WO2023148256A1 - Vaccin à virus sars-cov-2 inactivé - Google Patents

Vaccin à virus sars-cov-2 inactivé Download PDF

Info

Publication number
WO2023148256A1
WO2023148256A1 PCT/EP2023/052534 EP2023052534W WO2023148256A1 WO 2023148256 A1 WO2023148256 A1 WO 2023148256A1 EP 2023052534 W EP2023052534 W EP 2023052534W WO 2023148256 A1 WO2023148256 A1 WO 2023148256A1
Authority
WO
WIPO (PCT)
Prior art keywords
cov
sars
vaccine
dose
inactivated
Prior art date
Application number
PCT/EP2023/052534
Other languages
English (en)
Original Assignee
Valneva Austria Gmbh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Valneva Austria Gmbh filed Critical Valneva Austria Gmbh
Publication of WO2023148256A1 publication Critical patent/WO2023148256A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A61K39/215—Coronaviridae, e.g. avian infectious bronchitis virus
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/20—Antivirals for DNA viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5252—Virus inactivated (killed)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55505—Inorganic adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55516—Proteins; Peptides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55555—Liposomes; Vesicles, e.g. nanoparticles; Spheres, e.g. nanospheres; Polymers
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55577—Saponins; Quil A; QS21; ISCOMS
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/572—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 cytotoxic response
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/575—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
    • C12N2750/00011—Details
    • C12N2750/14011—Parvoviridae
    • C12N2750/14311—Parvovirus, e.g. minute virus of mice
    • C12N2750/14322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/20011—Coronaviridae
    • C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/24011—Flaviviridae
    • C12N2770/24111—Flavivirus, e.g. yellow fever virus, dengue, JEV
    • C12N2770/24134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the disclosure relates to SARS-CoV-2 vaccines and compositions and methods for producing said vaccines and administering the vaccines to subjects for the generation of an anti-SARS-CoV-2 immune response.
  • Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2; hereinafter the “virus”) was detected for the first time in China around November 2019. Since then, the virus has caused a global pandemic. The natural reservoir are bats and the virus belongs to the Coronaviridae family, genus Betacoronavirus (betaCoV). The virus has a ssRNA genome, 29,903 bp (wild type, Wuhan-Hu-1: GenBank Reference sequence: NC_045512.2 and MN908947; A new coronavirus associated with human respiratory disease in China. 2020 Wu, et al.
  • the virus has a variable size of between 60 to 140 nm in diameter. It is enveloped and sensitive to UV, heat, and lipid solvents. It has 89% nucleotide identity with bat SARS-like-CoVZXC21 and 81% nucleotide identity with human SARS-CoV. Evidence suggests that this virus spreads when an infected person coughs small droplets - packed with the virus - into the air.
  • SARS-CoV-2 virus infection also herein referred to as COVID-19, COVID or COVID-19 disease
  • COVID-19, COVID or COVID-19 disease may be mild, and include typically fever and cough, it can also be asymptomatic or in the other extreme it can be severe or fatal, i.e. lethal.
  • the key symptoms are usually high temperature, cough and breathing difficulties.
  • a universal vaccine based on a classical inactivation approach of the virus or virus mixture wherein the virus is optimized for high volume manufacturing could serve as such a vaccine, providing protection against various strains of SARS-CoV-2 as well as giving subjects a choice of using a well-established vaccine technology.
  • the present invention provides an improved inactivated SARS-CoV-2 vaccine capable of generating neutralizing antibodies against a native homologous and/or heterologous SARS-CoV-2 particles and/or is capable of raising an effective T-Cell response against a native homologous and/or heterologous SARS-CoV-2 particle in a human subject.
  • SARS-CoV-2 vaccine capable of generating neutralizing antibodies against a native homologous and/or heterologous SARS-CoV-2 particles and/or is capable of raising an effective T-Cell response against a native homologous and/or heterologous SARS-CoV-2 particle in a human subject.
  • subunit vaccines e.g. encoding the SARS-CoV-2 S protein or fragments thereof
  • live attenuated vaccines or recombinant DNA or RNA vaccines encoding viral proteins are examples of subunit vaccines (e.g. encoding the SARS-CoV-2 S protein or fragments thereof), live attenuated vaccines or recombinant
  • a further drawback of the existing vaccines is the emerging variants or variants of concern (“VOC”; see WHO definition) for which the existing vaccines do not provide a good or only a reduced protection. Furthermore, it seems that frequent boostering (e.g. every 4 months) is required by the existing vaccines, e.g. mRNA vaccines to provide for an ongoing protection.
  • the present invention aims to address these problems and thus to produce a safe and effective whole virus, inactivated SARS-CoV-2 vaccine that overcomes the drawbacks of the prior art.
  • the present invention provides a SARS-CoV-2 vaccine comprising at least two or exactly two different beta-propiolactone-inactivated SARS-CoV-2 particles; wherein the vaccine is capable of generating neutralizing antibodies to a native homologous and/or heterologous SARS-CoV- 2 particle and/or is capable of raising an effective T-Cell response against a native homologous and/or heterologous SARS-CoV-2 particle in a human subject.
  • a native surface conformation of the SARS-CoV-2 particle is preserved in the vaccine and/or the furin cleavage site activity is reduced or eliminated by passaging out the furin site and/or introducing mutations in the cleavage site.
  • the present invention provides a SARS-CoV-2 vaccine comprising at least two or exactly two different beta-propiolactone-inactivated SARS-CoV-2 particles; wherein a native surface conformation of the SARS-CoV-2 particle is preserved in the vaccine, such that the vaccine is capable of generating neutralizing antibodies against native SARS-CoV-2 particles and/or other immunological responses in a human subject that are able to protect partly or fully more than 50%, preferably more than 60%, more than 70%, more than 80%, more than 90% of said vaccinated human subjects.
  • the present invention aims to provide optimally inactivated SARS-CoV-2 particles, which are incapable of replication and infection of human cells, but which retain immunogenic epitopes of viral surface proteins and are thus suitable for generating protective immunity in vaccinated subjects.
  • a novel vaccine composition can be obtained that preserves a native surface conformation of SARS-CoV-2 particles and which reduces the risk of negative effects such as ADE, VAERD, ERD and immunopathology.
  • Such vaccine compositions are described in more detail below.
  • the invention aims to provide an optimal combination of optimally inactivated different SARS-CoV-2 particles, which are incapable of replication and infection of human cells, but which retain immunogenic epitopes of viral surface proteins and are thus suitable for generating protective immunity in vaccinated subjects.
  • an improved vaccine composition can be obtained that is capable of generating neutralizing antibodies against a native homologous and/or heterologous SARS- CoV-2 particle and/or is capable of raising an effective T-Cell response against a native homologous and/or heterologous SARS-CoV-2 particle in a human subject that are able to protect partly or fully more than 50%, preferably more than 60%, more than 70%, more than 80%, more than 90% of said vaccinated human subjects.
  • Steps include cell buildup of Vero host cells, infection of Vero cells with SARS-CoV-2, virus harvest, DNA reduction, primary inactivation, purification, optional secondary inactivation and formulation with adjuvant.
  • Figure 3 A preferred set-up for the sucrose gradient centrifugation used as a polishing step for the SARS-CoV-2 vaccine of the invention.
  • Figure 4 Total IgG in response to SARS-CoV-2 vaccine. Coating antigens: SI (A), receptor binding domain of spike protein (B) and nucleoprotein (C). Endpoint titer: absorbance of 3 -fold the blank used as cut-off (dashed line).
  • FIG. 6 Production process delivers high density and intact spike proteins. Shown are electron micrographs of the SARS-CoV-2 inactivated drug substance produced according to Example 1. About 1-1.5 10 7 viral particles per AU.
  • Figure 7 Comparison of Size-Exclusion-Chromatography and SDS-PAGE profiles of SARS-CoV-2 and JEV drug substance. High purity (>95%) according to SDS-PAGE (silver stain, reduced) and monomer virus (>95%) according to SE-HPLC. Difference in retention time due to different virus particle size (JEV (IXIARO) about 50nm, SARS-CoV-2 about lOOnm).
  • Figure 8. A) DNA sequence corresponding to the RNA sequence of a wild type isolate, also referred to as Wuhan or reference sequence (SEQ ID NO: 1); B) DNA sequence corresponding to the RNA sequence of a wild type isolate from INMI (SEQ ID NO: 9).
  • Figure 9 DNA sequence corresponding to the RNA sequence of a Delta typed isolate B.1.617.2 (SEQ ID NO: 2).
  • FIG. 11 DNA sequence corresponding to the RNA sequence of an Omicron typed isolate (SEQ ID NO: 4). (Rega-20174.2 rega-20174 Severe acute respiratory syndrome coronavirus 2, hCoV- 19/Belgium/rega-20174/2021
  • FIG 16. Phase 2/3 clinical study design described in Example 10.
  • Primary endpoints refer to a) GMT fold-rise for neutralizing antibodies against SARS-CoV-2 at Day 15 following a single booster dose with monovalent SARS-CoV-2 vaccine, and b) Frequency and severity of solicited AEs (local and systemic reactions) within 7 days after the booster vaccination with monovalent SARS-CoV-2 vaccine.
  • Figure 17. Study design for NHP challenge study. Three groups of 8 animals each; Two dose groups for SARS-CoV-2 vaccine (10 AU & 40 AU, formulated with 0.5 mg/dose Al 3+ and 1 mg Thl responsestimulating adjuvant per dose added directly before administration) and a placebo group (DPBS).
  • DPBS placebo group
  • the SARS-CoV-2 challenge strain is BetaCoV/France/IDF/0372/2020 (Maisonmasse et al., Hydroxychloroquine use against SARS-CoV-2 infection in non-human primates, 2020, Nature 585:584-587).
  • Methods and timing of testing Hematology on d-28, dO, d7, dl4, d21, d28, d35, d47, d49, d50, d51, d54, d62.
  • T cell response (ICS, EUISPOT) on d-28, dO, dl4, d35, d54, d62.
  • Cytokine response (LUMINEX) on d47, d49, d50, d51, d54, d62.
  • SWABS viral load (qRT-PCR-genomic + subgenomic): nasal & tracheal swabs on d35, d49, d50, d51, d54, d57, d62; rectal swabs at baseline and on d2, d7, d 15.
  • BAL viral load (qRT-PCR-genomic + subgenomic): d50.
  • Euthanasia lung harvest, viral load (qRT-PCR - genomic + subgenomic): d54, d62.
  • Embodiments of the present invention are directed to a SARS-CoV-2 vaccine or immunogenic composition comprising at least two or exactly two different inactivated SARS-CoV-2 particles.
  • the inactivated SARS-CoV-2 particles are whole virus, inactivated particles, i.e. the inactivated virus particles are derived from whole native SARS-CoV-2 particles that have been inactivated.
  • SARS-CoV-2 refers to the SARS-CoV-2 virus and “SARS-CoV-2 particles” typically refers to whole SARS-CoV-2 viral particles, i.e. virions and includes also variants of SARS-CoV-2.
  • the SARS-CoV-2 particles are inactivated without substantially modifying their surface structure.
  • a native surface conformation of the SARS-CoV-2 particles is retained in the inactivated virus particles. It has been found that by optimizing an inactivation process, e.g. using beta-propiolactone, infectivity of native SARS-CoV-2 particles can be substantially abrogated without adversely affecting their antigenicity and/or immunogenicity.
  • an inactivated virus vaccine e.g.
  • a beta-propiolactone - inactivated virus vaccine that is capable of generating neutralizing antibodies against a native homologous and/or heterologous SARS-CoV-2 particle and/or is capable of raising an effective T-Cell response against a native homologous and/or heterologous SARS-CoV-2 particle in a human subject.
  • the SARS-CoV-2 particles are inactivated by a method that preferentially targets viral RNA.
  • the inactivation step modifies viral RNA more than viral proteins.
  • the inactivated SARS-CoV-2 particles may comprise replication-deficient viral RNA, i.e. the viral RNA is modified in the inactivation step such that the inactivated particles are incapable of replicating.
  • the inactivation method spares viral (surface) proteins relative to viral RNA, e.g. the viral surface proteins (e.g. the spike (S) protein) may comprise fewer or more infrequent modifications resulting from the inactivation step compared to viral RNA.
  • the viral surface proteins e.g. the spike (S) protein
  • a lower proportion of amino acid residues in the viral surface proteins may be modified by the inactivation step compared to the proportion of modified nucleotide residues in the viral RNA.
  • the proportion of modified amino acid residues in the viral surface proteins (e.g. S protein) may be at least 5%, 10%, 20%, 30%, 50%, 70% or 90% lower than the proportion of modified nucleotide residues in the viral RNA.
  • modifications or “modified residues” it is meant to refer to non-native residues that are not present in the native SARS-CoV-2 particles, e.g. chemical (covalent) modifications of such residues resulting from the inactivation step.
  • the viral RNA is inactivated by alkylation and/or acylation, i.e. the modifications in the SARS-CoV-2 inactivated particles comprise alkylated and/or acylated nucleotide residues.
  • the modifications are preferentially targeted to purine (especially guanine) residues, e.g. the SARS-CoV-2 inactivated particles comprise one or more modified (e.g. alkylated or acylated) guanine residues.
  • the inactivation step may lead to cross-linking of viral RNA with viral proteins, e.g. via guanine residues in the viral RNA.
  • the inactivation step may also introduce nicks or strand breaks into viral RNA, e.g. resulting in fragmentation of the viral genome.
  • the inactivating agent comprises beta-propiolactone, i.e. the vaccine comprises beta-propiolactone-inactivated virus particles.
  • beta-propiolactone herein referred to also as “BPL”) treatment is particularly preferred according to the present invention, because it results in SARS-CoV- 2 particles, that are substantially inactive, but which retain high antigenicity and immunogenicity against neutralizing epitopes present in native SARS-CoV-2.
  • BPL beta-propiolactone
  • beta-propiolactone can be used to inactivate SARS-CoV-2 particles with a minimum number of protein modifications.
  • inactivation of SARS-CoV-2 particles using beta-propiolactone results in a much lower number of modifications of viral proteins compared to inactivation of influenza particles by beta-propiolactone.
  • beta- propiolactone-inactivated SARS-CoV-2 particles a native surface conformation of the viral particles can be preserved.
  • the viral RNA is inactivated in an optimized manner, i.e. such it is just sufficiently inactivated not to be infectious anymore but not “over”-inactivated so that numerous modification at different amino acids in particular at the S-protein occur.
  • the BPL inactivation not only sufficiently inactivates (but not overinactivates) the SARS-CoV-2 virus but also just sufficiently inactivates viruses that might be coenriched and co-cultured in the manufacturing process (see e.g. experimental part).
  • a particularly hard virus to inactivate that can co-culture and be co-enriched is PPV (porcine parvovirus) - see experimental part.
  • the concentration of beta-propiolactone in the inactivation step may be optimized to ensure complete inhibition of viral replication whilst preserving the conformation of surface proteins in the virus.
  • the concentration of beta-propiolactone in the inactivation step may be e.g. 0.01 to 1% by weight, preferably 0.01 to 0. 1% by weight, more preferably about 0.03% by weight.
  • a preferred amount of BPL was found to be 500ppm where the SARS-CoV-2 virus but also other concerning viruses/impurities are inactivated whilst preserving (i.e. not modifying) most of the amino acids of the S-protein (i.e. only a few amino acids were shown to be modified at low probability).
  • the native SARS-CoV-2 particles may be contacted with beta-propiolactone for at least 5 hours, at least 10 hours, at least 24 hours or at least 4 days, e.g. 5 to 24 hours or longer such as 48 hours.
  • the inactivation step may be performed at about 0°C to about 25°C, preferably about 4°C or about 22°C, or e.g. 18 to 24°C.
  • the inactivation step e.g. with beta- propiolactone
  • the inactivation step may optionally and preferably be followed by a hydrolyzation step of the inactivating agent, as is known in the art (which may be performed e.g.
  • the inactivation step may be performed for e.g. the shortest time necessary in order to produce a fully inactivated virus particle.
  • the inactivated viral solution was in one embodiment immediately cooled down to 5 ⁇ 3°C and stored there until inactivation was confirmed by large volume plaque assay and serial passaging assay. Further information on beta-propiolactone inactivation of SARS-CoV-2 may be found in WO2021/204825A3, which is incorporated herein by reference in its entirety.
  • Beta-propiolactone inactivation of SARS-CoV-2 particles may preferentially modify cysteine, methionine and/or histidine residues.
  • the inactivated SARS-CoV-2 particle comprises one or more beta-propiolactone-modified cysteine, methionine and/or histidine residues.
  • the beta-propiolactone-inactivated SARS-CoV-2 particles show relatively few protein modifications.
  • an inactivated SARS-CoV-2 particle in the vaccine may comprise fewer than 200, 100, 50, 30, 20, 15, 10, 9, 8, 7 or 6 beta- propiolactone -modified amino acid residues.
