WO2023125889A1 - Quadrivalent mrna vaccines for influenza viruses - Google Patents

Quadrivalent mrna vaccines for influenza viruses Download PDF

Info

Publication number
WO2023125889A1
WO2023125889A1 PCT/CN2022/143721 CN2022143721W WO2023125889A1 WO 2023125889 A1 WO2023125889 A1 WO 2023125889A1 CN 2022143721 W CN2022143721 W CN 2022143721W WO 2023125889 A1 WO2023125889 A1 WO 2023125889A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
naturally occurring
acid molecule
occurring nucleic
subject
Prior art date
Application number
PCT/CN2022/143721
Other languages
French (fr)
Inventor
Xishan LU
Zhuofan LI
Haifeng Song
Bo YING
Original Assignee
Suzhou Abogen Biosciences Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Suzhou Abogen Biosciences Co., Ltd. filed Critical Suzhou Abogen Biosciences Co., Ltd.
Priority to CN202280007166.9A priority Critical patent/CN116670267A/en
Publication of WO2023125889A1 publication Critical patent/WO2023125889A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53—DNA (RNA) vaccination
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/572—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 cytotoxic response
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
    • A61K2039/575—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 humoral response
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16211—Influenzavirus B, i.e. influenza B virus
    • C12N2760/16222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16211—Influenzavirus B, i.e. influenza B virus
    • C12N2760/16234—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the present disclosure generally relates to nucleic acid molecules that can be used for the management, prevention, and treatment of a disease or disorder caused by influenza viruses or by infection therewith.
  • the present disclosure also relates to lipid-containing compositions, including vaccines, of the nucleic acid molecules.
  • Influenza viruses belong to the family Orthomyxoviridae, and their genomes consist of segments of negative ⁇ sense RNA. 1 They are divided into A, B, C and D types, the latter of which was isolated from pigs exhibiting influenza ⁇ like symptoms in April 2011. 2 In humans, mainly the A and B types cause disease, and the A type causes more severe illness than the B type. 3, 4 Influenza A viruses are further categorized according to the antigenicity of their surface antigens, haemagglutinin (HA) and neuraminidase (NA) , and there are 18 HA and 11 NA serotypes. 5, 6 Influenza B viruses have diverged into only two antigenically distinguishable lineages, Victoria and Yamagata, since the 1970s. 3 Current influenza viruses circulating in humans are mainly A/H1N1 and A/H3N2 and the B/Victoria and B/Yamagata lineages. 7
  • Pandemics are usually more severe than annual epidemics and have previously claimed up to 50 million lives as during the H1N1 pandemic of 1918. 12 Pandemics also occurred in 1957 (H2N2, 'Asian flu' ) , 1968 (H3N2, 'Hong Kong flu' ) and2009 (H1N1, 's wine flu' ) . 13
  • Vaccination is considered the most effective method for controlling influenza. 14 Through continuous antigenic drift, that is, the accumulation of point mutations in the surface antigens, influenza viruses can escape immunity, 15 which is why yearly vaccination is required. Seasonal influenza vaccines have been steadily developed since the 1940s, and currently marketed preventive vaccines differ in type (whole, split, recombinant and subunit inactivated, and live-attenuated types) and the substrate used for production (embryonated eggs or cells) . 16
  • Quadrivalent inactivated influenza virus vaccines are most commonly administered to the public, but effectiveness of these vaccines lies in the range of 10%–60%due to a variety of factors, including poor immunogenicity and strain mismatches.
  • mRNA messenger RNA
  • in vitro-transcribed messenger RNA (mRNA) -based vaccines have shown promising efficacy against cancer and especially infectious diseases. For example, Moderna has finished a phase I study in 2019, which demonstrated both safety and robust immune responses to mRNA vaccines against H10N8 and H7N9 influenza viruses.
  • therapeutic nucleic acid molecules e.g., a set of at least four therapeutic nucleic acid molecules
  • pharmaceutical composition comprising the therapeutic nucleic acid molecules (e.g., a set of at least four therapeutic nucleic acid molecules) , including pharmaceutical composition formulated as lipid nanoparticles and related therapeutic methods and uses for preventing, managing and treating of a disease or disorder cause by influenza viruses or by infection with influenza viruses.
  • a mulitiple sets of four mRNA molecules i.e., the quadrivalent mRNA vaccines
  • the quadrivalent mRNA vaccines have been shown to induce higher IgG and HAI antibody titer responses, as well as a stronger cellular immune response than the inactivated vaccine.
  • the quadrivalent vaccine has shown a strong potency comparable to the individual monovalent vaccine.
  • non-naturally occurring nucleic acid molecules e.g., a set of at least four non-naturally occurring nucleic acid molecules, that can be used for the prevention, management and treatment of a disease or disorder cause by influenza viruses or by infection with influenza viruses.
  • the non-naturally occurring nucleic acid molecule comprises a coding nucleotide sequence encoding the HA protein of an influenza virus (e.g., A/H1N1, A/H3N2, B/Victoria, or B/Yamagata) , or an immunogenic fragment thereof.
  • an influenza virus e.g., A/H1N1, A/H3N2, B/Victoria, or B/Yamagata
  • the set of at least four non-naturally occurring nucleic acid molecules comprise: (1) a first non-naturally occurring nucleic acid molecule comprising a first coding nucleotide sequence encoding a first HA protein of an influenza virus of A/H1N1, or an immunogenic fragment thereof; (2) a second non-naturally occurring nucleic acid molecule comprising a second coding nucleotide sequence encoding a second HA protein of an influenza virus of A/H3N2, or an immunogenic fragment thereof; (3) a third non-naturally occurring nucleic acid molecule comprising a third coding nucleotide sequence encoding a third HA protein of an influenza virus of B/Victoria, or an immunogenic fragment thereof; and (4) a fourth non-naturally occurring nucleic acid molecule comprising a fourth coding nucleotide sequence encoding a fourth HA protein of an influenza virus of B/Yamagata, or an immunogenic fragment thereof.
  • the HA protein consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, 2, 3, or 4.
  • the first HA protein consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 1.
  • the first HA protein consists of, essentially consists of or comprises the amino acid sequence set forth in SEQ ID NO: 1.
  • the second HA protein consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 64.
  • the second HA protein consists of, essentially consists of or comprises the amino acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 64.
  • the third HA protein consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 3 or 65. In some embodiments, the third HA protein consists of, essentially consists of or comprises the amino acid sequence set forth in SEQ ID NO: 3 or 65.
  • the fourth HA protein consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 4. In some embodiments, the fourth HA protein consists of, essentially consists of or comprises the amino acid sequence set forth in SEQ ID NO: 4.
  • the coding nucleotide sequence consists of, essentially consists of or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 5, 6, 7, or 8.
  • the first coding nucleotide sequence consists of, essentially consists of or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 5.
  • the first coding nucleotide sequence consists of, essentially consists of or comprises the nucleotide sequence set forth in SEQ ID NO: 5.
  • the second coding nucleotide sequence consists of, essentially consists of or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 6 or 66.
  • the second coding nucleotide sequence consists of, essentially consists of or comprises the nucleotide sequence set forth in SEQ ID NO: 6 or 66.
  • the third coding nucleotide sequence consists of, essentially consists of or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 7 or 67.
  • the third coding nucleotide sequence consists of, essentially consists of or comprises the nucleotide sequence set forth in SEQ ID NO: 7 or 67.
  • the fourth coding nucleotide sequence consists of, essentially consists of or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 8.
  • the fourth coding nucleotide sequence consists of, essentially consists of or comprises the nucleotide sequence set forth in SEQ ID NO: 8.
  • the coding nucleotide sequence has been codon optimized for expression in cells of a subject.
  • the subject is a non-human mammal. In some embodiments, the subject is a human. In some embodiments, the HA protein or immunogenic fragment is fused to the native signal peptide. In some embodiments, the first HA protein or immunogenic fragment is fused to the first signal peptide. In some embodiments, the second HA protein or immunogenic fragment is fused to the second signal peptide. In some embodiments, the third HA protein or immunogenic fragment is fused to the third signal peptide. In some embodiments, the fourth HA protein or immunogenic fragment is fused to the fourth signal peptide.
  • the sigal peptide consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 9, 10, or 11.
  • the first sigal peptide consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 9.
  • the second sigal peptide consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 10.
  • the third sigal peptide consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 11.
  • the fourth sigal peptide consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 11.
  • the sigal peptide is encoded by a coding nucleotide sequence consisting of, essentially consisting of or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 12, 13, or 14.
  • the first sigal peptide is encoded by a coding nucleotide sequence consisting of, essentially consisting of or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 12.
  • the second sigal peptide is encoded by a coding nucleotide sequence consisting of, essentially consisting of or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 13.
  • the third sigal peptide is encoded by a coding nucleotide sequence consisting of, essentially consisting of or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 14.
  • the fourth sigal peptide is encoded by a coding nucleotide sequence consisting of, essentially consisting of or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 14.
  • the HA protein or immunogenic fragment is fused to a heterologous polypeptide.
  • the heterologous polypeptide is selected from a Fc region of human immunoglobulin, a signal peptide, and a peptide facilitating multimerization of the fusion protein.
  • the signal peptide is a signal peptide from IgE or tPA.
  • the sigal peptide consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 15.
  • the sigal peptide is encoded by a coding nucleotide sequence consisting of, essentially consisting of or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 16.
  • the sigal peptide consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 17.
  • the sigal peptide is encoded by a coding nucleotide sequence consisting of, essentially consisting of or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 18.
  • the multimerization is dimerization or trimerization.
  • the non-naturally occurring nucleic acid further comprises a 5’ untranslated region (5’-UTR) , wherein the 5’-UTR comprises the sequence set forth in any one of SEQ ID NOS: 19-26.
  • the non-naturally occurring nucleic acid further comprises a 3’ untranslated region (3’-UTR) , wherein the 3’-UTR comprises the sequence set forth in any one of SEQ ID NOS: 27-34.
  • the 3’-UTR further comprises a poly-A tail or a polyadenylation signal.
  • the non-naturally occurring nucleic acid comprises one or more functional nucleotide analogs that are selected from pseudouridine (psd) , 1-methyl-pseudouridine (m1) and 5-methylcytosine.
  • the nucleic acid is DNA or mRNA.
  • vectors or cells comprising the non-naturally occurring nucleic acid molecule or the set of at least four non-naturally occurring nucleic acid molecules (e.g., in a molar ratio of 1: 1: 1: 1) as described herein.
  • compositions comprising the non-naturally occurring nucleic acid molecule or the set of at least four non-naturally occurring nucleic acid molecules (e.g., in a molar ratio of 1: 1: 1: 1) as described herein.
  • the composition further comprises at least one lipid described herein. In some embodiments of the composition described herein, the composition further comprises at least a first lipid (e.g., a cationic lipid) described herein and optionally a second lipid (e.g., a polymer lipid) described herein.
  • a first lipid e.g., a cationic lipid
  • a second lipid e.g., a polymer lipid
  • the first lipid is a compound according to Formula (01-I) or (01-II) ; or a compound listed in Table 6; or a compound according to Formula (03-I) ; or a compound listed in Table 7; or a compound according to Formula (04-I) ; or a compound listed in Table 8.
  • the composition is formulated as lipid nanoparticles encapsulating the nucleic acid in a lipid shell.
  • the composition is a pharmaceutical composition.
  • the composition is a vaccine.
  • provided herein are methods for managing, preventing or treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject, comprising administering to the subject a therapeutically effective amount of the non-naturally occurring nucleic acid or the set of at least four non-naturally occurring nucleic acid molecules (e.g., in a molar ratio of 1: 1: 1: 1) as described herein, or a therapeutically effective amount of the pharmaceutical composition as described herein.
  • the subject is a human or a non-human mammal. In some embodiments, the subject is a human adult, a human child or a human toddler. In some embodiments, the subject has the disease or disorder. In some embodiments, the subject is at risk of, or is susceptible to, infection by influenza viruses. In some embodiments, the subject is an elderly human. In some embodiments, subject has been diagnosed positive for infection by influenza viruses. In some embodiments, the subject is asymptomatic.
  • the method comprises administering lipid nanoparticles encapsulating the nucleic acids to the subject, and wherein the lipid nanoparticles are endocytosed by the cells in the subject.
  • the nucleic acids are expressed by the cells in the subject.
  • an immune response against influenza viruses is elicited in the subject.
  • the immune response comprises production of cytokine in lymphocytes.
  • the immune response comprises increased proportion of cytokine-expressing lymphocytes.
  • the lymphocytes are CD4 + T cells and/or CD8 + T cells and/or splenocytes.
  • the cytokine is one or more of IFN- ⁇ , TNF- ⁇ , IL-2, and IL-4.
  • the production of cytokines in lymphocytes is increased.
  • the immune response comprises production of an antibody (e.g., one or more of pan-IgG, IgG1, and IgG2a) specifically binds to the viral HA proteins encoded by the nucleic acids.
  • the antibody is a neutralizing antibody against influenza viruses or cells infected by influenza viruses.
  • the serum titer of the antibody is increased in the subject.
  • antibody binds to a viral particle or an infected cell and mark the viral particle of infected cell for destruction by the immune system of the subject.
  • endocytosis of viral particles bound by the antibody is induced or enhanced.
  • antibody-dependent cell-mediated cytotoxicity (ADCC) against infected cells in the subject is induced or enhanced.
  • antibody-dependent cellular phagocytosis (ADCP) against infected cells in the subject is induced or enhanced.
