WO2023146974A2 - Antiviral prodrugs, intermediate- and long-acting formulations and methods - Google Patents
Antiviral prodrugs, intermediate- and long-acting formulations and methods Download PDFInfo
- Publication number
- WO2023146974A2 WO2023146974A2 PCT/US2023/011639 US2023011639W WO2023146974A2 WO 2023146974 A2 WO2023146974 A2 WO 2023146974A2 US 2023011639 W US2023011639 W US 2023011639W WO 2023146974 A2 WO2023146974 A2 WO 2023146974A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- pharmaceutical formulation
- compound
- formula
- rvn
- unsubstituted
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7068—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines having oxo groups directly attached to the pyrimidine ring, e.g. cytidine, cytidylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7042—Compounds having saccharide radicals and heterocyclic rings
- A61K31/7052—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides
- A61K31/706—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom
- A61K31/7064—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines
- A61K31/7076—Compounds having saccharide radicals and heterocyclic rings having nitrogen as a ring hetero atom, e.g. nucleosides, nucleotides containing six-membered rings with nitrogen as a ring hetero atom containing condensed or non-condensed pyrimidines containing purines, e.g. adenosine, adenylic acid
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
- C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic Table
- C07F9/02—Phosphorus compounds
- C07F9/547—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
- C07F9/6558—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom containing at least two different or differently substituted hetero rings neither condensed among themselves nor condensed with a common carbocyclic ring or ring system
- C07F9/65586—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom containing at least two different or differently substituted hetero rings neither condensed among themselves nor condensed with a common carbocyclic ring or ring system at least one of the hetero rings does not contain nitrogen as ring hetero atom
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
- C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic Table
- C07F9/02—Phosphorus compounds
- C07F9/547—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
- C07F9/6561—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom containing systems of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring or ring system, with or without other non-condensed hetero rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07F—ACYCLIC, CARBOCYCLIC OR HETEROCYCLIC COMPOUNDS CONTAINING ELEMENTS OTHER THAN CARBON, HYDROGEN, HALOGEN, OXYGEN, NITROGEN, SULFUR, SELENIUM OR TELLURIUM
- C07F9/00—Compounds containing elements of Groups 5 or 15 of the Periodic Table
- C07F9/02—Phosphorus compounds
- C07F9/547—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom
- C07F9/6561—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom containing systems of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring or ring system, with or without other non-condensed hetero rings
- C07F9/65616—Heterocyclic compounds, e.g. containing phosphorus as a ring hetero atom containing systems of two or more relevant hetero rings condensed among themselves or condensed with a common carbocyclic ring or ring system, with or without other non-condensed hetero rings containing the ring system having three or more than three double bonds between ring members or between ring members and non-ring members, e.g. purine or analogs
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H7/00—Compounds containing non-saccharide radicals linked to saccharide radicals by a carbon-to-carbon bond
- C07H7/06—Heterocyclic radicals
Definitions
- the present disclosure relates to antiviral prodrugs, methods for producing antiviral prodrugs, methods of treatment, and pharmaceutical formulations, such as long- or intermediate-acting formulations, of antiviral prodrugs for treatment of various diseases, such as SARS CoV-2 infections or human immunodeficiency infections, in mammals.
- Remdesivir nucleoside triphosphate potently inhibits enzymatic activity of the polymerase of every coronavirus tested thus far, including SARS CoV-2.
- Remdesivir also inhibits the polymerases of a number of other pathogenic RNA viruses, including Ebola virus, Nipah virus and respiratory syncytial virus (see, e.g., Wang M., et.
- remdesivir prodrug that could be administered orally for a week or intramuscularly on a single occasion to outpatients with SARS CoV-2 who are at risk for severe COVID-19 disease would greatly extend the clinical reach of this agent in the treatment of COVID-19 and, potentially, for the treatment of Ebola, Nipah, and RSV infection.
- Sustained release injectable formulations of remdesivir prodrugs are of interest because RDV is not highly bioavailable following oral administration and must be administered intravenously, thereby, in many instances, severely complicating its administration to high-risk patients prior to hospitalization with relatively advanced disease.
- a long-acting formulation of remdesivir nucleoside monophosphate which might enable plasma antiviral activity above the 90% effective concentration for at least about 5 to about 10 days after a single intramuscular or subcutaneous dose, would be particularly useful.
- Antiretroviral therapy has resulted in enormous reductions in HIV-1 related morbidity and mortality in the US and globally (see, e.g., Walensky R.P. et. al., J Infect Dis 200&, 194:11-19; and April M.D., et. al. J Infect Dis .2014;209:491-9).
- By 2021, 28 million of the 38 million people with HIV infection were receiving antiretroviral therapy see, e.g., https://www.unaids.org/en/resources/fact-sheet (accessed January 19, 2022)).
- antiretroviral therapy it is estimated that as many as 90% may be fully virally suppressed in resource rich settings.
- HIV-1 uninfected persons (termed pre-exposure prophylaxis or “PrEP”) has been effective in some populations, but not in others with protection rates ranging from 0 - 62% (see, e.g., Grant R.M. N Engl J Med 2010;363:2587-2599; Baeten J.M., et.al., N Engl J Med 2012;367:399-410; Thigpen M.C. N Engl J Med.
- PrEP is effective if adherence is high but persons at the highest risk for HIV-1 infection are often those facing the greatest barriers to adherence.
- PrEP is effective if adherence is high but persons at the highest risk for HIV-1 infection are often those facing the greatest barriers to adherence.
- the failure of the large FEM PrEP and VOICE trials to demonstrate any degree of protection despite concurrent assessments of 88 - 90% adherence by self- report and returned product counts has only underlined the adherence challenges posed by oral PrEP (see, e.g., Van Damme L,et.
- embodiments of the compounds and pharmaceutical formulations provided herein include orally useful antiviral prodrugs that may specifically target organs where viral replication is maximal and be conveniently administered at scale in any disease stage.
- some embodiments of the prodrugs of RVn or formulations provided herein can accomplish one or more of the following: 1) kinase bypass of the first nucleoside phosphorylation, 2) provide increased oral bioavailability , 3) deliver antivirally significant concentrations to lung and gastrointestinal tract and formulations which may provide for sustained levels in plasma for 5 to 30 days following a single injection.
- inventions of the compounds herein are prodrugs that may allow earlier and/or more effective treatment at the time of diagnosis of SARS-CoV-2 infection.
- the prodrugs herein may represent an approach that may be able to target the antiviral to the lung and away from the liver where remdesivir’ s major dose limiting is directed.
- compounds including antiviral prodrugs, are provided herein.
- the compounds have a structure according to formula (I): wherein Nuc is selected from the group consisting of an antiviral nucleoside and an antiviral nucleoside analog; Y is independently selected from the group consisting of hydrogen, a C1-C30 hydrocarbyl, a pharmaceutically acceptable cation, and a covalent bond to a carbon atom of a five-carbon sugar moiety of the antiviral nucleoside or the antiviral nucleoside analog; x is 0 or 1; L is independently a C1-C30 hydrocarbyl (such as a C1-C6 hydrocarbyl); and R is independently selected from the group consisting of a C10- C30 hydrocarbyl and a substituent of formula (A); wherein R 1 and R 2 are independently selected from the group consisting of hydrogen and a C1-C30 hydrocarbyl.
- Nuc is selected from the group consisting of an antiviral nucleoside
- pharmaceutical formulations are provided.
- the pharmaceutical formulations include an oil and one or more compounds described herein.
- the pharmaceutical formulations may be formulated for injection, such as intramuscular injection or subcutaneous injection.
- the pharmaceutical formulations may be orally bioavailable.
- methods of treatment are provided, such as methods for treating a virus (e.g., coronavirus), including virus infections in mammals.
- the methods include administering an effective amount of a compound described herein, or a pharmaceutical formulation described herein.
- methods of producing a compound such as a prodrug, are provided.
- the methods include (i) providing a compound of formula (a) -
- Het is a C1-C30 hydrocarbyl including at least one heteroatom
- Y is selected from the group consisting of hydrogen, a C1-C30 hydrocarbyl, and a pharmaceutically acceptable cation
- x is 0 or 1
- L is a C1-C30 hydrocarbyl (such as a C1-C6 hydrocarbyl)
- R is selected from the group consisting of a C10-C30 hydrocarbyl and a substituent of formula
- the methods may include performing an intramolecular esterification reaction of a product, such as a phosphodiester, to form a cyclic phosphate, such as a 3', 5'- cyclic phosphate.
- methods of producing a drug triphosphate also are provided.
- the methods include providing a plurality of cells, contacting the plurality of cells with an amount of a drug, incubating the plurality of cells and the amount of the drug for period effective to form the drug triphosphate.
- FIG. 1A depict concentration-response curves for ODBG-P-RVn, ODE-P-RVn, and HDP-P-RVn (4b), remdesivir (RDV), and remdesivir nucleoside (RVn) for SARS-CoV-2 infection in Vero E6 cells in two separate experiments performed in duplicate.
- RDV remdesivir
- RVn remdesivir nucleoside
- FIG. 2 depicts relative viabilities of embodiments of treated Vero E6 cells, as measured by CellTiter-Glo luminescent cell viability assay.
- FIG. 3 depicts LC/MS/MS analysis of cells that were centrifuged at 1200 rpm for 10 minutes, diluent aspirated, and resuspended in 250 pL of methanol/ distilled water (70/30).
- FIG. 4A and FIG. 4B depict plasma levels of ODBG-P-RVn (FIG. 4A) and RVn (FIG. 4B) in a seven day oral pharmacokinetic study in Syrian hamsters.
- FIG. 6A and FIG. 6B depict pharmacokinetics of ODE-Bn-TFV and ODE-TFV, respectively, after intramuscular administration of 100 mg/kg in formulation F3 to rats.
- FIG. 7 A and FIG. 7B are plots of the effects of 4 different formulations on the pharmacokinetics of ODE-Bn-TFV and ODE-TFV, respectively, after intramuscular administration of 100 mg/kg to rats.
- FIG. 8 depicts a comparison of 96 mg/kg ODE-Bn-TFV pharmacokinetics in rats using formulation F3 versus F8.
- FIG. 9 depicts rat plasma levels of ODE-Bn-TFV and ODE-TFV during a 3-month exposure to monthly intramuscular doses of ODE-Bn-TFV in formulation F3.
- FIG. 10 depicts plasma levels of ODE-Bn-TFV and ODE-TFV in beagle dogs treated with 100 mg/kg with ODE-Bn-TFV in formulation F3.
- FIG. 11A and FIG. 11B depict the TFVpp persistence in HFF cells of ODE-TFV (FIG. 11A) and ODE-Et-TFV (FIG. 11B).
- FIG. 12A and FIG. 12B depict plasma concentrations of an embodiments of formulations containing ODE-Bn-TFV (FIG. 12A) or ODE-TFV (FIG. 12B) (ODE-Bn- TFV ED90 10.9 ng/mL; ODE-TFV ED90 6.3 nm/mL).
- FIG. 12C and FIG. 12D depict plasma concentrations of embodiments of formulations containing ODE-Bn-TFV (FIG. 12C) and ODE-TFV (FIG. 12D).
- FIG. 12E and FIG. 12F depict plasma concentrations of embodiments of formulations containing ODE-Bn-TFV (FIG. 12E) and ODE-TFV (FIG. 12F).
- FIG. 12G and FIG. 12H depict plasma concentrations of embodiments of formulations containing ODE-Bn-TFV (FIG. 12G) and ODE-TFV (FIG. 12H).
- FIG. 121 depicts mean plasma concentrations of embodiments of formulations.
- FIG. 13 depicts the nanograms/mL of embodiments of active ingredients present in rat plasma after administration of embodiments of formulations herein.
- FIG. 14 depicts amounts of an embodiment of a disphosphate in PBMCs after administration of an embodiment of a formulation herein. Detailed Description
- pharmaceutical formulations are provided herein.
- the pharmaceutical formulations may include (i) an oil, and (ii) a compound of formula (I), as described herein.
- the pharmaceutical formulations also include benzyl alcohol, benzyl benzoate, ethyl alcohol, or a combination thereof.
- oil refers to a non-polar compound or a mixture of two or more non-polar compounds that is insoluble in water (e.g., a solubility of less than 1 g per liter of water), such as a non-polar compound that includes an at least partially saturated carbon chain (e.g., hydrocarbons, fatty acids, etc.).
- an oil is selected from the group consisting of sesame oil, triglycerides (e.g., medium chain triglycerides), and a combination thereof.
- An oil may be present at any effective concentration in the pharmaceutical formulations provided herein.
- an oil may be present in a pharmaceutical formulation at an amount of about 60 % to about 95 %, about 65 % to about 95 %, about 70 % to about 95 %, about 75 % to about 95 %, about 80 % to about 95 %, or about 85 % to about 95 %, by weight, based on the weight of the pharmaceutical formulation.
- the pharmaceutical formulations also include benzyl alcohol, benzyl benzoate, ethyl alcohol, or a combination thereof.
- benzyl alcohol, ethyl alcohol, benzy l benzoate or the combination thereof may be present at a total amount of about 0.01 % to about 25 %, about 0.01 % to about 20 %, about 0.01 % to about 15 %, about 0.01 % to about 10 %, or about 5 % to about 10 %, by weight, based on the weight of the pharmaceutical formulation.
- a compound of formula (I) may be present at any effective concentration in the pharmaceutical formulations provided herein.
- a compound of formula (I) may be present at an amount of about 0.01 % to about 40 %, about 0.01 % to about 30 %, about 0.01 % to about 20 %, about 0.01 % to about 10 %, about 0.01 % to about 5 %, by weight, based on the weight of the pharmaceutical formulation.
- the pharmaceutical formulations provided herein may be configured for any route of administration.
