WO2020226438A1 - Peptide for preventing or treating inflammatory bowel diseases - Google Patents

Peptide for preventing or treating inflammatory bowel diseases Download PDF

Info

Publication number
WO2020226438A1
WO2020226438A1 PCT/KR2020/006041 KR2020006041W WO2020226438A1 WO 2020226438 A1 WO2020226438 A1 WO 2020226438A1 KR 2020006041 W KR2020006041 W KR 2020006041W WO 2020226438 A1 WO2020226438 A1 WO 2020226438A1
Authority
WO
WIPO (PCT)
Prior art keywords
peptide
inflammatory bowel
bowel disease
present
preventing
Prior art date
Application number
PCT/KR2020/006041
Other languages
French (fr)
Korean (ko)
Inventor
김병찬
이철호
김재훈
장동호
노정란
김용훈
김명희
손미영
Original Assignee
한국생명공학연구원
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 한국생명공학연구원 filed Critical 한국생명공학연구원
Publication of WO2020226438A1 publication Critical patent/WO2020226438A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/66—Microorganisms or materials therefrom
    • A61K35/74—Bacteria
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K10/00—Animal feeding-stuffs
    • A23K10/10—Animal feeding-stuffs obtained by microbiological or biochemical processes
    • A23K10/16—Addition of microorganisms or extracts thereof, e.g. single-cell proteins, to feeding-stuff compositions
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23K—FODDER
    • A23K20/00—Accessory food factors for animal feeding-stuffs
    • A23K20/10—Organic substances
    • A23K20/142—Amino acids; Derivatives thereof
    • A23K20/147—Polymeric derivatives, e.g. peptides or proteins
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/18—Peptides; Protein hydrolysates
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L33/00—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10—Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17—Amino acids, peptides or proteins
    • A23L33/195—Proteins from microorganisms
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/02—Peptides of undefined number of amino acids; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/164—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2/00—Peptides of undefined number of amino acids; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/32—Foods, ingredients or supplements having a functional effect on health having an effect on the health of the digestive tract
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2200/00—Function of food ingredients
    • A23V2200/30—Foods, ingredients or supplements having a functional effect on health
    • A23V2200/324—Foods, ingredients or supplements having a functional effect on health having an effect on the immune system

Definitions

  • the present invention relates to a peptide for preventing, improving or treating inflammatory bowel disease, and a composition comprising the same.
  • IBD Inflammatory bowel disease
  • Ulcerative colitis mainly invades the mucous membrane, and the cause of the large intestine, which frequently forms patting or ulcers, is unknown.
  • Crohn's disease is a discontinuous ulceration of the entire digestive tract from the oral cavity to the anus, from the mucous membrane to the entire intestine. It is a granulomatous inflammatory lesion of unknown cause that develops fibrosis, stenosis and lesion, and is accompanied by systemic symptoms such as abdominal pain, chronic diarrhea, fever, and nutritional disorders.
  • Drugs that have been used to treat inflammatory bowel disease include steroidal immunosuppressants, 5-aminosalicylic acid (5-ASA) drugs that block the production of prostaglandins (e.g., sulfasalazine), Mesalazine and the like (Gastroenterol Clin North Am. 1989 Mar;18(1):1-20, etc.).
  • 5-ASA 5-aminosalicylic acid
  • these compounds are not only insignificant in the treatment of inflammatory bowel disease, but also cause serious side effects such as fullness, headache, rash, liver disease, leukopenia, agranulocytosis, and male infertility.
  • the present inventors confirmed that the Akkermansia muciniphila strain has a therapeutic effect on inflammatory bowel disease, identified the active ingredient of the strain, and discovered a functional fragment thereof to prevent and improve inflammatory bowel disease. By confirming the present invention was completed.
  • One object of the present invention is to provide a peptide for preventing or treating inflammatory bowel disease, consisting of 9 to 150 amino acids consecutive in the amino acid sequence of SEQ ID NO: 1 including the amino acid sequence of SEQ ID NO: 12.
  • Another object of the present invention is to provide a pharmaceutical composition for preventing or treating inflammatory bowel disease, comprising the peptide, a polynucleotide encoding the peptide, and a recombinant vector containing the polynucleotide as an active ingredient.
  • Another object of the present invention is to provide a composition for promoting intestinal cell differentiation, comprising the peptide, a polynucleotide encoding the peptide, and a recombinant vector containing the polynucleotide as an active ingredient.
  • Another object of the present invention is to provide a health functional food composition and feed composition for preventing or improving inflammatory bowel disease, comprising the peptide, a polynucleotide encoding the peptide, and a recombinant vector containing the polynucleotide as an active ingredient.
  • the peptide of the present invention has an excellent effect in the prevention or treatment of inflammatory bowel disease, it can be very usefully used in the prevention or treatment of inflammatory bowel disease.
  • 3 is a result of confirming the expression of inflammatory cytokines after administration of the Akermansia muciniphila strain to an inflammatory bowel disease mouse model.
  • Figure 8 shows the amount of gene expression related to distal colon stem cells by administering Amuc_1409 to an inflammatory bowel disease mouse model.
  • FIG. 10 shows the length of the colon after administration by changing the dose of Amuc_1409 to 1.8 ⁇ M and 3.6 ⁇ M to an inflammatory bowel disease mouse model.
  • FIG. 11 shows the intestinal tissue H&E staining after administration by changing the dose of Amuc_1409 to 1.8 ⁇ M and 3.6 ⁇ M in a mouse model of inflammatory bowel disease, and confirming the degree of inflammation in the distal colon.
  • FIG. 12 shows the expression levels of distal colon stem cell-related genes after administration by changing the dose of Amuc_1409 to 1.8 ⁇ M and 3.6 ⁇ M in a mouse model of inflammatory bowel disease.
  • Fig. 13 is a schematic diagram explaining a second-passage treatment process of Amuc_1409 to intestinal organoids.
  • FIG. 14 is a diagram showing the morphological changes, surface area, and number of buds of intestinal organoids when treated with varying the concentration of Amuc_1409.
  • the scale bar is 500 ⁇ m.
  • FIG. 16 shows the concentration of Amuc_1409 changed and treated with human intestinal organoids, and through immunofluorescence staining, intestinal organoid proliferation markers (Ki-67), epithelial markers (ECAD), intestinal stem cell markers (ASCL2), and mature intestinal markers ( It is a diagram showing the expression of OLFM4).
  • the scale bar is 200 ⁇ m.
  • FIG. 17 is a schematic diagram illustrating a process of treatment with proinflammatory cytokines (IFN ⁇ ) and Amuc_1409 in order to confirm the therapeutic effect of Amuc_1409 in a human intestinal organoid disease model.
  • IFN ⁇ proinflammatory cytokines
  • FIG. 18 and 19 show the morphological changes of intestinal organoids and the area of intestinal organoids when Amuc_1409 was treated for 7 days after 6 hours of proinflammatory cytokine (IFN ⁇ ) treatment (FIG. 18), and numerically It is shown (Fig. 19).
  • the scale bar is 1mm.
  • FIG. 20 shows a proliferation marker of intestinal organoids (Ki-67), an epithelial marker (ECAD), an intestinal stem cell marker (ASCL2), and an intestinal adhesion marker (ZO-1) after treatment of Amuc_1409 in a human intestinal organoid disease model. ) Is a diagram confirmed through immunofluorescence staining. The scale bar is 200 ⁇ m.
  • Fig. 21 shows the sequences of the four domains Pep.A, Pep.B, Pep.C, and Pep.D of the Amuc_1409 protein.
  • Figure 23 shows the sequence of the three subdomains of Pep.A Pep.A-1, Pep.A-2 and Pep.A-3.
  • Figure 25 shows the sequence of Pep.A-2h.
  • 26 shows the number of mouse intestinal organoids and the number of lobes in each case of treatment with Amuc_1409 and Pep.A-2h.
  • FIG. 27 shows the change in body weight by administering 3.6 ⁇ M of Amuc_1409 and Pep.A-2h to 1.8 ⁇ M and 3.6 ⁇ M in an inflammatory bowel disease mouse model.
  • FIG. 28 shows colon length measurements after administration of Amuc_1409 3.6 ⁇ M and Pep.A-2h at 1.8 ⁇ M and 3.6 ⁇ M in an inflammatory bowel disease mouse model.
  • 29 is a mouse model of inflammatory bowel disease in which the doses of Amuc_1409 3.6 ⁇ M and Pep.A-2h were changed to 1.8 ⁇ M and 3.6 ⁇ M, and after administration, H & E staining of intestinal tissues and the degree of inflammation of the distal colon were confirmed.
  • One aspect of the present invention provides a peptide for preventing or treating inflammatory bowel disease consisting of 9 or more consecutive amino acids in the amino acid sequence of SEQ ID NO: 1.
  • the amino acid sequence of SEQ ID NO: 1 includes the amino acid sequence of SEQ ID NO: 12, and the peptide for preventing or treating inflammatory bowel disease includes, without limitation, SEQ ID NO: 1 or a fragment thereof as long as it has inflammatory bowel disease prevention or treatment activity. can do.
  • the peptide for preventing or treating inflammatory bowel disease may be composed of 9 or more consecutive amino acids from the amino acid sequence of SEQ ID NO: 1 including the amino acid sequence of SEQ ID NO: 12.
  • the peptide for preventing or treating inflammatory bowel disease of the present invention may be composed of 9 to 150 consecutive amino acids from the amino acid sequence of SEQ ID NO: 1 including the amino acid sequence of SEQ ID NO: 12.
  • the peptide may include the amino acid sequence of SEQ ID NO: 12. In one embodiment, the peptide may include the amino acid sequence of SEQ ID NO: 10. In one embodiment, the peptide may include the amino acid sequence of SEQ ID NO: 5. In one embodiment, the peptide may include the amino acid sequence of SEQ ID NO: 3. However, it is not limited thereto.
  • the peptide may include one or more amino acid sequences selected from SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11, and SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11 in the peptide are N -Or, a part of the C-terminal may overlap.
  • the peptide may include any one or more amino acid sequences selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8.
  • the peptide of the present invention consists of 9 or more consecutive amino acids in the amino acid sequence of SEQ ID NO: 1, and is 80% or more, specifically 90% or more, 95% or more, 97% or more homology with SEQ ID NO: 12 It may be an amino acid sequence representing Specifically, the peptide of the present invention is composed of 9 or more consecutive amino acids in the amino acid sequence of SEQ ID NO: 1 and exhibits 80% or more, specifically 90% or more, 95% or more, 97% or more homology with SEQ ID NO: 5 It may be an amino acid sequence. In one embodiment, the peptide of the present invention may have 80% or more, 90% or more, 95% or more, 97% or more homology with the sequence represented by SEQ ID NO: 10.
  • the peptide of the present invention may be one that exhibits 80% or more, 90% or more, 95% or more, 97% or more homology with the sequence represented by SEQ ID NO: 3. In one embodiment, the peptide of the present invention may be one that exhibits 80% or more, 90% or more, 95% or more, 97% or more homology with the sequence represented by SEQ ID NO: 1.
  • the peptide of the present invention is not limited to the above-described embodiments, and one or more amino acids may be substituted, deleted, inserted, or modified by a combination thereof, and the modified sequence is also substantially As long as it is an amino acid sequence that shows the same effect of preventing or treating inflammatory bowel disease, it is included without limitation in the scope of the present invention.
  • proteins having an amino acid sequence in which some sequences are deleted, modified, substituted or added may also be used in the present application if they have the same or corresponding activity.
  • Such modification may be, for example, a modification in which one or more portions such as an N-terminal leader sequence or a transmembrane domain are removed. Alternatively, a portion may be removed from the N- and/or C-terminus of a mature protein, or may be an added mutation. Or it may include a conservative substitution (conservative substitution). Or it may include modification, such as deletion, addition, or substitution of amino acids having minimal influence on the properties and secondary structure of the polypeptide. However, it is not limited thereto.
  • the amino acid sequence of SEQ ID NO: 3 of the present invention corresponds to a sequence excluding only the leader sequence from the amino acid sequence of SEQ ID NO: 1
  • the peptide having the amino acid sequence of SEQ ID NO: 1 of the present invention is also used for preventing or treating inflammatory bowel disease. It can be used as a peptide.
  • the amino acid sequence of SEQ ID NO: 12 of the present invention is a form in which some amino acids are deleted at the C-terminus of the amino acid sequence of SEQ ID NO: 10, and one, 2 at the C-terminus of the amino acid sequence of SEQ ID NO: 10 of the present invention
  • a peptide having an amino acid sequence in which dog, 3, 4 or 5 amino acids are deleted may also be used as a peptide for preventing or treating inflammatory bowel disease.
  • amino acid sequence of SEQ ID NO: 10 of the present invention is a form in which some amino acids are deleted from the amino acid sequence of SEQ ID NO: 5
  • amino acid of SEQ ID NO: 5 is a form in which some amino acids are deleted from the amino acid sequence of SEQ ID NO: 3
  • Peptides having an amino acid sequence in which one or more amino acids are deleted from the amino acid sequence of 5 can also be used as a peptide for preventing or treating inflammatory bowel disease. However, it is not limited thereto.
  • the position of the amino acid to be substituted or the amino acid to be fixed at a specific position described herein may be relatively changed as an amino acid is deleted/added before or after the reference sequence or inside the reference sequence.
  • the position of the amino acid corresponding to the specific amino acid residue described herein within any amino acid sequence can be identified using an alignment method known in the art.
  • a peptide and a protein having 70%, 80%, or 90% or more homology with a peptide consisting of 9 to 150 consecutive amino acid sequences among the amino acid sequence of SEQ ID NO: 1 including the amino acid sequence of SEQ ID NO: 12 It should be construed as being included within the scope of the present invention.
  • homology refers to the degree of identicality of amino acid residues between sequences after alignment of both sequences in a specific comparison region to maximally match, and is used interchangeably with the term "identity”. I can. If the homology is sufficiently high, the expression product of the gene may have the same or similar activity. The percentage of sequence identity may be determined using a known sequence comparison program, and examples include BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlignTM (DNASTAR Inc), and the like.
  • the peptide represented by the amino acid sequence of SEQ ID NO: 12 when administered to an animal model of inflammatory bowel disease, it was confirmed that body weight was restored and colon length was increased.
  • intestinal organoids germinated It was confirmed that the number of organoids and the number of lobes significantly increased, and it was confirmed that intestinal cell differentiation was promoted and the differentiation of intestinal organoids was promoted (FIGS. 26, 27, 28, 29, etc.).
  • the peptide represented by the amino acid sequence of SEQ ID NO: 3 when administered to an enteritis animal model, a body weight recovery effect appears, the length of the colon increases in proportion to the dose, and the expression of stem cell markers increases. It was confirmed (Figs. 9-12, etc.). This indicates that the peptide of the present invention is effective in treating inflammatory bowel disease.
  • the peptide of the present invention may be a peptide derived from Akkermansia muciniphila strain.
  • the strain-derived peptide may be a protein composed of the amino acid sequence of SEQ ID NO: 1 (WP_012420447.1).
  • the protein may have the same function as the peptide composed of the amino acid sequence of SEQ ID NO: 3, and the strain-derived peptide may be composed of the amino acid sequence of SEQ ID NO: 3, but is not limited thereto.
  • Akermansia muciniphila belongs to Gram-negative bacteria, is absolutely anaerobic, has no mobility, does not form spores, and has an oval shape.
  • the Akermancia muciniphila bacteria use mucin as the sole source of carbon and nitrogen, and are known to inhabit the gastrointestinal tract of various animals including humans.
  • the peptide derived from the Akermansia muciniphila strain may be an extracellular protein or a secreted protein of the Akermancia muciniphila strain, and when cultured in a medium without mucin, the expression may increase, but is not limited thereto.
  • Another aspect of the present invention is a polynucleotide encoding the peptide of the present invention; And it provides a recombinant vector comprising the polynucleotide.
  • the polynucleotide of the present invention is a polymer of nucleotides in which nucleotide units are extended in a chain shape by covalent bonds, and as a DNA or RNA strand having a certain length or longer, it means a polynucleotide encoding the peptide according to the present invention. do.
  • polynucleotide of the present invention various modifications can be made to the coding region within a range that does not change the amino acid sequence of the peptide expressed from the coding region, taking into account the preferred codon in the organism to express the peptide, Various modifications or modifications may be made within a range that does not affect the expression of the gene even in parts other than the coding region. That is, as long as the polynucleotide of the present invention encodes a peptide having equivalent activity, one or more nucleic acid bases may be mutated by substitution, deletion, insertion, or a combination thereof, and these are also included in the scope of the present invention.
  • a known vector such as a plasmid vector, a cozmid vector, and a bacteriophage vector can be used, and any known vector using DNA recombination technology It can be easily manufactured by a person skilled in the art according to the method.
  • the peptide for preventing or treating inflammatory bowel disease of the present invention provides a pharmaceutical composition for preventing or treating inflammatory bowel disease, comprising a polynucleotide encoding the peptide or a recombinant vector comprising the polynucleotide as an active ingredient.
  • culturing the transformant to produce a peptide or a transformant expressing the peptide May be included in a pharmaceutical composition, or the dried product, extract, culture, or lysate of the transformant may be included in the pharmaceutical composition, or the peptide of the present invention may be recovered and used therefrom.
  • the dried product, extract, culture, or lysate of the transformant may be included in the pharmaceutical composition, or the peptide of the present invention may be recovered and used therefrom.
  • the pharmaceutical composition of the present invention may include any one or more of the cells of the Akkermansia muciniphila strain, dried products, extracts, cultures, and lysates of the strain.
  • the peptide of the present invention may be included in the pharmaceutical composition in a form contained within the cells of the Akkermansia muciniphila strain.
  • the pharmaceutical composition of the present invention may include any one or more of the strain, dry matter, extract, culture, and lysate.
  • the peptide of the present invention can be isolated and recovered from any one or more of the bacterial cells, the dried product of the strain, the extract, the culture, and the lysate, and used in the pharmaceutical composition of the present invention.
  • the pharmaceutical composition of the present invention may further include any one or more of the above strain, dry matter, extract, culture, and lysate in addition to the peptide of the present invention. However, it is not limited thereto.
  • inflammatory bowel disease includes all diseases of the intestine that are associated with an inflammatory response. For example, it may be caused by an inflammatory reaction.
  • the inflammatory bowel disease may be selected from enteritis, ulcerative colitis, Chrohn's disease, intestinal Bechet's disease, hemorrhagic rectal ulcer, and ileal cystitis, but is not limited thereto. Does not.
  • the inflammatory bowel disease may be accompanied by symptoms such as increased expression of inflammatory cytokines, weight loss, colon length reduction, abdominal pain, fever, diarrhea, and bleeding, but is not limited thereto.
  • the pharmaceutical composition comprising the peptide of the present invention is used to treat inflammatory bowel disease. It can be useful.
  • prevention of the present invention means any action of inhibiting or delaying inflammatory bowel disease by administering the composition of the present invention to an individual.
  • treatment refers to any action to improve or benefit the symptoms of inflammatory bowel disease by administering the composition of the present invention to an individual.
  • the peptide contained in the pharmaceutical composition of the present invention is not limited as long as it has an effect of treating or preventing inflammatory bowel disease, but in an amount of 0.0001 to 99.9% by weight, more specifically 0.01 to 80% by weight, based on the total weight of the final composition Can be included as In one embodiment, the peptide contained in the pharmaceutical composition of the present invention may be at a concentration greater than 0 and less than or equal to 10 ⁇ M, for example, 0.9 ⁇ M to 4.5 ⁇ M, 1.8 ⁇ M to 3.6 ⁇ M concentration.
  • the peptides included in the pharmaceutical composition of the present invention may have a concentration of more than 0 and 500 nM or less, for example, more than 0 100 nM, more than 0 50 nM, and more than 0 40 nM.
  • the present invention is not limited thereto, and an effective dose may be appropriately selected according to the administration target.
  • the pharmaceutical composition of the present invention may further include an appropriate carrier, excipient, or diluent commonly used in the preparation of pharmaceutical compositions.
  • an appropriate carrier refers to a carrier or diluent that does not stimulate an organism and does not inhibit the biological activity and properties of the administered compound.
  • the kind of the carrier that can be used in the present invention is not particularly limited, and any carrier commonly used in the art and pharmaceutically acceptable can be used.
  • Non-limiting examples of the carrier include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and the like. These may be used alone or in combination of two or more.
  • compositions of the present invention may be prepared in various dosage forms depending on whether the intended administration method is an oral administration method or a parenteral administration method.
  • Non-limiting examples of formulations for oral administration include troches, lozenges, tablets, aqueous suspensions, oily suspensions, powders, granules, emulsions, hard capsules, soft capsules, syrups or elixirs, etc. Can be lifted.
  • a dosage form for oral administration such as the above tablets or capsules, such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose (Cellulose), gelatin, etc.
  • Binder Excipients such as dicalcium phosphate and the like; Disintegrants such as corn starch or sweet potato starch; Lubricating oils such as magnesium stearate, calcium stearate, sodium stearyl fumarate, or polyethylene glycol wax may be included.
  • a liquid carrier such as fatty oil may be additionally contained.
  • Formulations for parenteral administration include, for example, injectable forms such as subcutaneous injection, intravenous injection, or intramuscular injection; Suppository injection method; Alternatively, it may be formulated for spraying such as an aerosol that allows inhalation through the respiratory tract, but is not limited thereto.
  • the composition of the present invention may be prepared as a solution or suspension by mixing in water together with a stabilizer or buffer, and formulated for unit administration of an ampoule or vial.
  • a propellant or the like may be blended with an additive so that the water-dispersed concentrate or wet powder is dispersed.
  • the pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount, and the term "pharmaceutically effective amount" of the present invention is used to treat or prevent diseases at a reasonable benefit/risk ratio applicable to medical treatment or prevention. It means a sufficient amount, and the effective dose level is the severity of the disease, the activity of the drug, the patient's age, weight, health, sex, the patient's sensitivity to the drug, the time of administration of the composition of the present invention used, the route of administration and the rate of excretion. The duration, factors including drugs used in combination or co-use with the composition of the present invention used, and other factors well known in the medical field.
  • the pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or administered in combination with other therapeutic agents, and may be administered sequentially or simultaneously with a conventional therapeutic agent. And can be administered single or multiple. Considering all of the above factors, it is possible to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects.
  • the dosage of the pharmaceutical composition of the present invention may be administered, for example, to animals including humans at a dose of 0 to 1 g/kg body weight during a day.
  • the strain when the peptide of the present invention is administered in a form contained in the cells of the strain, the strain may be administered at a dose of 1 ⁇ 10 4 cells/kg to 1 ⁇ 10 12 cells/kg.
  • it is not limited thereto.
  • the frequency of administration of the composition of the present invention is not particularly limited thereto, but may be administered once a day or divided into several doses.
  • the above dosage does not in any way limit the scope of the present invention.
  • Another aspect of the present invention provides a method for treating inflammatory bowel disease, comprising administering the pharmaceutical composition.
  • the peptide provided by the present invention has an effect of preventing or treating inflammatory bowel disease, and a pharmaceutical composition comprising the same can be used for preventing or treating inflammatory bowel disease.
  • the "individual" of the present invention may mean all animals including humans.
  • the animals may be mammals such as cows, horses, sheep, pigs, goats, camels, antelopes, dogs, cats, etc. in need of treatment for not only humans but similar symptoms. Or it may mean an animal other than humans, but is not limited thereto.
  • the "administration" of the present invention means introducing the composition of the present invention to an individual by any suitable method, and the route of administration may be administered through various routes, either orally or parenterally, as long as the target tissue can be reached.
  • the administration route of the pharmaceutical composition may be administered through any general route as long as it can reach the target tissue.
  • the pharmaceutical composition of the present invention is not particularly limited thereto, but the route of intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, intranasal administration, pulmonary administration, rectal administration, etc. Can be administered through.
  • the composition can be administered by any device capable of moving the active substance to the target cell.
  • the composition may be coated or formulated with an active agent to prevent degeneration or to protect from degradation, depending on the route of administration.
  • the peptide for preventing or treating inflammatory bowel disease of the present invention provides a composition for promoting intestinal cell differentiation, comprising a polynucleotide encoding the peptide or a recombinant vector comprising the polynucleotide as an active ingredient.
  • the peptide of the present invention by administering the peptide of the present invention to an inflammatory bowel disease model and an intestinal organoid, it was confirmed that intestinal cell differentiation and increased intestinal stem cell gene expression were increased. It was confirmed that the protein of the present invention can be usefully used to promote intestinal cell differentiation (FIGS. 5, 21, 24, 26, etc.).
  • the peptides of the present invention are as described above.
  • the peptide for preventing or treating inflammatory bowel disease of the present invention provides a health functional food composition for preventing or improving inflammatory bowel disease, comprising a polynucleotide encoding the peptide or a recombinant vector comprising the polynucleotide as an active ingredient.
  • the health functional food composition of the present invention can be consumed on a daily basis, it is very useful because it can expect an effect of preventing or improving inflammatory bowel disease.
  • the term "improvement” refers to all actions of at least reducing the severity of a parameter related to a condition to be treated by administration of a composition comprising the peptide of the present invention, for example, the severity of symptoms.
  • the health functional food of the present invention can be prepared by a method commonly used in the art, and at the time of manufacture, it can be prepared by adding raw materials and ingredients commonly added in the art.
  • the formulation of the health functional food may be prepared without limitation as long as it is a formulation recognized as a food.
  • the health functional food composition of the present invention can be prepared in various forms, and unlike general drugs, it has the advantage of not having side effects that may occur when taking drugs for a long time by using food as a raw material. It is very useful because it can be ingested, and it can be ingested as an adjuvant to enhance the therapeutic or preventive effect of inflammatory bowel disease.
  • the health functional food is not particularly limited to other ingredients other than the peptide of the present invention as an essential ingredient, and may contain various herbal extracts, food supplementary additives, natural carbohydrates, and the like as an additional ingredient like a normal health functional food.
  • the food additives include food additives conventional in the art, such as flavoring agents, flavoring agents, coloring agents, fillers, stabilizers, and the like.
  • Examples of the natural carbohydrate include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, and the like; And polysaccharides, for example, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol.
  • natural flavoring agents for example, rebaudioside A, glycyrrhizin, etc.
  • synthetic flavoring agents sacharin, aspartame, etc.
  • the health functional food composition of the present invention includes various nutrients, vitamins, water (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and heavy weight agents (cheese, chocolate, etc.), pectic acid and salts thereof.
  • Alginic acid and salts thereof organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and other natural fruit juices and fruit juice beverages and vegetables It may contain pulp for the manufacture of beverages.
  • health functional foods are in the form of any one of meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, gum, ice cream, soup, beverage, tea, functional water, drink, alcoholic beverage and vitamin complex.
  • the above health functional food may additionally contain food additives, and the suitability as a "food additive” shall be determined according to the General Regulations of the Food Additive Code approved by the Food and Drug Administration and general test methods, etc. It is judged according to standards and standards.
  • the content of the composition added to food including beverages may be appropriately added or subtracted as needed.
  • the peptide for preventing or treating inflammatory bowel disease of the present invention provides a feed composition for preventing or improving inflammatory bowel disease, comprising a polynucleotide encoding the peptide or a recombinant vector comprising the polynucleotide as an active ingredient.
  • the feed composition may include a feed additive.
  • the term "feed additive” is a substance added to feed for the purpose of various effects such as supplementing nutrients and preventing weight loss, improving digestibility of fiber in feed, improving oil quality, preventing reproductive disorders and improving conception rate, and preventing high temperature stress in summer Includes.
  • the feed additive of the present invention may correspond to an auxiliary feed according to the feed management method.
  • the term "feed” is any natural or artificial diet for eating, ingesting, and digesting animals or suitable therefor, as a component of the single meal meal, or the composition according to the present invention as an active ingredient.
  • the included feed can be prepared in various types of feed known in the art.
  • the kind of feed is not particularly limited, and feed commonly used in the art may be used.
  • Non-limiting examples of the feed include vegetable feed such as grains, root fruits, food processing by-products, algae, fiber, pharmaceutical by-products, oils and fats, starches, meals or grain by-products; Animal feeds such as proteins, inorganic logistics, oils and fats, minerals, oils and fats, single-cell proteins, zooplanktons or foods. These may be used alone or in combination of two or more.
  • the content of the peptide of the present invention contained in the feed composition of the present invention can be appropriately adjusted according to the type and age of the livestock to be applied, the application form, and the desired effect.
  • Example 1 Administration of Akkermansia muciniphila (AK) strain to a mouse model of inflammatory bowel disease
  • AK Akkermansia muciniphila
  • AK Akkermansia muciniphila
  • the body weight, colon length, and inflammatory cytokine expression levels of the experimental animals were measured to confirm whether symptoms were relieved.
  • Inflammatory colitis accompanied by ulcer has a characteristic that the length of the colon decreases as the lesion becomes more severe, so the length of the colon is used as a measure to evaluate the degree of improvement of symptoms in the inflammatory colitis model.
  • the colon was collected on the 6th day by the same method as the colon length measurement, and total RNA was isolated. Using 1 ⁇ g of total RNA, 20 ⁇ l of cDNA was obtained, and IL-6, TNF- ⁇ , and known as representative inflammatory cytokines. It was analyzed by performing real-time PCR using IL-1 ⁇ primer.
  • Amuc_1409 NCBI Reference Sequence: WP_012420447.1 (SEQ ID NO: 1) or Amuc_1100 from genomic DNA of Akermansia muciniphila strain to determine which protein among AK-derived proteins helps in the process of recovering enteritis.
  • cloni® 5-alpha Chemically Competent Cells, 60602-1, Lucigen) DNA (pET-30a(+) vector + Amuc_1409 (SEQ ID NO: 4) or Amuc_1100 gene (SEQ ID NO: 16)) was amplified and these recombinant plasmid DNAs were purified.
  • the purified recombinant plasmid DNA was transformed into E. Coli BL21 (DE3), a protein-expressing strain, to produce an E. Coli strain overexpressing the recombinant Amuc_1409 or Amuc_1100 protein. Transformed E.
  • Coli BL21(DE3) electro-competent cells were cultured in LB medium (50 ug/ml Kanamycin, 0.5 mM IPTG) at 25° C. 120 rpm for 18 hours to induce overexpression of Amuc_1409 or Amuc_1100 recombinant protein.
  • the cultured cells were disrupted using a sonicator, and the supernatant obtained by centrifugation at 13,000 rpm for 30 min was eluted on a column filled with Ni-NTA His-Bind Resin (70666-4CN, Merck), and His- Recombinant Amuc_1409 or Amuc_1100 protein to which the tag was bound was purified.
  • Example 3 Efficacy in promoting long organoid germination and differentiation of Amuc_1409 protein derived from AK strain
  • the epithelial stem cells extracted from the mouse small intestine crypt tissue sections were 3D cultured in a medium containing major niche components such as Wnt, Noggin, and R-spondin, and a metrigel scaffold to prepare intestinal organoids derived from mouse small intestine.
  • Example 3-1 Comparison of Amuc_1100 and Amuc_1409
  • the Amuc_1100 and Amuc_1409 proteins purified as described above on days 0, 2, and 4 were treated with 16 nM, and the number of organoids germinated on day 5 and the number of organoids by the number of leaves were checked and analyzed for comparison.
  • Example 3-2 Comparison of the effect of Amuc_1409 protein administration dose
  • the Amuc_1409 protein has excellent intestinal cell differentiation promoting ability.
  • the Amuc_1409 protein has an excellent effect in alleviating and treating symptoms caused by inflammatory bowel disease.
  • inflammatory bowel disease was induced by administering 2% DSS to 10-week-old C57BL/6 mice through negative water for 6 days. Subsequently, water was replaced to give a recovery period, and 150 ⁇ l of PBS and 150 ⁇ l of Amuc_1409 protein (1.8. 3.2 ⁇ M/day) for the control group were replaced with water and administered once a day during the recovery period. It was measured (Fig. 9). In addition, the length was measured by replacing it with a negative number and collecting the colon on the third day (FIG. 10), and the degree of enteritis symptoms was confirmed through H&E staining (FIG. 11). In addition, the distal colon was collected to analyze the expression of stem cell-related genes (FIG. 12).
  • mice of the Amuc_1409 protein-administered group quickly recovered their body weight in proportion to the dose at the time of replacing and recovering with water after the end of DSS administration (FIG. 9).
  • the administration of the Amuc_1409 protein of the present invention promotes recovery of inflammatory bowel disease and has an excellent effect of recovering intestinal tissue damaged by inflammation.
  • the Amuc_1409 protein of the present invention is used to prevent, improve and treat inflammatory bowel disease. It can be seen that it can be used usefully.
  • Example 6-1 Differentiation of human intestinal organoids derived from human pluripotent stem cells
  • Human pluripotent stem cells were used to differentiate human intestinal organoids using a previously reported method (Nature 470, 105-109 (2011)).
  • a medium containing 0%, 0.2%, and 2% fetal bovine serum was treated with 100 ng/ml of Activin A for 3 days, and then 500 ng for the formation of posterior spheroids.
  • Differentiation was induced by additional culture for 4 days with differentiation medium containing /ml FGF4, 3 ⁇ M CHIR 99021, and 2% fetal bovine serum.
  • the formed spheroid was inserted into the matrigel dome and cultured in a culture medium containing 1X B27 supplement, 100 ng/ml EGF, 100 ng/ml Noggin, and 500 ng/ml R-spondin1 in a three-dimensional culture environment. It was subcultured once every time.
  • Example 6-2 Confirmation of proliferation, development/maturity of human intestinal organoids following Amuc_1409 treatment
  • Amuc_1409 When culturing intestinal organoids, Amuc_1409 was added at concentrations of 8nM, 16nM, and 32nM and used (FIG. 13).
  • intestinal proliferation marker MKI67
  • intestinal stem cell marker LGR5, ASCL2, CD166, LRIG1
  • mature intestinal specific marker OLM4
  • RNA of intestinal organoids was extracted using the RNeasy kit (Qiagen), and cDNA was synthesized using the Superscript IV cDNA synthesis system (Invitrogen). qRT-PCR was performed through a 7500 Fast Real-time PCR system (Applied Biosystem).
  • proliferation markers Ki-67 and epithelial markers (ECAD) at the protein level through immunofluorescence staining.
  • ASCL2 intestinal stem cell marker
  • OFM4 intestinal maturation marker
  • Intestinal organoids were fixed in 4% Paraformaldehyde (PFA) and then frozen using 10-30% sucrose solution and then frozen using OCT solution.
  • PFA Paraformaldehyde
  • Using a microtome a 10-20 ⁇ m thick incision was made to make a flake, and PBS containing 0.1% Triton X-100 was treated to permeate the flake.
  • PBS containing 4% bovine serum albumin was treated for 1 hour to undergo a blocking process, and then reacted with the primary antibody at 4°C overnight. After reacting with the secondary antibody, the nuclei were stained through DAPI staining and then observed through a fluorescence microscope.
  • the antibodies used are shown in Table 2 below.
  • Proliferation marker Ki-67
  • epithelial marker ECAD
  • results confirming the expression of intestinal stem cell marker (ASCL2) and intestinal maturation marker (OLFM4).
  • ASCL2 intestinal stem cell marker
  • OLFM4 intestinal maturation marker
  • Amuc_1409 is effective in the proliferation and development/maturation of human intestinal organoids.
  • Example 6-3 Confirmation of the effect of Amuc_1409 in human intestinal organoid model inducing inflammatory disease
  • intestinal organoids cultured for 5 days after passage 2 were treated with proinflammatory cytokines (IFN ⁇ , 200 ng/ml) for 6 hours.
  • IFN ⁇ proinflammatory cytokines
  • intestinal proliferation marker (Ki-67) through immunofluorescence staining.
  • ECAD intestinal epithelial marker
  • ASCL2 intestinal stem cell marker
  • ZO-1 close junction marker
  • the Amuc_1409 protein of the present invention can be usefully used for preventing, improving, and treating inflammatory bowel disease.
  • the Amuc_1409 protein In order to determine which domain of the Amuc_1409 protein plays a major role in the recovery of inflammatory bowel disease, the Amuc_1409 protein was divided into four domains to identify domains that are effective in organoid germination and differentiation.
  • the Amuc_1409 protein was divided into 4 pieces of Pep.A (SEQ ID NO: 5), Pep.B (SEQ ID NO: 6), Pep.C (SEQ ID NO: 7), and Pep.D (SEQ ID NO: 8). Divided into domains.
  • the Pep.A domain of the Amuc_1409 protein is an important domain for the ability to promote intestinal cell differentiation, and thus it was confirmed that the Pep.A domain is a functional fragment of the Amuc_1409 protein.
  • Pep.A In order to identify which regions within the Pep.A domain play the most important role in the recovery of inflammatory bowel disease, Pep.A was subdivided into three subdomains and its efficacy was verified.
  • Pep.A is divided into three parts: Pep.A-1 (SEQ ID NO: 9), Pep.A-2 (SEQ ID NO: 10), and Pep.A-3 (SEQ ID NO: 11). Subdivided.
  • Pep.A-2 is a functional fragment of Pep.A, and it was confirmed that Pep.A-2 and a peptide containing the same can be usefully used in the prevention and treatment of inflammatory bowel disease.
  • the organoids were cultured and treated with Amuc_1409 protein and Pep.A-2h at a concentration of 16 nM on days 0, 2, and 4, and the number of organoids germinated on the 5th day and the number of organoids were checked for comparative analysis. (Fig. 26).
  • Pep.A-2h is a functional fragment of Pep.A-2, and it was confirmed that Pep.A-2h and a peptide containing the same can be usefully used for preventing and treating inflammatory bowel disease.
  • 2% DSS was administered to 10-week-old C57BL/6 mice through drinking water for 6 days, and then replaced with water to give a recovery period.
  • 150 ⁇ l of PBS for the control group and 150 ⁇ l of Pep.A-2h (1.8, 3.6 ⁇ M/day) for the experimental group were replaced with water, and then administered orally once a day during the recovery period, and the drinking water was replaced with water after the end of DSS administration.
  • the body weight was measured at the time of recovery (FIG. 27).
  • the length of the intestine was directly measured by replacing it with a negative number and collecting the colon on the third day (FIG. 28).
  • the degree of damage recovery of intestinal tissues was confirmed through H&E staining (FIG. 29).
  • mice of the Pep.A-2h administration group quickly recovered their body weight in proportion to the dose at the time of replacing and recovering with water after the end of DSS administration (FIG. 27).
  • Pep.A-2h of the present invention promotes recovery of inflammatory bowel disease and has an excellent effect of recovering intestinal tissue damaged by inflammation.
  • the Pep.A-2h of the present invention is inflammatory. It can be seen that it can be usefully used for preventing, improving and treating intestinal diseases.

