WO2023150272A2 - Exon skipping to treat usher syndrome - Google Patents
Exon skipping to treat usher syndrome Download PDFInfo
- Publication number
- WO2023150272A2 WO2023150272A2 PCT/US2023/012284 US2023012284W WO2023150272A2 WO 2023150272 A2 WO2023150272 A2 WO 2023150272A2 US 2023012284 W US2023012284 W US 2023012284W WO 2023150272 A2 WO2023150272 A2 WO 2023150272A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- grna
- seq
- exon
- target sequence
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/005—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P27/00—Drugs for disorders of the senses
- A61P27/16—Otologicals
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/33—Alteration of splicing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/34—Allele or polymorphism specific uses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
Definitions
- TECHNICAL FIELD Compositions for use in treating subjects with USH2A-associated retinal and/or cochlear degeneration that result from mutations in exon 13 of the USH2A gene by deletion of exon 13 splicing acceptor sequences from the USH2A gene or transcripts, and methods of use thereof, as well as genetically modified animals and cells.
- BACKGROUND Usher syndrome USH is the leading cause of inherited combined hearing and vision loss.
- Usher syndrome type II USH2
- USH2 Patients with USH2 display moderate-to- severe hearing loss, post-pubertal onset of retinitis pigmentosa (RP) and normal vestibular reflexes, and USH2 represents the most common form of inherited deaf– blindness and is estimated to affect approximately 1 in 17,000 individuals.
- mutations in exon 13 account for approximately 35% of all USH2 cases, including a single base deletion at position 2299 (c.2299delG), which is the most common mutation accounting for about 24% of cases.
- nucleic acids comprising sequences encoding a Cas9 protein, and a first gRNA, and a second gRNA, wherein the target sequence of the first gRNA is any one of SEQ ID NOs: 2-244 provided in Table 1, and the target sequence of the second gRNA is any one of SEQ ID NOs: 245-431 provided in Table 2.
- the target sequence of the first gRNA falls in the 3 ⁇ 1000 base-pairs (bp) of intron 12 and the target sequence of the second gRNA falls in exon 13; any combination of a first gRNA having a target sequence of any one of SEQ ID NOs: 2-244, and a second gRNA having a target sequence of any one of SEQ ID NOs: 245-431 can be used, in order to delete the relevant DNA fragment from the genome.
- the target sequence of the first gRNA is SEQ ID NO: 17 and the target sequence of the second gRNA is SEQ ID NO: 313.
- the target sequence of the first gRNA is SEQ ID NO: 17 and the target sequence of the second gRNA is SEQ ID NO: 260.
- a deletion mediated by paired-gRNAs provided herein will include part of intron 12 and part of exon 13, with deletion size ranging from 6 bp to several kilobase-pairs (kb), all of which can induce human USH2A exon 13 skipping, with the preferred range being 6 kb to 2 kb, with certain preferred combinations of gRNAs.
- the nucleic acid encodes S. pyogenes Cas9 or S. aureus Cas9 (optionally KKH SaCas9).
- the Cas9 comprises a nuclear localization signal, e.g., a C-terminal nuclear localization signal and/or an N-terminal nuclear localization signal; and/or wherein the sequences encoding Cas9 comprises a polyadenylation signal.
- the gRNA is a unimolecular S. aureus or S. pyogenes gRNA, or the corresponding two-part modular S. aureus or S. pyogenes gRNA (see, e.g., WO 2018/026976).
- the nucleic acid comprises a viral delivery vector, preferably an adeno-associated virus (AAV) vector.
- AAV adeno-associated virus
- the viral delivery vector comprises a promoter for Cas9, preferably a CMV, EFS, U1A or hGRKl promoter.
- the nucleic acid comprises: (i) a first guide RNA comprising a targeting domain sequence selected from any one of SEQ ID NOs: 2-244 and a second guide RNA comprising a targeting domain sequence selected from any one of SEQ ID NOs: 245-431; (ii) a first and a second inverted terminal repeat sequence (ITR); and (iii) a promoter for driving expression of the Cas9 selected from the group consisting of a CMV, an EFS, U1A or an hGRKl promoter.
- ITR inverted terminal repeat sequence
- the nucleic acids described herein can be used, e.g., in therapy, or in preparation of a medicament.
- the nucleic acids can be uses in a method of treating a subject who has a condition associated with a mutation in exon 13 of the USH2A gene.
- the condition is Usher Syndrome type 2 or autosomal recessive retinitis pigmentosa (arRP).
- the AAV vector is delivered to a retina of a subject by injection, such as by subretinal injection, or is delivered to the inner ear of a subject by injection, e.g., through the round window.