- the pharmaceutical formulations are configured for oral administration.
- the pharmaceutical formulations are configured for injection, such as intramuscular injection or subcutaneous injection.
- the pharmaceutical formulations provided herein may be configured to be administered as a single dose.
- a pharmaceutical formulation may be configured to be administered as a single, long-acting treatment, as described herein.
- the single dose may provide an effective amount of the pharmaceutical formulation, such as a compound of formula (I) that is present in the pharmaceutical formulation.
- the pharmaceutical formulations provided herein may be configured to be administered as a series of two or more doses, wherein each dose is administered at least 7 days, at least 14 days, at least 21 days, or at least 28 days after the preceding dose.
- each of the two or more doses may be a long-acting treatment, as described herein.
- the pharmaceutical formulations include one or more of the components of any of formulations F3, F4, F7, or F8:
- the pharmaceutical formulation is a long-acting treatment.
- long-acting treatment refers to a treatment or dose, respectively, that facilitates plasma antiviral activity above the 90% effective concentration for about 5 days to about 30 days, about 5 days to about 28 days, about 5 days to about 21 days, about 5 days to about 14 days, or about 5 days to about 7 days after the administration of a single dose.
- the pharmaceutical formulations described herein may include one or more additives that do not undesirably affect one or more features of the pharmaceutical formulations, such as the activity of a compound of formula (I), bioavailability, etc.
- additives include excipients, coloring agents, flavoring agents, buffers, preservatives, surfactants, other active ingredients, such as anti-inflammatory agents, pain reducing agents, etc.
- compounds are provided herein, including compounds of formula (I): formula (I).
- the “Nuc” of formula (I) may be any suitable nucleoside.
- the nucleoside may be bonded to a compound in any manner. For example, a 5’-hydroxyl of a nucleoside may be joined to a phosphate moiety as an ester bond.
- the nucleoside in some embodiments, is an antiviral nucleoside.
- the antiviral nucleoside may be an antiviral ribonucleoside.
- the nucleoside in some embodiments, is an antiviral nucleoside analog.
- the antiviral nucleoside analog may be an antiviral ribonucleoside analog.
- Nuc is RVn (GS-441524), beta-D-N 4 -hydroxy cytidine (NHC), or (2'R)-2-amino-2'-deoxy-2'-fluoro-N,2'-dimethyladenosine (CAS # is 1998705- 62-6).
- Nuc is GS-441524, and the compound of formula (I) has the following structure:
- N 4 -hydroxy-cytidine is an antiviral candidate entering clinical Phase I evaluation.
- Other nucleoside analogs known to inhibit RNA viruses are also suitable for modification according to this disclosure.
- Y of formula (I) may be any of the substituents described herein.
- Y is hydrogen, a C1-C30 hydrocarbyl, a pharmaceutically acceptable cation, or a covalent bond to a carbon atom of a five-carbon sugar moiety of the antiviral nucleoside or the antiviral nucleoside analog.
- the covalent bond may be a covalent bond to any carbon atom of a five-carbon sugar moiety of the antiviral nucleoside or the antiviral nucleoside analog (e.g., the 1 ’ carbon, the 2’ carbon, the 3’ carbon, or the 4’ carbon).
- the covalent bond may be a covalent bond between (i) the oxygen to which Y is bonded in formula (I), and (ii) any carbon atom of a five-carbon sugar moiety of the antiviral nucleoside or the antiviral nucleoside analog (e.g., the 1’ carbon, the 2’ carbon, the 3’ carbon, or the 4’ carbon).
- Nuc may be GS- 441524; the covalent bond may be between the oxygen to which Y is bonded in formula
- the pharmaceutically acceptable cation may be Na + .
- Y is a C1-C20 hydrocarbyl, a C1-C10 hydrocarbyl, or a C1-C6 hydrocarbyl. In some embodiments, Y is a C1-C6 alkyl, which may be unsubstituted. In some embodiments, Y includes at least one cyclic moiety. The at least one cyclic moiety may be a monocyclic moiety or a multicyclic moiety, e.g., a bicyclic moiety, a spiro moiety, etc.
- Y is aryl, arylalkyl, heteroaryl, heteroarylalkyl, or heterocycloalkyl, each of which may be unsubstituted or substituted. In some embodiments, Y is an unsubstituted or substituted pyridinyl. In some embodiments. Y is an unsubstituted or substituted benzyl.
- the unsubstituted or substituted benzyl may have a structure according to formula (B): formula (B), wherein R 3 , R 4 , R 5 , R 6 , and R 7 are independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl (alky 1 ).
- R 3 , R 4 , R 5 , R 6 , and R 7 are hydrogen. In some embodiments, at least two of R 3 , R 4 , R 5 , R 6 , and R 7 are hydrogen. In some embodiments, at least three of R 3 , R 4 , R 5 R 6 , and R 7 are hydrogen. In some embodiments, at least four of R 3 , R 4 , R 5 , R 6 , and R 7 are hydrogen.
- Y is an unsubstituted or substituted benzyl of formula (B)
- the compound of formula (I) has the following structure:
- x may be 1 or 0. When x is 1, the “-O-L-” moiety is present in the compounds of formula (I). When x is 0, R is bonded directed to the oxygen of the phosphonate moiety, as shown in the following structure:
- L is a C1-C30 hydrocarbyl, a C1-C20 hydrocarbyl, a C1-C10 hydrocarbyl, a C1-C6 hydrocarbyl, a C1-C5 hydrocarbyl, a C1-C4 hydrocarbyl, a C1-C3 hydrocarbyl, or a C1-C2 hydrocarbyl.
- L is an ethyl, which may be unsubstituted.
- L is a methyl, which may be unsubstituted.
- L is a propyl, which may be unsubstituted.
- R is a C1-C30 hydrocarbyl, a C5-C30 hydrocarbyl, a C10-C30 hydrocarbyl, a C12-C24 hydrocarbyl, a C13-C29 hydrocarbyl, a C15-C24 hydrocarbyl, or a C20-C24 hydrocarbyl.
- R in some embodiments, is a heteroalkyl.
- R may include 0 to 6 unsaturated bonds, 1 to 6 unsaturated bonds, 2 to 6 unsaturated bonds, 3 to 6 unsaturated bonds, or 4 to 6 unsaturated bonds.
- the “unsaturated bonds” described herein may include any non-single bond, and when more than one unsaturated bond is present, the two or more unsaturated bonds may be selected independently from a double bond or a triple bond. When one or more double bonds are present, the one or more double bonds may be cw-, irans-. or a combination thereof.
- R may include a cyclopropyl moiety, such as a terminal cyclopropyl moiety.
- R is - wherein a is 1 to 29. In some embodiments, a is 15 to 25. In some embodiments, a is 18 to 22. In some embodiments, a is 19. In some embodiments, a is 6 to 10. In some embodiments, a is 8. In some embodiments R is - wherein b is 1 to 29, c is 0 to 28, and a sum of b and c is 29 or less. In some embodiments, b is 1 to 4 and c is 15 to 20. In some embodiments, b is 3 and c is 15. In some embodiments, b is 2 and c is 17.
- R is a substituent of formula (A); formula (A), wherein R 1 and R 2 are hydrogen or a C1-C30 hydrocarbyl, such as a C10-C30 hydrocarbyl, or a C12-C24 hydrocarbyl.
- R 1 , R 2 , or both R 1 and R 2 may include at least one cyclic moiety, which may be a monocyclic moiety or a multicyclic moiety, e.g., a bicyclic moiety, a spiro moiety, etc.
- R 1 , R 2 , or both R 1 and R 2 may include 0 to 6 unsaturated bonds, 1 to 6 unsaturated bonds, 2 to 6 unsaturated bonds, 3 to 6 unsaturated bonds, or 4 to 6 unsaturated bonds. When one or more double bonds are present, the one or more double bonds may be cis-, trans-, or a combination thereof.
- R 1 , R 2 , or both R 1 and R 2 may include a branched hydrocarbyl, such as a penultimate branched hydrocarbyl.
- at least one of R 1 and R 2 are hydrogen.
- both R 1 and R 2 are independently selected from a C1-C30 hydrocarbyl.
- R 1 , R 2 , or both R 1 and R 2 are independently selected from the group consisting of aryl, arylalkyl, heteroaryl, heteroarylalkyl, and heterocycloalkyl, each of which may be unsubstituted or substituted.
- the arylalkyl may be an unsubstituted or substituted benzyl.
- the unsubstituted or substituted benzyl may have a structure according to formula (C): formula (C), wherein R 8 , R 9 , R 10 , R 11 , and R 12 are independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl), (heterocyclyl)alkyl, hydroxy, alkoxy, acyl, cyano, halogen, thiocarbonyl, O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, C-amido, N- amido, S-sulfonamido, N-sulfonamido, C-carboxy, O-carboxy, isocyanato, thiocyanate, isothiocyanate,
- each of R 8 , R 9 , R 10 , R 11 , and R 12 are hydrogen. In some embodiments, at least two of R 8 , R 9 , R 10 , R 11 , and R 12 are hydrogen. In some embodiments, at least three of R 8 , R 9 , R 10 , R 11 , and R 12 are hydrogen. In some embodiments, at least four of R 8 , R 9 , R 10 , R 11 , and R 12 are hydrogen. In some embodiments, at least five of R 8 , R 9 , R 10 , R 11 , and R 12 are hydrogen.
- R 1 is - wherein d is 1 to 29. In some embodiments, d is 5 to 29, 10 to 29, 15 to 29, 20 to 29, 25 to
- R 1 is wherein e is 1 to 27, f is 0 to 26, and a sum of e and f is 27 or less.
- R 2 is selected from the group consisting of-
- g is 5 to 10. In some embodiments, g is 7.
- the substituent of formula (A) may be a racemate, an sn-1 stereoisomer, or an sn-3 stereoisomer.
- formula (A) when a formula, such as formula (A), is depicted with no indication(s) of spatial orientation, then the formula reads on all isomers, e g., stereoisomers, of the compounds of the formula.
- a compound may have a structure according to formula (I), wherein x is 0, and R is a substituent of formula (A):
- This formula lacks any indication of spatial orientation, and therefore reads on the sn-3 isomer thereof, the sn-1 isomer thereof, and mixtures of the sn-3 and sn-1 isomers, including racemic mixtures thereof:
- a substituent at a particular location may be the same or different for each molecule of a formula (e.g., (i) a compound of formula (I) may include two molecules of formula (I), with each molecule having the same or a different C1-C30 hydrocarbyl selected for R; and/or (ii) two differently labeled substituents selected from the same pool of substituents may be the same or different (e.g., R and Y of a molecule of a compound of formula (I) may both be selected from “a C1-C30 hydrocarbyl”, and the C1- C30 hydrocarbyls selected for R and Y may be the same or different)).
- C1-C30 hydrocarbyl generally refer to aliphatic, aryl, or arylalkyl groups containing 1 to 30 carbon atoms, or 10 to 30 carbon atoms, respectively, including unsubstituted groups and substituted derivatives thereof, which, as explained herein, may include, but are not limited to, heteroaryl, heteroarylalkyl, heterocycloalkyl groups, etc.
- C1- C30 hydrocarbyl refers to and includes unsubstituted and substituted C1-C30 hydrocarbyls, unless expressly noted otherwise.
- aliphatic groups include, but are not limited to, an alkyl group, a cycloalkyl group, an alkenyl group, a cycloalkenyl group, an alkynyl group, an alkadienyl group, a cyclic group, and the like, and includes all substituted, unsubstituted, branched, and/or linear analogs or derivatives thereof, in each instance having 1 to 30 total carbon atoms or 10 to 30 total carbon atoms for a “C1-C30 hydrocarbyl ” and “C10-C30 hydrocarbyl”, respectively.
- alkyl groups include, but are not limited to, methyl, ethyl, propyl, isopropyl, n-butyl, t-butyl, isobutyl, pentyl, hexyl, isohexyl, heptyl, 4,4-dimethylpentyl, octyl, 2,2,4-trimethylpentyl, nonyl, decyl, undecyl and dodecyl.
- Cycloalkyl moieties may be monocyclic or multicyclic, and examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and adamantyl, including any heteroatom substituted derivative thereof. Additional examples of alkyl moieties have linear, branched and/or cyclic portions (e.g., l-ethyl-4-methyl-cyclohexyl).
- alkenyl moieties include vinyl, allyl, 1-butenyl, 2-butenyl, isobutylenyl, 1- pentenyl, 2-pentenyl, 3-methyl-l-butenyl, 2-methyl-2-butenyl, 2,3-dimethyl-2-butenyl, 1- hexenyl, 2-hexenyl, 3-hexenyl, 1-heptenyl, 2-heptenyl, 3-heptenyl, 1-octenyl, 2-octenyl, 3- octenyl, 1-nonenyl, 2-nonenyl, 3-nonenyl, 1-decenyl, 2-decenyl and 3-decenyl.
- alkynyl moieties include acetylenyl, propynyl, 1-butynyl, 2-butynyl, 1- pentynyl, 2-pentynyl, 3-methyl-l-butynyl, 4-pentynyl, 1 -hexynyl, 2 -hexynyl, 5-hexynyl, 1 -heptynyl, 2-heptynyl, 6-heptynyl, 1 -octynyl, 2-octynyl, 7 -octynyl, 1-nonynyl, 2- nonynyl, 8-nonynyl, 1 -decynyl, 2-decynyl and 9-decynyl.
- aryl or arylalkyl moieties include, but are not limited to, anthracenyl, azulenyl, biphenyl, fluorenyl, indan, indenyl, naphthyl, phenanthrenyl, phenyl, 1,2,3,4-tetrahydro-naphthalene, anthracenyl, tolyl, xylyl, mesityl, benzyl, and the like, including any heteroatom substituted derivative thereof.