Abstract

The present invention relates to a peptide for preventing or treating inflammatory bowel diseases. The peptide of the present invention exhibits excellent effects in preventing or treating inflammatory bowel diseases and thus can be extremely beneficially used in preventing or treating said diseases.

Description

염증성 장질환의 예방 또는 치료용 펩타이드Peptides for preventing or treating inflammatory bowel disease
본 발명은 염증성 장질환의 예방, 개선 또는 치료용 펩타이드, 이를 포함하는 조성물에 관한 것이다.The present invention relates to a peptide for preventing, improving or treating inflammatory bowel disease, and a composition comprising the same.
염증성 장질환(Inflammatory bowel disease, IBD)은 위장관 내에 만성적인 염증을 유발하는 질환으로, 비교적 청년층부터 발병하며 복통, 발열, 설사, 하혈 등의 증상을 수반한다. 대체로, 궤양성 대장염(Ulcerative colitis, UC)과 크론병(Cron's disease, CD)의 2가지 형태로 분류되는데, 궤양성 대장염은 주로 점막을 침범하여, 자주 문드러짐이나 궤양을 형성하는 대장의 원인불명의 확산성 비특이성 염증(diffuse nonspecific inflammation)의 일종으로서, 혈성 설사를 비롯하여 다양한 전신 증상을 수반하고, 크론병은 구강에서 항문까지 전 소화관을 비연속성으로 점막에서 장관(腸管) 전 층에 궤양, 섬유화, 협착과 병변(病變)이 진전되는 원인불명의 육아종성 염증성 병변으로, 복통, 만성 설사, 발열, 영양장애 등의 전신 증상을 수반한다.Inflammatory bowel disease (IBD) is a disease that causes chronic inflammation in the gastrointestinal tract, and it develops from relatively young people and accompanies symptoms such as abdominal pain, fever, diarrhea, and bleeding. In general, it is classified into two types: Ulcerative colitis (UC) and Crohn's disease (CD). Ulcerative colitis mainly invades the mucous membrane, and the cause of the large intestine, which frequently forms patting or ulcers, is unknown. As a type of diffuse nonspecific inflammation of the disease, it accompanies various systemic symptoms including bloody diarrhea, and Crohn's disease is a discontinuous ulceration of the entire digestive tract from the oral cavity to the anus, from the mucous membrane to the entire intestine. It is a granulomatous inflammatory lesion of unknown cause that develops fibrosis, stenosis and lesion, and is accompanied by systemic symptoms such as abdominal pain, chronic diarrhea, fever, and nutritional disorders.
기존 염증성 장질환 치료를 위해 사용되어 온 약물로는 스테로이드성 면역억제제, 프로스타글란딘(prostaglandins)의 생성을 차단하는 5-아미노살리실산(5-aminosalicylic acid; 5-ASA) 계통 약물(예, 설파살라진 등), 메살라진 등이 있다(Gastroenterol Clin North Am. 1989 Mar;18(1):1-20 등). 그러나 이들 화합물은 염증성 장질환의 치료효과가 미미할 뿐만 아니라 복부허실(fullness), 두통, 발진, 간질환, 백혈구 감소증, 무과립구증, 남성 불임 등의 심각한 부작용을 유발하기 때문에, 그 사용이 제한되고 있어 염증성 장질환 치료를 위한 새로운 물질의 개발이 필요한 실정이다. Drugs that have been used to treat inflammatory bowel disease include steroidal immunosuppressants, 5-aminosalicylic acid (5-ASA) drugs that block the production of prostaglandins (e.g., sulfasalazine), Mesalazine and the like (Gastroenterol Clin North Am. 1989 Mar;18(1):1-20, etc.). However, these compounds are not only insignificant in the treatment of inflammatory bowel disease, but also cause serious side effects such as fullness, headache, rash, liver disease, leukopenia, agranulocytosis, and male infertility. There is a need to develop new substances for treating intestinal diseases.
본 발명자들은 아커만시아 뮤시니필라(Akkermansia muciniphila) 균주가 염증성 장질환의 치료 효과를 가진다는 것을 확인하고, 상기 균주의 유효성분을 규명하고 이의 기능적 단편을 발굴하여 염증성 장질환의 예방 및 개선 효과를 확인함으로써 본 발명을 완성하였다.The present inventors confirmed that the Akkermansia muciniphila strain has a therapeutic effect on inflammatory bowel disease, identified the active ingredient of the strain, and discovered a functional fragment thereof to prevent and improve inflammatory bowel disease. By confirming the present invention was completed.
본 발명의 하나의 목적은 서열번호 12의 아미노산 서열을 포함하는 서열번호 1의 아미노산 서열 중에서 연속하는 9개 내지 150개의 아미노산으로 이루어진, 염증성 장질환의 예방 또는 치료용 펩타이드를 제공하는 것이다.One object of the present invention is to provide a peptide for preventing or treating inflammatory bowel disease, consisting of 9 to 150 amino acids consecutive in the amino acid sequence of SEQ ID NO: 1 including the amino acid sequence of SEQ ID NO: 12.
본 발명의 다른 하나의 목적은 상기 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는, 염증성 장질환 예방 또는 치료용 약학적 조성물을 제공하는 것이다. Another object of the present invention is to provide a pharmaceutical composition for preventing or treating inflammatory bowel disease, comprising the peptide, a polynucleotide encoding the peptide, and a recombinant vector containing the polynucleotide as an active ingredient.
본 발명의 다른 하나의 목적은 상기 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는, 장세포 분화 촉진용 조성물을 제공하는 것이다.Another object of the present invention is to provide a composition for promoting intestinal cell differentiation, comprising the peptide, a polynucleotide encoding the peptide, and a recombinant vector containing the polynucleotide as an active ingredient.
본 발명의 다른 하나의 목적은 상기 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드, 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는, 염증성 장질환의 예방 또는 개선용 건강기능식품 조성물 및 사료 조성물을 제공하는 것이다.Another object of the present invention is to provide a health functional food composition and feed composition for preventing or improving inflammatory bowel disease, comprising the peptide, a polynucleotide encoding the peptide, and a recombinant vector containing the polynucleotide as an active ingredient. To provide.
본 발명의 펩타이드는 염증성 장질환의 예방 또는 치료에 우수한 효과를 갖는바, 염증성 장질환의 예방 또는 치료에 매우 유용하게 사용할 수 있다.Since the peptide of the present invention has an excellent effect in the prevention or treatment of inflammatory bowel disease, it can be very usefully used in the prevention or treatment of inflammatory bowel disease.
도 1은 아커만시아 뮤시니필라 균주를 염증성 장질환 마우스 모델에 투여한 후 체중 변화를 측정한 결과이다.1 is a result of measuring the change in body weight after administration of the Akermansia muciniphila strain to an inflammatory bowel disease mouse model.
도 2는 아커만시아 뮤시니필라 균주를 염증성 장질환 마우스 모델에 투여한 후 결장 길이를 측정한 결과이다.2 is a result of measuring the length of the colon after administration of the Akermansia muciniphila strain to a mouse model of inflammatory bowel disease.
도 3은 아커만시아 뮤시니필라 균주를 염증성 장질환 마우스 모델에 투여한 후 염증성 사이토카인 발현을 확인한 결과이다.3 is a result of confirming the expression of inflammatory cytokines after administration of the Akermansia muciniphila strain to an inflammatory bowel disease mouse model.
도 4는 아커만시아 뮤시니필라 균주 유래 단백질 Amuc_1409 또는 Amuc_1100을 처리하여 마우스 장 오가노이드의 발달 및 분화에 미치는 효과를 확인한 결과이다.4 is a result of confirming the effect on the development and differentiation of mouse intestinal organoids by treatment with the protein Amuc_1409 or Amuc_1100 derived from Akermansia muciniphila strain.
도 5는 아커만시아 뮤니시니필라 균주 유래 단백질 Amuc_1409를 처리하여 마우스 장 오가노이드의 발달 및 분화에 미치는 효과를 확인한 것이다.5 shows the effect on the development and differentiation of mouse intestinal organoids by processing the protein Amuc_1409 derived from the Akermansia municiniphila strain.
도 6은 염증성 장질환 마우스 모델에 Amuc_1409를 투여하여 체중 변화를 측정한 것이다.6 is a measurement of body weight change by administering Amuc_1409 to an inflammatory bowel disease mouse model.
도 7은 염증성 장질환 마우스 모델에 Amuc_1409를 투여하여 결장 길이를 측정한 것이다.7 is a measurement of colon length by administering Amuc_1409 to an inflammatory bowel disease mouse model.
도 8은 염증성 장질환 마우스 모델에 Amuc_1409를 투여하여 원위결장 줄기세포 관련 유전자 발현량을 확인한 것이다.Figure 8 shows the amount of gene expression related to distal colon stem cells by administering Amuc_1409 to an inflammatory bowel disease mouse model.
도 9는 염증성 장질환 마우스 모델에 Amuc_1409의 용량을 1.8 μM, 3.6 μM 로 변화시키며 투여하여 체중 변화를 확인한 것이다.9 shows the change in body weight by administering the dose of Amuc_1409 to 1.8 μM and 3.6 μM in a mouse model of inflammatory bowel disease.
도 10은 염증성 장질환 마우스 모델에 Amuc_1409 의 용량을 1.8 μM, 3.6 μM로 변화시키며 투여한 후 결장 길이를 측정한 것이다.FIG. 10 shows the length of the colon after administration by changing the dose of Amuc_1409 to 1.8 μM and 3.6 μM to an inflammatory bowel disease mouse model.
도 11은 염증성 장질환 마우스 모델에 Amuc_1409 의 용량을 1.8 μM, 3.6 μM로 변화시키며 투여한 후 장 조직을 H&E 염색하고 원위결장의 염증 정도를 확인한 것이다.FIG. 11 shows the intestinal tissue H&E staining after administration by changing the dose of Amuc_1409 to 1.8 μM and 3.6 μM in a mouse model of inflammatory bowel disease, and confirming the degree of inflammation in the distal colon.
도 12는 염증성 장질환 마우스 모델에 Amuc_1409 의 용량을 1.8 μM, 3.6 μM로 변화시키며 투여한 후 원위결장 줄기세포 관련 유전자의 발현량을 확인한 것이다. FIG. 12 shows the expression levels of distal colon stem cell-related genes after administration by changing the dose of Amuc_1409 to 1.8 μM and 3.6 μM in a mouse model of inflammatory bowel disease.
도 13 내지 도 15는 Amuc_1409가 장 발달 및 장 줄기세포의 성숙화에 미치는 영향을 인간 장 오가노이드를 이용해 확인한 것이다.13 to 15 show the effects of Amuc_1409 on intestinal development and maturation of intestinal stem cells using human intestinal organoids.
도 13은 장 오가노이드에 Amuc_1409의 2계대 처리 과정을 설명한 모식도이다.Fig. 13 is a schematic diagram explaining a second-passage treatment process of Amuc_1409 to intestinal organoids.
도 14는 Amuc_1409의 농도를 변화시키며 처리하였을 때 장 오가노이드의 형태학적 변화와 표면적 및 싹 구조(bud)의 수를 수치화하여 나타낸 도이다. 스케일 바는 500 μm 이다. 14 is a diagram showing the morphological changes, surface area, and number of buds of intestinal organoids when treated with varying the concentration of Amuc_1409. The scale bar is 500 μm.
도 15는 Amuc_1409의 농도를 변화시키며 처리하였을 때 장 오가노이드의 증식(MKI67) 또는 장 줄기세포(LGR5, ASCL2, CD166, LRIG1) 및 성숙 장 마커 유전자(OLFM4)의 발현 수준을 qRT-PCR을 통해 확인한 도이다.15 shows the expression levels of intestinal organoid proliferation (MKI67) or intestinal stem cells (LGR5, ASCL2, CD166, LRIG1) and mature intestinal marker genes (OLFM4) when treated with varying the concentration of Amuc_1409 through qRT-PCR. It is a confirmed degree.
도 16은 Amuc_1409의 농도를 변화시키며 인간 장 오가노이드에 처리하여 면역형광염색을 통해 장 오가노이드 증식 마커(Ki-67), 상피 마커(ECAD), 장 줄기세포 마커(ASCL2) 및 성숙 장 마커(OLFM4)의 발현을 나타내는 도이다. 스케일바는 200 μm 이다.FIG. 16 shows the concentration of Amuc_1409 changed and treated with human intestinal organoids, and through immunofluorescence staining, intestinal organoid proliferation markers (Ki-67), epithelial markers (ECAD), intestinal stem cell markers (ASCL2), and mature intestinal markers ( It is a diagram showing the expression of OLFM4). The scale bar is 200 μm.
도 17 내지 19는 인간 장 오가노이드 염증 유발 모델에서 Amuc_1409의 효과를 확인한 것이다. 17 to 19 confirm the effect of Amuc_1409 in a human intestinal organoid inflammation induction model.
도 17은 인간 장 오가노이드 질환 모델에서의 Amuc_1409의 치료효과를 확인하기 위하여 전염증성 사이토카인(IFNγ) 및 Amuc_1409의 처리 과정을 설명한 모식도이다.FIG. 17 is a schematic diagram illustrating a process of treatment with proinflammatory cytokines (IFNγ) and Amuc_1409 in order to confirm the therapeutic effect of Amuc_1409 in a human intestinal organoid disease model.
도 18 및 도 19는 전염증성 사이토카인(IFNγ)을 6시간 처리 후, 7일 간 Amuc_1409를 처리하였을 시 장 오가노이드의 형태학적 변화와 장 오가노이드의 면적을 확인(도 18), 이를 수치화하여 나타낸 것(도 19)이다. 스케일 바는 1mm 이다.18 and 19 show the morphological changes of intestinal organoids and the area of intestinal organoids when Amuc_1409 was treated for 7 days after 6 hours of proinflammatory cytokine (IFNγ) treatment (FIG. 18), and numerically It is shown (Fig. 19). The scale bar is 1mm.
도 20은 Amuc_1409를 인간 장 오가노이드 질환 모델에 처리한 후, 장 오가노이드의 증식 마커(Ki-67), 상피 마커(ECAD), 장 줄기세포 마커(ASCL2) 및 장 밀착연접 마커(ZO-1)의 발현을 면역형광염색 통해 확인한 도이다. 스케일 바는 200 μm 이다.FIG. 20 shows a proliferation marker of intestinal organoids (Ki-67), an epithelial marker (ECAD), an intestinal stem cell marker (ASCL2), and an intestinal adhesion marker (ZO-1) after treatment of Amuc_1409 in a human intestinal organoid disease model. ) Is a diagram confirmed through immunofluorescence staining. The scale bar is 200 μm.
도 21은 Amuc_1409 단백질의 4개의 도메인 Pep.A, Pep.B, Pep.C, Pep.D의 서열을 나타낸 것이다.Fig. 21 shows the sequences of the four domains Pep.A, Pep.B, Pep.C, and Pep.D of the Amuc_1409 protein.
도 22는 Amuc_1409 단백질과 Amuc_1409 단백질의 4개 도메인 Pep.A, Pep.B, Pep.C, Pep.D를 각각 처리하는 경우 마우스 장 오가노이드 수와 엽의 개수를 확인한 것이다. 22 shows the number of mouse intestinal organoids and the number of lobes when each of the four domains Pep.A, Pep.B, Pep.C, and Pep.D of the Amuc_1409 protein and the Amuc_1409 protein are treated.
도 23은 Pep.A의 3개의 서브 도메인 Pep.A-1, Pep.A-2 및 Pep.A-3의 서열을 나타낸 것이다.Figure 23 shows the sequence of the three subdomains of Pep.A Pep.A-1, Pep.A-2 and Pep.A-3.
도 24는 Pep.A의 3개의 서브 도메인 Pep.A-1, Pep.A-2 및 Pep.A-3을 각각 처리하는 경우 마우스 장 오가노이드 수와 엽의 개수를 확인한 것이다.24 shows the number of mouse intestinal organoids and the number of lobes when the three subdomains Pep.A-1, Pep.A-2, and Pep.A-3 of Pep.A are treated, respectively.
도 25는 Pep.A-2h의 서열을 나타낸 것이다.Figure 25 shows the sequence of Pep.A-2h.
도 26은 Amuc_1409와 Pep.A-2h를 각각 처리하는 경우 마우스 장 오가노이드 수와 엽의 개수를 확인한 것이다.26 shows the number of mouse intestinal organoids and the number of lobes in each case of treatment with Amuc_1409 and Pep.A-2h.
도 27은 염증성 장질환 마우스 모델에 Amuc_1409 3.6 μM과 Pep.A-2h의 용량을 1.8 μM, 3.6 μM로 변화시키며 투여하여 체중 변화를 확인한 것이다.FIG. 27 shows the change in body weight by administering 3.6 μM of Amuc_1409 and Pep.A-2h to 1.8 μM and 3.6 μM in an inflammatory bowel disease mouse model.
도 28은 염증성 장질환 마우스 모델에 Amuc_1409 3.6 μM과 Pep.A-2h의 용량을 1.8 μM, 3.6 μM로 변화시키며 투여한 후 결장 길이를 측정한 것이다.FIG. 28 shows colon length measurements after administration of Amuc_1409 3.6 μM and Pep.A-2h at 1.8 μM and 3.6 μM in an inflammatory bowel disease mouse model.
도 29는 염증성 장질환 마우스 모델에 Amuc_1409 3.6 μM과 Pep.A-2h의 용량을 1.8 μM, 3.6 μM로 변화시키며 투여한 후 투여한 후 장 조직을 H&E 염색하고 원위결장의 염증 정도를 확인한 것이다.29 is a mouse model of inflammatory bowel disease in which the doses of Amuc_1409 3.6 μM and Pep.A-2h were changed to 1.8 μM and 3.6 μM, and after administration, H & E staining of intestinal tissues and the degree of inflammation of the distal colon were confirmed.
이를 구체적으로 설명하면 다음과 같다. 한편, 본 발명에서 개시된 각각의 설명 및 실시형태는 각각의 다른 설명 및 실시 형태에도 적용될 수 있다. 즉, 본 발명에서 개시된 다양한 요소들의 모든 조합이 본 발명의 범주에 속한다. 또한, 하기 기술된 구체적인 서술에 의하여 본 발명의 범주가 제한된다고 볼 수 없다.This will be described in detail as follows. Meanwhile, each description and embodiment disclosed in the present invention can be applied to each other description and embodiment. That is, all combinations of various elements disclosed in the present invention belong to the scope of the present invention. In addition, it cannot be seen that the scope of the present invention is limited by the specific description described below.
또한, 당해 기술분야의 통상의 지식을 가진 자는 통상의 실험만을 사용하여 본 발명에 기재된 본 발명의 특정 양태에 대한 다수의 등가물을 인지하거나 확인할 수 있다. 또한, 이러한 등가물은 본 발명에 포함되는 것으로 의도된다.In addition, those of ordinary skill in the art can recognize or ascertain using only routine experimentation a number of equivalents to the specific aspects of the invention described herein. Also, such equivalents are intended to be included in the present invention.
본 발명의 하나의 양태는 서열번호 1의 아미노산 서열 중에서 연속하는 9개 이상의 아미노산으로 이루어진 염증성 장질환 예방 또는 치료용 펩타이드를 제공한다.One aspect of the present invention provides a peptide for preventing or treating inflammatory bowel disease consisting of 9 or more consecutive amino acids in the amino acid sequence of SEQ ID NO: 1.
상기 서열번호 1의 아미노산 서열은 서열번호 12의 아미노산 서열을 포함하는 것으로, 상기 염증성 장질환 예방 또는 치료용 펩타이드는 염증성 장질환 예방 또는 치료 활성을 가지는 한, 서열번호 1 혹은 그의 단편을 제한 없이 포함할 수 있다.The amino acid sequence of SEQ ID NO: 1 includes the amino acid sequence of SEQ ID NO: 12, and the peptide for preventing or treating inflammatory bowel disease includes, without limitation, SEQ ID NO: 1 or a fragment thereof as long as it has inflammatory bowel disease prevention or treatment activity. can do.
일 구현예로, 상기 염증성 장질환 예방 또는 치료용 펩타이드는 서열번호 12의 아미노산 서열을 포함하는 서열번호 1의 아미노산 서열 중에서 연속하는 9개 이상의 아미노산으로 이루어진 것일 수 있다. In one embodiment, the peptide for preventing or treating inflammatory bowel disease may be composed of 9 or more consecutive amino acids from the amino acid sequence of SEQ ID NO: 1 including the amino acid sequence of SEQ ID NO: 12.
일 구현예로, 본 발명의 염증성 장질환 예방 또는 치료용 펩타이드는 서열번호 12의 아미노산 서열을 포함하는 서열번호 1의 아미노산 서열 중에서 연속하는 9개 내지 150개의 아미노산으로 이루어진 것일 수 있다. In one embodiment, the peptide for preventing or treating inflammatory bowel disease of the present invention may be composed of 9 to 150 consecutive amino acids from the amino acid sequence of SEQ ID NO: 1 including the amino acid sequence of SEQ ID NO: 12.
일 구현예로, 상기 펩타이드는 서열번호 12의 아미노산 서열을 포함하는 것일 수 있다. 일 구현예로, 상기 펩타이드는 서열번호 10의 아미노산 서열을 포함하는 것일 수 있다. 일 구현예로, 상기 펩타이드는 서열번호 5의 아미노산 서열을 포함하는 것일 수 있다. 일 구현예로, 상기 펩타이드는 서열번호 3의 아미노산 서열을 포함하는 것일 수 있다. 그러나 이에 제한되지 않는다.In one embodiment, the peptide may include the amino acid sequence of SEQ ID NO: 12. In one embodiment, the peptide may include the amino acid sequence of SEQ ID NO: 10. In one embodiment, the peptide may include the amino acid sequence of SEQ ID NO: 5. In one embodiment, the peptide may include the amino acid sequence of SEQ ID NO: 3. However, it is not limited thereto.
일 구현예로, 상기 펩타이드는 서열번호 9, 서열번호 10 및 서열번호 11 중에서 선택되는 하나 이상의 아미노산 서열을 포함하는 것일 수 있고, 상기 펩타이드 내의 서열번호 9, 서열번호 10 및 서열번호 11은 서로 N-또는 C-말단의 일부가 중복되는 형태일 수 있다. 일 구현예로, 상기 펩타이드는 서열번호 5, 서열번호 6, 서열번호 7 및 서열번호 8 중에서 선택된 어느 하나 이상의 아미노산 서열을 포함하는 것일 수 있다. In one embodiment, the peptide may include one or more amino acid sequences selected from SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11, and SEQ ID NO: 9, SEQ ID NO: 10, and SEQ ID NO: 11 in the peptide are N -Or, a part of the C-terminal may overlap. In one embodiment, the peptide may include any one or more amino acid sequences selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8.
일 구현예로, 본 발명의 펩타이드는 서열번호 1의 아미노산 서열 중에서 연속하는 9개 이상의 아미노산으로 이루어진 것으로 서열번호 12와 80% 이상, 구체적으로는 90% 이상, 95% 이상, 97% 이상의 상동성을 나타내는 아미노산 서열일 수 있다. 구체적으로, 본 발명의 펩타이드는 서열번호 1의 아미노산 서열 중에서 연속하는 9개 이상의 아미노산으로 이루어진 것으로 서열번호 5와 80% 이상, 구체적으로는 90% 이상, 95% 이상, 97% 이상의 상동성을 나타내는 아미노산 서열일 수 있다. 일 구현예로, 본 발명의 펩타이드는 서열번호 10으로 표시되는 서열과 80% 이상, 90% 이상, 95% 이상, 97% 이상의 상동성을 나타내는 것일 수 있다. 일 구현예로, 본 발명의 펩타이드는 서열번호 3으로 표시되는 서열과 80% 이상, 90% 이상, 95% 이상, 97% 이상의 상동성을 나타내는 것일 수 있다. 일 구현예로, 본 발명의 펩타이드는 상기 서열번호 1로 표시되는 서열과 80% 이상, 90% 이상, 95% 이상, 97% 이상의 상동성을 나타내는 것일 수 있다. In one embodiment, the peptide of the present invention consists of 9 or more consecutive amino acids in the amino acid sequence of SEQ ID NO: 1, and is 80% or more, specifically 90% or more, 95% or more, 97% or more homology with SEQ ID NO: 12 It may be an amino acid sequence representing Specifically, the peptide of the present invention is composed of 9 or more consecutive amino acids in the amino acid sequence of SEQ ID NO: 1 and exhibits 80% or more, specifically 90% or more, 95% or more, 97% or more homology with SEQ ID NO: 5 It may be an amino acid sequence. In one embodiment, the peptide of the present invention may have 80% or more, 90% or more, 95% or more, 97% or more homology with the sequence represented by SEQ ID NO: 10. In one embodiment, the peptide of the present invention may be one that exhibits 80% or more, 90% or more, 95% or more, 97% or more homology with the sequence represented by SEQ ID NO: 3. In one embodiment, the peptide of the present invention may be one that exhibits 80% or more, 90% or more, 95% or more, 97% or more homology with the sequence represented by SEQ ID NO: 1.