- compositions comprising first ribonucleoprotein (RNP) complexes comprising a Cas9 protein and a first gRNA or sgRNA, and/or second RNP complexes comprising a Cas9 protein and a second gRNA or sgRNA, wherein the target sequence of the first gRNA is any one of SEQ ID NOs: 2-244 and the target sequence of the second gRNA is any one of SEQ ID NOs: 245-431.
- the Cas9 is S. aureus Cas9, optionally KKH SaCas9 (optionally KKH SaCas9) or S. pyogenes Cas9.
- the methods include contacting the cell with a nucleic acid or composition as described herein.
- Also provided herein are methods for genome editing in human cells including using CRISPR editing to form a first double strand break within intron 12 of the human USH2A gene and a second double strand break within exon 13 of the human USH2A gene and results in the removal of a fragment of genome DNA containing part of intron 12 and part of exon 13 of the USH2A gene on chromosome 1.
- the first double strand break is generated using a gRNA having a target sequence of any one of SEQ ID NOs: 2-244 and the second double strand break is generated using a gRNA having a target sequence of any one of SEQ ID NOs: 245-431.
- the cell is in or from a subject who has a mutation in the USH2A gene. In some embodiments, the cell is a cell of the eye or inner ear of a mammal.
- all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Methods and materials are described herein for use in the present invention; other, suitable methods and materials known in the art can also be used. The materials, methods, and examples are illustrative only and not intended to be limiting. All publications, patent applications, patents, sequences, database entries, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control.
- FIG.1 Schematic diagram of CRISPR/Cas9 splicing acceptor targeting strategy to induce USH2A exon 13 skipping by a pair of gRNAs targeting the flanking genomic DNA of the splicing acceptor site.
- FIGs.2A-I Splicing acceptor targeting strategy increases exon 12 (human exon 13 equivalent) skipping in-frame Ush2A transcript in mouse cells.
- (a) Gel image showing full exon 12 deletion strategy in the genome using CRISPR/Cas9. Red asterisks indicate fragment after deletion.
- NGS Next generation sequencing
- FIGs.3A-H Efficient genome editing at USH2A exon 13 loci using splicing acceptor targeting strategy in human cells.
- FIGs.4A-I Splicing acceptor targeting strategy caused small deletion results in robust generation of USH2A exon 13 skipping transcripts in human cells.
- (a) Schematic diagram of exon 13-unskipped (upper) and –skipped (lower) transcripts of human USH2A.
- (b) Gel image showing exon skipping efficiency with or without genome editing. Red arrows indicate USH2A transcripts.
- (c) Representative Sanger sequencing data showing exon 13 skipping in USH2A transcript after genome editing.
- f Pie chart showing the percentage of different USH2A transcripts in cells edited with paired gRNAs sgL1 and sgK4.
- g Pie chart showing the percentage of different USH2A transcripts in cells edited with paired gRNAs sgL1 and sgK5. This combination generates the highest percentage (73%) of exon 13-skipped USH2A transcripts in human cells.
- FIGs.5A-F Splicing acceptor targeting strategy induces USH2A exon 13- skipped transcripts in human induced pluripotent stem cells (hiPSCs) derived from an USH2 patient harboring a homozygous mutation c.2299delG).
- hiPSCs human induced pluripotent stem cells
- FIGs.6A-6B Efficient exon skipping in inner ear organoids generated from hiPSCs derived from an USH2 patient.
- (a) Gel image shows a full length USH2A transcript in a healthy control and in inner ear organoids generated from hiPSCs derived from an USH2 patient. After exon skipping, exon 13 was skipped in a majority of transcripts as shown by an arrow at day 50.
- FIGs.7A-7B Bar graph showing quantitation of the ratio between USH2A exon 13- skipped transcripts and full-length USH2A transcripts, indicating over 75% exon 13 skipping mediated by the sgRNA pair sgL1/sgK5 in inner ear organoids generated from hiPSCs derived from an USH2 patient.
- FIGs.7A-7B Exon 5 skipping in Ush2a gene causes hearing loss in mice.
- WT/KO mouse model of Usher syndrome
- skipping exon 13 in the USH2A transcript could be a potential treatment modality in which the resulting transcript encodes a slightly shortened in-framed USHERIN protein, lacking several of the Laminin EGF-like domains.
- the USHERIN protein translated from exon 13-skipped transcripts retains functionality, so the exon 13 skipping strategy has therapeutic potential for any hearing loss caused by mutations of USH2A exon 13.
- the splicing acceptor can be deleted by gene editing at a higher efficiency relative to deleting the entire exon 13.
- Cas9 and dual sgRNAs can be delivered into patients' inner ear by, e.g., AAV vector or lipid nanoparticles.