  • a spike (S) protein of the inactivated SARS- CoV-2 particle comprises fewer than 100, 50, 30, 20, 15, 10, 9, 8, 7 or 6 beta-propiolactone-modified amino acid residues. More preferably the inactivated SARS-CoV-2 particle or spike protein thereof comprises 20 or fewer, 15 or fewer, 10 or fewer, or 5 or fewer beta-propiolactone-modified amino acid residues. Most preferably the inactivated SARS-CoV-2 particle or spike protein thereof comprises 1 to 100, 2 to 70, 3 to 50, 4 to 30, 5 to 25, 5 to 20, 10 to 20 or about 15 beta-propiolactone-modified amino acid residues.
  • fewer than 20%, 15%, 10%, 5% or 4% of SARS-CoV-2 polypeptides are beta- propiolactone-modified.
  • 0.1 to 10%, 1 to 8%, 2 to 7% or about 3%, 4%, 5% or 6% of SARS-CoV-2 polypeptides in the particle may be beta-propiolactone-modified.
  • Beta-propiolactone modification of residues and/or polypeptides in the vaccine may be detected by mass spectrometry, e.g. using liquid chromatography with tandem mass spectrometry (LC-MS-MS), for instance using a method as described in Examples 6 and 7.
  • LC-MS-MS liquid chromatography with tandem mass spectrometry
  • the SARS-CoV-2 particles may be digested in order to fragment proteins into SARS-CoV-2 polypeptides for LC-MS-MS analysis.
  • the digestion step may be performed by any suitable enzyme or combination of enzymes, e.g. by trypsin, chymotrypsin and/or PNGase F (peptide:N-glycosidase F), or by e.g. acid hydrolysis.
  • the percentage of BPL-modified polypeptides detected by LC-MS-MS following enzymatic digestion or acid hydrolysis is: (a) trypsin digestion, 1 to 5%, 2 to 4% or about 3%; (b) trypsin + PNGase F digestion, 1 to 5%, 2 to 4% or about 3%; (c) chymotrypsin, 1 to 10%, 3 to 8% or about 6% ; (d) acid hydrolysis, 1 to 6%, 2 to 5% or about 4%.
  • a “beta-propiolactone-modified” polypeptide means that the polypeptide comprises at least one beta-propiolactone modification, e.g. at least one beta- propiolactone-modified residue.
  • a spike (S) protein of the inactivated SARS-CoV-2 particle comprises a beta- propiolactone modification at one or more of the following residues: 49, 146, 166, 177, 207, 245, 379, 432, 519, 625, 1029, 1032, 1058, 1083, 1088, 1101, 1159 and/or 1271, e.g. in SEQ ID NO: 5, or a corresponding position in SEQ ID NO: 2, 3, 4.
  • the inactivated SARS-CoV-2 particle comprises a beta-propiolactone modification at one or more of the following residues: H49, H146, C166, M177, H207, H245, C432, H519, H625, M1029, H1058, H1083, H1088, Hl 101, Hl 159 and/or Hl 271, e.g. in SEQ ID NO: 5, or a corresponding position in another variant inactivated SARS-CoV-2 particle.
  • the inactivated SARS-CoV-2 particle comprises a beta-propiolactone modification at one or more of the following residues: H207, H245, C379, M1029 and/or C1032, e.g.
  • a corresponding position it is meant a corresponding position in another variant inactivated SARS- CoV-2 particle that aligns with position H207, H245, C379, M1029 and/or C1032 in SEQ ID NO: 5, e.g. when such a corresponding sequence is aligned with SEQ ID NO: 5 using a program such as NCBI Basic Local Alignment Search Tool (BLAST).
  • BLAST NCBI Basic Local Alignment Search Tool
  • a membrane (M) glycoprotein of the inactivated SARS-CoV-2 particle comprises a beta-propiolactone modification at one or more of the following residues: 125, 154, 155, 159 and/or 210, preferably H154, H155, C159 and/or H210.
  • a nucleocapsid (N) protein of the inactivated SARS-CoV-2 particle comprises a beta-propiolactone modification at M234.
  • fewer than 30%, 20%, 10%, 5%, 3% or 1% of one or more of the following residues in the inactivated SARS-CoV-2 particles are beta-propiolactone modified: (i) in the spike (S) protein, e.g.
  • fewer than 30%, 20%, 10%, 5%, 3% or 1% of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or each of the above residues in the inactivated SARS-CoV-2 particles are beta-propiolactone modified.
  • the percentage of modified residues is intended to refer to the site occupancy, e.g. the ratio of modified to unmodified peptide for the same modification site normalized to the protein abundance as described in Examples 6 and/or 7 below.
  • the proportion of beta-propiolactone-modified residues (i.e. site occupancy) at the following positions in the inactivated SARS-CoV-2 particles is:
  • H245 less than 10%, preferably 0.1 to 5%;
  • (j) M234 less than 90%, less than 10% or less than 0. 1%.
  • the proportion of beta-propiolactone-modified residues (i.e. site occupancy) at each of the following positions in the spike (S) protein e.g. of SEQ ID NO: 5, or a corresponding position in a variant of the inactivated SARS-CoV-2 particles is:
  • residues M177, C432, H625 less than 30%, preferably 0.1 to 20%, more preferably 1 to 10%;
  • the proportion of beta-propiolactone-modified amino acid residues in the inactivated SARS-CoV-2 particle may be at least 5%, 10%, 20%, 30%, 50%, 70% or 90% lower than the proportion of modified residues in a beta-propiolactone-inactivated influenza particle (or hemagglutinin (HA) or neuraminidase (NA) protein thereof), e.g. in an influenza particle that has been inactivated under similar conditions to the SARS-CoV-2 particle.
  • HA hemagglutinin
  • NA neuraminidase
  • the viral RNA may be inactivated by treatment with ultraviolet (UV) light.
  • UV treatment can be used to preferentially target RNA (compared to polypeptides) in the viral particles, resulting in e.g. modified nucleotides and/or fragmentation.
  • UV treatment can be combined with beta-propiolactone treatment to improve inactivation of the virus, e.g. a beta-propiolactone treatment step can be followed by a UV treatment step or vice versa, or a UV treatment step can be performed at the same time as the beta-propiolactone treatment step.
  • the native SARS-CoV-2 particles may be inactivated using formaldehyde.
  • formaldehyde inactivation is typically less preferred in the present invention, as it is less suitable for preferentially targeting viral RNA and preserving immunogenic epitopes in the viral surface proteins.
  • the inactivation step(s) are performed under mild conditions in order to preserve surface antigen integrity, especially integrity of the S protein.
  • such a mild inactivation method comprises contacting a liquid composition comprising native SARS-CoV-2 particles with a chemical viral inactivating agent (such as e.g. any of the chemical inactivation agents as listed above or a combination, for instance formaldehyde or preferably beta-propiolactone) in a container, mixing the chemical viral inactivating agent and the liquid composition comprising SARS-CoV-2 particles under conditions of laminar flow but not turbulent flow, and incubating the chemical viral inactivating agent and the liquid composition comprising SARS- CoV-2 particles for a time sufficient to inactivate the viral particles.
  • the mild inactivation step is optionally performed in a flexible bioreactor bag.
  • the mild inactivation step preferably comprises 5 or less container inversions during the period of inactivation.
  • the mixing of the chemical viral inactivating agent and the composition comprising native SARS-CoV-2 particles comprises subjecting the container to rocking, rotation, orbital shaking, or oscillation for not more than 10 minutes at not more than 10 rpm during the period of incubation.
  • the inactivation step substantially eliminates infectivity of mammalian (e.g. human) cells by the inactivated SARS-CoV-2 particle.
  • infectivity of mammalian cells may be reduced by at least 99%, 99.99% or 99.9999% as compared to a native SARS-CoV-2 particle, or infectivity of human cells by the inactivated A SARS-CoV-2 particle may be undetectable.
  • Standard assays may be used for determining residual infectivity and effective viral titer, e.g. plaque assays, determination of TCID50 (50% tissue culture infectious dose).
  • the mammalian cells may be MDCK, COS or Vero cells.
  • a native surface conformation of the SARS-CoV-2 particles is preserved in the inactivated virus particles.
  • e.g. one or more or all immunogenic (neutralizing) epitopes are retained in the inactivated virus particles, such that the inactivated particles are capable of generating neutralizing antibodies against native SARS-CoV-2 particles when administered to a human subject.
  • native surface conformation it is meant to refer to the surface conformation found in native SARS-CoV-2 particles, i.e. SARS-CoV-2 particles (virions) that have not been inactivated.
  • the property of the vaccine or inactivated SARS-CoV-2 particles in generating neutralizing antibodies in a subject may be determined using e.g. a plaque reduction neutralization test (PRNT assay), e.g. using a serum sample from the subject as known in the art.
  • PRNT assay plaque reduction neutralization test
  • the present invention comprises that a native conformation of (i) spike (S) protein; (ii) nucleocapsid (N) protein; (iii) membrane (M) glycoprotein; and/or (iv) envelope (E) protein is preserved in the inactivated viral particles.
  • the inactivated SARS-CoV-2 particle comprises a native conformation spike (S) protein.
  • the S (and/or N and/or M and/or E) protein in the inactivated SARS-CoV-2 particle preferably comprises one or more or all (intact) immunogenic (neutralizing) epitopes present in native SARS-CoV-2 particles.
  • the S (and/or N and/or M and/or E) protein in the inactivated viral particles is not modified, or not substantially modified by the inactivation step.
  • preservation of the surface conformation of the viral particles can be assessed using standard techniques. For instance, methods such as X-ray crystallography, MS analysis (shift of amino acid mass by modification) and cryo-electron microscopy may be used to visualize the virus surface.
  • the secondary and tertiary structures of proteins present on the surface of viral particles may also be analyzed by methods such as by circular dichroism (CD) spectroscopy (e.g. in the far (190-250 nm) UV or near (250-300 nm) UV range).
  • CD circular dichroism
  • preservation of a native surface conformation can be confirmed by using antibodies directed against epitopes present on the native viral surface, e.g. in the S protein. Cross-reaction of anti-SARS-CoV-2 antibodies between the inactivated and native virus particles can thus be used to demonstrate retention of potentially neutralizing epitopes in the vaccine.
  • SARS-CoV-2 virions and in particular the spike (S) protein is known, and has been published in several recent studies. See for instance Shang, J. et al. (Structural basis of receptor recognition by SARS-CoV-2. Nature https://doi.org/10.1038/s41586-020-2179-y (2020)), which describes the crystal structure of the SARS-CoV-2 receptor binding domain. In addition, Walls et al.
  • SARS-CoV-2 nucleocaspid (N) protein which has been confirmed as an important antigen in studies using convalescent sera (Zeng W et al. Biochemical characterization of SARS-CoV- 2 nucleocapsid protein. 2020 BBRC 527(3): 618-623). Further guidance with regard to potentially important SARS-CoV-2 epitopes is available in the COVIEdb database, a compilation of information from coronavirus epitope mapping studies (http://biopharm.zju.edu.cn/coviedb/; Wu J COVIEdb: A Database for Potential Immune Epitopes of Coronaviruses. 2020 Front. Pharmacol. 11:572249; doi: 10.3389/fphar.2020.572249).
  • Monoclonal antibodies against SARS-CoV-2 surface epitopes are described in the literature (e.g. as mentioned above), available from commercial sources and/or can be generated using standard techniques, such as immunization of experimental animals.
  • SARS-CoV-2 surface epitopes are described in the literature (e.g. as mentioned above), available from commercial sources and/or can be generated using standard techniques, such as immunization of experimental animals.
  • MyBioSource, Inc. San Diego, CA
  • MBS857474747 see www.MyBioSource.com
  • SARS-CoV-2 Monoclonal antibodies against SARS-CoV-2 surface epitopes
  • SARS-CoV-2 surface epitopes are described in the literature (e.g. as mentioned above), available from commercial sources and/or can be generated using standard techniques, such as immunization of experimental animals.
  • MyBioSource, Inc. San Diego, CA
  • MBS857474747 see www.MyBioSource.com
  • SARS-CoV-2 were available from Sino Biological
  • a skilled person can detect preservation of a native surface conformation of SARS-CoV-2 (or e.g. the S or N protein thereof) via cross-reaction of such antibodies with the inactivated particles.
  • the inactivated particles bind specifically to one or more anti-SARS-CoV-2 antibodies directed against surface epitopes, preferably anti-S-protein antibodies, e.g. to antibodies generated against neutralizing epitopes in native SARS-CoV-2 virions.
  • the SARS-CoV-2 particles in the vaccine composition may be derived from any known strain of SARS- CoV-2 and one or more variants thereof.
  • the two or more viruses may be selected from a strain as defined in Figure 2 or 8 to 11, or may comprise a nucleotide or amino acid sequence as defined therein, or a variant sequence having at least e.g. 95% sequence identity thereto.
  • the SARS-CoV-2 particle comprises an RNA sequence corresponding to a DNA sequence (i) as defined in SEQ ID NO: 1.
  • the SARS-CoV-2 particle comprises an RNA sequence corresponding to a DNA sequence (i) as defined in SEQ ID NO: 9.
  • the defined DNA sequence is an equivalent of the viral RNA sequence, i.e. is a DNA or cDNA sequence that encodes the viral RNA or a sequence complementary to the viral RNA.
  • the inactivation process may result in modification (e.g. alkylation or acylation) and/or fragmentation of viral RNA, and thus it will be understood that the inactivated viral particles may not comprise an intact RNA sequence as defined herein, but rather are derived from native viral particles which do comprise such a sequence.
  • the SARS-CoV-2 particles may also comprise variants of the known SARS-CoV-2 Wuhan-Hu-1 lineage or also referred to as the reference lineage or the INMI isolate, e.g. sequences having at least 85%, at least 90%, at least 95% or at least 99% sequence identity to SEQ ID NO: 1 and/or NCBI Reference Sequence NC_045512.2 or MN908947 or sequences having at least 85%, at least 90%, at least 95% or at least 99% sequence identity to SEQ ID NO: 9 and/or NCBI accession number MT066156.
  • the variant sequence encodes an infectious SARS-CoV-2 particle, e.g. a native (non-inactivated) SARS-CoV-2 particle comprising the RNA sequence that is able to pack a virulent SARS-CoV-2 virus.
  • SARS-CoV-2 particles may also comprise variants of the known SARS-CoV-2 such as variants of concern (see e.g. SARS-CoV-2 variants of concern as of 27 January 2022 (europa.eu)): South African lineage B. 1.351 (WHO label: Beta), e.g. sequences having at least 85%, at least 90%, at least 95% or at least 99% sequence identity to NCBI Reference Sequence MW598408.
  • the variant sequence encodes an infectious SARS-CoV-2 particle, e.g. a native (non-inactivated) SARS- CoV-2 particle comprising the RNA sequence that is able to pack a virulent SARS-CoV-2 virus.
  • variants of the known SARS-CoV-2 South African lineage B.1.351 are given in Figure 2.
  • SARS-CoV-2 particles may also comprise variants ofthe known SARS-CoV-2 Brazilian lineage P.l (WHO label: Gamma), e.g. sequences having at least 85%, at least 90%, at least 95% or at least 99% sequence identity to NCBI Reference Sequence MW520923.
  • the variant sequence encodes an infectious SARS-CoV-2 particle, e.g. a native (non-inactivated) SARS-CoV-2 particle comprising the RNA sequence that is able to pack a virulent SARS-CoV-2 virus.
  • variants of the known SARS-CoV-2 Brazilian lineage P. 1 are given in Figure 2.
  • SARS-CoV-2 particles may also comprise variants of the known SARS-CoV-2 UK lineage B.1. 1.7, e.g. sequences having at least 85%, at least 90%, at least 95% or at least 99% sequence identity to NCBI Reference Sequence MW422256.
  • the variant sequence encodes an infectious SARS-CoV-2 particle, e.g. a native (non-inactivated) SARS-CoV-2 particle comprising the RNA sequence that is able to pack a virulent SARS-CoV-2 virus.
  • variants of the known SARS-CoV-2 UK lineage B.l.1.7 are given in Figure 2.
  • SARS-CoV-2 particles may also comprise variants of the known SARS-CoV-2 India lineages B.1.617.2 (WHO label: Delta), e.g. sequences having at least 85%, at least 90%, at least 95% or at least 99% sequence identity to SEQ ID NO: 2 or more generally a SARS-CoV-2 with a S-protein with spike mutations of interest: E452R. T478K. D6 I4G. P68 IR.
  • the variant sequence encodes an infectious SARS-CoV-2 particle, e.g. a native (non-inactivated) SARS-CoV-2 particle comprising the RNA sequence that is able to pack a virulent SARS-CoV-2 virus.
  • variants of the known SARS-CoV-2 Californian lineages are listed in Figure 2.
  • SARS-CoV-2 particles may also comprise variants of the known SARS-CoV-2 South African/Botswana lineages B. 1.1.529 (WHO label: Omicron), e.g. sequences having at least 85%, at least 90%, at least 95% or at least 99% sequence identity to SEQ ID NOs: 3 or 4 or more generally any SARS-CoV-2 with a S-protein with spike mutations of interest: A67V, A69-70, T95I, G142D, A143- 145, N21 H, A212, ins215EPE, G339D, S371L, S373P, S375F, K417N, N440K, G446S, S477N, T478K, E484A, Q493R, G496S, Q498R, N501Y, Y505H, T547K, D614G, H655Y, N679K, P681H, N764K, D796Y, N856
  • the variant sequence encodes an infectious SARS-CoV-2 particle, e.g. a native (non-inactivated) SARS-CoV-2 particle comprising the RNA sequence that is able to pack a virulent SARS-CoV-2 virus.
  • infectious SARS-CoV-2 particle e.g. a native (non-inactivated) SARS-CoV-2 particle comprising the RNA sequence that is able to pack a virulent SARS-CoV-2 virus.
  • the SARS-CoV-2 particle comprises an S protein of the Wuhan lineage comprising or consisting of (i) an amino acid sequence as defined in SEQ ID NO: 5 (see Figure 12), or (ii) an amino acid sequence having at least 95%, at least 97% or at least 99% identity to SEQ ID NO: 5.
  • the SARS-CoV-2 particle comprises an S protein of the South African Bl.351 lineage comprising or consisting of (i) an amino acid sequence as defined in genebank, or (ii) an amino acid sequence having at least 95%, at least 97% or at least 99% identity to said GenBank sequence.
  • the SARS-CoV-2 particle comprises an S protein of the Brazilian P. 1 lineage comprising or consisting of (i) an amino acid sequence as defined in genebank, or (ii) an amino acid sequence having at least 95%, at least 97% or at least 99% identity to said GenBank sequence.
