WO2023158061A1 - Method for producing cultured meat that differentiates muscle and fat together, and cultured meat produced thereby - Google Patents

Method for producing cultured meat that differentiates muscle and fat together, and cultured meat produced thereby Download PDF

Info

Publication number
WO2023158061A1
WO2023158061A1 PCT/KR2022/018053 KR2022018053W WO2023158061A1 WO 2023158061 A1 WO2023158061 A1 WO 2023158061A1 KR 2022018053 W KR2022018053 W KR 2022018053W WO 2023158061 A1 WO2023158061 A1 WO 2023158061A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
muscle
stem cells
muscle stem
chicken
Prior art date
Application number
PCT/KR2022/018053
Other languages
French (fr)
Korean (ko)
Inventor
조철훈
김민수
김조현
유민경
정현영
이창규
최광환
이동경
Original Assignee
서울대학교산학협력단
주식회사 스페이스에프
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020220149918A external-priority patent/KR20230125719A/en
Application filed by 서울대학교산학협력단, 주식회사 스페이스에프 filed Critical 서울대학교산학협력단
Publication of WO2023158061A1 publication Critical patent/WO2023158061A1/en

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L13/00—Meat products; Meat meal; Preparation or treatment thereof
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues

Definitions

  • the present invention relates to a method for producing cultured meat and cultured meat produced by the method.
  • skeletal muscle is composed of multinucleated contractile muscle fibers, and the muscle fibers are formed by fusion of mesodermal-derived cells called myoblasts during development. These myoblasts differentiate from muscle stem cells called satellite cells.
  • Proximal satellite cells exist under the basal layer of muscle fibers in a quiescent state (quiescent) in the body. Resting proximal satellite cells are activated by stimuli such as muscle damage and exercise, and are differentiated into myoblasts, myocytes, and myofibrils. When culturing muscles in vitro, proximal satellite cells and myoblasts are also called muscle stem cells.
  • MRFs myogenic regulatory factors
  • muscle stem cells of livestock can be cultured and then differentiated into muscle and fat at the same time, the intramuscular fat of real meat can be directly imitated and a texture similar to that of real meat can be expressed, which can have an important meaning in the cultured meat production process. .
  • the inventors of the present invention studied the medium composition for culturing chicken muscle stem cells from various angles, and as a result, when subculturing chicken muscle stem cells using the medium composition for culturing chicken muscle stem cells of the present invention, long-term in vitro culture Despite this, it was confirmed that the proliferative capacity of muscle stem cells and the ability to differentiate into muscle cells can be maintained, and that they can be simultaneously differentiated into muscle and fat. The invention was completed.
  • Adipose and muscle cell co-culture system A novel in vitro tool to mimic the in vivo cellular environment. Biology 10:6.
  • An object of the present invention is to provide a medium composition for culturing chicken muscle stem cells.
  • An object of the present invention is to provide a method for simultaneously differentiating muscle cells and fat cells from chicken muscle stem cells.
  • an object of the present invention is to provide a method for producing cultured meat that differentiates muscle and fat together, and cultured meat produced thereby.
  • the present invention provides a medium composition for culturing chicken muscle stem cells containing a p38 inhibitor, EGF and dexamethasone.
  • the p38 inhibitor may be SB203580.
  • the content of EGF may be 10 -1 ng/ml to 10 4 ng/ml
  • the content of dexamethasone may be 10 -3 ⁇ M to 100 ⁇ M
  • the content of SB203580 may be 1 ⁇ M to 100 ⁇ M.
  • the present invention provides a chicken muscle stem cell culture method using the culture medium composition for chicken muscle stem cell culture according to an embodiment of the present invention.
  • the present invention provides (S1) subculturing the isolated chicken muscle stem cells using the chicken muscle stem cell culture medium composition according to an embodiment of the present invention; and (S2) culturing in the step (S1). It provides a method for simultaneously differentiating muscle cells and adipocytes from chicken muscle stem cells, including the step of using the differentiated chicken muscle stem cells in a differentiation medium containing horse serum.
  • the present invention provides cultured meat produced by the method for producing cultured meat according to an embodiment of the present invention.
  • the present invention provides a food composition comprising cultured meat according to an embodiment of the present invention.
  • the cultured meat manufacturing method for differentiating muscle and fat together provides cultured meat in which fat is differentiated and accumulated from chicken muscle stem cells. Since intramuscular fat of animal muscles can be implemented, cultured meat similar to actual meat can be produced in the future, and cultured meat production process can be dramatically improved.
  • the medium composition for culturing chicken muscle stem cells of the present invention can maintain the proliferative ability and differentiation ability of chicken muscle stem cells even during long-term in vitro culture, so it can be usefully used for producing cultured meat.
  • Figure 1 shows the results of analyzing the separation performance according to the preplating time when separating chicken muscle stem cells.
  • Pre-plating efficiency Pax7-positive cell ratio of cultured cells after pre-plating - Pax7-positive cell ratio (%) of cells attached to the culture dish during pre-plating.
  • Figure 1b shows the staining results of cultured cells after preplating (green: Pax7-positive cells, blue: cell nuclei).
  • Figure 2 is a result of analyzing the effect of the medium to which the p38 inhibitor was added during the culture of chicken muscle stem cells.
  • Figure 2a is the number of chicken muscle stem cells according to the p38 inhibitor treatment according to the concentration
  • Figure 2b is the p38 inhibitor treatment according to the concentration This is the result of the analysis of the differentiation rate into muscle according to the passage culture.
  • Figure 3 is a result of analyzing the growth rate of chicken muscle stem cells according to the treatment of each concentration of dexamethasone and EGF in a medium containing a p38 inhibitor.
  • 3b is a result of comparing the proliferation rates of chicken muscle stem cells when EGF was treated by concentration in a medium containing a p38 inhibitor.
  • Figure 4 is a result of culturing chicken muscle stem cells in a medium containing a p38 inhibitor, dexamethasone and EGF, and then treating and differentiating the muscle differentiation medium.
  • Figure 4a compares the expression patterns of muscle-specific genes MYH1 and MyoG 4b is the result of immunostaining with MHC antibody, and
  • FIG. 4c is the result of confirming fat accumulation.
  • 5 is a result showing the muscle-related gene expression pattern by culture day of cultured meat through three-dimensional culture of chicken muscle stem cells.
  • Figure 6 is a result showing the fat-related gene expression pattern by culture date of cultured meat through three-dimensional culture of chicken muscle stem cells.
  • Figure 7 is the result of confirming the muscle and fat expression patterns according to the degree of culture of cultured meat through three-dimensional culture of chicken muscle stem cells under a microscope (red color in the result of an optical microscope: neutral fat, red color in the result of a fluorescence microscope) : response to MHC antibodies).
  • the terms “medium”, “culture medium”, “culture medium”, “medium composition”, “culture composition”, “culture medium composition” can support the growth and survival of stem cells in vitro culture conditions. It refers to a culture medium containing nutrients that can be used interchangeably without being distinguished in the present specification.
  • muscle stem cells include progenitor cells such as quiescent satellite cells in a growth-quiescent state and activated satellite cells called myoblasts. Muscle stem cells can differentiate into muscle cells, and in particular, livestock-derived muscle stem cells can be used for actual cultured meat production, etc., and thus are cells with very high utility value in agrobiological terms.
  • cultivation of muscle stem cells means that muscle stem cells proliferate while maintaining the differentiation potential of stem cells.
  • Muscle stem cells exist under the basal layer of muscle fibers and are responsible for the regeneration of muscle tissue. Muscle stem cells have been used in research on muscle physiology and regeneration, and have recently been considered as important candidates for the production of cultured meat of livestock. Since the in vivo growth environment of muscle stem cells is composed of various types of tissues and cells such as muscle fibers, connective tissue, and stromal cells, the process of separating muscle stem cells from muscle tissue proceeds through a series of steps.
  • muscle tissues collected from animals are dissociated from tissues using proteolytic enzymes such as trypsin, pronase, and collagenase.
  • Dissociated single cells are separated from tissue debris and muscle fibers through a sieve.
  • the isolated cell population includes various types of cells such as somatic cells, blood cells, stromal cells and muscle stem cells. Therefore, various classification methods have been developed based on physical, biological, and molecular characteristics of muscle stem cells to obtain highly purified muscle stem cells.
  • the most widely used methods of sorting muscle stem cells are density gradient centrifugation and preplating, which do not require special tools.
  • Density gradient centrifugation is a method for separating cells according to their density. Since muscle stem cells and other somatic cells have different densities, stem cells can be separated from various cells by centrifugation using a solution with a density gradient.
  • the pre-plating method is a method of dividing a cell population using adherent cells, since there is a difference in adhesion ability to an extracellular matrix (ECM) depending on the cell type.
  • ECM extracellular matrix
  • muscle stem cells attached to the bottom of the culture vessel can be minimized.
  • the proliferative ability of muscle stem cells in a medium environment containing 10% FBS gradually decreased according to the culture period (0 ⁇ M in FIG. 2). It is known that the percentage of cells expressing PAX7 (Paired box 7), a factor affecting the self-renewal ability and function of muscle stem cells, rapidly decreased after subculture.
  • PAX7 Paned box 7
  • MYF5 muscle stem cell marker genes
  • the present invention provides a composition for culturing chicken muscle stem cells for maintaining the proliferation and differentiation potential of muscle stem cells isolated from chickens in vitro for a long time.
  • composition for culturing chicken muscle stem cells may include a p38 inhibitor, EGF and dexamethasone.
  • a p38 inhibitor represented by SB203580 is known to induce the self-renewal ability of embryonic stem cells and the proliferative ability of various mesenchymal stem cells, and induce the differentiation of some stem cells, but the proliferation and differentiation ability of livestock muscle stem cells It has not been reported that it affects the maintenance of
  • EGF as an epidermal growth factor, is known to play an important role in the growth and proliferation of fibroblasts in cell culture as well as in epidermal and epithelial tissues in vivo and in vitro. In addition, it is known to induce the differentiation of mesenchymal stem cells.
  • Dexamethasone is a synthetic glucocorticoid, and is known to induce osteogenic, adipogenic, and chondrogenic differentiation in mesenchymal stem cells, and induce differentiation into hepatocytes in embryonic stem cells.
  • SB203580, EGF, and dexamethasone contained in the composition for culturing chicken muscle stem cells according to an embodiment of the present invention are each 1 ⁇ M to 100 ⁇ M, 10 -1 ng / ml to 10 4 ng / ml, 10 -3 ⁇ M to 100 It has a content of ⁇ M. If the content of SB203580 is 1 ⁇ M or less, there is no special effect, and if it is 100 ⁇ M or more, it may have toxicity to cells. When the content of EGF is 10 ⁇ 1 ng/ml or less, there is no special effect, and when the content is 10 4 ng/ml or more, additional effects due to an increase in concentration cannot be expected. If the content of dexamethasone is less than 10 -3 ⁇ M, there is no special effect, and if it is more than 100 ⁇ M, it may have toxicity to cells.
  • SB203580, EGF and dexamethasone included in the composition for culturing livestock muscle stem cells according to one embodiment of the present invention have contents of 20 ⁇ M, 100 ng/ml and 10 ⁇ M, respectively, but are not limited thereto.
  • the basic medium of the medium composition for culturing livestock muscle stem cells containing the p38 inhibitor, EGF and dexamethasone of the present invention may be arbitrarily selected from conventional mediums suitable for culturing stem cells used in the field.
  • culture conditions may also be arbitrarily selected from appropriate conditions used in the field. That is, the medium and culture conditions can be selected according to the type of cells to be cultured.
  • a medium used for culture is a cell culture minimum medium (CCMM), and generally includes a carbon source, a nitrogen source, and trace elements.
  • Cell culture minimal media that can be used in the present invention are DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal essential Medium), BME (Basal Medium Eagle), RPMI1640, F-10, F-12, ⁇ -MEM (alpha-modified Minimum Essential Media), GMEM (Glasgow's Minimal essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), and DMEM/F12, but are not necessarily limited thereto.
  • DMEM/F-12 medium used for cell culture in the industry is used as a basic medium.
  • antibiotics In addition to the medium composition of the present invention, it is preferable to use antibiotics, antifungal agents, and/or substances commonly used in the art to prevent infection with bacteria, fungi, and/or the like, and/or prevent the growth of mycoplasma.
  • antibiotics all antibiotics commonly used for cell culture such as penicillin-streptomycin can be used.
  • Antifungal agents include alporericin B, and mycoplasma inhibitors include gentamicin, ciprofloxacin, and azithromycin. Materials used may be used, but are not limited thereto.
  • a commercially available antibiotic-antimycotic (AA) (Gibco) may be used.
  • FBS may be included in the medium composition of the present invention.
  • the content of FBS included in the medium is 5% to 20%.
  • the composition for culturing livestock muscle stem cells according to one embodiment of the present invention may include 5%, 10%, 15%, or 20% FBS, preferably 10% FBS.
  • % means v/v%.
  • the medium composition of the present invention may include 1% glutamax (or glutamine) and 0.1 mM beta-mercaptoethanol.
  • One embodiment of the present invention provides a chicken muscle stem cell culture method using the culture medium composition for chicken muscle stem cell culture of the present invention.
  • the culturing method may include subculturing the stem cells.
  • the method can maintain the stem cells in an undifferentiated state, and specifically, can maintain the stem cells in an undifferentiated state during or after subculture.
  • stem cell activity can be maintained even after 3 to 10 or more subcultures.
  • the term “passage culture” refers to periodically transferring a part of the cells to a new culture container in order to continuously culture the cells for a long period of time in a healthy state, and then continuously culturing the cells while changing the culture medium. means how to The term “passage” refers to the growth of pluripotent stem cells from the initial seed culture in a culture vessel to the time of vigorous growth (confluence) in the same culture vessel. As the number of cells increases in a culture vessel with a limited space, growth nutrients are consumed or contaminants accumulate and the cells naturally die after a certain period of time, so it is used as a method to increase the number of healthy cells. Replacing the culture vessel) or dividing and culturing the cell population is called 1 passage. Methods of subculturing may use methods known in the art without limitation, but may be preferably performed by mechanical separation or enzymatic separation.
  • One embodiment of the present invention provides a method for producing cultured meat using the method for culturing livestock muscle stem cells of the present invention.
  • the present invention comprises the steps of (S1) culturing the isolated chicken muscle stem cells using a medium composition for culturing chicken muscle stem cells containing a p38 inhibitor, EGF, and dexamethasone; and
  • step (S2) culturing the chicken muscle stem cells cultured in step (S1) using a differentiation medium containing horse serum; to provide.
  • the number of passages in step (S1) is 1 to 30 passages.
  • the number of passages in step (S1) is 1 to 12 passages.
  • the differentiation medium is characterized in that horse serum is included in the medium at 1 to 10% (v / v).
  • the differentiation medium is characterized in that horse serum is included in the medium at 2% (v / v).
  • the present invention provides a method for producing cultured meat using a method of simultaneously differentiating muscle cells and fat cells from chicken muscle stem cells according to an embodiment of the present invention.
  • the method of simultaneously differentiating muscle cells and fat cells from chicken muscle stem cells is a method of simultaneously differentiating muscle cells and fat cells in one culture vessel, based on which the actual meat is produced during cultured meat production.
  • the cultured meat production method of the present invention is a method of producing muscle cells and fat cells from muscle stem cells. This method of simultaneous differentiation in a culture vessel has the advantage of being able to simulate meat with intramuscular fat.
  • the p38 inhibitor alone when included in the culture medium used for subculture of chicken muscle stem cells, they are not differentiated into adipocytes but differentiated only into muscle cells, whereas when all of the p38 inhibitors, EGF and dexamethasone are included, adipocytes and It was confirmed that the muscle cells were simultaneously differentiated.
  • Example 1 Chicken muscle stem cell isolation and culture
  • Fertilized eggs were cultured at 38°C until embryonic day 18, and then euthanized by CO 2 inhalation.
  • Breast muscle tissues of 16 chicken embryos were collected and washed with Dulbecco's phosphatebuffered saline (DPBS; Welgene, Gyeongsan, Korea) containing 2X antibioticantimycotic (AA; Gibco, Gaithersburg, USA).
  • DPBS Dulbecco's phosphatebuffered saline
  • AA 2X antibioticantimycotic
  • Fat, connective tissue, and blood vessels were removed from the muscle tissue.
  • the separated tissue was finely cut with scissors and disassembled using 0.8 mg/mL pronase (Sigma-Aldrich, St. Louis, USA) while vortexing every 10 minutes for 40 minutes at 37°C. .
  • the digested product was filtered through 100 ⁇ m and 40 ⁇ m cell strainers, and centrifuged at 1,200 X g for 3 minutes. The precipitate was resuspended in ⁇ -MEM containing 10% fetal bovine serum (FBS; Gibco).
  • FBS fetal bovine serum
  • cells isolated from muscle tissue have the property that fibroblasts attach first to the gelatin-coated dish and myoblasts attach slowly, so the optimal culture time for isolating myoblasts can be determined using this.
  • the previously isolated precipitate was incubated on a gelatin-coated dish for 0 hour, 0.5 hour, 1 hour, and 2 hours.
  • the supernatant containing the muscle stem cells was centrifuged at 1,200 X g for 3 minutes to harvest a single cell population.
  • the isolated chicken muscle stem cells were cultured in a proliferation medium on a gelatin-coated dish for 3 days by dispensing 4 units of 6 ⁇ 10 per well.
  • the growth medium used at this time was a chicken muscle stem cell basal medium of DMEM/F12 medium containing 10% (v/v) FBS, 1 X GlutaMax, 1 X AA, and 0.1 mM BME (beta-mercaptoethanol).
  • chicken muscle stem cells were treated with 4% (w/v) paraformaldehyde at 4° C. for 30 minutes and fixed. The fixed cells were washed twice with DPBS (Welgene), then treated with 0.2% (v/v) Triton X-100 (Sigma-Aldrich) for 15 minutes and 10% (v/v) goat serum for 1 hour. processed. Then, a primary antibody against chicken Myosin heavy chain (1:1000; MAB4470, R&D Systems) and a primary antibody against Pax7 (1:200; R&D Systems) were added and incubated overnight at 4°C. Then, goat serum and primary antibody were removed, and Alexa Fluor-conjugated secondary antibody was treated overnight at 4°C. Cell nuclei were stained with Hoechst 33342 (Molecular Probes, Eugene, USA).
  • chicken muscle stem cells for each passage were supplemented with 2% (v/v) horse serum (Biowest, Nuaille, France), 1 ⁇ glutamax, 1 ⁇ AA, and 0.1 mM BME.
  • the cells were cultured for 3 days in a muscle cell differentiation medium composed of DMEM, and the culture medium was changed once on the second day. After muscle fibers were formed, mRNA was extracted with Trizol or fixed with 4% paraformaldehyde for further analysis.
  • cell proliferation tended to increase as the concentration of the p38 inhibitor (SB203580) increased, and the maximum number of cells was shown at 20 ⁇ M. This cell proliferation enhancing effect was observed in all 1, 2, 3, and 4 passages regardless of the number of passages.
  • the p38 inhibitor (SB203580) increases the cell proliferation of chicken muscle stem cells, but suppresses the ability to differentiate into muscle cells.
  • dexamethasone and EGF various concentrations of dexamethasone (0 ⁇ M, 0.01 ⁇ M, 0.1 ⁇ M, 1 ⁇ M, 10 ⁇ M, 100 ⁇ M) were added to the chicken muscle stem cell basal culture medium containing 20 ⁇ M of p38 inhibitor (SB203580).
  • medium containing EGF (0 ng/mL, 0.1 ng/mL, 1 ng/mL, 10 ng/mL, 100 ng/mL
  • medium containing both 10 ⁇ M dexamethasone+100 mg/ml EGF
  • a basal medium supplemented with a p38 inhibitor (SB203580) (20 ⁇ M) supplemented with 10 ⁇ m of dexamethasone and 100 ng/mL of EGF was selected as the optimal medium.
  • SB203580 p38 inhibitor
  • MYH1 myosin heavy chain 1
  • MyoG myosin mouse; Myosin G
  • the muscle cell differentiation medium-treated chicken muscle stem cells were treated with 4% (w / v) paraformaldehyde at 4 ° C. for 30 minutes and fixed.
  • the fixed cells were washed twice with DPBS (Welgene), reacted with 60% (v/v) isopropanol for 5 minutes, and then mixed with Oil Red O solution for 10 to 20 minutes. After washing several times, it was observed under a microscope.
  • chicken muscle stem cells proliferated using the p38i medium did not differentiate into adipocytes as well as into muscle cells when treated with the muscle cell differentiation medium.
  • chicken muscle stem cells proliferated using p38i+EGF+Dexa medium were treated with muscle differentiation medium to induce differentiation into muscle, but it was confirmed that fat was accumulated along with muscle cell differentiation (FIG. 4c). ).
  • Example 4 Cultured meat production using three-dimensional culture of chicken muscle stem cells and medium composition
  • a cell-laden hydrogel was prepared according to the procedure below. Collagen, gelatin, fibrin, alginate, matrigel, laminin, GelMA, Poly(ethylene glycol) diacrylate (PEGDA), N-isopropylacrylamide (NIPAAm), acrylic acid, polyacrylamide (PAAm), etc.
  • muscle markers MYH1 myosin heavy chain 1 and MyoG (myosin G)
  • fat markers FASN fatty acid synthase
  • SCD1 stearoyl-CoA desaturase 1
  • PPAR- ⁇ peroxisome proliferator-activated receptor alpha
  • PPAR- ⁇ peroxisome proliferator-activated receptor gamma
  • PGC1- ⁇ peroxisome proliferator-activated receptor-gamma coactivator-1 alpha
  • C/EBP- ⁇ C/EBP- ⁇ (CCAAT/enhancer-binding protein alpha
  • cDNA was synthesized using High-Capacity RNA-to-cDNA Kit (Applied Biosystems, Foster City, USA) .
  • cDNA was amplified using each of the primer sets listed below and the DyNAmo HS SYBR Green qPCR kit (Thermo Fisher Scientific, Waltham, USA). The primers used are listed in Table 2 below.
  • Example 3 Similar to the results of Example 3, which is two-dimensional culture, as the culture date increased in the three-dimensional culture result, muscle markers MYOG and MYH1 of cultured meat increased, and fat markers FASN, SCD1, PPAR- ⁇ , and PPAR - ⁇ , PGC1- ⁇ , and C/EBP- ⁇ were also increased (Figs. 5 and 6).
  • Immunofluorescence staining and fat staining were performed to confirm the degree of muscle differentiation and fat expression rate in the early and late stages of culture.
  • the three-dimensionally cultured muscle stem cells were treated with 4% (w/v) paraformaldehyde at 4° C. for 30 minutes and then fixed.
  • the fixed cells were washed twice with DPBS (Welgene), then treated with 0.2% (v/v) Triton X-100 (Sigma-Aldrich) for 15 minutes and 10% (v/v) goat serum for 1 hour. processed.
  • a primary antibody against chicken Myosin heavy chain (1:1000; MAB4470, R&D Systems) was added and incubated overnight at 4°C.
  • goat serum and primary antibody were removed, and Alexa Fluor-conjugated secondary antibody was treated overnight at 4°C.
  • Cell nuclei were stained with Hoechst 33342 (Molecular Probes, Eugene, USA).
  • Fat staining was performed as follows. Three-dimensionally cultured chicken muscle stem cells were treated with 4% (w/v) paraformaldehyde at 4° C. for 30 minutes and then fixed. The fixed cells were washed twice with DPBS (Welgene), reacted with 60% (v/v) isopropanol for 5 minutes, and then mixed with Oil Red O solution for 10 to 20 minutes. After washing several times, it was observed under a microscope.
  • DPBS Welgene