- AAV vector or lipid nanoparticles e.g., lipid nanoparticles.
- AON antisense oligonucleotide
- the compositions and methods disclosed here provide a one-time therapeutic, including the exon 13 skipping strategy, that could have durability, even for a patient’s entire lifetime.
- the present disclosure provides evidence of robust induction of specific target exon skipping, which can be developed into gene-editing therapies for diseases involving other splicing mutations.
- gRNAs mediate efficient removal of USH2A exon 13 in multiple human cell lines, e.g., WERI-RB1 cells, and human induced pluripotent stems cells (hiPSCs) derived from an Usher syndrome patient.
- Exon 13 removal leads to efficient production of USH2A in-frame transcripts excluding exon 13, which are shown in a mouse model to be functional and promote rescue of hearing and vision.
- the USHERIN protein encoded by USH2A (GenBank Acc No.
- NC_000001.11, Reference GRCh38.p7 Primary Assembly, Range 215622894- 216423396, complement; SEQ ID NO:1) is a transmembrance protein anchored in the photoreceptor plasma membrane (van Wijk, E., et al., Am J Hum Genet, 2004.74(4): p.738-44; Grati, M., et al., J Neurosci, 2012.32(41): p.14288-93).
- NM_206933.2 (transcript) and NP_996816.2 (protein)) is most abundantly expressed in retina and is used as the canonical, standard sequence in the literature and in this application.
- Methods of Treatment CRISPR/Cas-based exon-skipping has been successfully used for restoring the expression of functional dystrophin and dystrophic muscle function in the Duchene muscular dystrophy mouse model.
- the methods described herein include methods for the treatment of disorders associated with mutations in exon 13 of the USH2A gene.
- the disorder is Usher syndrome, e.g., type 2 Usher syndrome.
- Subjects with type 2 Usher syndrome (USH2) typically have moderate to severe hearing loss at birth, and vision that becomes progressively impaired starting in adolescence.
- the disorder is autosomal recessive retinitis pigmentosa (arRP).
- the methods include administering a therapeutically effective amount of a genome editing system as described herein, to a subject who is in need of, or who has been determined to be in need of, such treatment.
- the term "genome editing system” refers to any system having RNA-guided DNA editing activity. Genome editing systems of the present disclosure include at least two components adapted from naturally occurring CRISPR systems: a gRNA and an RNA-guided nuclease.
- SSB single-strand break
- a DSB double-strand break
- a base substitution for example by making one or more of a single- strand break (an SSB or nick), a double-strand break (a DSB) and/or a base substitution.
- SSB single- strand break
- a DSB double-strand break
- to “treat” means to ameliorate at least one symptom of the disorder associated with mutations in exon 13 of the USH2A gene.
- a treatment comprising administration of a therapeutic gene editing system as described herein can result in a reduction in hearing impairment and/or visual impairment; a reduction in the rate of progression of hearing loss and/or vision loss; and/or a return or approach to normal hearing and/or vision.
- Hearing and vision can be tested using known methods, e.g., electroretinogram, optical coherence tomography, videonystagmography, and audiology testing.
- the methods can be used to treat any subject (e.g., a mammalian subject, preferably a human subject) who has a mutation in exon 13 of the USH2A gene, e.g., the c.2299delG mutation or c.2276G>T mutation, e.g., in one or both alleles of USH2A.
- an “allele” is one of a pair or series of genetic variants of a polymorphism (also referred to as a mutation) at a specific genomic location.
- “genotype” refers to the diploid combination of alleles for a given genetic polymorphism.
- a homozygous subject carries two copies of the same allele and a heterozygous subject carries two different alleles.
- Methods for identifying subjects with such mutations are known in the art; see, e.g., Yan et al., J Hum Genet.2009 Dec; 54(12): 732–738; Leroy et al., Exp Eye Res.2001 May;72(5):503-9; or Consugar et al., Genet Med.2015 Apr;17(4):253-261.
- gel electrophoresis, capillary electrophoresis, size exclusion chromatography, sequencing, and/or arrays can be used to detect the presence or absence of the allele or genotype.
- Amplification of nucleic acids can be accomplished using methods known in the art, e.g., PCR.
- a sample e.g., a sample comprising genomic DNA
- the DNA in the sample is then examined to identify or detect the presence of an allele or genotype as described herein.
- the allele or genotype can be identified or determined by any method described herein, e.g., by Sanger sequencing or Next Generation Sequencing (NGS). Since the exon 13 is 643bp in size, thus the genotyping of the patients with exon 13 mutations is simple and straight forward using Sanger sequencing or NGS.