  • the SARS-CoV-2 particle comprises an S protein of Delta variant comprising or consisting of (i) an amino acid sequence as defined in GenBank, or (ii) an amino acid sequence having at least 95%, at least 97% or at least 99% identity to said GenBank sequence.
  • the SARS-CoV-2 particle comprises an S protein of Omicron variant comprising or consisting of (i) an amino acid sequence as defined in GenBank, or (ii) an amino acid sequence having at least 95%, at least 97% or at least 99% identity to said GenBank sequence.
  • a combination of SARS-CoV-2 particles in the vaccine comprises or consists of at least two SARS-CoV-2 particles selected from the group consisting of i) the reference Wuhan_l lineage such as e.g. SEQ ID Nos: 1 or the INMI isolate provided by SEQ ID NO: 9; ii) the Delta variant such as e.g. SEQ ID NO: 2; or iii) the Omicron variant such as e.g. SEQ ID NO: 3 or SEQ ID NO: 4.
  • the reference Wuhan_l lineage such as e.g. SEQ ID Nos: 1 or the INMI isolate provided by SEQ ID NO: 9
  • the Delta variant such as e.g. SEQ ID NO: 2
  • Omicron variant such as e.g. SEQ ID NO: 3 or SEQ ID NO: 4.
  • a combination of SARS-CoV-2 particles in the vaccine comprises or consists of at least three SARS-CoV-2 particles selected from the group consisting of i) the reference Wuhan_l lineage such as e.g. SEQ ID No: 1 or the INMI isolate provided by SEQ ID NO: 9; ii) the Delta variant such as e.g. SEQ ID NO: 2; or iii) the Omicron variant such as e.g. SEQ ID NO: 3 or SEQ ID NO: 4.
  • one or more of the SARS-CoV-2 particles of the above comprise viral RNA wherein the furin cleavage site activity is reduced or eliminated by passaging out the furin site and/or introducing mutations in the cleavage site.
  • sequence identity is frequently measured in terms of percentage identity; the higher the percentage, the more similar the two sequences are.
  • Homologs, orthologs, or variants of a polynucleotide or polypeptide will possess a relatively high degree of sequence identity when aligned using standard methods. Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci.
  • the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is present in both sequences.
  • the percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence, or by an articulated length (such as 100 consecutive nucleotides or amino acid residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100.
  • 75.11, 75.12, 75.13, and 75.14 are rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2.
  • the length value will always be an integer.
  • NCBI Basic Local Alignment Search Tool (Altschul et al., Mol. Biol. 215:403, 1990) is available from several sources, including the National Center for Biotechnology Information (NCBI, Bethesda, MD) and on the internet, for use in connection with the sequence analysis programs BLASTP, BLASTN, BLASTX, TBLASTN and TBLASTX. A description of how to determine sequence identity using this program is available on the NCBI website on the internet.
  • NCBI National Center for Biotechnology Information
  • the BLAST and the BLAST 2.0 algorithms are also described in Altschul et al., Nucleic Acids Res. 25:3389-3402, 1977.
  • the BLASTP program (for amino acid sequences) uses as defaults a word length (W) of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915, 1989).
  • Homologs and variants of a polynucleotide or polypeptide are typically characterized by possession of at least about 75%, for example at least about 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity counted over at least 50, 100, 150, 250, 500, 1000, 2000, 5000 or 10,000 nucleotide or amino acid residues of the reference sequence, over the full length of the reference sequence or over the full length alignment with the reference amino acid sequence of interest.
  • Polynucleotides or proteins with even greater similarity to the reference sequences will show increasing percentage identities when assessed by this method, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity.
  • sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
  • test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters are used.
  • PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, Mol. Evol. 35:351-360, 1987. The method used is similar to the method described by Higgins & Sharp, CABIOS 5: 151-153, 1989.
  • a reference sequence is compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps.
  • PILEUP can be obtained from the GCG sequence analysis software package, e.g., version 7.0 (Devereaux et al., Nuc. Acids Res. 12:387-395, 1984).
  • reference to "at least 80% identity” refers to at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or even 100% identity to a specified reference sequence, e.g. to at least 50, 100, 150, 250, 500, 1000, 5000 or 10,000 nucleotide or amino acid residues of the reference sequence or to the full length of the sequence.
  • reference to “at least 90% identity” refers to "at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or even 100% identity" to a specified reference sequence, e.g. to at least 50, 100, 150, 250, 500, 1000, 5000 or 10,000 nucleotide or amino acid residues of the reference sequence or to the full length of the sequence.
  • the inactivated SARS-CoV-2 particles are combined with an adjuvant in the vaccine.
  • the adjuvant is a Thl response-directing adjuvant (also referred to herein as “Thl adjuvant”).
  • Thl adjuvant a Thl response-directing adjuvant
  • the adjuvant comprises 3-O-desacyl-4'-monophosphoryl lipid A (MPL), saponin QS-21, a CpG-containing oligodeoxynucleotide (CpG ODN), squalene, DL-a-tocopherol, a cationic peptide, a deoxyinosine-containing immunostimulatory oligodeoxynucleic acid molecule (I-ODN) and/or imiquimod.
  • MPL 3-O-desacyl-4'-monophosphoryl lipid A
  • CpG ODN CpG-containing oligodeoxynucleotide
  • squalene e.g., a CpG-containing oligodeoxynucleotide
  • DL-a-tocopherol e.g., a cationic peptide
  • I-ODN immunostimulatory oligodeoxynucleic acid molecule
  • suitable adjuvants may comprise: Adjuvant System 01 (AS01), which is a liposomal preparation comprising 3-O-desacyl-4'-monophosphoryl lipid A (MPL) and saponin QS-21; CpG 1018, a CpG ODN comprising the sequence 5’ TGACTGTGAACGTTCGAGATGA 3’ (SEQ ID NO: 8); Adjuvant System 03 (AS03), comprising squalene, DL-a-tocopherol and polysorbate 80; IC31, comprising a peptide comprising the sequence KLKL5KLK (SEQ ID NO: 7) and an I-ODN comprising oligo-d(IC)i 3 (SEQ ID NO: 6); or MF59, an oil-in-water emulsion comprising squalene, Tween 80 and Span 85.
  • Adjuvant System 01 AS01
  • MPL 3-O-desacyl-4'-monophosphoryl lipid A
  • SEQ ID NO: 8 Ad
  • the vaccine or adjuvant does not comprise a CpG-containing oligodeoxynucleotide (CpG ODN). In another embodiment, the vaccine or adjuvant does not comprise CpG 1018, i.e. the vaccine or adjuvant does not comprise the sequence 5’ TGACTGTGAACGTTCGAGATGA 3’.
  • the dosage of a Thl promoting adjuvant such as especially AS01, AS03, MF59, imiquimod or CpG, will be arrived at empirically. In some embodiments, the dosage of the Thl promoting adjuvant will be determined from previous studies.
  • the adjuvant may comprise an aluminium salt, e.g. aluminium oxide, aluminium hydroxide or aluminium phosphate.
  • a preferred aluminium salt is the aluminium hydroxide with reduced Cu content, e.g. lower than 1.25 ppb based on the weight of the vaccine composition, an adjuvant described in detail in WO2013/083726 or Schlegl et al., Vaccine 33 (2015) 5989-5996.
  • an alum adjuvant is the only adjuvant in the vaccine composition.
  • the weight of the alum component refers to the weight of the Al 3+ in the solution, regardless of what type of aluminium salt is used.
  • 0.5 mg of Al 3+ corresponds to 1.5 mg alum.
  • the amount alum (Al 3+ ) present in the SARS-CoV-2 vaccine composition is between about 0.1 and 2 mg/mL, between about 0.2 and 1.5 mg/mL, between about 0.5 and 1.3 mg/mL, especially between about 0.8 to 1.2 mg/mL, most preferably about 1 mg/mL, i.e., 0.5 mg/dose.
  • the use of aluminium adjuvants alone is generally less preferred in the present invention, as they tend to direct a predominantly Th2 type immune response. Therefore in embodiments where the vaccine comprises an aluminium salt, it is particularly preferred that the vaccine further comprises a Thl- directing adjuvant, e.g. as described above.
  • the adjuvant may comprise an aluminium salt and a CpG ODN, e.g. CpG 1018.
  • CpG 1018 can be adsorbed onto alum and, when used as a combinatorial adjuvant, has been shown to induce both Thl and Th2 responses (Tian, et al. 2017 Oncotarget 8(28)45951-45964); i.e. a more “balanced” immune response.
  • CpG when administered in combination with alum, CpG has been shown to increase the overall magnitude of the immune response and to reduce the Th2 bias that is induced by conventional adjuvants such as alum (X.P. loannou et al.
  • CpG-containing oligodeoxynucleotides in combination with conventional adjuvants, enhance the magnitude and change the bias of the immune responses to a herpesvirus glycoprotein.
  • 2002 Vaccine 21: 127-137 The dose range for CpG in combination with alum may be anywhere between 10 pg and 1 mg per dose such as between 1 to 2 mg per dose. Further information regarding inactivated SARS-CoV-2 virus adjuvanted with CpG and alum can be found in WO2021/176434A1 and WO2021/178318A1, which are incorporated herein by reference in their entirety.
  • the adjuvant is combined with the inactivated SARS-CoV-2 particles during manufacture of the vaccine product, i.e. the manufactured vaccine product comprises the adjuvant and is sold/distributed in this form.
  • the adjuvant may be combined with the inactivated SARS-CoV-2 particles at the point of use, e.g. immediately before clinical administration of the vaccine (sometimes referred to as “bedside mixing” of the components of the vaccine).
  • the present invention comprises both vaccine products comprising inactivated SARS-CoV-2 particles and an adjuvant as described herein, as well as kits comprising the individual components thereof (e.g. suitable for bedside mixing), and the combined use of the individual components of the vaccine in preventing or treating SARS-CoV-2 infection.
  • the SARS-CoV-2 vaccine may be produced by methods involving a step of inactivation of native SARS-CoV-2 particles, as described above.
  • the native SARS-CoV-2 particles may be obtained by standard culture methods, e.g. by in vitro production in mammalian cells, preferably using Vero cells.
  • the native SARS-CoV-2 particles may be produced using methods analogous to those described in e.g. WO 2017/109225 and/or WO 2019/057793, the contents of which are incorporated herein in their entirety, which describe methods for the production of Zika and Chikungunya viruses in Vero cells.
  • the steps such as passaging, harvesting, precipitation, dialysis, filtering and purification described in those documents are equally applicable to the present process for producing SARS-CoV-2 particles.
  • the method may comprise purifying the inactivated SARS-CoV-2 particles by one or more size exclusion methods such as (i) a sucrose density gradient centrifugation, (ii) a solid-phase matrix packed in a column comprising a ligand-activated core and an inactive shell comprising pores, wherein the molecular weight cut-off of the pores excludes the virus particles from entering the ligand-activated core, and wherein a molecule smaller than the molecular weight cut-off of the pores can enter the ligand-activated core and collecting the virus particles, and/or (iii) batch or size exclusion chromatography; to obtain purified inactivated SARS-CoV-2 particles.
  • size exclusion methods such as (i) a sucrose density gradient centrifugation, (ii) a solid-phase matrix packed in a column comprising a ligand-activated core and an inactive shell comprising pores, wherein the molecular weight cut-off of the pores excludes the virus particles from entering the ligand
  • the concentration of residual host cell DNA is less than 100 ng/mL; (ii) the concentration of residual host cell protein is less than 1 pg/mL; and (iii) the concentration of residual aggregates of infectious virus particles is less than 1 pg/mL.
  • the method may comprise a step of precipitating a harvested culture medium comprising SARS-CoV-2 particles, thereby producing native SARS-CoV-2 particles in a supernatant.
  • the precipitating step may comprise contacting the culture medium with protamine sulfate or benzonase.
  • a molecule smaller than the molecular weight cut-off of the pores e.g. the protamine sulfate
  • the residual host cell DNA of the obtained virus preparation or vaccine may be less than 1 pg/mL, especially less than 900, 800, 700, 600, 500, 400, 300 or 200 ng/mL, preferably less than 150 or 100 ng/mL.
  • the residual host cell DNA of the virus preparation or vaccine is less than 40 pg/mL.
  • the residual host cell protein of the virus preparation or vaccine is less than 10 pg/mL, especially less than 9, 8, 7, 6, 5, 4, 3 or 2 pg/mL, preferably less than 1 pg/mL.
  • the residual host cell protein of the virus preparation or vaccine is less than 150 ng/mL.
  • the residual non-infectious virus particles of the virus preparation or vaccine is less than 10 pg/mL, especially less than 9, 8, 7, 6, 5, 4, 3 or 2 pg/mL, preferably less than 1 pg/mL. In a preferred embodiment, the content of residual non-infectious virus particles of the virus preparation or vaccine is less than 100 ng/mL.
  • the vaccine and/or SARS-CoV-2 particles may comprise residual protamine (e.g. protamine sulfate), typically in trace amounts.
  • residual protamine (e.g. protamine sulfate) in the virus preparation or vaccine is less than 2 pg/mL or 1 pg/mL, especially less than 900, 800, 700, 600, 500, 400, 300 or 200 ng/mL, preferably less than 100 ng/mL, more preferably is below the detection limit of HPLC, in particular below the detection limit in the final drug substance.
  • the PS content is tested by HPLC or size exclusion chromatography (SEC).
  • HPLC is validated for PS determination in JEV sucrose gradient pool samples as a routine release assay and is very sensitive (i.e., limit of quantification (LOQ) 3 pg/mL; limit of detection (LOD) 1 pg/mL).
  • PS content in SARS-CoV-2 drug substance was ⁇ LOD.
  • the HPLC assessment of PS content can be performed on a Superdex Peptide 10/300GL column (GE: 17-5176-01) using 30% Acetonitrile, 0,1% Trifluoroacetic acid as solvent with a flow rate of 0.6 ml/min at 25°C and detection at 214 nm.
  • a more sensitive method of measurement for residual protamine in a purified virus preparation is mass spectrometry (MS).
  • MS mass spectrometry
  • the residual PS levels in a Zika virus preparation are tested by MS or other such highly sensitive method, e.g. nuclear magnetic resonance (NMR).
  • NMR nuclear magnetic resonance
  • residual PS, as well as fragments and/or break-down products of PS can be detected at trace amounts, such as levels as low as, for example, 10 6 , 10 7 or 10 8 molecules per typical sample load.
  • the PS levels are tested in the drug product.
  • the PS levels are tested in the drug substance.
  • an amount of the inactivating agent (e.g. beta-propiolactone) in the drug product or drug substance (e.g. vaccine composition) is very low, e.g. less than 100 ppm, less than 10 ppm, or less than 1 ppm (by weight).
  • the SARS-CoV-2 vaccine may be administered to a subject, preferably a mammalian subject, more preferably a human subject.
  • the SARS-CoV-2 vaccine is administered to a subject at risk of SARS-CoV-2 infection, e.g. in order to prevent SARS-CoV-2 infection and/or to prevent SARS-CoV- 2 associated disease (COVID- 19), in particular to prevent severe COVID- 19 disease, hospitalization or death caused by SARS-CoV-2 infection.
  • the subject is preferably (i) an elderly subject (e.g. older than 65 years, 70 years or 80 years) (ii) a pregnant subject (iii) an immunocompromised subject or (iv) a child (e.g.
  • the SARS- CoV-2 vaccine described herein is advantageously capable of generating robust immune responses in subjects particularly susceptible or vulnerable to SARS-CoV-2-mobidity or mortality, i.e. immunocompromised, pregnant or elderly subjects.
  • the SARS-CoV-2 vaccine may be administered to the subject in a single dose or two or more doses, e.g. separated by intervals of about 7, 14, 21, 28 or 29 days.
  • the vaccine does not induce ADE, VAERD or ERD of SARS-CoV-2-associated disease (CO VID-19). It is an advantage of the present invention that the inactivated SARS-CoV-2 vaccine described herein shows low or no ADE, VAERD or ERD in human subjects, and can therefore be safely used for mass vaccination purposes.
  • the vaccine described herein retains high quality immunogenic epitopes, which therefore results in high neutralizing antibody titers and diminishes the risk of ADE, VAERD or ERD on administration to subjects.
  • the risk of ADE, VAERD or ERD development may be assessed in non-human primates (see also Luo F, et al. (2016), Virologica Sinica 33:201-204).
  • a vaccine e.g. a SARS-CoV vaccine
  • a Th2-type immunopathology e.g. a hypersensitivity response to SARS-CoV components in animals.
  • a Thl type response is favored, e.g. by use of a Thl-directing adjuvant (e.g. AS01 or another adjuvant as described herein).
  • a balanced Th2/Thl-type immune response is preferred, such as that induced by use of a Th2-stimulating adjuvant, e.g., alum, combined with a Thl -stimulating adjuvant.
  • a Th2-stimulating adjuvant e.g., alum
  • Thl -stimulating adjuvant e.g., alum
  • the risk of immunopathology developing may be assessed in animal models, e.g. as described in Tseng C.T. et al. (2012) PLoS ONE 7(4):e35421.
  • the vaccines of the invention show a shift in the Th2/Thl-type immune response to a Thl -type immune response compared to a vaccine adjuvanted with alum.
  • any of the SARS-CoV-2 vaccines or compositions described herein may be administered to a subject in a therapeutically effective amount or a dose of a therapeutically effective amount.
  • a “therapeutically effective amount” of vaccine is any amount that results in a desired response or outcome in a subject, such as those described herein, including but not limited to prevention of infection, an immune response or an enhanced immune response to SARS-CoV-2, or prevention or reduction of symptoms associated with SARS-CoV-2 disease. More specifically, a therapeutic amount of the SARS- CoV-2 vaccine of the invention may be a total viral protein mass of between about 0.05 and 50 pg, more preferably between about 0.5 to 10 pg.