Landscapes

  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Food Science & Technology (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Polymers & Plastics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Nutrition Science (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to a method for producing cultured meat that differentiates muscle and fat together, and cultured meat produced thereby, and relates to a method for producing cultured meat having a texture similar to real meat. The present invention also provides a medium for culturing chicken muscle stem cells for producing the cultured meat.

Description

근육과 지방을 함께 분화시키는 배양육 제조방법 및 이로 제조된 배양육Method for producing cultured meat that differentiates muscle and fat together and cultured meat produced thereby
본 출원은 2022년 02월 21일자 한국 특허 출원 제10-2022-0022267호 및 2022년 11월 10일자 한국 특허 출원 제10-2022-0149918호에 기초한 우선권의 이익을 주장하며, 해당 한국 특허 출원의 문헌에 개시된 모든 내용은 본 명세서의 일부로서 포함한다.This application claims the benefit of priority based on Korean Patent Application No. 10-2022-0022267 dated February 21, 2022 and Korean Patent Application No. 10-2022-0149918 dated November 10, 2022, and All content disclosed in the literature is incorporated as part of this specification.
본 발명은 배양육 제조방법 및 상기 제조방법으로 제조된 배양육에 관한 발명이다.The present invention relates to a method for producing cultured meat and cultured meat produced by the method.
체내에서 골격근(skeletal muscle)은 다핵의 수축성 근섬유(muscle fiber)로 구성이 되어 있으며, 상기 근섬유는 발달과정에서 근아세포(myoblast)라 불리는 중배엽 기원의 세포의 융합으로 형성된다. 이러한 근아세포는 근위성세포(satellite cells)라 불리는 근육 줄기세포(muscle stem cell)로부터 분화한다.In the body, skeletal muscle is composed of multinucleated contractile muscle fibers, and the muscle fibers are formed by fusion of mesodermal-derived cells called myoblasts during development. These myoblasts differentiate from muscle stem cells called satellite cells.
근위성세포는 체내에서 휴지 상태(quiescent)로 근섬유의 기저층 아래에 존재한다. 휴지 상태의 근위성세포는 근육 손상, 운동 등의 자극에 의해 활성화되면서 근아세포, 근세포, 근섬유로 분화된다. 근육을 체외에서 배양할 때에는 근위성세포와 근아세포를 아울러 근육 줄기세포로 부른다.Proximal satellite cells exist under the basal layer of muscle fibers in a quiescent state (quiescent) in the body. Resting proximal satellite cells are activated by stimuli such as muscle damage and exercise, and are differentiated into myoblasts, myocytes, and myofibrils. When culturing muscles in vitro, proximal satellite cells and myoblasts are also called muscle stem cells.
일반적으로 줄기세포를 체외 배양하기 위해서는 체내와 유사한 세포 주변의 미세환경(microenvironment)을 조성해야 한다. 따라서, 체외에서 근육 줄기세포를 배양할 때 역시 체내 세포 주변의 미세환경에서 분비되는 것으로 알려진 다양한 인자들과 함께 배양해야 한다. 이때 사용되는 인자로서는 기초 섬유아세포 성장인자(bFGF), 인슐린, 인슐린 유사 성장인자, 인터페론 등이 있으며, 이러한 인자들을 활용한 다양한 연구가 진행되었다. 또한, 다른 줄기세포 배양과 마찬가지로 근육 줄기세포도 소태아혈청을 사용하여 체외 배양하는 방법이 사용되고 있다.In general, in order to culture stem cells in vitro, it is necessary to create a microenvironment around the cells similar to that in the body. Therefore, when culturing muscle stem cells in vitro, they should also be cultured with various factors known to be secreted from the microenvironment around cells in the body. Factors used at this time include basic fibroblast growth factor (bFGF), insulin, insulin-like growth factor, interferon, and the like, and various studies using these factors have been conducted. In addition, as in other stem cell cultures, muscle stem cells are also in vitro cultured using fetal bovine serum.
하지만, 근육 줄기세포를 장기간 체외에서 배양할 경우 근원성 조절인자(MRFs:Myogenic regulatory factors)의 발현이 감소하고, 세포의 증식 및 분화능이 점진적으로 감소하는 것으로 확인된다. 또한 지금까지 닭의 근육 줄기세포를 장기간 배양하기 위한 최적의 체외 배양 조건을 확립한 사례는 알려진 바 없다.However, when muscle stem cells are cultured in vitro for a long period of time, it is confirmed that the expression of myogenic regulatory factors (MRFs) decreases and the proliferation and differentiation potential of the cells gradually decrease. In addition, there has been no known case of establishing optimal in vitro culture conditions for long-term culturing of chicken muscle stem cells.
배양육 제조과정에서 가장 큰 문제점은 실제 근내 지방이 같이 존재하는 식육을 그대로 모사할 수 없다는 점이다. 현재까지 알려진 바로는 근육세포와 지방세포를 별도로 배양하여 만든 근육과 지방을 혼합하는 작업이 필요하므로, 근내 지방이 존재하는 식육의 식감을 그대로 모사할 수 없고, 분쇄육 등의 형태로 가공할 수밖에 없다는 문제가 있다.The biggest problem in the process of manufacturing cultured meat is that it is impossible to replicate meat with actual intramuscular fat. As far as is known, it is necessary to mix muscles and fats made by culturing muscle cells and fat cells separately, so the texture of meat with intramuscular fat cannot be copied as it is, and it is inevitable to process it in the form of ground meat. There is a problem with no
따라서, 근육과 지방을 공배양(co-culture)하여 근내 지방이 존재하는 식육을 모사한 배양육을 제조려는 시도가 있었으나, 주로 C2C12와 같은 근육세포주를 지방전구세포와 함께 각 지방 및 근육세포 배양에 필요한 인자들을 함께 넣고 배양하면서 서로 다른 세포간 또는 세포내 상호작용을 연구하는 것이 대부분이었다. 또한, 근육 줄기세포를 지방세포로 교차 분화하는 연구가 시도되긴 했으나, 근육과 지방을 동시에 분화시키는 연구는 지금까지 시도된 바 없다.Therefore, an attempt has been made to produce cultured meat that mimics meat in which intramuscular fat exists by co-culture of muscle and fat, but mainly muscle cell lines such as C2C12 are cultured with pre-adipocytes and each fat and muscle cell. Most of the studies were conducted on the intercellular or intracellular interactions of different cells while incubating the factors necessary for cell growth. In addition, although studies on cross-differentiation of muscle stem cells into fat cells have been attempted, studies on simultaneously differentiating muscle and fat have not been attempted so far.
가축의 근육 줄기세포를 배양한 후 근육과 지방으로 동시에 분화시킬 수 있다면 실제 식육의 근내지방을 직접 모방할 수 있어 실제 식육과 유사한 식감을 표현할 수 있으므로, 배양육 생산 공정에 중요한 의미를 가질 수 있다.If muscle stem cells of livestock can be cultured and then differentiated into muscle and fat at the same time, the intramuscular fat of real meat can be directly imitated and a texture similar to that of real meat can be expressed, which can have an important meaning in the cultured meat production process. .
이러한 배경하에서, 본 발명의 발명자들은 닭 근육 줄기세포 배양용 배지 조성물을 다각도로 연구한 결과, 본 발명의 줄기세포 배양용 배지 조성물을 이용하여 닭 근육 줄기세포를 계대 배양하는 경우, 장기간 체외 배양에도 불구하고 근육 줄기세포의 증식능 및 근세포로의 분화능을 유지할 수 있을 뿐 아니라, 근육과 지방으로 동시에 분화할 수 있음을 확인하였고, 이러한 양상은 3차원 배양을 통한 배양육 생산 과정에도 유지됨을 확인하여 본 발명을 완성하였다.Under this background, the inventors of the present invention studied the medium composition for culturing chicken muscle stem cells from various angles, and as a result, when subculturing chicken muscle stem cells using the medium composition for culturing chicken muscle stem cells of the present invention, long-term in vitro culture Despite this, it was confirmed that the proliferative capacity of muscle stem cells and the ability to differentiate into muscle cells can be maintained, and that they can be simultaneously differentiated into muscle and fat. The invention was completed.
[선행기술문헌][Prior art literature]
[특허문헌][Patent Literature]
미국 등록특허 US 7541183(등록일: 2009.07.02.)US registered patent US 7541183 (registration date: 2009.07.02.)
[비특허문헌][Non-Patent Literature]
Yablonka-Reuveni Z, Paterson BM. 2001. MyoD and myogenin expression patterns in cultures of fetal and adult chicken myoblasts. Journal of Histochemistry & Cytochemistry 49:455-462Yablonka-Reuveni Z, Paterson BM. 2001. MyoD and myogenin expression patterns in cultures of fetal and adult chicken myoblasts. Journal of Histochemistry & Cytochemistry 49:455-462
Kuppusamy P, Kim D, Soundharrajan I, Hwang I, Choi, KC. 2021. Adipose and muscle cell co-culture system: A novel in vitro tool to mimic the in vivo cellular environment. Biology 10:6.Kuppusamy P, Kim D, Soundharrajan I, Hwang I, Choi, KC. 2021. Adipose and muscle cell co-culture system: A novel in vitro tool to mimic the in vivo cellular environment. Biology 10:6.
본 발명은 닭 근육 줄기세포 배양용 배지 조성물을 제공하는 것을 목적으로 한다.An object of the present invention is to provide a medium composition for culturing chicken muscle stem cells.
본 발명은 닭 근육 줄기세포에서 근육세포 및 지방세포를 동시에 분화시키는 방법을 제공하는 것을 목적으로 한다.An object of the present invention is to provide a method for simultaneously differentiating muscle cells and fat cells from chicken muscle stem cells.
또한, 본 발명은 근육과 지방을 함께 분화시키는 배양육 제조방법 및 이로 제조된 배양육을 제공하는 것을 목적으로 한다.In addition, an object of the present invention is to provide a method for producing cultured meat that differentiates muscle and fat together, and cultured meat produced thereby.
상기 목적을 달성하기 위해, 본 발명은 p38 저해제, EGF 및 덱사메타손을 포함하는 닭 근육 줄기세포 배양용 배지 조성물을 제공한다.In order to achieve the above object, the present invention provides a medium composition for culturing chicken muscle stem cells containing a p38 inhibitor, EGF and dexamethasone.
본 발명의 일 구현예에 따라, 상기 p38 저해제는 SB203580일 수 있다.According to one embodiment of the present invention, the p38 inhibitor may be SB203580.
본 발명의 일 구현예에 따라, EGF의 함량은 10-1 ng/ml 내지 104 ng/ml일 수 있고, 상기 덱사메타손의 함량은 10-3 μM 내지 100 μM일 수 있고, 상기 SB203580의 함량은 1 μM 내지 100 μM일 수 있다.According to one embodiment of the present invention, the content of EGF may be 10 -1 ng/ml to 10 4 ng/ml, the content of dexamethasone may be 10 -3 μM to 100 μM, and the content of SB203580 may be 1 μM to 100 μM.
또한, 본 발명은 본 발명의 일 구현예에 따른 닭 근육 줄기세포 배양용 배지 조성물을 이용한 닭 근육 줄기세포 배양 방법을 제공한다.In addition, the present invention provides a chicken muscle stem cell culture method using the culture medium composition for chicken muscle stem cell culture according to an embodiment of the present invention.
또한, 본 발명은 (S1) 본 발명의 일 구현예에 따른 닭 근육 줄기세포 배양용 배지 조성물을 이용하여 분리된 닭 근육 줄기세포를 계대 배양하는 단계;및 (S2) 상기 (S1) 단계에서 배양된 닭 근육 줄기세포를 말 혈청이 포함된 분화 배지를 이용하는 단계;를 포함하는 닭 근육 줄기세포에서 근육세포 및 지방세포를 동시에 분화시키는 방법을 제공한다.In addition, the present invention provides (S1) subculturing the isolated chicken muscle stem cells using the chicken muscle stem cell culture medium composition according to an embodiment of the present invention; and (S2) culturing in the step (S1). It provides a method for simultaneously differentiating muscle cells and adipocytes from chicken muscle stem cells, including the step of using the differentiated chicken muscle stem cells in a differentiation medium containing horse serum.
또한, 본 발명의 일 구현예에 따른 닭 근육 줄기세포에서 근육세포 및 지방세포를 동시에 분화시키는 방법을 이용한 배양육 생산 방법을 제공한다.In addition, a method for producing cultured meat using a method of simultaneously differentiating muscle cells and fat cells from chicken muscle stem cells according to an embodiment of the present invention is provided.
또한, 본 발명은 본 발명의 일구현예에 따른 배양육 생산 방법에 의해 생산된 배양육을 제공한다.In addition, the present invention provides cultured meat produced by the method for producing cultured meat according to an embodiment of the present invention.
또한, 본 발명은 본 발명의 일 구현예에 따른 배양육을 포함하는 식품 조성물을 제공한다.In addition, the present invention provides a food composition comprising cultured meat according to an embodiment of the present invention.
본 발명에 따른 근육과 지방을 함께 분화시키는 배양육 제조방법은 닭 근육 줄기세포로부터 근육과 함께 지방이 분화되어 축적된 배양육을 제공한다. 이는 동물 근육의 근내지방을 구현할 수 있으므로, 향후 실제 식육과 유사한 배양육을 생산할 수 있을 뿐만 아니라, 배양육 생산 과정을 획기적으로 개선할 수 있다.The cultured meat manufacturing method for differentiating muscle and fat together according to the present invention provides cultured meat in which fat is differentiated and accumulated from chicken muscle stem cells. Since intramuscular fat of animal muscles can be implemented, cultured meat similar to actual meat can be produced in the future, and cultured meat production process can be dramatically improved.
또한, 본 발명의 닭 근육 줄기세포 배양용 배지 조성물은 장기간의 체외 배양중에도 닭 근육 줄기세포의 증식능 및 분화능을 유지시킬 수 있으므로, 배양육 생산에 유용하게 이용될 수 있다.In addition, the medium composition for culturing chicken muscle stem cells of the present invention can maintain the proliferative ability and differentiation ability of chicken muscle stem cells even during long-term in vitro culture, so it can be usefully used for producing cultured meat.
도 1은 닭 근육 줄기세포 분리시 프리플레이팅(preplating) 시간에 따른 분리능 분석결과로, 도 1a는 프리플레이팅 중 부착된 세포와 배양된 세포의 Pax7 양성(Pax7+) 세포 비율을 나타낸 것이다(프리플레이팅 효율= 프리플레이팅 후 배양된 세포의 Pax7 양성 세포 비율 - 프리플레이팅 중 배양용기에 부착된 세포의 Pax7 양성 세포 비율(%)). 도 1b는 프리플레이팅 후 배양된 세포의 염색 결과이다(녹색: Pax7 양성 세포, 청색: 세포핵).Figure 1 shows the results of analyzing the separation performance according to the preplating time when separating chicken muscle stem cells. Pre-plating efficiency = Pax7-positive cell ratio of cultured cells after pre-plating - Pax7-positive cell ratio (%) of cells attached to the culture dish during pre-plating. Figure 1b shows the staining results of cultured cells after preplating (green: Pax7-positive cells, blue: cell nuclei).
