise specified.

[Example 5]

Confirmation of intestinal protective effect in colitis intestinal organoids

First, in order to confirm the intestinal protective effect of NCG against ulcerative colitis, colitis was evaluated in colitis intestinal organoids treated with NCG.

As in Example [2-1], intestinal organoids were simultaneously treated with IFNγ/TNFα and NCG for 3 days, and the intestinal protective effect of NCG against inflammation was observed. And, as described in Example 3 above, mucin secretion and goblet cells, one of the main functions of the intestine, were subjected to mucin mucin staining techniques (AB-PAS staining) and MUC2 immunofluorescence analysis. Proinflammatory cytokines (IL-1β, IL-6, IL-8 and Tnfα) and intestinal epithelial cells and structures (VIL1, EPCAM, KRT20), barrier structure (CLAUDIN), and goblet cells by qRT-PCR analysis at the gene level (MUC2) and Panes cells (LYZ) were compared.

As a result, after 72 hours of pro-inflammatory cytokine (IFNγ/TNFα) treatment in intestinal organoids, the germination structure and organoid size decreased, but the germination structure and surface area of the NCG-treated group were maintained similar to the normal intestinal epithelial structure. (FIGS. 9b and 9c). Through H&E staining and mucin staining, it was confirmed that goblet cells and mucus layer were maintained at levels similar to normal intestinal organoids in the NCG-treated group (FIG. 9d). In addition, compared to colitis-like intestinal organoids, in the NCG-treated group, barrier functionality (ZO-1) was restored, cells expressing the intestinal stem cell proliferation marker (ki-67) were not reduced, and intestinal epithelial structure (ECAD) was improved. Compared to the marker, the expression level of the barrier structure (ZO-1) increased (FIG. 9e).

In addition, at the gene level, when inflammation was induced by IFNγ/TNFα treatment of intestinal organoids, the expression of inflammatory cytokines such as IL-1β, IL-6, IL-8, and TNFα was increased, but concurrent treatment with NCG increased inflammation. The expression of cytokines decreased, and the expression of intestinal epithelial cells and structures (VIL1, EPCAM, KRT20), barrier structure (CLAUDIN), goblet cells (MUC2), and Panes cells (LYZ) increased (FIG. 9f ),

Through the above results, it was confirmed that NCG has an effect of protecting the intestine against colitis.

[Example 6]

Confirmation of NCG effect as a protective agent for ulcerative colitis and analysis of appropriate dosage concentration

In order to confirm the protective efficacy of NCG against ulcerative colitis, ulcerative colitis was evaluated in an animal model in which NCG was orally administered.

Specifically, among the 20-25 g mice prepared in Example 1, the experimental group was orally administered 200 μl of NCG at different concentrations (0, 1, 10, 100, 200, 250, 500 mM) daily while treating drinking water for 8 days. After that, colitis was induced with 2% DSS drinking water for 7 days, and NCG was also orally administered for 7 days (FIG. 10a). The control group was treated with DSS and then injected intraperitoneally with PBS. Thereafter, according to the method described in Examples 2 and 3, weight gain and loss, fecal morphology, and occult blood in feces, which are important indicators of intestinal inflammatory disease, were observed for a total of 15 days.

As a result, it was confirmed that the body weight increased in the 100 and 200 mM NCG experimental groups compared to the control group and the experimental groups with other concentrations (1, 10, 250, 500 mM) (FIG. 10b). In addition, when compared to the ulcerative colitis control group, it was confirmed that the length of the large intestine was recovered in the experimental groups administered with 100 and 200 mM NCG, and the shape of the feces was changed to a lumpy form as in the normal group (FIGS. 10c and 10d).

In addition, as a result of histological analysis in the same manner as in Example 3, the inflammatory response was reduced in the experimental group orally administered with 100 and 200 mM NCG compared to the control group, and the degree of infiltration of immune cells and reduction of goblet cells was alleviated. and it was confirmed that the crypt and villous structures were maintained (FIG. 10e). Through the above experimental results, it was found that NCG exhibits a therapeutic effect on ulcerative colitis, and the appropriate concentration range of NCG that can exhibit a therapeutic effect is 100 to 200 mM.

[Example 7]

Confirmation of the effectiveness of NCG as a treatment for ulcerative colitis

[7-1] Confirmation of treatment effect of ulcerative colitis by administration of NCG

In order to confirm the therapeutic efficacy of NCG for ulcerative colitis, ulcerative colitis was evaluated by orally administering NCG to an animal model of ulcerative colitis.

Specifically, after inducing colitis by administering 2-2.5% DSS drinking water to the mice prepared in Example 2 for 8 days, DSS drinking was stopped and drinking water was administered for 7 days. The experimental group was orally administered 200 μl of NCG daily for 10 days at various concentrations (0, 10, 50, 100, 200, 500 mM) from the 5th day, when the weight gain rate inflection point, soft stools and diarrhea, which are the initial symptoms of ulcerative colitis, were observed. A control group received an intraperitoneal injection of PBS (FIG. 11A). According to Examples 3 and 4, important markers of intestinal inflammatory diseases, such as weight gain and loss, fecal shape and occult blood in feces, were observed for a total of 15 days, and histological analysis and gene expression levels of inflammatory markers were compared.