  • the therapeutically effective amount of a SARS-CoV-2 vaccine or composition described herein is an amount sufficient to generate antigen-specific antibodies (e.g., anti-SARS-CoV- 2 antibodies). In some embodiments, the therapeutically effective amount is sufficient to seroconvert a subject with at least 70% probability. In some embodiments, the therapeutically effective amount is sufficient to seroconvert a subject with at least 75%, 80%, 85% 90%, 95%, 96%, 97%, 98%, or at least 99% probability. Whether a subject has seroconverted can be assessed by any method known in the art, such as obtaining a serum sample from the subject and performing an assay to detect anti-SARS-CoV- 2 antibodies.
  • a subject is seroconverted if a serum sample from the subject contains an amount of anti- SARS-CoV-2 antibodies that surpasses a threshold or predetermined baseline.
  • a subject is generally considered seroconverted if there is at least a 4-fold increase in anti- SARS-CoV-2 antibodies (i.e., anti-SARS-CoV-2 S protein IgG antibodies) present in a serum sample from the subject as compared to a serum sample previously taken from the same subject.
  • the dose of the inactivated SARS-CoV-2 component in the vaccine composition of the current invention is between about 0.01 and 25 mAU (milli-absorption units x minutes as assessed by SEC-HPLC), preferably between about 0.05 and 10 mAU, more preferably between about 0.1 and 5 mAU, most preferably between about 0.25 and 2.5 mAU.
  • the dose of each of inactivated SARS-CoV-2 component is between about 0.05 and 50 pg total protein as measured by (p)BCA assay, between about 0.1 and 25 pg, between about 0.25 and 12.5 pg, preferably between about 0.5 and 5 pg total protein.
  • each of the inactivated SARS-CoV-2 component in the vaccine composition is at least 2.5 pg total protein, at least 3.5 pg total protein or at least 2.5 pg total protein, e.g. the vaccine composition comprises 2.5 pg to 25 pg, 3.5 pg to 20 pg or 4 pg to 12 pg total protein/dose, preferably about 10 pg total protein/dose, e.g. 2 times 5 pg protein of each inactivated SARS-CoV-2 component.
  • the dosage is determined by the total amount of S protein in the inactivated SARS-CoV-2 formulation, as assessed by e.g. EUISA.
  • the mass of antigen may also be estimated by assessing the SE-HPLC peak area per dose equivalent (recorded as milli- absorption units x minutes; mAU), which is estimated to be approximately 2 pg/ml total surface protein and approximately 1 pg/mL S-protein.
  • the dose is between about 0.025 and 25 pg S-protein as measured by ELISA, between about 0.05 and 12.5 pg, between about 0.125 and 6.25 pg, preferably between about 0.25 and 2.5 pg S-protein.
  • the amount of antigen in the SARS-CoV-2 vaccine is determined by ELISA.
  • the ELISA measures a SARS-CoV-2 protein or portion of a protein, e.g., nucleocapsid (N), membrane (M) or spike (S) protein; i.e., the ELISA utilizes a coating antibody specific to a SARS-CoV-2 protein or portion of a protein.
  • the coating antibody is specific to the SARS-CoV-2 Spike protein SI subunit, e.g. residues 14-685 (or 14-683) of the S-protein sequence of SEQ ID NO: 5, or to the Receptor Binding Domain (RBD), e.g.
  • the ELISA readout is a mass per unit measure of the detected protein, e.g. pg/mL S-protein.
  • the standard used is a spike protein trimer and the results of the SARS-CoV-2 ELISA are reported as “antigen units” (AU), corresponding to the ACE-2 binding ability of the standard protein (determined by the manufacturer).
  • the amount of each of the SARS-CoV-2 particle administered to a subject is between about 1 to 150 AU/dose, preferably between about 2 to 75 AU/dose, preferably between about 3 and 60 AU/dose, more preferably between about 3 and 55 AU/dose, more preferably between about 33 AU/dose (if e.g. 2 different SARS-CoV-2 particles are combined in a vaccine, the total amount of the two components is about 66 AU/dose).
  • the amount of each SARS- CoV-2 antigen administered to a subject is at least 10 AU/dose, at least 20 AU/dose, at least 25 AU/dose or at least 30 AU/dose, e.g.
  • each SARS-CoV-2 particle (e.g. in AU/dose) may be assessed, for example, by a SARS-CoV-2 ELISA assay as described in Example 1. It is estimated that there are about 1 to 1.5 x 10 7 viral particles per AU, and the amounts of SARS-CoV-2 particle described above may be construed accordingly.
  • the amount of each SARS-CoV-2 antigen administered to a subj ect is between about 1.5 x 10 7 to 1.5 x 10 9 viral particles/dose, or between about 4.5 x 10 7 to 9.0 x 10 8 viral particles/dose, e.g. at least 1.5 x 10 8 viral particles/dose or at least 3.0 x 10 8 viral particles/dose, about 1.5 x 10 8 to 7.5 x 10 8 viral particles/dose or about 4.5 x 10 8 to 6.0 x 10 8 viral particles/dose.
  • the ratio of the two or more different inactivated SARS-CoV-2 particles is equal, i.e. in case of two inactivated SARS-CoV-2 particles it can be 1 : 1 but also may be 1 :2 or 2: 1 or 1:3 or 3: 1.
  • the ratio depends on the ability of one of the inactivated SARS-CoV-2 particles in the vaccine to generating more neutralizing antibodies against a native homologous and/or heterologous SARS-CoV-2 particle and/or is capable of raising more of an effective T-Cell response against a native homologous and/or heterologous SARS-CoV-2 particle in a human subject as the other SARS-CoV-2 particle.
  • the ratio may be adjusted.
  • seroconversion of a subject is assessed by performing a plaque reduction neutralization test (PRNT). Briefly, PRNT is used to determine the serum titer required to reduce the number of SARS-CoV-2 plaques by 50% (PRNT50) as compared to a control serum/antibody.
  • the PRNT50 may be carried out using monolayers of Vero cells or any other cell type/line that can be infected with SARS-CoV-2. Sera from subjects are diluted and incubated with live, non-inactivated SARS-CoV-2. The serum/virus mixture may be applied to Vero cells and incubated for a period of time. Plaques formed on the Vero cell monolayers are counted and compared to the number of plaques formed by the SARS-CoV-2 in the absence of serum or a control antibody. A threshold of neutralizing antibodies of 1 : 10 dilution of serum in a PRNT50 is generally accepted as evidence of protection in the case of JEV (Hornbach et. al. Vaccine (2005) 23:5205-5211).
  • the two or more SARS-CoV-2 particles may be formulated for administration in a composition, such as a pharmaceutical composition.
  • pharmaceutical composition as used herein means a product that results from the mixing or combining of at least one active ingredient, such as an inactivated SARS-CoV-2, and one or more inactive ingredients, which may include one or more pharmaceutically acceptable excipient.
  • a preferred pharmaceutically acceptable excipient is human serum albumin (HSA), such as, especially recombinant HSA (rHSA).
  • the SARS-CoV-2 vaccine of the invention contains about 10 to 50 pg HSA/dose, preferably about 20 to 40 pg HSA/dose, more preferably about 25 to 35 pg HSA/dose.
  • the two or more SARS-CoV-2 particles may be not formulated for administration in the same composition, such as a pharmaceutical composition but in two different compositions and then assembled in a kit.
  • compositions of the invention can be prepared in accordance with methods well known and routinely practiced in the art (see e.g., Remington: The Science and Practice of Pharmacy, Mack Publishing Co. 20th ed. 2000; and Ingredients of Vaccines - Fact Sheet from the Centers for Disease Control and Prevention, e.g., adjuvants and enhancers as described above to help the vaccine improve its work, preservatives and stabilizers to help the vaccine remain unchanged (e.g., albumin, such as human serum albumin (HSA) or recombinant HSA (rHSA), phenols, glycine)).
  • HSA human serum albumin
  • rHSA recombinant HSA
  • glycine refers to an immunogenic composition, e.g.
  • the vaccine or composition capable of inducing an immune response in a (human) subject against an antigen (e.g. against a SARS-CoV-2 antigen).
  • the vaccine or composition may be capable of generating neutralizing antibodies against SARS-CoV-2.
  • the vaccine or composition is capable of generating antibodies (e.g. IgG) against SARS-CoV-2 S (spike) protein.
  • the vaccine or composition is capable of generating a T cell response against SARS-CoV-2 proteins or peptides, for instance a T cell response against a SARS-CoV-2 S-protein, membrane (M) protein and/or nucleocapsid (N) protein or peptides derived therefrom.
  • the vaccine or immunogenic composition is capable of inducing a protective effect against a disease caused by the antigen, e.g. a protective effect against SARS-CoV-2 infection (e.g. symptomatic and/or asymptomatic infection), severe disease, hospitalization or death caused by COVID-19 disease).
  • a protective effect against SARS-CoV-2 infection e.g. symptomatic and/or asymptomatic infection
  • severe disease e.g. symptomatic and/or asymptomatic infection
  • hospitalization or death caused by COVID-19 disease e.g. a protective effect against SARS-CoV-2 infection
  • compositions are preferably manufactured under GMP conditions.
  • a therapeutically effective dose of the inactivated SARS-CoV-2 vaccine preparation is employed in the pharmaceutical composition of the invention.
  • the inactivated SARS-CoV-2 particles are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art. Dosage regimens are adjusted to provide the optimum desired response (e.g., the prophylactic response).
  • Dosages of the active ingredients in the pharmaceutical compositions of the present invention can be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired pharmaceutical response for a particular subject, composition, and mode of administration, without being toxic to the subject.
  • the selected dosage level depends upon a variety of pharmacokinetic factors, including the activity of the particular compositions of the present invention employed, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the subject being treated, and like factors.
  • a physician, veterinarian or other trained practitioner can start dosing of the inactivated SARS-CoV-2 vaccine employed in the pharmaceutical composition at levels lower than that required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect (e.g., production of anti-SARS-CoV-2 virus antibodies) is achieved.
  • effective doses of the compositions of the present invention, for the prophylactic treatment of groups of people as described herein vary depending upon many different factors, including means of administration, target site, physiological state of the patient, whether the patient is human or an animal, other medications administered, and the titer of anti-SARS-CoV-2 antibodies desired. Dosages need to be titrated to optimize safety and efficacy.
  • the dosing regimen entails subcutaneous or intramuscular administration of a dose of inactivated SARS-CoV-2 vaccine twice (primary vaccination). In some embodiments, the dosing regimen entails subcutaneous administration of a dose of inactivated SARS-CoV-2 vaccine twice, once at day 0 and once at about day 14. In some embodiments, the dosing regimen entails subcutaneous administration of a dose of inactivated SARS- CoV-2 vaccine twice, once at day 0 and once at about day 28. In some embodiments, the inactivated SARS-CoV-2 vaccine is administered to the subject once. In a preferred embodiment, the SARS-CoV- 2 vaccine is administered to the subject more than once, preferably two times. In a preferred embodiment, the vaccine is administered on day 0 and day 21. In another preferred embodiment, the vaccine is administered on day 0 and day 28.
  • Booster vaccination In further embodiments, a so called booster dose of the inactivated SARS-CoV-2 vaccine of the invention is administered at least after about every 6 months, about every 7 months, about every 8 months, about every 9 months, about every 10 months, about every 11 months or about every 12 months or about every 13 months after the last dose of the SARS-CoV-2 vaccine, preferably wherein such further dose of the vaccine is the same formulation as the first.
  • the booster dose of the inactivated SARS-CoV-2 vaccine is administered once after about 6 to 12 months after the primary vaccination.
  • the inactivated SARS-CoV-2 vaccine is administered as a booster dose only, e.g. a first (prime) dose or doses of a (different) SARS-CoV-2 vaccine (e.g. vector or mRNA vaccine) is administered and then a second (boost) dose of the inactivated SARS-CoV-2 vaccine of the invention is administered, e.g. at least 180 or 360 days after the first dose.
  • the first (prime) dose of the SARS- CoV-2 vaccine may comprise any other vaccine or immunogenic composition that stimulates an immune response and/or a protective effect in subjects against SARS-CoV-2 virus.
  • the first dose of SARS-CoV-2 vaccine may comprise a recombinant viral vector or an mRNA sequence encoding one or more SARS-CoV-2 proteins and/or fragments thereof, e.g. a SARS-CoV-2 spike (S) protein.
  • the first dose of SARS-CoV-2 vaccine may comprise a subunit vaccine, e.g. comprising one or more SARS-CoV-2 proteins and/or fragments thereof, e.g. a SARS-CoV-2 spike (S) protein or fragment thereof.
  • kits for use in prophylactic administration to a subject for example to prevent or reduce the severity of SARS-CoV-2 infection.
  • kits can include one or more containers comprising a composition containing two or more inactivated SARS-CoV-2, such as an inactivated SARS-CoV-2 vaccine of the invention.
  • the kit may further include one or more additional components comprising a second composition, such as a second vaccine, e.g. a second kind of SARS-CoV-2 vaccine that applies a different technology than in the first dose.
  • the second vaccine is a vaccine for an arbovirus.
  • the second vaccine is a Japanese encephalitis virus vaccine, a Zika virus vaccine, a Dengue virus vaccine and/or a Chikungunya virus vaccine.
  • the kit can comprise instructions for use in accordance with any of the methods described herein.
  • the included instructions can comprise a description of administration of the composition containing inactivated SARS-CoV-2 vaccine to prevent, delay the onset, or reduce the severity of SARS-CoV-2 infection.
  • the kit may further comprise a description of selecting a subject suitable for administration based on identifying whether that subject is at risk for exposure to SARS- CoV-2 or contracting a SARS-CoV-2 infection.
  • the instructions comprise a description of administering a composition containing inactivated SARS-CoV-2 vaccine to a subject at risk of exposure to SARS-CoV-2 or contracting SARS-CoV-2 infection.
  • the instructions relating to the use of the composition containing inactivated SARS-CoV-2 vaccine generally include information as to the dosage, dosing schedule, and route of administration for the intended treatment.
  • the containers may be unit doses, bulk packages (e.g., multi-dose packages, multi- vials) or sub-unit doses.
  • Instructions supplied in the kits of the invention are typically written instructions on a label or package insert (e.g., a paper sheet included in the kit), but machine -readable instructions are also acceptable.
  • kits of the present disclosure are in suitable packaging.
  • suitable packaging includes, but is not limited to, vials, bottles, jars, flexible packaging, and the like. Also contemplated are packages for use in combination with a specific device, such as a syringe or an infusion device.
  • the container may have a sterile access port, for example the container may be a vial having a stopper pierceable by a hypodermic injection needle.
  • At least one active agent in the composition is an inactivated SARS-CoV- 2, as described herein.
  • the methods and techniques of the present disclosure are generally performed according to conventional methods well-known in the art. Generally, nomenclatures used in connection with, and techniques of biochemistry, enzymology, molecular and cellular biology, microbiology, virology, cell or tissue culture, genetics and protein and nucleic chemistry described herein are those well-known and commonly used in the art. The methods and techniques of the present disclosure are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated.
  • the JEV process platform (Srivastava et al., Vaccine 19 (2001) 4557-4565; US 6,309,650Bl) was used as a basis, also taking into account improvements in the process as adapted to Zika virus purification as disclosed in WO2017/109223A1 (which is incorporated herein in its entirety). Briefly, non-infectious SARS-CoV-2 particle aggregates, host cell proteins and other low molecular weight impurities are removed by protamine sulfate precipitation or benzonase treatment and the resulting preparation is optionally further purified by sucrose gradient centrifugation. See Fig. 1 for an outline of the production process.
  • SARS-CoV-2 isolates from Italy, identified and characterized at the National Institute for Infectious Diseases “Lazzaro Spallanzani” IRCCS, Rome, Italy (Accession No: MT066156), the RNA sequence thereof corresponding to the DNA sequence provided by SEQ ID NO: 9, was used in all Examples disclosed herein.
  • Other novel coronavirus SARS-CoV-2 isolates may also be obtained from the following sources:
  • EVAg European Virus Archive
  • 2019-nCoV/Italy-INMIl e.g. one of the following strains: 2019-nCoV/Italy-INMIl, (Ref-SKU:008V-03893, SEQ ID NO: 9; https://www.european- virus-archive.com/virus/human-2019-ncov-strain-2019-ncovitaly-inmil) (see Fig. 8B);
  • NCBI GenBank e.g., one of the following strains:
  • Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1 complete genome (Accession No: MN908947), SEQ ID NO: 1 (see Fig. 8A);
  • SARS-CoV-2 ASL517-Delta-India (B. 1.617.2), SEQ ID NO: 2, may be obtained by recombinant technology (see Fig. 9).
  • Isolates with RNA corresponding to a DNA sequence of SEQ ID NO: 4 may be obtained by KU Loewen also referred to as rega-20174.2 rega-20174 Severe acute respiratory syndrome coronavirus 2, hCoV-19/Belgium/rega-20174/2021
  • SARS-CoV-2 severe acute respiratory syndrome coronavirus 2
  • Isolates with RNA corresponding to a DNA sequence of SEQ ID NO: 3 may be obtained by IHU Marseille: also referred to as PAC-IHU-49242.3 IHU Marseille isolate hCoV- 19/France/PAC-IHU-49242/2021