도 2는 닭 근육 줄기세포 배양시 p38 저해제를 첨가한 배지의 영향을 분석한 결과로, 도 2a는 농도에 따른 p38 저해제 처리에 따른 닭 근육 줄기세포의 숫자이고, 도 2b는 농도별 p38 저해제 처리시 계대배양에 따른 근육으로의 분화율 분석결과이다.Figure 2 is a result of analyzing the effect of the medium to which the p38 inhibitor was added during the culture of chicken muscle stem cells. Figure 2a is the number of chicken muscle stem cells according to the p38 inhibitor treatment according to the concentration, Figure 2b is the p38 inhibitor treatment according to the concentration This is the result of the analysis of the differentiation rate into muscle according to the passage culture.
도 3은 p38 저해제를 포함하는 배지에서 덱사메타손과 EGF 농도별 처리에 따른 닭 근육 줄기세포 증식율을 분석한 결과로, 도 3a는 p38 저해제가 포함된 배지에 덱사메타손을 농도별로 처리했을 때, 닭 근육 줄기세포의 증식율을 비교한 결과이고, 도 3b는 p38 저해제가 포함된 배지에 EGF를 농도별로 처리했을 때, 닭 근육 줄기세포의 증식율을 비교한 결과이다.Figure 3 is a result of analyzing the growth rate of chicken muscle stem cells according to the treatment of each concentration of dexamethasone and EGF in a medium containing a p38 inhibitor. 3b is a result of comparing the proliferation rates of chicken muscle stem cells when EGF was treated by concentration in a medium containing a p38 inhibitor.
도 4는 닭 근육 줄기세포에 p38 저해제, 덱사메타손 및 EGF가 포함된 배지로 배양한 후, 근육 분화용 배지를 처리하여 분화시킨 결과로, 도 4a는 근육 특이적 유전자인 MYH1과 MyoG 발현 양상을 비교한 결과이고, 도 4b는 MHC 항체로 면역 염색한 결과이고, 도 4c는 지방 축적을 확인한 결과이다.Figure 4 is a result of culturing chicken muscle stem cells in a medium containing a p38 inhibitor, dexamethasone and EGF, and then treating and differentiating the muscle differentiation medium. Figure 4a compares the expression patterns of muscle-specific genes MYH1 and MyoG 4b is the result of immunostaining with MHC antibody, and FIG. 4c is the result of confirming fat accumulation.
도 5는 닭 근육 줄기세포의 3차원 배양을 통한 배양육의 배양일자별 근육 관련 유전자 발현 양상을 나타낸 결과이다.5 is a result showing the muscle-related gene expression pattern by culture day of cultured meat through three-dimensional culture of chicken muscle stem cells.
도 6은 닭 근육 줄기세포의 3차원 배양을 통한 배양육의 배양일자별 지방 관련 유전자 발현 양상을 나타낸 결과이다.Figure 6 is a result showing the fat-related gene expression pattern by culture date of cultured meat through three-dimensional culture of chicken muscle stem cells.
도 7은 닭 근육 줄기세포의 3차원 배양을 통한 배양육의 배양정도에 따른 근육 및 지방 발현양상을 현미경으로 확인한 결과이다(광학현미경 결과에서의 붉은 색: 중성지방, 형광현미경 결과에서의 붉은 색: MHC 항체에 대한 반응).Figure 7 is the result of confirming the muscle and fat expression patterns according to the degree of culture of cultured meat through three-dimensional culture of chicken muscle stem cells under a microscope (red color in the result of an optical microscope: neutral fat, red color in the result of a fluorescence microscope) : response to MHC antibodies).
이하, 본 발명을 더욱 상세히 설명한다.Hereinafter, the present invention will be described in more detail.
본 개시내용의 특정의 특성을 기술하고 청구함에 있어서, 다음의 용어는 달리 지정되지 않는 한 이하에 기술된 정의에 따라 사용될 것이다.In describing and claiming particular features of the present disclosure, the following terms will be used in accordance with the definitions set forth below unless otherwise specified.
본 명세서에서 어떤 양태들이 “"~를 포함하는”이란 용어와 함께 기술되더라도, “~로 구성된” 및/또는 “본질적으로 ~로 구성된”의 관점에서 기술된 다른 유사 양태들 또한 제공된다는 것이 이해되어야 한다.It should be understood that although certain aspects herein are described with the term “comprising of”, other similar aspects described in terms of “consisting of” and/or “consisting essentially of are also provided. do.
본 발명에서 용어 “배지”, “배양 배지”, “배양용 배지”, “배지 조성물”, “배양용 조성물”, “배양용 배지 조성물”은 체외 배양 조건에서 줄기세포의 성장 및 생존을 지지할 수 있게 하는 영양물질을 포함하는 배양액을 의미하는 것으로서 본 명세서에서는 구분되지 않고, 혼용하여 사용할 수 있다.In the present invention, the terms "medium", "culture medium", "culture medium", "medium composition", "culture composition", "culture medium composition" can support the growth and survival of stem cells in vitro culture conditions. It refers to a culture medium containing nutrients that can be used interchangeably without being distinguished in the present specification.
본 발명에서 “근육 줄기세포”는 생장 정지 상태의 근위성세포(quiescent satellite cells)와 근아세포(myoblast)라 불리는 활성화된 근위성세포(activated satellite cells)와 같은 전구세포를 포함한다. 근육 줄기세포는 근세포로 분화할 수 있고, 특히 가축 유래 근육 줄기세포는 실제 배양육 생산 등에 사용될 수 있어, 농생물학적으로 효용가치가 매우 높은 세포이다.In the present invention, "muscle stem cells" include progenitor cells such as quiescent satellite cells in a growth-quiescent state and activated satellite cells called myoblasts. Muscle stem cells can differentiate into muscle cells, and in particular, livestock-derived muscle stem cells can be used for actual cultured meat production, etc., and thus are cells with very high utility value in agrobiological terms.
본 발명에서 “근육 줄기세포의 배양”은 근육 줄기세포가 줄기세포능인 분화능을 유지한 채로, 세포증식하는 것을 의미한다.In the present invention, "cultivation of muscle stem cells" means that muscle stem cells proliferate while maintaining the differentiation potential of stem cells.
근육 줄기세포는 근섬유의 기저층 아래에 존재하며 근육 조직의 재생을 담당한다. 근육 줄기세포는 근육생리 및 재생에 관한 연구에 이용되어 왔으며, 최근에는 가축의 배양육 생산을 위한 중요한 후보물질로 간주되고 있다. 근육 줄기세포의 체내 생장 환경은 근육섬유, 결체조직, 기질세포 등 다양한 형태의 조직과 다양한 세포들로 구성되어 있기 때문에 근육조직에서 근육 줄기세포를 분리하는 과정은 일련의 단계를 거쳐 진행된다.Muscle stem cells exist under the basal layer of muscle fibers and are responsible for the regeneration of muscle tissue. Muscle stem cells have been used in research on muscle physiology and regeneration, and have recently been considered as important candidates for the production of cultured meat of livestock. Since the in vivo growth environment of muscle stem cells is composed of various types of tissues and cells such as muscle fibers, connective tissue, and stromal cells, the process of separating muscle stem cells from muscle tissue proceeds through a series of steps.
동물의 근육 줄기세포를 분리하는 과정은, 먼저 동물에서 채취한 근육 조직을 트립신, 프로나제, 콜라게나제와 같은 단백질 분해 효소를 이용하여 조직에서 세포를 해리시킨다. 거름망을 통해 해리된 단일 세포를 조직 파편 및 근섬유로부터 분리한다. 분리된 세포 군집은 체세포, 혈액 세포, 기질 세포 및 근육 줄기세포와 같은 다양한 유형의 세포를 포함한다. 따라서 높은 순도로 정제된 근육 줄기세포를 얻기 위해 근육 줄기세포의 물리적, 생물학적, 분자적 특징을 기반으로 다양한 분류 방법이 개발되었다.In the process of isolating animal muscle stem cells, first, muscle tissues collected from animals are dissociated from tissues using proteolytic enzymes such as trypsin, pronase, and collagenase. Dissociated single cells are separated from tissue debris and muscle fibers through a sieve. The isolated cell population includes various types of cells such as somatic cells, blood cells, stromal cells and muscle stem cells. Therefore, various classification methods have been developed based on physical, biological, and molecular characteristics of muscle stem cells to obtain highly purified muscle stem cells.
근육 줄기세포의 분류 방법 중 가장 널리 사용되는 방법은 특별한 도구가 필요하지 않은 밀도 구배 원심분리법(Density gradient centrifugation)과 프리플레이팅법(preplating; 사전배양법)이다.The most widely used methods of sorting muscle stem cells are density gradient centrifugation and preplating, which do not require special tools.
밀도 구배 원심분리법는 밀도에 따라 세포를 분리하는 방법이다. 근육 줄기세포와 기타 체세포는 밀도가 다르기 때문에 밀도 구배가 있는 용액을 사용하여 원심분리를 통해 다양한 세포들로부터 줄기세포를 분리할 수 있다.Density gradient centrifugation is a method for separating cells according to their density. Since muscle stem cells and other somatic cells have different densities, stem cells can be separated from various cells by centrifugation using a solution with a density gradient.
프리플레이팅법은 부착성 세포의 경우 세포 종류에 따라 세포외기질(extracellular matrix; ECM)에 대한 부착 능력의 차이가 있으므로, 이를 이용하여 세포 집단을 나누는 방법이다. 근육 줄기세포와 섬유아세포는 각각 라미닌과 콜라겐/젤라틴 부착 환경을 선호하기 때문에, 콜라겐/젤라틴 코팅된 배양 플레이트에 근육 조직에서 분리된 세포군을 파종한(plating) 후 40-60분에 상층액을 수확하면 대부분의 섬유아세포와 상피세포는 배양 접시에 부착된 상태로 남아 있고, 근육 줄기세포는 배양 접시에 부착되지 않으므로 줄기세포 집단을 분리할 수 있다.The pre-plating method is a method of dividing a cell population using adherent cells, since there is a difference in adhesion ability to an extracellular matrix (ECM) depending on the cell type. Since muscle stem cells and fibroblasts prefer environments attached to laminin and collagen/gelatin, respectively, cell populations isolated from muscle tissue are plated on collagen/gelatin-coated culture plates, and the supernatant is harvested 40-60 minutes later. When most of the fibroblasts and epithelial cells remain attached to the culture dish, and muscle stem cells do not adhere to the culture dish, stem cell populations can be isolated.
본 발명에서는 닭 근육 줄기세포 분리시 60분 프리플레이팅하는 경우, 배양 용기 바닥에 붙는 근육 줄기세포를 최소화할 수 있다는 것을 확인하였다.In the present invention, it was confirmed that in the case of pre-plating for 60 minutes during isolation of chicken muscle stem cells, muscle stem cells attached to the bottom of the culture vessel can be minimized.
앞서 언급한 바와 같이 근육 줄기세포는 분리하는 과정 자체가 근아세포로의 활성화, 및 근세포와 근섬유로의 분화를 유도하는 과정이므로, 체외에서 근육 줄기세포를 배양하는 것은 다양한 시도에도 불구하고 지금까지 표준화된 방법이 존재하지 않는다.As mentioned above, since the process of isolating muscle stem cells itself is a process that induces activation into myoblasts and differentiation into muscle cells and muscle fibers, culturing muscle stem cells in vitro has been standardized despite various attempts. there is no way to
돼지 근육 줄기세포의 경우, 다양한 배양 배지를 이용한 돼지 근육 줄기세포 배양이 시도되어 왔다. 미확인된 성장인자를 다양하게 포함하는 고농도의 FBS는 체외 배양동안 돼지 근육 줄기세포의 증식능과 근육 분화능의 유지를 돕는다고 알려져 있다. 구체적으로는 고농도의 FBS가 포함된 MEM을 사용하는 것이 다양하게 보고되었고, 상기 MEM 기반 배지는 McCoy의 5A, Ham′s F12, 또는 DMEM/F12 기반 배지에 비해 더 높은 돼지 근육 증식률을 보이는 것으로 알려져 있다.In the case of pig muscle stem cells, culture of pig muscle stem cells using various culture media has been attempted. It is known that high-concentration FBS containing various unidentified growth factors helps maintain the proliferative capacity and muscle differentiation capacity of porcine muscle stem cells during in vitro culture. Specifically, the use of MEM containing high concentration of FBS has been variously reported, and the MEM-based medium is known to show a higher porcine muscle growth rate than McCoy's 5A, Ham's F12, or DMEM/F12-based medium. there is.
닭 근육 줄기세포의 경우, FBS 또는 닭 배아 추출물(Chicken Embryo Extract; CEE)를 포함하는 MEM 배지에서 더 높은 세포 증식능을 확인하였다. FBS와 CEE와 같은 물질에는 다양한 미확인된 성장인자가 포함되어 있으며, 이들은 근육 줄기세포의 증식능의 유지를 돕는 것으로 알려져 있다.In the case of chicken muscle stem cells, higher cell proliferation capacity was confirmed in MEM medium containing FBS or chicken embryo extract (CEE). Substances such as FBS and CEE contain various unidentified growth factors, which are known to help maintain the proliferative capacity of muscle stem cells.
하지만 본 발명에서는 10% FBS가 포함된 배지 환경에서 근육 줄기세포의 증식능은 배양기간에 따라 점차 감소하였다(도면 2의 0μM). 근육 줄기세포의 자가재생능 및 기능에 영향을 주는 인자인 PAX7(Paired box 7)을 발현하는 세포 비율이 계대배양 이후 급격히 감소한 것으로 알려져 있다. 또한 유전자발현 분석 결과에서도 근육 줄기세포 표지유전자(PAX7, MYF5, MYOD)의 발현이 계대배양에 따라 급격히 감소하는 것으로 알려져 있고 본 발명에서도 10% FBS가 포함된 배양용 배지로 계대배양하는 경우 근육 세포로의 분화능이 감소되는 것을 확인할 수 있다.However, in the present invention, the proliferative ability of muscle stem cells in a medium environment containing 10% FBS gradually decreased according to the culture period (0 μM in FIG. 2). It is known that the percentage of cells expressing PAX7 (Paired box 7), a factor affecting the self-renewal ability and function of muscle stem cells, rapidly decreased after subculture. In addition, in the results of gene expression analysis, it is known that the expression of muscle stem cell marker genes (PAX7, MYF5, MYOD) rapidly decreases with subculture, and in the present invention, when subcultured in a culture medium containing 10% FBS, muscle cells It can be confirmed that the differentiation capacity to the .
이에 본 발명은 닭으로부터 분리된 근육 줄기세포의 증식능 및 분화능을 장시간동안 체외에서 유지시키기 위한 닭 근육 줄기세포 배양용 조성물을 제공한다.Accordingly, the present invention provides a composition for culturing chicken muscle stem cells for maintaining the proliferation and differentiation potential of muscle stem cells isolated from chickens in vitro for a long time.
본 발명의 일 구현예에 따른 닭 근육 줄기세포 배양용 조성물은 p38 저해제, EGF 및 덱사메타손을 포함할 수 있다.The composition for culturing chicken muscle stem cells according to one embodiment of the present invention may include a p38 inhibitor, EGF and dexamethasone.
SB203580으로 대표되는 p38 저해제는 배아줄기세포의 자기 재생능(self-renewal) 및 다양한 중간엽 줄기세포의 증식능을 유도하고, 일부 줄기세포의 분화를 유도한다고 알려져 있으나, 가축 근육 줄기세포의 증식능 및 분화능의 유지에 영향을 끼친다는 것은 보고된 바 없다.A p38 inhibitor represented by SB203580 is known to induce the self-renewal ability of embryonic stem cells and the proliferative ability of various mesenchymal stem cells, and induce the differentiation of some stem cells, but the proliferation and differentiation ability of livestock muscle stem cells It has not been reported that it affects the maintenance of
EGF는 상피세포성장인자(Epidermal growth factor)로서 in vivo 및 in vitro에서 표피 및 상피 조직에서뿐만 아니라, 세포 배양시 섬유아세포(fibroblast)의 성장과 증식에 중요한 역할을 한다고 알려져 있다. 또한, 중간엽 줄기세포의 분화를 유도한다고 알려져 있다.EGF, as an epidermal growth factor, is known to play an important role in the growth and proliferation of fibroblasts in cell culture as well as in epidermal and epithelial tissues in vivo and in vitro. In addition, it is known to induce the differentiation of mesenchymal stem cells.