- substituted when used to describe a chemical structure or moiety, refers to a derivative of that structure or moiety wherein (i) a multi-valent non-carbon atom (e.g., oxygen, nitrogen, sulfur, phosphorus, etc.) is bonded to one or more carbon atoms of the chemical structure or moiety (e.g., a “substituted” C4 hydrocarbyl may include, but is not limited to, a pyrimidinyl moiety, a pyridinyl moiety, a dioxanyl moiety, a diethyl ether moiety, a methyl propionate moiety, an N,N- dimethylacetamide moiety, a butoxy moiety, etc., and a “substituted” aryl C12 hydrocarbyl may include, but is not limited to, an oxy dibenzene moiety, a benzophenone moiety, etc.) or (ii) one or more of
- kits for treating a virus infection such as a coronavirus infection.
- the vims infection may be an infection in a mammal.
- the methods include administering to a mammal an effective amount of a compound described herein or a pharmaceutical formulation described herein.
- the virus infection may be an RNA virus infection.
- the RNA vims infection is caused by a RNA virus of a viral family selected from the group consisting of Filoviridae, Orthomyxoviridae, Paramyxoviridae, Pneumoviridae, Phenuiviridae, Nairoviridae, Arenaviridae, Flaviviridae, and Coronaviridae.
- Compounds, including prodrugs, provided herein may be screened for inhibitory activity against SARS-CoV-2 and related coronaviruses (or other viruses), using conventional techniques for evaluating anti-coronavirus activity and cytotoxicity. Typically, compounds are first screened for inhibition of coronavirus in vitro, and those showing significant antiviral activity are then screened for efficacy in vivo.
- Non-limiting examples of potentially useful in vitro assays including the following: a) Using the OC43 beta-coronavirus strain (ATCC 1558) in the human adenocarcinoma cell line, HCT-8 (ATCC CCL-244), or using coronavirus 229E in MRC-5 human lung fibroblasts. Endpoints can include semiquantitative RT-PCR and pfu as determined by triplicate serial dilution, b) The activity of compounds may be studied using laboratory and clinical isolates of SARS-CoV-2 in Vero E6 cells, Caco-2, Calu-3, HPSC human lung cells, or Huh7.5 cells.
- Initial SARS CoV-2 growth inhibition assays can quantify plaque reduction on Vero cells grown in 12 well plates using a commercial murine anti-SARS CoV-2 spike protein detection antibody (Item 40021-MM07, SinoBiological.com). Virus can also be quantified in culture supernatants by serial dilution on Vero cell lawns and by RT-PCR. Laboratory strains that can be obtained, for example, from BEI Resources (Strains NR52281 and NR522282), and clinical strains that can be isolated from patients participating in clinical trials can be used. Cytotoxicity can be measured by commercially MTT or Cell Titer Gio. Compounds with the lowest 90 % inhibitory concentrations and that require the highest concentrations to induce cellular cytotoxicity may be selected for further evaluation.
- Anti-coronavirus compounds may also be evaluated in a lung explant model for SARS CoV infection.
- candidate molecules with the highest therapeutic indices in Vero E6 cells can be advanced to studies in human lung explants.
- the compounds provided herein may be prepared by a variety of processes, including the processes described herein.
- protected analogs of remdesivir nucleoside, RVn, 2 are prepared and then coupled to suitable alkoxy alkyl phosphates to form phosphodiesters. Removal of the protecting groups can afford compounds of Formula (I).
- [l,2,4]triazin-7-yl)-2,5-anhydro- D-altrononitrile (RVn, 2) is first converted to its 2’, 3’-isopropylidene derivative.
- Mixtures of alkoxyalkyl phosphates and protected RVn may then be treated with N, N- di cyclohexylcarbodiimide (DCC) and N,N-dimethylaminopyridine (DMAP) under conditions suitable to prepare the phosphodiesters.
- DCC N- di cyclohexylcarbodiimide
- DMAP N,N-dimethylaminopyridine
- Removal of the isopropylidene protecting group by treatment with dilute HC1 or other suitable acid may provide compounds of Formula (I) in suitable yield and purity.
- the methods include providing a compound of formula (a) - wherein x, R, L, and Y are as defined herein.
- the methods include providing a compound of formula (b) - formula (b), wherein Het is as defined herein.
- Het is selected from the group consisting of -
- formula (b) does not include any stereochemical indication(s), and therefore, reads on at least the following stereoisomer of formula (b):
- the methods include contacting a compound of formula (a) and a compound of formula (b) to form a compound of formula (c) -
- the contacting of a compound of formula (a) and a compound of formula (b) may occur at any temperature or pressure, and may occur in the presence of any suitable liquid.
- the liquid may include a C1-C30 hydrocarbyl, such as a C1-C30 hydrocarbyl that includes at least one cyclic moiety , at least one heteroatom, such as nitrogen, or a combination thereof.
- the liquid is JV,JV-dicyclohexylcarbodiimide, 4- dimethylaminopyndine, or a combination thereof.
- the methods contacting a compound of formula (c) with an acid to form a compound of formula (d) -
- the acid may include any acid that is capable of facilitating the formation of a compound of formula (d).
- the acid may be an organic acid or inorganic acid.
- the acid may include a hydrogen halide, such as hydrogen chloride.
- the contacting of a compound of formula (c) with an acid may occur in the presence of any suitable liquid.
- the liquid may be a C1-C30 hydrocarbyl, such as a C1-C30 hydrocarbyl including at least one cyclic moiety, at least one heteroatom, or a combination thereof.
- the liquid is tetrahydrofuran.
- the methods include performing an intramolecular esterification reaction of a compound of formula (d) to form a cyclic phosphate, such as a 3',5'-cyclic phosphate.
- the methods include providing a plurality of cells, contacting the plurality of cells with an amount of a drug, incubating the plurality of cells and the amount of the drug for period effective to form the drug triphosphate.
- the plurality of cells may include any suitable cells.
- the plurality of cells includes Vero E6 cells, Calu-2 cells, Caco-2 cells, MRC5 human lung fibroblasts, Huh7.5 cells and PSC human lung cells.
- the drug includes remdesivir or the remdesivir nucleoside (GS441524).
- the present disclosure may address one or more of the problems and deficiencies of known methods and processes. However, it is contemplated that various embodiments may prove useful in addressing other problems and deficiencies in a number of technical areas. Therefore, the present disclosure should not necessarily be construed as limited to addressing any of the particular problems or deficiencies discussed herein.
- fusion protein, a pharmaceutical composition, and/or a method that “comprises” a list of elements is not necessarily limited to only those elements (or components or steps), but may include other elements (or components or steps) not expressly listed or inherent to the fusion protein, pharmaceutical composition and/or method.
- the transitional phrases “consists of’ and “consisting of’ exclude any element, step, or component not specified.
- “consists of’ or “consisting of’ used in a claim would limit the claim to the components, materials or steps specifically recited in the claim except for impurities ordinarily associated therewith (i.e., impurities within a given component).
- the phrase “consists of’ or “consisting of’ appears in a clause of the body of a claim, rather than immediately following the preamble, the phrase “consists of’ or “consisting of’ limits only the elements (or components or steps) set forth in that clause; other elements (or components) are not excluded from the claim as a whole.
- transitional phrases “consists essentially of’ and “consisting essentially of’ are used to define a compound, pharmaceutical formulations, and/or method that includes materials, steps, features, components, or elements, in addition to those literally disclosed, provided that these additional materials, steps, features, components, or elements do not materially affect the basic and novel characteristic(s) of the claimed invention.
- the term “consisting essentially of’ occupies a middle ground between “comprising” and “consisting of’.
- a is intended to include plural alternatives, e.g, at least one.
- the disclosure of “a compound”, “a pharmaceutical formulation”, “an acid”, and the like is meant to encompass one, or mixtures or combinations of more than one compound, pharmaceutical formulation, acid, and the like, unless otherwise specified.
- any one of the listed items can be employed by itself or in combination with any one or more of the listed items.
- the expression “A and/or B” is intended to mean either or both of A and B, i.e. A alone, B alone or A and B in combination.
- the expression “A, B and/or C” is intended to mean A alone, B alone, C alone, A and B in combination, A and C in combination, B and C in combination or A, B, and C in combination.
- composition refers to pharmaceutically acceptable compositions, wherein the composition comprises a pharmaceutically active agent, and in some embodiments further comprises a pharmaceutically acceptable carrier.
- the pharmaceutical composition may be a combination of pharmaceutically active agents and carriers.
- combination refers to either a fixed combination in one dosage unit form, or a kit of parts for the combined administration where one or more active compounds and a combination partner (e.g., another drug as explained below, also referred to as “therapeutic agent” or “co-agent”) may be administered independently at the same time or separately within time intervals.
- a combination partner e.g., another drug as explained below, also referred to as “therapeutic agent” or “co-agent”
- the combination partners show a cooperative, e.g., synergistic effect.
- co-administration or “combined administration” or the like as utilized herein are meant to encompass administration of the selected combination partner to a single subject in need thereof (e.g., a patient), and are intended to include treatment regimens in which the agents are not necessarily administered by the same route of administration or at the same time.
- pharmaceutical combination means a product that results from the mixing or combining of more than one active ingredient and includes both fixed and non-fixed combinations of the active ingredients.
- fixed combination means that the active ingredients, e.g., a compound and a combination partner, are both administered to a patient simultaneously in the form of a single entity or dosage.
- non-fixed combination means that the active ingredients, e.g., a compound and a combination partner, are both administered to a patient as separate entities either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the two compounds in the body of the patient.
- cocktail therapy e.g., the administration of three or more active ingredients.
- the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopoeia, other generally recognized pharmacopoeia in addition to other formulations that are safe for use in animals, and more particularly in humans and/or non- human mammals.
- the term “pharmaceutically acceptable carrier” refers to an excipient, diluent, preservative, solubilizer, emulsifier, adjuvant, and/or vehicle with which demethylation compound(s), is administered.
- Such carriers may be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents.
- Antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; and agents for the adjustment of tonicity' such as sodium chloride or dextrose may also be a carrier.
- Methods for producing compositions in combination with carriers are know n to those of skill in the art.
- the language “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art.
- terapéuticaally effective amount refers to an amount of a pharmaceutically active compound(s) that is sufficient to treat or ameliorate, or in some manner reduce the symptoms associated with diseases and medical conditions.
- the method is sufficiently effective to treat or ameliorate, or in some manner reduce the symptoms associated with diseases or conditions.
- an effective amount in reference to diseases is that amount which is sufficient to block or prevent onset; or if disease pathology has begun, to palliate, ameliorate, stabilize, reverse or slow progression of the disease, or otherwise reduce pathological consequences of the disease.
- an effective amount may be given in single or divided doses.
- the terms “treat,” “treatment,” or “treating” embraces at least an amelioration of the symptoms associated with diseases in the patient, where amelioration is used in a broad sense to refer to at least a reduction in the magnitude of a parameter, e.g. a symptom associated with the disease or condition being treated.
- treatment also includes situations where the disease, disorder, or pathological condition, or at least symptoms associated therewith, are completely inhibited (e.g. prevented from happening) or stopped (e.g. terminated) such that the patient no longer suffers from the condition, or at least the symptoms that characterize the condition.
- the terms “prevent,” “preventing” and “prevention” refer to the prevention of the onset, recurrence or spread of a disease or disorder, or of one or more symptoms thereof.
- the terms refer to the treatment with or administration of a compound or dosage form provided herein, with or without one or more other additional active agent(s), prior to the onset of symptoms, particularly to subjects at risk of disease or disorders provided herein.
- the terms encompass the inhibition or reduction of a symptom of the particular disease.
- subjects with familial history of a disease are potential candidates for preventive regimens.
- subjects who have a history of recurring symptoms are also potential candidates for prevention.
- the term “prevention” may be interchangeably used with the term “prophylactic treatment.”
- a prophylactically effective amount of a compound is an amount sufficient to prevent a disease or disorder, or prevent its recurrence.
- a prophylactically effective amount of a compound means an amount of therapeutic agent, alone or in combination with one or more other agent(s), which provides a prophylactic benefit in the prevention of the disease.
- the term “prophylactically effective amount” can encompass an amount that improves overall prophylaxis or enhances the prophylactic efficacy of another prophylactic agent.
- the term "subject” is defined herein to include animals such as mammals, including, but not limited to, primates (e.g., humans), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice, and the like. In specific embodiments, the subject is a human.
- the terms "subject” and “patient” are used interchangeably herein in reference, for example, to a mammalian subject, such as a human.
- a compound described herein is intended to encompass all possible stereoisomers, unless a particular stereochemistry is specified.
- the compound may exist as a single tautomer or a mixture of tautomers. This can take the form of proton tautomerism; or so-called valence tautomerism in the compound, e.g., that contain an aromatic moiety .
- Nucleic acid or “nucleic acid molecule” refers to a multimeric compound comprising two or more covalently bonded nucleosides or nucleoside analogs having nitrogenous heterocyclic bases, or base analogs, where the nucleosides are linked together by phosphodiester bonds or other linkages to form a polynucleotide.
- Nucleic acids include RNA, DNA, or chimeric DNA-RNA polymers or oligonucleotides, and analogs thereof.
- a nucleic acid backbone can be made up of a variety of linkages, including one or more of sugar-phosphodiester linkages, peptide-nucleic acid bonds, phosphorothioate linkages, methylphosphonate linkages, or combinations thereof.
- Sugar moieties of the nucleic acid can be ribose, deoxyribose, or similar compounds having known substitutions (e.g. 2'- methoxy substitutions and 2'-halide substitutions).
- Nitrogenous bases can be conventional bases (A, G, C, T, U) or analogs thereof (e.g., inosine, 5-methylisocytosine, isoguanine).