  • SARS-CoV-2 severe acute respiratory syndrome coronavirus 2
  • the Vero cells used in the methods described herein were the VERO (WHO) cell line, obtained from the Health Protection Agency general cell collection under catalogue number 88020401, from which a master cell bank was generated.
  • a research master seed bank (rMSB) of SARS-CoV-2 (strain used 2019-nCoV/Italy-INMIl) was prepared on Vero cells and the genomic sequence was checked by sequencing.
  • Vero cells were grown in Eagle's minimal essential medium (EMEM) containing 10% fetal bovine serum (FBS) and monolayers were infected with SARS-CoV-2 at a multiplicity of infection (moi) of 0.001 to 1, preferably 0.01, plaque forming units (pfu) per cell. After allowing virus adsorption, the cultures were washed 2-4 times with PBS, fed with serum-free EMEM and incubated at 35 °C with 5% CO2 until the virus titer reaches a desired level.
  • EMEM Eagle's minimal essential medium
  • SARS-CoV-2 harvest The culture medium was harvested at days 2, 3, 5 and 7 and harvests were pooled and centrifuged in a standard centrifuge. The resulting supernatant was filtered, followed by TFF ultrafiltration to remove cell culture medium components and reduce batch volume. Host cell DNA and protein reduction as well as reduction of non-infectious virus aggregates in the concentrated material was achieved by precipitation with protamine sulfate. Protamine sulfate was added to the diafiltrated SARS-CoV-2 material to a final nominal concentration of ⁇ 2 mg/mL, while stirring, followed by incubation at 2-8°C for 30 minutes. Alternatively, the diafiltrated SARS-CoV-2 material was treated with benzonase.
  • SARS-CoV-2 virus was inactivated by treatment with betapropiolactone directly after removal of virus-containing cell culture medium from Vero cells, in order to render the virus safe to handle at BSL2.
  • Inactivation is possible at any stage in the purification process, however, such as e.g., after centrifugation, before, during or after treatment with protamine sulfate or benzonase or before or after sucrose gradient centrifugation.
  • Inactivation is carried out by the use of a chemical inactivation agent such as formaldehyde (formalin); enzyme; beta-propiolactone; ethanol; trifluroacetic acid; acetonitrile; bleach; urea; guanidine hydrochloride; tri-n-butyl phosphate; ethylene -imine or a derivative thereof; an organic solvent, optionally Tween, Triton, sodium deoxy cholate, or sulfobetaine; or a combination thereof.
  • a chemical inactivation agent such as formaldehyde (formalin); enzyme; beta-propiolactone; ethanol; trifluroacetic acid; acetonitrile; bleach; urea; guanidine hydrochloride; tri-n-butyl phosphate; ethylene -imine or a derivative thereof; an organic solvent, optionally Tween, Triton, sodium deoxy cholate, or sulfobetaine; or a combination thereof.
  • Inactivation may also be achieved by pH changes (very high or very low pH), by heat treatment or by irradiation such as gamma irradiation or UV irradiation, particularly UV-C irradiation.
  • the SARS-CoV-2 virus is optionally inactivated by two separate inactivation steps, such as, e.g. beta-propiolactone treatment and UV-C irradiation.
  • PPV highly resistant model virus
  • Porcine Parvovirus was selected as a model virus to evaluate the inactivation capability of BPL in aqueous solution because of its high resistance to physico-chemical inactivation.
  • Three starting concentrations of BPL were evaluated: 300 ppm (1/3333), 500 ppm (1/2000) and 700 ppm (1/1429).
  • Virus solution was spiked with BPL at these concentrations and incubated at 5 ⁇ 2°C for 24 hours.
  • Kinetic samples were taken at 0.5, 2, 6, 24h and after the BPL hydrolyzation step and analysed for remaining infectivity. The results are shown in Table A
  • BPL concentration 500 ppm (1/2000) was selected for the inactivation of SARS-CoV- 2 virus harvest material.
  • an incubation temperature of 5 ⁇ 3°C and an incubation time of 24 hours were selected to ensure enough BPL present throughout the whole inactivation.
  • the inactivation solution is transferred to a fresh container where the inactivation takes place under controlled conditions. This transfer excludes the possibility of virus particles in potential dead- spots during initial mixing not being in contact with BPL.
  • protamine sulfate (PS) treated concentrated harvest pre-cooled to 5 ⁇ 3°C is supplemented with 25 mM HEPES pH 7.4.
  • the solution is warmed to temperatures above 32°C for a total time of 2.5 hours ⁇ 0.5 hours in a temperature-controlled incubator set to 37 ⁇ 2°C.
  • the total time of the hydrolyzation step for the current process volume of about IL was between 5 hours 15 minutes and 6 hours 15 minutes including the warming to and the incubation above 32°C.
  • the inactivated viral solution (IVS) was immediately cooled down to 5 ⁇ 3°C in a temperature-controlled fridge and stored there until inactivation was confirmed by large volume plaque assay and serial passaging assay which currently requires 18 days in total. Recovery of virus particles throughout the inactivation process was monitored by size-exclusion chromatography.
  • the inactivation step(s) are particularly gentle, in order to preserve surface antigen integrity, especially integrity of the S protein.
  • the gentle inactivation method comprises contacting a liquid composition comprising SARS-CoV-2 particles with a chemical viral inactivating agent (such as e.g. any of the chemical inactivation agents as listed above or a combination thereof, preferably beta-propiolactone) in a container, mixing the chemical viral inactivating agent and the liquid composition comprising SARS-CoV-2 particles under conditions of laminar flow but not turbulent flow, and incubating the chemical viral inactivating agent and the liquid composition comprising SARS-CoV-2 particles for atime sufficient to inactivate the viruses.
  • a chemical viral inactivating agent such as e.g. any of the chemical inactivation agents as listed above or a combination thereof, preferably beta-propiolactone
  • the gentle inactivation step is optionally performed in a flexible bioreactor bag.
  • the gentle inactivation step preferably comprises five or less container inversions during the period of inactivation.
  • the mixing of the chemical viral inactivating agent and the composition comprising SARS-CoV-2 particles comprises subjecting the container to rocking, rotation, orbital shaking, or oscillation for not more than 10 minutes at not more than 10 rpm during the period of incubation.
  • the material was immediately further processed by batch adsorption (also known herein as batch chromatography) with CaptoTM Core 700 or CC400 chromatography media at a final concentration of ⁇ 1% CC700 or CC400.
  • batch adsorption also known herein as batch chromatography
  • CaptoTM Core 700 or CC400 chromatography media at a final concentration of ⁇ 1% CC700 or CC400.
  • the material was incubated at 4°C for 15 minutes under constant agitation using a magnetic stirrer. After incubation, if used, the CC700 or CC400 solid matter was allowed to settle by gravity for 10 minutes and the SARS-CoV-2 material is removed from the top of the solution in order to avoid blockage of the filter by CaptoCore particles.
  • CaptoCore particles and DNA precipitate were then removed from the solution by filtration using a 0.2 pm Mini Kleenpak EKV filter capsule (Pall).
  • the pooled filtered harvest material was adjusted to a final concentration of 25 mM Tris pH 7.5 and 10% sucrose (w/w) using stock solutions of both components. This allowed for freezing the concentrated harvest at ⁇ -65°C if required.
  • the resulting filtrate is further processed by sucrose density gradient centrifugation (also known herein as batch centrifugation) for final concentration and polishing of the SARS-CoV-2 material.
  • sucrose density gradient centrifugation also known herein as batch centrifugation
  • PS concentrated protamine sulfate
  • benzonase preferred is PS
  • treated harvest was loaded on top of a solution consisting of three layers of sucrose with different densities. The volumes of individual layers for a centrifugation in 100 mb bottle scale are shown in Table la.
  • the sucrose gradient bottles were prepared by stratifying the individual sucrose layers by pumping the solutions into the bottom of the bottles, starting with the SARS-CoV-2 material with the lowest sucrose density (10% sucrose (w/w)), followed by the other sucrose solutions in ascending order.
  • the described setup is shown in Figure 3.
  • the prepared SG bottles were transferred into a rotor pre-cooled to 4°C and centrifuged at ⁇ 11,000 RCF max at 4°C for at least 20 hours, without brake/deceleration.
  • SARS-CoV-2 Formulation of SARS-CoV-2 with adjuvant.
  • the SARS-CoV-2 particles were formulated with alum.
  • a Thl adjuvant was also added to the formulation or provided as a separate composition for bedside mixing.
  • SARS-CoV-2 ELISA Assay Inactivated SARS-CoV-2 antigen content (i.e. content of SI as the major antigenic protein) in preparations described herein was determined (quantified) by ELISA.
  • the SARS- CoV-2 ELISA used herein is a four-layer immuno-enzymatic assay with a SARS-CoV-2 spike antibody (AM001414; coating antibody) immobilized on a microtiter plate to which the SARS-CoV-2 sample is added. On binding of the antigen to the coating antibody, the plate was further treated with primary antibody (i.e. AbFlex® SARS-COV-2 spike antibody (rAb) (AM002414)).
  • the secondary antibody which is an enzyme linked conjugate antibody (i.e. Goat anti-Mouse IgG HRP Conjugate).
  • the plates were washed between various steps using a mild detergent solution (PBS-T) to remove any unbound proteins or antibodies.
  • PBS-T mild detergent solution
  • the plate was developed by addition of a tetramethyl benzidine (TMB) substrate.
  • TMB tetramethyl benzidine
  • the hydrolyzed TMB forms a stable colored conjugate that is directly proportional to the concentration of antigen content in the sample.
  • the antigen quantification was carried out by spectrophotometric detection at X450nm (763 Onm reference) using the standard curve generated in an automated plate reader as a reference.
  • Standard concentrations 20 AU/mL, 10 AU/mL, 5 AU/mL, 2.5 AU/mL, 1.25 AU/mL, 0.625 AU/mL, 0.3125 AU/mL and 0.1263 AU/mL. Each dilution was tested in duplicate per plate.
  • An “antigen unit” of the spike trimer standard corresponds to its binding ability in a functional ELISA with Recombinant Human ACE-2 His-tag.
  • SARS-CoV-2 Spike Antibody A001414) Spike Trimer (S1+S2), His-tag (SARS-CoV-2) (e.g. BPS Lot# 200826; Cat#100728) SARS-CoV-2 QC (e.g. RSQC240920AGR)
  • Coating buffer Carbonate buffer
  • ELISA wash buffer PBS + 0.05% Tween-20 (PBS-T).
  • Sample dilution buffer PBS-T + 1% BSA.
  • SARS-CoV-2 drug substance according to the invention was highly pure (>95%) according to SDS-PAGE (silver stain, reduced) and free from aggregates (monomer virus (>95%) according to SE-HPLC (see Figure 7).
  • RNA sequence and/or fragments thereof, optionally comprising modified (preferably alkylated or acylated) nucleotide residues) corresponding to a DNA sequence (i) as defined by SEQ ID NO: 2; (ii) as defined by SEQ ID NO: 3; (iii) as defined by SEQ ID NO: 4 will be produced using a process to eliminate or reduce furin cleavage activity.
  • Example 2 In vitro and in vivo assessment of immunogenicity and protective capacity of inactivated SARS-CoV-2 virus compositions
  • mice Prior to immunization, experimental groups of 10 Balb/c mice were bled and pre- immune sera are prepared. The mice were administered a dose titration of inactivated SARS-CoV-2 formulated with alum subcutaneously (see Table 2). At two different intervals after immunization (see below), blood was collected and immune sera prepared, spleens were collected at the final bleed. All animal experiments were carried out in accordance with Austrian law (BGB1 Nr. 501/1989) and approved by “Magistrats 58”. Sera were assessed for total IgG and subclasses (IgGl/IgG2a) by ELISA and neutralizing antibodies by PRNT. Thl/Th2 responses were further assessed by IFN-y ELI Spot and intracellular cytokine staining (CD4 + /CD8 + ).
  • mice/group 3 dosage groups: 0.2 - 2 pg total protein; number of experiments: 3.
  • the Thl adjuvant is added directly to the SARS-CoV-2/alum formulation before immunization of the mice.
  • Plaque reduction neutralization test PRNT. Each well of a twelve-well tissue culture plate was seeded with Vero cells and incubated 35°C with 5% CO2 for three days. Serial dilutions from pools of heat-inactivated sera from each treatment group are tested. Each serum preparation was incubated with approximately 50-80 pfu of SARS-CoV-2 at 35°C with 5% CO2 for 1 hour. The cell culture medium was aspirated from the Vero cells and the SARS-CoV-2 /serum mixtures were added to each well. The plates are gently rocked and then incubated for 2 hours at 35°C with 5% CO2.
  • Table 3A Design of dosing experiment 4743 using SARS-CoV-2 ELISA-determined dosages.
  • mice Female Balb/c mice (10 mice/group) were immunized two times s.c. (100 pL) on days 0 and 21 with doses and adjuvants as outlined in Table 3A. The readouts from the experiment were total IgG and subclasses (IgGl/IgG2a) and virus neutralization (PRNT).
  • Vaccine formulation used in experiment 4743 purified inactivated SARS-CoV-2 produced from a research virus seed bank (rVSB) formulated in PBS with 17 pg Al 3+ (alum)Zdose.
  • HRP-conjugated goat anti -mouse IgG was used and developed with ABTS and read at absorbance 405 nm. Wells were washed with PBS-T between each step. Endpoint titers were determined with a cut-off set to 3-fold the blank.
  • IgG subclass immune response Plates were coated with the SI part ( Figure 4A) of spike glycoprotein and sera taken on day 35 were analyzed. Subclass specific secondary antibodies (IgGl and IgG2a) conjugated with HRP were used for detection. As standard curves (4-paramater regression) for determination of the amount of the different IgG subclasses (IgGl and IgG2a), monoclonal antibodies with different subclasses were used (IgGl mAb clone 43 and IgG2amAb clone CR3022). Bound HRP- conjugated secondary mAbs were developed with ABTS and read at absorbance 405 nm. Wells were washed with PBS-T between each step. The relative IgG subclass concentration is shown in Figure 5A and the ratio of IgG2a/IgGl in Figure 5B.
  • the alum-adjuvanted inactivated SARS-CoV-2 promoted an immune response shifted more towards a Th2 (IgGl) compared with a Thl (IgG2a) response as demonstrated by quantification of IgG subclasses by SI ELISA.
  • the total amounts of IgG2a and IgGl measured and the ratio of IgG2a:IgGl in the treatment groups are shown in Figs. 5A and 5B, respectively.
  • a shift in the immune response toward Thl (IgG2a) would likewise be expected by addition of a Thl -stimulating adjuvant to the SARS-CoV-2 vaccine composition.
  • a challenge study is carried out in immunized non-human primates (NHP) (see Figure 17) and a passive transfer study is carried out in hamsters using sera from human subjects vaccinated with the SARS-CoV-2 vaccine candidate of the invention (see Table 1c).
  • NTP immunized non-human primates
  • a passive transfer study is carried out in hamsters using sera from human subjects vaccinated with the SARS-CoV-2 vaccine candidate of the invention (see Table 1c).
  • Immune sera from inactivated SARS-CoV-2- vaccinated mice are assessed for hallmarks of enhanced disease in vitro.
  • Such assays are described by e.g. Wang, S.-F., et al. 2014 (Antibody-dependent SARS coronavirus infection is mediated by antibodies against spike proteins (2014) BBRC 451 :208-214). Briefly, susceptible cell types or cell lines are incubated with immune sera and subsequently infected with SARS-CoV-2. Cells are assessed for cytopathic effect and/or production of inflammatory markers.
  • mice are immunized twice at two-week intervals with inactivated SARS-Cov-2 formulated as described herein followed by challenge with SARS-CoV-2. SARS-CoV-2 titers and immune cell infiltration of the lung are tested.
  • Non-human primate model of ADE The risk of ADE development in non-human primates is assessed as described by Luo F, et al. (Evaluation of Antibody-Dependent Enhancement of SARS-CoV Infection in Rhesus Macaques Immunized with an Inactivated SARS-CoV Vaccine (2016) Virologica Sinica 33:201-204). Briefly, NHPs are immunized with inactivated SARS-CoV-2, followed by SARS-CoV-2 challenge and evaluation of symptoms and disease pathology.
  • Formulation of inactivated SARS-CoV-2 (monovalent, wild type) for Phase 1 trial is to assess the safety of the vaccine, along with immunogenicity, and to determine an optimal dose of the individual SARS-CoV-2 particles and adjuvant(s).
  • several antigen doses were tested in clinical phase 1 : High, Medium and Low doses are chosen to have a distance between each dose of approximately 3 -fold and a span covering about a 10-fold difference between the high and low doses.
  • the dose range is selected in part to indicate any potential dose-sparing effect of a Thl adjuvant.
  • the SARS-CoV-2 virus as purified herein has a high purity of >90% as assessed by SDS-PAGE, SE- HPLC and/or SARS-CoV-2 ELISA (data not shown). Furthermore, preliminary studies have indicated that the incidence of genetic heterogeneities during passage of the virus is low and no particular individual mutations stand out (data not shown).
  • the SARS-CoV-2 virus as purified herein has a high purity of >90% as assessed by SDS-PAGE, SE- HPLC and/or SARS-CoV-2 ELISA (see, e.g., Fig. 7). Furthermore, preliminary studies have indicated that the incidence of genetic heterogeneities during passage of the virus is low and no particular individual mutations stand out (data not shown).
  • the SARS-CoV-2 virus was compared with JEV, specifically assessing SE- HPLC peak area per dose equivalent (recorded as milli-absorption units x minutes; mAU), the total amount of inactivated viral particles per dose and the total viral surface equivalent per dose (see Table 4).
  • SE- HPLC peak area per dose equivalent recorded as milli-absorption units x minutes; mAU
  • This assessment was based on the assumption of a similar surface antigen density between S (spike; SARS-CoV-2) and E (envelope; JEV) proteins.