덱사메타손(dexamethasone)은 합성 글루코코르티코이드(glucocorticoid)로서, 중간엽 줄기세포에서 osteogenic, adipogenic, chondrogenic 분화를 유도한다고 알려져 있고, 배아줄기세포에서는 hepatocyte로 분화를 유도한다고 알려져 있다.Dexamethasone is a synthetic glucocorticoid, and is known to induce osteogenic, adipogenic, and chondrogenic differentiation in mesenchymal stem cells, and induce differentiation into hepatocytes in embryonic stem cells.
이와 같이 p38 저해제, EGF 및 덱사메타손이 줄기세포의 성장 및/또는 분화에 영향을 미친다는 것은 보고된 바 있으나, p38 저해제, EGF 및 덱사메타손이 닭 근육 줄기세포의 증식능 및 분화능의 유지에 영향을 끼친다는 것은 보고된 바 없다.As such, it has been reported that p38 inhibitors, EGF and dexamethasone affect the growth and/or differentiation of stem cells. that has not been reported
본 발명의 일 구현예에 따른 p38 저해제를 포함하는 닭 근육 줄기세포 배양용 배지 조성물을 이용하여 닭 근육 줄기세포를 배양하는 경우, p38 저해제를 포함하지 않는 배지 조성물에 비해 농도 의존적으로 세포 증식을 증가시키는 결과를 보였다. 하지만, 상기 증식된 닭 근육 줄기세포는 근육세포로의 분화가 억제되는 현상을 확인할 수 있었다. 특히 이러한 근육 분화 억제 현상은 계대배양 횟수에 따라 증가한다는 것을 확인할 수 있었다.When chicken muscle stem cells are cultured using the medium composition for culturing chicken muscle stem cells containing a p38 inhibitor according to an embodiment of the present invention, cell proliferation is increased in a concentration-dependent manner compared to a medium composition without a p38 inhibitor. showed results. However, it was confirmed that the differentiation of the proliferated chicken muscle stem cells into muscle cells was suppressed. In particular, it was confirmed that this inhibition of muscle differentiation increased with the number of subcultures.
하지만, 이런 근육 분화 억제 현상은 p38 저해제에 EGF 와 덱사메타손을 동시에 처리하는 경우, 계대 배양 횟수를 늘리더라도 근육세포로의 분화능 감소가 거의 관찰되지 않았을 뿐만 아니라, 세포 증식률도 높이는 것을 확인할 수 있었다.However, it was confirmed that this inhibition of muscle differentiation was observed when EGF and dexamethasone were simultaneously treated with a p38 inhibitor, even if the number of subcultures was increased, not only was little reduction in differentiation ability into muscle cells observed, but also the cell proliferation rate was increased.
다만, 덱사메타손을 p38 저해제와 같이 처리하는 경우 이러한 세포 증식 효과는 크게 나타나지 않았다.However, when dexamethasone was treated with a p38 inhibitor, such a cell proliferation effect was not significantly observed.
본 발명의 일 구현예에 따른 닭 근육 줄기세포 배양용 조성물에 포함된 SB203580, EGF, 덱사메타손은 각각 1 μM 내지 100 μM, 10-1 ng/ml 내지 104 ng/ml, 10-3 μM 내지 100 μM의 함량을 가진다. SB203580의 함량이 1 μM 이하인 경우 특별한 효과가 없으며, 100 μM 이상인 경우 세포에 독성을 가질 수 있다. EGF의 함량이 10-1 ng/ml 이하인 경우 특별한 효과가 없으며, 104 ng/ml 이상인 경우 농도 증가에 따른 추가적인 효과를 기대할 수 없다. 덱사메타손의 함량이 10-3 μM 이하인 경우 특별한 효과가 없으며, 100 μM 이상인 경우 세포에 독성을 가질 수 있다.SB203580, EGF, and dexamethasone contained in the composition for culturing chicken muscle stem cells according to an embodiment of the present invention are each 1 μM to 100 μM, 10 -1 ng / ml to 10 4 ng / ml, 10 -3 μM to 100 It has a content of μM. If the content of SB203580 is 1 μM or less, there is no special effect, and if it is 100 μM or more, it may have toxicity to cells. When the content of EGF is 10 −1 ng/ml or less, there is no special effect, and when the content is 10 4 ng/ml or more, additional effects due to an increase in concentration cannot be expected. If the content of dexamethasone is less than 10 -3 μM, there is no special effect, and if it is more than 100 μM, it may have toxicity to cells.
본 발명의 일 구현예에 따른 가축 근육 줄기세포 배양용 조성물에 포함된 SB203580, EGF 및 덱사메타손은 각각 20 μM, 100 ng/ml 및 10 μM의 함량을 가지지만, 이에 제한되지 않는다.SB203580, EGF and dexamethasone included in the composition for culturing livestock muscle stem cells according to one embodiment of the present invention have contents of 20 μM, 100 ng/ml and 10 μM, respectively, but are not limited thereto.
본 발명의 p38 저해제, EGF 및 덱사메타손이 포함된 가축 근육 줄기세포 배양용 배지 조성물의 기본 배지는 줄기세포의 배양에 적절한 해당 분야에서 사용되는 통상의 배지에서 임의로 선택될 수 있다. 또한, 배양 조건 역시 해당 분야에서 사용되는 적절한 조건에서 임의로 선택될 수 있다. 즉 배양하고자 하는 세포의 종류에 따라 배지와 배양 조건을 선택할 수 있다. 배양에 사용되는 배지는 세포 배양 최소 배지(CCMM: cell culture minimum medium)으로서, 일반적으로 탄소원, 질소원, 및 미량원소 성분을 포함한다.The basic medium of the medium composition for culturing livestock muscle stem cells containing the p38 inhibitor, EGF and dexamethasone of the present invention may be arbitrarily selected from conventional mediums suitable for culturing stem cells used in the field. In addition, culture conditions may also be arbitrarily selected from appropriate conditions used in the field. That is, the medium and culture conditions can be selected according to the type of cells to be cultured. A medium used for culture is a cell culture minimum medium (CCMM), and generally includes a carbon source, a nitrogen source, and trace elements.
본 발명에서 사용될 수 있는 세포 배양 최소 배지는 DMEM(Dulbecco′s Modified Eagle′s Medium), MEM(Minimal essential Medium), BME(Basal Medium Eagle), RPMI1640, F-10, F-12, α-MEM(alpha-modified Minimum Essential Media), GMEM(Glasgow′s Minimal essential Medium), IMDM(Iscove′s Modified Dulbecco′s Medium), DMEM/F12 등이 있지만, 반드시 이에 제한되지 않는다. 본 발명에서는 해당 업계에서 세포 배양에 사용되는 DMEM/F-12 배지를 기본 배지로 한다.Cell culture minimal media that can be used in the present invention are DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal essential Medium), BME (Basal Medium Eagle), RPMI1640, F-10, F-12, α-MEM (alpha-modified Minimum Essential Media), GMEM (Glasgow's Minimal essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), and DMEM/F12, but are not necessarily limited thereto. In the present invention, DMEM/F-12 medium used for cell culture in the industry is used as a basic medium.
본 발명의 배지 조성물에는 추가적으로, 박테리아, 곰팡이 등의 감염을 막기 위해 항생제, 항진균제 및/또는 마이코플라스마의 성장을 예방하는 해당 업계에서 일반적으로 사용하는 물질을 사용하는 것이 바람직하다. 항생제로는 페니실린-스트렙토마이신 등 통상적으로 세포배양에 사용되는 항생제를 모두 이용 가능하며, 항진균제로는 알포레리신 B, 마이코플라즈마 억제제로는 젠타마이신, 시프로플로사신, 아지트로마이신 등의 일반적으로 사용하는 물질을 사용할 수 있지만, 이에 제한되지 않는다. 또한, 시판되는 항생제-항진균제(antibiotic-antimycotic; AA)(Gibco)가 사용될 수 있다.In addition to the medium composition of the present invention, it is preferable to use antibiotics, antifungal agents, and/or substances commonly used in the art to prevent infection with bacteria, fungi, and/or the like, and/or prevent the growth of mycoplasma. As antibiotics, all antibiotics commonly used for cell culture such as penicillin-streptomycin can be used. Antifungal agents include alporericin B, and mycoplasma inhibitors include gentamicin, ciprofloxacin, and azithromycin. Materials used may be used, but are not limited thereto. In addition, a commercially available antibiotic-antimycotic (AA) (Gibco) may be used.
또한, 본 발명의 배지 조성물에는 FBS가 포함될 수 있다. 배지에 포함된 FBS의 함량은 5% 내지 20%이다. 본 발명의 일 구현예에 따른 가축 근육 줄기세포 배양용 조성물에는 5%, 10%, 15%, 또는 20%의 FBS를 포함할 수 있고, 바람직하게는 10%의 FBS를 포함한다. 여기서 %는 v/v%를 의미한다.In addition, FBS may be included in the medium composition of the present invention. The content of FBS included in the medium is 5% to 20%. The composition for culturing livestock muscle stem cells according to one embodiment of the present invention may include 5%, 10%, 15%, or 20% FBS, preferably 10% FBS. Here, % means v/v%.
또한, 본 발명의 배지 조성물에는 1% 글루타맥스(또는 글루타민)과 0.1 mM 베타-머캅토에탄올을 포함될 수 있다.In addition, the medium composition of the present invention may include 1% glutamax (or glutamine) and 0.1 mM beta-mercaptoethanol.
본 발명의 일 구현예에서는 본 발명의 닭 근육 줄기세포 배양용 배지 조성물을 이용한 닭 근육 줄기세포 배양 방법을 제공한다.One embodiment of the present invention provides a chicken muscle stem cell culture method using the culture medium composition for chicken muscle stem cell culture of the present invention.
상기 배양 방법은 줄기세포를 계대 배양하는 단계를 포함할 수 있다. 상기 방법은 줄기세포를 미분화 상태로 유지할 수 있으며, 구체적으로는, 계대 배양하는 동안 또는 그 이후에도 줄기세포를 미분화 상태로 유지할 수 있다. 상기 방법은 예를 들어, 3 내지 10 이상 계대 배양 후에도 줄기세포능을 유지할 수 있다.The culturing method may include subculturing the stem cells. The method can maintain the stem cells in an undifferentiated state, and specifically, can maintain the stem cells in an undifferentiated state during or after subculture. In this method, for example, stem cell activity can be maintained even after 3 to 10 or more subcultures.
본 명세서에서 사용되는 용어, “계대 배양”은 세포를 건강한 상태로 지속적으로 장기간 배양하기 위해 주기적으로 세포의 일부를 새로운 배양용기에 옮긴 후 배양배지를 갈아주면서 세포의 대(代)를 계속 이어서 배양하는 방법을 의미한다. 상기 용어, “계대(passage)”는 배양 용기에서 초기 종배양부터 동일한 배양용기에 세포가 왕성하게 자라는 시기(confluence)까지의 다능성 줄기세포로의 성장을 의미한다. 한정된 공간을 가진 배양용기 내에서 세포의 수가 늘어나면서 일정시간이 지나면 증식 영양분이 소비되거나 오염 물질이 쌓여 세포가 자연히 죽게 되므로, 건강한 세포의 수를 늘리기 위한 방법으로 사용되며, 통상적으로 한 차례 배지(배양용기)를 교체하는 것 또는 세포군을 나누어 배양하는 것을 1 계대 (1 passage)라고 한다. 계대 배양의 방법은 당업계에 공지된 방법을 제한 없이 사용할 수 있으나, 바람직하게는 기계적 분리 또는 효소적 분리로 수행될 수 있다.As used herein, the term “passage culture” refers to periodically transferring a part of the cells to a new culture container in order to continuously culture the cells for a long period of time in a healthy state, and then continuously culturing the cells while changing the culture medium. means how to The term "passage" refers to the growth of pluripotent stem cells from the initial seed culture in a culture vessel to the time of vigorous growth (confluence) in the same culture vessel. As the number of cells increases in a culture vessel with a limited space, growth nutrients are consumed or contaminants accumulate and the cells naturally die after a certain period of time, so it is used as a method to increase the number of healthy cells. Replacing the culture vessel) or dividing and culturing the cell population is called 1 passage. Methods of subculturing may use methods known in the art without limitation, but may be preferably performed by mechanical separation or enzymatic separation.
본 발명의 일 구현예에서는 본 발명의 가축 근육 줄기세포 배양 방법을 이용한 배양육 생산 방법을 제공한다.One embodiment of the present invention provides a method for producing cultured meat using the method for culturing livestock muscle stem cells of the present invention.
본 발명은 (S1) 분리된 닭 근육 줄기세포를 p38 저해제, EGF, 덱사메타손을 포함하는 닭 근육 줄기세포 배양용 배지 조성물을 이용하여 배양하는 단계; 및The present invention comprises the steps of (S1) culturing the isolated chicken muscle stem cells using a medium composition for culturing chicken muscle stem cells containing a p38 inhibitor, EGF, and dexamethasone; and
(S2) 상기 (S1) 단계에서 배양된 닭 근육 줄기세포를 말 혈청이 포함된 분화 배지를 이용하여 배양하는 단계;를 포함하는, 닭 근육 줄기세포에서 근육세포 및 지방세포를 동시에 분화시키는 방법을 제공한다.(S2) culturing the chicken muscle stem cells cultured in step (S1) using a differentiation medium containing horse serum; to provide.
본 발명의 일 구현예에서는 상기 (S1) 단계에서 계대 배양 횟수는 1 내지 30 계대인 것을 특징으로 한다.In one embodiment of the present invention, the number of passages in step (S1) is 1 to 30 passages.
본 발명의 일 구현예에서는 상기 (S1) 단계에서 계대 배양 횟수는 1 내지 12 계대인 것을 특징으로 한다.In one embodiment of the present invention, the number of passages in step (S1) is 1 to 12 passages.
본 발명의 일 구현예에서 상기 분화 배지에는 말 혈청이 1~10%(v/v)로 배지에 포함되는 것을 특징으로 한다.In one embodiment of the present invention, the differentiation medium is characterized in that horse serum is included in the medium at 1 to 10% (v / v).
본 발명의 일 구현예에서 상기 분화 배지에는 말 혈청이 2%(v/v)로 배지에 포함되는 것을 특징으로 한다.In one embodiment of the present invention, the differentiation medium is characterized in that horse serum is included in the medium at 2% (v / v).
본 발명은 본 발명의 일 구현예에 따른 닭 근육 줄기세포에서 근육세포 및 지방세포를 동시에 분화시키는 방법을 이용하여 배양육을 생산하는 방법을 제공한다.The present invention provides a method for producing cultured meat using a method of simultaneously differentiating muscle cells and fat cells from chicken muscle stem cells according to an embodiment of the present invention.
본 발명의 일 구현예에 따른 닭 근육 줄기세포에서 근육세포 및 지방세포를 동시에 분화시키는 방법은 하나의 배양용기에서 근육세포와 지방세포를 동시에 분화시키는 방법으로, 이를 기반으로 배양육 제조시 실제 식육의 식감을 모사할 수 있는 특징이 있다. 즉 지금까지는 근육세포와 지방세포를 별도로 분화시켜 제조된 근육 조직과 지방 조직을 분쇄하여 혼합한 형태의 가공육의 형태였다면, 본 발명의 배양육 생산 방법은 근육 줄기세포로부터 근육세포와 지방세포를 하나의 배양용기에서 동시에 분화시키는 방법으로 근내 지방이 존재하는 식육을 모사할 수 있다는 장점이 있다.The method of simultaneously differentiating muscle cells and fat cells from chicken muscle stem cells according to an embodiment of the present invention is a method of simultaneously differentiating muscle cells and fat cells in one culture vessel, based on which the actual meat is produced during cultured meat production. There is a feature that can mimic the texture of. In other words, if the processed meat was in the form of mixing muscle tissue and adipose tissue prepared by separately differentiating muscle cells and fat cells until now, the cultured meat production method of the present invention is a method of producing muscle cells and fat cells from muscle stem cells. This method of simultaneous differentiation in a culture vessel has the advantage of being able to simulate meat with intramuscular fat.