- a nucleic acid can comprise only conventional sugars, bases, and linkages as found in RNA and DNA, or can include conventional components and substitutions (e.g., conventional bases linked by a 2'-methoxy backbone, or a nucleic acid including a mixture of conventional bases and one or more base analogs).
- Nucleic acids can include “locked nucleic acids” (LNA), in which one or more nucleotide monomers have a bicyclic furanose unit locked in an RNA mimicking sugar conformation, which enhances hybridization affinity toward complementary sequences in single-stranded RNA (ssRNA), single-stranded DNA (ssDNA), or double-stranded DNA (dsDNA).
- Nucleic acids can include modified bases to alter the function or behavior of the nucleic acid (e.g., addition of a 3 '-terminal dideoxynucleotide to block additional nucleotides from being added to the nucleic acid). Synthetic methods for making nucleic acids in vitro are well known in the art although nucleic acids can be purified from natural sources using routine techniques. Nucleic acids can be single-stranded or double-stranded.
- a nucleic acid is typically single-stranded or double-stranded and will generally contain phosphodiester bonds, although in some cases, as outlined, herein, nucleic acid analogs are included that may have alternate backbones, including, for example and without limitation, phosphoramide (Beaucage et al. (1993) Tetrahedron 49(10): 1925 and references therein; Letsinger (1970) J. Org. Chem. 35:3800; SRocl et al. (1977) Eur. J. Biochem. 81:579; Letsinger et al. (1986) Nucl. Acids Res. 14: 3487; Sawai et al. (1984) Chem. Lett. 805; Letsinger et al.
- nucleic acids containing one or more carbocyclic sugars are also included within the definition of nucleic acids (see Jenkins et al. (1995) Chem. Soc. Rev. pp 169-176, which is incorporated by reference).
- nucleic acid analogs are also described in, e g., Rawls, C & E News Jun. 2, 1997 page 35, which is incorporated by reference. These modifications of the ribose-phosphate backbone may be done to facilitate the addition of additional moieties such as labels, or to alter the stability and half-life of such molecules in physiological environments.
- nucleic acid analogs also include those having non-naturally occurring heterocyclic or modified bases, many of which are described, or otherwise referred to, herein.
- non-naturally occurring heterocyclic or modified bases are described further in, e.g., Seela et al. (1991) Helv. Chim. Acta 74: 1790, Grein et al. (1994) Bioorg. Med. Chem. Lett. 4:971-976, and Seela et al. (1999) Helv. Chim.
- nucleotides that act as melting temperature include 7-deazapurines (e.g., 7- deazaguanine, 7-deazaadenine, etc.), pyrazolo [3, 4-d] pyrimidines, propynyl-dN (e.g., propynyl-dU, propynyl-dC, etc.), and the like. See, e.g., U.S. Pat. No. 5,990,303, entitled “SYNTHESIS OF 7-DEAZA-2'-DEOXYGUANOSINE NUCLEOTIDES,” which issued Nov.
- heterocyclic bases include, e.g., hypoxanthine, inosine, xanthine; 8-aza derivatives of 2- aminopurine, 2,6-diaminopurine, 2-amino-6-chloropurine, hypoxanthine, inosine and xanthine; 7 -deaza-8-aza derivatives of adenine, guanine, 2-aminopurine, 2,6- diaminopurine, 2-amino-6-chloropurine, hypoxanthine, inosine and xanthine; 6- azacytosine; 5-fluorocytosine; 5-chlorocytosine; 5-iodocytosine; 5 -bromocytosine; 5- methylcytosine; 5-propynylcytosine; 5-bromovinyluracil; 5-fluorouracil; 5-chlorouracil; 5- iodouracil; 5-
- modified bases and nucleotides are also described in, e.g., U.S. Pat. No 5,484,908, entitled “OLIGONUCLEOTIDES CONTAINING 5-PROPYNYL PYRIMIDINES,” issued Jan. 16, 1996 to Froehler et al., U.S. Pat. No. 5,645,985, entitled “ENHANCED TRIPLE-HELIX AND DOUBLE-HELIX FORMATION WITH OLIGOMERS CONTAINING MODIFIED PYRIMIDINES,” issued Jul. 8, 1997 to Froehler et al., U.S. Pat. No.
- oligonucleotide refers to a nucleic acid that includes at least two nucleic acid monomer units (e.g., nucleotides), typically more than three monomer units, and more typically greater than ten monomer units. The exact size of an oligonucleotide generally depends on various factors, including the ultimate function or use of the oligonucleotide. Oligonucleotides are optionally prepared by any suitable method, including, but not limited to, isolation of an existing or natural sequence, DNA replication or amplification, reverse transcription, cloning and restriction digestion of appropriate sequences, or direct chemical synthesis by a method such as the phosphotriester method of Narang et al. (1979) Meth. Enzymol.
- RNA viruses include the following viral families: Filoviridae, Orthomyxoviridae, Paramyxoviridae, Pneumoviridae, Phenuiviridae, Nairoviridae, Arenaviridae, Flaviviridae and Coronaviridae.
- the names of exemplary viruses in each family are included in the below table.
- Embodiments of the compounds, pharmaceutical formulations, and methods described herein are provided at the following listing: Embodiment 1.
- Y is independently selected from the group consisting of hydrogen, a C1-C30 hydrocarbyl, a pharmaceutically acceptable cation, and a covalent bond to a carbon atom of a five-carbon sugar moiety of the antiviral nucleoside or the antiviral nucleoside analog;
- x is 0 or 1;
- L is independently a C1-C30 hydrocarbyl; and R is independently selected from the group consisting of a C10-C30 hydrocarbyl and a substituent of formula (A); wherein R 1 and R 2 are independently selected from the group consisting of hydrogen and a C1-C30 hydrocarbyl; wherein optionally the compound of formula (I)
- Embodiment 2 The compound of Embodiment 1, wherein the antiviral nucleoside or the antiviral nucleoside analog is an antiviral ribonucleoside or an antiviral ribonucleoside analog, respectively.
- Embodiment 3 The compound of any one of the previous Embodiments, wherein Nuc is selected from the group consisting of GS-441524, beta-D-N 4 -hydroxy cytidine (NHC), and (2'R)-2-amino-2'-deoxy-2'-fluoro-N,2'-dimethyladenosine.
- Nuc is selected from the group consisting of GS-441524, beta-D-N 4 -hydroxy cytidine (NHC), and (2'R)-2-amino-2'-deoxy-2'-fluoro-N,2'-dimethyladenosine.
- Embodiment 4 The compound of any one of the previous Embodiments, wherein Nuc is -
- Embodiment 5 The compound of any one of the previous Embodiments, wherein
- Y is an unsubstituted C1-C6 alkyl, a C1-C20 hydrocarbyl, a C1-C10 hydrocarbyl, a C1-C6 hydrocarbyl, or Nat Embodiment 6.
- Y comprises at least one cyclic moiety.
- Embodiment 7 The compound of any one of the previous Embodiments, wherein
- Y is selected from the group consisting of aryl, arylalkyl, heteroaryl, heteroarylalkyl, and heterocycloalkyl, each of which is unsubstituted or substituted.
- Embodiment 8 The compound of any one of the previous Embodiments, wherein the heteroaryl is an unsubstituted or substituted pyridinyl.
- Embodiment 9 The compound of any one of the previous Embodiments, wherein the arylalkyl is an unsubstituted or substituted benzyl.
- Embodiment 10 The compound of any one of the previous Embodiments, wherein the unsubstituted or substituted benzyl has a structure according to formula (B): formula (B), wherein R 3 , R 4 , R 5 , R 6 , and R 7 are independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl), (heterocyclyl)alkyl, hydroxy, alkoxy, acyl, cyano, halogen, thiocarbonyl, O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, C-amido, N- amido, S-sulfonamido, N-sulfonamido, C-carboxy, O-carboxy, is
- Embodiment 11 The compound of any one of the previous Embodiments, wherein at least two of R 3 , R 4 , R 5 , R 6 , and R 7 are hydrogen.
- Embodiment 12 The compound of any one of the previous Embodiments, wherein R (i) is an unsubstituted or substituted C12-C24 hydrocarbyl, (ii) comprises 0 to 6 unsaturated bonds, (iii) comprises a cyclopropyl moiety, or (iv) a combination thereof.
- Embodiment 13 The compound of any one of the previous Embodiments, wherein R (i) is an unsubstituted or substituted C13-C29 heteroalkyl, (ii) comprises 0 to 6 unsaturated bonds, or (iii) a combination thereof.
- Embodiment 14 The compound of any one of the previous Embodiments, wherein R is selected from the group consisting of -
- Embodiment 15 The compound of any one of the previous Embodiments, wherein (i) a is 15 to 25, or (ii) b is 1 to 4 and c is 15 to 20.
- Embodiment 16 The compound of any one of the previous Embodiments, wherein (i) a is 19, (ii) b is 3 and c is 15, or (iii) b is 2 and c is 17.
- Embodiment 17 The compound of any one of the previous Embodiments, wherein a is 8.
- Embodiment 18 The compound of any one of the previous Embodiments, wherein R 1 and/or R 2 , independently, (i) is an unsubstituted or substituted C12-C24 hydrocarbyl, (ii) comprises 0 to 6 unsaturated bonds, or (iii) a combination thereof.
- Embodiment 19 The compound of any one of the previous Embodiments, wherein (i) R 1 , (ii) R 2 , or (iii) both R 1 and R 2 are independently selected from a C1-C30 hydrocarbyl comprising at least one cyclic moiety.
- Embodiment 20 The compound of any one of the previous Embodiments, wherein (i) R 1 , (ii) R 2 , or (iii) both R 1 and R 2 are independently selected from the group consisting of aryl, arylalkyl, heteroaryl, heteroarylalkyl, and heterocycloalkyl, each of which is unsubstituted or substituted.
- Embodiment 21 The compound of any one of the previous Embodiments, wherein the arylalkyl is an unsubstituted or substituted benzyl.
- Embodiment 22 The compound of any one of the previous Embodiments, wherein the unsubstituted or substituted benzyl has a structure according to formula (C): wherein R 8 , R 9 , R 10 , R 11 , and R 12 are independently selected from the group consisting of hydrogen, alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, aryl, heteroaryl, heterocyclyl, aryl(alkyl), heteroaryl(alkyl), (heterocyclyl)alkyl, hydroxy, alkoxy, acyl, cyano, halogen, thiocarbonyl, O-carbamyl, N-carbamyl, O-thiocarbamyl, N-thiocarbamyl, C-amido, N- amido, S-sulfonamido, N-sulfonamido, C-carboxy, O-carboxy, isocyanato
- Embodiment 23 The compound of any one of the previous Embodiments, wherein at least two of R 8 , R 9 , R 10 , R 11 , and R 12 are hydrogen.
- Embodiment 24 The compound of any one of the previous Embodiments, wherein the substituent of formula (A) is a racemate, an sn-1 stereoisomer (e.g., glyceryl-sn-1- phospho), or an sn-3 stereoisomer (e.g., glyceryl-sn-3-phospho).
- Embodiment 25 The compound of any one of the previous Embodiments, wherein -
- R 1 and/or R 2 independently, is selected from the group consisting of - wherein e is 1 to 27, f is 0 to 26, and a sum of e and f is 27 or less;
- R 1 and/or R 2 independently, is selected from the group consisting of- or (iii) a combination thereof.
- Embodiment 26 The compound of any one of the previous Embodiments, wherein g is 5 to 10.
- Embodiment 27 The compound of any one of the previous Embodiments, wherein g is 7.
- Embodiment 28 The compound of any one of the previous Embodiments, wherein x is 1, and L is an unsubstituted or substituted C1-C3 hydrocarbyl.
- Embodiment 29 The compound of any one of the previous Embodiments, wherein L is selected from the group consisting of an unsubstituted methyl, an unsubstituted ethyl and an unsubstituted propyl.
- Embodiment 30 The compound of any one of the previous Embodiments, wherein the compound of formula (I) is at least one of the following compounds or a
- Embodiment 31 A pharmaceutical formulation comprising -
- Embodiment 32 The pharmaceutical formulation of Embodiment 31, wherein the oil is selected from the group consisting of sesame oil, triglycerides (e.g., medium chain triglycerides), and a combination thereof.
- the oil is selected from the group consisting of sesame oil, triglycerides (e.g., medium chain triglycerides), and a combination thereof.
- Embodiment 33 The pharmaceutical formulation of Embodiment 31 or 32, wherein (A) the oil is present in the pharmaceutical formulation at an amount of about 60 % to about 95 %, about 65 % to about 95 %, about 70 % to about 95 %, about 75 % to about 95 %, about 80 % to about 95 %, or about 85 % to about 95 %, by weight, based on the weight of the pharmaceutical formulation, (B) the compound of formula (I) is present at an amount of about 0.01 % to about 40 %, about 0.01 % to about 30 %, about 0.01 % to about 20 %, about 0.01 % to about 10 %, about 0.01 % to about 5 %, by weight, based on the weight of the pharmaceutical formulation, or (C) a combination thereof.
- A the oil is present in the pharmaceutical formulation at an amount of about 60 % to about 95 %, about 65 % to about 95 %, about 70 % to about 95 %, about 75 % to about 95
- Embodiment 34 The pharmaceutical formulation of any one of Embodiments 31 to 33, wherein the pharmaceutical formulation further comprises benzyl alcohol, benzyd benzoate, ethyl alcohol, or a combination thereof; wherein, optionally, the benzyl alcohol, ethyl alcohol, benzyl benzoate, or the combination thereof is present at a total amount of about 0.01 % to about 25 %, about 0.01 % to about 20 %, about 0.01 % to about 15 %, about 0.01 % to about 10 %, or about 5 % to about 10 %, by weight, based on the weight of the pharmaceutical formulation.