  • Total protein was determined by pBCA assay (Table 4). Although the assay was variable, a correspondence of 1 mAU to ⁇ 2 pg total protein per mb was observed.
  • SARS-CoV-2 ELISA assay As described in Example 1, was developed and the doses of the vaccine formulations for entry into Phase 1 trials were determined using this assay.
  • the Phase 1 treatment groups are set forth in Table 5.
  • rHSA Human Serum Albumin
  • PBS Phosphate buffered saline
  • vaccinated subjects are challenged with an infectious dose of live SARS-CoV-2 virus (Asian and/or European lineage).
  • Treatment groups for Phase 1 testing of inactivated SARS-CoV-2 vaccine (low, medium and high doses are those provided in Table 4).
  • the objective of the Phase 1 trial is to assess the safety of the vaccine, along with immunogenicity, and to determine an optimal dose of each of the individual SARS_CoV-2 particles and adjuvant(s).
  • several antigen doses in different ratio i.e. 1: 1 or 1:2 or 2: 1 wild type: omicron
  • Other objective is to evaluate amount of adjuvant(s), e.g. it is expected that alum and a Thl adjuvant such as CpG1018 will be evaluated.
  • Alum concentration is expected to be in the range of 0.5 mg/dose
  • Example 5 Testing of Sera of vaccinated organism with a neutralization assay
  • Sera of vaccinated mice, hamsters, non-human primates or humans can be tested in neutralization assays such as e.g. described in “Szurgot, I., Hanke, L., Sheward, D.J. et al. DNA-launched RNA replicon vaccines induce potent anti-SARS-CoV-2 immune responses in mice. Sci Rep 11, 3125 (2021). https://doi.org/10.1038/s41598-021-82498-5”.
  • the read-out of the test gives an indication how well sera of vaccinated subjects can neutralize new variants and thus guides in the design of the vaccine.
  • Example 6 Liquid chromatography with tandem mass spectrometry (LC-MS-MS) analysis of inactivated SARS-CoV-2
  • Protein identification The bands could be clearly atributed to the three main viral proteins (Spike-protein, Membrane-protein, Nucleoprotein) as well as to background proteins from the host system (see Figure 10). Traces of SARS- CoV-2 ORF9b and the replicase polyprotein could also be detected, but these proteins were probably not well resolved on the gel due to their size (data not shown).
  • the separation patern on the gel was very similar for both samples with the exception of a host protein band (band 2.3), a slightly different S-protein patern (bands 2.10-2.13), and an expected strong band of serum albumin in one ofthe samples (sample 2) (data not shown). Additionally, a number of typical lab contaminants of human origin (e.g.
  • BPL modifications could be detected (mainly in the form of +72 Da) but at a low abundance.
  • 2894 sample 1
  • 3086 sample 2 identified spectra for SARS-CoV-2 proteins only 73 and 110, respectively, carried a BPL modification, which translates to 2.5 to 3.6 % (see Table 6). This was also confirmed by the open modification search using FragPipe, which atributed a similarly low fraction of spectra to mass differences matching the BPL-modification.
  • the FragPipe search revealed two other modifications (most likely acetaldehyde and acetylation) to occur in around 10% of the spectra. These modifications represent most likely artifacts introduced during gel staining and sample preparation, as they also occur on contaminant proteins.
  • Example 7 Further liquid chromatography with tandem mass spectrometry (LC-MSMS) analysis of inactivated SARS-CoV-2
  • the Coomassie-stained bands corresponding to spike protein (based on previous analysis) were subjected to in-gel digestion with trypsin or chymotrypsin or to acid hydrolysis. Trypsin digests were performed twice, once with and once without previous PNGase F (peptide :N-glycosidase F) digestion, to identify peptides masked by glycosylation.
  • PNGase F peptide :N-glycosidase F
  • Digested peptides were analysed by LC-MSMS essentially as described in Example 6.
  • the resulting peptides were analyzed with nano-liquid chromatography coupled to a high-resolution accurate mass spectrometer.
  • Peptides were identified from raw spectra using the MaxQuant software package and the UniProt reference databases for SARS-CoV-2 and Chlorocebus sabcieus in combination with a database of common lab contaminants.
  • BPL B-propiolactone
  • spectra of all BPL-modified peptides of the SARS-CoV-2 spike protein were manually validated.
  • the degree of modification was globally estimated as the percentage of BPL-modified spectra identified, and on site-level by calculating site occupancies from the ratio of modified to unmodified peptides for each peptide/site separately.
  • Example 6 this confirms that the percentage of BPL-modified peptides is low regardless of the digestion method, e.g. less than 7%, 2% to 7% or around 2-5% on average.
  • Example 8 Outline of a next generation inactivated SARS-CoV-2 vaccine
  • the vaccine platform and manufacturing process allows to combine SARS-CoV-2 variants and quickly modify the formulation as needed (based on circulating strains). Therefore, the technology platform is highly suitable for a yearly booster and/or virus adaptation similar to the yearly influenza vaccinations.
  • Manufacturing scale Manufacturing production capacity can be scaled up to meet the need of its stakeholders.
  • Vaccine’s platform is designed for routine use and distribution - a meaningful improvement over other COVID-19 vaccines.
  • the vaccines of the invention can be routinely stored at 2-8°C and the anticipated minimum shelflife is 24 months. Additionally, the vaccines are expected to be stable for 24-48 hours at ambient temperature.
  • the monovalent SARS-CoV-2 vaccine (SEQ ID NO: 9) is a highly-purified, whole virus, SARS-CoV- 2 vaccine candidate produced on Vero cells and inactivated with p-propiolactone. Said vaccine is adjuvanted with a Thl adjuvant in combination with Aluminum Hydroxide.
  • the monovalent SARS-CoV-2 vaccine candidate had superiority against the comparator vaccine, AstraZeneca’s AZD1222 (ChAdOxl-S), in terms of geometric mean titer (GMT) for neutralizing antibodies, as well as non-inferiority in terms of seroconversion rates (SCR above 95% in both treatment groups) at two weeks after the second vaccination.
  • the monovalent SARS-CoV-2 vaccine candidate induced broad T-cell responses with antigenspecific IFN -gamma-producing T-cells against the S, M and N proteins.
  • the monovalent SARS-CoV-2 vaccine candidate was generally well tolerated, demonstrating a statistically significant better tolerability profile compared to AZDI 222.
  • a third dose of the monovalent SARS-CoV-2 vaccine candidate produced also neutralizing antibodies against the Omicron variants in laboratory studies.
  • Bivalent SARS-CoV-2 vaccine The clinical development would be based on neutralizing antibody titer levels for one specific SARS-CoV-2 strain in a non-inferiority immunogenicity trial. In the absence of an established correlate, similar levels of neutralizing antibodies against any new SARS-CoV-2 vaccine strain would be shown through adopted and specific assays.
  • the clinical trial would evaluate the safety, tolerability, and immunogenicity in healthy adults 18 to 55 years of age.
  • the trial would have four cohorts examining different regimens of the current monovalent vaccine and bivalent vaccine.
  • the bivalent vaccine may be able to induce a greater breadth of protection in seropositive individuals than the monovalent SARS-CoV-2 vaccine, but in particular compared with RNA, viral vector, and nanoparticle vaccines that are focusing solely on the S-protein. Therefore, the company believes the study can be considered as a primary two-dose and/or booster vaccine.
  • a third dose of the monovalent SARS-CoV- 2 vaccine candidate administered 7 to 8 months after the second dose of primary vaccination increased levels of antibodies against the Wuhan virus strain 42- to 106 -fold, depending on the pre-boost antibody levels.
  • IXIARO® a vaccine against Japanese Encephalitis that uses the same or similar technology platform. At least eleven months after primary vaccination with IXIARO, we saw that 83% of subjects still had protective neutralizing antibodies (5 years in over 60% of vaccinees).
  • IXIARO is recommended to have a single booster dose at least 1 Imonths after primary immunization with IXIARO (Taucher et al. 2019, Package-Insert-and-Patient-Information-IXIARO, September 2018 [https ://www.fda.gov/media/75777/download]) .
  • the route of administration of the monovalent SARS-CoV-2 vaccine is intramuscular injection (i.m).
  • the vaccine will be provided in both single and multi-dose vials as a liquid formulation containing Aluminium Hydroxide and a Thl adjuvant ready for use.
  • bivalent vaccine candidate e.g. Wuhan & Omicron strains
  • Inactivated SARS-CoV-2 vaccines are a critical component of the portfolio of vaccine response to COVID- 19 since they may have the potential to offer a greater breadth of protection against variants than the mRNA, viral vector, and nanoparticle vaccines currently licensed in the U.S. and E.U. Whereas inactivated vaccines utilize all four SARS-CoV-2 structural proteins as antigens, other vaccine technologies rely on the spike (S) protein alone.
  • SARS-CoV-2 vaccines of the invention contain all four structural proteins of SARS-CoV-2: the spike (S) protein, the nucleocapsid (N) protein, the membrane (M) protein, and the envelope (E) protein.
  • S spike
  • N nucleocapsid
  • M membrane
  • E envelope
  • the monovalent SARS-CoV-2 vaccine elicited cellular responses to at least three different antigens, demonstrating the breadth of responses expected from an inactivated vaccine. o In the pivotal phase 3 trial, 74% of subjects mounted responses to S, 46% to N, and 20% to M. Responses to E were not evaluated.
  • the storage conditions for the product are 2-8°C. Based on the long term and accelerated stability data collected for monovalent SARS-CoV-2 vaccine to date the anticipated shelf life is at least 24 months. This would include up to 48 hour storage at ambient temperature.
  • Example 9 An open-label phase 3 study assessing the safety, tolerability and immunogenicity of the monovalent SARS-CoV-2 vaccine in adults aged > 56 years
  • Participants will be provided with an electronic Diary (e-Diary) and will be trained to record specifically solicited systemic and local symptoms daily for 7 days following each vaccination as well as any additional AEs during follow-up period after each of both vaccinations up to the next visit to the site until Day 43 visit has been completed.
  • e-Diary electronic Diary
  • Booster vaccination with the monovalent SARS-CoV-2 vaccine Participants will be provided with an electronic Diary (e-Diary) and will be trained to record specifically solicited systemic and local symptoms daily for 7 days following booster vaccination as well as any additional AEs during follow-up period after booster vaccination up to visit B3.
  • e-Diary electronic Diary
  • Example 10 An open-label phase 2/3 clinical study to investigate safety and immunogenicity of a single monovalent SARS-CoV-2 vaccine booster vaccination in adult volunteers after receipt of nationally rolled out mRNA COVID-19 vaccines and/or natural SARS-CoV-2 infection
  • the monovalent SARS-CoV-2 vaccine booster (standard dose of 0.5 mL or double dose of 1.0 mL) will be applied:
  • Cohort 1 and Cohort 2 groups A and B: at least 6 months after vaccination with mRNA COVID-19 vaccine
  • Cohort 1 and Cohort 2 groups C and D: at least 6 months after vaccination with mRNA COVID-19 vaccine or at least 4 months after a documented PCR or antigen test for confirmed SARS-CoV-2 infection in case the infection occurred after the administration of the last dose of mRNA CO VID-19 vaccine
  • Cohort 3 groups C and D: at least 6 months after vaccination with mRNA COVID-19 vaccine or at least 4 months after a documented PCR or antigen test for confirmed SARS-CoV-2 infection in case the infection occurred after the administration of the last dose of mRNA CO VID-19 vaccine
  • the monovalent SARS-CoV-2 vaccine booster (standard dose of 0.5 mL for participants >18 to ⁇ 50 years or double dose of 1.0 mL for >50 years) will be applied at least 4 months after documented PCR or antigen test confirmation of natural SARS-CoV-2 infection.
  • the booster dose with the monovalent SARS-CoV-2 vaccine is to be administered at least 6 months after the last mRNA dose. In case the infection occurred after the last dose of mRNA, then the booster dose with the monovalent SARS-CoV-2 vaccine is to be administered at least 4 months after the documented PCR or antigen test confirmation of the infection.
  • Rapid antigen test results can be considered as proof of previous COVID- 19 infection but only if the antigen test results have been officially documented or registered in an official system - as for the PCR test results, in all cases, a paper document must be available/printable to be considered sufficient proof of a previous infection prior to enrollment (in the relevant Cohorts). See Table 10 for an overview on cohorts and targeted number of participants.
  • the first 10 participants aged >50 years of the Cohort 2 from any of the group (A, B, C and D) or Cohort 3 (monovalent SARS-CoV-2 vaccine double dose, i.e., 1.0 mL) will be considered sentinel participants and undergo special precautionary safety measures.
  • -Double dose administration of the monovalent SARS-CoV-2 vaccine for these sentinels will be done at a single site to ensure permanent oversight of safety data by one principal investigator.
  • a second site may need to be involved in the recruitment of the sentinel participants, in this case vaccinations will be limited to one site on a specific day.
  • Safety data exchange between the study sites will be ensured.
  • -Sentinel participants will be observed for 60 minutes at the study site to monitor for the development of any acute reaction. Prior to discharge, vital signs will be measured and participants will be instructed to use their e-Diaries.
  • Safety telephone calls will be performed by the study site approximately 24 and 48 hours after vaccination for safety follow-up. The information provided must be compared with the entries in the participant’s eDiary.
  • -A Data Safety Monitoring Board (DSMB) will review the accrued safety data when all 10 sentinel participants have completed the 7-day e-diary period after vaccination. Applicable for all participants
  • -Participants will be provided with an electronic Diary (e-Diary) and will be trained to record specifically solicited, predefined systemic and local symptoms daily for 7 days following the booster vaccination as well as any additional AEs during the follow-up period up to Day 15. The following information will be collected:
  • a SARS-CoV-2 vaccine comprising at least two or exactly two different beta-propiolactone- inactivated SARS-CoV-2 particles, wherein the vaccine is capable of generating neutralizing antibodies against a native homologous and/or heterologous SARS-CoV-2 particle and/or is capable of raising an effective T-cell response against a native homologous and/or heterologous SARS-CoV-2 particle in a human subject.
  • a SARS-CoV-2 vaccine according to aspect Al wherein a native surface conformation of the SARS-CoV-2 particle is preserved in the vaccine and/or wherein the activity of the furin cleavage site within the viral RNA is reduced or eliminated by passaging out the furin site and/or introducing mutations in the cleavage site.
  • viral RNA in the inactivated SARS-CoV-2 particle is replication-deficient, preferably wherein viral RNA in the inactivated SARS-CoV-2 particle (i) is alkylated and/or acylated (ii) comprises one or more modified purine (preferably guanine) residues and/or strand breaks and/or (iii) is cross-linked with one or more viral proteins.
  • a SARS-CoV-2 vaccine according to any preceding aspect, wherein the SARS-CoV-2 particles are beta-propiolactone -inactivated at a concentration of 300 to 700ppm, more preferably 500ppm and inactivated for about 1 to 48h, preferably 20 to 28h, most preferred 24 hours ⁇ 2 hours (such as also ⁇ 1 hour or ⁇ 0.5 hour) at 2°C to 8°C, followed optionally by a hydrolyzation for 2.5 hours ⁇ 0.5 hours at 35°C to 39°C, preferably around 37°C.
  • a SARS-CoV-2 vaccine according to any preceding aspect, wherein surface proteins in the inactivated SARS-CoV-2 particles comprise reduced modifications compared to viral RNA in the inactivated SARS-CoV-2 particles, preferably wherein surface proteins comprise a reduced proportion of modified residues compared to viral RNA in the inactivated SARS-CoV-2 particles; said modifications being with respect to a native SARS-CoV-2 particles, preferably wherein said modifications comprise alkylated and/or acylated nucleotide or amino acid residues.
  • a SARS-CoV-2 vaccine according to any preceding aspect, wherein the inactivated SARS-CoV- 2 particles comprises a native conformation of (i) spike (S) protein; (ii) nucleocapsid (N) protein; (iii) membrane (M) glycoprotein; and/or (iv) envelope (E) protein; preferably wherein the inactivated SARS-CoV-2 particle comprises a native conformation spike (S) protein.
  • an inactivated SARS-CoV- 2 particles comprises fewer than 200, 100, 50, 30, 20, 15, 10, 9, 8, 7 or 6 beta-propiolactone- modified amino acid residues; preferably wherein a spike (S) protein of the inactivated SARS- CoV-2 particle comprises fewer than 100, 50, 30, 20, 15, 10, 9, 8, 7 or 6 beta-propiolactone- modified amino acid residues; more preferably wherein the inactivated SARS-CoV-2 particles or spike proteins thereof comprises 15 or fewer beta-propiolactone-modified amino acid residues; most preferably wherein the inactivated SARS-CoV-2 particles or spike proteins thereof comprises 1 to 100, 2 to 50, 3 to 30, 5 to 20 or about 15 beta-propiolactone-modified amino acid residues.
  • a SARS-CoV-2 vaccine according to any preceding aspect wherein fewer than 20%, 15%, 10%, 5% or 4% of SARS-CoV-2 polypeptides in the particle are beta-propiolactone-modified; preferably wherein 0. 1 to 10%, more preferably 1 to 5%, more preferably 2 to 8% or about 3-6% of SARS-CoV-2 polypeptides in the particles, comprise at least one beta-propiolactone modification; preferably as detected in the vaccine by mass spectroscopy, optionally following enzymatic digestion with trypsin, chymotrypsin and/or PNGase F or acid hydrolysis.