- nucleic acid probe e.g., a DNA probe (which includes cDNA and oligonucleotide probes) or an RNA probe.
- the nucleic acid probe can be designed to specifically or preferentially hybridize with a particular mutation (also referred to as a polymorphic variant).
- Other methods of nucleic acid analysis can include direct manual sequencing (Church and Gilbert, Proc. Natl. Acad. Sci. USA 81:1991-1995 (1988); Sanger et al., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1977); Beavis et al., U.S. Pat. No.
- the present disclosure provides AAV vectors encoding CRISPR/Cas9 genome editing systems including a first gRNA and a second gRNA, wherein the target sequence of the first gRNA is any one of SEQ ID NOs: 2-244 provided in Table 1, and the target sequence of the second gRNA is any one of SEQ ID NOs: 245-431 provided in Table 2, and provides the use of such vectors to treat USH2A-associated disease.
- Exemplary AAV vector genomes are known in the art; see, e.g., FIG.9 PCT/US2019/023934, which illustrates certain fixed and variable elements of these vectors: inverted terminal repeats (ITRs), one or two gRNA sequences and promoter sequences to drive their expression, a Cas9 coding sequence and another promoter to drive its expression.
- ITRs inverted terminal repeats
- gRNA sequences one or two gRNA sequences and promoter sequences to drive their expression
- Cas9 coding sequence a Cas9 coding sequence and another promoter to drive its expression.
- RNA-guided nucleases/Cas9 Various RNA-guided nucleases can be used in the present methods, e.g., as described in WO 2018/026976.
- This approach can use different CRISPR proteins and their corresponding gRNAs, including Streptococcus pyogenes Cas9 (SpCas9) and engineered SpCas9 variants, Staphylococcus aureus Cas9 (SaCas9), KKH variant SaCas9 (See Kleinstiver et al., Nat Biotechnol.2015 Dec; 33(12): 1293–1298; WO 2016/141224), Cpf1 (also known as Cas12a, such as AsCpf1, LPCpf1), Cas12f (such as Un1Cas12f1, AsCas12f1) etc.
- the RNA-guided nuclease used in the present methods and compositions is a S. aureus Cas9 or a S. pyogenes cas9.
- a Cas9 sequence is modified to include two nuclear localization sequences (NLSs) (e.g., PKKKRKV (SEQ ID NO: 432) at the C- and N-termini of the Cas9 protein, and a mini-polyadenylation signal (or Poly- A sequence).
- NLSs nuclear localization sequences
- An exemplary NLS is SV40 large T antigen NLS (PKKKRRV (SEQ ID NO: 433)) and nucleoplasmin NLS (KRPAATKKAGQAKKKK (SEQ ID NO: 434)).
- NLSs are known in the art; see, e.g., Cokol et al., EMBO Rep.2000 Nov 15; 1(5):411–415; Freitas and Cunha, Curr Genomics.2009 Dec; 10(8): 550–557.
- An exemplary polyadenylation signal is TAGCAATAAAGGATCGTTTATTTTCATTGGAAGCGTGTG TTGGTTTTTTGATCAGGCGCG (SEQ ID NO: 435)).
- Exemplary S. aureus Cas9 sequences are described in Table 4 of WO 2018/026976, e.g., SEQ ID NOs 10 and 11 therein.
- the gRNAs used in the present disclosure can be unimolecular or modular, as described below. Described herein are approaches for treating subjects with mutations in exon 13 of USH2A that make use of dual-gRNAs for deletion of exon 13.
- Two gRNAs sgRNA-L and sgRNA-R, one with target sequence in intron 12, one with target sequence in intron 13
- sgRNA-L has a target sequence in intron 12
- sgRNA-R has a target sequence in exon 13.
- Tables 1 and 2 provide exemplary sequences for target sequences of the sgRNAs targeting intron 12 (sgRNA-L) and exon 13 (sgRNA-R), respectively.
- the sgRNA targets fall in the 3 ⁇ 1000 bp of intron 12 (SEQ ID NOs: 2-244) and exon 13 (SEQ ID NOs: 245-431). Note that in the sequences provided here, the actual sgRNA would have U in place of T.
- any combination of a first gRNA having a target sequence of any one of SEQ ID NOs: 2-244, and a second gRNA having a target sequence of any one of SEQ ID NOs: 245-431 can be used to delete a certain DNA fragment from the genome, though certain combinations may be more preferred, as exemplified below.
- the compositions and methods disclosed herein use Staphylococcus aureus Cas9 (SaCas9) and corresponding gRNAs.
- SaCas9 is one of several smaller Cas9 orthologues that are suited for viral delivery (Horvath et al., J Bacteriol 190, 1401-1412 (2008); Ran et al., Nature 520, 186-191 (2015); Zhang et al., Mol Cell 50, 488-503 (2013)).