  • complement dependent cytotoxicity (CDC) against infected cells in the subject is induced or enhanced.
  • the disease or disorder caused by influenza viruses is flu.
  • Flu is a contagious respiratory illness, often infects the nose, throat, and sometimes the lungs. It can cause disease that ranges in severity from sub-clinical infection to primary viral pneumonia which can result in death.
  • the clinical effects of infection vary with the virulence of the influenza strain and the exposure, history, age, and immune status of the host.
  • non-naturally occurring nucleic acid or the set of at least four non-naturally occurring nucleic acid molecules e.g., in a molar ratio of 1: 1: 1: 1) as described herein, or a therapeutically effective amount of the pharmaceutical composition as described herein, for use in managing, preventing or treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject.
  • non-naturally occurring nucleic acid or the set of at least four non-naturally occurring nucleic acid molecules e.g., in a molar ratio of 1: 1: 1: 1) as described herein, or a therapeutically effective amount of the pharmaceutical composition as described herein, in the manufacture of a lipid nanoparticles encapsulating the nucleic acids or a vaccine for managing, preventing or treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject.
  • the subject is a human or a non-human mammal. In some embodiments, the subject is a human adult, a human child or a human toddler. In some embodiments, the subject has the disease or disorder. In some embodiments, the subject is at risk of, or is susceptible to, infection by influenza viruses. In some embodiments, the subject is an elderly human. In some embodiments, subject has been diagnosed positive for infection by influenza viruses. In some embodiments, the subject is asymptomatic.
  • the disease or disorder caused by influenza viruses is flu.
  • FIGs. 1-4 show cell surface expression of the HA protein by different mRNA constructs (shown by sequence identifiers) or negative control, as determined by FACS.
  • FIGs. 5A to 5G show serum HA-specific IgG production induced by vaccination with different mRNA vaccines (shown by sequence identifiers) or PBS.
  • FIGs. 6A to 6D show cytokine secretion induced by vaccination with different mRNA vaccines (shown by sequence identifiers) or PBS.
  • FIG. 7 shows serum IgG titer against H1N1 HA on Day 21 and Day 35 induced by vaccination with mRNA vaccine SEQ ID NO: 44 vs quadrivalent vaccine.
  • FIG. 8 shows serum IgG titer against H3N2 HA on Day 21 and Day 35 induced by vaccination with mRNA vaccine SEQ ID NO: 49 vs quadrivalent vaccine.
  • FIG. 9 shows serum IgG titer against B/Victoria HA on Day 21 and Day 35 induced by vaccination with mRNA vaccine SEQ ID NO: 50 vs quadrivalent vaccine.
  • FIG. 10 shows serum IgG titer against B/Yamagata HA on Day 21 and Day 35 induced by vaccination with mRNA vaccine SEQ ID NO: 61 vs quadrivalent vaccine.
  • FIG. 11 shows the secretion of IFN- ⁇ by T cells in the mouse vaccinated with the respective antigens (SEQ ID NO: 44 vs quadrivalent) or PBS.
  • FIG. 12 shows the secretion of IL-2 by T cells in the mouse vaccinated with the respective antigens (SEQ ID NO: 44 vs quadrivalent) or PBS.
  • FIG. 13 shows the secretion of IL-4 by T cells in the mouse vaccinated with the respective antigens (SEQ ID NO: 44 vs quadrivalent) or PBS.
  • FIG. 14 shows HAI titer against H1N1 virus induced by the respectice vaccines on Day 21 and Day 28.
  • FIG. 15 shows HAI titer against H3N2 virus induced by the respectice vaccines on Day 21 and Day 28.
  • FIG. 16 shows HAI titer against BV virus induced by the respectice vaccines on Day 21 and Day 28.
  • FIG. 17 shows HAI titer against BY virus induced by the respectice vaccines on Day 21 and Day 28.
  • FIG. 18 shows CD8+T cell cytokine release under stimulation of H1N1 peptide pool
  • FIG. 19 shows CD4+T cell cytokine release under stimulation of H1N1 peptide pool
  • therapeutic nucleic acid molecules e.g., a set of at least four therapeutic nucleic acid molecules
  • pharmaceutical composition comprising the therapeutic nucleic acid molecules (e.g., a set of at least four therapeutic nucleic acid molecules) , including pharmaceutical composition formulated as lipid nanoparticles and related therapeutic methods and uses for preventing, managing and treating of a disease or disorder cause by influenza viruses or by infection with influenza viruses. Additional features of the present disclosure will become apparent to those skilled in the art upon consideration of the following detailed description of particular embodiments.
  • lipid refers to a group of organic compounds that include, but are not limited to, esters of fatty acids and are generally characterized by being poorly soluble in water, but soluble in many nonpolar organic solvents. While lipids generally have poor solubility in water, there are certain categories of lipids (e.g., lipids modified by polar groups, e.g., DMG-PEG2000) that have limited aqueous solubility and can dissolve in water under certain conditions. Known types of lipids include biological molecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids.
  • lipids include biological molecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids.
  • Lipids can be divided into at least three classes: (1) “simple lipids, ” which include fats and oils as well as waxes; (2) “compound lipids, ” which include phospholipids and glycolipids (e.g., DMPE-PEG2000) ; and (3) “derived lipids” such as steroids. Further, as used herein, lipids also encompass lipidoid compounds.
  • the term “lipidoid compound, ” also simply “lipidoid” refers to a lipid-like compound (e.g. an amphiphilic compound with lipid-like physical properties) .
  • lipid nanoparticle refers to a particle having at least one dimension on the order of nanometers (nm) (e.g., 1 to 1,000 nm) , which contains one or more types of lipid molecules.
  • the LNP provided herein can further contain at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules) .
  • the LNP comprises a non-lipid payload molecule either partially or completely encapsulated inside a lipid shell.
  • the payload is a negatively charged molecule (e.g., mRNA encoding a viral protein)
  • the lipid components of the LNP comprise at least one cationic lipid.
  • a LNP according to the present disclosure comprises one or more lipids of Formula (01-I) , (01-II) , (03-I) and (04-I) (and sub-formulas thereof) as described herein..
  • cationic lipid refers to a lipid that is either positively charged at any pH value or hydrogen ion activity of its environment, or capable of being positively charged in response to the pH value or hydrogen ion activity of its environment (e.g., the environment of its intended use) .
  • the term “cationic” encompasses both “permanently cationic” and “cationisable. ”
  • the positive charge in a cationic lipid results from the presence of a quaternary nitrogen atom.
  • the cationic lipid comprises a zwitterionic lipid that assumes a positive charge in the environment of its intended use (e.g., at physiological pH) .
  • the cationic lipid is one or more lipids of Formula (01-I) , (01-II) , (03-I) and (04-I) (and sub-formulas thereof) as described herein.
  • polymer conjugated lipid refers to a molecule comprising both a lipid portion and a polymer portion.
  • An example of a polymer conjugated lipid is a pegylated lipid (PEG-lipid) , in which the polymer portion comprises a polyethylene glycol.
  • neutral lipid encompasses any lipid molecules existing in uncharged forms or neutral zwitterionic forms at a selected pH value or within a selected pH range.
  • the selected useful pH value or range corresponds to the pH condition in an environment of the intended uses of the lipids, such as the physiological pH.
  • neutral lipids that can be used in connection with the present disclosure include, but are not limited to, phosphotidylcholines such as 1, 2-distearoyl-sn-glycero-3-phosphocholine (DSPC) , 1, 2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) , 1, 2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC) , 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) , 1, 2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) , phophatidylethanolamines such as 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) , 2- ( (2, 3-bis (oleoyloxy) propyl) dimethylammonio) ethyl hydrogen phosphate (DOPE) ,
  • charged lipid encompasses any lipid molecules that exist in either positively charged or negatively charged forms at a selected pH or within a selected pH range.
  • the selected pH value or range corresponds to the pH condition in an environment of the intended uses of the lipids, such as the physiological pH.
  • charged lipids that can be used in connection with the present disclosure include, but are not limited to, phosphatidylserines, phosphatidic acids, phosphatidylglycerols, phosphatidylinositols, sterol hemisuccinates, dialkyl trimethylarnmonium-propanes, (e.g., DOTAP, DOTMA) , dialkyl dimethylaminopropanes, ethyl phosphocholines, dimethylaminoethane carbamoyl sterols (e.g., DC-Chol) , 1, 2-dioleoyl-sn-glycero-3-phospho-L-serine sodium salt (DOPS-Na) , 1, 2-dioleoyl-sn-glycero-3-phospho- (1'-rac-glycerol) sodium salt (DOPG-Na) , and 1, 2-dioleoyl-sn-g
  • alkyl refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, which is saturated.
  • the alkyl group has, for example, from one to twenty-four carbon atoms (C 1 -C 24 alkyl) , four to twenty carbon atoms (C 4 -C 20 alkyl) , six to sixteen carbon atoms (C 6 -C 16 alkyl) , six to nine carbon atoms (C 6 -C 9 alkyl) , one to fifteen carbon atoms (C 1 -C 15 alkyl) , one to twelve carbon atoms (C 1 -C 12 alkyl) , one to eight carbon atoms (C 1 -C 8 alkyl) or one to six carbon atoms (C 1 -C 6 alkyl) and which is attached to the rest of the molecule by a single bond.
  • alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (isopropyl) , n-butyl, n-pentyl, 1, 1-dimethylethyl (t-butyl) , 3-methylhexyl, 2-methylhexyl, and the like. Unless otherwise specified, an alkyl group is optionally substituted.
  • alkenyl refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, which contains one or more carbon-carbon double bonds.
  • alkenyl also embraces radicals having “cis” and “trans” configurations, or alternatively, “E” and “Z” configurations, as appreciated by those of ordinary skill in the art.
  • the alkenyl group has, , for example, from two to twenty-four carbon atoms (C 2 -C 24 alkenyl) , four to twenty carbon atoms (C 4 -C 20 alkenyl) , six to sixteen carbon atoms (C 6 -C 16 alkenyl) , six to nine carbon atoms (C 6 -C 9 alkenyl) , two to fifteen carbon atoms (C 2 -C 15 alkenyl) , two to twelve carbon atoms (C 2 - C 12 alkenyl) , two to eight carbon atoms (C 2 -C 8 alkenyl) or two to six carbon atoms (C 2 -C 6 alkenyl) and which is attached to the rest of the molecule by a single bond.
  • alkenyl groups include, but are not limited to, ethenyl, prop-1-enyl, but-1-enyl, pent-1-enyl, penta-1, 4-dienyl, and the like. Unless otherwise specified, an alkenyl group is optionally substituted.
  • alkynyl refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, which contains one or more carbon-carbon triple bonds.
  • the alkynyl group has, for example, from two to twenty-four carbon atoms (C 2 -C 24 alkynyl) , four to twenty carbon atoms (C 4 -C 20 alkynyl) , six to sixteen carbon atoms (C 6 -C 16 alkynyl) , six to nine carbon atoms (C 6 -C 9 alkynyl) , two to fifteen carbon atoms (C 2 -C 15 alkynyl) , two to twelve carbon atoms (C 2 -C 12 alkynyl) , two to eight carbon atoms (C 2 -C 8 alkynyl) or two to six carbon atoms (C 2 -C 6 alkynyl) and which is attached to the
  • alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, and the like. Unless otherwise specified, an alkynyl group is optionally substituted.
  • alkylene or “alkylene chain” refers to a straight or branched divalent hydrocarbon chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen, which is saturated.
  • the alkylene has, for example, from one to twenty-four carbon atoms (C 1 -C 24 alkylene) , one to fifteen carbon atoms (C 1 -C 15 alkylene) , one to twelve carbon atoms (C 1 -C 12 alkylene) , one to eight carbon atoms (C 1 -C 8 alkylene) , one to six carbon atoms (C 1 -C 6 alkylene) , two to four carbon atoms (C 2 -C 4 alkylene) , one to two carbon atoms (C 1 -C 2 alkylene) .
  • alkylene groups include, but are not limited to, methylene, ethylene, propylene, n-butylene, and the like.
  • the alkylene chain is attached to the rest of the molecule through a single bond and to the radical group through a single bond.
  • the points of attachment of the alkylene chain to the rest of the molecule and to the radical group can be through one carbon or any two carbons within the chain. Unless otherwise specified, an alkylene chain is optionally substituted.
  • alkenylene refers to a straight or branched divalent hydrocarbon chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen, which contains one or more carbon-carbon double bonds.
  • the alkenylene has, for example, from two to twenty-four carbon atoms (C 2 -C 24 alkenylene) , two to fifteen carbon atoms (C 2 -C 15 alkenylene) , two to twelve carbon atoms (C 2 -C 12 alkenylene) , two to eight carbon atoms (C 2 -C 8 alkenylene) , two to six carbon atoms (C 2 -C 6 alkenylene) or two to four carbon atoms (C 2 -C 4 alkenylene) .
  • alkenylene include, but are not limited to, ethenylene, propenylene, n-butenylene, and the like.
  • the alkenylene is attached to the rest of the molecule through a single or double bond and to the radical group through a single or double bond.
  • the points of attachment of the alkenylene to the rest of the molecule and to the radical group can be through one carbon or any two carbons within the chain. Unless otherwise specified, an alkenylene is optionally substituted.
  • cycloalkyl refers to a non-aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms, and which is saturated. Cycloalkyl group may include fused or bridged ring systems. In one embodiment, the cycloalkyl has, for example, from 3 to 15 ring carbon atoms (C 3 -C 15 cycloalkyl) , from 3 to 10 ring carbon atoms (C 3 -C 10 cycloalkyl) , or from 3 to 8 ring carbon atoms (C 3 -C 8 cycloalkyl) .