- Embodiment 35 The pharmaceutical formulation of any one of Embodiments 31 to 34, wherein the pharmaceutical formulation (A) is formulated for injection, such as intramuscular or subcutaneous injection, (B) is configured to achieve kinase bypass of the first nucleoside phosphorylation, (C) delivers antivirally significant concentrations to lungs and/or gastrointestinal tract, (D) provides sustained levels of active ingredient in plasma for about 5 to about 30 days, about 5 days to about 28 days, about 5 days to about 21 days, about 5 days to about 14 days, or about 5 days to about 7 days following administration of a single dose, such as by intramuscular injection, or (E) a combination thereof.
- Embodiment 36 A method for treating coronavirus infection in a mammal (e.g., a human), the method comprising administering to the mammal an effective amount of the pharmaceutical formulation of any one of Embodiments 31 to 35.
- Embodiments 37 The method of Embodiment 36, wherein the effective amount of the pharmaceutical formulation is administered as a single dose.
- Embodiment 38 The method of Embodiment 36 or 37, wherein the pharmaceutical formulation comprises an intermediate acting oil formulation, such as formulation F8 or formulation F7, as described herein.
- Embodiment 39 A method for treating HIV infection in a mammal, the method comprising administering to the mammal an effective amount of the pharmaceutical formulation of any one of Embodiments 31 to 35.
- Embodiment 40 The method of Embodiment 39, wherein the pharmaceutical formulation is a long-acting treatment.
- Embodiment 41 The method of Embodiment 39 or 40, wherein the pharmaceutical formulation comprises formulation F3 or formulation F4, as described herein.
- Embodiment 42 A method for treating and/or inhibiting the replication of respiratory syncytial virus (RSV), the method comprises administering to the mammal an effective amount of the pharmaceutical formulation of any one of Embodiments 31 to 35.
- RSV respiratory syncytial virus
- Embodiment 43 A method for treating a virus infection in a mammal, the method comprising administering to the mammal an effective amount of the pharmaceutical formulation of any one of Embodiments 31 to 35, wherein the virus is a RNA virus of a viral family selected from the group consisting of Filoviridae, Orthomyxoviridae, Paramyxoviridae, Pneumoviridae, Phenuiviridae, Nairoviridae, Arenaviridae, Flaviviridae, and Coronaviridae.
- Filoviridae Orthomyxoviridae, Paramyxoviridae, Pneumoviridae, Phenuiviridae, Nairoviridae, Arenaviridae, Flaviviridae, and Coronaviridae.
- Embodiment 44 A method for producing a prodrug, the method comprising:
- Embodiment 45 The method for producing a prodrug of any of the previous Embodiments, wherein the contacting of the compound of formula (a) and the compound of formula (b) occurs in the presence of A,A-dicyclohexylcarbodii mide, 4- dimethylaminopyridine, or a combination thereof.
- Embodiment 46 The method for producing a prodrug of any of the previous Embodiments, wherein the acid comprises HC1.
- Embodiment 47 The method for producing a prodrug of any of the previous Embodiments, wherein the contacting of formula (c) with the acid occurs in the presence of tetrahydrofuran (THF).
- THF tetrahydrofuran
- N.N-Diisopropylcarbodiimide (DIC, 3.3 mmol) was added to a mixture of GS-441524 acetonide (1.65 mmol), lipid phosphate (1.65 mmol), and 1- methylimidazole (NMI, 406 mg, 4.95 mmol) in dry pyridine (30 mL), and then the mixture was stirred for 48 hours at room temperature until analysis of the reaction mixture by TLC indicated substantial formation of coupled product Water (5 mL) was then added, and the mixture was concentrated on a rotary evaporator. The residue was adsorbed onto silica gel and purified by flash column chromatography on silica gel 60. Gradient elution (100% CH2CI2 to CH2Cl/20% methanol) afforded the protected phosphodiester analogs.
- GS-441524 acetonide was coupled to 2b according to General Method B. N,N-Dicyclohexylcarbodiimide (DCC, 619 mg, 3 mmol) was added to a mixture of GS-441524 acetonide (300 mg, 0.91 mmol), 3- (hexadecyloxy)propyl phosphate (2b, 414 mg, 1.10 mmol), and 4-dimethylaminopyridine (DMAP, 122 mg, 1.0 mmol) in 25 mL of dry pyridine, and then the mixture was heated to 90 °C and stirred for 24 hours.
- DCC N,N-Dicyclohexylcarbodiimide
- DMAP 4-dimethylaminopyridine
- Scheme 2 depicts embodiments of synthesis methods that were used to produce the following embodiments of l -O-alkyl-2-O-substituted-sn-gly ceryl esters of GS-441524 5 '-monophosphate.
- 11c 1 -O-octadecyl-3-O-trityl-OT-glycerol. Prepared from 10c according to General Method H. Yield 87%.
- lid 1-O-oleyl-3-O-trityl-sn-glycerol Prepared from lOd according to General Method H. Yield 77%.
- 14f 1 -O-Octadecyl-2-G-octyl-sn-glyceryl-phospo-RVn acetonide - Prepared from GS-441524 acetonide and 13f according to General Method C.
- 14g 1-O-Octadecyl-2-O-(cyclohexylmethyl)-SM-glyceryl-phospo-RVn acetonide - May be prepared from GS-441524 acetonide and 13g according to General Method C.
- 15i 1-O-Octadecyl-2-G-(4-methoxybenzyl)-sn-glyceryl-phospho-RVn- May be prepared from Compound 14i according to General Method E.
- 15j l -O-Octadecyl-2-O-(3-fluoro-4-methoxy-benzyl)-sn-glyceryl-phospho-RVn- Prepared from Compound 14j according to General Method E.
- compounds of the diclosure are 3',5'-cyclic phosphates.
- the 3',5'-cyclic phosphates were prepared from known or readily prepared starting materials, following methods known to one skilled in the art of organic synthesis.
- 3', 5 '-cyclic phosphates 18-eq, 18-ax, 19-eq and 19-ax are prepared from phosphodiesters 15d and 4c by an intramolecular esterification reaction:
- the compounds of this example were assayed for anti-coronavirus activity in Vero E6 cells in comparison with remdesivir (RDV) and the remdesivir nucleoside (RVn).
- RDV remdesivir
- RVn remdesivir nucleoside
- Ten thousand Vero E6 cells were seeded in 100 microliters of culture medium in 96 well plates. The following day serial two-fold dilutions of antiviral compounds or the DMSO- containing vehicle were added to each well. The USA WA-01 strain of SARS CoV-2 was added to each well at a multiplicity of infection of 0.1 thirty minutes later. Cells were incubated for 48 hours, washed twice in PBS and lysed with TRIzol. RNA was extracted using Directzol micro RNA columns.
- ODE-P-RVn (4c) and ODBG-P-RVn (15d) were 9 to 15 times more active against the USA WA-1 strain of SARS-CoV-2019 in Vero E6 cells.
- HDP-P-RVn (4b) was 3.3-fold more active than remdesivir.
- Vero E6 cells were pretreated with the indicated dose of the indicated drug for thirty minutes and then infected with SARS-CoV-2 isolate USA-WA1/2020 for 48 hours.
- the relative SARS-CoV-2 Spike RNA expression was determined by qRT-PCR. Each dose-response comparison was conducted simultaneously for all drugs on 2 separate occasions. Data from both experiments are shown at FIG. 1A-FIG. IF. Data points indicate the mean relative expression from duplicate wells. Error bars represent the standard deviations (SDs). The black vertical dashed line indicates the concentrations at which there is 50% inhibition (EC50). (FIG. IF). Combined inhibition curves for all five compounds and DMSO on a single chart. DMSO, which was the vehicle for all compounds, had no effect on SARS-CoV-2 replication at the concentrations used. The three lipid esters of RVn-monophosphate were all substantially more active than RDV and RVn.
- the following table shows the effective concentrations (EC50, EC90), 50% cytotoxic concentration (CC50), and selectivity index of the compounds, mean ⁇ SD. Cytotoxicity (CC50) was assessed using Cell Titer Gio. The EC50 values of RDV and RVn were 4.6 and 1.7 pM, respectively. The lipid prodrugs were more active with ECsos of ranging from 0. 19 ⁇ 0.023 to 0.96 ⁇ 0.17. ODBG-P-RVn and ODE-P-RVn were the most active and selective compounds. Based on the ECso values the most active compound, ODBG-P-RVn, was 24 times more active than RDV and 8.9 times more active than RVn (p ⁇ 0.001 and 0.005) with a selectivity index of 240.
- RVn resembling lysophospholipids that are normally absorbed in the GI tract.
- the RVn liponucleotides were not metabolized rapidly in plasma and gain rapid entry to the cell often exhibiting greatly increased antiviral activity.
- Oral 1-O-octadecyl-2-O-benzyl-sn-glycero-3-cidofovir targets the lung and is effective against a lethal respiratory challenge with ectromelia virus in mice; Antiviral Res. 2007 Mar;73(3):212-8).
- lipid prodrugs of RVn were synthesized that were substantially more active than RDV or RVn in Vero E6 cells.
- the two most active compounds ODBG-P-RVn and ODE-P-RVn were 24 and 9.8 times more active than RDV. These compounds were expected to be orally bioavailable, stable in plasma and provide significant exposure and antiviral activity to all tissues infected with SARS-CoV- 2.
- Remdesivir GS-5734
- remdesivir nucleoside GS-4415244
- AA Blocks San Diego, CA
- Mason-Chem Patent-Chem
- Vero E6 were obtained from ATCC and grown in DMEM (Coming) with 10 % FBS and Penicillin-Streptomycin (Gibco).
- SARS-CoV-2 infection SARS-CoV-2 isolate USA-WA1/2020 (BEI Resources) was propagated and infectious units quantified by plaque assay using Vero E6 (ATCC) cells. Approximately 10 4 Vero E6 cells per well were seeded in a 96 well plate and incubated overnight. Compounds or controls were added at the indicated concentrations 30 minutes prior to infection followed by the addition of SARS-CoV-2 at a multiplicity of infection equal to 0.01. After incubation for 48 hours at 37 °C and 5% CO2, cells were washed twice with PBS and lysed in 200ul TRIzol (ThermoFisher).
- RNA extraction, cDNA synthesis and qPCR RNA was purified from TRIzol lysates using Direct-zol RNA Microprep kits (Zymo Research) according to manufacturer recommendations that included DNase treatment. RNA was converted to cDNA using the iScript cDNA synthesis kit (BioRad) and qPCR was performed using iTaq universal SYBR green supermix (BioRad) and an ABI 7300 real-time per system. cDNA was amplified using the following primers RPLP0 F - GTGTTCGACAATGGCAGCAT iSEQ ID NO: 1 ); RPLPO R - GACACCCTCCAGGAAGCGA (SEQ ID NO: 2); SARS- .(. . .;.
- SARS-CoV-2 Spike RNA expression was calculated by delta-delta-Ct by first normalizing to the housekeeping gene RPLPO and then comparing to SARS-CoV-2 infected Vero E6 cells that were untreated (reference control). Curves were fit and 50 and 90% effective concentrations EC50 and EC90 values calculated using Prism 8.
- CellTiter-glo luminescent cell viability assay Approximately 10 4 Vero E6 cells per well were seeded in opaque walled 96 well cell culture plates and incubated overnight. Compounds or controls were added at the indicated concentrations. After incubation for 48.5 hours at 37°C and 5% CO2, an equal volume of CellTiter-Glo reagent (Cat. # G7570, Promega, Madison, WI) was added, mixed and luminescence recorded on an EnSpire Multimode Plate Reader (PerkinElmer) according to manufacturer recommendations. Viability was calculated compared to untreated controls and CC50 values were calculated using Prism 8.
- CC50 50% cytotoxic concentrations
- Cell Titer Gio Cat. # G7570, Promega, Madison, WI
- the calculated CC50 values are shown in the foregoing table.
- Vero E6 cells were treated with increasing concentrations of remdesivir analogs, remdesivir (GS-5734), remdesivir nucleoside (GS441524) or DMSO vehicle (control) for 48.5 hrs. Relative viability was measured by CellTiter-Glo luminescent cell viability assay, as depicted at FIG. 2.
- Vero E6 cells were plated in 6 well plates at about 3.4 x 10 5 cells per well in 2 mL of media (DMEM, 10% FBS).
- RDV remdesivir
- RVn remdesivir nucleoside
- ODE-P-RVn octadecyloxyethyl-phospho-RVn (4c);
- ODBG-P-RVn 1-O-octadecyl-2-O-benzyl-glyceryl-sn-3-phospho-RVn (15d)
- RVn-TP remdesivir triphosphate
- human Coronavirus 229E (ATCC) was propagated and infectious units quantified by TCIDso using MRC-5 cells.
- ATCC human Coronavirus 229E
- MRC-5 cells For antiviral testing, approximately 104 MRC-5 cells were seeded per well in EMEM (10% FCS) at 37 °C in a 96 well plate overnight. Medium from each well was removed and cells were infected with 100 TCID50 virus in 100 pL medium for two hours.
- the % inhibition was calculated as (Atv - Acv)/(Acd - Acv) x 100% where Atv indicates the absorbance of the test compounds with virus infected cells and Acv and Acd indicate the absorbance of the virus control and the absorbance of the cell control, respectively.
- the average half-maximal effective concentration (EC50) was defined as the concentration which achieved 50% inhibition of virus-induced cytopathic effects.
- TMPRSS2-Vero cells or 20e3 Huh7.5 cells were seeded per well in black with clear flat bottom 96 well plates and incubated overnight. Compounds or controls were added about 30 to about 60 minutes prior to infection at the indicated concentrations with addition of SARS-CoV-2 at a multiplicity of infection (FFU/cell) equal to 0.01 for TMPRSS2-Vero and 0.1 for Huh7.5.