또한, 닭 근육 줄기세포 계대 배양시 사용되는 배양용 배지에 p38 저해제 단독을 포함된 경우에는 지방세포로 분화되지 않고, 근육세포로만 분화되는 반면, p38 저해제, EGF 및 덱사메타손을 모두 포함한 경우 지방세포 및 근육세포가 동시에 분화되는 것을 확인하였다.In addition, when the p38 inhibitor alone is included in the culture medium used for subculture of chicken muscle stem cells, they are not differentiated into adipocytes but differentiated only into muscle cells, whereas when all of the p38 inhibitors, EGF and dexamethasone are included, adipocytes and It was confirmed that the muscle cells were simultaneously differentiated.
달리 나타내지 않는 한, 본 명세서 및 청구범위에 사용된 모든 숫자는, 언급되었든지 아니든지, 모든 경우에 용어 “약”에 의해 수식될 수 있는 것으로 이해되어야 한다. 또한, 본 명세서 및 특허청구범위에 사용된 정밀한 수치는 본 개시내용의 추가적인 실시양태를 형성하는 것으로 이해되어야 한다. 실시예에 개시된 수치의 정확성을 보장하기 위해 노력을 기울였다. 그러나, 측정된 모든 수치는 내재적으로 이의 각각의 측정 기법에서 실측된 표준 편차로부터 생성된 특정 오차값을 함유할 수 있다.Unless otherwise indicated, all numbers used in the specification and claims, whether stated or not, are to be understood in all instances as being modified by the term "about." Also, the precise numerical values used in the specification and claims are to be understood as forming additional embodiments of the present disclosure. Efforts have been made to ensure the accuracy of the figures disclosed in the examples. However, any measured number inherently may contain certain error values resulting from the standard deviation found in its respective measurement technique.
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로, 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다.Hereinafter, the present invention will be described in more detail through examples. These examples are only for explaining the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. .
실시예Example
실시예 1. 닭 근육 줄기세포 분리 및 배양Example 1. Chicken muscle stem cell isolation and culture
모든 동물실험은 서울대학교의 Institutional Animal Care and Use Committee(IACUC)의 승인(승인번호: SNU-210310-6) 후 서울대학교 동물관리실의 표준 규정에 따라 실시하였다.All animal experiments were conducted according to the standard regulations of the Seoul National University Animal Care Office after approval (approval number: SNU-210310-6) of the Institutional Animal Care and Use Committee (IACUC) of Seoul National University.
유정란은 배아 18일차까지 38℃에서 배양한 후 CO2 흡입을 통해 안락사를 시켰다. 16개 닭 배아의 가슴 근육조직을 채취하였으며, 2X antibioticantimycotic(AA; Gibco, Gaithersburg, USA)를 포함하는 Dulbecco′s phosphatebuffered saline(DPBS; Welgene, Gyeongsan, Korea)로 세척하였다. 지방, 결체 조직, 혈관은 근육조직으로부터 제거되었다. 분리된 조직을 가위로 잘게 잘라준 다음 0.8 mg/mL 프로나제(pronase)(Sigma-Aldrich, St. Louis, USA)를 사용하여 37℃에서 40분 동안 10분마다 볼텍싱(vortexing)하면서 분해하였다. 분해된 결과물을 100 μm와 40 μm 세포여과기(cell strainer)로 여과하였으며, 이를 3분 동안 1,200 X g에서 원심분리하였다. 침전물은 10% 소태아혈청(FBS; Gibco)을 함유하는 α-MEM에 재현탁시켰다.Fertilized eggs were cultured at 38°C until embryonic day 18, and then euthanized by CO 2 inhalation. Breast muscle tissues of 16 chicken embryos were collected and washed with Dulbecco's phosphatebuffered saline (DPBS; Welgene, Gyeongsan, Korea) containing 2X antibioticantimycotic (AA; Gibco, Gaithersburg, USA). Fat, connective tissue, and blood vessels were removed from the muscle tissue. The separated tissue was finely cut with scissors and disassembled using 0.8 mg/mL pronase (Sigma-Aldrich, St. Louis, USA) while vortexing every 10 minutes for 40 minutes at 37°C. . The digested product was filtered through 100 μm and 40 μm cell strainers, and centrifuged at 1,200 X g for 3 minutes. The precipitate was resuspended in α-MEM containing 10% fetal bovine serum (FBS; Gibco).
통상 근육조직으로부터 분리된 세포는 섬유아세포(fibroblast)가 젤라틴 코팅 접시에 먼저 부착되고, 근아세포(myoblast)가 천천히 부착되는 성질을 가지고 있으므로, 이를 이용하여 근아세포를 분리하기 위한 최적의 배양 시간을 분석하기 위해 앞서 분리한 침전물을 0시간, 0.5시간, 1시간, 2시간 동안 젤라틴 코팅 접시에 배양하였다.In general, cells isolated from muscle tissue have the property that fibroblasts attach first to the gelatin-coated dish and myoblasts attach slowly, so the optimal culture time for isolating myoblasts can be determined using this. For analysis, the previously isolated precipitate was incubated on a gelatin-coated dish for 0 hour, 0.5 hour, 1 hour, and 2 hours.
배양 이후, 근육 줄기세포를 포함하고 있는 상층액을 3분 동안 1,200 X g에서 원심분리하여 단일 세포군을 수확하였다. 분리된 닭 근육 줄기세포는 1 well당 6Х104 개를 분주하여 젤라틴 코팅 접시에 증식배지로 3일간 배양시켰다.After culturing, the supernatant containing the muscle stem cells was centrifuged at 1,200 X g for 3 minutes to harvest a single cell population. The isolated chicken muscle stem cells were cultured in a proliferation medium on a gelatin-coated dish for 3 days by dispensing 4 units of 6Х10 per well.
이때 사용한 증식 배지는 10%(v/v) FBS, 1 X GlutaMax, 1 X AA 및 0.1 mM BME(베타-머캅토에탄올)을 포함하는 DMEM/F12 배지의 닭 근육 줄기세포 기본 배지를 사용하였다.The growth medium used at this time was a chicken muscle stem cell basal medium of DMEM/F12 medium containing 10% (v/v) FBS, 1 X GlutaMax, 1 X AA, and 0.1 mM BME (beta-mercaptoethanol).
세포 염색을 위해 닭 근육 줄기세포는 4%(w/v) 파라포름알데하이드로 4℃에서 30분간 처리하여 고정하였다. 고정된 세포는 DPBS(Welgene)로 두 번 세척한 후, 0.2 %(v/v) Triton X-100 (Sigma-Aldrich)을 15분 동안 처리하고 10%(v/v) 염소 혈청을 1시간동안 처리하였다. 이후 닭 Myosin heavy chain에 대한 1차 항체(1:1000; MAB4470, R&D Systems)와 Pax7에 대한 1차 항체(1:200; R&D Systems)를 추가하여 4℃에서 하룻밤 배양하였다. 이후 염소 혈청 및 1차 항체를 제거하고, Alexa Fluor-접합 2차 항체를 4℃에서 하룻밤 처리하였다. 세포핵은 Hoechst 33342(Molecular Probes, Eugene, USA)로 염색하였다.For cell staining, chicken muscle stem cells were treated with 4% (w/v) paraformaldehyde at 4° C. for 30 minutes and fixed. The fixed cells were washed twice with DPBS (Welgene), then treated with 0.2% (v/v) Triton X-100 (Sigma-Aldrich) for 15 minutes and 10% (v/v) goat serum for 1 hour. processed. Then, a primary antibody against chicken Myosin heavy chain (1:1000; MAB4470, R&D Systems) and a primary antibody against Pax7 (1:200; R&D Systems) were added and incubated overnight at 4°C. Then, goat serum and primary antibody were removed, and Alexa Fluor-conjugated secondary antibody was treated overnight at 4°C. Cell nuclei were stained with Hoechst 33342 (Molecular Probes, Eugene, USA).
프리플레이팅(사전배양)을 다양한 시간 동안 진행한 결과 진행시간에 따라 근육 줄기세포를 나타내는 Pax7+ 세포비율이 늘어남을 확인하였다(도 1a, 1b). 하지만, 프리플레이팅을 오래 할수록 근육 줄기세포 또한 바닥에 높은 비율로 붙는 것을 확인하였고, 이에 따라 세포 수율이 갈수록 낮아지므로 60분의 프리플레이팅이 적합할 것으로 판단하였다.As a result of pre-plating (pre-culture) for various times, it was confirmed that the percentage of Pax7 + cells representing muscle stem cells increased according to the progress time (FIGS. 1a and 1b). However, it was confirmed that the longer the pre-plating, the higher the rate of muscle stem cells attached to the bottom, and accordingly, the lower the cell yield, so it was judged that 60 minutes of pre-plating would be appropriate.
실시예 2. 닭 근육 줄기세포 배지의 최적화Example 2. Optimization of chicken muscle stem cell medium
실시예 2.1. P38 저해제 농도의 최적화Example 2.1. Optimization of P38 inhibitor concentration
닭 근육 줄기세포 배지에 있어서, P38 저해제의 최적의 농도를 찾기 위해 p38 저해제인 SB203580을 0 μM, 1 μM, 10 μM, 20 μM를 포함하는 닭 근육 줄기세포 기본배지로 1계대, 2계대, 3계대 및 4계대에서의 세포 수 및 근육세포로의 분화 정도를 분석하였다.In the chicken muscle stem cell medium, in order to find the optimal concentration of the p38 inhibitor, SB203580, a p38 inhibitor, was added to the chicken muscle stem cell basal medium containing 0 μM, 1 μM, 10 μM, and 20 μM for passages 1, 2, and 3. The number of cells and the degree of differentiation into muscle cells were analyzed at passages 4 and 4.
계대수에 따른 근육세포로의 분화능 분석을 위해서 각 계대별 닭 근육 줄기세포를 2%(v/v) 말혈청(Biowest, Nuaille, France), 1 Х glutamax, 1 Х AA 및 0.1 mM BME을 포함하는 DMEM으로 구성된 근육세포 분화 배지에서 3일간 배양하며 2일차에 배양액을 한번 갈아주었다. 근섬유가 형성된 후 추가 분석을 위하여 Trizol로 mRNA를 추출하거나 4% 파라포름알데히드로 고정하였다.For analysis of differentiation potential into muscle cells according to the number of passages, chicken muscle stem cells for each passage were supplemented with 2% (v/v) horse serum (Biowest, Nuaille, France), 1 Х glutamax, 1 Х AA, and 0.1 mM BME. The cells were cultured for 3 days in a muscle cell differentiation medium composed of DMEM, and the culture medium was changed once on the second day. After muscle fibers were formed, mRNA was extracted with Trizol or fixed with 4% paraformaldehyde for further analysis.
그 결과 도 2에서와 같이 p38 저해제(SB203580)의 농도가 높아질수록 세포 증식이 증가하는 경향을 보였고, 20 μM에서 최대의 세포 수를 보였다. 이와 같은 세포 증식 증진 효과는 계대수와는 무관하게 1, 2, 3, 4계대에서 모두 관찰되었다.As a result, as shown in FIG. 2, cell proliferation tended to increase as the concentration of the p38 inhibitor (SB203580) increased, and the maximum number of cells was shown at 20 μM. This cell proliferation enhancing effect was observed in all 1, 2, 3, and 4 passages regardless of the number of passages.
하지만, 계대 배양된 닭 근육 줄기세포에서 근육세포로의 분화능은 알려진 바와 같이 계대가 증가할수록 현저하게 감소되는 경향을 보였으며, 오히려 p38 저해제(SB203580)를 처리했을 때 근육세포로의 분화능은 오히려 더 감소하는 것을 확인하였다.However, as known, the differentiation capacity of subcultured chicken muscle stem cells into muscle cells tended to decrease markedly as the passage increased, and rather, when treated with a p38 inhibitor (SB203580), the differentiation capacity into muscle cells increased. confirmed to decrease.
따라서, 닭 근육 줄기세포의 배양에 있어서, p38 저해제(SB203580)는 닭 근육 줄기세포의 세포 증식은 증가시키지만, 근육세포로의 분화능은 억제하는 것을 알 수 있다.Therefore, in the culture of chicken muscle stem cells, it can be seen that the p38 inhibitor (SB203580) increases the cell proliferation of chicken muscle stem cells, but suppresses the ability to differentiate into muscle cells.
실시예 2.2 덱사메타손 및 EGF 농도의 최적화Example 2.2 Optimization of Dexamethasone and EGF Concentrations
앞서, p38 저해제(SB203580)를 농도별로 첨가한 닭 근육 줄기세포 기본 배지로 증식한 닭 근육 줄기세포를 근육세포로 분화할 경우 계대배양 횟수에 따라 분화율이 감소함을 확인하였으므로, EGF와 덱사메타손을 처리하여 분화율 감소 문제를 해결하고자 하였다.Previously, it was confirmed that the differentiation rate decreased according to the number of subcultures when the chicken muscle stem cells proliferated in the chicken muscle stem cell basal medium supplemented with the p38 inhibitor (SB203580) by concentration were differentiated into muscle cells, so EGF and dexamethasone treatment to solve the problem of reduced differentiation rate.
덱사메타손 및 EGF의 농도를 최적화하기 위해 20 μM의 p38 저해제(SB203580)가 포함된 닭 근육 줄기세포 기본 배양액에 다양한 농도의 덱사메타손(0 μM, 0.01 μM, 0.1 μM, 1 μM, 10 μM, 100 μM), EGF(0 ng/mL, 0.1 ng/mL, 1 ng/mL, 10 ng/mL, 100 ng/mL)을 포함한 배지, 또는 둘을 모두 포한하는 배지(10 μM 덱사메타손+100 mg/ml EGF)로 1일, 2일, 3일 배양 후 세포 수를 측정하였다. 그 결과 p38 저해제(SB203580)가 첨가된 닭 근육 줄기세포 기본 배지에 덱사메타손을 농도별로 처리하는 경우 세포 증식율에 영향이 없었다(도 3a), 하지만, p38 저해제(SB203580)가 첨가된 닭 근육 줄기세포 기본 배지에 EGF를 농도별로 처리한 경우 농도에 따라 세포 증식율이 증가하는 경향을 보였다(도 3b).To optimize the concentration of dexamethasone and EGF, various concentrations of dexamethasone (0 μM, 0.01 μM, 0.1 μM, 1 μM, 10 μM, 100 μM) were added to the chicken muscle stem cell basal culture medium containing 20 μM of p38 inhibitor (SB203580). , medium containing EGF (0 ng/mL, 0.1 ng/mL, 1 ng/mL, 10 ng/mL, 100 ng/mL), or medium containing both (10 μM dexamethasone+100 mg/ml EGF) After culturing for 1, 2, and 3 days, the number of cells was measured. As a result, when dexamethasone was treated by concentration in the chicken muscle stem cell basal medium to which the p38 inhibitor (SB203580) was added, there was no effect on the cell proliferation rate (FIG. 3a). When the medium was treated with EGF at each concentration, the cell proliferation rate tended to increase according to the concentration (FIG. 3b).
이를 활용하여 덱사메타손 10 μm와 EGF 100 ng/mL을 첨가한 p38 저해제(SB203580) (20 μM) 첨가 기본 배지를 최적 배지로 선정하였다. 최적 배지의 경우 덱사메타손과 EGF 단독 처리에 비하여 시너지 효과가 있음을 확인하였다(도 3a, b).Using this, a basal medium supplemented with a p38 inhibitor (SB203580) (20 µM) supplemented with 10 µm of dexamethasone and 100 ng/mL of EGF was selected as the optimal medium. In the case of the optimal medium, it was confirmed that there is a synergistic effect compared to the treatment of dexamethasone and EGF alone (Fig. 3a, b).
실시예 3. 최적화된 배지로 배양된 닭 근육 줄기세포의 분화능 분석Example 3. Analysis of differentiation potential of chicken muscle stem cells cultured in optimized medium
각 계대별 닭 근육 줄기세포의 근육 분화능을 분석하기 위해 닭 근육 줄기세포 배양용 기본 배지에 20 μM p38 저해제(SB203580)가 포함된 배지(p38i) 및 20 μM p38 저해제, 20 ng/ml EGF, 및 10 μM 덱사메타손이 포함된 배지(p38i+EGF+Dexa)를 이용하여 닭 근육 줄기세포를 배양한 후, 각 계대의 닭 근육 줄기세포에 근육세포 분화배지를 처리하여 근육으로 분화시켰을 때의 분화능을 분석하였다. 근육세포로의 분화 정도는 근육 표지 유전자인 MYH1(미오신 중쇄 1; myosin heavy chain 1) 및 MyoG(미오신 쥐; Myosin G) 유전자의 상대적인 발현율을 RT-PCR로 분석하였다.In order to analyze the muscle differentiation potential of chicken muscle stem cells for each passage, a medium (p38i) containing 20 μM p38 inhibitor (SB203580) and 20 μM p38 inhibitor, 20 ng/ml EGF, and After culturing chicken muscle stem cells using a medium (p38i + EGF + Dexa) containing 10 μM dexamethasone, analyzing the differentiation ability when differentiated into muscle by treating chicken muscle stem cells of each passage with a muscle cell differentiation medium did The degree of differentiation into muscle cells was analyzed by RT-PCR for the relative expression rates of muscle marker genes MYH1 (myosin heavy chain 1) and MyoG (myosin mouse; Myosin G) genes.