  • the cycloalkyl is attached to the rest of the molecule by a single bond.
  • Examples of monocyclic cycloalkyl radicals include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl.
  • Examples of polycyclic cycloalkyl radicals include, but are not limited to, adamantyl, norbornyl, decalinyl, 7, 7-dimethyl-bicyclo [2.2.1] heptanyl, and the like. Unless otherwise specified, a cycloalkyl group is optionally substituted.
  • cycloalkylene is a divalent cycloalkyl group. Unless otherwise specified, a cycloalkylene group isoptionally substituted.
  • cycloalkenyl refers to a non-aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms, and which includes one or more carbon-carbon double bonds. Cycloalkenyl may include fused or bridged ring systems. In one embodiment, the cycloalkenyl has, for example, from 3 to 15 ring carbon atoms (C 3 -C 15 cycloalkenyl) , from 3 to 10 ring carbon atoms (C 3 -C 10 cycloalkenyl) , or from 3 to 8 ring carbon atoms (C 3 -C 8 cycloalkenyl) .
  • the cycloalkenyl is attached to the rest of the molecule by a single bond.
  • monocyclic cycloalkenyl radicals include, but are not limited to, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, and the like. Unless otherwise specified, a cycloalkenyl group is optionally substituted.
  • cycloalkenylene is a divalent cycloalkenyl group. Unless otherwise specified, a cycloalkenylene group is optionally substituted.
  • heterocyclyl refers to a non-aromatic radical monocyclic or polycyclic moiety that contains one or more (e.g., one, one or two, one to three, or one to four) heteroatoms independently selected from nitrogen, oxygen, phosphorous, and sulfur.
  • the heterocyclyl may be attached to the main structure at any heteroatom or carbon atom.
  • a heterocyclyl group can be a monocyclic, bicyclic, tricyclic, tetracyclic, or other polycyclic ring system, wherein the polycyclic ring systems can be a fused, bridged or spiro ring system.
  • Heterocyclyl polycyclic ring systems can include one or more heteroatoms in one or more rings.
  • a heterocyclyl group can be saturated or partially unsaturated.
  • Saturated heterocycloalkyl groups can be termed “heterocycloalkyl” .
  • Partially unsaturated heterocycloalkyl groups can be termed “heterocycloalkenyl” if the heterocyclyl contains at least one double bond, or “heterocycloalkynyl” if the heterocyclyl contains at least one triple bond.
  • the heterocyclyl has, for example, 3 to 18 ring atoms (3-to 18-membered heterocyclyl) , 4 to 18 ring atoms (4-to 18-membered heterocyclyl) , 5 to 18 ring atoms (3-to 18-membered heterocyclyl) , 4 to 8 ring atoms (4-to 8-membered heterocyclyl) , or 5 to 8 ring atoms (5-to 8-membered heterocyclyl) .
  • a numerical range such as “3 to 18” refers to each integer in the given range; e.g., “3 to 18 ring atoms” means that the heterocyclyl group can consist of 3 ring atoms, 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, 8 ring atoms, 9 ring atoms, 10 ring atoms, etc., up to and including 18 ring atoms.
  • heterocyclyl groups include, but are not limited to, imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl. Unless otherwise specified, a heterocyclyl group is optionally substituted.
  • heterocyclylene is a divalent heterocyclyl group. Unless otherwise specified, a heterocyclylene group is optionally substituted
  • aryl refers to a monocyclic aromatic group and/or multicyclic monovalent aromatic group that contain at least one aromatic hydrocarbon ring.
  • the aryl has from 6 to 18 ring carbon atoms (C 6 -C 18 aryl) , from 6 to 14 ring carbon atoms (C 6 -C 14 aryl) , or from 6 to 10 ring carbon atoms (C 6 -C 10 aryl) .
  • aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulenyl, anthryl, phenanthryl, pyrenyl, biphenyl, and terphenyl.
  • aryl also refers to bicyclic, tricyclic, or other multicyclic hydrocarbon rings, where at least one of the rings is aromatic and the others of which may be saturated, partially unsaturated, or aromatic, for example, dihydronaphthyl, indenyl, indanyl, or tetrahydronaphthyl (tetralinyl) . Unless otherwise specified, an aryl group is optionally substituted.
  • arylene is a divalent aryl group. Unless otherwise specified, an arylene group is optionally substituted.
  • heteroaryl refers to a monocyclic aromatic group and/or multicyclic aromatic group that contains at least one aromatic ring, wherein at least one aromatic ring contains one or more (e.g., one, one or two, one to three, or one to four) heteroatoms independently selected from O, S, and N.
  • the heteroaryl may be attached to the main structure at any heteroatom or carbon atom. In certain embodiments, the heteroaryl has from 5 to 20, from 5 to 15, or from 5 to 10 ring atoms.
  • heteroaryl also refers to bicyclic, tricyclic, or other multicyclic rings, where at least one of the rings is aromatic and the others of which may be saturated, partially unsaturated, or aromatic, wherein at least one aromatic ring contains one or more heteroatoms independently selected from O, S, and N.
  • Examples of monocyclic heteroaryl groups include, but are not limited to, pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furanyl, thienyl, oxadiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, and triazinyl.
  • bicyclic heteroaryl groups include, but are not limited to,indolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuranyl, isobenzofuranyl, chromonyl, coumarinyl, cinnolinyl, quinoxalinyl, indazolyl, purinyl, pyrrolopyridinyl, furopyridinyl, thienopyridinyl, dihydroisoindolyl, and tetrahydroquinolinyl.
  • tricyclic heteroaryl groups include, but are not limited to, carbazolyl, benzindolyl, phenanthrollinyl, acridinyl, phenanthridinyl, and xanthenyl. Unless otherwise specified, aheteroaryl group is optionally substituted.
  • heteroarylene is a divalent heteroaryl group. Unless otherwise specified, a heteroarylene group is optionally substituted.
  • the substituent is a C 1 -C 12 alkyl group. In other embodiments, the substituent is a cycloalkyl group. In other embodiments, the substituent is a halo group, such as fluoro. In other embodiments, the substituent is an oxo group. In other embodiments, the substituent is a hydroxyl group. In other embodiments, the substituent is an alkoxy group (-OR’) . In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amino group (-NR’R’) .
  • optionally substituted means that the subsequently described event of circumstances may or may not occur, and that the description includes instances where said event or circumstance occurs and instances in which it does not.
  • optionally substituted alkyl means that the alkyl radical may or may not be substituted and that the description includes both substituted alkyl radicals and alkyl radicals having no substitution.
  • prodrug of a biologically active compound refers to a compound that may be converted under physiological conditions or by solvolysis to the biologically active compound.
  • prodrug refers to a metabolic precursor of the biologically active compound that is pharmaceutically acceptable.
  • a prodrug may be inactive when administered to a subject in need thereof, but is converted in vivo to the biologically active compound.
  • Prodrugs are typically rapidly transformed in vivo to yield the parent biologically active compound, for example, by hydrolysis in blood.
  • the prodrug compound often offers advantages of solubility, tissue compatibility or delayed release in a mammalian organism (see, Bundgard, H., Design of Prodrugs (1985) , pp.
  • prodrugs are provided in Higuchi, T., et al., A.C.S. Symposium Series, Vol. 14, and in Bioreversible Carriers in Drug Design, Ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.
  • prodrug is also meant to include any covalently bonded carriers, which release the active compound in vivo when such prodrug is administered to a mammalian subject.
  • Prodrugs of a compound may be prepared by modifying functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compound.
  • Prodrugs include compounds wherein a hydroxyl, amino or mercapto group is bonded to any group that, when the prodrug of the compound is administered to a mammalian subject, cleaves to form a free hydroxyl, free amino or free mercapto group, respectively.
  • prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohol or amide derivatives of amine functional groups in the compounds provided herein.
  • the term “pharmaceutically acceptable salt” includes both acid and base addition salts.
  • Examples of pharmaceutically acceptable acid addition salts include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, and organic acids such as, but not limited to, acetic acid, 2, 2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfuric acid, ethane-1, 2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glu
  • Examples of pharmaceutically acceptable base addition salt include, but are not limited to, salts prepared from addition of an inorganic base or an organic base to a free acid compound.
  • Salts derived from inorganic bases include, but are not limited to, the sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like.
  • the inorganic salts are the ammonium, sodium, potassium, calcium, and magnesium salts.
  • Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, tromethamine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins and the like.
  • the organic bases are isopropyl
  • a compound provided herein may contain one or more asymmetric centers and may thus give rise to enantiomers, diastereomers, and other stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R) -or (S) -or, as (D) -or (L) -for amino acids. Unless otherwise specified, a compound provided herein is meant to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-) , (R) -and(S) -, or (D) -and (L) -isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, for example, chromatography and fractional crystallization.
  • the term “isomer” refers to different compounds that have the same molecular formula.
  • “Stereoisomers” are isomers that differ only in the way the atoms are arranged in space.
  • “Atropisomers” are stereoisomers from hindered rotation about single bonds.
  • “Enantiomers” are a pair of stereoisomers that are non-superimposable mirror images of each other. A mixture of a pair of enantiomers in any proportion can be known as a “racemic” mixture.
  • “Diastereoisomers” are stereoisomers that have at least two asymmetric atoms, but which are not mirror-images of each other.
  • Stepoisomers can also include E and Z isomers, or a mixture thereof, and cis and trans isomers or a mixture thereof.
  • a compound described herein is isolated as either the E or Z isomer.
  • a compound described herein is a mixture of the E and Z isomers.
  • Tautomers refers to isomeric forms of a compound that are in equilibrium with each other. The concentrations of the isomeric forms will depend on the environment the compound is found in and may be different depending upon, for example, whether the compound is a solid or is in an organic or aqueous solution.
  • a compound described herein can contain unnatural proportions of atomic isotopes at one or more of the atoms.
  • the compounds may be radiolabeled with radioactive isotopes, such as for example tritium ( 3 H) , iodine-125 ( 125 I) , sulfur-35 ( 35 S) , or carbon-14 ( 14 C) , or may be isotopically enriched, such as with deuterium ( 2 H) , carbon-13 ( 13 C) , or nitrogen-15 ( 15 N) .
  • an “isotopolog” is an isotopically enriched compound.
  • isotopically enriched refers to an atom having an isotopic composition other than the natural isotopic composition of that atom. “Isotopically enriched” may also refer to a compound containing at least one atom having an isotopic composition other than the natural isotopic composition of that atom. The term “isotopic composition” refers to the amount of each isotope present for a given atom. Radiolabeled and isotopically enriched compounds are useful as therapeutic agents, e.g., cancer therapeutic agents, research reagents, e.g., binding assay reagents, and diagnostic agents, e.g., in vivo imaging agents.
  • isotopologs of a compound described herein are deuterium, carbon-13, and/or nitrogen-15 enriched.
  • deuterated means a compound wherein at least one hydrogen (H) has been replaced by deuterium (indicated by D or 2 H) , that is, the compound is enriched in deuterium in at least one position.
  • the term “pharmaceutically acceptable carrier, diluent or excipient” includes without limitation any adjuvant, carrier, excipient, glidant, sweetening agent, diluent, preservative, dye/colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, or emulsifier which has been approved by the United States Food and Drug Administration as being acceptable for use in humans or domestic animals.
  • composition is intended to encompass a product containing the specified ingredients (e.g., a mRNA molecule provided herein) in, optionally, the specified amounts.
  • polynucleotide or “nucleic acid, ” as used interchangeably herein, refers to polymers of nucleotides of any length and includes, e.g., DNA and RNA.
  • the nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase or by a synthetic reaction.
  • a polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs.
  • Nucleic acid can be in either single-or double-stranded forms.
  • nucleic acid also includes nucleic acid mimics such as locked nucleic acids (LNAs) , peptide nucleic acids (PNAs) , and morpholinos.
  • LNAs locked nucleic acids
  • PNAs peptide nucleic acids
  • morpholinos morpholinos.
  • Oligonucleotide refers to short synthetic polynucleotides that are generally, but not necessarily, fewer than about 200 nucleotides in length.
  • oligonucleotide and polynucleotide are not mutually exclusive. The description above for polynucleotides is equally and fully applicable to oligonucleotides.
  • the left-hand end of any single-stranded polynucleotide sequence disclosed herein is the 5’ end; the left-hand direction of double-stranded polynucleotide sequences is referred to as the 5’ direction.
  • the direction of 5’ to 3’ addition of nascent RNA transcripts is referred to as the transcription direction; sequence regions on the DNA strand having the same sequence as the RNA transcript that are 5’ to the 5’ end of the RNA transcript are referred to as “upstream sequences” ; sequence regions on the DNA strand having the same sequence as the RNA transcript that are 3’ to the 3’ end of the RNA transcript are referred to as “downstream sequences. ”
  • non-naturally occurring when used in reference to a nucleic acid molecule as described herein is intended to mean that the nucleic acid molecule is not found in nature.
  • a non-naturally occurring nucleic acid encoding a viral peptide or protein contains at least one genetic alternation or chemical modification not normally found in a naturally occurring strain of the virus, including wild-type strains of the virus.
  • Genetic alterations include, for example, modifications introducing expressible nucleic acid sequences encoding peptides or polypeptides heterologous to the virus, other nucleic acid additions, nucleic acid deletions, nucleic acid substitution, and/or other functional disruption of the virus’ genetic material.