그러나 본 발명의 펩타이드는 전술한 구현예에 제한되지 않고, 하나 이상의 아미노산이 치환, 결실, 삽입되거나 또는 이들의 조합에 의해 변형될 수 있으며, 그와 같이 변형된 서열도 서열번호 3의 펩타이드와 실질적으로 동일하게 염증성 장질환의 예방 또는 치료 효과를 나타내는 아미노산 서열이라면, 본 발명의 범위에 제한 없이 포함된다. However, the peptide of the present invention is not limited to the above-described embodiments, and one or more amino acids may be substituted, deleted, inserted, or modified by a combination thereof, and the modified sequence is also substantially As long as it is an amino acid sequence that shows the same effect of preventing or treating inflammatory bowel disease, it is included without limitation in the scope of the present invention.
즉, 본 발명에 '특정 서열번호로 기재된 아미노산 서열을 갖는 단백질 또는 폴리펩티드', '특정 서열번호로 기재된 아미노산 서열을 포함하는 단백질 또는 폴리펩티드'라고 기재되어 있다 하더라도, 해당 서열번호의 아미노산 서열로 이루어진 폴리펩티드와 동일 혹은 상응하는 활성을 가지는 경우라면, 일부 서열이 결실, 변형, 치환 또는 부가된 아미노산 서열을 갖는 단백질도 본 출원에서 사용될 수 있음은 자명하다.That is, even if the present invention is described as'protein or polypeptide having an amino acid sequence described by a specific sequence number' or'protein or polypeptide containing an amino acid sequence described by a specific sequence number', a polypeptide consisting of the amino acid sequence of the corresponding sequence number It is obvious that proteins having an amino acid sequence in which some sequences are deleted, modified, substituted or added may also be used in the present application if they have the same or corresponding activity.
이와 같은 변형은 예를 들면 N-말단 리더 서열(leader sequence) 또는 막전이 도메인(transmembrane domain)과 같은 하나 이상의 부분이 제거된 변형일 수 있다. 또는, 성숙 단백질 (mature protein)의 N- 및/또는 C- 말단으로부터 일부분이 제거되거나, 혹은 부가된 변이일 수 있다. 또는 보존적 치환(conservative substitution)을 포함하는 것일 수 있다. 또는 폴리펩티드의 특성과 2차 구조에 최소한의 영향을 갖는 아미노산들의 결실, 부가, 또는 치환 등의 변형을 포함할 수 있다. 그러나 이에 제한되지 않는다.Such modification may be, for example, a modification in which one or more portions such as an N-terminal leader sequence or a transmembrane domain are removed. Alternatively, a portion may be removed from the N- and/or C-terminus of a mature protein, or may be an added mutation. Or it may include a conservative substitution (conservative substitution). Or it may include modification, such as deletion, addition, or substitution of amino acids having minimal influence on the properties and secondary structure of the polypeptide. However, it is not limited thereto.
예를 들어, 본 발명의 서열번호 3의 아미노산 서열은 서열번호 1의 아미노산 서열에서 leader sequence만을 제외한 서열에 상응하므로, 본 발명의 서열번호 1의 아미노산 서열을 갖는 펩타이드도 염증성 장질환 예방 또는 치료용 펩타이드로 사용될 수 있다.For example, since the amino acid sequence of SEQ ID NO: 3 of the present invention corresponds to a sequence excluding only the leader sequence from the amino acid sequence of SEQ ID NO: 1, the peptide having the amino acid sequence of SEQ ID NO: 1 of the present invention is also used for preventing or treating inflammatory bowel disease. It can be used as a peptide.
다른 예로, 본 발명의 서열번호 12의 아미노산 서열은 서열번호 10의 아미노산 서열의 C-말단에서 일부 아미노산이 결실된 형태로, 본 발명의 서열번호 10의 아미노산 서열의 C-말단에서 1개, 2개, 3개, 4개 또는 5개의 아미노산이 결실된 아미노산 서열을 갖는 펩타이드 또한 염증성 장질환 예방 또는 치료용 펩타이드로 사용될 수 있다. 마찬가지로, 본 발명의 서열번호 10의 아미노산 서열은 서열번호 5의 아미노산 서열에서 일부 아미노산이 결실된 형태이고, 서열번호 5의 아미노산은 서열번호 3의 아미노산 서열에서 일부 아미노산이 결실된 형태이므로, 서열번호 5의 아미노산 서열에서 1개 이상의 아미노산이 결실된 아미노산 서열을 갖는 펩타이드 역시 염증성 장질환 예방 또는 치료용 펩타이드로 사용될 수 있다. 다만 이에 제한되지 않는다.In another example, the amino acid sequence of SEQ ID NO: 12 of the present invention is a form in which some amino acids are deleted at the C-terminus of the amino acid sequence of SEQ ID NO: 10, and one, 2 at the C-terminus of the amino acid sequence of SEQ ID NO: 10 of the present invention A peptide having an amino acid sequence in which dog, 3, 4 or 5 amino acids are deleted may also be used as a peptide for preventing or treating inflammatory bowel disease. Likewise, the amino acid sequence of SEQ ID NO: 10 of the present invention is a form in which some amino acids are deleted from the amino acid sequence of SEQ ID NO: 5, and the amino acid of SEQ ID NO: 5 is a form in which some amino acids are deleted from the amino acid sequence of SEQ ID NO: 3, Peptides having an amino acid sequence in which one or more amino acids are deleted from the amino acid sequence of 5 can also be used as a peptide for preventing or treating inflammatory bowel disease. However, it is not limited thereto.
한편 본원에서 기재한 특정 위치의 치환되는 아미노산 혹은 고정되는 아미노산의 위치는 기준 서열 앞뒤 혹은 내부에 아미노산이 결실/부가됨에 따라 상대적으로 변경될 수 있다. 이 경우 임의의 아미노산 서열 내에 본원에서 기재하는 특정 아미노산 잔기에 상응하는 아미노산의 위치는 당업계에 알려진 alignment 방법을 이용하여 확인할 수 있다.Meanwhile, the position of the amino acid to be substituted or the amino acid to be fixed at a specific position described herein may be relatively changed as an amino acid is deleted/added before or after the reference sequence or inside the reference sequence. In this case, the position of the amino acid corresponding to the specific amino acid residue described herein within any amino acid sequence can be identified using an alignment method known in the art.
또 다른 예로, 서열번호 12의 아미노산 서열을 포함하는 서열번호 1의 아미노산 서열 중에서 연속하는 9개 내지 150개의 아미노산 서열로 이루어진 펩타이드와 70%, 80% 또는 90% 이상의 상동성을 갖는 펩타이드와 단백질도 본 발명의 범위에 포함되는 것으로 해석되어야 한다. In another example, a peptide and a protein having 70%, 80%, or 90% or more homology with a peptide consisting of 9 to 150 consecutive amino acid sequences among the amino acid sequence of SEQ ID NO: 1 including the amino acid sequence of SEQ ID NO: 12 It should be construed as being included within the scope of the present invention.
본 발명의 "상동성"은 아미노산 서열에 있어서, 특정 비교 영역에서 양 서열을 최대한 일치되도록 정렬(align)시킨 후 서열 간의 아미노산 잔기의 동일한 정도를 의미하며, 용어 "동일성" 과 상호 교환적으로 사용될 수 있다. 상동성이 충분히 높은 경우 해당 유전자의 발현 산물은 동일하거나 유사한 활성을 가질 수 있다. 상기 서열 동일성의 퍼센트는 공지의 서열 비교 프로그램을 사용하여 결정될 수 있으며, 일례로 BLAST(NCBI), CLC Main Workbench (CLC bio), MegAlignTM(DNASTAR Inc) 등을 들 수 있다.The term "homology" of the present invention refers to the degree of identicality of amino acid residues between sequences after alignment of both sequences in a specific comparison region to maximally match, and is used interchangeably with the term "identity". I can. If the homology is sufficiently high, the expression product of the gene may have the same or similar activity. The percentage of sequence identity may be determined using a known sequence comparison program, and examples include BLAST (NCBI), CLC Main Workbench (CLC bio), MegAlignTM (DNASTAR Inc), and the like.
본 발명의 일 구현예에서는, 서열번호 12의 아미노산 서열로 표시되는 펩타이드를 염증성 장질환 동물 모델에 투여하면 체중이 회복되고 결장 길이가 증가하는 것을 확인하였으며, 장 오가노이드에 처리하는 경우, 발아된 오가노이드 수와 엽의 개수가 유의하게 증가하는 것을 확인하여, 장세포 분화를 촉진하고 장관 오가노이드의 분화를 촉진하는 것을 확인하였다(도 26, 도 27, 도 28, 도 29 등). In one embodiment of the present invention, when the peptide represented by the amino acid sequence of SEQ ID NO: 12 was administered to an animal model of inflammatory bowel disease, it was confirmed that body weight was restored and colon length was increased. When treated with intestinal organoids, germinated It was confirmed that the number of organoids and the number of lobes significantly increased, and it was confirmed that intestinal cell differentiation was promoted and the differentiation of intestinal organoids was promoted (FIGS. 26, 27, 28, 29, etc.).
본 발명의 다른 구현예에서는, 서열번호 12를 포함하는 서열번호 10의 아미노산 서열로 표시되는 펩타이드를 장 오가노이드에 처리하는 경우 발아된 오가노이드 수와 엽의 개수가 유의하게 증가하는 것을 확인하여, 장세포 분화를 촉진하고 장관 오가노이드의 분화를 촉진하는 것을 확인하였다 (도 24).In another embodiment of the present invention, it was confirmed that the number of germinated organoids and the number of leaves significantly increased when the peptide represented by the amino acid sequence of SEQ ID NO: 10 including SEQ ID NO: 12 was treated on intestinal organoids, It was confirmed that intestinal cell differentiation was promoted and intestinal organoid differentiation was promoted (FIG. 24 ).
본 발명의 다른 구현예에서는, 서열번호 12를 포함하는 서열번호 5의 아미노산 서열로 표시되는 펩타이드를 장 오가노이드에 처리하는 경우 발아된 오가노이드 수와 엽의 개수가 유의하게 증가하는 것을 확인하여, 장세포 분화를 촉진하고 장관 오가노이드의 분화를 촉진하는 것을 확인하였다(도 22). In another embodiment of the present invention, it was confirmed that when the peptide represented by the amino acid sequence of SEQ ID NO: 5 including SEQ ID NO: 12 was treated on intestinal organoids, the number of germinated organoids and the number of leaves significantly increased, It was confirmed that intestinal cell differentiation was promoted and intestinal organoid differentiation was promoted (FIG. 22).
본 발명의 또 다른 구현예에서는 서열번호 3의 아미노산 서열로 표시되는 펩타이드를 장염 동물 모델에 투여하는 경우 체중 회복 효과가 나타나며, 결장 길이가 용량에 비례하여 증가하고, 줄기세포 마커 발현이 증가하는 것을 확인하였다(도 9-12 등). 이는 본 발명의 펩타이드가 염증성 장질환 치료에 효과적이라는 것을 나타낸다.In another embodiment of the present invention, when the peptide represented by the amino acid sequence of SEQ ID NO: 3 is administered to an enteritis animal model, a body weight recovery effect appears, the length of the colon increases in proportion to the dose, and the expression of stem cell markers increases. It was confirmed (Figs. 9-12, etc.). This indicates that the peptide of the present invention is effective in treating inflammatory bowel disease.
본 발명의 펩타이드는, 아커만시아 뮤시니필라(Akkermansia muciniphila) 균주 유래의 펩타이드일 수 있다.The peptide of the present invention may be a peptide derived from Akkermansia muciniphila strain.
구체적으로, 상기 균주 유래 펩타이드는 서열번호 1의 아미노산 서열로 구성되는 단백질일 수 있다(WP_012420447.1). 상기 단백질은 서열번호 3의 아미노산 서열로 구성되는 펩타이드와 동일한 기능을 갖는 것일 수 있는 바, 상기 균주 유래 펩타이드는 서열번호 3의 아미노산 서열로 구성되는 것일 수 있으나 이에 제한되지 않는다.Specifically, the strain-derived peptide may be a protein composed of the amino acid sequence of SEQ ID NO: 1 (WP_012420447.1). The protein may have the same function as the peptide composed of the amino acid sequence of SEQ ID NO: 3, and the strain-derived peptide may be composed of the amino acid sequence of SEQ ID NO: 3, but is not limited thereto.
본 발명의 "아커만시아 뮤시니필라"는 그람 음성균에 속하며, 절대적인 혐기성으로 운동성이 없고, 포자를 형성하지 않으며 타원형의 형태를 가지고 있는 세균이다. 상기 아커만시아 뮤시니필라균은 탄소와 질소의 유일한 공급원으로 뮤신(mucin)을 이용하며, 사람을 포함한 다양한 동물의 위장관에 서식한다고 알려져 있다."Akermansia muciniphila" of the present invention belongs to Gram-negative bacteria, is absolutely anaerobic, has no mobility, does not form spores, and has an oval shape. The Akermancia muciniphila bacteria use mucin as the sole source of carbon and nitrogen, and are known to inhabit the gastrointestinal tract of various animals including humans.
상기 아커만시아 뮤시니필라 균주 유래 펩타이드는 아커만시아 뮤시니필라 균주의 세포외 단백질, 분비 단백질일 수 있으며, 뮤신이 없는 배지에서 배양되는 경우 발현이 증가하는 것일 수 있으나, 이에 제한되지 않는다. The peptide derived from the Akermansia muciniphila strain may be an extracellular protein or a secreted protein of the Akermancia muciniphila strain, and when cultured in a medium without mucin, the expression may increase, but is not limited thereto.
본 발명의 다른 하나의 양태는, 본 발명의 펩타이드를 코딩하는 폴리뉴클레오티드; 및 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 제공한다.Another aspect of the present invention is a polynucleotide encoding the peptide of the present invention; And it provides a recombinant vector comprising the polynucleotide.
본 발명의 폴리뉴클레오티드는 뉴클레오티드 단위체(monomer)가 공유결합에 의해 사슬모양으로 길게 이어진 뉴클레오티드의 중합체(polymer)이며, 일정한 길이 이상의 DNA 또는 RNA 가닥으로서, 본 발명에 따른 펩타이드를 코딩하는 폴리뉴클레오티드를 의미한다. The polynucleotide of the present invention is a polymer of nucleotides in which nucleotide units are extended in a chain shape by covalent bonds, and as a DNA or RNA strand having a certain length or longer, it means a polynucleotide encoding the peptide according to the present invention. do.
또한, 본 발명의 폴리뉴클레오티드는 상기 펩타이드를 발현시키고자 하는 생물에서 선호되는 코돈을 고려하여, 코딩영역으로부터 발현되는 펩타이드의 아미노산 서열을 변화시키지 않는 범위 내에서 코딩영역에 다양한 변형이 이루어질 수 있고, 코딩영역을 제외한 부분에서도 유전자의 발현에 영향을 미치지 않는 범위 내에서 다양한 변형 또는 수식이 이루어질 수 있다. 즉, 본 발명의 폴리뉴클레오티드는 이와 동등한 활성을 갖는 펩타이드를 코딩하는 한, 하나 이상의 핵산 염기가 치환, 결실, 삽입 또는 이들의 조합에 의해 변이될 수 있으며, 이들 또한 본 발명의 범위에 포함된다.In addition, in the polynucleotide of the present invention, various modifications can be made to the coding region within a range that does not change the amino acid sequence of the peptide expressed from the coding region, taking into account the preferred codon in the organism to express the peptide, Various modifications or modifications may be made within a range that does not affect the expression of the gene even in parts other than the coding region. That is, as long as the polynucleotide of the present invention encodes a peptide having equivalent activity, one or more nucleic acid bases may be mutated by substitution, deletion, insertion, or a combination thereof, and these are also included in the scope of the present invention.
본 발명의 재조합 벡터는 세포 내에 도입하여 본 발명의 펩타이드를 발현시키기 위한 수단으로서, 플라스미드 벡터, 코즈미드 벡터, 박테리오파아지 벡터 등 공지의 벡터를 사용할 수 있으며, 벡터는 DNA 재조합 기술을 이용한 임의의 공지된 방법에 따라 당업자가 용이하게 제조할 수 있다.As a means for introducing the recombinant vector of the present invention into a cell and expressing the peptide of the present invention, a known vector such as a plasmid vector, a cozmid vector, and a bacteriophage vector can be used, and any known vector using DNA recombination technology It can be easily manufactured by a person skilled in the art according to the method.
본 발명의 다른 하나의 양태는, 본 발명의 염증성 장질환 예방 또는 치료용 펩타이드; 상기 펩타이드를 코딩하는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는, 염증성 장질환 예방 또는 치료용 약학적 조성물을 제공한다.Another aspect of the present invention, the peptide for preventing or treating inflammatory bowel disease of the present invention; It provides a pharmaceutical composition for preventing or treating inflammatory bowel disease, comprising a polynucleotide encoding the peptide or a recombinant vector comprising the polynucleotide as an active ingredient.
일 구현예로 본 발명의 펩타이드를 코딩하는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터로 숙주세포를 형질전환 시킨 후, 상기 형질전환체를 배양하여 펩타이드를 생산하거나, 펩타이드를 발현하는 형질전환체를 약학적 조성물에 포함시키거나, 상기 형질전환체의 건조물, 추출물, 배양물, 파쇄물을 약학적 조성물에 포함시키거나 그로부터 본 발명의 펩타이드를 회수하여 사용할 수 있다. 다만 이에 제한되지 않는다.In one embodiment, after transforming a host cell with a polynucleotide encoding the peptide of the present invention or a recombinant vector containing the polynucleotide, culturing the transformant to produce a peptide or a transformant expressing the peptide May be included in a pharmaceutical composition, or the dried product, extract, culture, or lysate of the transformant may be included in the pharmaceutical composition, or the peptide of the present invention may be recovered and used therefrom. However, it is not limited thereto.
본 발명의 약학적 조성물은, 아커만시아 뮤시니필라(Akkermansia muciniphila) 균주의 균체, 상기 균주의 건조물, 추출물, 배양물, 파쇄물 중 어느 하나 이상을 포함할 수 있다. The pharmaceutical composition of the present invention may include any one or more of the cells of the Akkermansia muciniphila strain, dried products, extracts, cultures, and lysates of the strain.
일 구현예로, 본 발명의 펩타이드는 아커만시아 뮤시니필라 (Akkermansia muciniphila) 균주의 균체 내에 포함된 형태로 상기 약학적 조성물에 포함될 수 있다. 다른 구현예로, 본 발명의 약학적 조성물은 상기 균주, 건조물, 추출물, 배양물, 파쇄물 중 어느 하나 이상을 포함할 수 있다. 또 다른 구현예로, 균주의 균체, 상기 균주의 건조물, 추출물, 배양물, 파쇄물 중 어느 하나 이상으로부터 본 발명의 펩타이드를 분리, 회수하여 본 발명의 약학적 조성물에 사용할 수 있다. 또 다른 구현예로, 본 발명의 약학적 조성물은 본 발명의 펩타이드에 추가로 상기 균주, 건조물, 추출물, 배양물, 파쇄물 중 어느 하나 이상을 더 포함할 수 있다. 그러나 이에 제한되지는 않는다.In one embodiment, the peptide of the present invention may be included in the pharmaceutical composition in a form contained within the cells of the Akkermansia muciniphila strain. In another embodiment, the pharmaceutical composition of the present invention may include any one or more of the strain, dry matter, extract, culture, and lysate. In another embodiment, the peptide of the present invention can be isolated and recovered from any one or more of the bacterial cells, the dried product of the strain, the extract, the culture, and the lysate, and used in the pharmaceutical composition of the present invention. In another embodiment, the pharmaceutical composition of the present invention may further include any one or more of the above strain, dry matter, extract, culture, and lysate in addition to the peptide of the present invention. However, it is not limited thereto.
본 발명의 일 구현예에서는 본 발명의 펩타이드를 포함하는 아커만시아 뮤시니필라 (Akkermansia muciniphila) 균주의 균체를 투여하여 염증성 장질환에 의한 체중 손실이 회복되고, 결장 길이가 회복되며, 결장 내 염증성 사이토카인 발현 수준이 낮아지는 것을 확인하였다(도 1-3).In one embodiment of the present invention, by administering the cells of the Akkermansia muciniphila strain containing the peptide of the present invention, weight loss due to inflammatory bowel disease is recovered, the length of the colon is restored, and inflammatory properties in the colon It was confirmed that the cytokine expression level was lowered (FIGS. 1-3 ).
본 발명의 용어, "염증성 장질환(inflammatory bowel disease)"은 염증 반응과 관련이 있는 장의 모든 질환을 포함한다. 예를 들어, 염증 반응에 의해 발생하는 것일 수 있다.The term "inflammatory bowel disease" of the present invention includes all diseases of the intestine that are associated with an inflammatory response. For example, it may be caused by an inflammatory reaction.
구체적으로 상기 염증성 장질환은 장염, 궤양성 대장염(ulcerative colitis), 크론병(Chrohn's disease), 장형 베체트병(intestinal Bechet's disease), 출혈성 직장 궤양, 및 회장낭염 중에서 선택되는 것일 수 있으나, 이에 제한되지 않는다. Specifically, the inflammatory bowel disease may be selected from enteritis, ulcerative colitis, Chrohn's disease, intestinal Bechet's disease, hemorrhagic rectal ulcer, and ileal cystitis, but is not limited thereto. Does not.
상기 염증성 장질환은 염증성 사이토카인의 발현 증가, 체중 감소, 결장 길이 감소, 복통, 발열, 설사, 하혈 등의 증상을 수반하는 것일 수 있으나 이에 제한되지 않는다.The inflammatory bowel disease may be accompanied by symptoms such as increased expression of inflammatory cytokines, weight loss, colon length reduction, abdominal pain, fever, diarrhea, and bleeding, but is not limited thereto.