구체적으로는 닭 근육 줄기세포에서 TRIzol(Invitrogen, Carlsbad, USA)을 사용하여 Total RNA를 추출한 후, High-Capacity RNA-to-cDNA Kit(Applied Biosystems, Foster City, USA)를 사용하여 cDNA를 합성했다. cDNA는 아래 나열된 각 프라이머 세트와 DyNAmo HS SYBR Green qPCR 키트 (Thermo Fisher Scientific, Waltham, USA)를 사용하여 증폭하였다. 사용된 프라이머는 아래 표 1에 기재하였다.Specifically, total RNA was extracted from chicken muscle stem cells using TRIzol (Invitrogen, Carlsbad, USA), and cDNA was synthesized using High-Capacity RNA-to-cDNA Kit (Applied Biosystems, Foster City, USA) . cDNA was amplified using each of the primer sets listed below and the DyNAmo HS SYBR Green qPCR kit (Thermo Fisher Scientific, Waltham, USA). The primers used are listed in Table 1 below.
GeneGene Primer sequence (5′→ 3′)Primer sequence (5′→ 3′) Product size (bp)Product size (bp) Accession No.Accession no.
MYOGMYOG ForwardForward ATGGGGAAAACTTCCTGGGCATGGGGAAAACTTCCTGGGC 109109 NM_204184.1NM_204184.1
ReverseReverse TTCTCCTCCAAAGCCCCTCTTTCTCCTCCAAAGCCCCTCT
MYH1MYH1 ForwardForward TCCGCAAGATCCAACACGAATCCGCAAGATCCAACACGAA 150150 NM_001013397.2NM_001013397.2
ReverseReverse ATGCCACTTTGTTGTCACGAATGCCACTTTGTTGTCACGA
GAPDHGAPDH ForwardForward CGTCCTCTCTGGCAAAGTCCCGTCCTCTCTGGCAAAGTCC 132132 NM_204305.1NM_204305.1
앞서 확인한 바와 같이 p38i 배지를 이용하여 닭 근육 줄기세포를 배양하는 경우, 앞서 도 2b에서 확인한 바와 같이 2계대부터 근육으로 거의 분화되지 않았다. 하지만, 세 가지 성분이 모두 포함된 배지(p38i+EGF+Dexa)를 이용하여 닭 근육 줄기세포를 배양하여 분화시킨 경우 9계대 근육 줄기세포의 분화에서도 안정적으로 근육세포 마커인 MYH1, MyoG를 발현하는 양상을 보였다(도 4a).As confirmed above, when the chicken muscle stem cells were cultured using the p38i medium, they were hardly differentiated into muscle from the second passage, as shown in FIG. 2B. However, when chicken muscle stem cells were cultured and differentiated using a medium containing all three components (p38i+EGF+Dexa), they stably expressed muscle cell markers MYH1 and MyoG even in the differentiation of 9th-generation muscle stem cells. pattern was observed (Fig. 4a).
또한, MHC 세포 염색 결과에서도 p38i 배지를 이용하여 닭 근육 줄기세포를 배양한 경우 비교적 초기 계대(4계대)에서도 근육으로의 분화능을 거의 잃어버린 반면, p38i+EGF+Dexa 배지를 이용한 경우 고계대(12계대)에서도 특징적인 근육세포의 모양을 보이는 것을 확인하였다(도 4b).In addition, in the results of MHC cell staining, when chicken muscle stem cells were cultured using p38i medium, they almost lost their ability to differentiate into muscle even in relatively early passages (4th passage), whereas when using p38i+EGF+Dexa medium, high passages (12 Passage) was also confirmed to show the characteristic muscle cell shape (Fig. 4b).
또한, 상기 근육세포가 지방세포로 분화했는지 여부를 확인하기 위해, 근육세포 분화배지 처리한 닭 근육 줄기 세포는 4%(w/v) 파라포름알데하이드로 4℃에서 30 분간 처리하여 고정하였다. 고정된 세포는 DPBS(Welgene)로 두 번 세척한 후, 60%(v/v) isopropanol을 5분간 반응시킨 후 오일 레드 오(Oil Red O) 용액을 넣어 10 내지 20분간 섞어주면서 반응시켰다. 이후 수차례 세척한 후 현미경으로 관찰하였다.In addition, in order to determine whether the muscle cells differentiated into adipocytes, the muscle cell differentiation medium-treated chicken muscle stem cells were treated with 4% (w / v) paraformaldehyde at 4 ° C. for 30 minutes and fixed. The fixed cells were washed twice with DPBS (Welgene), reacted with 60% (v/v) isopropanol for 5 minutes, and then mixed with Oil Red O solution for 10 to 20 minutes. After washing several times, it was observed under a microscope.
관찰 결과, p38i 배지를 이용하여 증식된 닭 근육 줄기세포는 근육세포 분화 배지를 처리하였을 때 근육세포로 분화되지 않은 것과 마찬가지로 지방세포로도 분화하지 않았다. 하지만, p38i+EGF+Dexa 배지를 이용하여 증식된 닭 근육 줄기세포는 근육 분화 배지를 처리하여 근육으로 분화를 유도했음에도 불구하고, 근육세포의 분화와 함께 지방이 축적되는 현상을 확인하였다(도 4c).As a result of observation, chicken muscle stem cells proliferated using the p38i medium did not differentiate into adipocytes as well as into muscle cells when treated with the muscle cell differentiation medium. However, chicken muscle stem cells proliferated using p38i+EGF+Dexa medium were treated with muscle differentiation medium to induce differentiation into muscle, but it was confirmed that fat was accumulated along with muscle cell differentiation (FIG. 4c). ).
따라서, 이와 같은 결과를 활용하여 근육과 지방을 동시에 포함하는 닭 배양육 생산이 가능할 것으로 보인다.Therefore, it seems possible to produce chicken cultured meat containing muscle and fat at the same time using these results.
실시예 4. 닭 근육 줄기세포의 3차원 배양과 배지 조성을 활용한 배양육 생산Example 4. Cultured meat production using three-dimensional culture of chicken muscle stem cells and medium composition
닭 근육 줄기세포 배양용 기본 배지에 20 μM p38 저해제(SB203580)가 포함된 배지 (p38i) 및 20 μM p38 저해제, 20 ng/ml EGF, 및 10 μM 덱사메타손이 포함된 배지(p38i+EGF+Dexa)를 이용하여 닭 근육 줄기세포를 배양한 후, 충분한 세포숫자가 될 때까지 계대배양하였다.Basic medium for chicken muscle stem cell culture containing 20 μM p38 inhibitor (SB203580) (p38i) and 20 μM p38 inhibitor, 20 ng/ml EGF, and 10 μM dexamethasone (p38i+EGF+Dexa) After culturing chicken muscle stem cells using, it was subcultured until a sufficient number of cells.
3차원 배양을 위하여 아래 과정에 따라 세포가 포함된(Cell-laden) 하이드로젤을 제조하였다. 일반적으로 세포의 3차원 배양에 사용되는 collagen, gelatin, fibrin, alginate, matrigel, laminin, GelMA, Poly(ethylene glycol) diacrylate(PEGDA), N-isopropylacrylamide(NIPAAm), acrylic acid, polyacrylamide(PAAm) 등의 수용성 젤에 세포를 104 내지 108 cells/mL의 농도로 넣어준 다음, 닭 근육 줄기세포 배양용 기본 배지에 20 μM p38 저해제(SB203580)가 포함된 배지 (p38i) 및 20 μM p38 저해제, 20 ng/ml EGF, 및 10 μM 덱사메타손이 포함된 배지(p38i+EGF+Dexa)를 이용하여 1 내지 5일간 배양하였다. 이후 0 내지 2%(v/v) 말혈청(Biowest, Nuaille, France, 혹은 KnockOutTM Serum Replacement (KSR; Gibco)), 1 Х glutamax, 1 Х AA 및 0.1 mM BME을 포함하는 분화 배양액으로 교체하여 배양을 진행하였다. 37℃ CO2 incubator에서 분화를 유도하고 성숙된 근섬유 확인 전까지 2 또는 3일 간격으로 새로운 배지로 교체해주면서 배양하였다.For 3D culture, a cell-laden hydrogel was prepared according to the procedure below. Collagen, gelatin, fibrin, alginate, matrigel, laminin, GelMA, Poly(ethylene glycol) diacrylate (PEGDA), N-isopropylacrylamide (NIPAAm), acrylic acid, polyacrylamide (PAAm), etc. Cells were put on a water-soluble gel at a concentration of 10 4 to 10 8 cells/mL, and then a medium (p38i) containing 20 μM p38 inhibitor (SB203580) and 20 μM p38 inhibitor, 20 It was cultured for 1 to 5 days using a medium (p38i+EGF+Dexa) containing ng/ml EGF and 10 µM dexamethasone. Then, it was replaced with a differentiation medium containing 0 to 2% (v/v) horse serum (Biowest, Nuaille, France, or KnockOut TM Serum Replacement (KSR; Gibco)), 1 Х glutamax, 1 Х AA, and 0.1 mM BME. Cultivation proceeded. Differentiation was induced in a 37°C CO 2 incubator and cultured while replacing the medium with a new medium at intervals of 2 or 3 days until mature muscle fibers were identified.
각 배양일자에 따라 근육 표지 인자인 MYH1(myosin heavy chain 1) 및 MyoG(myosin G), 지방 표지 인자인 FASN(fatty acid synthase), SCD1(stearoyl-CoA desaturase1), PPAR-α(peroxisome proliferator-activated receptor alpha), PPAR-γ(peroxisome proliferator-activated receptor gamma), PGC1-α(peroxisome proliferator-activated receptor-gamma coactivator-1 alpha), C/EBP-α (CCAAT/enhancer-binding protein alpha) 유전자의 상대적인 발현율을 RT-PCR로 분석하였다.According to each culture day, muscle markers MYH1 (myosin heavy chain 1) and MyoG (myosin G), fat markers FASN (fatty acid synthase), SCD1 (stearoyl-CoA desaturase 1), PPAR-α (peroxisome proliferator-activated receptor alpha), PPAR-γ (peroxisome proliferator-activated receptor gamma), PGC1-α (peroxisome proliferator-activated receptor-gamma coactivator-1 alpha), and C/EBP-α (CCAAT/enhancer-binding protein alpha) genes Expression rates were analyzed by RT-PCR.
구체적으로는 닭 근육 줄기세포에서 TRIzol(Invitrogen, Carlsbad, USA)을 사용하여 Total RNA를 추출한 후, High-Capacity RNA-to-cDNA Kit(Applied Biosystems, Foster City, USA)를 사용하여 cDNA를 합성했다. cDNA는 아래 나열된 각 프라이머 세트와 DyNAmo HS SYBR Green qPCR 키트(Thermo Fisher Scientific, Waltham, USA)를 사용하여 증폭하였다. 사용된 프라이머는 아래 표 2에 기재하였다.Specifically, after extracting total RNA from chicken muscle stem cells using TRIzol (Invitrogen, Carlsbad, USA), cDNA was synthesized using High-Capacity RNA-to-cDNA Kit (Applied Biosystems, Foster City, USA) . cDNA was amplified using each of the primer sets listed below and the DyNAmo HS SYBR Green qPCR kit (Thermo Fisher Scientific, Waltham, USA). The primers used are listed in Table 2 below.
GeneGene Primer sequence (5′→ 3′)Primer sequence (5′→ 3′) Product size (bp)Product size (bp) Accession No.Accession no.
MYOGMYOG ForwardForward ATGGGGAAAACTTCCTGGGCATGGGGAAAACTTCCTGGGC 109109 NM_204184.1NM_204184.1
ReverseReverse TTCTCCTCCAAAGCCCCTCTTTCTCCTCCAAAGCCCCTCT
MYH1MYH1 ForwardForward TCCGCAAGATCCAACACGAATCCGCAAGATCCAACACGAA 150150 NM_001013397.2NM_001013397.2
ReverseReverse ATGCCACTTTGTTGTCACGAATGCCACTTTGTTGTCACGA
GAPDHGAPDH ForwardForward CGTCCTCTCTGGCAAAGTCCCGTCCTCTCTGGCAAAGTCC 132132 NM_204305.1NM_204305.1
ReverseReverse TTCCCGTTCTCAGCCTTGACTTCCCGTTCTCAGCCTTGAC
FASNFASN ForwardForward TTCTGATTCTGGCTCCACTGTTCTGATTCTGGCTCCACTG 122122 NM_205155.4NM_205155.4
ReverseReverse CCTGCTTAGCACTCTCAACGCCTGCTTAGCACTCTCAACG
SCD1SCD1 ForwardForward CTGCTCACATGTTTGGCAATCTGCTCACATGTTTGGCAAT 129129 NM_204890.2NM_204890.2
ReverseReverse TGGAGTAGTCGTAGGGGAATGTGGAGTAGTCGTAGGGGAATG
PPAR-αPPAR-α ForwardForward CAATGCACTGGAACTGGATGCAATGCACTGGAACTGGATG 126126 XM_046906390.1XM_046906390.1
ReverseReverse ACATGCACAATGCTCTCCTGATATGCACAATGCTCTCCTG
PPAR-γPPAR-γ ForwardForward CTCCAGGATTGCCAAAGTGCCTCCAGGATTGCCAAAGTGC 138138 NM_001001460.1NM_001001460.1
ReverseReverse GTCCCCACACACACGACATTGTCCCCACACACACGACATT
PGC1-αPGC1-α ForwardForward GTACAGCGACCAGTCTGAGGGTACAGCGACCAGTCTGAGG 9494 NM_001006457NM_001006457
ReverseReverse CAAGTTTGCCTCATTCTCTTCATCCAAGTTTGCCTCATTCTCTTCATC
C/EBP-αC/EBP-α ForwardForward TTCTACGAGGTCGATTCCCGTTCTACGAGGTCGATTCCCG 9696 NM_001031459.1NM_001031459.1
ReverseReverse AGCCTCTCTGTAGCCGTAGAGCCTCTCTGTAGCCGTAG
2차원 배양인 실시예 3의 결과와 유사하게 3차원 배양 결과에서 배양일자가 증가함에 따라 배양육의 근육 표지 인자인 MYOG와 MYH1이 증가하였고, 지방 표지인자인 FASN, SCD1, PPAR-α, PPAR-γ, PGC1-α, C/EBP-α 역시 증가하는 양상을 보였다(도 5, 6).Similar to the results of Example 3, which is two-dimensional culture, as the culture date increased in the three-dimensional culture result, muscle markers MYOG and MYH1 of cultured meat increased, and fat markers FASN, SCD1, PPAR-α, and PPAR -γ, PGC1-α, and C/EBP-α were also increased (Figs. 5 and 6).
배양 초기와 후기에 근육 분화 정도 및 지방 발현율을 확인하기 위하여 면역형광염색법과 지방염색법을 시행하였다. Immunofluorescence staining and fat staining were performed to confirm the degree of muscle differentiation and fat expression rate in the early and late stages of culture.
면역형광염색을 위해 3차원 배양된 근육 줄기세포는 4%(w/v) 파라포름알데하이드로 4℃에서 30 분간 처리하여 고정하였다. 고정된 세포는 DPBS(Welgene)로 두 번 세척한 후, 0.2 %(v/v) Triton X-100(Sigma-Aldrich)을 15 분 동안 처리하고 10%(v/v) 염소 혈청을 1 시간동안 처리하였다. 이후 닭 Myosin heavy chain에 대한 1차 항체(1:1000; MAB4470, R&D Systems)를 추가하여 4℃에서 하룻밤 배양하였다. 이후 염소 혈청 및 1차 항체를 제거하고, Alexa Fluor-접합 2차 항체를 4℃에서 하룻밤 처리하였다. 세포핵은 Hoechst 33342(Molecular Probes, Eugene, USA)로 염색하였다.For immunofluorescence staining, the three-dimensionally cultured muscle stem cells were treated with 4% (w/v) paraformaldehyde at 4° C. for 30 minutes and then fixed. The fixed cells were washed twice with DPBS (Welgene), then treated with 0.2% (v/v) Triton X-100 (Sigma-Aldrich) for 15 minutes and 10% (v/v) goat serum for 1 hour. processed. Then, a primary antibody against chicken Myosin heavy chain (1:1000; MAB4470, R&D Systems) was added and incubated overnight at 4°C. Then, goat serum and primary antibody were removed, and Alexa Fluor-conjugated secondary antibody was treated overnight at 4°C. Cell nuclei were stained with Hoechst 33342 (Molecular Probes, Eugene, USA).
지방 염색은 다음과 같이 진행하였다. 3차원 배양된 닭 근육 줄기세포는 4%(w/v) 파라포름알데하이드로 4℃에서 30 분간 처리하여 고정하였다. 고정된 세포는 DPBS(Welgene)로 두 번 세척한 후, 60%(v/v) isopropanol을 5분간 반응시킨 후 오일 레드 오(Oil Red O) 용액을 넣어 10 내지 20 분간 섞어주면서 반응시켰다. 이후 수차례 세척한 후 현미경으로 관찰하였다.Fat staining was performed as follows. Three-dimensionally cultured chicken muscle stem cells were treated with 4% (w/v) paraformaldehyde at 4° C. for 30 minutes and then fixed. The fixed cells were washed twice with DPBS (Welgene), reacted with 60% (v/v) isopropanol for 5 minutes, and then mixed with Oil Red O solution for 10 to 20 minutes. After washing several times, it was observed under a microscope.
관찰결과 닭 근육 줄기세포의 3차원 배양을 통한 배양육의 경우 배양 초기에는 근육으로의 분화만 확인된 반면, 배양이 진행됨에 따라 근육 분화와 함께 중성지방의 축적이 확인되었다(도 7).As a result of observation, in the case of cultured meat through three-dimensional culture of chicken muscle stem cells, only differentiation into muscle was confirmed at the beginning of culture, while accumulation of neutral fat was confirmed along with muscle differentiation as culture progressed (FIG. 7).