  • modifications include, for example, modifications in the coding regions and functional fragments thereof, for heterologous, homologous or both heterologous and homologous polypeptides for the viral species. Additional modifications include, for example, modifications in non-coding regulatory regions in which the modifications alter expression of a gene or operon. Additional modifications also include, for example, incorporation of a nucleic acid sequence into a vector, such as a plasmid or an artificial chromosome. Chemical modifications include, for example, one or more functional nucleotide analog as described herein.
  • an “isolated nucleic acid” is a nucleic acid, for example, an RNA, DNA, or a mixed nucleic acids, which is substantially separated from other genome DNA sequences as well as proteins or complexes such as ribosomes and polymerases, which naturally accompany a native sequence.
  • An “isolated” nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule.
  • an“isolated” nucleic acid molecule such as an mRNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
  • nucleic acid molecules encoding an antigen as described herein are isolated or purified.
  • the term embraces nucleic acid sequences that have been removed from their naturally occurring environment, and includes recombinant or cloned DNA or RNA isolates and chemically synthesized analogues or analogues biologically synthesized by heterologous systems.
  • a substantially pure molecule may include isolated forms of the molecule.
  • nucleic acid or grammatical equivalents thereof as it is used in reference to nucleic acid molecule encompasses (a) a nucleic acid molecule in its native state or when manipulated by methods well known to those skilled in the art that can be transcribed to produce mRNA which is then translated into a peptide and/or polypeptide, and (b) the mRNA molecule itself.
  • the antisense strand is the complement of such a nucleic acid molecule, and the encoding sequence can be deduced therefrom.
  • coding region refers to a portion in an encoding nucleic acid sequence that is translated into a peptide or polypeptide.
  • UTR untranslated region
  • 5’-UTR a UTR if located to the 5’-end of a coding region
  • 3’-UTR a UTR if located to the 3’-end of a coding region
  • mRNA refers to a message RNA molecule comprising one or more open reading frame (ORF) that can be translated by a cell or an organism provided with the mRNA to produce one or more peptide or protein product.
  • ORF open reading frame
  • the region containing the one or more ORFs is referred to as the coding region of the mRNA molecule.
  • the mRNA molecule further comprises one or more untranslated regions (UTRs) .
  • the mRNA is a monocistronic mRNA that comprises only one ORF.
  • the monocistronic mRNA encodes a peptide or protein comprising at least one epitope of a selected antigen (e.g., a pathogenic antigen or a tumor associated antigen) .
  • the mRNA is a multicistronic mRNA that comprises two or more ORFs.
  • the multiecistronic mRNA encodes two or more peptides or proteins that can be the same or different from each other.
  • each peptide or protein encoded by a multicistronic mRNA comprises at least one epitope of a selected antigen.
  • different peptide or protein encoded by a multicistronic mRNA each comprises at least one epitope of different antigens.
  • the at least one epitope can be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 epitopes of an antigen.
  • nucleobases encompasses purines and pyrimidines, including natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural or synthetic analogs or derivatives thereof.
  • nucleotide analog refers to a modified version of a canonical nucleotide A, G, C, U or T that (a) retains the base-pairing properties of the corresponding canonical nucleotide, and (b) contains at least one chemical modification to (i) the nucleobase, (ii) the sugar group, (iii) the phosphate group, or (iv) any combinations of (i) to (iii) , of the corresponding natural nucleotide.
  • base pairing encompasses not only the canonical Watson-Crick adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between canonical nucleotides and functional nucleotide analogs or between a pair of functional nucleotide analogs, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a modified nucleobase and a canonical nucleobase or between two complementary modified nucleobase structures.
  • a functional analog of guanosine (G) retains the ability to base-pair with cytosine (C) or a functional analog of cytosine.
  • a functional nucleotide analog can be either naturally occurring or non-naturally occurring. Accordingly, a nucleic acid molecule containing a functional nucleotide analog can have at least one modified nucleobase, sugar group and/or internucleoside linkage. Exemplary chemical modifications to the nucleobases, sugar groups, or internucleoside linkages of a nucleic acid molecule are provided herein.
  • translational enhancer element refers to an region in a nucleic acid molecule that functions to promotes translation of a coding sequence of the nucleic acid into a protein or peptide product, such as via cap-dependent or cap-independent translation.
  • a TEE typically locates in the UTR region of a nucleic acid molecule (e.g., mRNA) and enhance the translational level of a coding sequence located either upstream or downstream. For example, a TEE in a 5’-UTR of a nucleic acid molecule can locate between the promoter and the starting codon of the nucleic acid molecule.
  • TEE sequences are known in the art (Wellensiek et al. Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug; 10 (8) : 747–750; Chappell et al. PNAS June 29, 2004 101 (26) 9590-9594) . Some TEEs are known to be conserved across multiple species (Pánek et al. Nucleic Acids Research, Volume 41, Issue 16, 1 September 2013, Pages 7625–7634) .
  • stem-loop sequence refers to a single-stranded polynucleotide sequence having at least two regions that are complementary or substantially complementary to each other when read in opposite directions, and thus capable of base-pairing with each other to form at least one double helix and an unpaired loop.
  • the resulting structure is known as a stem-loop structure, a hairpin, or a hairpin loop, which is a secondary structure found in many RNA molecules.
  • peptide refers to a polymer containing between two and fifty (2-50) amino acid residues linked by one or more covalent peptide bond (s) .
  • the terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally occurring amino acid (e.g., an amino acid analog or non-natural amino acid) .
  • polypeptide and protein are used interchangeably herein to refer to a polymer of greater than fifty (50) amino acid residues linked by covalent peptide bonds. That is, a description directed to a polypeptide applies equally to a description of a protein, and vice versa.
  • the terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally occurring amino acid (e.g., an amino acid analog) .
  • the terms encompass amino acid chains of any length, including full length proteins (e.g., antigens) .
  • derivative refers to a peptide or polypeptide that comprises an amino acid sequence of the viral peptide or protein, or a fragment of a viral peptide or protein, which has been altered by the introduction of amino acid residue substitutions, deletions, or additions.
  • derivative also refers to a viral peptide or protein, or a fragment of a viral peptide or protein, which has been chemically modified, e.g., by the covalent attachment of any type of molecule to the polypeptide.
  • a viral peptide or protein or a fragment of the viral peptide or protein may be chemically modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, chemical cleavage, formulation, metabolic synthesis of tunicamycin, linkage to a cellular ligand or other protein, etc.
  • the derivatives are modified in a manner that is different from naturally occurring or starting peptide or polypeptides, either in the type or location of the molecules attached. Derivatives further include deletion of one or more chemical groups which are naturally present on the viral peptide or protein.
  • aderivative of a viral peptide or protein or a fragment of a viral peptide or protein may contain one or more non-classical amino acids.
  • a derivative is a functional derivative of the native or unmodified peptide or polypeptide from which it was derived.
  • a functional derivative refers to a derivative that retains one or more functions or activities of the naturally occurring or starting peptide or polypeptide from which it was derived.
  • a functional derivative of a influenza virus S protein may retain the ability to bind one or more of its receptors on a host cell.
  • a functional derivative of a influenza virus N protein may retain the ability to bind RNA or the package viral genome.
  • identity refers to a relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by aligning and comparing the sequences. “Percent (%) amino acid sequence identity” with respect to a reference polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity.
  • Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or MEGALIGN (DNAStar, Inc. ) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
  • a “modification” of an amino acid residue/position refers to a change of a primary amino acid sequence as compared to a starting amino acid sequence, wherein the change results from a sequence alteration involving said amino acid residue/position.
  • typical modifications include substitution of the residue with another amino acid (e.g., a conservative or non-conservative substitution) , insertion of one or more (e.g., generally fewer than 5, 4, or 3) amino acids adjacent to said residue/position, and/or deletion of said residue/position.
  • fragment refers to a peptide or polypeptide that comprises less than the full length amino acid sequence. Such a fragment may arise, for example, from a truncation at the amino terminus, a truncation at the carboxy terminus, and/or an internal deletion of a residue (s) from the amino acid sequence. Fragments may, for example, result from alternative RNA splicing or from in vivo protease activity.
  • fragments refers to polypeptides comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 30 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least contiguous 100 amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 200 contiguous amino acid residues, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least
  • immunogenic fragment refers to a fragment of a peptide or polypeptide that retains the ability of the peptide or polypeptide in eliciting an immune response upon contacting the immune system of a mammal, including innate immune responses and/or adaptive immune responses.
  • an immunogenic fragment of a peptide or polypeptide can be an epitope.
  • the term “antigen” refers to a substance that can be recognized by the immune system of a subject (including by the adaptive immune system) , and is capable of triggering an immune response after the subject is contacted with the antigen (including an antigen-specific immune response) .
  • the antigen is a protein associated with a diseased cell, such as a cell infected by a pathogen or a neoplastic cell (e.g., tumor associated antigen (TAA) ) .
  • An “epitope” is the site on the surface of an antigen molecule to which a single antibody molecule binds, such as a localized region on the surface of an antigen that is capable of being bound to one or more antigen binding regions of an antibody, and that has antigenic or immunogenic activity in an animal, such as a mammal (e.g., a human) , that is capable of eliciting an immune response.
  • An epitope having immunogenic activity is a portion of a polypeptide that elicits an antibody response in an animal.
  • An epitope having antigenic activity is a portion of a polypeptide to which an antibody binds as determined by any method well known in the art, including, for example, by an immunoassay.
  • Antigenic epitopes need not necessarily be immunogenic. Epitopes often consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and have specific three dimensional structural characteristics as well as specific charge characteristics. Antibody epitopes may be linear epitopes or conformational epitopes. Linear epitopes are formed by a continuous sequence of amino acids in a protein. Conformational epitopes are formed of amino acids that are discontinuous in the protein sequence, but which are brought together upon folding of the protein into its three-dimensional structure. Induced epitopes are formed when the three dimensional structure of the protein is in an altered conformation, such as following activation or binding of another protein or ligand.
  • an epitope is a three-dimensional surface feature of a polypeptide. In other embodiments, an epitope is linear feature of a polypeptide. Generally an antigen has several or many different epitopes and may react with many different antibodies.
  • heterologous refers an entity not found in nature to be associated with (e.g., encoded by and/or expressed by the genome of) a naturally occurring influenza virus.
  • homologous refers an entity found in nature to be associated with (e.g., encoded by and/or expressed by the genome of) a naturally occurring influenza virus.
  • the term “genetic vaccine” as used herein refers to a therapeutic or prophylactic composition comprising at least one nucleic acid molecule encoding an antigen associated with a target disease (e.g., an infectious disease or a neoplastic disease) .
  • Administration of the vaccine to a subject allows for the production of the encoded peptide or protein, thereby eliciting an immune response against the target disease in the subject.
  • the immune response comprises adaptive immune response, such as the production of antibodies against the encoded antigen, and/or activation and proliferations of immune cells capable of specifically eliminating diseased cells expressing the antigen.
  • the immune response further comprises innate immune response.
  • a vaccine can be administered to a subject either before or after the onset of clinical symptoms of the target disease.
  • vaccination of a healthy or asymptomatic subject renders the vaccinated subject immune or less susceptible to the development of the target disease.
  • vaccination of a subject showing symptoms of the disease improves the condition of, or treats, the disease in the vaccinated subject.
  • vector refers to a substance that is used to carry or include a nucleic acid sequence, including for example, a nucleic acid sequence encoding a viral peptide or protein as described herein, in order to introduce a nucleic acid sequence into a host cell, or serve as a transcription template to carry out in vitro transcription reaction in a cell-free system to produce mRNA.
  • Vectors applicable for use include, for example, expression vectors, plasmids, phage vectors, viral vectors, episomes, and artificial chromosomes, which can include selection sequences or markers operable for stable integration into a host cell’s chromosome. Additionally, the vectors can include one or more selectable marker genes and appropriate transcription or translation control sequences.
  • Selectable marker genes that can be included, for example, provide resistance to antibiotics or toxins, complement auxotrophic deficiencies, or supply critical nutrients not in the culture media.
  • Transcription or translation control sequences can include constitutive and inducible promoters, transcription enhancers, transcription terminators, and the like, which are well known in the art.
  • both nucleic acid molecules can be inserted, for example, into a single expression vector or in separate expression vectors.
  • the encoding nucleic acids can be operationally linked to one common transcription or translation control sequence or linked to different transcription or translation control sequences, such as one inducible promoter and one constitutive promoter.
  • the introduction of nucleic acid molecules into a host cell can be confirmed using methods well known in the art. Such methods include, for example, nucleic acid analysis such as Northern blots or polymerase chain reaction (PCR) amplification of mRNA, immunoblotting for expression of gene products, or other suitable analytical methods to test the expression of an introduced nucleic acid sequence or its corresponding gene product.
  • nucleic acid analysis such as Northern blots or polymerase chain reaction (PCR) amplification of mRNA
  • immunoblotting for expression of gene products or other suitable analytical methods to test the expression of an introduced nucleic acid sequence or its corresponding gene product.
  • nucleic acid molecules are expressed in a sufficient amount to produce a desired product (e.g., a mRNA transcript of the nucleic acid as described herein) , and it is further understood that expression levels can be optimized to obtain sufficient expression using methods well known in the art.
  • a desired product e.g., a mRNA transcript of the nucleic acid as described herein
  • innate immune response and “innate immunity” are recognized in the art, and refer to non-specific defense mechanism a body’s immune system initiates upon recognition of pathogen-associated molecular patterns, which involves different forms of cellular activities, including cytokine production and cell death through various pathways.