As a result, body weight was recovered in general in the experimental group administered with NCG compared to the PBS control group, but in particular, it was confirmed that the body weight increased significantly in the 100 and 200 mM experimental groups (FIG. 2b). In addition, when compared to the ulcerative colitis control group, it was confirmed that the length of the large intestine was recovered in the experimental groups administered with 100 and 200 mM NCG, and the shape of the feces was changed to a lumpy form as in the normal group (FIGS. 11c and 11d).

In addition, as a result of histological analysis, in the experimental group orally administered with 100 and 200 mM NCG, compared to the control group, the inflammatory response was reduced, the infiltration of immune cells and the reduction of goblet cells were alleviated, and the crypt and villous structure were maintained. (FIGS. 12a and 12b). Through the above experimental results, it was found that NCG exhibits a therapeutic effect on ulcerative colitis, and an appropriate dosage range of NCG capable of exhibiting a therapeutic effect is 100 to 200 mM.

[7-2] Confirmation of barrier function recovery effect by administration of NCG

It was confirmed whether NCG has an effect of restoring the function of the intestinal wall in an ulcerative colitis model.

Specifically, as described in Example 3, mucin secretion and goblet cells, one of the main functions of the intestine, were subjected to mucin mucin staining technique (AB-PAS staining) and MUC2 immunofluorescence analysis.

As a result, it was confirmed that the functional recovery of goblet cells was significantly better and mucin secretion increased in the 100 and 200 mM NCG experimental groups than in the PBS control group or other concentration experimental groups. In particular, when treated with 100 mM NCG, mucin secretion throughout the intestinal epithelium and goblet cell expression at a level similar to that of the normal group were confirmed (FIGS. 12c and 12d).

In addition, as shown in FIG. 13, it was confirmed through immunofluorescence staining that the expression of barrier function-related proteins (ZO-1, CLDN1) and intestinal epithelial structural protein (ECAD) increased, and the intestinal structure was significantly recovered compared to the control group. confirmed that it was.

[7-3] Confirmation of the inflammation reduction effect by administration of NCG

In order to evaluate the effect of NCG on inflammation in ulcerative colitis, the level of inflammation was evaluated by observing the secretion of intestinal pro-inflammatory cytokines, inflammation-related enzymes, and infiltration of immune cells at the protein or gene level.

Specifically, through tissue immunofluorescence staining in the same manner as in Example 2 and genetic analysis in the same manner as in Example 3, intestinal proinflammatory cytokines at the protein or gene level, secretion of inflammation-related enzymes and infiltration of immune cells phenomenon was observed. The secretion of pro-inflammatory cytokines (TNFα, IFNγ, IL-17), inflammation-related enzymes (iNOS), and infiltration of immune cells (myeloid cells; CD11b+, macrophages; F4/80+) were analyzed by immunofluorescence staining. Expression levels of pro-inflammatory cytokines (Il-6, Il-1β, Tnfα, Il-17a) and the nitric oxide indicator iNos were measured by qPCR analysis at the gene level.

As a result, it was confirmed that the expression of the above inflammatory phenomena and indicators increased in the colitis control group compared to the normal group and significantly decreased in the 100mM or 200mM NCG treated experimental group (FIG. 14a). In addition, it was confirmed that the expression levels of pro-inflammatory cytokines (Il-6, Il-1β, Tnfα, Il-17a) and iNos were also decreased in the 100 or 200 mM NCG treated experimental group at the gene level, especially in the 100 mM NCG treated group. It was confirmed that all inflammatory indicators were significantly reduced (FIG. 14b).

Through the above experimental results, it was confirmed again that the treatment effect of NCG was different depending on the treatment concentration, and in particular, it was found that 100 mM NCG was effective in treating ulcerative colitis.

[Example 8]

Analysis of the main mechanism of NCG as a treatment for ulcerative colitis

In order to confirm the main mechanism of the therapeutic efficacy of NCG in ulcerative colitis, RNAseq-based genome analysis was performed on the normal group, the colitis control group, and the 100 and 200 mM NCG treated experimental groups.

Specifically, genetic analysis was performed in the same manner as in Example 3, and from the RNA sequencing data, the genomes of the normal group, ulcerative colitis control group, and NCG experimental group were comparatively analyzed through Spearman's correlation, and a total of 21,823 Genetic analysis was performed (FIGS. 15a and 15b). As a result of DEG GO analysis of 238 genes whose expression decreased in the colitis control group and whose expression increased to the normal level in the 100 mM NCG experimental group, it was confirmed that the Wnt signaling pathway was the main mechanism (FIGS. 15c to 15e). However, it was confirmed that there was no significant difference in the expression level of Cps1 in the 100 mM NCG experimental group compared to the ulcerative colitis control group (FIG. 15h).