- the wild type recognizes a longer NNGRRT PAM that is expected to occur once in every 32 bps of random DNA; or the alternative NNGRRA PAM.
- Tables 1 and 2 provide exemplary sequences for the target site in exons 12 and 13, respectively. Note that the “target site” sequences provided herein are the sequences of the gRNA (although gRNA would have U in place of T).
- TABLE 1 Target sequences of exemplary sgRNA-L targeting USH2A intron 12, Reference genome: Human GRCh38 (NCBI RefSeq NC_000001.11) chr1:216247225-216248226.
- AAV Delivery Systems include delivery of a CRISPR/Cas9 genome editing system, including a Cas9 nuclease and one or two guide RNAs, to a subject in need thereof.
- the delivery methods can include, e.g., viral delivery, preferably using an adeno- associated virus (AAV) vector that encodes the Cas9 and one or more guide RNA(s).
- AAV adeno- associated virus
- AAV is a naturally occurring defective virus that requires another virus, such as an adenovirus or a herpes virus, as a helper virus for efficient replication and a productive life cycle.
- another virus such as an adenovirus or a herpes virus
- AAV vectors efficiently transduce various cell types and can produce long-term expression of transgenes in vivo.
- AAV vectors have been extensively used for gene augmentation or replacement and have shown therapeutic efficacy in a range of animal models as well as in the clinic; see, e.g., Mingozzi and High, Nature Reviews Genetics 12, 341-355 (2011); Deyle and Russell, Curr Opin Mol Ther.2009 Aug; 11(4): 442–447; Asokan et al., Mol Ther.2012 April; 20(4): 699–708.
- AAV vectors containing as little as 300 base pairs of AAV can be packaged and can produce recombinant protein expression.
- AAV2, AAV5, AAV2/5, AAV2/8 and AAV2/7 vectors have been used to introduce DNA into photoreceptor cells (see, e.g., Pang et al., Vision Research 2008, 48(3):377-385; Khani et al., Invest Ophthalmol Vis Sci.2007 Sep;48(9):3954-61; Allocca et al., J. Virol.200781(20):11372-11380).
- the AAV vector can include (or include a sequence encoding) an AAV capsid polypeptide described in PCT/US2014/060163; for example, a virus particle comprising an AAV capsid polypeptide having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, and 17 of PCT/US2014/060163, and a Cas9 sequence and guide RNA sequence as described herein.
- the AAV capsid polypeptide is an Anc80 polypeptide, e.g., Anc80L27; Anc80L59; Anc80L60; Anc80L62; Anc80L65; Anc80L33; Anc80L36; or Anc80L44.
- the AAV incorporates inverted terminal repeats (ITRs) derived from the AAV2 serotype. Exemplary left and right ITRs are presented in Table 6 of WO 2018/026976. It should be noted, however, that numerous modified versions of the AAV2 ITRs are used in the field, and the ITR sequences shown below are exemplary and are not intended to be limiting.
- Cas9 expression can be driven by a promoter known in the art.
- expression is driven by one of three promoters: cytomegalovirus (CMV), elongation factor-1 (EFS), or human g-protein receptor coupled kinase-1 (hGRKl), which is specifically expressed in retinal photoreceptor cells.
- CMV cytomegalovirus
- EFS elongation factor-1
- hGRKl human g-protein receptor coupled kinase-1
- Nucleotide sequences for each of these promoters are provided in Table 5 of WO 2018/026976. Modifications of these sequences may be possible or desirable in certain applications, and such modifications are within the scope of this disclosure.
- the nucleic acid or AAV vector shares at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or greater sequence identity with one of the nucleic acids or AAV vectors recited above
- AAV genomes described above can be packaged into AAV capsids (for example, AAV5 capsids), which capsids can be included in compositions (such as pharmaceutical compositions) and/or administered to subjects.
- An exemplary pharmaceutical composition comprising an AAV capsid according to this disclosure can include a pharmaceutically acceptable carrier such as balanced saline solution (BSS) and one or more surfactants (e.g., Tween 20) and/or a thermosensitive or reverse-thermosensitive polymer (e.g., pluronic).
- BSS balanced saline solution
- surfactants e.g., Tween 20
- thermosensitive or reverse-thermosensitive polymer e.g., pluronic
- Other pharmaceutical formulation elements known in the art may also be suitable for use in the compositions described here.
- Compositions comprising AAV vectors according to this disclosure can be administered to subjects by any suitable means, including without limitation injection, for example, subretinal injection or injection through the round window.