  • innate immune responses include, without limitation, increased production of inflammation cytokines (e.g., type I interferon or IL-10 production) , activation of the NF ⁇ B pathway, increased proliferation, maturation, differentiation and/or survival of immune cells, and in some cases, induction of cell apoptosis.
  • Activation of the innate immunity can be detected using methods known in the art, such as measuring the (NF) - ⁇ B activation.
  • adaptive immune response and “adaptive immunity” are recognized in the art, and refer to antigen-specific defense mechanism a body’s immune system initiates upon recognition of a specific antigen, which include both humoral response and cell-mediated responses.
  • adaptive immune responses include cellular responses that is triggered and/or augmented by a vaccine composition, such as a genetic composition described herein.
  • the vaccine composition comprises an antigen that is the target of the antigen-specific adaptive immune response.
  • the vaccine composition upon administration, allows the production in an immunized subject of an antigen that is the target of the antigen-specific adaptive immune response. Activation of an adaptive immune response can be detected using methods known in the art, such as measuring the antigen-specific antibody production, or the level of antigen-specific cell-mediated cytotoxicity.
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • FcRs Fc receptors
  • cytotoxic cells e.g., Natural Killer (NK) cells, neutrophils, and macrophages
  • NK cells the primary cells for mediating ADCC
  • monocytes express Fc ⁇ RI, Fc ⁇ RII, and Fc ⁇ RIII.
  • ADCC activity of a molecule of interest can be assessed in vitro, for example, in an animal model (see, e.g., Clynes et al., 1998, Proc. Natl. Acad. Sci. USA 95: 652-56) .
  • Antibodies with little or no ADCC activity may be selected for use.
  • ADCP antibody-dependent cellular phagocytosis
  • FcRs Fc receptors
  • phagocytotic cells e.g., neutrophils, monocytes, and macrophages
  • an in vitro ADCP assay see, e.g., Bracher et al., 2007, J. Immunol. Methods 323: 160-71 can be performed.
  • phagocytotic cells for such assays include peripheral blood mononuclear cells (PBMC) , purified monocytes from PBMC, or U937 cells differentiated to the mononuclear type.
  • PBMC peripheral blood mononuclear cells
  • ADCP activity of the molecule of interest may be assessed in vivo, for example, in an animal model (see, e.g., Wallace et al., 2001, J. Immunol. Methods 248: 167-82) .
  • Antibodies with little or no ADCP activity may be selected for use.
  • Fc receptor or “FcR” describes a receptor that binds to the Fc region of an antibody.
  • An exemplary FcR is a native sequence human FcR.
  • an exemplary FcR is one that binds an IgG antibody (e.g., a gamma receptor) and includes receptors of the Fc ⁇ RI, Fc ⁇ RII, and Fc ⁇ RIII subclasses, including allelic variants and alternatively spliced forms of these receptors.
  • Fc ⁇ RII receptors include Fc ⁇ RIIA (an “activating receptor” ) and Fc ⁇ RIIB (an “inhibiting receptor” ) , which have similar amino acid sequences that differ primarily in the cytoplasmic domains thereof (see, e.g., 1997, Annu. Rev. Immunol. 15: 203-34) .
  • Various FcRs are known (see, e.g., Ravetch and Kinet, 1991, Annu. Rev. Immunol. 9: 457-92; Capel et al., 1994, Immunomethods 4: 25-34; and de Haas et al., 1995, J. Lab. Clin. Med. 126: 330-41) .
  • FcR FcR
  • the term also includes the neonatal receptor, FcRn, which is responsible for the transfer of maternal IgGs to the fetus (see, e.g., Guyer et al., 1976, J. Immunol. 117: 587-93; and Kim et al., 1994, Eu. J. Immunol. 24: 2429-34) .
  • Antibody variants with improved or diminished binding to FcRs have been described (see, e.g., WO 2000/42072; U.S. Pat. Nos. 7,183,387; 7,332,581; and 7.335,742; Shields et al. 2001, J. Biol. Chem. 9 (2) : 6591-604) .
  • “Complement dependent cytotoxicity” or “CDC” refers to the lysis of a target cell in the presence of complement. Activation of the classical complement pathway is initiated by the binding of the first component of the complement system (C1q) to antibodies (of the appropriate subclass) which are bound to their cognate antigen.
  • C1q the first component of the complement system
  • a CDC assay see, e.g., Gazzano-Santoro et al., 1996, J. Immunol. Methods 202: 163 may be performed.
  • Polypeptide variants with altered Fc region amino acid sequences polypeptides with a variant Fc region
  • increased or decreased C1q binding capability have been described (see, e.g., US Pat. No. 6,194,551; WO 1999/51642; Idusogie et al., 2000, J. Immunol. 164: 4178-84) .
  • Antibodies with little or no CDC activity may be selected for use.
  • antibody is intended to include a polypeptide product of B cells within the immunoglobulin class of polypeptides that is able to bind to a specific molecular antigen and is composed of two identical pairs of polypeptide chains, wherein each pair has one heavy chain (about 50-70 kDa) and one light chain (about 25 kDa) , each amino-terminal portion of each chain includes a variable region of about 100 to about 130 or more amino acids, and each carboxy-terminal portion of each chain includes a constant region. See, e.g., Antibody Engineering (Borrebaeck ed., 2d ed. 1995) ; and Kuby, Immunology (3d ed. 1997) .
  • the specific molecular antigen can be bound by an antibody provided herein, including a polypeptide, a fragment or an epitope thereof.
  • Antibodies also include, but are not limited to, synthetic antibodies, recombinantly produced antibodies, camelized antibodies, intrabodies, anti-idiotypic (anti-Id) antibodies, and functional fragments of any of the above, which refers to a portion of an antibody heavy or light chain polypeptide that retains some or all of the binding activity of the antibody from which the fragment was derived.
  • functional fragments include single-chain Fvs (scFv) (e.g., including monospecific, bispecific, etc.
  • antibodies provided herein include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, for example, antigen-binding domains or molecules that contain an antigen-binding site (e.g., one or more CDRs of an antibody) .
  • antigen-binding domains or molecules that contain an antigen-binding site e.g., one or more CDRs of an antibody
  • the antibodies provided herein can be of any class (e.g., IgG, IgE, IgM, IgD, and IgA) or any subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2) of immunoglobulin molecule.
  • administer refers to the act of injecting or otherwise physically delivering a substance as it exists outside the body (e.g., a lipid nanoparticle composition as described herein) into a patient, such as by mucosal, intradermal, intravenous, intramuscular delivery, and/or any other method of physical delivery described herein or known in the art.
  • a disease, disorder, condition, or a symptom thereof is being treated, administration of the substance typically occurs after the onset of the disease, disorder, condition, or symptoms thereof.
  • a disease, disorder, condition, or symptoms thereof are being prevented, administration of the substance typically occurs before the onset of the disease, disorder, condition, or symptoms thereof.
  • Chronic administration refers to administration of the agent (s) in a continuous mode (e.g., for a period of time such as days, weeks, months, or years) as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time.
  • Intermittent administration is treatment that is not consecutively done without interruption, but rather is cyclic in nature.
  • target delivery refers to the process that promotes the arrival of a delivered agent (such as a therapeutic payload molecule in a lipid nanoparticle composition as described herein) at a specific organ, tissue, cell and/or intracellular compartment (referred to as the targeted location) more than any other organ, tissue, cell or intracellular compartment (referred to as the non-target location) .
  • a delivered agent such as a therapeutic payload molecule in a lipid nanoparticle composition as described herein
  • Targeted delivery can be detected using methods known in the art, for example, by comparing the concentration of the delivered agent in a targeted cell population with the concentration of the delivered agent at a non-target cell population after systemic administration. In certain embodiments, targeted delivery results in at least 2 fold higher concentration at a targeted location as compared to a non-target location.
  • an “effective amount” is generally an amount sufficient to reduce the severity and/or frequency of symptoms, eliminate the symptoms and/or underlying cause, prevent the occurrence of symptoms and/or their underlying cause, and/or improve or remediate the damage that results from or is associated with a disease, disorder, or condition, including, for example, infection and neoplasia.
  • the effective amount is a therapeutically effective amount or a prophylactically effective amount.
  • terapéuticaally effective amount refers to the amount of an agent (e.g., a vaccine composition) that is sufficient to reduce and/or ameliorate the severity and/or duration of a given disease, disorder, or condition, and/or a symptom related thereto (e.g., an infectious disease such as caused by viral infection, or a neoplastic disease such as cancer) .
  • A“therapeutically effective amount” of a substance/molecule/agent of the present disclosure may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the substance/molecule/agent to elicit a desired response in the individual.
  • a therapeutically effective amount encompasses an amount in which any toxic or detrimental effects of the substance/molecule/agent are outweighed by the therapeutically beneficial effects.
  • the term “therapeutically effective amount” refers to an amount of a lipid nanoparticle composition as described herein or a therapeutic or prophylactic agent contained therein (e.g., a therapeutic mRNA) effective to “treat” a disease, disorder, or condition, in a subject or mammal.
  • a “prophylactically effective amount” is an amount of a pharmaceutical composition that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing, delaying, or reducing the likelihood of the onset (or reoccurrence) of a disease, disorder, condition, or associated symptom (s) (e.g., an infectious disease such as caused by viral infection, or a neoplastic disease such as cancer) .
  • a prophylactic dose is used in subjects prior to or at an earlier stage of a disease, disorder, or condition, aprophylactically effective amount may be less than a therapeutically effective amount.
  • the full therapeutic or prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a therapeutically or prophylactically effective amount may be administered in one or more administrations.
  • prevent, ” and “prevention” refer to reducing the likelihood of the onset (or recurrence) of a disease, disorder, condition, or associated symptom (s) (e.g., an infectious disease such as caused by viral infection, or a neoplastic disease such as cancer) .
  • a disease, disorder, condition, or associated symptom e.g., an infectious disease such as caused by viral infection, or a neoplastic disease such as cancer
  • a subject is administered one or more therapies (e.g., prophylactic or therapeutic agents, such as a lipid nanoparticle composition as described herein) to “manage” an infectious or neoplastic disease, one or more symptoms thereof, so as to prevent the progression or worsening of the disease.
  • therapies e.g., prophylactic or therapeutic agents, such as a lipid nanoparticle composition as described herein
  • prophylactic agent refers to any agent that can totally or partially inhibit the development, recurrence, onset, or spread of disease and/or symptom related thereto in a subject.
  • therapeutic agent refers to any agent that can be used in treating, preventing, or alleviating a disease, disorder, or condition, including in the treatment, prevention, or alleviation of one or more symptoms of a disease, disorder, or condition and/or a symptom related thereto.
  • the term “therapy” refers to any protocol, method, and/or agent that can be used in the prevention, management, treatment, and/or amelioration of a disease, disorder, or condition.
  • the terms “therapies” and “therapy” refer to a biological therapy, supportive therapy, and/or other therapies useful in the prevention, management, treatment, and/or amelioration of a disease, disorder, or condition, known to one of skill in the art such as medical personnel.
  • a “prophylactically effective serum titer” is the serum titer of an antibody in a subject (e.g., a human) , that totally or partially inhibits the development, recurrence, onset, or spread of a disease, disorder, or condition, and/or symptom related thereto in the subject.
  • a “therapeutically effective serum titer” is the serum titer of an antibody in a subject (e.g., a human) , that reduces the severity, the duration, and/or the symptoms associated with a disease, disorder, or condition, in the subject.
  • serum titer refers to an average serum titer in a subject from multiple samples (e.g., at multiple time points) or in a population of at least 10, at least 20, at least 40 subjects, up to about 100, 1000, or more.
  • side effects encompasses unwanted and/or adverse effects of a therapy (e.g., a prophylactic or therapeutic agent) . Unwanted effects are not necessarily adverse. An adverse effect from a therapy (e.g., a prophylactic or therapeutic agent) might be harmful, uncomfortable, or risky.
  • a therapy e.g., a prophylactic or therapeutic agent
  • side effects include, diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, anorexia, abdominal cramping, fever, pain, loss of body weight, dehydration, alopecia, dyspenea, insomnia, dizziness, mucositis, nerve and muscle effects, fatigue, dry mouth, loss of appetite, rashes or swellings at the site of administration, flu-like symptoms such as fever, chills, and fatigue, digestive tract problems, and allergic reactions. Additional undesired effects experienced by patients are numerous and known in the art. Many are described in Physician’s Desk Reference (68th ed. 2014) .
  • a subject is a mammal, such as a non-primate (e.g., cow, pig, horse, cat, dog, rat, etc. ) or a primate (e.g., monkey and human) .
  • the subject is a human.
  • the subject is a mammal (e.g., a human) having an infectious disease or neoplastic disease.
  • the subject is a mammal (e.g., a human) at risk of developing an infectious disease or neoplastic disease.
  • the term “elderly human” refers to a human 65 years or older.
  • the term “human adult” refers to a human that is 18 years or older.
  • the term “human child” refers to a human that is 1 year to 18 years old.
  • the term “human toddler” refers to a human that is 1 year to 3 years old.
  • the term “human infant” refers to a newborn to 1 year old year human.
  • detectable probe refers to a composition that provides a detectable signal.
  • the term includes, without limitation, any fluorophore, chromophore, radiolabel, enzyme, antibody or antibody fragment, and the like, that provide a detectable signal via its activity.