In order to verify the results of genome analysis, qPCR analysis was performed, and it was confirmed that the expression of all major genes (Fzd7, Tcf7, Ror1, Axin2) related to the Wnt signaling pathway, which were decreased in the colitis control group, increased significantly in the 100mM NCG treated group. (Fig. 15f). In addition, as a result of confirming the expression of the intestinal stem cell proliferation marker (Ki-67) through immunofluorescence chemical staining, it was confirmed that it decreased in the colitis control group compared to the normal group, but significantly increased when treated with 100 mM NCG (FIG. 15g).

Through the above results, when treated at an appropriate concentration of 100 mM, NCG does not affect the expression of Cps1, activates the Wnt signaling pathway or increases the expression of Ki-67, thereby promoting the proliferation of intestinal stem cells. , it can be seen that it can show the therapeutic effect of ulcerative colitis through this.

[Example 9]

Confirmation of non-existence of toxicity and side effects of NCG

In order to confirm the effect of NCG in the normal group, the phenotype of the 100 mM NCG treated experimental group, which has protective and therapeutic effects from ulcerative colitis, was compared with that of the normal group.

Specifically, PBS or NCG was orally administered to mice of the normal group for 10 days from the 5th day of drinking water, and clinical symptoms were observed for 10 days (FIG. 16a). As a result of observing a total of 15 days of weight change, the 100mM NCG treated group showed a greater increase in body weight than the normal group, but there was no significant difference except for the 9th day (FIG. 16b). In addition, there was no significant difference in the length of the extracted colon, and the shape of the feces was similar to that of the control group in the form of lumps, confirming that there was no toxicity (FIG. 16c).

Similar to the results of histological analysis of the intestine, it was confirmed that crypts and villous structures were maintained even with 100 mM NCG treatment, similar to the normal group, and there was no significant change in the increase or decrease of goblet cells through AB-PAS staining and MUC2 immunofluorescence staining. It was confirmed that there was no effect on mucin secretion function (FIGS. 16d and 16e).

There is no significant change in the expression levels of pro-inflammatory cytokines (Il-6, Il-1β, Tnfα, Ifnγ, Il-17a) and inflammation-related enzymes (iNOS), which are representative inflammatory indicators of ulcerative colitis previously identified at the gene level was confirmed (FIG. 16f). From the above experimental results, it was found that there was no toxicity or side effects when the normal group was treated alone with NCG at the concentration (100 mM).

Claims (15)

1. Cultivating the Lactobacillus reuteri DS0384 strain; a method for producing N-carbamyl-L-glutamic acid, including.
2. The method of claim 1,

   Separating the culture of the strain; method for producing N-carbamyl-L-glutamic acid (N-carbamyl-L-glutamic acid) further comprising.
3. The method of claim 1,

   Purifying N-carbamyl-L-glutamic acid in the culture broth of the strain; further comprising a method for producing N-carbamyl-L-glutamic acid (N-carbamyl-L-glutamic acid).
4. A pharmaceutical composition for the treatment of inflammatory diseases comprising N-carbamyl-L-glutamic acid as an active ingredient.
5. The method of claim 4,

   The N-carbamyl-L-glutamic acid is produced by Lactobacillus reuteri DS0384 strain, the composition.
6. The method of claim 4,

   Wherein the inflammatory disease is inflammatory bowel disease.
7. In claim 6,

   Wherein the inflammatory bowel disease is ulcerative colitis or Crohn's disease, the composition.
8. In claim 4,

   Wherein the N-carbamyl-L-glutamic acid is contained in a concentration of 1mM to 300mM, the composition.
9. The method of claim 4,

   Wherein the N-carbamyl-L-glutamic acid reduces the expression of iNOs, the composition.
10. The method of claim 4,

    Wherein the N-carbamyl-L-glutamic acid increases the expression of one or more genes selected from the group consisting of ZO-1, CLDN1 and ECAD.
11. The method of claim 4,

    wherein the N-carbamyl-L-glutamic acid reduces the expression of one or more pro-inflammatory cytokines selected from the group consisting of TNFα, IFNγ, Il-6, Il-8, Il-1β and IL-17; composition.
12. The method of claim 4,

    Wherein the N-carbamyl-L-glutamic acid increases the expression of one or more genes selected from the group consisting of Fzd7, Tcf7, Ror1 and Axin2.
13. The method of claim 4,

    Wherein the N-carbamyl-L-glutamic acid increases the expression of one or more genes selected from the group consisting of VIL1, EPCAM, KRT20, CLAUDIN, MUC2, LYZ and Ki-67, the composition.
14. A health functional food composition for preventing or improving inflammatory diseases comprising N-carbamyl-L-glutamic acid as an active ingredient.
15. A feed composition for preventing or improving inflammatory diseases comprising N-carbamyl-L-glutamic acid as an active ingredient.

Images