본 발명의 일 구현예에서는, 본 발명의 펩타이드를 염증성 장질환 동물모델에 투여한 결과 염증성 장질환으로 인한 병증 감소를 확인하였는바, 본 발명의 펩타이드를 포함하는 약학적 조성물은 염증성 장질환 치료에 유용하게 사용될 수 있다.In one embodiment of the present invention, as a result of administering the peptide of the present invention to an animal model of inflammatory bowel disease, it was confirmed that the symptom is reduced due to inflammatory bowel disease, and the pharmaceutical composition comprising the peptide of the present invention is used to treat inflammatory bowel disease. It can be useful.
본 발명의 용어, "예방"은 본 발명의 상기 조성물을 개체에 투여하여 염증성 장질환을 억제하거나 지연시키는 모든 행위를 의미한다.The term "prevention" of the present invention means any action of inhibiting or delaying inflammatory bowel disease by administering the composition of the present invention to an individual.
본 발명에서 사용되는 용어, "치료"는 본 발명의 상기 조성물을 개체에 투여하여 염증성 장질환의 증세가 호전되도록 하거나 이롭게 되도록 하는 모든 행위를 의미한다.The term "treatment" used in the present invention refers to any action to improve or benefit the symptoms of inflammatory bowel disease by administering the composition of the present invention to an individual.
본 발명의 약학적 조성물에 포함되는 펩타이드는, 염증성 장질환 치료 또는 예방 효과가 있는 한 제한되지 않으나, 최종 조성물 총 중량을 기준으로 0.0001 내지 99.9 중량%, 보다 구체적으로는 0.01 내지 80 중량%의 함량으로 포함될 수 있다. 일 구현예로, 본 발명의 약학적 조성물에 포함되는 펩타이드는 0 초과 10 μM 이하 농도일 수 있고, 예를 들어 0.9 μM 내지 4.5μM, 1.8 μM 내지 3.6 μM 농도로 포함될 수 있다. 다른 구현예로, 본 발명의 약학적 조성물에 포함되는 펩타이드는 0 초과 500 nM 이하 농도일 수 있고, 예를 들어 0 초과 100 nM, 0 초과 50 nM, 0 초과 40 nM 농도로 포함 될 수 있다. 그러나 이에 제한되지 않고, 투여 대상에 따라 효과적인 용량을 적절히 선택할 수 있다.The peptide contained in the pharmaceutical composition of the present invention is not limited as long as it has an effect of treating or preventing inflammatory bowel disease, but in an amount of 0.0001 to 99.9% by weight, more specifically 0.01 to 80% by weight, based on the total weight of the final composition Can be included as In one embodiment, the peptide contained in the pharmaceutical composition of the present invention may be at a concentration greater than 0 and less than or equal to 10 μM, for example, 0.9 μM to 4.5 μM, 1.8 μM to 3.6 μM concentration. In another embodiment, the peptides included in the pharmaceutical composition of the present invention may have a concentration of more than 0 and 500 nM or less, for example, more than 0 100 nM, more than 0 50 nM, and more than 0 40 nM. However, the present invention is not limited thereto, and an effective dose may be appropriately selected according to the administration target.
본 발명의 약학적 조성물은 약학 조성물의 제조에 통상적으로 사용하는 적절한 담체, 부형제 또는 희석제를 추가로 포함할 수 있다. 본 발명에서 사용되는 용어, "약학적으로 허용 가능한 담체"란 생물체를 자극하지 않으면서, 투여되는 화합물의 생물학적 활성 및 특성을 저해하지 않는 담체 또는 희석제를 의미한다.The pharmaceutical composition of the present invention may further include an appropriate carrier, excipient, or diluent commonly used in the preparation of pharmaceutical compositions. As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier or diluent that does not stimulate an organism and does not inhibit the biological activity and properties of the administered compound.
본 발명에 사용 가능한 상기 담체의 종류는 특별히 제한되지 아니하며 당해 기술 분야에서 통상적으로 사용되고 약학적으로 허용되는 담체라면 어느 것이든 사용할 수 있다. 상기 담체의 비제한적인 예로는, 식염수, 멸균수, 링거액, 완충 식염수, 알부민 주사 용액, 덱스트로즈 용액, 말토 덱스트린 용액, 글리세롤, 에탄올 등을 들 수 있다. 이들은 단독으로 사용되거나 2 종 이상을 혼합하여 사용될 수 있다.The kind of the carrier that can be used in the present invention is not particularly limited, and any carrier commonly used in the art and pharmaceutically acceptable can be used. Non-limiting examples of the carrier include saline, sterile water, Ringer's solution, buffered saline, albumin injection solution, dextrose solution, maltodextrin solution, glycerol, ethanol, and the like. These may be used alone or in combination of two or more.
또한, 필요한 경우 항산화제, 완충액 및/또는 정균제 등 다른 통상의 첨가제를 첨가하여 사용할 수 있으며, 희석제, 분산제, 계면 활성제, 결합제 및/또는 윤활제 등을 부가적으로 첨가하여 수용액, 현탁액, 유탁액 등과 같은 주사용 제형, 환약, 캡슐, 과립 또는 정제 등으로 제제화하여 사용할 수 있다. 본 발명의 약학적 조성물은 목적하는 투여 방식이 경구 투여 방식인지 또는 비경구 투여 방식인지에 따라 다양한 제형으로 제작될 수 있다.In addition, if necessary, other conventional additives such as antioxidants, buffers and/or bacteriostatic agents can be added and used, and diluents, dispersants, surfactants, binders and/or lubricants are additionally added to provide aqueous solutions, suspensions, emulsions, etc. It can be formulated and used in the same injectable formulation, pill, capsule, granule, or tablet. The pharmaceutical composition of the present invention may be prepared in various dosage forms depending on whether the intended administration method is an oral administration method or a parenteral administration method.
경구 투여용 제형의 비제한적인 예로는, 트로키제(troches), 로젠지(lozenge), 정제, 수용성 현탁액, 유성 현탁액, 조제 분말, 과립, 에멀젼, 하드캡슐, 소프트 캡슐, 시럽 또는 엘릭시르제 등을 들 수 있다.Non-limiting examples of formulations for oral administration include troches, lozenges, tablets, aqueous suspensions, oily suspensions, powders, granules, emulsions, hard capsules, soft capsules, syrups or elixirs, etc. Can be lifted.
상기 정제 또는 캡슐 등과 같은 경구 투여용 제형으로 제제화하기 위하여, 락토오스, 사카로오스 (Saccharose), 솔비톨 (Sorbitol), 만니톨(Mannitol), 전분, 아밀로펙틴 (Amylopectin), 셀룰로오스 (Cellulose) 또는 젤라틴 (Gelatin) 등과 같은 결합제; 디칼슘 포스페이트 (dicalcium phosphate) 등과 같은 부형제; 옥수수 전분 또는 고구마 전분 등과 같은 붕괴제; 스테아르산 마그네슘 (magnesium stearate), 스테아르산 칼슘 (calcium stearate), 스테아릴 푸마르 산 나트륨(sodium stearyl fumarate) 또는 폴리에틸렌 글리콜 왁스 (polyethylene glycol wax) 등과 같은 윤활유 등을 포함할 수 있다. 나아가 캡슐 제형의 경우 상기 언급한 물질 외에도 지방유와 같은 액체 담체 등을 추가로 함유할 수 있다.In order to formulate into a dosage form for oral administration such as the above tablets or capsules, such as lactose, saccharose, sorbitol, mannitol, starch, amylopectin, cellulose (Cellulose), gelatin, etc. Binder; Excipients such as dicalcium phosphate and the like; Disintegrants such as corn starch or sweet potato starch; Lubricating oils such as magnesium stearate, calcium stearate, sodium stearyl fumarate, or polyethylene glycol wax may be included. Furthermore, in the case of a capsule formulation, in addition to the above-mentioned substances, a liquid carrier such as fatty oil may be additionally contained.
비경구 투여를 위한 제형으로는, 예를 들어 피하 주사, 정맥 주사 또는 근육내 주사 등의 주사용 형태; 좌제 주입 방식; 또는 호흡기를 통하여 흡입이 가능하도록 하는 에어로졸제 등 스프레이용으로 제제화할 수 있으나 이에 제한되지 아니한다. 상기 주사용 제형으로 제제화하기 위해서는 본 발명의 조성물을 안정제 또는 완충제와 함께 물에서 혼합하여 용액 또는 현탁액으로 제조하고 이를 앰플(ampoule) 또는 바이알 (vial)의 단위 투여용으로 제제화할 수 있다. 상기 에어로졸제 등의 스프레이용으로 제형화하는 경우, 수분산된 농축물 또는 습윤 분말이 분산되도록 추진제 등이 첨가제와 함께 배합될 수 있다.Formulations for parenteral administration include, for example, injectable forms such as subcutaneous injection, intravenous injection, or intramuscular injection; Suppository injection method; Alternatively, it may be formulated for spraying such as an aerosol that allows inhalation through the respiratory tract, but is not limited thereto. In order to formulate the formulation for injection, the composition of the present invention may be prepared as a solution or suspension by mixing in water together with a stabilizer or buffer, and formulated for unit administration of an ampoule or vial. When formulated for spraying such as the aerosol, a propellant or the like may be blended with an additive so that the water-dispersed concentrate or wet powder is dispersed.
상기 본 발명의 약학 조성물은 약학적으로 유효한 양으로 투여될 수 있는데, 본 발명의 용어 "약학적으로 유효한 양"이란 의학적 치료 또는 예방에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료 또는 예방하기에 충분한 양을 의미하며, 유효 용량 수준은 질환의 중증도, 약물의 활성, 환자의 연령, 체중, 건강, 성별, 환자의 약물에 대한 민감도, 사용된 본 발명 조성물의 투여 시간, 투여 경로 및 배출 비율 치료기간, 사용된 본 발명의 조성물과 배합 또는 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount, and the term "pharmaceutically effective amount" of the present invention is used to treat or prevent diseases at a reasonable benefit/risk ratio applicable to medical treatment or prevention. It means a sufficient amount, and the effective dose level is the severity of the disease, the activity of the drug, the patient's age, weight, health, sex, the patient's sensitivity to the drug, the time of administration of the composition of the present invention used, the route of administration and the rate of excretion. The duration, factors including drugs used in combination or co-use with the composition of the present invention used, and other factors well known in the medical field.
본 발명의 약학 조성물은 개별 치료제로 투여하거나 다른 치료제와 병용하여투여될 수 있고 종래의 치료제와는 순차적 또는 동시에 투여될 수 있다. 그리고 단일 또는 다중 투여될 수 있다. 상기 요소를 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여할 수 있다.The pharmaceutical composition of the present invention may be administered as an individual therapeutic agent or administered in combination with other therapeutic agents, and may be administered sequentially or simultaneously with a conventional therapeutic agent. And can be administered single or multiple. Considering all of the above factors, it is possible to administer an amount capable of obtaining the maximum effect in a minimum amount without side effects.
본 발명의 약학 조성물의 투여량은 예를 들어, 본 발명의 약학 조성물을 사람을 포함하는 동물에 하루 동안 0 내지 1 g/체중 kg 용량으로 투여할 수 있다. 일 구현예로, 본 발명의 펩타이드가 균주의 균체에 포함된 형태로 투여되는 경우 상기 균주는 1Х104 cells/kg 내지 1Х1012 cells/kg 용량으로 투여될 수 있다. 그러나 이에 제한되지 않는다.The dosage of the pharmaceutical composition of the present invention may be administered, for example, to animals including humans at a dose of 0 to 1 g/kg body weight during a day. In one embodiment, when the peptide of the present invention is administered in a form contained in the cells of the strain, the strain may be administered at a dose of 1Х10 4 cells/kg to 1Х10 12 cells/kg. However, it is not limited thereto.
본 발명의 조성물의 투여 빈도는 특별히 이에 제한되지 않으나, 1일 1회 투여하거나 또는 용량을 분할하여 수회 투여할 수 있다. 상기 투여량은 어떠한 면으로든 본 발명의 범위를 한정하는 것은 아니다. The frequency of administration of the composition of the present invention is not particularly limited thereto, but may be administered once a day or divided into several doses. The above dosage does not in any way limit the scope of the present invention.
본 발명의 다른 하나의 양태는 상기 약학적 조성물을 투여하는 단계를 포함하는, 염증성 장질환 치료 방법을 제공한다.Another aspect of the present invention provides a method for treating inflammatory bowel disease, comprising administering the pharmaceutical composition.
상술한 바와 같이, 본 발명에서 제공하는 펩타이드는 염증성 장질환 예방 또는 치료 효과를 가지는 바, 이를 포함하는 약학적 조성물을 염증성 장질환의 예방 또는 치료에 사용할 수 있다.As described above, the peptide provided by the present invention has an effect of preventing or treating inflammatory bowel disease, and a pharmaceutical composition comprising the same can be used for preventing or treating inflammatory bowel disease.
본 발명의 "개체" 는 인간을 포함한 모든 동물을 의미할 수 있다. 상기 동물은 인간뿐만 아니라 이와 유사한 증상의 치료를 필요로 하는 소, 말, 양, 돼지, 염소, 낙타, 영양, 개, 고양이 등의 포유동물일 수 있다. 또는 인간을 제외한 동물을 의미할 수 있으나, 이에 제한되지는 않는다.The "individual" of the present invention may mean all animals including humans. The animals may be mammals such as cows, horses, sheep, pigs, goats, camels, antelopes, dogs, cats, etc. in need of treatment for not only humans but similar symptoms. Or it may mean an animal other than humans, but is not limited thereto.
본 발명의 "투여"는 어떠한 적절한 방법으로 개체에게 본 발명의 조성물을 도입하는 것을 의미하며, 투여 경로는 목적 조직에 도달할 수 있는 한 경구 또는 비경구의 다양한 경로를 통하여 투여될 수 있다.The "administration" of the present invention means introducing the composition of the present invention to an individual by any suitable method, and the route of administration may be administered through various routes, either orally or parenterally, as long as the target tissue can be reached.
상기 약학 조성물의 투여 경로는 목적 조직에 도달할 수 있는 한 어떠한 일반적인 경로를 통하여도 투여될 수 있다. 본 발명의 약학 조성물은 특별히 이에 제한되지 않으나, 목적하는 바에 따라 복강내 투여, 정맥내 투여, 근육내 투여, 피하 투여, 피내 투여, 경구 투여, 비내 투여, 폐내 투여, 직장내 투여 등의 경로를 통해 투여 될 수 있다. 또한, 상기 조성물은 활성 물질이 표적 세포로 이동할 수 있는 임의의 장치에 의해 투여될 수 있다. 또한, 상기 조성물은 투여 경로에 따라 상기 조성물의 변성을 방지하기 위해 혹은 분해로부터 보호되도록 활성 약제를 코팅하거나 제형화 될 수 있다.The administration route of the pharmaceutical composition may be administered through any general route as long as it can reach the target tissue. The pharmaceutical composition of the present invention is not particularly limited thereto, but the route of intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, intranasal administration, pulmonary administration, rectal administration, etc. Can be administered through. In addition, the composition can be administered by any device capable of moving the active substance to the target cell. In addition, the composition may be coated or formulated with an active agent to prevent degeneration or to protect from degradation, depending on the route of administration.
본 발명의 다른 하나의 양태는, 본 발명의 염증성 장질환 예방 또는 치료용 펩타이드; 상기 펩타이드를 코딩하는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는, 장세포 분화 촉진용 조성물을 제공한다. Another aspect of the present invention, the peptide for preventing or treating inflammatory bowel disease of the present invention; It provides a composition for promoting intestinal cell differentiation, comprising a polynucleotide encoding the peptide or a recombinant vector comprising the polynucleotide as an active ingredient.
본 발명의 일 구현예에서는, 본 발명의 펩타이드를 염증성 장질환 모델 및 장 오가노이드에 투여하여, 장세포 분화 촉진 및 장 줄기세포 유전자 발현의 증가를 확인하였는바. 본 발명의 단백질이 장세포 분화 촉진에 유용하게 사용될 수 있음을 확인하였다(도 5, 도 21, 도 24, 도 26 등).In one embodiment of the present invention, by administering the peptide of the present invention to an inflammatory bowel disease model and an intestinal organoid, it was confirmed that intestinal cell differentiation and increased intestinal stem cell gene expression were increased. It was confirmed that the protein of the present invention can be usefully used to promote intestinal cell differentiation (FIGS. 5, 21, 24, 26, etc.).
본 발명의 펩타이드에 대해서는 전술한 바와 같다.The peptides of the present invention are as described above.
본 발명의 다른 하나의 양태는, 본 발명의 염증성 장질환 예방 또는 치료용 펩타이드; 상기 펩타이드를 코딩하는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는, 염증성 장질환의 예방 또는 개선용 건강기능식품 조성물을 제공한다.Another aspect of the present invention, the peptide for preventing or treating inflammatory bowel disease of the present invention; It provides a health functional food composition for preventing or improving inflammatory bowel disease, comprising a polynucleotide encoding the peptide or a recombinant vector comprising the polynucleotide as an active ingredient.
본 발명의 건강기능식품 조성물은 일상적으로 섭취하는 것이 가능하기 때문에, 염증성 장질환의 예방 또는 개선 효과를 기대할 수 있어 매우 유용하다.Since the health functional food composition of the present invention can be consumed on a daily basis, it is very useful because it can expect an effect of preventing or improving inflammatory bowel disease.
본 발명에서 용어, "개선"은 본 발명의 펩타이드를 포함하는 조성물의 투여로 치료되는 상태와 관련된 파라미터, 예를 들면 증상의 정도를 적어도 감소시키는 모든 행위를 의미한다.In the present invention, the term "improvement" refers to all actions of at least reducing the severity of a parameter related to a condition to be treated by administration of a composition comprising the peptide of the present invention, for example, the severity of symptoms.
본 발명의 건강기능식품은 당 업계에서 통상적으로 사용되는 방법에 의하여 제조가능하며, 상기 제조시에는 당 업계에서 통상적으로 첨가하는 원료 및 성분을 첨가하여 제조할 수 있다. 또한 상기 건강기능식품의 제형 또한 식품으로 인정되는 제형이면 제한 없이 제조될 수 있다. 본 발명의 건강기능식품 조성물은 다양한 형태의 제형으로 제조될 수 있으며, 일반 약품과는 달리 식품을 원료로 하여 약품의 장기 복용 시 발생할 수 있는 부작용 등이 없는 장점이 있고, 휴대성이 뛰어나 일상적으로 섭취하는 것이 가능하기 때문에 매우 유용하며, 염증성 장질환의 치료 또는 예방 효과를 증진시키기 위한 보조제로 섭취가 가능하다.The health functional food of the present invention can be prepared by a method commonly used in the art, and at the time of manufacture, it can be prepared by adding raw materials and ingredients commonly added in the art. In addition, the formulation of the health functional food may be prepared without limitation as long as it is a formulation recognized as a food. The health functional food composition of the present invention can be prepared in various forms, and unlike general drugs, it has the advantage of not having side effects that may occur when taking drugs for a long time by using food as a raw material. It is very useful because it can be ingested, and it can be ingested as an adjuvant to enhance the therapeutic or preventive effect of inflammatory bowel disease.
상기 건강기능식품은 필수 성분으로서 본 발명의 펩타이드 외에는 다른 성분에는 특별히 제한이 없으며 통상의 건강기능식품과 같이 여러가지 생약추출물, 식품 보조 첨가제 또는 천연 탄수화물 등을 추가 성분으로서 함유할 수 있다. 또한, 상기 식품 보조 첨가제는 당업계에 통상적인 식품 보조 첨가제, 예를 들어 향미제, 풍미제, 착색제, 충진제, 안정화제 등을 포함한다.The health functional food is not particularly limited to other ingredients other than the peptide of the present invention as an essential ingredient, and may contain various herbal extracts, food supplementary additives, natural carbohydrates, and the like as an additional ingredient like a normal health functional food. In addition, the food additives include food additives conventional in the art, such as flavoring agents, flavoring agents, coloring agents, fillers, stabilizers, and the like.
상기 천연 탄수화물의 예는 모노사카라이드, 예를 들어, 포도당, 과당 등; 디사카라이드, 예를 들어 말토스, 슈크로스 등; 및 폴리사카라이드, 예를 들어 덱스트린, 시클로덱스트린 등과 같은 통상적인 당, 및 자일리톨, 소르비톨, 에리트리톨 등의 당알콜이다. 상술한 것 이외에 향미제로서 천연 향미제(예를 들어 레바우디오시드 A, 글리시르히진 등) 및 합성 향미제(사카린, 아스파르탐 등)를 유리하게 사용할 수 있다.Examples of the natural carbohydrate include monosaccharides such as glucose, fructose, and the like; Disaccharides such as maltose, sucrose, and the like; And polysaccharides, for example, common sugars such as dextrin and cyclodextrin, and sugar alcohols such as xylitol, sorbitol, and erythritol. In addition to those described above, natural flavoring agents (for example, rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) can be advantageously used as flavoring agents.
상기 성분 외에도 본 발명의 건강기능식품 조성물은 여러 가지 영양제, 비타민, 물(전해질), 합성 풍미제 및 천연 풍미제 등의 풍미제, 착색제 및 중진제(치즈, 초콜릿 등), 펙트산 및 그의 염, 알긴산 및 그의 염, 유기산, 보호성 콜로이드 증점제, pH 조절제, 안정화제, 방부제, 글리세린, 알코올, 탄산 음료에 사용되는 탄산화제 등을 함유할 수 있으며, 그 밖에 천연 과일쥬스 및 과일 쥬스 음료 및 야채 음료의 제조를 위한 과육을 함유할 수 있다. 이러한 성분은 독립적으로 또는 조합하여 사용할 수 있다. 또한, 건강기능식품은 육류, 소세지, 빵, 쵸코렛, 캔디류, 스넥류, 과자류, 피자, 라면, 껌류, 아이스크림류, 스프, 음료수, 차, 기능수, 드링크제, 알콜 음료 및 비타민 복합제 중 어느 하나의 형태일 수 있다.In addition to the above ingredients, the health functional food composition of the present invention includes various nutrients, vitamins, water (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and heavy weight agents (cheese, chocolate, etc.), pectic acid and salts thereof. , Alginic acid and salts thereof, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohols, carbonates used in carbonated beverages, and other natural fruit juices and fruit juice beverages and vegetables It may contain pulp for the manufacture of beverages. These components may be used independently or in combination. In addition, health functional foods are in the form of any one of meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, gum, ice cream, soup, beverage, tea, functional water, drink, alcoholic beverage and vitamin complex. Can be