- the concentration of AAV vector within the composition is selected to ensure, among other things, that a sufficient AAV dose is administered to the retina or inner ear of the subject, taking account of dead volume within the injection apparatus and the relatively limited volume that can be safely administered.
- Suitable doses may include, for example, 1x10 11 viral genomes (vg)/mL, 2x10 11 viral genomes (vg)/mL, 3x10 11 viral genomes (vg)/mL, 4x10 11 viral genomes (vg)/mL, 5x10 11 viral genomes (vg)/mL, 6x10 11 viral genomes (vg)/mL, 7x10 11 viral genomes (vg)/mL, 8x10 11 viral genomes (vg)/mL, 9x10 11 viral genomes (vg)/mL, 1x10 12 vg/mL, 2x10 12 viral genomes (vg)/mL, 3x10 12 viral genomes (vg)/mL, 4x10 12 viral genomes (
- any suitable volume of the composition may be delivered to the subretinal or cochlear space.
- the volume is selected to form a bleb in the subretinal space, for example 1 microliter, 10 microliters, 50 microliters, 100 microliters, 150 microliters, 200 microliters, 250 microliters, 300 microliters, etc.
- Any region of the retina may be targeted, though the fovea (which extends approximately 1 degree out from the center of the eye) may be preferred in certain instances due to its role in central visual acuity and the relatively high concentration of cone photoreceptors there relative to peripheral regions of the retina.
- injections may be targeted to parafoveal regions (extending between approximately 2 and 10 degrees off center), which are characterized by the presence of all three types of retinal photoreceptor cells.
- injections into the parafoveal region may be made at comparatively acute angles using needle paths that cross the midline of the retina.
- injection paths may extend from the nasal aspect of the sclera near the limbus through the vitreal chamber and into the parafoveal retina on the temporal side, from the temporal aspect of the sclera to the parafoveal retina on the nasal side, from a portion of the sclera located superior to the cornea to an inferior parafoveal position, and/or from an inferior portion of the sclera to a superior parafoveal position.
- the use of relatively small angles of injection relative to the retinal surface may advantageously reduce or limit the potential for spillover of vector from the bleb into the vitreous body and, consequently, reduce the loss of the vector during delivery.
- the macula (inclusive of the fovea) can be targeted, and in other cases, additional retinal regions can be targeted, or can receive spillover doses.
- injection to the cochlear duct which is filled with high potassium endolymph fluid, could provide direct access to hair cells.
- alterations to this delicate fluid environment may disrupt the endocochlear potential, heightening the risk for injection- related toxicity.
- the perilymph-filled spaces surrounding the cochlear duct, scala tympani and scala vestibuli can be accessed from the middle ear, either through the oval or round window membrane (RWM).
- the RWM which is the only non-bony opening into the inner ear, is relatively easily accessible in many animal models and administration of viral vector using this route is well tolerated. Administration through the oval window or across the tympanic membrane can also be used. See, e.g., WO2017100791 and US7206639.
- systems, compositions, nucleotides and vectors according to this disclosure can be evaluated ex vivo using a human retinal explant system, or in vivo using an animal model such as a mouse, rabbit, pig, nonhuman primate, etc.
- Retinal explants are optionally maintained on a support matrix, and AAV vectors can be delivered by injection into the space between the photoreceptor layer and the support matrix, to mimic subretinal injection.
- Tissue for retinal explanation can be obtained from human or animal subjects, for example mouse.
- Explants are particularly useful for studying the expression of gRNAs and/or Cas9 following viral transduction, and for studying genome editing over comparatively short intervals. These models also permit higher throughput than may be possible in animal models, and can be predictive of expression and genome editing in animal models and subjects.
- Small (mouse, rat) and large animal models can be used for pharmacological and/or toxicological studies and for testing the systems, nucleotides, vectors and compositions of this disclosure under conditions and at volumes that approximate those that will be used in clinic.
- model systems are selected to recapitulate relevant aspects of human anatomy and/or physiology, the data obtained in these systems will generally (though not necessarily) be predictive of the behavior of AAV vectors and compositions according to this disclosure in human and animal subjects.
- Example 1 Efficient deletion of mouse Ush2A exon 12 splicing acceptor using paired- sgRNA in mice cells.
- Mouse organ of Corti HEI-OC1 cells were used as an in vitro cell line model to test the methods disclosed herein.
- HEI-OC1 cells are derived from mouse cochlea (Kalinec et al. (1999) Cell biology international 23(3):175-184; Kelley et al. (1993) Development 119(4):1041-1053).
- HEI-OC1 cells express USHERIN, making these cells particularly appropriate for these studies.
- CRISPR/Cas9 genome editing technology was used to induce mouse exon 12 or human exon 13 skipping in Ush2a/USH2A transcripts.