  • detectable agent refers to a substance that can be used to ascertain the existence or presence of a desired molecule, such as an antigen encoded by an mRNA molecule as described herein, in a sample or subject.
  • a detectable agent can be a substance that is capable of being visualized or a substance that is otherwise able to be determined and/or measured (e.g., by quantitation) .
  • substantially all refers to at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.
  • the term “about” or “approximately” means an acceptable error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined. In certain embodiments, the term “about” or “approximately” means within 1, 2, 3, or 4 standard deviations. In certain embodiments, the term “about” or “approximately” means within 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.05%, or less of a given value or range.
  • the therapeutic nucleic acid molecules for the management, prevention and treatment of influenza virus infection.
  • the therapeutic nucleic acid encodes a peptide or polypeptide, which upon administration into a subject in need thereof, is expressed by the cells in the subject to produce the encoded peptide or polypeptide.
  • the therapeutic nucleic acid molecules are DNA molecules.
  • the therapeutic nucleic acid molecules are RNA molecules.
  • the therapeutic nucleic acid molecules are mRNA molecules.
  • the therapeutic nucleic acid molecule is formulated in a vaccine composition.
  • the vaccine composition is a genetic vaccine as described herein.
  • the vaccine composition comprises an mRNA molecule as described herein.
  • the mRNA molecule of the present disclosure encodes a peptide or polypeptide of interest, including any naturally or non-naturally occurring or otherwise modified polypeptide.
  • a peptide or polypeptide encoded by an mRNA may be of any size and may have any secondary structure or activity.
  • the polypeptide encoded by an mRNA payload can have a therapeutic effect when expressed in a cell.
  • the mRNA molecule of the present disclosure comprises at least one coding region encoding a peptide or polypeptide of interest (e.g., an open reading frame (ORF) ) .
  • the nucleic acid molecule further comprises at least one untranslated region (UTR) .
  • the untranslated region (UTR) is located upstream (to the 5’-end) of the coding region, and is referred to herein as the 5’-UTR.
  • the untranslated region (UTR) is located downstream (to the 3’-end) of the coding region, and is referred to herein as the 3’-UTR.
  • the nucleic acid molecule comprises both a 5’-UTR and a 3’-UTR.
  • the 5’-UTR comprises a 5’-Cap structure.
  • the nucleic acid molecule comprises a Kozak sequence (e.g., in the 5’-UTR) .
  • the nucleic acid molecule comprises a poly-A region (e.g., in the 3’-UTR) .
  • the nucleic acid molecule comprises a polyadenylation signal (e.g., in the 3’-UTR) .
  • the nucleic acid molecule comprises stabilizing region (e.g., in the 3’-UTR) .
  • the nucleic acid molecule comprises a secondary structure.
  • the secondary structure is a stem-loop.
  • the nucleic acid molecule comprises a stem-loop sequence (e.g., in the 5’-UTR and/or the 3’-UTR) .
  • the nucleic acid molecule comprises one or more intronic regions capable of being excised during splicing.
  • the nucleic acid molecule comprises one or more region selected from a 5’-UTR, and a coding region.
  • the nucleic acid molecule comprises one or more region selected from a coding region and a 3’-UTR.
  • the nucleic acid molecule comprises one or more region selected from a 5’-UTR, a coding region, and a 3’-UTR.
  • the nucleic acid molecule of the present disclosure comprises at least one coding region.
  • the coding region is an open reading frame (ORF) that encodes for a single peptide or protein.
  • the coding region comprises at least two ORFs, each encoding a peptide or protein.
  • the encoded peptides and/or proteins can be the same as or different from each other.
  • the multiple ORFs in a coding region are separated by non-coding sequences.
  • a non-coding sequence separating two ORFs comprises an internal ribosome entry sites (IRES) .
  • an internal ribosome entry sites can act as the sole ribosome binding site, or serve as one of multiple ribosome binding sites of an mRNA.
  • An mRNA molecule containing more than one functional ribosome binding site can encode several peptides or proteins that are translated independently by the ribosomes (e.g., multicistronic mRNA) .
  • the nucleic acid molecule of the present disclosure e.g., mRNA
  • IRES sequences that can be used in connection with the present disclosure include, without limitation, those from picomaviruses (e.g., FMDV) , pest viruses (CFFV) , polio viruses (PV) , encephalomyocarditis viruses (ECMV) , foot-and-mouth disease viruses (FMDV) , hepatitis C viruses (HCV) , classical swine fever viruses (CSFV) , murine leukemia virus (MLV) , simian immune deficiency viruses (SIV) or cricket paralysis viruses (CrPV) .
  • picomaviruses e.g., FMDV
  • CFFV pest viruses
  • PV polio viruses
  • ECMV encephalomyocarditis viruses
  • FMDV foot-and-mouth disease viruses
  • HCV hepatitis C viruses
  • CSFV classical swine fever viruses
  • MLV murine leukemia virus
  • SIV simian immune deficiency
  • the nucleic acid molecule of the present disclosure encodes for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 peptides or proteins. Peptides and proteins encoded by a nucleic acid molecule can be the same or different.
  • the nucleic acid molecule of the present disclosure encodes a dipeptide (e.g., camosine and anserine) .
  • the nucleic acid molecule encodes a tripeptide.
  • the nucleic acid molecule encodes a tetrapeptide.
  • the nucleic acid molecule encodes a pentapeptide.
  • the nucleic acid molecule encodes a hexapeptide. In some embodiments, the nucleic acid molecule encodes a heptapeptide. In some embodiments, the nucleic acid molecule encodes an octapeptide. In some embodiments, the nucleic acid molecule encodes a nonapeptide. In some embodiments, the nucleic acid molecule encodes a decapeptide. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide that has at least about 15 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide that has at least about 50 amino acids.
  • the nucleic acid molecule encodes a peptide or polypeptide that has at least about 100 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide that has at least about 150 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide that has at least about 300 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide that has at least about 500 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide that has at least about 1000 amino acids.
  • the nucleic acid molecule of the present disclosure is at least about 30 nucleotides (nt) in length. In some embodiments, the nucleic acid molecule is at least about 35 nt in length. In some embodiments, the nucleic acid molecule is at least about 40 nt in length. In some embodiments, the nucleic acid molecule is at least about 45 nt in length. In some embodiments the nucleic acid molecule is at least about 50 nt in length. In some embodiments, the nucleic acid molecule is at least about 55 nt in length. In some embodiments, the nucleic acid molecule is at least about 60 nt in length.
  • the nucleic acid molecule is at least about 65 nt in length. In some embodiments, the nucleic acid molecule is at least about 70 nt in length. In some embodiments, the nucleic acid molecule is at least about 75 nt in length. In some embodiments, the nucleic acid molecule is at least about 80 nt in length. In some embodiments the nucleic acid molecule is at least about 85 nt in length. In some embodiments, the nucleic acid molecule is at least about 90 nt in length. In some embodiments, the nucleic acid molecule is at least about 95 nt in length. In some embodiments, the nucleic acid molecule is at least about 100 nt in length.
  • the nucleic acid molecule is at least about 120 nt in length. In some embodiments, the nucleic acid molecule is at least about 140 nt in length. In some embodiments, the nucleic acid molecule is at least about 160 nt in length. In some embodiments, the nucleic acid molecule is at least about 180 nt in length. In some embodiments, the nucleic acid molecule is at least about 200 nt in length. In some embodiments, the nucleic acid molecule is at least about 250 nt in length. In some embodiments, the nucleic acid molecule is at least about 300 nt in length. In some embodiments, the nucleic acid molecule is at least about 400 nt in length.
  • the nucleic acid molecule is at least about 500 nt in length. In some embodiments, the nucleic acid molecule is at least about 600 nt in length. In some embodiments, the nucleic acid molecule is at least about 700 nt in length. In some embodiments, the nucleic acid molecule is at least about 800 nt in length. In some embodiments, the nucleic acid molecule is at least about 900 nt in length. In some embodiments, the nucleic acid molecule is at least about 1000 nt in length. In some embodiments, the nucleic acid molecule is at least about 1100 nt in length. In some embodiments, the nucleic acid molecule is at least about 1200 nt in length.
  • the nucleic acid molecule is at least about 1300 nt in length. In some embodiments, the nucleic acid molecule is at least about 1400 nt in length. In some embodiments, the nucleic acid molecule is at least about 1500 nt in length. In some embodiments, the nucleic acid molecule is at least about 1600 nt in length. In some embodiments, the nucleic acid molecule is at least about 1700 nt in length. In some embodiments, the nucleic acid molecule is at least about 1800 nt in length. In some embodiments, the nucleic acid molecule is at least about 1900 nt in length. In some embodiments, the nucleic acid molecule is at least about 2000 nt in length.
  • the nucleic acid molecule is at least about 2500 nt in length. In some embodiments, the nucleic acid molecule is at least about 3000 nt in length. In some embodiments, the nucleic acid molecule is at least about 3500 nt in length. In some embodiments, the nucleic acid molecule is at least about 4000 nt in length. In some embodiments, the nucleic acid molecule is at least about 4500 nt in length. In some embodiments, the nucleic acid molecule is at least about 5000 nt in length.
  • the therapeutic nucleic acid of the present disclosure are formulated as a vaccine composition (e.g., a genetic vaccine) as described herein.
  • the therapeutic nucleic acid encodes a peptide or protein capable of eliciting immunity against one or more target conditions or disease.
  • the target condition is related to or caused by infection by a pathogen, such as influenza viruses.
  • the therapeutic nucleic acid sequence e.g., mRNA
  • a pathogenic protein characteristic for the pathogen or an immunogenic fragment (e.g., epitope) or derivative thereof.
  • the vaccine upon administration to a vaccinated subject, allows for expression of the encoded pathogenic protein (or the immunogenic fragment or derivative thereof) , thereby eliciting immunity in the subject against the pathogen.
  • compositions for the management, prevention and treatment of a diseases or disorder caused by influenza viruses or by infection with influenza viruses.
  • nucleic acids encoding a viral peptide or protein derived from influenza viruses.
  • the nucleic acid encodes a viral peptide or protein derived from influenza viruses, where the viral peptide or protein is one or more selected from (a) the HA protein, (b) the NA protein, (c) an immunogenic fragment of any one of (a) to (b) , and (d) a functional derivative of any one of (a) to (b) .
  • the therapeutic nucleic acid of the present disclosure encodes the influenza virus HA protein, or an immunogenic fragment of the HA protein, or a functional derivative of the HA protein or the immunogenic fragment thereof.
  • Table 1 shows exemplary influenza virus native antigen sequences.
  • Table 1 Exemplary sequences of influenza virus antigens.
  • sequences in the parentheses are signal peptides.
  • the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the HA protein has an amino acid sequence of SEQ ID NO: 1.
  • the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the therapeutic nucleic acid comprises a DNA coding sequence of SEQ ID NO: 5.
  • the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the HA protein has an amino acid sequence of SEQ ID NO: 2 OR SEQ ID NO: 64.
  • the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the therapeutic nucleic acid comprises a DNA coding sequence of SEQ ID NO: 6 or 66.
  • the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the HA protein has an amino acid sequence of SEQ ID NO: 3 or 65.
  • the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the therapeutic nucleic acid comprises a DNA coding sequence of SEQ ID NO: 7 or 67.
  • the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the HA protein has an amino acid sequence of SEQ ID NO: 4.
  • the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the therapeutic nucleic acid comprises a DNA coding sequence of SEQ ID NO: 8.
  • the RNA sequence is in vitro transcribed.
  • the nucleic acid molecule is an mRNA molecule.
  • the therapeutic nucleic acid of the present disclosure encodes an immunogenic fragment of the HA protein of influenza viruses. In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes a functional derivative of the HA protein of influenza viruses. In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes a functional derivative of an immunogenic fragment of the HA protein of influenza viruses.
  • influenza virus HA protein is a mutant.
  • the therapeutic nucleic acid of the present disclosure encodes a fusion protein comprising the influenza virus HA protein or an immunogenic fragment thereof fused to a trimmerization peptide, such that the fusion protein is capable of forming a trimeric complex comprising three copies of the HA protein or immunogenic fragment thereof.
  • the HA protein or immunogenic fragment thereof is fused to a trimmerization peptide via a peptidic linker.
  • Table 2 shows exemplary trimmerization peptide and linker peptide that can be used in connection with the present disclosure, and sequences of fusion proteins.
  • the therapeutic nucleic acid encodes a fusion protein comprising the HA protein of influenza viruses or a functional derivative thereof fused to a trimmerization peptide.
  • the fusion between the HA protein and the trimmerization peptide is via a peptide linker.
  • the peptide linker comprises the amino acid sequence of SEQ ID NO: 37.
  • the trimmerization peptide comprises the amino acid sequence of SEQ ID NO: 39.
  • the therapeutic nucleic acid encodes a fusion protein comprising the HA protein of influenza viruses fused to a trimmerization peptide, wherein the nucleic acid comprises a DNA coding sequence.
  • the therapeutic nucleic acid encodes a fusion protein comprising the HA protein of influenza viruses fused to a trimmerization peptide, wherein the nucleic acid comprises a RNA sequence transcribed from the DNA coding sequence.
  • the RNA sequence is in vitro transcribed.
  • the nucleic acid molecule is an mRNA molecule.
  • a fusion protein comprising a viral peptide or polypeptide fused to an immunoglobulin Fc region can enhance immunogenicity of the viral peptide or polypeptide.
  • the therapeutic nucleic acid molecule of the present disclosure encodes a fusion protein comprising a viral peptide or protein derived from influenza viruses fused with an Fc region of an immunoglobulin.