또한 상기 건강기능식품은 식품첨가물을 추가로 포함할 수 있으며, "식품첨가물"로서의 적합여부는 다른 규정이 없는 한 식품의약품안정청에 승인된 식품첨가물공전의 총칙 및 일반시험법 등에 따라 해당 품목에 관한 규격 및 기준에 의하여 판정한다.In addition, the above health functional food may additionally contain food additives, and the suitability as a "food additive" shall be determined according to the General Regulations of the Food Additive Code approved by the Food and Drug Administration and general test methods, etc. It is judged according to standards and standards.
이때, 건강기능식품을 제조하는 과정에서 음료를 포함한 식품에 첨가되는 조성물은 필요에 따라 그 함량을 적절히 가감할 수 있다.At this time, in the process of manufacturing the health functional food, the content of the composition added to food including beverages may be appropriately added or subtracted as needed.
본 발명의 다른 하나의 양태는, 본 발명의 염증성 장질환 예방 또는 치료용 펩타이드; 상기 펩타이드를 코딩하는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는, 염증성 장질환의 예방 또는 개선용 사료 조성물을 제공한다.Another aspect of the present invention, the peptide for preventing or treating inflammatory bowel disease of the present invention; It provides a feed composition for preventing or improving inflammatory bowel disease, comprising a polynucleotide encoding the peptide or a recombinant vector comprising the polynucleotide as an active ingredient.
상기 사료 조성물은 사료 첨가제를 포함할 수 있다.The feed composition may include a feed additive.
본 발명에서 용어, "사료 첨가제"는 영양소 보충 및 체중감소 예방, 사료 내섬유소의 소화 이용성 증진, 유질 개선, 번식장애 예방 및 수태율 향상, 하절기 고온 스트레스 예방 등 다양한 효과를 목적으로 사료에 첨가하는 물질을 포함한다. 본 발명의 사료첨가제는 사료관리법상 보조사료에 해당할 수 있다.In the present invention, the term "feed additive" is a substance added to feed for the purpose of various effects such as supplementing nutrients and preventing weight loss, improving digestibility of fiber in feed, improving oil quality, preventing reproductive disorders and improving conception rate, and preventing high temperature stress in summer Includes. The feed additive of the present invention may correspond to an auxiliary feed according to the feed management method.
본 발명에서 용어, "사료"는 동물이 먹고, 섭취하며, 소화시키기 위한 또는 이에 적당한 임의의 천연 또는 인공 규정식, 한끼식 등 또는 상기 한끼식의 성분으로, 본 발명에 따른 조성물을 유효성분으로 포함하는 사료는 당업계의 공지된 다양한 형태의 사료로 제조할 수 있다.In the present invention, the term "feed" is any natural or artificial diet for eating, ingesting, and digesting animals or suitable therefor, as a component of the single meal meal, or the composition according to the present invention as an active ingredient. The included feed can be prepared in various types of feed known in the art.
상기 사료의 종류는 특별히 제한되지 아니하며, 당해 기술 분야에서 통상적으로 사용되는 사료를 사용할 수 있다. 상기 사료의 비제한적인 예로는, 곡물류, 근과류, 식품 가공 부산물류, 조류, 섬유질류, 제약 부산물류, 유지류, 전분류, 박 류 또는 곡물 부산물류 등과 같은 식물성 사료; 단백질류, 무기물류, 유지류, 광물성류, 유지류, 단세포 단백질류, 동물성 플랑크톤류 또는 음식물 등과 같은 동물성 사료를 들 수 있다. 이들은 단독으로 사용되거나 2종 이상을 혼합하여 사용될 수 있다.The kind of feed is not particularly limited, and feed commonly used in the art may be used. Non-limiting examples of the feed include vegetable feed such as grains, root fruits, food processing by-products, algae, fiber, pharmaceutical by-products, oils and fats, starches, meals or grain by-products; Animal feeds such as proteins, inorganic logistics, oils and fats, minerals, oils and fats, single-cell proteins, zooplanktons or foods. These may be used alone or in combination of two or more.
본 발명의 사료 조성물 내에 포함되는 본 발명의 펩타이드의 함량은 적용 가축의 종류 및 연령, 적용 형태, 목적하는 효과 등에 따라서 적절하게 조절 가능하다.The content of the peptide of the present invention contained in the feed composition of the present invention can be appropriately adjusted according to the type and age of the livestock to be applied, the application form, and the desired effect.
이하 본 발명을 실시예 및 실험예를 통하여 보다 상세하게 설명한다. 그러나 이들 실시예 및 실험예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예 및 실험예에 한정되는 것은 아니다.Hereinafter, the present invention will be described in more detail through examples and experimental examples. However, these Examples and Experimental Examples are for illustrative purposes only, and the scope of the present invention is not limited to these Examples and Experimental Examples.
실시예 1: 염증성 장질환 마우스 모델에 아커만시아 뮤시니필라(Akkermansia muciniphila; AK) 균주 투여Example 1: Administration of Akkermansia muciniphila (AK) strain to a mouse model of inflammatory bowel disease
염증성 장염 회복과정에서 Akkermansia muciniphila (AK) 균주의 궤양성 대장염 모델에서의 효능을 확인하기 위한 실험을 수행하였다. 구체적으로 10주령의 C57BL/6 마우스에 2% DSS를 음수 시켜 장손상을 유발하였고, DSS를 투여하기 3일 전부터 대조군에는 BTTM 배지를, 실험군에는 4.5Х108 cells (150 ㎕)의 AK 균주를 경구로 1일 1회 투여하였다. DSS는 음용수에 녹여서 자유롭게 섭취할 수 있도록 하였고, 6일 동안 투여하고 물로 교체하였다. An experiment was conducted to confirm the efficacy of the Akkermansia muciniphila (AK) strain in the ulcerative colitis model during the recovery process of inflammatory enteritis. Specifically, intestinal damage was induced by drinking 2% DSS in 10 weeks old C57BL/6 mice, and from 3 days before DSS administration, BTTM medium was used for the control group, and 4.5Х10 8 cells (150 µl) of AK strain was orally administered to the experimental group Was administered once a day. DSS was dissolved in drinking water so that it could be freely ingested, administered for 6 days, and replaced with water.
실험 동물들의 체중, 결장 길이 및 염증성 사이토카인 발현 수준을 측정하여 증상의 완화여부를 확인하였다.The body weight, colon length, and inflammatory cytokine expression levels of the experimental animals were measured to confirm whether symptoms were relieved.
약 2주간 체중을 측정한 결과, 투여군이 대조군에 비해 체중이 더 빨리 증가하였고, 최종 체중 회복율도 유의하게 높은 것으로 나타나, AK 균주가 DSS로 인한 장손상을 회복하는데 매우 도움이 된다는 것을 확인하였다 (도 1).As a result of measuring body weight for about 2 weeks, the administration group gained faster body weight compared to the control group, and the final body weight recovery rate was also significantly higher, confirming that the AK strain was very helpful in recovering intestinal damage caused by DSS ( Fig. 1).
궤양이 동반되는 염증성 대장염은 병변이 심해질수록 결장의 길이가 감소하는 특징이 있기 때문에, 결장 길이는 염증성 대장염 모델에서 증상의 호전 정도를 평가하기 위한 척도로 사용된다.Inflammatory colitis accompanied by ulcer has a characteristic that the length of the colon decreases as the lesion becomes more severe, so the length of the colon is used as a measure to evaluate the degree of improvement of symptoms in the inflammatory colitis model.
6일간 DSS 2% 투여 후 6일째에 결장을 채취하여 장의 길이를 측정한 결과, 대조군의 결장의 길이가 AK 균주 투여군에 비해 감소한 것을 확인할 수 있었다(도 2).As a result of measuring the length of the colon by collecting the colon on the 6th day after 2% DSS administration for 6 days, it was confirmed that the length of the colon of the control group decreased compared to the group administered with the AK strain (FIG. 2 ).
상기 결장 길이 측정과 동일한 방법으로 6일 째에 결장을 채취하여 total RNA를 분리하고, 1 μg의 total RNA를 이용하여 20 ㎕의 cDNA를 얻어 대표적인 염증성 사이토카인으로 알려진 IL-6, TNF-α 및 IL-1β 프라이머를 이용하여 real-time PCR를 수행하여 분석하였다. The colon was collected on the 6th day by the same method as the colon length measurement, and total RNA was isolated. Using 1 μg of total RNA, 20 µl of cDNA was obtained, and IL-6, TNF-α, and known as representative inflammatory cytokines. It was analyzed by performing real-time PCR using IL-1β primer.
그 결과, AK 균주를 투여했을 때 염증성 사이토카인이 전반적으로 감소되는 것을 관찰할 수 있었다(도 3).As a result, when the AK strain was administered, it could be observed that inflammatory cytokines were generally reduced (FIG. 3).
실시예 2: 아커만시아 뮤시니필라 균주로부터 단백질 분리 및 정제 Example 2: Protein isolation and purification from Akermansia muciniphila strain
상기 실험을 토대로, AK 유래 단백질 중 어떠한 단백질이 장염 회복과정에 도움을 주는지 확인하기 위하여 아커만시아 뮤시니필라 균주의 게놈 DNA로부터 Amuc_1409(NCBI Reference Sequence: WP_012420447.1)(서열번호 1) 또는 Amuc_1100(NCBI Reference Sequence: WP_012420141.1)(서열번호 13) 각각의 leader sequence를 제외한 기능적 단편인 서열번호 3, 서열번호 15(이하 실시예에서 Amuc_1409, Amuc_1100 단백질로 지칭함)을 코딩하는 유전자를 발현 vector로 pET-30a(+) vector 이용하여 Amuc_1409 또는 Amuc_1100 단백질을 coding하는 유전자를 vector내에 삽입하고 E. coli competent cell(E. cloni® 5-alpha Chemically Competent Cells, 60602-1, Lucigen)내에 transformation하여 재조합 플라즈미드 DNA(pET-30a(+) vector + Amuc_1409 (서열번호 4) 또는 Amuc_1100 gene(서열번호 16))를 증폭하고 이들 재조합 플라즈미드 DNA를 정제하였다. 정제한 재조합 플라즈미드 DNA를 단백질 발현 균주인 E. Coli BL21(DE3)에 다시 transformation하여 재조합 Amuc_1409 또는 Amuc_1100 단백질을 과발현하는 E. Coli 균주를 제작하였다. 형질전환된 E. Coli BL21(DE3) electro-competent cell을 LB 배지(50 ug/ml Kanamycin, 0.5 mM IPTG)에서 25℃ 120 rpm 조건으로 18시간 배양하여 Amuc_1409 또는 Amuc_1100 재조합 단백질의 과발현을 유도한 후 배양 균체를 초음파분쇄기(sonicator)를 이용하여 cell을 파쇄하고 13,000 rpm, 30 min 동안 원심분리 하여 얻은 상등액을 Ni-NTA His-Bind Resin(70666-4CN, Merck)을 충진한 column에 용출하여 His-tag이 결합된 재조합 Amuc_1409 또는 Amuc_1100 단백질을 정제하였다. Zeba™ Spin Desalting Columns, 7K MWCO (89893, Thermo)과 Pierce™ High Capacity Endotoxin Removal Spin Columns (88276, Thermo) 제품을 이용하여 정제된 단백질 시료 용액 내에 포함된 염, 이미다졸 및 E. coli 유래 LPS 등을 제거하여 순수한 Amuc_1409 (서열번호 3) 또는 Amuc_1100 단백질 (서열번호 16) 을 획득하고 PBS로 용해한 후 소분하여 -80℃에 냉동보관 하여 사용하였다.Based on the above experiment, Amuc_1409 (NCBI Reference Sequence: WP_012420447.1) (SEQ ID NO: 1) or Amuc_1100 from genomic DNA of Akermansia muciniphila strain to determine which protein among AK-derived proteins helps in the process of recovering enteritis. (NCBI Reference Sequence: WP_012420141.1) (SEQ ID NO: 13) Functional fragments excluding each leader sequence, SEQ ID NO: 3, SEQ ID NO: 15 (hereinafter referred to as Amuc_1409, Amuc_1100 proteins) as an expression vector Recombinant plasmid by inserting the gene encoding Amuc_1409 or Amuc_1100 protein into the vector using pET-30a(+) vector and transforming into E. coli competent cells (E. cloni® 5-alpha Chemically Competent Cells, 60602-1, Lucigen) DNA (pET-30a(+) vector + Amuc_1409 (SEQ ID NO: 4) or Amuc_1100 gene (SEQ ID NO: 16)) was amplified and these recombinant plasmid DNAs were purified. The purified recombinant plasmid DNA was transformed into E. Coli BL21 (DE3), a protein-expressing strain, to produce an E. Coli strain overexpressing the recombinant Amuc_1409 or Amuc_1100 protein. Transformed E. Coli BL21(DE3) electro-competent cells were cultured in LB medium (50 ug/ml Kanamycin, 0.5 mM IPTG) at 25° C. 120 rpm for 18 hours to induce overexpression of Amuc_1409 or Amuc_1100 recombinant protein. The cultured cells were disrupted using a sonicator, and the supernatant obtained by centrifugation at 13,000 rpm for 30 min was eluted on a column filled with Ni-NTA His-Bind Resin (70666-4CN, Merck), and His- Recombinant Amuc_1409 or Amuc_1100 protein to which the tag was bound was purified. Salts contained in protein sample solutions purified using Zeba™ Spin Desalting Columns, 7K MWCO (89893, Thermo) and Pierce™ High Capacity Endotoxin Removal Spin Columns (88276, Thermo) products, imidazole and LPS derived from E. coli, etc. Was removed to obtain pure Amuc_1409 (SEQ ID NO: 3) or Amuc_1100 protein (SEQ ID NO: 16), dissolved in PBS, subdivided, and stored frozen at -80°C.
실시예 3: AK 균주 유래 Amuc_1409 단백질의 장오가노이드 발아 및 분화 촉진효능Example 3: Efficacy in promoting long organoid germination and differentiation of Amuc_1409 protein derived from AK strain
마우스 소장 crypt 조직 절편으로부터 추출한 상피 줄기세포를 Wnt, Noggin, R-spondin 등 주요 니치 성분을 가진 배지와 메트리젤 지지체 안에서 3D 배양하여, 마우스 소장 유래 장 오가노이드를 제작하였다. The epithelial stem cells extracted from the mouse small intestine crypt tissue sections were 3D cultured in a medium containing major niche components such as Wnt, Noggin, and R-spondin, and a metrigel scaffold to prepare intestinal organoids derived from mouse small intestine.
실시예 3-1: Amuc_1100 및 Amuc_1409의 비교Example 3-1: Comparison of Amuc_1100 and Amuc_1409
오가노이드를 배양하며 0, 2, 4일 차에 상기한 바와 같이 정제한 Amuc_1100 및 Amuc_1409 단백질을 16 nM로 처리하여 5일차에 발아된 organoid 개수와 엽 개수별로 organoid 숫자를 확인하여 비교 분석하였다.After culturing organoids, the Amuc_1100 and Amuc_1409 proteins purified as described above on days 0, 2, and 4 were treated with 16 nM, and the number of organoids germinated on day 5 and the number of organoids by the number of leaves were checked and analyzed for comparison.
그 결과, Amuc_1409 단백질을 처리한 군에서 발아된 오가노이드 수와 엽의 개수가 유의하게 더 많이 형성되어 있는 것을 확인하였다(도 4).As a result, it was confirmed that the number of germinated organoids and the number of leaves were significantly greater in the group treated with the Amuc_1409 protein (FIG. 4).
실시예 3-2: Amuc_1409 단백질 투여 용량에 따른 효과 비교Example 3-2: Comparison of the effect of Amuc_1409 protein administration dose
Amuc_1409 단백질의 농도에 따른 마우스 장 오가노이드의 발아 및 엽의 형성 정도에 미치는 영향을 확인하기 위하여, Amuc_1409 단백질을 4, 8, 16 nM 용량으로 처리하여 분석한 결과, 용량 의존적으로 발아된 오가노이드 수와 엽의 개수가 형성되는 것을 확인할 수 있었다(도 5).In order to confirm the effect of the concentration of Amuc_1409 protein on the germination of mouse intestinal organoids and the degree of lobe formation, as a result of analyzing the Amuc_1409 protein at 4, 8, 16 nM doses, the number of germinated organoids in a dose-dependent manner It was confirmed that the number of leaves and leaves was formed (FIG. 5).
이를 통해, Amuc_1409 단백질의 장세포 분화 촉진능이 우수하다는 것을 확인하였다.Through this, it was confirmed that the Amuc_1409 protein has excellent intestinal cell differentiation promoting ability.
실시예 4: 장염 동물모델에서의 Amuc_1409의 효과 검증Example 4: Verification of the effect of Amuc_1409 in an enteritis animal model
상기 실시예 3에서 장 오가노이드의 발아 및 분화를 촉진하는 효과가 우수하다고 확인한 Amuc_1409 단백질의 효과를 장염 동물모델에서 확인하고자 실험을 수행하였다. An experiment was conducted to confirm the effect of the Amuc_1409 protein, which was confirmed to have an excellent effect of promoting germination and differentiation of intestinal organoids in Example 3, in an enteritis animal model.
10주령의 C57BL/6 마우스에 2% DSS를 6일간 음수를 통해 투여하고, 이후 물로 교체하여 회복 기간을 주었다. 대조군에는 PBS 150 ㎕를, 실험군에는 Amuc_1409 단백질을 150 ㎕씩 (1.8 μM/day) DSS를 투여하기 3일 전부터 실험 전기간 동안 경구로 1일 1회 투여하였다.10 weeks old C57BL/6 mice were administered 2% DSS through drinking water for 6 days, and then replaced with water to give a recovery period. 150 µl of PBS was administered to the control group, and 150 µl of Amuc_1409 protein (1.8 µM/day) to the experimental group was administered orally once a day for the entire experimental period from 3 days before DSS administration.
체중 변화를 측정한 결과, Amuc_1409 단백질 투여군의 마우스들이 체중을 빠르게 회복하는 것으로 나타나 Amuc_1409 단백질이 장염 회복 유도를 촉진한다는 것을 확인하였다(도 6). 음수로 교체하고 6일 째에 결장을 채취하여 장의 길이를 직접 측정하여 비교한 결과, Amuc_1409 단백질 투여군의 결장 길이가 대조군 결장 길이에 비해 더 증가되어 있어 장염 회복이 더 잘 되었다는 것을 확인하였다(도 7).As a result of measuring the change in body weight, it was found that the mice of the Amuc_1409 protein-administered group recovered their body weight rapidly, and it was confirmed that the Amuc_1409 protein promotes induction of enteritis recovery (FIG. 6). As a result of comparing with a negative number and collecting the colon on the 6th day and measuring the length of the intestine directly, it was confirmed that the colon length of the Amuc_1409 protein-administered group was increased more than that of the control colony, so that the recovery of enteritis was better (Fig. 7). ).
장염 회복 유도 6일차에 원위 결장부위를 채취하여 줄기세포 관련 유전자들의 발현을 분석한 결과, 대조군에 비해 Amuc_1409 단백질을 투여한 마우스들의 원위결장 줄기세포 관련 유전자들의 발현량이 증가한 것을 확인할 수 있었다(도 8).As a result of analyzing the expression of stem cell-related genes by harvesting the distal colon on the 6th day of induction of enteritis recovery, it was confirmed that the expression level of the distal colonic stem cell-related genes was increased in mice administered with Amuc_1409 protein compared to the control group (Fig. 8). ).
이를 통해 Amuc_1409 단백질이 염증성 장질환으로 인한 증상의 완화 및 치료에 우수한 효과가 있음을 확인하였다.Through this, it was confirmed that the Amuc_1409 protein has an excellent effect in alleviating and treating symptoms caused by inflammatory bowel disease.
실시예 5: Amuc_1409의 용량에 따른 효과 검증Example 5: Verification of the effect according to the dose of Amuc_1409
앞의 실시예에서 염증성 장질환에 우수한 효과를 나타내는 Amuc_1409 단백질의 투여 용량에 따른 염증성 장질환 회복 효과를 확인하였다.In the previous example, the effect of recovering inflammatory bowel disease according to the dosage of Amuc_1409 protein, which has an excellent effect on inflammatory bowel disease, was confirmed.
구체적으로 10주령의 C57BL/6 마우스에 2% DSS를 6일간 음수를 통해 투여하여 염증성 장질환을 유도하였다. 이후 물로 교체하여 회복 기간을 주었으며, 대조군에는 PBS 150 ㎕를, 실험군에는 Amuc_1409 단백질을 150 ㎕씩 (1.8. 3.2 μM/day)을 물로 교체 후 회복기간 동안 경구로 1일 1회 투여하여 체중 변화를 측정하였다(도 9). 또한 음수로 교체하고 3일 째에 결장을 채취하여 길이를 측정하였으며(도 10), 장염 증상 정도를 H&E 염색을 통해 확인하였다(도 11). 또한, 원위 결장부위를 채취하여 줄기세포 관련 유전자들의 발현을 분석하였다(도 12).Specifically, inflammatory bowel disease was induced by administering 2% DSS to 10-week-old C57BL/6 mice through negative water for 6 days. Subsequently, water was replaced to give a recovery period, and 150 µl of PBS and 150 µl of Amuc_1409 protein (1.8. 3.2 µM/day) for the control group were replaced with water and administered once a day during the recovery period. It was measured (Fig. 9). In addition, the length was measured by replacing it with a negative number and collecting the colon on the third day (FIG. 10), and the degree of enteritis symptoms was confirmed through H&E staining (FIG. 11). In addition, the distal colon was collected to analyze the expression of stem cell-related genes (FIG. 12).
실험 결과, DSS 투여 종료 후 물로 음수를 대체하고 회복하는 시기에 Amuc_1409 단백질 투여군의 마우스들이 투여량에 비례하여 체중을 빠르게 회복하는 것으로 나타났다 (도 9). As a result of the experiment, it was found that the mice of the Amuc_1409 protein-administered group quickly recovered their body weight in proportion to the dose at the time of replacing and recovering with water after the end of DSS administration (FIG. 9).
또한, 투여량에 비례하여 Amuc_1409 투여군에서 결장 길이가 회복되는 것을 확인하였으며(도 10) 장염에 의한 조직 손상 회복 역시 활발히 이루어지고(도 11) 원위결장 줄기세포 관련 유전자의 발현량이 증가한 것을 확인하였다(도 12).In addition, it was confirmed that colon length was recovered in the Amuc_1409 administration group in proportion to the dose (FIG. 10), and tissue damage recovery due to enteritis was also actively performed (FIG. 11), and the expression level of distal colon stem cell-related genes increased ( Fig. 12).
이를 통해 본 발명의 Amuc_1409 단백질의 투여가 염증성 장질환 회복을 촉진하고, 염증에 의해 손상된 장 조직을 회복하는 효과가 우수하다는 것을 확인하였는 바, 본 발명의 Amuc_1409 단백질을 염증성 장질환 예방, 개선 및 치료에 유용하게 사용할 수 있음을 알 수 있다.Through this, it was confirmed that the administration of the Amuc_1409 protein of the present invention promotes recovery of inflammatory bowel disease and has an excellent effect of recovering intestinal tissue damaged by inflammation.The Amuc_1409 protein of the present invention is used to prevent, improve and treat inflammatory bowel disease. It can be seen that it can be used usefully.