- the LONZA 4D- Nucleofector TM was used to deliver Cas9/sgRNA protein complex in to the cells. Transfection programs were optimized following manufacturer’s instruction (DS120, SG Cell Line 4D-Nucleofector TM X Kit). Purified sgRNA was incubated with Cas9 protein for 5 minutes before transfection. Media was replaced approximately 16 hours after nucleofection and cells were harvested for subsequent genomic DNA extraction after approximately 96 hours.
- WERI-RB1 human retinoblastoma-derived cell line
- WERI-RB1 cells express USHERIN.
- Multiple paired-sgRNA combinations were screened to test the deletion efficiency at human USH2A exon 13, with each pair of sgRNAs including one sgRNA targeting human USH2A intron 12 and the other targeting exon 13 (FIG. 1).
- the removel of the exon 13 splicing acceptor by paired sgRNAs should abolish the recognition of the remaining exon 13 as an exon, with the production of a USH2A transcript with exon 13 skipped (FIG.3D).
- SpCas9 protein and paired sgRNAs were combined to form RNPs and delivered into the cells by nucleofection.48 hours later, genomic DNA was extracted from the cells. Next, PCR and next generation sequencing (NGS) were performed to evaluate the deletion efficiency at the USH2A locus. NGS analysis showed that the acceptor targeting paired-sgRNA strategy resulted in deletion efficiency of 69% for sgL1/sgK4 pair (having target sequences corresponding to SEQ ID NO: 17 and SEQ ID NO: 313, respectively) and 84% for sgL1/sgK5 pair (having target sequences corresponding to SEQ ID NO: 17 and SEQ ID NO: 260, respectively) (FIG.3E-h).
- first-strand cDNA was produced using PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara) with random hexamers, following the manufacturer’s instructions. PCR was performed and results indicated that sgL1/sgK5 generated the highest exon 13 skipping induction efficiency (FIG.4B). Sanger sequencing of shorter fragment from DNA gels confirmed in-frame exon 13 skipping. NGS was performed on cDNA reverse transcribed from the USH2A transcripts in order to analyse different types of USH2A transcripts generated by genome editing.
- hiPSCs human induced pluripotent stem cells derived from a female USH2 patient were obtained.
- the cells carried homozygous c.2299delG mutations (FIG.5A).
- c.2299delG mutation is located in human USH2A exon 13 and is the most frequent pathogenic mutation observed in Usher syndrome patients.
- sgL1/sgK5 sgRNAs were used to induce USH2A exon 13 skipping in c.2299delG hiPSCs.
- PB-SAM donor plasmid (addgene, 102559) with the sgRNAs to activate USH2A expression was co-transfected with PiggyBac transposon vector (PB210PA, System Biosciences) in the c.2299delG hiPSCs after genome editing with the Cas9/sgL1/sgK5 RNP.
- Cells were cultured and selected in growth medium containing 10 ⁇ g/mL Blasticidin. Total mRNA was isolated, cRNA was reverse transcribed, and NGS and RT-PCR were performed in order to analyze expressed USH2A transcripts with exon 13 skipped.
- Example 4 Efficient exon skipping in human USH2A patient inner ear organoids.
- delG/delG delG/delG Wild-type hiPSCs, USH2A hiPSCs, and genome-edited USH2A hiPSCs were differentiated into inner ear organoids, which model human cochlea development in vivo. Differentiation of each of the three types of hiPSCs generated hair cell-containing inner ear organoids. On day 50, organoid samples were collected, total mRNA was extracted, and cDNA was reversed transcribed.
- AAV vectors targeting Ush2a exon 5 and exon 12 (which is equivalent to human USH2A exon 13) in the mice genome were designed.
- the AAVs vectors were administered to an Usher syndrome mouse model harborying a heterozygous Ush2a mutation (Ush2a +/- ).