  • the viral peptide or protein is one or more selected from (a) the HA protein, (b) the NA protein, (c) an immunogenic fragment of any one of (a) to (b) , and (d) a functional derivative of any one of (a) to (b) .
  • the immunoglobulin is human immunoglobulin (Ig) .
  • the immunoglobulin is human IgG, IgA, IgD, IgE, or IgM.
  • the immunoglobulin is human IgG1, IgG2, IgG3 or IgG4.
  • the immunoglobulin Fc is fused to the N terminus of the viral peptide or polypeptide. In other embodiments, the immunoglobulin Fc is fused to the C terminus of the viral peptide or polypeptide.
  • a signal peptide can mediate transportation of a polypeptide fused thereto to particular locations of a cell.
  • the therapeutic nucleic acid molecule of the present disclosure encodes a fusion protein comprising a viral peptide or protein fused to a signal peptide.
  • the viral peptide or protein is one or more selected from (a) the HA protein, (b) the NA protein, (c) an immunogenic fragment of any one of (a) to (b) , and (d) a functional derivative of any one of (a) to (b) .
  • the signal peptide is fused to the N terminus of the viral peptide or polypeptide.
  • the signal peptide is fused to the C terminus of the viral peptide or polypeptide.
  • Table 3 shows exemplary sequences for signal peptides that can be use in connection with the present disclosure, and exemplary influenza virus antigenic sequences comprising the signal peptides.
  • Table 3 Exemplary sequences of signal peptides.
  • the signal peptide is encoded by a gene of the influenza virus from which the viral peptide or polypeptide is derived.
  • a signal peptide encoded by a gene of influenza virus is fused to a viral peptide or polypeptide encoded by a different gene of influenza viruses.
  • a signal peptide encoded by a gene of influenza viruses is fused to a viral peptide or polypeptide encoded by the same gene of influenza viruses.
  • the viral peptide or protein is one or more selected from (a) the HA protein, (b) the NA protein, (c) an immunogenic fragment of any one of (a) to (b) , and (d) a functional derivative of any one of (a) to (b) .
  • the therapeutic nucleic acid of the present disclosure encodes the HA protein or immunogenic fragment of influenza viruses without the native signal peptide.
  • the encoded HA protein or immunogenic fragment comprises a signal peptide having an amino acid sequence of SEQ ID NO: 15 or 17.
  • the therapeutic nucleic acid of the present disclosure encodes the HA protein or immunogenic fragment of influenza viruses having a signal peptide, and wherein the therapeutic nucleic acid comprises a DNA coding sequence of SEQ ID NO: 16 or 18.
  • the therapeutic nucleic acid of the present disclosure encodes the HA protein or immunogenic fragment of influenza viruses having a signal peptide, and wherein the therapeutic nucleic acid comprises a RNA sequence transcribed from the DNA coding sequence of SEQ ID NO: 16 or 18.
  • the RNA sequence is in vitro transcribed.
  • the nucleic acid molecule is an mRNA molecule.
  • the therapeutic nucleic acid of the present disclosure encodes the ectodomain (ECD) of the HA protein of influenza viruses having a signal peptide.
  • ECD ectodomain
  • the RNA sequence is in vitro transcribed.
  • the nucleic acid molecule is an mRNA molecule.
  • the signal peptide is encoded by an exogenous gene sequence that does not present in influenza viruses from which the viral peptide or polypeptide is derived.
  • a heterologous signal peptide replaces a homologous signal peptide in the fusion protein encoded by the nucleic acid molecule of the present disclosure.
  • the signal peptide is encoded by a mammalian gene.
  • the signal peptide is encoded by human Immunoglobulin gene.
  • the signal peptide is encoded by human IgE gene.
  • a signal peptide having amino acid sequence of MDWTWILFLVAAATRVHS is fused to the viral peptide or polypeptide encoded by the nucleic acid molecule of the present disclosure.
  • the viral peptide or protein is one or more selected from (a) the HA protein, (b) the NA protein, (c) an immunogenic fragment of any one of (a) to (b) , and (d) a functional derivative of any one of (a) to (b) .
  • a 5’-cap structure of a polynucleotide is involved in nuclear export and increasing polynucleotide stability and binds the mRNA Cap Binding Protein (CBP) , which is responsible for polynucleotide stability in the cell and translation competency through the association of CBP with poly-A binding protein to form the mature cyclic mRNA species.
  • CBP mRNA Cap Binding Protein
  • the 5’-cap structure further assists the removal of 5’-proximal introns removal during mRNA splicing.
  • the nucleic acid molecules of the present disclosure comprise a 5’-cap structure.
  • Nucleic acid molecules may be 5’-end capped by the endogenous transcription machinery of a cell to generate a 5’-ppp-5’-triphosphate linkage between a terminal guanosine cap residue and the 5’-terminal transcribed sense nucleotide of the polynucleotide. This 5’-guanylate cap may then be methylated to generate an N7-methyl-guanylate residue.
  • the ribose sugars of the terminal and/or anteterminal transcribed nucleotides of the 5’ end of the polynucleotide may optionally also be 2’-O-methylated.
  • 5’-decapping through hydrolysis and cleavage of the guanylate cap structure may target a nucleic acid molecule, such as an mRNA molecule, for degradation.
  • the nucleic acid molecules of the present disclosure comprise one or more alterations to the natural 5’-cap structure generated by the endogenous process.
  • a modification on the 5’-cap may increase the stability of polynucleotide, increase the half-life of the polynucleotide, and could increase the polynucleotide translational efficiency.
  • Exemplary alterations to the natural 5’-Cap structure include generation of a non-hydrolyzable cap structure preventing decapping and thus increasing polynucleotide half-life.
  • modified nucleotides may be used during the capping reaction.
  • a Vaccinia Capping Enzyme from New England Biolabs (Ipswich, Mass. ) may be used with ⁇ -thio-guanosine nucleotides according to the manufacturer’s instructions to create a phosphorothioate linkage in the 5’-ppp-5’ cap.
  • Additional modified guanosine nucleotides may be used, such as ⁇ -methyl-phosphonate and seleno-phosphate nucleotides.
  • Additional exemplary alterations to the natural 5’-Cap structure also include modification at the 2’-and/or 3’-position of a capped guanosine triphosphate (GTP) , areplacement of the sugar ring oxygen (that produced the carbocyclic ring) with a methylene moiety (CH 2 ) , a modification at the triphosphate bridge moiety of the cap structure, or a modification at the nucleobase (G) moiety.
  • GTP capped guanosine triphosphate
  • Additional exemplary alterations to the natural 5’-cap structure include, but are not limited to, 2’-O-methylation of the ribose sugars of 5’-terminal and/or 5’-anteterminal nucleotides of the polynucleotide (as mentioned above) on the 2’-hydroxy group of the sugar.
  • Multiple distinct 5’-cap structures can be used to generate the 5’-cap of a polynucleotide, such as an mRNA molecule.
  • Additional exemplary 5’-Cap structures that can be used in connection with the present disclosure further include those described in International Patent Publication Nos. WO2008127688, WO 2008016473, and WO 2011015347, the entire contents of each of which are incorporated herein by reference.
  • 5’-terminal caps can include cap analogs.
  • Cap analogs which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (i.e., endogenous, wild-type, or physiological) 5’-caps in their chemical structure, while retaining cap function.
  • Cap analogs may be chemically (i.e., non-enzymatically) or enzymatically synthesized and/linked to a polynucleotide.
  • the Anti-Reverse Cap Analog (ARCA) cap contains two guanosines linked by a 5’-5’-triphosphate group, wherein one guanosine contains an N7-methyl group as well as a 3’-O-methyl group (i.e., N7, 3’-O-dimethyl-guanosine-5’-triphosphate-5’-guanosine, m 7 G-3’ mppp-G, which may equivalently be designated3’ O-Me-m7G (5’) ppp (5’) G) .
  • N7, 3’-O-dimethyl-guanosine-5’-triphosphate-5’-guanosine, m 7 G-3’ mppp-G which may equivalently be designated3’ O-Me-m7G (5’) ppp (5’) G
  • the 3’-O atom of the other, unaltered, guanosine becomes linked to the 5’-terminal nucleotide of the capped polynucleotide (e.g., an mRNA) .
  • the N7-and 3’-O-methlyated guanosine provides the terminal moiety of the capped polynucleotide (e.g., mRNA) .
  • Another exemplary cap structure is mCAP, which is similar to ARCA but has a 2’-O-methyl group on guanosine (i.e., N7, 2’-O-dimethyl-guanosine-5’-triphosphate-5’-guanosine, m 7 Gm-ppp-G) .
  • a cap analog can be a dinucleotide cap analog.
  • the dinucleotide cap analog may be modified at different phosphate positions with a boranophosphate group or a phophoroselenoate group such as the dinucleotide cap analogs described in U.S. Patent No.: 8,519,110, the entire content of which is herein incorporated by reference in its entirety.
  • a cap analog can be a N7- (4-chlorophenoxyethyl) substituted dinucleotide cap analog known in the art and/or described herein.
  • Non-limiting examples of N7- (4-chlorophenoxyethyl) substituted dinucleotide cap analogs include a N7- (4-chlorophenoxyethyl) -G (5’) ppp (5’) G and a N7- (4-chlorophenoxyethyl) -m3’-OG (5’) ppp (5’) G cap analog (see, e.g., the various cap analogs and the methods of synthesizing cap analogs described in Kore et al.
  • a cap analog useful in connection with the nucleic acid molecules of the present disclosure is a 4-chloro/bromophenoxyethyl analog.
  • a cap analog can include a guanosine analog.
  • Useful guanosine analogs include but are not limited to inosine, N1-methyl-guanosine, 2’-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.
  • cap analogs allow for the concomitant capping of a polynucleotide in an in vitro transcription reaction, up to 20% of transcripts remain uncapped. This, as well as the structural differences of a cap analog from the natural 5’-cap structures of polynucleotides produced by the endogenous transcription machinery of a cell, may lead to reduced translational competency and reduced cellular stability.
  • a nucleic acid molecule of the present disclosure can also be capped post-transcriptionally, using enzymes, in order to generate more authentic 5’-cap structures.
  • the phrase “more authentic” refers to a feature that closely mirrors or mimics, either structurally or functionally, an endogenous or wild type feature. That is, a “more authentic” feature is better representative of an endogenous, wild-type, natural or physiological cellular function, and/or structure as compared to synthetic features or analogs of the prior art, or which outperforms the corresponding endogenous, wild-type, natural, or physiological feature in one or more respects.
  • Non-limiting examples of more authentic 5’-cap structures useful in connection with the nucleic acid molecules of the present disclosure are those which, among other things, have enhanced binding of cap binding proteins, increased half-life, reduced susceptibility to 5’-endonucleases, and/or reduced 5’-decapping, as compared to synthetic 5’-cap structures known in the art (or to a wild-type, natural or physiological 5’-cap structure) .
  • recombinant Vaccinia Virus Capping Enzyme and recombinant 2’-O-methyltransferase enzyme can create a canonical 5’-5’-triphosphate linkage between the 5’-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide wherein the cap guanosine contains an N7-methylation and the 5’-terminal nucleotide of the polynucleotide contains a 2’-O-methyl.
  • a structure is termed the Cap1 structure.
  • cap results in a higher translational-competency, cellular stability, and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5’ cap analog structures known in the art.
  • Other exemplary cap structures include 7mG (5’) ppp (5’) N, pN2p (Cap 0) , 7mG (5’) ppp (5’) NlmpNp (Cap 1) , 7mG (5’) -ppp (5’) NlmpN2mp (Cap 2) , and m (7) Gpppm (3) (6, 6, 2’) Apm (2’) Apm (2’) Cpm (2) (3, 2’) Up (Cap 4) .
  • nucleic acid molecules of the present disclosure can be capped post-transcriptionally, and because this process is more efficient, nearly 100%of the nucleic acid molecules may be capped.
  • the nucleic acid molecules of the present disclosure comprise one or more untranslated regions (UTRs) .
  • an UTR is positioned upstream to a coding region in the nucleic acid molecule, and is termed 5’-UTR.
  • an UTR is positioned downstream to a coding region in the nucleic acid molecule, and is termed 3’-UTR.
  • the sequence of an UTR can be homologous or heterologous to the sequence of the coding region found in a nucleic acid molecule.
  • Multiple UTRs can be included in a nucleic acid molecule and can be of the same or different sequences, and/or genetic origin. According to the present disclosure, any portion of UTRs in a nucleic acid molecule (including none) can be codon optimized and any may independently contain one or more different structural or chemical modification, before and/or after codon optimization.
  • a nucleic acid molecule of the present disclosure comprises UTRs and coding regions that are homologous with respect to each other.
  • a nucleic acid molecule of the present disclosure e.g., mRNA
  • a nucleic acid molecule comprising the UTR and a coding sequence of a detectable probe can be administered in vitro (e.g., cell or tissue culture) or in vivo (e.g., to a subject) , and an effect of the UTR sequence (e.g., modulation on the expression level, cellular localization of the encoded product, or half-life of the encoded product) can be measured using methods known in the art.
  • an effect of the UTR sequence e.g., modulation on the expression level, cellular localization of the encoded product, or half-life of the encoded product
  • the UTR of a nucleic acid molecule of the present disclosure comprises at least one translation enhancer element (TEE) that functions to increase the amount of polypeptide or protein produced from the nucleic acid molecule.
  • TEE translation enhancer element
  • the TEE is located in the 5’-UTR of the nucleic acid molecule.