Claims (15)

  1. 닭 근육 줄기세포 배양용 배지 조성물에 있어서, p38 저해제, EGF 및 덱사메타손을 포함하는, 닭 근육 줄기세포 배양용 배지 조성물.A medium composition for culturing chicken muscle stem cells, comprising a p38 inhibitor, EGF and dexamethasone.
  2. 제1항에 있어서,According to claim 1,
    상기 p38 저해제는 SB203580인, 닭 근육 줄기세포 배양용 배지 조성물.The p38 inhibitor is SB203580, a medium composition for culturing chicken muscle stem cells.
  3. 제2항에 있어서,According to claim 2,
    상기 SB203580의 함량은 1 μM 내지 100 μM이고, 상기 EGF의 함량은 10-1 ng/ml 내지 104 ng/ml이고, 상기 덱사메타손의 함량은 10-3 μM 내지 100 μM인, 닭 근육 줄기세포 배양용 배지 조성물.The content of SB203580 is 1 μM to 100 μM, the content of EGF is 10 -1 ng / ml to 10 4 ng / ml, and the content of dexamethasone is 10 -3 μM to 100 μM, chicken muscle stem cell culture Medium composition for use.
  4. 제3항에 있어서,According to claim 3,
    상기 SB203580의 함량은 20 μM, 상기 EGF의 함량은 100 ng/ml이고, 상기 덱사메타손의 함량은 10 μM 인, 닭 근육 줄기세포 배양용 배지 조성물.The content of the SB203580 is 20 μM, the content of the EGF is 100 ng / ml, and the content of the dexamethasone is 10 μM, chicken muscle stem cell culture medium composition.
  5. 제1항 내지 제4항 중 어느 한 항의 닭 근육 줄기세포 배양용 배지 조성물을 이용한 닭 근육 줄기세포 배양 방법. A method for culturing chicken muscle stem cells using the medium composition for culturing chicken muscle stem cells according to any one of claims 1 to 4.
  6. 제5항의 닭 근육 줄기세포 배양 방법을 이용한 배양육 생산 방법.Cultured meat production method using the chicken muscle stem cell culture method of claim 5.
  7. 닭 근육 줄기세포에서 근육세포 및 지방세포를 동시에 분화시키는 방법에 있어서,A method for simultaneously differentiating muscle cells and fat cells from chicken muscle stem cells,
    (S1) 분리된 닭 근육 줄기세포를 제1항 내지 제4항 중 어느 한 항의 닭 근육 줄기세포 배양용 배지 조성물을 이용하여 계대 배양하는 단계; 및(S1) subculturing the separated chicken muscle stem cells using the culture medium composition for culturing chicken muscle stem cells according to any one of claims 1 to 4; and
    (S2) 상기 (S1) 단계에서 배양된 닭 근육 줄기세포를 말 혈청이 포함된 분화 배지를 이용하여 배양하는 단계;를 포함하는, 닭 근육 줄기세포에서 근육세포 및 지방세포를 동시에 분화시키는 방법.(S2) culturing the chicken muscle stem cells cultured in step (S1) using a differentiation medium containing horse serum; a method for simultaneously differentiating muscle cells and adipocytes from chicken muscle stem cells.
  8. 제7항에 있어서,According to claim 7,
    상기 (S1) 단계에서의 계대 배양 횟수는 1 내지 30 계대인, 닭 근육 줄기세포에서 근육세포 및 지방세포를 동시에 분화시키는 방법.The method of simultaneously differentiating muscle cells and adipocytes from chicken muscle stem cells, wherein the number of passages in step (S1) is 1 to 30 passages.
  9. 제8항에 있어서,According to claim 8,
    상기 계대 배양 횟수는 1 내지 12 계대인, 닭 근육 줄기세포에서 근육세포 및 지방세포를 동시에 분화시키는 방법.The method of simultaneously differentiating muscle cells and adipocytes from chicken muscle stem cells, wherein the number of passages is 1 to 12 passages.
  10. 제7항에 있어서,According to claim 7,
    상기 (S2) 단계의 말 혈청은 1~10%(v/v)로 배지에 포함되는, 닭 근육 줄기세포에서 근육세포 및 지방세포를 동시에 분화시키는 방법.The method of simultaneously differentiating muscle cells and fat cells from chicken muscle stem cells, wherein the horse serum in step (S2) is contained in the medium at 1-10% (v / v).
  11. 제10항에 있어서,According to claim 10,
    상기 말 혈청은 2%(v/v)로 배지에 포함되는, 닭 근육 줄기세포에서 근육세포 및 지방세포를 동시배양육에 분화시키는 방법.The method of differentiating muscle cells and adipocytes from chicken muscle stem cells to co-cultured meat, wherein the horse serum is contained in the medium at 2% (v / v).
  12. 제7항의 닭 근육 줄기세포에서 근육세포 및 지방세포를 동시에 분화시키는 방법을 이용한 배양육 생산 방법.A method for producing cultured meat using a method of simultaneously differentiating muscle cells and fat cells from the chicken muscle stem cells of claim 7.
  13. 제12항의 배양육 생산 방법으로 생산된 배양육.Cultured meat produced by the cultured meat production method of claim 12.
  14. 제13항에 있어서,According to claim 13,
    상기 닭 배양육은 근육세포와 근내 지방이 동시에 존재하는 배양육.The chicken cultured meat is cultured meat in which muscle cells and intramuscular fat are present at the same time.
  15. 제14항의 배양육을 포함하는 식품 조성물.A food composition comprising the cultured meat of claim 14.
PCT/KR2022/018053 2022-02-21 2022-11-16 Method for producing cultured meat that differentiates muscle and fat together, and cultured meat produced thereby WO2023158061A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR10-2022-0022267 2022-02-21
KR20220022267 2022-02-21
KR10-2022-0149918 2022-11-10
KR1020220149918A KR20230125719A (en) 2022-02-21 2022-11-10 Methods for manufacturing cultured meat by differentiation of muscle and fat, and the cultured meat thereby