- FFU/cell multiplicity of infection
- SARS-CoV-2 infection assay Approximately 20k Calu-3 cells were seeded per well in black with clear flat bottom 96 well plates (Corning #3904) and incubated 48-72h. Compounds or controls were added 30-60 minutes prior to infection at the indicated concentrations with addition of SARS-CoV-2 at a multiplicity of infection (FFU/cell) equal to 0.01. After incubation for 44 hour at 37 °C and 5% CO2, the medium was removed and cells were incubated in 4% formaldehyde for 30 minutes at room temperature.
- FFU/cell multiplicity of infection
- Formaldehyde fixed cells were washed with PBS and permeabilized for immunofluorescence in 0.1% Triton-X 100 in PBS with 1% bovine serum albumin (BSA) fraction V (Millipore- Sigma) and stained for SARS-CoV-2 with a primary anti-Nucleocapsid antibody (GeneTex GTX135357) followed by AlexaFluor 594 secondary antibody (Thermo Fisher Scientific A-11012) with nuclear counterstain Sytox Green (Thermo Fisher Scientific). Five images per well were obtained at lOx magnification using an Incucyte S3 (Sartorius).
- the percent infected cells and nuclei count were calculated using built-in image analysis tools for the Incucyte S3. Calculations for EC50. EC90 and CC50 were carried out using the nonlinear regression analysis in GraphPad Prism 9 with the bottom and top parameters constrained to 0 and 100, respectively. All work with authentic SARS-CoV-2 was conducted in Biosafety Level-3 conditions at the University of California San Diego.
- Cell viability assay For select compounds the CC50 was calculated up to a maximum of 100pM using CellTiter-Glo. For these experiments, approximately 20k Calu-3 cells were seeded per well in opaque white 96-well plates (cat# 655073, Greiner Bio-One, Monroe, North Carolina) and incubated 4 CO2. After which an equal volume of CellTiter-Glo reagent (Cat. # G7570, Promega, Madison, WI) was added, mixed and luminescence recorded on a Veritas Microplate Luminometer (Turner BioSystems) according to manufacturer recommendations.
- CellTiter-Glo reagent Cat. # G7570, Promega, Madison, WI
- Vero E6, Caco-2, and Calu-3 cell lines were obtained from ATCC.
- Huh7.5 cells were obtained from Apath LLC. Calu-3 and Caco-2 cells were propagated in MEM (Coming), 10% FBS, Penicillin-Streptomycin (Gibco).
- Vero E6 and Huh7.5 cells were propagated in DMEM (Coming) with 10% FBS and Penicillin-Streptomycin (Gibco).
- Human PSC-lung cell generation, human lung organoids were generated as previously described (Leibel SL, McVicar RN, Winquist AM, Niles WD, Snyder EY Generation of complete multi-cell type lung organoids from human embryonic and patient-specific induced pluripotent stem cells for infectious disease modeling and therapeutics validation Curr. Protoc.
- H9 embryonic stem cells (WiCell) were cultured in feeder free conditions upon Matrigel (Coming #354230) coated plates in mTeSR medium (StemCellTech #85850). Media was changed daily, and stem cells were passaged using enzyme free dissociation reagent ReLeSRTM (Stem Cell Tech#05872). Cultures were maintained in an undifferentiated state, in a 5% CO2 incubator at 37 °C.
- human PSCs were dissociated into single cells, and then seeded on Matrigel-coated plates (BD Biosciences) at a density of 5.3 x 10 4 cells/cm 2 in Definitive Endoderm (DE) induction medium (RPMI1640, 2% B27 supplement, 1% HEPES, 1% glutamax, 50 U/mL penicillin/streptomycin), supplemented with 100 ng/mL human activin A (R&D), 5pM CHIR99021 (Stemgent), and lOpM ROCK inhibitor, Y-27632 (R&D Systems) on day 1. On days 2 and 3 cells were cultured in DE induction media with only 100 ng/mL human activin A.
- DE Definitive Endoderm
- Anterior Foregut Endoderm was generated by supplementing serum free basal medium (3 parts IMDM: 1 part F12, B27+N2 supplements, 50U/mL penicillin/streptomycin, 0.25% BSA, 0.05 mg/mL L- ascorbic acid, 0.4mM monothioglycerol) with lOpM SB431542 (R&D) and 2 pM Dorsomorphin (StemGent) on days 4-6.
- Lung Progenitor Cell Lung Progenitor Cell (LPC) induction medium, containing serum free basal medium supplemented with 10 ng/mL human recombinant BMP4 (R&D), 0.1 pM all-trans retinoic acid (Sigma-A days.
- LPC Lung Progenitor Cell
- LPCs were dissociated in accutase for lOminutes and resuspended in Matrigel in a 12-well, 0.4pm pore size Transwell (Coming) culture insert at 5.0 x 10 4 cells/200ul of Matrigel.
- proximal lung organoid maturation media were cultured in proximal lung organoid maturation media using serum free basal medium supplemented with 250ng/mL FGF2, lOOng/mL rhFGFlO, 50nM dexamethasone (Dex), 100pM 8-Bromoadenosine 3’,5’-cyclic monophosphate sodium salt (Br-cAMP), lOOpM 3 -Isobutyl- 1 -methylxanthine (IBMX) and 10 pM ROCK inhibitor (Y- 27632).
- Proximal lung organoid media was changed every other day for 3 weeks.
- Human PSC-derived lung organoids were dissociated into single cells and seeded at 20,000 cells per well of a matrigel coated 96-well plate one day before transfection. Transwells containing the proximal organoids in matrigel were incubated in 2U/ml dispase for 30 minutes at 37 °C. Cold PBS was added to the mixture then centrifuged at 400 x g for 5 minutes.
- SARS-CoV-2 infection SARS-CoV-2 isolate USA-WA1/2020 (BEI Resources) was propagated and infectious units quantified by plaque assay using Vero E6 (ATCC) cells. Approximately 12,000 cells from each cell line were seeded per well in a 96 well plate. Vero E6 and Huh7.5 were seeded approximately 24 hours prior to treatment/infection. Calu-3 and Caco-2 were seeded approximately 48h prior to treatment/infection. Human PSC lung cell infections and cytotoxicity experiments were performed when cells reached 100% confluency. Compounds or controls were added at the indicated c SARS-CoV-2 at a multiplicity of infection equal to 0.01.
- RNA extraction, cDNA synthesis and qPCR RNA was purified from TRIzol lysates using Direct-zol RNA Microprep kits (Zymo Research) according to manufacturer recommendations that included Dnase treatment. RNA was converted to cDNA using the iScript cDNA synthesis kit (BioRad) and qPCR was performed using iTaq universal SYBR green supermix (BioRad) and an ABI 7300 real-time per system.
- cDNA was amplified using the following primers RPLPO F - expression of SARS-CoV-2 Spike RNA was calculated by delta-delta-Ct by first normalizing to the housekeeping gene RPLPO and then comparing to SARS-CoV-2 infected Vero E6 cells that were untreated (reference control). Curves were fit using the nonlinear regression - log(inhibitor) vs. response (four parameter) model using Prism 9. To calculate effective concentrations EC50 and EC90 values, qRT-PCR values were normalized to percent inhibition and curves fit using the 20 nonlinear regression - log(agonist) vs. response (four parameter) model with bottom and top constrained to 0 and 100 respectively using Prism 9.
- Cell viability assay Cell type were seeded as per SARS-CoV-2 infection studies in opaque walled 96-well cell culture plates or 229E infection studies in clear 96-well cell culture plates and incubated overnight. Compounds or controls were added at the indicated concentrations.
- SARS-CoV-2 related studies cells were incubated for 48.5 hours at 37°C and 5% CO2, an equal volume of CellTiter-Glo reagent (Cat. # G7570, Promega, Madison, WI) was added, mixed and luminescence recorded on a Veritas Microplate Luminometer (Turner BioSystems) according to manufacturer recommendations.
- the EC50 of ODBG-P-RVn and ODE-P-RVn were less than 0.35pM in PSC- lung and Calu-3, both models of human lung infection.
- the antiviral activities of ODBG- P-RVn and ODE-P-RVn were significantly better than RVn in PSC-lung cells.
- ODBG-P- RVn, ODE-P-RVn and HDP-P-RVn demonstrated strong antiviral activity in Huh7.5 cells with EC50 less than 0.2pM that was not significantly different from RDV or RVn.
- the EC50 of ODBG-P-RVn was 0.3pM which was significantly lower than RVn but similar to RDV .
- the EC50 of ODE-P-RVn was O.77pM. which was significantly higher than RDV.
- cytotoxicity of each compound by incubating each of these cell lines with serial dilutions of each compound from 1 ,23pM to I OOpM for 48 hours.
- the average 50% cytotoxic concentrations (CC50) for all compounds were greater than 60pM in all cell lines except for RDV which had a CC50 of 32.7pM in PSC-lung cells and 15.2pM in Huh7.5, a human hepatocyte cell line.
- the selectivity index of ODBG-P-RV ranged from 295 to 699 in the five cell types tested in this example).
- Human Coronavirus 229E was propagated and infectious units quantified by TCID50 using MRC-5 cells.
- MRC-5 cells were seeded per well in EMEM (10%FCS) at 37C in a 96 well plate overnight Medium from each well was removed and cells were infected with 100 TCID50 virus in 100 pL medium for two hours.
- various compounds of the disclosure inhibit the human Alphacoronavirus 229E.
- Cells were infected with 229E for 2 hours followed by treatment with the indicated dose of the indicated drug for 72 hours.
- the relative CPE was determined by measuring cell viability using an MTT assay, depicts the cytotoxicity in MRC-5 cells incubated in the presence of the indicated drug at the indicated concentration for 72 hours, after which cell viability was measured by the CellTiter-Glo assay. Data points indicate the averages from 3 independent experiments performed in duplicate. Error bars represent the standard error mean (SEM). Both ODBG-P-RVn and RDV demonstrated a dose-dependent inhibition of cytopathic effect (CPE).
- ODBG-P-RVn and RDV were 0.15pM and 0.04pM and the EC90S were 0.54 mM and 0.26 mM respectively.
- the CC50 for ODBG-P-RVn and RDV were greater than 50pM in MRC-5 cells.
- the most active compounds were compounds which had 3-fluoro,4- methoxy substitutions. Together with the antiviral data for SARS-CoV-2, this demonstrates that ODBG-P-RVn related analogs have antiviral activity against two genetically distinct human pathogenic coronaviruses.
- Example 9 - Orally administered ODBG-P-RVn (15d) achieved therapeutic plasma levels in Syrian Hams ter s
- ODBG-P-RVn in 0.1M sodium carbonate/bicarbonate buffer, pH 9.0 was administered to Syrian Hamsters by oral gavage every 12 hours for seven days.
- Plasma curves were generally similar at day 1 and 7 except at 16.9 mg/kg, the 7 d values were slightly higher than the levels at day 1.
- ODBG-P-RVn levels were above the EC90 for ODBG-P-RVn in all cell lines studied including Vero E6 cells and PSC lung cells on both day 1 and 7.
- Levels of the RVn, the nucleoside metabolite of ODBG-P-RVn peaked at 3 hours after administration and declined thereafter. Plasma levels of RVn were less than the EC90 for RVn in both PSC lung cells and Vero E6 cells.
- RVn The observed low levels or RVn suggest that antiviral activity attributable to this metabolite will be minimal and are also consistent with finding of OBDG-P-RVn stability in human plasma. Collectively, these results suggest that ODBG-P-RVn will be effective in suppressing viral replication in a variety of tissue types in vivo.
- FIG. 4A and FIG. 4B depict the seven day oral pharmacokinetics in Syrian hamsters.
- Syrian hamsters were given vehicle or ODBG-P-RVn by oral gavage every 12 hours for 7 days.
- Groups of 3 animals received vehicle or drug at doses of 16.9 and 13.2 mg/kg. Animals were weighed daily and monitored for clinical signs. Plasma samples were obtained at 1, 3, 6 and 12 hours on day 1 and day 7 and frozen for analysis of ODBG-P-RVn (FIG. 4A) and RVn (FIG. 4B) by LC/MS/MS.
- ODBG-P-RVn Hamster plasma samples (10 pL) containing ODBG-P-RVn and K2EDTA as the anticoagulant were added to polypropylene tubes containing water (100 pL), internal standard solution (10 pL; 1,000 ng/mL of ODE- P-RVn in ACN:DMF (1: 1, v/v)), and 10 pL of ACN:DMF (1: 1, v/v). The solutions were mixed, then acidified with phosphoric acid, 85% w/v:water (1 : 19, v/v; 10 pL), mixed, then diluted with 200 pL of IP A, mixed, then diluted with 500 pL of water, and mixed.
- the citric acid solution was prepared as watercitric acid monohydrate (20:0.4, v/w). After elution, 100 pL of water was added to each sample.
- the ODBG-P-RVn extracts were analyzed using an Agilent 1200 HPLC system (Agilent, Santa Clara, CA) coupled to an API5500 mass analyzer (SCIEX, Foster City, CA).
- the mobile phase was nebulized using heated nitrogen in a Turbo-V source/interface set to electrospray positive ionization mode.
- the ionized compounds were detected using multiple reaction monitoring with transitions m/z 788.4 > 229 (V2043) and 668.4 > 467.2 (V2041).
- This method is applicable for measuring ODBG-P-RVn concentrations ranging from 6.25 to 3,000 ng/mL using 10.0 pL of plasma for extraction.
- the peak areas of ODBG-P-RVn and RVn were acquired using Analyst v. 1.6.2 (SCIEX, Framingham, MA).
- the calibration curve was obtained by fitting the peak area ratios of the analyte/I.S.