  • a SARS-CoV-2 vaccine according to any preceding aspect, wherein a spike (S) protein of the inactivated SARS-CoV-2 particle comprises a beta-propiolactone modification at one or more of the following residues: 49, 146, 166, 177, 207, 245, 379, 432, 519, 625, 1029, 1032, 1058, 1083, 1088, 1101, 1159 and/or 1271; preferably H49, H146, C166, M177, H207, H245, C432, H519, H625, M1029, H1058, H1083, H1088, Hl 101, Hl 159 and/or H1271; or H207, H245, C379, M1029 and/or C1032, e.g. in SEQ ID NO: 5, or a corresponding position in another variant inactivated SARS-CoV-2 particle.
  • a SARS-CoV-2 vaccine according to any preceding aspect wherein fewer than 30%, 20%, 10%, 5%, 3% or 1% of one or more of the following residues, preferably of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or all ofthe following residues, in the inactivated SARS- CoV-2 particles are beta-propiolactone modified in the spike (S) protein, residues 49, 146, 166, 177, 207, 245, 379, 432, 519, 625, 1029, 1032, 1058, 1083, 1088, 1101, 1159 and/or 1271; preferably H49, H146, C166, M177, H207, H245, C432, H519, H625, M1029, H1058, H1083, H1088, Hl 101, Hl 159 and/or H1271; or H207, H245, C379, M1029 and/or C1032; e.g. in SEQ ID NO: 5, or a
  • a SARS-CoV-2 vaccine according to any preceding aspect wherein infectivity of mammalian cells by the inactivated SARS-CoV-2 particles is reduced by at least 99%, 99.99% or 99.9999% compared a native SARS-CoV-2 particle, or wherein infectivity of mammalian cells by the inactivated A SARS-CoV-2 particle is undetectable.
  • a SARS-CoV-2 vaccine according to any preceding aspect further comprising one or more pharmaceutically acceptable excipients, such as e.g., human serum albumin (HSA).
  • HSA human serum albumin
  • a SARS-CoV-2 vaccine according to any preceding aspect further comprising an adjuvant.
  • a SARS-CoV-2 vaccine according to aspect A18 wherein the Thl response-directing adjuvant comprises 3-O-desacyl-4'-monophosphoryl lipid A (MPL), saponin QS-21, a CpG-containing oligodeoxynucleotide (CpG ODN), squalene, DL-a-tocopherol, a cationic peptide, a deoxyinosine-containing immunostimulatory oligodeoxynucleic acid molecule (I-ODN) and/or imiquimod.
  • MPL 3-O-desacyl-4'-monophosphoryl lipid A
  • saponin QS-21 a CpG-containing oligodeoxynucleotide
  • CpG ODN CpG-containing oligodeoxynucleotide
  • squalene DL-a-tocopherol
  • a cationic peptide a deoxyinosine-containing immunostimulatory oligodeoxyn
  • a liposomal preparation comprising 3-O-desacyl-4'-monophosphoryl lipid A (MPL) and saponin QS-21, preferably Adjuvant System 01;
  • a CpG ODN comprising the sequence 5’ TGACTGTGAACGTTCGAGATGA 3’, preferably CpG 1018 (SEQ ID NO: 8);
  • SARS-CoV-2 vaccine according to any one of the preceding aspects, wherein the SARS- CoV-2 particle comprises at least two, e.g. two or three RNA sequences selected from the group consisting of
  • RNA sequence (and/or fragments thereof, optionally comprising modified (preferably alkylated or acylated) nucleotide residues) corresponding to a DNA sequence (i) as defined by SEQ ID NO: 1 or 9; or (ii) having at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity to SEQ ID NO: 1 or 9 as provided in Figures 8A and 8B, respectively; preferably wherein a native (non-inactivated) SARS-CoV-2 particle comprising the RNA sequence is able to pack a virulent SARS-CoV-2 virus; and
  • RNA sequence (and/or fragments thereof, optionally comprising modified (preferably alkylated or acylated) nucleotide residues) corresponding to a DNA sequence (i) as defined by a sequence of a variant of concern; or (ii) having at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity to such a sequence of a variant of concern (SEQ ID NO: 2 in Figure 9 or SEQ ID NO: 3 in Figure 10 or SEQ ID NO: 4 in Figure 11); preferably wherein a native (non-inactivated) SARS-CoV-2 particle comprising the RNA sequence is able to pack a virulent SARS-CoV-2 virus; wherein the combination of SEQ ID NO: 1 (wild-type, reference type) and SEQ ID NO: 3 or 4 (Omicron); SEQ ID NO: 9 (wild-type, INMI isolate) and SEQ ID NO: 3 or 4 (Omicron); or SEQ ID NO: 2 (Delt
  • A25 The SARS-CoV-2 vaccine according to any one of the preceding aspects, wherein the said vaccine comprises an additional SARS-CoV-2 particle that comprises an RNA sequence (and/or fragments thereof, optionally comprising modified (preferably alkylated or acylated) nucleotide residues) corresponding to a DNA sequence (i) as defined by SEQ ID NO: 2; or (ii) having at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity to SEQ ID NO: 2; preferably wherein a native (non-inactivated) SARS-CoV-2 particle comprising the RNA sequence is able to pack a virulent SARS-CoV-2 virus.
  • the said vaccine comprises an additional SARS-CoV-2 particle that comprises an RNA sequence (and/or fragments thereof, optionally comprising modified (preferably alkylated or acylated) nucleotide residues) corresponding to a DNA sequence (i) as defined by SEQ ID NO: 2; or
  • the SARS-CoV-2 vaccine according to any one of the preceding aspects, wherein the said vaccine comprises an additional SARS-CoV-2 particle that comprises an RNA sequence (and/or fragments thereof, optionally comprising modified (preferably alkylated or acylated) nucleotide residues) corresponding to a DNA sequence (i) as defined by SEQ ID NO: 3; or (ii) having at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity to SEQ ID NO: 3; preferably wherein a native (non-inactivated) SARS-CoV-2 particle comprising the RNA sequence is able to pack a virulent SARS-CoV-2 virus.
  • an additional SARS-CoV-2 particle that comprises an RNA sequence (and/or fragments thereof, optionally comprising modified (preferably alkylated or acylated) nucleotide residues) corresponding to a DNA sequence (i) as defined by SEQ ID NO: 3; or (ii) having at
  • the SARS-CoV-2 vaccine according to any preceding aspect, wherein, upon administration to a human subject, the vaccine (i) does not induce antibody-dependent enhancement (ADE) of SARS-CoV-2-associated disease (COVID-19); and/or (ii) does not induce immunopathology in the subject.
  • the vaccine upon administration to a human subject, the vaccine (i) does not induce antibody-dependent enhancement (ADE) of SARS-CoV-2-associated disease (COVID-19); and/or (ii) does not induce immunopathology in the subject.
  • A29 A method of preventing or treating SARS-CoV-2 infection and/or SARS-CoV-2-associated disease (COVID-19) such as severe COVID-19 disease, hospitalization caused by COVID-19 or death caused by COVID-19, in a human subject in need thereof, comprising administering a prophy tactically or therapeutically effective amount of the SARS-CoV-2 vaccine of any preceding aspect to the subject.
  • COVID-19 SARS-CoV-2 infection and/or SARS-CoV-2-associated disease
  • A30 The method according to aspect A29, further comprising administering a second, third or further dose of a prophylactically or therapeutically effective amount of the SARS-CoV-2 vaccine, preferably wherein the second dose of the vaccine is the same formulation as the first.
  • A31 The method according to aspect A29 or A30, wherein said prophylactically or therapeutically effective amount of the SARS-CoV-2 vaccine per dose is defined as about 1 to 150 AU/dose per SARS-CoV-2 particle, preferably between about 2 to 75 AU/dose per SARS-CoV-2 particle, preferably between about 3 and 60 AU/dose per SARS-CoV-2 particle, more preferably between about 3 and 55 AU/dose per SARS-CoV-2 particle, more preferably between about 3 and 53 AU/dose per SARS-CoV-2 particle, as assessed by ELISA, even more preferably between about 3 and 40 AU/dose per SARS-CoV-2 particle, more preferably about 10 to 60 AU/dose per SARS- CoV-2 particle, 20 to 50 AU/dose per SARS-CoV-2 particle, 25 to 45 AU/dose per SARS-CoV- 2 particle or 30 to 40 AU/dose per SARS-CoV-2 particle, such as e.g. 33 AU/dose or similar per SARS-
  • A32 The method according to aspect A29 or A30, wherein said prophylactically or therapeutically effective amount per dose of the SARS-CoV-2 variant in the vaccine is defined as about 0.05 to 50 pg total protein, about 0.1 to 25 pg, about 0.25 to 12.5 pg, preferably about 0.5 to 5 pg total protein, more preferably at least 2.5 pg total protein, at least 3.5 pg total protein or at least 2.5 pg total protein, even more preferably 2.5 pg to 25 pg, 3.5 pg to 10 pg or 4 pg to 6 pg total protein/dose, most preferably about 5 pg total protein/dose, e.g. as measured by (p)BCA.
  • A33 The method according to aspect A29 or A30, wherein said prophylactically or therapeutically effective amount per dose of the SARS-CoV-2 variant in the vaccine is defined as about 0.025 to 25 pg S-protein, about 0.05 to 12.5 pg, about 0.125 to 6.25 pg, preferably about 0.25 to 2.5 pg S -protein, as measured by ELISA.
  • a second dose of the SARS-CoV-2 vaccine is administered about 7 days, about 14 days, about 21 days, or about 28 days after a first dose of the SARS-CoV-2 vaccine, preferably wherein the second dose of the vaccine is the same formulation as the first; and/or
  • a further dose of the SARS-CoV-2 vaccine about every 6 months, about every 7 months, about every 8 months, about every 9 months, about every 10 months, about every 11 months or about every 12 months or about every 13 months after the last dose of the SARS-CoV-2 vaccine, preferably wherein such further dose of the vaccine is the same formulation as the first.
  • A35 The method according to any one of aspects A28 to A34, wherein the administering results in production of SARS-CoV-2 neutralizing antibodies.
  • a method of producing a SARS-CoV-2 vaccine comprising:
  • the inactivation step comprises (i) alkylating and/or acylating viral RNA (ii) modifying purine (preferably guanine) residues or introducing strand breaks into viral RNA and/or (iii) cross-linking viral RNA with one or more viral proteins.
  • A41 The method according to any one of aspects A36, A39 or A40, wherein the inactivation step comprises treating the native SARS-CoV-2 particles with beta-propiolactone.
  • A42 The method according to aspect A41, wherein the concentration of beta-propiolactone in the inactivation step is 0.01 to 1% by weight, preferably 0.05 to 0.5% by weight, more preferably about 0.1% by weight.
  • A43 The method according to aspect A41 or A42, wherein the native SARS-CoV-2 particles are contacted with beta-propiolactone for at least 5 hours, at least 10 hours, at least 24 hour or at least 4 days.
  • step (a) comprises one or more of the following steps:
  • A49 The method according to any one of aspects A36 or A39 to A48, further comprising dialyzing the inactivated SARS-CoV-2 particles, thereby producing a dialyzed SARS-CoV-2.
  • A50 The method according to aspect A49, further comprising filtering the dialyzed SARS-CoV-2.
  • the inactivation step comprises contacting a liquid composition comprising native SARS-CoV-2 particles with a chemical viral inactivating agent in a container, mixing the chemical viral inactivating agent and the liquid composition comprising SARS-CoV-2 particles under conditions of laminar flow but not turbulent flow, and incubating the chemical viral inactivating agent and the liquid composition comprising SARS-CoV-2 particles for a time sufficient to inactivate the viral particles.
  • A52 The method according to aspect A51, wherein the inactivation step is performed in a flexible bioreactor bag.
  • A53. The method according to aspect A51 or A52, wherein the inactivation step comprises five or less container inversions during the period of inactivation.
  • A54 The method according to any one of aspects A51 to A53, wherein the mixing of the chemical viral inactivating agent and the composition comprising native SARS-CoV-2 particles comprises subjecting the container to rocking, rotation, orbital shaking, or oscillation for not more than 10 minutes at not more than 10 rpm during the period of incubation.
  • A55 The method according to any one of aspects A36 or A39 to A54, further comprising purifying the inactivated SARS-CoV-2 particles by one or more methods selected from (i) batch chromatography and/or (ii) sucrose density gradient centrifugation.
  • step (c) comprises combining the inactivated SARS-CoV-2 particles with an adjuvant.
  • the adjuvant comprises 3-O-desacyl-4'- monophosphoryl lipid A (MPL), saponin QS-21, a CpG-containing oligodeoxynucleotide (CpG ODN), squalene, DL-a-tocopherol and/or imiquimod.
  • MPL 3-O-desacyl-4'- monophosphoryl lipid A
  • saponin QS-21 saponin QS-21
  • CpG ODN CpG-containing oligodeoxynucleotide
  • squalene DL-a-tocopherol and/or imiquimod.
  • a SARS-CoV-2 vaccine obtained or obtainable by the method of any one of aspects A36 or A39 to A58.
  • SARS-CoV-2 vaccine of any one of aspects Al to A28 or A59 for the treatment or prevention of a SARS-CoV-2 infection in a subject.
  • a pharmaceutical composition for use in the prevention or treatment of a SARS-CoV-2 infection in a subject wherein said pharmaceutical composition is the inactivated SARS-CoV-2 vaccine as defined in any one of aspects Al to A28 or A59, optionally in combination with one or more pharmaceutically acceptable excipients and/or adjuvants.
  • A62 The SARS-CoV-2 vaccine as defined in any one of aspects Al to A28 or A59 for use as a medicament.
  • A63 A vaccine, method, use or pharmaceutical composition according to any preceding aspect, wherein the subject is (i) an elderly subject, preferably a subject over 65, over 70 or over 80 years of age; (ii) an immunocompromised subject; or (iii) a pregnant subject.
  • ADE antibodydependent enhancement
  • VAERD vaccine-associated respiratory disease
  • ERP enhanced respiratory disease
  • immunopathology immunopathology
  • a SARS-CoV-2 vaccine for use as a booster vaccination wherein the vaccine comprises a betapropiolactone inactivated SARS-CoV-2 particle, wherein said SARS-CoV-2 particle comprises an RNA sequence corresponding to a DNA sequence (i) as defined by SEQ ID NO: 9; or (ii) having at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity to SEQ ID NO: 9; preferably wherein a native (non-inactivated) SARS-CoV-2 particle comprising the RNA sequence is able to pack a virulent SARS-CoV-2 virus.
  • SARS-CoV-2 vaccine for use as a booster vaccination of aspect Bl, wherein said SARS- CoV-2 virus comprises a Spike (S) protein comprising or consisting of (i) an amino acid sequence as defined by SEQ ID NO: 5, or (ii) an amino acid sequence having at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity to SEQ ID NO: 5; preferably wherein a native (non-inactivated) SARS-CoV-2 particle comprising the Spike protein is able to pack a virulent SARS-CoV-2 virus.
  • S Spike
  • MPL 3-O-desacyl-4'-monophosphoryl lipid A
  • CpG ODN CpG-containing oligodeoxynucleotide
  • squalene DL-a- tocopherol and/or imiquimod.
  • the adjuvant is an aluminium salt, i.e., aluminium phosphate or aluminium hydroxide.
  • SARS-CoV-2 vaccine for use as a booster vaccination according to any one of aspects B 1 to B8, further comprising one or more pharmaceutically acceptable excipients.
  • rHSA human serum albumin
  • PBS phosphate buffered saline
  • SARS-CoV-2 vaccine for use as a booster vaccination according to any one of aspects B 1 to BIO, wherein a “standard” dose is defined as 33 AU/0.5 mb.
  • SARS-CoV-2 vaccine for use as a booster vaccination according to any one of aspects B 1 to BIO, wherein a “double” dose is defined as 66 AU/1.0 mb.
  • a method of preventing or treating SARS-CoV-2 infection and/or SARS-CoV-2-associated disease (COVID-19) in a human subject in need thereof comprising administering as a booster vaccination a prophylactically or therapeutically effective amount of a SARS-CoV-2 vaccine comprising a beta-propiolactone inactivated SARS-CoV-2 particle, wherein said SARS-CoV-2 particle comprises an RNA sequence corresponding to a DNA sequence (i) as defined by SEQ ID NO: 9; or (ii) having at least 80%, at least 85%, at least 90%, at least 95% or at least 99% sequence identity to SEQ ID NO: 9; preferably wherein a native (non-inactivated) SARS-CoV-2 particle comprising the RNA sequence is able to pack a virulent SARS-CoV-2 virus.
  • said prophylactically or therapeutically effective amount of the SARS-CoV-2 vaccine per dose is defined as about 1 to 100 AU/dose, preferably between about 2 to 75 AU/dose, preferably between about 3 and 60 AU/dose, more preferably between about 3 and 55 AU/dose, more preferably between about 3 and 53 AU/dose, as assessed by EUISA, even more preferably between about 3 and 70 AU/dose, more preferably about 10 to 60 AU/dose, 20 to 50 AU/dose, 25 to 45 AU/dose or 30 to 40 AU/dose such as e.g. 33 AU/ dose, 35 AU/dose, 40 AU/dose or 66 AU/dose.
  • prophylactically or therapeutically effective amount of the SARS-CoV-2 vaccine per dose is defined as about 0.05 to 50 pg total protein, about 0. 1 to 25 pg, about 0.25 to 12.5 pg, preferably about 0.5 to 5 pg total protein, more preferably at least 2.5 pg total protein, at least 3.5 pg total protein or at least 2.5 pg total protein, even more preferably 2.5 pg to 25 pg, 3.5 pg to 10 pg or 4 pg to 6 pg total protein/dose, most preferably about 5 pg total protein/dose, e.g. as measured by (p)BCA.
  • Bl 8 The method according to any one of aspects B13 to Bl 6, wherein the prophylactically or therapeutically effective amount of the SARS-CoV-2 vaccine is administered as a booster following vaccination with a homologous or heterologous SARS-CoV-2 vaccine.
  • B20 The method according to any one of aspects B13 to Bl 9, wherein the administering of the prophylactically or therapeutically effective amount of the SARS-CoV-2 vaccine results in production of SARS-CoV-2 neutralizing antibodies.
  • B21 The method according to any one of aspects B13 to B20, wherein the booster vaccination is administered at least 2 weeks, at least 4 weeks, at least 8 weeks, at least 12 weeks, at least 16 weeks, preferably at least 6 months following the last vaccination with a homologous or heterologous SARS-CoV-2 vaccine or natural COVID-19 infection.
  • heterologous SARS-CoV- 2 vaccine is an mRNA SARS-CoV-2 vaccine or an adenovirus vector SARS-CoV-2 vaccine.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Communicable Diseases (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Mycology (AREA)
  • Molecular Biology (AREA)
  • Immunology (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Epidemiology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Pulmonology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