실시예 6: Amuc_1409의 인간 장 오가노이드에서의 효과 검증Example 6: Verification of the effect of Amuc_1409 in human intestinal organoids
실시예 6-1: 인간 전분화능 줄기세포 유래 인간 장 오가노이드 분화 Example 6-1: Differentiation of human intestinal organoids derived from human pluripotent stem cells
실험에 사용하기 위한 인간 장 오가노이드는 아래와 같이 제작하였다.Human intestinal organoids for use in experiments were prepared as follows.
인간 전분화능 줄기세포를 활용하여 인간 장 오가노이드 분화 시 기보고한 방법(Nature 470, 105-109 (2011))을 통해 분화하였다. Human pluripotent stem cells were used to differentiate human intestinal organoids using a previously reported method (Nature 470, 105-109 (2011)).
구체적으로, 진정내배엽 유도를 위해 3일 간 100 ng/ml의 Activin A와 함께 0%, 0.2%, 2% 농도의 태아 소 혈청이 포함된 배지를 처리하였고, 이후 후장 스페로이드 형성을 위해 500 ng/ml FGF4, 3 μM CHIR 99021, 2% 태아 소 혈청이 포함된 분화배지로 4일간 추가 배양함으로써 분화를 유도하였다. Specifically, for induction of sedation endoderm, a medium containing 0%, 0.2%, and 2% fetal bovine serum was treated with 100 ng/ml of Activin A for 3 days, and then 500 ng for the formation of posterior spheroids. Differentiation was induced by additional culture for 4 days with differentiation medium containing /ml FGF4, 3 μM CHIR 99021, and 2% fetal bovine serum.
형성된 스페로이드는 마트리젤 돔 내부에 삽입되어 3차원 배양 환경에서 1X B27 supplement, 100 ng/ml EGF, 100 ng/ml Noggin, 그리고 500 ng/ml R-spondin1이 포함된 배양배지에서 배양하고 10일에 한 번씩 계대배양하였다.The formed spheroid was inserted into the matrigel dome and cultured in a culture medium containing 1X B27 supplement, 100 ng/ml EGF, 100 ng/ml Noggin, and 500 ng/ml R-spondin1 in a three-dimensional culture environment. It was subcultured once every time.
실시예 6-2:Example 6-2: Amuc_1409 처리에 따른 인간 장 오가노이드의 증식, 발달/성숙 확인Confirmation of proliferation, development/maturity of human intestinal organoids following Amuc_1409 treatment
Amuc_1409 처리에 따른 장 오가노이드 증식, 발달/성숙 과정을 확인하기 위해 3가지 농도의 Amuc_1409를 실시예 6-1에서 제작한 인간 전분화능 줄기세포 유래 인간 장 오가노이드에 처리하여 관찰하였다. In order to confirm the intestinal organoid proliferation and development/maturation process according to Amuc_1409 treatment, three concentrations of Amuc_1409 were treated with human intestinal organoids derived from human pluripotent stem cells prepared in Example 6-1 and observed.
장 오가노이드 배양 시 Amuc_1409는 8nM, 16nM, 32nM의 농도로 첨가하여 사용하였다 (도 13). When culturing intestinal organoids, Amuc_1409 was added at concentrations of 8nM, 16nM, and 32nM and used (FIG. 13).
장 증식 마커(MKI67), 장 줄기세포 마커(LGR5, ASCL2, CD166, LRIG1) 및 성숙 장 특이적 마커(OLFM4) 유전자의 발현을 qRT-PCR을 이용해 비교 분석하였다.Expression of intestinal proliferation marker (MKI67), intestinal stem cell marker (LGR5, ASCL2, CD166, LRIG1) and mature intestinal specific marker (OLFM4) genes were compared and analyzed using qRT-PCR.
장 오가노이드의 전체 RNA는 RNeasy kit (Qiagen)를 활용하여 추출하였고, Superscript IV cDNA synthesis system (Invitrogen)을 활용하여 cDNA 합성하였다. qRT-PCR은 7500 Fast Real-time PCR system (Applied Biosystem)을 통해 수행되었다. Total RNA of intestinal organoids was extracted using the RNeasy kit (Qiagen), and cDNA was synthesized using the Superscript IV cDNA synthesis system (Invitrogen). qRT-PCR was performed through a 7500 Fast Real-time PCR system (Applied Biosystem).
실험에 사용한 프라이머 서열은 하기 표 1과 같다.The primer sequences used in the experiment are shown in Table 1 below.
GeneGene 프라이머 (Forward)Primer (Forward) 서열번호Sequence number 프라이머 (Reverse)Primer (Reverse) 서열번호Sequence number
GAPDHGAPDH
GAAGGTGAAGGTCGGAGTCGAAGGTGAAGGTCGGAGTC 1717 GAAGATGGTGATGGGATTTC GAAGATGGTGATGGGATTTC 1818
MKI67 MKI67 TGACCCTGATGAGAAAGCTCAATGACCCTGATGAGAAAGCTCAA 1919 CCCTGAGCAACACTGTCTTTT CCCTGAGCAACACTGTCTTTT 2020
LGR5LGR5 CCTGCTTGACTTTGAGGAAGACCCCTGCTTGACTTTGAGGAAGACC 2121 CCAGCCATCAAGCAGGTGTTCA CCAGCCATCAAGCAGGTGTTCA 2222
ASCL2 ASCL2 CGTGAAGCTGGTGAACTTGGCGTGAAGCTGGTGAACTTGG 2323 GGATGTACTCCACGGCTGAGGGATGTACTCCACGGCTGAG 2424
CD166 CD166 TCAAGGTGTTCAAGCAACCATCAAGGTGTTCAAGCAACCA 2525 CTGAAATGCAGTCACCCAACCTGAAATGCAGTCACCCAAC 2626
LRIG1LRIG1 GACCCTTTCTGACCGACAAGACCCTTTCTGACCGACAA 2727 CGCTTTCCACGGCTCTTTCGCTTTCCACGGCTCTTT 2828
OLFM4OLFM4 ACCTTTCCCGTGGACAGAGTACCTTTCCCGTGGACAGAGT 2929 TGGACATATTCCCTCACTTTGGA TGGACATATTCCCTCACTTTGGA 3030
또한 면역형광염색법을 통해 단백질 수준에서 증식 마커(Ki-67), 상피 마커(ECAD). 장 줄기세포 마커(ASCL2) 및 장 성숙 마커(OLFM4)의 발현을 확인하였다.In addition, proliferation markers (Ki-67) and epithelial markers (ECAD) at the protein level through immunofluorescence staining. Expression of intestinal stem cell marker (ASCL2) and intestinal maturation marker (OLFM4) was confirmed.
장 오가노이드는 4% Paraformaldehyde(PFA)에 고정 과정을 거친 후 10-30% 수크로오스 용액으로 동결 보호 과정을 거친 뒤 OCT solution을 활용하여 동결하였다. Microtome을 활용하여 10-20 μm 두께로 절개하여 박편을 만든 뒤 0.1% 트리톤 X-100이 포함된 PBS를 처리하여 박편을 투과하였다. 4% Bovine serum albumin을 포함하는 PBS를 1시간 처리하여 블로킹 과정을 거친 후 4℃ 에서 하룻밤동안 1차 항체와 반응시켰다. 이후 2차 항체와 반응시킨 후 DAPI 염색을 통해 핵을 염색한 뒤 형광현미경을 통해 관찰하였다. 사용된 항체는 하기된 표 2와 같다.Intestinal organoids were fixed in 4% Paraformaldehyde (PFA) and then frozen using 10-30% sucrose solution and then frozen using OCT solution. Using a microtome, a 10-20 μm thick incision was made to make a flake, and PBS containing 0.1% Triton X-100 was treated to permeate the flake. PBS containing 4% bovine serum albumin was treated for 1 hour to undergo a blocking process, and then reacted with the primary antibody at 4°C overnight. After reacting with the secondary antibody, the nuclei were stained through DAPI staining and then observed through a fluorescence microscope. The antibodies used are shown in Table 2 below.
항체Antibody Catalog No.Catalog No. 회사company 희석Dilution
Intestine markersIntestine markers
anti-Ki67anti-Ki67 MAB9260MAB9260 MilliporeMillipore 1:1001:100
anti-E-Cadherinanti-E-Cadherin AF648AF648 R&D systemsR&D systems 1:5001:500
anti-ASCL2anti-ASCL2 MAB4418MAB4418 MilliporeMillipore 1:1001:100
anti-OLFM4anti-OLFM4 ab85046ab85046 abcamabcam 1:100 1:100
Anti-ZO-1Anti-ZO-1 61-730061-7300 Thermo ScientificThermo Scientific 1:501:50
qRT-PCR을 이용해 유전자 발현을 확인해본 결과, Amuc_1409 처리 시 대조군 대비 장 증식 마커, 장 줄기세포 마커 및 성숙 장 특이적 마커의 발현이 증가하는 것을 확인하였다(도 14, 도 15). As a result of checking gene expression using qRT-PCR, it was confirmed that the expression of intestinal proliferation markers, intestinal stem cell markers, and mature intestinal-specific markers was increased compared to the control group when Amuc_1409 was treated (FIGS. 14 and 15 ).
면역형광염색법을 통해 단백질 수준에서 증식 마커(Ki-67), 상피 마커(ECAD). 장 줄기세포 마커(ASCL2) 및 장 성숙 마커(OLFM4)의 발현을 확인한 결과. 16nM, 32nM의 Amuc_1409 처리군에서 대조군 대비 마커의 발현이 크게 증가하는 양상을 확인하였다(도 16).Proliferation marker (Ki-67), epithelial marker (ECAD) at the protein level via immunofluorescence staining. Results confirming the expression of intestinal stem cell marker (ASCL2) and intestinal maturation marker (OLFM4). In the 16nM, 32nM Amuc_1409 treatment group, the expression of the marker was significantly increased compared to the control group (FIG. 16).
이를 통해 Amuc_1409가 인간 장 오가노이드의 증식 및 발달/성숙에 효과가 있음을 확인하였다.Through this, it was confirmed that Amuc_1409 is effective in the proliferation and development/maturation of human intestinal organoids.
실시예 6-3: 염증성 질환을 유도한 인간 장 오가노이드 모델에서 Amuc_1409의 효과 확인Example 6-3: Confirmation of the effect of Amuc_1409 in human intestinal organoid model inducing inflammatory disease
염증성 장질환 모델을 모사하기 위하여 인간 장 오가노이드에 전염증성 사이토카인(IFNγ)를 처리한 후 Amuc_1409의 치료 효과를 확인하였다. In order to simulate the inflammatory bowel disease model, human intestinal organoids were treated with proinflammatory cytokines (IFNγ), and then the therapeutic effect of Amuc_1409 was confirmed.
장 질환 모델을 제작하기 위하여, 2계대(P2) 이후 5일간 배양한 장 오가노이드에 전염증성 사이토카인(IFNγ, 200 ng/ml)을 6시간 동안 처리하였다 구체적인 실험 과정은 도 17에 나타내었다. qPCR 및 면역형광염색은 실시예 6-2와 동일한 방법으로 수행하였다.In order to construct a bowel disease model, intestinal organoids cultured for 5 days after passage 2 (P2) were treated with proinflammatory cytokines (IFNγ, 200 ng/ml) for 6 hours. The specific experimental procedure is shown in FIG. 17. qPCR and immunofluorescence staining were performed in the same manner as in Example 6-2.
형태학 및 표면적 분석 결과, Amuc_1409 처리군에서 IFNγ+PBS 그룹에 비해 표면적이 유의적으로 증가하였고, 전염증성 사이토카인 처리 후에도 싹 구조가 유지되고 있음을 확인하였다(도 18 및 도 19).As a result of morphological and surface area analysis, it was confirmed that the surface area was significantly increased in the Amuc_1409 treatment group compared to the IFNγ+PBS group, and that the shoot structure was maintained even after the pro-inflammatory cytokine treatment (FIGS. 18 and 19 ).
또한 면역형광염색법을 통해 장 증식 마커(Ki-67). 장 상피 마커(ECAD), 장 줄기세포 마커(ASCL2) 및 밀착연접 마커(ZO-1)의 단백질 발현을 확인한 결과, IFNγ+PBS 그룹에 대비 Amuc_1409 처리한 장 오가노이드에서는 상기 4가지 마커의 발현이 크게 증가하는 것을 확인하였다(도 20).Also, intestinal proliferation marker (Ki-67) through immunofluorescence staining. As a result of confirming the protein expression of the intestinal epithelial marker (ECAD), the intestinal stem cell marker (ASCL2), and the close junction marker (ZO-1), the expression of the above four markers was observed in the intestinal organoids treated with Amuc_1409 compared to the IFNγ+PBS group. It was confirmed that it increased significantly (FIG. 20).
이를 통해, 본 발명의 Amuc_1409 단백질을 염증성 장질환 예방, 개선 및 치료에 유용하게 사용할 수 있음을 알 수 있다.Through this, it can be seen that the Amuc_1409 protein of the present invention can be usefully used for preventing, improving, and treating inflammatory bowel disease.
실시예 7: Amuc_1409의 기능적 단편 발굴Example 7: Discovery of functional fragments of Amuc_1409
Amuc_1409 단백질의 어떠한 도메인이 염증성 장질환 회복에 주요한 역할을 하는지 확인하기 위해, Amuc_1409 단백질을 4개의 도메인으로 나누어 오가노이드 발아와 분화에 효과가 있는 도메인을 확인하였다.In order to determine which domain of the Amuc_1409 protein plays a major role in the recovery of inflammatory bowel disease, the Amuc_1409 protein was divided into four domains to identify domains that are effective in organoid germination and differentiation.
구체적으로, 도 21에 도시된 바와 같이 Amuc_1409 단백질을 Pep.A(서열번호 5), Pep.B(서열번호 6), Pep.C(서열번호 7), Pep.D(서열번호 8) 4개의 도메인으로 나누었다. Specifically, as shown in Fig. 21, the Amuc_1409 protein was divided into 4 pieces of Pep.A (SEQ ID NO: 5), Pep.B (SEQ ID NO: 6), Pep.C (SEQ ID NO: 7), and Pep.D (SEQ ID NO: 8). Divided into domains.
Pep.A, Pep.B, Pep.C, Pep.D 의 오가노이드 분화에 대한 분석을 위하여 비교 마우스 오가노이드를 배양하며 0, 2, 4일 차에 상기한 Amuc_1409 및 Pep.A, Pep.B, Pep.C, Pep.D를 16 nM로 처리하고, 5일차에 발아된 organoid 개수와 엽 개수별로 organoid 숫자를 확인하여 비교 분석하였다.In order to analyze the differentiation of the organoids of Pep.A, Pep.B, Pep.C, and Pep.D, comparative mouse organoids were cultured. Amuc_1409 and Pep.A, Pep.B described above on Days 0, 2 and 4 were cultured. , Pep.C, Pep.D were treated with 16 nM, and the number of organoids germinated on the 5th day and the number of organoids were checked and analyzed for comparison.
실험 결과, Amuc_1409 단백질을 처리한 군과 Pep.A를 처리한 군에서 발아된 오가노이드 수와 엽의 개수가 유의하게 더 많이 형성되어 있는 것을 확인하였다(도 22).As a result of the experiment, it was confirmed that the number of germinated organoids and the number of leaves were significantly greater in the group treated with Amuc_1409 protein and the group treated with Pep.A (FIG. 22).
이를 통해, Amuc_1409 단백질의 Pep.A 도메인이 장세포 분화 촉진능에 중요한 도메인임을 확인하여, Pep.A 도메인이 Amuc_1409 단백질의 기능적 단편임을 확인하였다.Through this, it was confirmed that the Pep.A domain of the Amuc_1409 protein is an important domain for the ability to promote intestinal cell differentiation, and thus it was confirmed that the Pep.A domain is a functional fragment of the Amuc_1409 protein.
실시예 8: Pep.A 도메인의 기능적 단편 발굴 및 효능 검증Example 8: Pep.A domain functional fragment discovery and efficacy verification
Pep.A 도메인 내의 어느 영역이 염증성 장질환 회복에 가장 주요한 역할을 하는지 확인하기 위해 Pep.A를 3개의 서브도메인으로 세분화하여 그 효능을 검증하였다.In order to identify which regions within the Pep.A domain play the most important role in the recovery of inflammatory bowel disease, Pep.A was subdivided into three subdomains and its efficacy was verified.
구체적으로, 도 23에 도시된 바와 같이 Pep.A를 Pep.A-1(서열번호 9), Pep.A-2(서열번호 10), Pep.A-3(서열번호 11)의 3부분으로 세분화하였다.Specifically, as shown in Fig. 23, Pep.A is divided into three parts: Pep.A-1 (SEQ ID NO: 9), Pep.A-2 (SEQ ID NO: 10), and Pep.A-3 (SEQ ID NO: 11). Subdivided.
다음으로, 세분화한 Pep.A의 서브 도메인 Pep.A-1, Pep.A-2 및 Pep.A-3을 오가노이드를 배양하며 0, 2, 4일 차에 Pep.A (Pep.A full) 및 Pep.A-1, Pep.A-2, Pep.A-3을 16 nM 농도로 처리하고, 5일차에 발아된 organoid 개수와 엽 개수별로 organoid 숫자를 확인하여 비교 분석하였다 (도 24).Next, the sub-domains Pep.A-1, Pep.A-2, and Pep.A-3 of the sub-domains of Pep.A were cultured to incubate organoids, and Pep.A (Pep.A full) on days 0, 2, and 4 ) And Pep.A-1, Pep.A-2, and Pep.A-3 were treated at a concentration of 16 nM, and the number of organoids germinated on the 5th day and the number of organoids by the number of leaves were checked and analyzed for comparison (Fig. .
실험 결과, Pep.A를 처리한 군과 Pep.A-2 를 처리한 군에서 발아된 오가노이드 수와 엽의 개수가 유의하게 더 많이 형성되어 있는 것을 확인할 수 있었다 (도 24). As a result of the experiment, it was confirmed that the number of germinated organoids and the number of leaves were significantly greater in the group treated with Pep.A and the group treated with Pep.A-2 (FIG. 24).
이를 통해, Pep.A-2가 Pep.A 의 기능적 단편임을 확인하였는바, Pep.A-2 및 이를 포함하는 펩타이드를 염증성 장질환 예방 및 치료에 유용하게 사용할 수 있음을 확인하였다.Through this, it was confirmed that Pep.A-2 is a functional fragment of Pep.A, and it was confirmed that Pep.A-2 and a peptide containing the same can be usefully used in the prevention and treatment of inflammatory bowel disease.
실시예 9: Pep.A-2 도메인의 기능적 단편 발굴 및 효능 검증Example 9: Pep.A-2 domain functional fragment discovery and efficacy verification
Pep.A-2 도메인에서 염증성 장질환 회복에 주요한 역할을 하는 최소 단위를 확인하기 위해 도 25에 도시된 바와 같이 9개의 아미노산을 가진 Pep.A-2h 펩타이드(서열번호 12)를 제작하였다.In order to identify the smallest unit that plays a major role in the recovery of inflammatory bowel disease in the Pep.A-2 domain, a Pep.A-2h peptide (SEQ ID NO: 12) having 9 amino acids was prepared as shown in FIG. 25.
다음으로, 오가노이드를 배양하며 0, 2, 4일 차에 Amuc_1409 단백질과 Pep.A-2h를 16 nM 농도로 처리하고, 5일차에 발아된 organoid 개수와 엽 개수별로 organoid 숫자를 확인하여 비교 분석하였다(도 26).Next, the organoids were cultured and treated with Amuc_1409 protein and Pep.A-2h at a concentration of 16 nM on days 0, 2, and 4, and the number of organoids germinated on the 5th day and the number of organoids were checked for comparative analysis. (Fig. 26).
실험 결과, Amuc_1409 단백질과 Pep.A-2h를 처리한 군에서 발아된 오가노이드 수와 엽의 개수가 유의하게 더 많이 형성되어 있는 것을 확인할 수 있었다(도 26).As a result of the experiment, it was confirmed that the number of germinated organoids and the number of leaves were significantly greater in the group treated with Amuc_1409 protein and Pep.A-2h (FIG. 26).
이를 통해, Pep.A-2h가 Pep.A-2 의 기능적 단편임을 확인하였는바, Pep.A-2h 및 이를 포함하는 펩타이드를 염증성 장질환 예방 및 치료에 유용하게 사용할 수 있음을 확인하였다.Through this, it was confirmed that Pep.A-2h is a functional fragment of Pep.A-2, and it was confirmed that Pep.A-2h and a peptide containing the same can be usefully used for preventing and treating inflammatory bowel disease.
실시예 10: Pep.A-2h의 용량에 따른 효과 검증Example 10: Verification of the effect according to the dose of Pep.A-2h
실시예 9로부터 확인한 Pep.A-2h 도메인의 추가적인 효과 검증을 위해, Pep.A-2h를 염증성 장질환 동물 모델에 투여하여 효과를 확인하는 실험을 수행하였다.To verify the additional effect of the Pep.A-2h domain identified from Example 9, an experiment was performed to confirm the effect by administering Pep.A-2h to an inflammatory bowel disease animal model.
구체적으로, 10주령의 C57BL/6 마우스에 2% DSS를 6일간 음수를 통해 투여하고, 이후 물로 교체하여 회복 기간을 주었다. 대조군에는 PBS 150 ㎕를, 실험군에는 Pep.A-2h 를 150 ㎕씩 (1.8, 3.6 μM/day) 을 물로 교체 후 회복기간 동안 경구로 1일 1회 투여하고, DSS 투여 종료 후 물로 음수를 대체하고 회복하는 시기에 체중을 측정하였다(도 27). 또한, 음수로 교체하고 3일째에 결장을 채취하여 장의 길이를 직접 측정하였다(도 28). 아울러, H&E 염색을 통해 장 조직의 손상 회복 정도를 확인하였다(도 29).Specifically, 2% DSS was administered to 10-week-old C57BL/6 mice through drinking water for 6 days, and then replaced with water to give a recovery period. 150 µl of PBS for the control group and 150 µl of Pep.A-2h (1.8, 3.6 μM/day) for the experimental group were replaced with water, and then administered orally once a day during the recovery period, and the drinking water was replaced with water after the end of DSS administration. And the body weight was measured at the time of recovery (FIG. 27). In addition, the length of the intestine was directly measured by replacing it with a negative number and collecting the colon on the third day (FIG. 28). In addition, the degree of damage recovery of intestinal tissues was confirmed through H&E staining (FIG. 29).
실험 결과, DSS 투여 종료 후 물로 음수를 대체하고 회복하는 시기에 Pep.A-2h 투여군의 마우스들이 투여량에 비례하여 체중을 빠르게 회복하는 것으로 나타났다(도 27). As a result of the experiment, it was found that the mice of the Pep.A-2h administration group quickly recovered their body weight in proportion to the dose at the time of replacing and recovering with water after the end of DSS administration (FIG. 27).
또한, 투여한 Pep.A-2h의 투여량에 비례하여 결장 길이가 증가하였으며 (도 28), 장염에 의한 조직 손상 회복 역시 활발히 이루어진 것을 확인하였다(도 29).In addition, it was confirmed that the length of the colon increased in proportion to the dose of the administered Pep.A-2h (FIG. 28), and tissue damage recovery due to enteritis was also actively performed (FIG. 29).
이를 통해, 본 발명의 Pep.A-2h의 투여가 염증성 장질환 회복을 촉진하고, 염증에 의해 손상된 장 조직을 회복하는 효과가 우수하다는 것을 확인하였는 바, 본 발명의 Pep.A-2h를 염증성 장질환 예방, 개선 및 치료에 유용하게 사용할 수 있음을 알 수 있다.Through this, it was confirmed that the administration of Pep.A-2h of the present invention promotes recovery of inflammatory bowel disease and has an excellent effect of recovering intestinal tissue damaged by inflammation. The Pep.A-2h of the present invention is inflammatory. It can be seen that it can be usefully used for preventing, improving and treating intestinal diseases.
이상의 설명으로부터, 본 발명이 속하는 기술분야의 당업자는 본 발명이 그 기술적 사상이나 필수적 특징을 변경하지 않고서 다른 구체적인 형태로 실시될 수 있다는 것을 이해할 수 있을 것이다. 이와 관련하여, 이상에서 기술한 실시예들은 모든 면에서 예시적인 것이며 한정적인 것이 아닌 것으로 이해해야만 한다. 본 발명의 범위는 상기 상세한 설명보다는 후술하는 특허 청구범위의 의미 및 범위 그리고 그 등가 개념으로부터 도출되는 모든 변경 또는 변형된 형태가 본 발명의 범위에 포함되는 것으로 해석되어야 한다.From the above description, those skilled in the art to which the present invention pertains will be able to understand that the present invention can be implemented in other specific forms without changing the technical spirit or essential features thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not limiting. The scope of the present invention should be construed that all changes or modifications derived from the meaning and scope of the claims to be described later rather than the above detailed description, and equivalent concepts thereof, are included in the scope of the present invention.