- RVn (GS-441524): Hamster plasma samples (20 //L) containing GS-441524 and K2EDTA as the anticoagulant were added to Eppendorf LoBind microfuge tubes containing acetonitrile (300 /zL) and water: acetonitrile (2:8, v/v; 60 uL). The solutions were mixed and centrifuged at 16,000 g for five minutes. The supernatant (300 //L) was then filtered through an Ostro protein precipitation and phospholipid removal plate (25 mg; Waters, Milford, MA). Filtration occurred under positive pressure conditions using nitrogen. Collected filtered samples were capped, mixed and stored at 10°C pending analysis.
- the GS-441524 extracts were analyzed using an Acquity UPLC system (Waters, Milford, MA) coupled to a G2-S QTof mass analyzer (Waters, Milford, MA). Analytes were chromatographically separated using a Unison-UK Amino HT col system consisting of Mobile Phase A (0.008% ammonium hydroxide, 0.012% acetic acid in water, v/v/v) and Mobile Phase B (0.008% ammonium hydroxide, 0.012% acetic acid in acetonitrile, v/v/v). The total analytical run time was 12.5 minutes. The mobile phase was nebulized using heated nitrogen in a Z-spray source/interface set to electrospray positive ionization mode.
- the ionized compounds were detected using Tof MS scan monitoring in sensitivity mode scanning from 50.0 to 700 m/z. This method is applicable for measuring GS-441524 concentrations ranging from 1.00 to 1,000 ng/mL using 20.0 «L of plasma for extraction.
- the peak areas of GS-441524 were acquired using MassLynx V4.2 (Waters, Milford, MA).
- the calibration curve was obtained by fitting the peak area ratios of the analyte and the standard concentrations to a linear equation with 1/x 2 weighting using MassLynx. The equation of the calibration curve was then used to interpolate the concentrations of the analyte in the samples using their peak areas. The peak areas used for the calculations were not rounded.
- Example 10 Stability of ODE-P-RVn (4c) and ODBG-P-RVn (15d) in Human Plasma
- One of the disadvantages of remdesivir is instability in plasma where it has been reported to persist at virologically significant levels for less than 2 hours after intravenous infusion. (1, 2).
- Remdesivir also has limited stability ex vivo in human plasma with a reported T% of 69 minutes (Siegel D, Hui HC, Doerffler E, Clarke MO, Chun K, Zhang L, Neville S, Carra E, Lew W, Ross B, Wang Q, Wolfe L, Jordan R, Soloveva V, Knox J, Peny J, Perron M, Stray KM, Barauskas O, Feng JY, Xu Y, Lee G, Rheingold AL, Ray AS, Bannister R, Strickley R, Swaminathan S, Lee WA, Bavari S, Cihlar T, Lo MK, Warren TK, Mackman RL.
- ODE-P-RVn and ODBG-P-RVn in human plasma were evaluated with either K2EDTA or sodium heparin as an anticoagulant.
- FIG. 5A and FIG. 5B shows that both ODE-P-RVn and ODBG-P-RVn were stable for at least 24 hours in human plasma with either K2EDTA (FIG. 5A) or sodium heparin (FIG. 5B) as anticoagulants.
- the SRV A2 strain of RSV was obtained from the ATCC. Ten thousand Hep-2 cells were seeded into each well of a 96-well plate in EMEM with 10% fetal bovine serum and 1% penicillin and streptomycin. Each well was inoculated with 100 TCIDso of virus. Two hours later wells were washed once with medium and serial four-fold dilutions of candidate antiviral drugs were added. Cell cultures were observed for 72 to 96 hours for cytopathic effects. The concentration of drug that reduced CPE by 50 or 90% was calculated using Prism 7 software and expressed as the EC50 and EC90, respectively.
- Cell viability assay For select compounds the CC50 was calculated up to a maximum of lOOpM using CellTiter-Glo. For these experiments, approximately 20k Calu- 3 cells were seeded per well in opaque white 96-well plates (cat# 655073, Greiner Bio- One, Monroe, North Carolina) and incubated 48-72h. Compounds or controls were added and incubated for 44h at 37 °C and 5% CO2. After which an equal volume of CellTiter- Glo reagent (Cat. # G7570, Promega, Madison, WI) was added, mixed and luminescence recorded on a Veritas Microplate Luminometer (Turner BioSystems) according to manufacturer recommendations.
- compounds 15j, 15m, and 15c may be at least 2 to 3 times more active than compound 15d.
- compound 15m may be more active than remdesivir.
- Compounds of the disclosure had very marked antiviral activity in Hep-2 cells infected with RSV A2. Cytotoxicity was moderate and the selectivity (CC50/EC50) ranged from 605 to 2,500.
- N,N-Dicyclohexylcarbodiimide (DCC, 410 mg, 2.0 mmol) was added to a solution of emtricitabine (230 mg, 0.9 mmol), octadecyloxyethyl phosphate (320 mg, 0.74 mmol), and 4-dimethylaminopyridine (DMAP, 110 mg, 0.9 mmol) in 10 mL of dry pyridine, and then the mixture was heated to 80 °C and stirred for 3 days. Pyridine was then evaporated and the residue was purified by flash column chromatography on silica gel 60.
- DCC N,N-Dicyclohexylcarbodiimide
- Octadecyloxy ethyl-phospho-emtricitabine (220 mg, 0.35 mmol), benzyl alcohol (76 mg, 0.70 mmol), diisopropylethylamine (DIEA, 0.12ml, 0.70 mmol), and (1H- benzotriazol-l-yloxy)-tripyrrolidinophosphonium hexafluorophosphate (PyBOP, 360 mg, 0.70 mmol) in dry DMF (10 mL) were stirred at room temperature. After 3 h. DMF was evaporated under vacuum. The residue was dissolved in ethyl acetate (50 mL) washed with saturated NaHCCb (3 x 10 mL).
- Long-acting HIV antivirals For use in long-acting intramuscular treatment of infection with the human immunodeficiency virus, the antiviral compounds suitable for use are described in this application and in US Patent 8,835,630 and include the following: Compounds useful as long-acting HIV antivirals Antiviral activity in HIV infected human PBMCs
- compositions included a compound as described herein, such as a compound of formula (I).
- the pharmaceutical formulation was orally bioavailable.
- the pharmaceutical formulation is formulated for injection, such as intramuscular injection.
- the pharmaceutical formulations included one compound described herein, or more than one (e.g., two, three, etc.) compounds described herein.
- the pharmaceutical formulations included any one or more pharmaceutically acceptable excipients.
- Oil based formulations for compounds of the disclosure have the following composition by weight (w/w%):
- composition of intermediate- and long-acting formulations of compounds for treatment of coronavirus or HIV infections The following materials were used in the formulations of the foregoing table:
- one or more of the compounds described herein, such as those of formula (I), were soluble in an oil, such as one of formulations F3, F4, F7, and F8.
- an amount of one or more compounds described herein, such as those of formula (I) were soluble in an oil, then the resulting pharmaceutical formulation may be used in any of the methods herein, including a method of treating coronavirus with a single dose of the pharmaceutical formulation.
- Formulations of the foregoing table were prepared using compounds of the disclosure.
- Antiviral prodrugs of the disclosure employing HIV antivirals or RNA virus antiviral compounds described in PCT/US2021/043094 may be utilized in the formulations.
- the following pharmacokinetic experiments were done using ODE-Bn-Tenofovir as the antiviral prodrug.
- FIG. 6A and FIG. 6B depict pharmacokinetics of ODE-Bn-TFV and ODE-TFV, respectively, after intramuscular administration of 100 mg/kg in formulation F3 to rats.
- Results Rats were injected IM at day zero and weights and clinical observations were acquired twice a week for 42 days. The increases in body weight in vehicle and drug treated rats were identical and no clinical signs were noted.
- Comprehensive metabolic panels at study termination did not show any abnormalities in liver or kidney functions tests. CBCs were normal controls and all drug dosage groups. After administration ODE- Bn-TFV was metabolized to the more active metabolite, ODE-TFV.
- the two logio panels below show various formulations at doses of 100 mg/kg (formulation drug concentrations of 200 mg/ml).
- the left panel was ODE-Bn-TFV and the right panel shows plasma levels of ODE-TFV (nM/L). All four formulations given at 100 mg/kg allow for maximal plasma levels of ODE-Bn-TFV at 6 to 48 hours followed by a gradual decline to 2.87 ng/ml (F8) to 6.95 (F3).
- the highest values at day 28 were noted in F3, ODE-Bn-TFV 6.95 ng/ml (10.3 nM) and ODE-TFV 1.78 ng/ml (3.05 nM). These values were above the EC50s for these two compounds (1.7 and 1.1 nM).
- FIG. 7A and FIG. 7B are plots of the effects of 4 different formulations on the pharmacokinetics of ODE-Bn-TFV and ODE-TFV, respectively, after intramuscular administration of 100 mg/kg to rats.
- the following figures shows the comparison between intramuscular ODE-Bn-TFV in Formulation F3 versus formulation F8 in rats.
- ODE-Bn-TFV in F3 provided lower early levels of drug in comparison with F8 but levels persisted longer, remaining above the HIV EC90 for 28 days.
- the F8 formulation produced higher drug levels until day 15 and was more suitable for treatment courses of 5 to 14 days.
- FIG. 8 depicts a comparison of 96 mg/kg ODE-Bn-TFV pharmacokinetics in rats using formulation F3 versus F8.
- Formulation F3 provided the greatest exposure during the second 14 days.
- Formulation F8 and F7 showed the highest percentage exposures, 89 and 83%, during the first 14 days.
- FIG. 9 depicts rat plasma levels of ODE-Bn-TFV and ODE-TFV during a 3 month exposure to monthly intramuscular doses of ODE-Bn-TFV in formulation F3.
- Plasma drug levels 15 days following the first dose ODE-Bn-TFV levels were high and the first metabolite, ODE-TFV, were about 30% of the parent compound. However, as the 3 month study proceeded, ODE-TFV levels gradually became the dominant active compound in plasma. After the last dose at 60 days, levels of ODE-TFV remained substantial until day 105 at which time they were 11 nanomolar.
- the EC90 of ODE-TFV is 10 nM (Beadle JR, Aldem KA, Zhang XQ, Valiaeva N, Hostetler KY, Schooley RT.
- Octadecyloxyethyl benzyl tenofovir A novel tenofovir diester provided sustained intracellular levels of tenofovir diphosphate. (Antiviral Res. 2019 Nov, 171 : 104614).
- Therapeutic levels of ODE-Bn-TFV and ODE-TFV were maintained to 105 days following 3 monthly IM doses at 0, 30 and 60 days. Rats received maximal (volume) doses of 100 microliters. Since their weight doubled during treatment, the second and third doses were only 62 mg/kg. Even with the lower 2 nd and 3 rd doses, therapeutic levels of drug were maintained for 105 days. Therapeutic levels of the ODE- TFV metabolite persisted for 105 days.
- FIG. 10 shows the levels of ODE-Bn-TFV (circles) and ODE-TFV (squares).
- EC90 values are shown in triangles to indicate when the plasma drug levels pass below the 90% effective level.
- intramuscular ODE-Bn-TFV in formulation F3 provided 30 to 34 days above the EC90 values for both ODE-Bn-TFV and its active metabolite, ODE-TFV.
- FIG. 10 depicts plasma levels of ODE-Bn-TFV and ODE-TFV in beagle dogs treated with 100 mg/kg with ODE-Bn-TFV in formulation F3.
- Non- limiting examples of effective antiviral prodrugs of the remdesivir nucleoside monophosphate may be selected from the structures shown below:
- Antiviral Compounds and Formulations for Intramuscular Treatment of Human immunodeficiency infections For use in long-acting intramuscular treatment of infection with the human immunodeficiency virus, the antiviral compounds suitable for use are described in US Patent 8,835,630. These compounds may be used in formulations F3 or F4.
- Non-limiting examples that may be used in the formulations described herein include the following compounds:
- FIG. 11A and FIG. 11B depict the TFVpp persistence in HFF cells of ODE-TFV
- FIG. 11A Injection-Et-TFV (FIG. 11B).
- ODE-Bn-TFV oil-based formulations for ODE-Bn-TFV were prepared. The accelerated stability of 20 mg/mL formulations was determined. API loadings were assessed.
- formulations of ODE-Bn-TFV for IM usage (20 mg/mL formulations) were prepared, and included the components of the following table (w/w%):
- a 42 days pharmacokinetic study of formulations 3, 4, 7, and 8 of this example in rats was conducted.
- 100, 30, and 10 mg/kg of each formulation was administered by intramuscular (IM) injection to male Sprague Dawley rates (100 microliters).
- Blood was taken at 0.25, 1, 2, 7, 14, 21, 28, 35, and 42 days after injection, and plasma levels of ODE-Bn-TFV and ODE-TFV were determined.
- the rats were subjected to twice weekly clinical observations, and weights were collected.
- FIG. 12A and FIG. 12B depict plasma concentrations of formulation F3V containing ODE-Bn-TFV (FIG. 12A) and ODE-TFV (FIG. 12B) (ODE-Bn-TFV ED90 10.9 ng/mL; ODE-TFV ED90 6.3 nm/mL).
- FIG. 12C and FIG. 12D depict plasma concentrations of formulation F4V containing ODE-Bn-TFV (FIG. 12C) and ODE-TFV (FIG. 12D).
- FIG. 12E and FIG. 12F depict plasma concentrations of formulation F7V containing ODE-Bn-TFV (FIG. 12E) and ODE-TFV (FIG. 12F).
- FIG. 12G and FIG. 12H depict plasma concentrations of formulation F8V containing ODE-Bn-TFV (FIG. 12G) and ODE-TFV (FIG. 12H).
- FIG. 121 depicts mean plasma concentrations of formulations F3V, F4V, F7V, and F8V.
- API pharmacokinetic parameters of this example are provided at the following table:
- Formulations F3 and F4 of this example released, for example, 69 and 79 % of the lead compound in the first 14 days, but this release profile may be modified as described herein.