- the hearing test demonstrated that exon 5 skipping, but not exon 12 skipping, can lead to hearing loss in the mouse model. This study indicated that the requirement of exon 5, but not exon 12, for functional USHERIN protein in normal hearing in the Usher syndrome mouse model.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Virology (AREA)
- Epidemiology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP23750204.2A EP4472675A4 (en) | 2022-02-04 | 2023-02-03 | EXON SKIPPING FOR THE TREATMENT OF USHER SYNDROME |
| US18/833,060 US20250108129A1 (en) | 2022-02-04 | 2023-02-03 | Exon skipping to treat Usher Syndrome |
| JP2024546064A JP2025506403A (ja) | 2022-02-04 | 2023-02-03 | アッシャー症候群を処置するためのエクソンスキッピング |
| CA3250864A CA3250864A1 (en) | 2022-02-04 | 2023-02-03 | EXON JUMPING TO TREAT USHER SYNDROME |
| CN202380031655.2A CN119325510A (zh) | 2022-02-04 | 2023-02-03 | 治疗厄舍综合征的外显子跳读 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263306833P | 2022-02-04 | 2022-02-04 | |
| US63/306,833 | 2022-02-04 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2023150272A2 true WO2023150272A2 (en) | 2023-08-10 |
| WO2023150272A3 WO2023150272A3 (en) | 2024-01-25 |
Family
ID=87552793
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2023/012284 Ceased WO2023150272A2 (en) | 2022-02-04 | 2023-02-03 | Exon skipping to treat usher syndrome |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20250108129A1 (https=) |
| EP (1) | EP4472675A4 (https=) |
| JP (1) | JP2025506403A (https=) |
| CN (1) | CN119325510A (https=) |
| CA (1) | CA3250864A1 (https=) |
| WO (1) | WO2023150272A2 (https=) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11028388B2 (en) * | 2014-03-05 | 2021-06-08 | Editas Medicine, Inc. | CRISPR/Cas-related methods and compositions for treating Usher syndrome and retinitis pigmentosa |
| WO2019123430A1 (en) * | 2017-12-21 | 2019-06-27 | Casebia Therapeutics Llp | Materials and methods for treatment of usher syndrome type 2a and/or non-syndromic autosomal recessive retinitis pigmentosa (arrp) |
| AU2018393050A1 (en) * | 2017-12-21 | 2020-06-18 | Bayer Healthcare Llc | Materials and methods for treatment of Usher Syndrome Type 2A |
| EP4143315A1 (en) * | 2020-04-28 | 2023-03-08 | The Broad Institute Inc. | <smallcaps/>? ? ?ush2a? ? ? ? ?targeted base editing of thegene |
-
2023
- 2023-02-03 JP JP2024546064A patent/JP2025506403A/ja active Pending
- 2023-02-03 WO PCT/US2023/012284 patent/WO2023150272A2/en not_active Ceased
- 2023-02-03 CN CN202380031655.2A patent/CN119325510A/zh active Pending
- 2023-02-03 CA CA3250864A patent/CA3250864A1/en active Pending
- 2023-02-03 EP EP23750204.2A patent/EP4472675A4/en active Pending
- 2023-02-03 US US18/833,060 patent/US20250108129A1/en active Pending
Also Published As
| Publication number | Publication date |
|---|---|
| CN119325510A (zh) | 2025-01-17 |
| WO2023150272A3 (en) | 2024-01-25 |
| US20250108129A1 (en) | 2025-04-03 |
| EP4472675A2 (en) | 2024-12-11 |
| CA3250864A1 (en) | 2023-08-10 |
| JP2025506403A (ja) | 2025-03-11 |
| EP4472675A4 (en) | 2025-12-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20250346875A1 (en) | CRISPR/Cas9-Mediated Exon-Skipping Approach for USH2A-Associated Usher Syndrome | |
| CN112020561A (zh) | 用于治疗人受试者中非年龄相关的听力损害的组合物和方法 | |
| EP3762040A1 (en) | Compositions and methods for delivering nucleic acids to cochlear and vestibular cells | |
| US20260000787A1 (en) | Methods of treating non-syndromic sensorineural hearing loss | |
| US12410440B2 (en) | ABCA4 trans-splicing molecules | |
| US20250108129A1 (en) | Exon skipping to treat Usher Syndrome | |
| US20220395583A1 (en) | Compositions and methods for gene replacement | |
| WO2025227102A1 (en) | Crispr/cas9-mediated exon-skipping for ush2a-associated usher syndrome | |
| Hassall et al. | Retinal Gene Therapy | |
| Malerba et al. | Gene therapy for oculopharyngeal muscular dystrophy | |
| WO2024233941A1 (en) | Base editing approaches to treat abca4-associated stargardt disease | |
| LLADO SANTAEULARIA | THERAPEUTIC GENOME EDITING IN RETINA AND LIVER | |
| HK40123798A (en) | Crispr/cas9-mediated exon-skipping approach for ush2a-associated usher syndrome | |
| TW202532649A (zh) | 用於治療具有缺陷耳畸蛋白基因之人類個體之聽力損失的組合物及方法 | |
| TW202417634A (zh) | 用於治療人類個體非年齡相關聽力障礙之組合物及方法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23750204 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 18833060 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2024546064 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202417063855 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2023750204 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2023750204 Country of ref document: EP Effective date: 20240904 |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23750204 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202380031655.2 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 202380031655.2 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 18833060 Country of ref document: US |