Claims (15)

  1. 서열번호 12의 아미노산 서열을 포함하는 서열번호 1의 아미노산 서열 중에서 연속하는 9개 내지 150개의 아미노산으로 이루어진, 염증성 장질환 예방 또는 치료용 펩타이드.Peptide for preventing or treating inflammatory bowel disease, consisting of 9 to 150 amino acids consecutive in the amino acid sequence of SEQ ID NO: 1 including the amino acid sequence of SEQ ID NO: 12.
  2. 제1항에 있어서, 상기 펩타이드는 서열번호 12의 아미노산 서열을 포함하는 염증성 장질환 예방 또는 치료용 펩타이드.According to claim 1, wherein the peptide is a peptide for preventing or treating inflammatory bowel disease comprising the amino acid sequence of SEQ ID NO: 12.
  3. 제1항에 있어서, 상기 펩타이드는 서열번호 10의 아미노산 서열을 포함하는, 염증성 장질환 예방 또는 치료용 펩타이드.According to claim 1, wherein the peptide comprises the amino acid sequence of SEQ ID NO: 10, inflammatory bowel disease prevention or treatment peptide.
  4. 제1항에 있어서, 상기 펩타이드는 서열번호 5의 아미노산 서열을 포함하는, 염증성 장질환 예방 또는 치료용 펩타이드.According to claim 1, wherein the peptide comprises the amino acid sequence of SEQ ID NO: 5, inflammatory bowel disease prevention or treatment peptide.
  5. 제1항에 있어서, 상기 펩타이드는 아커만시아 뮤시니필라(Akkermansia mucinipihla) 유래인 것인, 염증성 장질환 예방 또는 치료용 펩타이드.The peptide according to claim 1, wherein the peptide is derived from Akkermansia mucinipihla , for preventing or treating inflammatory bowel disease.
  6. 제1항에 있어서, 상기 펩타이드는 장세포 분화를 촉진하는 것인, 염증성 장질환 예방 또는 치료용 펩타이드.According to claim 1, wherein the peptide is to promote the differentiation of intestinal cells, the peptide for preventing or treating inflammatory bowel disease.
  7. 제1항에 있어서, 상기 펩타이드는 장관 오가노이드 분화를 촉진하는 것인, 염증성 장질환 예방 또는 치료용 펩타이드.According to claim 1, wherein the peptide is to promote the differentiation of intestinal organoids, the peptide for preventing or treating inflammatory bowel disease.
  8. 제1항의 펩타이드를 코딩하는 폴리뉴클레오티드.A polynucleotide encoding the peptide of claim 1.
  9. 제8항의 폴리뉴클레오티드를 포함하는, 재조합 벡터.A recombinant vector comprising the polynucleotide of claim 8.
  10. 제1항 내지 제7항 중 어느 한 항의 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는, 염증성 장질환 예방 또는 치료용 약학적 조성물.A pharmaceutical composition for preventing or treating inflammatory bowel disease, comprising as an active ingredient the peptide of any one of claims 1 to 7, a polynucleotide encoding the peptide, or a recombinant vector comprising the polynucleotide.
  11. 제10항에 있어서, 상기 염증성 장질환은 장염, 궤양성 대장염(ulcerative colitis), 크론병(Chrohn's disease), 장형 베체트병(intestinal Bechet's disease), 출혈성 직장 궤양, 및 회장낭염 중에서 선택되는 어느 하나 이상인 것인, 염증성 장질환 예방 또는 치료용 약학적 조성물.The method of claim 10, wherein the inflammatory bowel disease is any one or more selected from enteritis, ulcerative colitis, Chrohn's disease, intestinal Bechet's disease, hemorrhagic rectal ulcer, and ileal cystitis. That, a pharmaceutical composition for preventing or treating inflammatory bowel disease.
  12. 제1항 내지 제7항 중 어느 한 항의 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는, 장세포 분화 촉진용 조성물.A composition for promoting intestinal cell differentiation, comprising the peptide of any one of claims 1 to 7, a polynucleotide encoding the peptide, or a recombinant vector comprising the polynucleotide as an active ingredient.
  13. 제1항 내지 제7항 중 어느 한 항의 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는, 염증성 장질환 예방 또는 개선용 건강기능식품 조성물.A health functional food composition for preventing or improving inflammatory bowel disease, comprising the peptide of any one of claims 1 to 7, a polynucleotide encoding the peptide, or a recombinant vector comprising the polynucleotide as an active ingredient.
  14. 제1항 내지 제7항 중 어느 한 항의 펩타이드, 상기 펩타이드를 코딩하는 폴리뉴클레오티드 또는 상기 폴리뉴클레오티드를 포함하는 재조합 벡터를 유효성분으로 포함하는, 염증성 장질환 예방 또는 개선용 사료 조성물.A feed composition for preventing or improving inflammatory bowel disease, comprising the peptide of any one of claims 1 to 7, a polynucleotide encoding the peptide, or a recombinant vector comprising the polynucleotide as an active ingredient.
  15. 제1항 내지 제7항 중 어느 한 항의 펩타이드를 개체에 투여하는 단계를 포함하는, 염증성 장질환 치료 방법.A method of treating inflammatory bowel disease, comprising administering the peptide of any one of claims 1 to 7 to an individual.
PCT/KR2020/006041 2019-05-07 2020-05-07 Peptide for preventing or treating inflammatory bowel diseases WO2020226438A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2019-0053101 2019-05-07
KR20190053101 2019-05-07