- formulation F3 a 3 month study was conducted in rats with monthly IM injections of 100 microliters, and measuring plasma drug levels and PBMC levels of TFVpp.
- 105 Days Pharmacokinetic Study (Monthly IM Injections of F3 in Rats): 100 microliters of the API of formulation 3 was administered monthly by IM injection to male Sprague Dawley rats. Due to the fact that the rats gained significant weight over the 105 day period, the actual dosages based on weigth were as follows: 90, 62, and 60 mg/kg. Blood was collected at 15, 30, 45, 60, 75, 90, 98, and 105 days. Plasma levels of ODE-Bn- TFV and ODE-TFV were determined. PBMCs also were obtained at the foreoing days, and fmol/10 6 cells was determined.
- FIG. 13 depicts the nanograms/mL of ODE-Bn-TFV and ODE-TFV in plasma.
- FIG. 14 depicts TFV disphosphate in PBMCs.
- Example 13a Synthesis of 1-O-Octadecyl-2-O-(4-cyanobenzyl)-5 «-glyceryl- phospho-RVn (OD(4-CN-Bn)G-P-RVn)
- the phosphate (200 mg, 0.37 mmol) was coupled to RVn (GS-441524)-acetomde (132 mg, 0.40 mmol) using diisopropylcabodiimide (DIC, 100 mg, 0.80 mmol), N- methylimidazole (NMI, 98 mg, 1.2 mmol) in pyridine (10 mL) to yield ((3aR,4R,6R,6aR)- 6-(4-aminopyrrolo[2,l-f][l,2,4]triazin-7-yl)-6-cyano-2,2-dimethyltetrahydrofuro[3,4- d] [l,3]dioxol-4-yl)methyl ((R)-2-((4-cyanobenzyl)oxy)-3-(octadecyloxy)propyl) hydrogen phosphate (60 mg, 19 %, MS m/z [M-H]' 851.55) which was then treated with formic acid
- Example 13c Synthesis of l- ⁇ 9-Octadecyl-2-O-(2-cyanobenzyl)-5 , M-glyceryl- phospho-RVn (OD(2-CN-Bn)G-P-RVn)
- the phosphate (460 mg, 0.85 mmol) was coupled to RVn (GS-441524)-acetomde (280 mg, 0.85 mmol) using DIG (210 mg, 1.7 mmol), NMI (140 mg, 1.7 mmol) in dry pyridine (15 mL).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Epidemiology (AREA)
- Genetics & Genomics (AREA)
- Biotechnology (AREA)
- Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Virology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Saccharide Compounds (AREA)
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP23747606.4A EP4469061A4 (en) | 2022-01-26 | 2023-01-26 | ANTIVIRAL PRODRUGS, INTERMEDIATE- AND LONG-ACTING FORMULATIONS, AND METHODS |
| JP2024543104A JP2025508656A (ja) | 2022-01-26 | 2023-01-26 | 抗ウイルスプロドラッグ、中期及び長期作用型製剤、並びに方法 |
| CA3247143A CA3247143A1 (en) | 2022-01-26 | 2023-01-26 | Antiviral prodrugs, intermediate and long-acting formulations, and methods |
| AU2023213682A AU2023213682B2 (en) | 2022-01-26 | 2023-01-26 | Antiviral prodrugs, intermediate- and long-acting formulations and methods |
| CN202380016345.3A CN118591377A (zh) | 2022-01-26 | 2023-01-26 | 抗病毒前药、中效和长效制剂和方法 |
| US18/833,747 US12594292B2 (en) | 2022-01-26 | 2023-01-26 | Antiviral prodrugs, intermediate-and long-acting formulations and methods |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202263303376P | 2022-01-26 | 2022-01-26 | |
| US63/303,376 | 2022-01-26 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2023146974A2 true WO2023146974A2 (en) | 2023-08-03 |
| WO2023146974A3 WO2023146974A3 (en) | 2024-06-20 |
Family
ID=87472411
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2023/011639 Ceased WO2023146974A2 (en) | 2022-01-26 | 2023-01-26 | Antiviral prodrugs, intermediate- and long-acting formulations and methods |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US12594292B2 (enExample) |
| EP (1) | EP4469061A4 (enExample) |
| JP (1) | JP2025508656A (enExample) |
| CN (1) | CN118591377A (enExample) |
| AU (1) | AU2023213682B2 (enExample) |
| CA (1) | CA3247143A1 (enExample) |
| WO (1) | WO2023146974A2 (enExample) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12173029B2 (en) | 2020-07-24 | 2024-12-24 | The Regents Of The University Of California | Antiviral prodrugs, pharmaceutical formulations, and methods |
| WO2025031248A1 (zh) * | 2023-08-04 | 2025-02-13 | 杭州居维叶生物医药有限公司 | 一种聚乙二醇化磷酸前药及其制备与应用 |
| US12594292B2 (en) | 2022-01-26 | 2026-04-07 | The Regents Of The University Of California | Antiviral prodrugs, intermediate-and long-acting formulations and methods |
Family Cites Families (23)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE3529478A1 (de) | 1985-08-16 | 1987-02-19 | Boehringer Mannheim Gmbh | 7-desaza-2'desoxyguanosin-nukleotide, verfahren zu deren herstellung und deren verwendung zur nukleinsaeure-sequenzierung |
| US5484908A (en) | 1991-11-26 | 1996-01-16 | Gilead Sciences, Inc. | Oligonucleotides containing 5-propynyl pyrimidines |
| TW393513B (en) | 1991-11-26 | 2000-06-11 | Isis Pharmaceuticals Inc | Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines |
| AU3222793A (en) | 1991-11-26 | 1993-06-28 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines |
| DE60025172T2 (de) | 1999-03-18 | 2006-09-21 | Exiqon A/S | Einstufige probezubereitung und bestimmung von nukleinsäure in biologischen proben |
| DE60029314T2 (de) | 1999-03-24 | 2007-07-12 | Exiqon A/S | Verbesserte Synthese für -2.2.1. I Bicyclo-Nukleoside |
| US6734291B2 (en) | 1999-03-24 | 2004-05-11 | Exiqon A/S | Synthesis of [2.2.1]bicyclo nucleosides |
| EP2558466A4 (en) * | 2010-04-14 | 2013-11-13 | Univ California | PHOSPHONATES WITH REDUCED TOXICITY FOR THE TREATMENT OF VIRUS INFECTIONS |
| SG10201800188SA (en) | 2013-03-15 | 2018-02-27 | Univ California | Acyclic nucleoside phosphonate diesters |
| LT3043803T (lt) * | 2013-09-11 | 2022-08-10 | Emory University | Nukleotidų ir nukleozidų kompozicijos ir jų panaudojimas |
| CN111808136B (zh) | 2014-09-15 | 2024-06-11 | 加利福尼亚大学董事会 | 核苷酸类似物 |
| TWI687432B (zh) | 2014-10-29 | 2020-03-11 | 美商基利科學股份有限公司 | 絲狀病毒科病毒感染之治療 |
| EP3350191B9 (en) | 2015-09-15 | 2021-12-22 | The Regents of the University of California | Nucleotide analogs |
| US10874683B2 (en) | 2016-03-10 | 2020-12-29 | Emory University | N4-hydroxycytidine and derivatives and anti-viral uses related thereto |
| CA3075950A1 (en) | 2017-09-18 | 2019-03-21 | Janssen Biopharma, Inc. | Substituted nucleosides, nucleotides and analogs thereof |
| TWI791193B (zh) * | 2020-02-18 | 2023-02-01 | 美商基利科學股份有限公司 | 抗病毒化合物 |
| WO2021222535A1 (en) | 2020-05-01 | 2021-11-04 | Irazu Bio | Method for treating respiratory viral infections comprising administration of fatty acid compositions |
| US12173029B2 (en) | 2020-07-24 | 2024-12-24 | The Regents Of The University Of California | Antiviral prodrugs, pharmaceutical formulations, and methods |
| IL300412A (en) | 2020-08-24 | 2023-04-01 | Gilead Sciences Inc | Phospholipid compounds and their uses |
| TW202344257A (zh) * | 2020-10-16 | 2023-11-16 | 美商基利科學股份有限公司 | 磷脂化合物及其用途 |
| TW202317144A (zh) | 2021-06-14 | 2023-05-01 | 美商維納拓爾斯製藥公司 | 口服生物可利用的核苷類似物 |
| CA3247143A1 (en) | 2022-01-26 | 2023-08-03 | The Regents Of The University Of California | Antiviral prodrugs, intermediate and long-acting formulations, and methods |
| WO2024159117A1 (en) | 2023-01-26 | 2024-08-02 | The Regents Of The University Of California | Antiviral prodrugs, intermediate-and long-acting formulations, and methods |
-
2023
- 2023-01-26 CA CA3247143A patent/CA3247143A1/en active Pending
- 2023-01-26 US US18/833,747 patent/US12594292B2/en active Active
- 2023-01-26 EP EP23747606.4A patent/EP4469061A4/en active Pending
- 2023-01-26 WO PCT/US2023/011639 patent/WO2023146974A2/en not_active Ceased
- 2023-01-26 CN CN202380016345.3A patent/CN118591377A/zh active Pending
- 2023-01-26 JP JP2024543104A patent/JP2025508656A/ja active Pending
- 2023-01-26 AU AU2023213682A patent/AU2023213682B2/en active Active
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12173029B2 (en) | 2020-07-24 | 2024-12-24 | The Regents Of The University Of California | Antiviral prodrugs, pharmaceutical formulations, and methods |
| US12594292B2 (en) | 2022-01-26 | 2026-04-07 | The Regents Of The University Of California | Antiviral prodrugs, intermediate-and long-acting formulations and methods |
| WO2025031248A1 (zh) * | 2023-08-04 | 2025-02-13 | 杭州居维叶生物医药有限公司 | 一种聚乙二醇化磷酸前药及其制备与应用 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4469061A4 (en) | 2025-10-08 |
| AU2023213682A1 (en) | 2024-07-25 |
| WO2023146974A3 (en) | 2024-06-20 |
| JP2025508656A (ja) | 2025-04-10 |
| CA3247143A1 (en) | 2023-08-03 |
| CN118591377A (zh) | 2024-09-03 |
| US20250177428A1 (en) | 2025-06-05 |
| EP4469061A2 (en) | 2024-12-04 |
| US12594292B2 (en) | 2026-04-07 |
| AU2023213682B2 (en) | 2026-02-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP7794798B2 (ja) | 抗ウイルスプロドラッグ、医薬製剤、及び方法 | |
| AU2023213682B2 (en) | Antiviral prodrugs, intermediate- and long-acting formulations and methods | |
| AU2016304899B2 (en) | Cyclic di-nucleotide compounds as sting agonists | |
| TWI774697B (zh) | 環二核苷酸化合物 | |
| WO2024159117A1 (en) | Antiviral prodrugs, intermediate-and long-acting formulations, and methods | |
| CN102939291B (zh) | 用于病毒感染治疗的具有降低的毒性的膦酸酯 | |
| AU2021330835B2 (en) | Phospholipid compounds and uses thereof | |
| Chang et al. | Discovery of PSI-353661, a novel purine nucleotide prodrug for the treatment of HCV infection | |
| NO342571B1 (no) | Fosfonatanaloger til HIV-inhibitorsammensetninger | |
| AU2014217892B2 (en) | Design of short oligonucleotides as vaccine adjuvants and therapeutic agents | |
| KR20230088432A (ko) | 인지질 화합물 및 이의 용도 | |
| US20240092819A1 (en) | Novel ligands for asialoglycoprotein receptor | |
| AU2013349750A1 (en) | Phosphonucleosides useful in the treatment of viral disorders | |
| Piperno et al. | Synthesis of C-4′ truncated phosphonated carbocyclic 2′-oxa-3′-azanucleosides as antiviral agents | |
| EP3505527A1 (en) | Cyclic dinucleotides for cytokine induction | |
| Passow et al. | A chemical strategy for intracellular arming of an endogenous broad-Spectrum antiviral nucleotide | |
| Singh et al. | Prodrug Strategies for the Development of β-l-5-((E)-2-Bromovinyl)-1-((2 S, 4 S)-2-(hydroxymethyl)-1, 3-(dioxolane-4-yl)) uracil (l-BHDU) against Varicella Zoster Virus (VZV) | |
| WO2005023270A2 (en) | Compositions and methods for use of antiviral drugs in the treatment of retroviral diseases resistant to nucleoside reverse transcriptase inhibitors | |
| AU2022328698B2 (en) | Phospholipid compounds and methods of making and using the same | |
| KR102914688B1 (ko) | L-bhdu의 전구약물 및 바이러스 감염을 치료하는 방법 | |
| Jia et al. | Antiviral activity of lipophilic nucleoside tetraphosphate compounds | |
| EP3548087A1 (en) | Nucleoside triphosphate and nucleoside triphosphate analogue prodrugs | |
| EA051236B1 (ru) | Пролекарства l-bhdu и способы лечения вирусных инфекций |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23747606 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202380016345.3 Country of ref document: CN Ref document number: AU2023213682 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2024543104 Country of ref document: JP |
|
| ENP | Entry into the national phase |
Ref document number: 2023213682 Country of ref document: AU Date of ref document: 20230126 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 18833747 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112024015223 Country of ref document: BR |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2023747606 Country of ref document: EP Effective date: 20240826 |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 23747606 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 112024015223 Country of ref document: BR Kind code of ref document: A2 Effective date: 20240725 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11202501574R Country of ref document: SG |
|
| WWP | Wipo information: published in national office |
Ref document number: 11202501574R Country of ref document: SG |
|
| WWP | Wipo information: published in national office |
Ref document number: 18833747 Country of ref document: US |
|
| WWG | Wipo information: grant in national office |
Ref document number: 18833747 Country of ref document: US |