Publications (1)

Publication Number Publication Date
WO2023158061A1 true WO2023158061A1 (en) 2023-08-24

Family

ID=87578783

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/018053 WO2023158061A1 (en) 2022-02-21 2022-11-16 Method for producing cultured meat that differentiates muscle and fat together, and cultured meat produced thereby

Country Status (1)

Country Link
WO (1) WO2023158061A1 (en)

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
CHOI JUNGSEOK: "Challenges We have to Solve for Production of Cell Cultured Meat", FOOD SCIENCE OF ANIMAL RESOURCES AND INDUSTRY, vol. 9, no. 1, 1 January 2020 (2020-01-01), pages 2 - 10, XP093085772 *
CHOI JUNGSEOK: "Research Trends in Alternative Protein and Cultured Meat Materials", FOOD INDUSTRY AND NUTRITION, vol. 24, no. 2, 1 January 2019 (2019-01-01), pages 15 - 20, XP093085770 *
CHOI KWANG-HWAN, KIM MINSU, YOON JI WON, JEONG JINSOL, RYU MINKYUNG, JO CHEORUN, LEE CHANG-KYU: "Purification of Pig Muscle Stem Cells Using Magnetic-Activated Cell Sorting (MACS) Based on the Expression of Cluster of Differentiation 29 (CD29)", FOOD SCIENCE OF ANIMAL RESOURCES, KOREAN INTELLECTUAL PROPERTY OFFICE, vol. 40, no. 5, 1 September 2020 (2020-09-01), pages 852 - 859, XP093084771, ISSN: 2636-0772, DOI: 10.5851/kosfa.2020.e51 *
CHOI KWANG‐HWAN, YOON JI WON, KIM MINSU, LEE HYUN JUNG, JEONG JINSOL, RYU MINKYUNG, JO CHEORUN, LEE CHANG‐KYU: "Muscle stem cell isolation and in vitro culture for meat production: A methodological review", COMPREHENSIVE REVIEWS IN FOOD SCIENCE AND FOOD SAFETY, INSTITUTE OF FOOD TECHNOLOGISTS , CHICAGO , IL, US, vol. 20, no. 1, 1 January 2021 (2021-01-01), US , pages 429 - 457, XP055904480, ISSN: 1541-4337, DOI: 10.1111/1541-4337.12661 *
DING SHIJIE, SWENNEN G. N. M, MESSMER TOBIAS, GAGLIARDI MICK, MOLIN DANIËL G. M., LI CHUNBAO, ZHOU GUANGHONG, POST MARK J.: "Maintaining bovine satellite cells stemness through p38 pathway", SCIENTIFIC REPORTS, vol. 8, no. 1, 1 December 2018 (2018-12-01), pages 10808, XP055891808, DOI: 10.1038/s41598-018-28746-7 *
KWANG-HWAN CHOI, JI WON YOON, MINSU KIM, JINSOL JEONG, MINKYUNG RYU, SUNGKWON PARK, CHEORUN JO, CHANG-KYU LEE: "Optimization of Culture Conditions for Maintaining Pig Muscle Stem Cells In Vitro", FOOD SCIENCE OF ANIMAL RESOURCES, KOREAN INTELLECTUAL PROPERTY OFFICE, vol. 40, no. 4, 1 July 2020 (2020-07-01), pages 659 - 667, XP055758327, ISSN: 2636-0772, DOI: 10.5851/kosfa.2020.e39 *
LAUMONIER THOMAS, BERMONT FLAVIEN, HOFFMEYER PIERRE, KINDLER VINCENT, MENETREY JACQUES: "Human myogenic reserve cells are quiescent stem cells that contribute to muscle regeneration after intramuscular transplantation in immunodeficient mice", SCIENTIFIC REPORTS, vol. 7, no. 1, 14 June 2017 (2017-06-14), pages 3462, XP093084774, DOI: 10.1038/s41598-017-03703-y *
M. RYU, K. MINSU, Z.J. HYUN: "Inhibition of p38 in chicken muscle stem cells affects proliferation and differentiation to muscle.", 18 November 2021 (2021-11-18), pages 137, XP009548188 *

Similar Documents

Publication Publication Date Title
EP1948786B1 (en) Multipotent stem cells derived from human adipose tissue and cellular therapeutic agents comprising the same
EP2205724B1 (en) Method for isolating and culturing adult stem cells derived from human amniotic epithelium
WO2013032052A1 (en) Method for preparing a basic culture medium for mesenchymal stem cells, basic culture medium for mesenchymal stem cells, and cell therapeutic agent cultured and differentiated using same
WO2015105356A1 (en) Stem cells derived from pure chorionic trophoblast layer and cell therapy comprising same
KR102292132B1 (en) Serum-free medium composition
WO2015105357A1 (en) Stem cells derived from basal portion of chorionic trophoblast layer and cell therapy comprising same
US20230325487A1 (en) Production of therapeutics potential mesenchymal stem cells
US20130059378A1 (en) Human epidermis-derived mesenchymal stem cell-like pluripotent cells and preparation method thereof
WO2019198962A1 (en) Method for promoting proliferation and differentiation of induced pluripotent stem cells prepared from urine-derived stem cells
WO2016068596A1 (en) Medium composition for culturing stem cells
Li et al. An efficient and economical way to obtain porcine muscle stem cells for cultured meat production
WO2013085303A1 (en) Canine amniotic membrane-derived multipotent stem cells
WO2012173358A2 (en) Testis somatic cell-derived pluripotent stem cells, method for producing same, and pharmaceutical composition for impotence treatment including same
WO2012008733A2 (en) Stem cells derived from primary placenta tissue and cellular therapeutic agent containing same
WO2021118226A1 (en) Method for preparation of mesenchymal stem cell from human pluripotent stem cell and mesenchymal stem cells prepared thereby
WO2023158061A1 (en) Method for producing cultured meat that differentiates muscle and fat together, and cultured meat produced thereby
WO2011102680A2 (en) Cd49f promoting proliferation, multipotency and reprogramming of adult stem cells through pi3k/akt/gsk3 pathway
JP6721504B2 (en) Process for producing pluripotent stem and progenitor cells
CN115125192B (en) Bone marrow supernatant and application thereof in cell culture
Ibtisham et al. The optimized condition for the isolation and in vitro propagation of mouse spermatogonial stem cells
KR20230125719A (en) Methods for manufacturing cultured meat by differentiation of muscle and fat, and the cultured meat thereby
WO2019221477A1 (en) Composition for promoting stem cell differentiation, comprising progenitor cell culture solution and multilayer graphene film, and use thereof
KR102427028B1 (en) Medium composition for culturing muscle stem cells of domestic animals
WO2022103129A1 (en) Early mesenchymal stem cells with reduced aging and preserved stem cell ability, and culturing method therefor
WO2017039251A1 (en) Enhanced postnatal adherent cell, and use for same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22927457

Country of ref document: EP

Kind code of ref document: A1