Publications (1)

Publication Number Publication Date
WO2020226438A1 true WO2020226438A1 (en) 2020-11-12

Family

ID=73051312

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2020/006041 WO2020226438A1 (en) 2019-05-07 2020-05-07 Peptide for preventing or treating inflammatory bowel diseases

Country Status (2)

Country Link
KR (1) KR102263030B1 (en)
WO (1) WO2020226438A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021209590A1 (en) * 2020-04-16 2021-10-21 Amucin Oy Ltd Improved probiotic strains and uses thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20220061018A (en) * 2020-11-05 2022-05-12 한국생명공학연구원 A novel peptide having anti-inflammatory and regenerative effect

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130021920A (en) * 2011-08-24 2013-03-06 포항공과대학교 산학협력단 Composition comprising extracellular vesicles derived from akkermansia muciniphila and bacteroides acidifaciens as an active ingredient for treating or preventing inflammatory disease
US20150246081A1 (en) * 2014-03-03 2015-09-03 Shayne Kenneth Morris Probiotics with methods for growth and use separately and in combination
WO2017060698A1 (en) * 2015-10-05 2017-04-13 Liam O'mahony Use of akkermansia muciniphila for treating inflammatory conditions
US20180250347A1 (en) * 2015-09-10 2018-09-06 Université Catholique de Louvain Use of pasteurized akkermansia for treating metabolic disorders

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20180011130A (en) * 2015-05-06 2018-01-31 바게닝겐 유니버시테이트 Use of polypeptides to effect immune signal transduction and / or to influence intestinal barrier function and / or metabolic status

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20130021920A (en) * 2011-08-24 2013-03-06 포항공과대학교 산학협력단 Composition comprising extracellular vesicles derived from akkermansia muciniphila and bacteroides acidifaciens as an active ingredient for treating or preventing inflammatory disease
US20150246081A1 (en) * 2014-03-03 2015-09-03 Shayne Kenneth Morris Probiotics with methods for growth and use separately and in combination
US20180250347A1 (en) * 2015-09-10 2018-09-06 Université Catholique de Louvain Use of pasteurized akkermansia for treating metabolic disorders
WO2017060698A1 (en) * 2015-10-05 2017-04-13 Liam O'mahony Use of akkermansia muciniphila for treating inflammatory conditions

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DATABASE Protein 12 July 2013 (2013-07-12), "hypothetical protein [Akkermansia muciniphila", XP055760289, retrieved from NCBI Database accession no. WP_012420447.1 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021209590A1 (en) * 2020-04-16 2021-10-21 Amucin Oy Ltd Improved probiotic strains and uses thereof

Also Published As

Publication number Publication date
KR102263030B1 (en) 2021-06-10
KR20200129059A (en) 2020-11-17

Similar Documents

Publication Publication Date Title
AU2020336649B2 (en) Akkermansia muciniphila EB-AMDK19 strainand use thereof
WO2013169077A1 (en) Composition for preventing or treating cachexia
AU2020339348B2 (en) Akkermansia muciniphila EB-AMDK27 strain and use thereof
WO2020226438A1 (en) Peptide for preventing or treating inflammatory bowel diseases
WO2017131402A1 (en) Novel human gut-derived lactic acid bacteria having immune regulatory function, and use thereof
WO2021261632A1 (en) Novel faecalibacterium prausnitzii strain eb-fpdk11 and use thereof
WO2016093599A1 (en) Pharmaceutical composition for prevention or treatment of metabolic disease, comprising bacteroides acidifaciens as effective ingredient
WO2020076136A9 (en) Akkermansia muciniphila strain and use thereof
WO2020262755A1 (en) Novel probiotic composition for regulation of intestinal immunity
WO2021066549A1 (en) Lactobacillus acidophilus kbl409 strain and use thereof
WO2023055188A1 (en) Novel probiotics and use thereof
WO2017034244A1 (en) Peptide having effect of preventing or treating central nervous system diseases and pharmaceutical composition for preventing and treating central nervous system diseases, containing same as active ingredient
WO2013100718A2 (en) Pharmaceutical composition for preventing or treating inflammatory diseases or asthma, containing lagerstroemia ovalifolia extract or fraction thereof as active ingredient
WO2016010340A1 (en) Composition for preventing and treating inflammation or allergic diseases, containing gynura procumbens extract as active ingredient, and use thereof
WO2024048934A1 (en) Novel lactic acid lactiplantibacillus plantarum sko-001 bacterium for reducing body fat, and uses thereofhh
WO2009088264A2 (en) A composition containing arazyme for the prevention and treatment of arthritis
WO2022169283A2 (en) Composition comprising lactobacillus plantarum-derived polysaccharide or extract
WO2021261631A1 (en) Novel picalibacterium prosnich eb-fpdk9 strain and uses thereof
WO2018105998A1 (en) Composition for preventing and treating male infertility, containing flavonoid derivative compound as active ingredient, and use thereof
WO2021033995A1 (en) Composition comprising amomum tsaoko extract for prevention, alleviation, or treatment of sarcopenia-related disease
WO2020106048A1 (en) Pharmaceutical composition for prevention or treatment of neurodegenerative disease
WO2022071753A1 (en) Composition including plgf for prevention or treatment of neuropsychologic disease
WO2019035644A1 (en) Composition containing monoacetyldiacylglycerol compound for prevention or treatment of pseudomonas sp. infection
WO2023113541A1 (en) Pharmaceutical composition for preventing or treating cancer or inflammatory disease
WO2022071752A1 (en) Composition for preventing or treating neuropsychologic disease, comprising manf

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 20802879

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 20802879

Country of ref document: EP

Kind code of ref document: A1