L'invention concerne des vaccins contre le SARS-CoV-2 et des compositions et procédés de production et d'administration desdits vaccins à des patients en ayant besoin.
PCT/EP2023/052534 2022-02-02 2023-02-02 Vaccin à virus sars-cov-2 inactivé WO2023148256A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP22154863.9 2022-02-02
EP22154863 2022-02-02

Publications (1)

Publication Number Publication Date
WO2023148256A1 true WO2023148256A1 (fr) 2023-08-10

Family

ID=80225882

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2023/052534 WO2023148256A1 (fr) 2022-02-02 2023-02-02 Vaccin à virus sars-cov-2 inactivé

Country Status (1)

Country Link
WO (1) WO2023148256A1 (fr)

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6309650B1 (en) 1997-08-28 2001-10-30 Cheil Jedang Corporation Attenuated Japanese encephalitis virus adapted to Vero cell and a Japanese encephalitis vaccine
WO2013083726A1 (fr) 2011-12-06 2013-06-13 Intercell Ag Composés de l'aluminium destinés à être utilisés dans des produits thérapeutiques et des vaccins
WO2017109223A1 (fr) 2015-12-23 2017-06-29 Valneva Se Purification de virus
WO2019057793A1 (fr) 2017-09-21 2019-03-28 Valneva Se Procédé de production de compositions pharmaceutiques comprenant le virus immunogène du chikungunya chikv-delta5nsp3
WO2021048221A1 (fr) 2019-09-09 2021-03-18 Valneva Austria Gmbh Procédé d'inactivation de virus
WO2021178318A1 (fr) 2020-03-01 2021-09-10 Dynavax Technologies Corporation Vaccins à coronavirus comprenant un agoniste de tlr9
WO2021176434A1 (fr) 2020-03-01 2021-09-10 Valneva Austria Gmbh Vaccin contre le virus sras-cov-2 à adjuvant cpg
WO2021204825A2 (fr) 2020-04-06 2021-10-14 Valneva Austria Gmbh Vaccin à virus sars-cov-2 inactivé

Patent Citations (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6309650B1 (en) 1997-08-28 2001-10-30 Cheil Jedang Corporation Attenuated Japanese encephalitis virus adapted to Vero cell and a Japanese encephalitis vaccine
WO2013083726A1 (fr) 2011-12-06 2013-06-13 Intercell Ag Composés de l'aluminium destinés à être utilisés dans des produits thérapeutiques et des vaccins
WO2017109223A1 (fr) 2015-12-23 2017-06-29 Valneva Se Purification de virus
WO2017109225A1 (fr) 2015-12-23 2017-06-29 Valneva Austria Gmbh Vaccin contre le virus zika
WO2019057793A1 (fr) 2017-09-21 2019-03-28 Valneva Se Procédé de production de compositions pharmaceutiques comprenant le virus immunogène du chikungunya chikv-delta5nsp3
WO2021048221A1 (fr) 2019-09-09 2021-03-18 Valneva Austria Gmbh Procédé d'inactivation de virus
WO2021178318A1 (fr) 2020-03-01 2021-09-10 Dynavax Technologies Corporation Vaccins à coronavirus comprenant un agoniste de tlr9
WO2021176434A1 (fr) 2020-03-01 2021-09-10 Valneva Austria Gmbh Vaccin contre le virus sras-cov-2 à adjuvant cpg
WO2021204825A2 (fr) 2020-04-06 2021-10-14 Valneva Austria Gmbh Vaccin à virus sars-cov-2 inactivé

Non-Patent Citations (40)

* Cited by examiner, † Cited by third party
Title
"GenBank", Database accession no. NC_045512.2
"Reactions of β-Propiolactone with Nucleobase Analogues, Nucleosides, and Peptides, Protein Structure and Foldingl", ISSUE 42, vol. 286, 21 October 2011 (2011-10-21), pages 36198 - 36214
ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 10
ALTSCHUL ET AL., MOL. BIOL., vol. 215, 1990, pages 403
ALTSCHUL ET AL., NUCLEIC ACIDS RES, vol. 25, 1977, pages 3389 - 3402
CORPET ET AL., NUC. ACIDS RES., vol. 16, 1988, pages 10881 - 90
DEVEREAUX ET AL., NUC. ACIDS RES., vol. 12, 1984, pages 387 - 395
FENGDOOLITTLE, MOL. EVOL., vol. 35, 1987, pages 351 - 360
GUPTA DIVYA ET AL: "Inactivation of SARS-CoV-2 by [beta]-propiolactone causes aggregation of viral particles and loss of antigenic potential", VIRUS RESEARCH, AMSTERDAM, NL, vol. 305, 4 September 2021 (2021-09-04), XP086814677, ISSN: 0168-1702, [retrieved on 20210904], DOI: 10.1016/J.VIRUSRES.2021.198555 *
HENIKOFFHENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1989, pages 10915
HIGGINSSHARP, CABIOS, vol. 5, 1989, pages 151 - 153
HIGGINSSHARP, GENE, vol. 73, 1988, pages 237 - 44
HOFFMANN ET AL., CELL, vol. 184, no. 9, 29 April 2021 (2021-04-29), pages 2384 - 2393
HOMBACH, VACCINE, vol. 23, 2005, pages 5205 - 5211
HUANG ET AL., COMPUTER APPLS. IN THE BIOSCIENCES, vol. 8, 1992, pages 155 - 65
KHAN WAJIHUL HASAN ET AL: "COVID-19 Pandemic and Vaccines Update on Challenges and Resolutions", FRONTIERS IN CELLULAR AND INFECTION MICROBIOLOGY, vol. 11, 10 September 2021 (2021-09-10), pages 1 - 23, XP055951569, DOI: 10.3389/fcimb.2021.690621 *
LUO F ET AL.: "Evaluation of Antibody-Dependent Enhancement of SARS-CoV Infection in Rhesus Macaques Immunized with an Inactivated SARS-CoV Vaccine", VIROLOGICA SINICA, vol. 33, 2018, pages 201 - 204, XP037069021, DOI: 10.1007/s12250-018-0009-2
MAISONMASSE ET AL.: "Hydroxychloroquine use against SARS-CoV-2 infection in non-human primates", NATURE, vol. 585, 2020, pages 584 - 587, XP037253993, DOI: 10.1038/s41586-020-2558-4
NEEDLEMANWUNSCH, MOL. BIOL., vol. 48, 1970, pages 443
OU ET AL.: "Characterization of spike glycoprotein of SARS-CoV-2 on virus entry and its immune cross-reactivity with SARS-CoV", NATURE COMMUNICATIONS, vol. 11, 2020, pages 1620, Retrieved from the Internet <URL:https://doi.org/10.1038/s41467-020-15562-9>
PEARSON ET AL., METH. MOL. BIO., vol. 24, 1994, pages 307 - 31
PEARSONLIPMAN, PROC. NATL. ACAD. SCI. USA, vol. 85, 1988, pages 2444
REMINGTON: "The Science and Practice of Pharmacy", 2000, MACK PUBLISHING CO.
SCHLEGL ET AL., VACCINE, vol. 33, 2015, pages 5989 - 5996
SHANG, J. ET AL.: "Structural basis of receptor recognition by SARS-CoV-2", NATURE, 2020, Retrieved from the Internet <URL:https://doi.org/10.1038/s41586-020-2179-y>
SHE YI-MIN ET AL.: "Surface modifications of influenza proteins upon virus inactivation by beta-propiolactone", PROTEOMICS, vol. 13, 2013, pages 3537 - 3547, XP055385707, DOI: 10.1002/pmic.201300096
SMITHWATERMAN, ADV. APPL. MATH., vol. 2, 1981, pages 482
SRIVASTAVA ET AL., VACCINE, vol. 19, 2001, pages 4557 - 4565
SZURGOT, I.HANKE, L.SHEWARD, D.J. ET AL.: "DNA-launched RNA replicon vaccines induce potent anti-SARS-CoV-2 immune responses in mice", SCI REP, vol. 11, 2021, pages 3125, Retrieved from the Internet <URL:https://doi.org/10.1038/s41598-021-82498-5>
TAUCHER ET AL., PACKAGE-INSERT-AND-PATIENT-INFORMATION-IXIARO, September 2018 (2018-09-01), Retrieved from the Internet <URL:https://www.fda.gov/media/75777/download>
TIAN ET AL., ONCOTARGET, vol. 8, no. 28, 2017, pages 45951 - 45964
TSENG C.T. ET AL., PLOS ONE, vol. 7, no. 4, 2012, pages e35421
TSENG C.T. ET AL.: "Immunization with SARS Coronavirus Vaccines Leads to Pulmonary Immunopathology on Challenge with the SARS Virus", PLOS ONE, vol. 7, no. 4, 2012, pages 35421
TSENG, C.-T.K. ET AL.: "Severe Acute Respiratory Syndrome Coronavirus Infection of Mice Transgenic for the Human Angiotensin-Converting Enzyme 2 Virus Receptor", J OF VIROL, vol. 81, 2007, pages 1162 - 1173
WALLS: "Structure, Function, and Antigenicity of the SARS-CoV-2 Spike Glycoprotein", CELL, vol. 180, 2020, pages 1 - 12, Retrieved from the Internet <URL:https://doi.org/10.1016/j.cell.2020.02.058>
WANG, S.-F. ET AL.: "Antibody-dependent SARS coronavirus infection is mediated by antibodies against spike proteins", BBRC, vol. 451, 2014, pages 208 - 214
WU J: "COVIEdb: A Database for Potential Immune Epitopes of Coronaviruses", FRONT. PHARMACOL., vol. 11, 2020, pages 572249, Retrieved from the Internet <URL:http://biopharm.zju.edu.cn/coviedb>
X.P. IOANNOU ET AL.: "CpG-containing oligodeoxynucleotides, in combination with conventional adjuvants, enhance the magnitude and change the bias of the immune responses to a herpesvirus glycoprotein", VACCINE, vol. 21, 2002, pages 127 - 137, XP004393294, DOI: 10.1016/S0264-410X(02)00378-X
ZENG W ET AL.: "Biochemical characterization of SARS-CoV-2 nucleocapsid protein", BBRC, vol. 527, no. 3, 2020, pages 618 - 623, XP086163952, DOI: 10.1016/j.bbrc.2020.04.136
ZHANG B ET AL.: "Mining of epitopes on spike protein of SARS-CoV-2 from COVID-19 patients", CELL RESEARCH, vol. 30, 2020, pages 702 - 704, XP037208259, DOI: 10.1038/s41422-020-0366-x

Similar Documents

Publication Publication Date Title
US11684669B2 (en) CpG-adjuvanted SARS-CoV-2 virus vaccine
US11219681B2 (en) Zika virus vaccine
TW202203967A (zh) 不活化ＳＡＲＳ—ＣｏＶ—２病毒疫苗
EP3895729A1 (fr) Vaccin contre le virus sars-cov-2 adjuvé par cpg
CN115666633A (zh) CpG-佐剂的SARS-CoV-2病毒疫苗
WO2023148256A1 (fr) Vaccin à virus sars-cov-2 inactivé
IL296072A (en) Inactivated sars-cov-2 virus vaccine
WO2021173965A1 (fr) Identification de résidus de grippe variables et leurs utilisations

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 23702809

Country of ref document: EP

Kind code of ref document: A1