  • the TEE is located at the 3’-UTR of the nucleic acid molecule.
  • at least two TEE are located at the 5’-UTR and 3’-UTR of the nucleic acid molecule respectively.
  • a nucleic acid molecule of the present disclosure can comprise one or more copies of a TEE sequence or comprise more than one different TEE sequences.
  • different TEE sequences that are present in a nucleic acid molecule of the present disclosure can be homologues or heterologous with respect to one another.
  • the TEE can be an internal ribosome entry site (IRES) , HCV-IRES or an IRES element. Chappell et al. Proc. Natl. Acad. Sci. USA 101: 9590-9594, 2004; Zhou et al. Proc. Natl. Acad. Sci. 102: 6273-6278, 2005. Additional internal ribosome entry site (IRES) that can be used in connection with the present disclosure include but are not limited to those described in U.S. Patent No. 7,468,275, U.S. Patent Publication No. 2007/0048776 and U.S. Patent Publication No.
  • the TEE can be those described in Supplemental Table 1 and in Supplemental Table 2 of Wellensiek et al Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug; 10 (8) : 747–750; the content of which is incorporated by reference in its entirety.
  • Additional exemplary TEEs that can be used in connection with the present disclosure include but are not limited to the TEE sequences disclosed in U.S. Patent No. 6,310,197, U.S. Patent No. 6,849,405, U.S. Patent No. 7,456,273, U.S. Patent No. 7,183,395, U.S. Patent Publication No. 2009/0226470, U.S. Patent Publication No. 2013/0177581, U.S. Patent Publication No. 2007/0048776, U.S. Patent Publication No. 2011/0124100, U.S. Patent Publication No. 2009/0093049, International Patent Publication No. WO2009/075886, International Patent Publication No. WO2012/009644, and International Patent Publication No.
  • a nucleic acid molecule of the present disclosure comprises at least one UTR that comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55 or more than 60 TEE sequences.
  • the TEE sequences in the UTR of a nucleic acid molecule are copies of the same TEE sequence.
  • At least two TEE sequences in the UTR of a nucleic acid molecule are of different TEE sequences.
  • multiple different TEE sequences are arranged in one or more repeating patterns in the UTR region of a nucleic acid molecule.
  • a repeating pattern can be, for example, ABABAB, AABBAABBAABB, ABCABCABC, or the like, where in these exemplary patterns, each capitalized letter (A, B, or C) represents a different TEE sequence.
  • at least two TEE sequences are consecutive with one another (i.e., no spacer sequence in between) in a UTR of a nucleic acid molecule.
  • a UTR can comprise a TEE sequence-spacer sequence module that is repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more than 9 times in the UTR.
  • the UTR can be a 5’-UTR, a 3’-UTR or both 5’-UTR and 3’-UTR of a nucleic acid molecule.
  • the UTR of a nucleic acid molecule of the present disclosure comprises at least one translation suppressing element that functions to decrease the amount of polypeptide or protein produced from the nucleic acid molecule.
  • the UTR of the nucleic acid molecule comprises one or more miR sequences or fragment thereof (e.g., miR seed sequences) that are recognized by one or more microRNA.
  • the UTR of the nucleic acid molecule comprises one or more stem-loop structure that downregulates translational activity of the nucleic acid molecule. Other mechanisms for suppressing translational activities associated with a nucleic acid molecules are known in the art.
  • the UTR can be a 5’-UTR, a 3’-UTR or both 5’-UTR and 3’-UTR of a nucleic acid molecule.
  • Table 4 shows exemplary 5’-UTR and 3’-UTR sequences that can be used in connection with the present disclosure.
  • the nucleic acid molecule of the present disclose comprises a 5’-UTR selected from SEQ ID NOS: 19-26. In specific embodiments, the nucleic acid molecule of the present disclose comprises a 3’-UTR selected from SEQ ID NOS: 27-34. In specific embodiments, the nucleic acid molecule of the present disclose comprises a 5’-UTR selected from SEQ ID NOS: 19-26 and a 3’-UTR selected from SEQ ID NOS: 27-34. In any of the embodiments described in this paragraph, the nucleic acid molecule may further comprise a coding region having a sequence as described herein, such as any of the DNA coding sequences in Tables 1 to 4 or equivalent RNA sequences thereof. In particular embodiments, the nucleic acid molecules described in this paragraph can be RNA molecules in vitro transcribed.
  • a n 150mer of A, or 110mer of A, for example.
  • poly-A region a long chain of adenosine nucleotides (poly-A region) is normally added to messenger RNA (mRNA) molecules to increase the stability of the molecule.
  • mRNA messenger RNA
  • poly-A polymerase adds a chain of adenosine nucleotides to the RNA.
  • the process called polyadenylation, adds a poly-A region that is between 100 and 250 residues long. Without being bound by the theory, it is contemplated that a poly-A region can confer various advantages to the nucleic acid molecule of the present disclosure.
  • a nucleic acid molecule of the present disclosure comprises a polyadenylation signal.
  • a nucleic acid molecule of the present disclosure comprises one or more polyadenylation (poly-A) regions.
  • a poly-A region is composed entirely of adenine nucleotides or functional analogs thereof.
  • the nucleic acid molecule comprises at least one poly-A region at its 3’-end.
  • the nucleic acid molecule comprises at least one poly-A region at its 5’-end.
  • the nucleic acid molecule comprises at least one poly-A region at its 5’-end and at least one poly-A region at its 3’-end.
  • the poly-A region can have varied lengths in different embodiments. Particularly, in some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 30 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 35 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 40 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 45 nucleotides in length.
  • the poly-A region of a nucleic acid molecule of the present disclosure is at least 50 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 55 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 60 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 65 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 70 nucleotides in length.
  • the poly-A region of a nucleic acid molecule of the present disclosure is at least 75 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 80 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 85 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 90 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 95 nucleotides in length.
  • the poly-A region of a nucleic acid molecule of the present disclosure is at least 100 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 110 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 120 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 130 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 140 nucleotides in length.
  • the poly-A region of a nucleic acid molecule of the present disclosure is at least 150 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 160 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 170 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 180 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 190 nucleotides in length.
  • the poly-A region of a nucleic acid molecule of the present disclosure is at least 200 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 225 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 250 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 275 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 300 nucleotides in length.
  • the poly-A region of a nucleic acid molecule of the present disclosure is at least 350 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 400 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 450 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 500 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 600 nucleotides in length.
  • the poly-A region of a nucleic acid molecule of the present disclosure is at least 700 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 800 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 900 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1000 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1100 nucleotides in length.
  • the poly-A region of a nucleic acid molecule of the present disclosure is at least 1200 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1300 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1400 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1500 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1600 nucleotides in length.
  • the poly-A region of a nucleic acid molecule of the present disclosure is at least 1700 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1800 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1900 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2000 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2250 nucleotides in length.
  • the poly-A region of a nucleic acid molecule of the present disclosure is at least 2500 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2750 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 3000 nucleotides in length.
  • length of a poly-A region in a nucleic acid molecule can be selected based on the overall length of the nucleic acid molecule, or a portion thereof (such as the length of the coding region or the length of an open reading frame of the nucleic acid molecule, etc. ) .
  • the poly-A region accounts for about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%or more of the total length of nucleic acid molecule containing the poly-A region.
  • RNA-binding proteins can bind to the poly-A region located at the 3’-end of an mRNA molecule.
  • These poly-A binding proteins PABP
  • PABP poly-A binding proteins
  • the nucleic acid molecule of the present disclosure comprises at least one binding site for poly-A binding protein (PABP) .
  • PABP poly-A binding protein
  • the nucleic acid molecule is conjugated or complex with a PABP before loaded into a delivery vehicle (e.g., lipid nanoparticles) .
  • the nucleic acid molecule of the present disclosure comprises a poly-A-G quartet.
  • the G-quartet is a cyclic hydrogen bonded array of four guanosine nucleotides that can be formed by G-rich sequences in both DNA and RNA.
  • the G-quartet is incorporated at the end of the poly-A region.
  • the resultant polynucleotides e.g., mRNA
  • the nucleic acid molecule of the present disclosure may include a poly-A region and may be stabilized by the addition of a 3’-stabilizing region.
  • the 3’-stabilizing region which may be used to stabilize a nucleic acid molecule (e.g., mRNA) including the poly-A or poly-A-G quartet structures as described in International Patent Publication No. WO2013/103659, the content of which is incorporated herein by reference in its entirety.
  • the 3’-stabilizing region which may be used in connection with the nucleic acid molecules of the present disclosure include a chain termination nucleoside such as but is not limited to 3’-deoxyadenosine (cordycepin) , 3’-deoxyuridine, 3’-deoxycytosine, 3’-deoxyguanosine, 3’-deoxythymine, 2’, 3’-dideoxynucleosides, such as 2’, 3’-dideoxyadenosine, 2’, 3’-dideoxyuridine, 2’, 3’-dideoxycytosine, 2’, 3’-dideoxyguanosine, 2’, 3’-dideoxythymine, a 2’-deoxynucleoside, or an O-methylnucleoside, 3’-deoxynucleoside, 2’, 3’-dideoxynucleoside 3’-O-methylnucleosides, 3’-O-ethyl
  • a stem-loop structure can direct RNA folding, protect structural stability of a nucleic acid molecule (e.g., mRNA) , provide recognition sites for RNA binding proteins, and serve as a substrate for enzymatic reactions.
  • a nucleic acid molecule e.g., mRNA
  • the incorporation of a miR sequence and/or a TEE sequence changes the shape of the stem loop region which may increase and/or decrease translation (Kedde et al. A Pumilio-induced RNA structure switch in p27-3’ UTR controls miR-221 and miR-222 accessibility. Nat Cell Biol., 2010 Oct; 12 (10) : 1014-20, the content of which is herein incorporated by reference in its entirety) .
  • the nucleic acid molecules as described herein may assume a stem-loop structure, such as but is not limited to a histone stem loop.
  • the stem-loop structure is formed from a stem-loop sequence that is about 25 or about 26 nucleotides in length such as, but not limited to, those as described in International Patent Publication No. WO2013/103659, the content of which is incorporated herein by reference in its entirety. Additional examples of stem-loop sequences include those described in International Patent Publication No. WO2012/019780 and International Patent Publication No. WO201502667, the contents of which are incorporated herein by reference.
  • the step-loop sequence comprises a TEE as described herein. In some embodiments, the step-loop sequence comprises a miR sequence as described herein. In specific embodiments, the stem loop sequence may include a miR-122 seed sequence. In specific embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 41) . In other embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 42) .
  • the nucleic acid molecule of the present disclosure comprises a stem-loop sequence located upstream (to the 5’-end) of the coding region in a nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 5’-UTR of the nucleic acid molecule. In some embodiments, the nucleic acid molecule of the present disclosure (e.g., mRNA) comprises a stem-loop sequence located downstream (to the 3’-end) of the coding region in a nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 3’-UTR of the nucleic acid molecule.
  • a nucleic acid molecule can contain more than one stem-loop sequences.
  • the nucleic acid molecule comprises at least one stem-loop sequence in the 5’-UTR, and at least one stem-loop sequence in the 3’-UTR.
  • a nucleic acid molecule comprising a stem-loop structure further comprises a stabilization region.
  • the stabilization region comprises at least one chain terminating nucleoside that functions to slow down degradation and thus increases the half-life of the nucleic acid molecule.
  • Exemplary chain terminating nucleoside that can be used in connection with the present disclosure include but are not limited to 3’-deoxyadenosine (cordycepin) , 3’-deoxyuridine, 3’-deoxycytosine, 3’-deoxyguanosine, 3’-deoxythymine, 2’, 3’-dideoxynucleosides, such as 2’, 3’-dideoxyadenosine, 2’, 3’-dideoxyuridine, 2’, 3’-dideoxycytosine, 2’, 3’-dideoxyguanosine, 2’, 3’-dideoxythymine, a 2’-deoxynucleoside, or an O-methylnucleoside, 3’-deoxynucleoside, 2’, 3’-dideoxynucleoside 3’-O-methylnucleosides, 3’-O-ethylnucleosides, 3’-arabinosides, and other alternative
  • a stem-loop structure may be stabilized by an alteration to the 3’-region of the polynucleotide that can prevent and/or inhibit the addition of oligio (U) (International Patent Publication No. WO2013/103659, incorporated herein by reference in its entirety) .
  • a nucleic acid molecule of the present disclosure comprises at least one stem-loop sequence and a poly-A region or polyadenylation signal.
  • Non-limiting examples of polynucleotide sequences comprising at least one stem-loop sequence and a poly-Aregion or a polyadenylation signal include those described in International Patent Publication No. WO2013/120497, International Patent Publication No. WO2013/120629, International Patent Publication No. WO2013/120500, International Patent Publication No. WO2013/120627, International Patent Publication No. WO2013/120498, International Patent Publication No. WO2013/120626, International Patent Publication No. WO2013/120499 and International Patent Publication No. WO2013/120628, the content of each of which is incorporated herein by reference in its entirety.
  • the nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal can encode for a pathogen antigen or fragment thereof such as the polynucleotide sequences described in International Patent Publication No. WO2013/120499 and International Patent Publication No. WO2013/120628, the content of each of which is incorporated herein by reference in its entirety.
  • the nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal can encode for a therapeutic protein such as the polynucleotide sequences described in International Patent Publication No. WO2013/120497 and International Patent Publication No. WO2013/120629, the content of each of which is incorporated herein by reference in its entirety.
  • the nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal can encode for a tumor antigen or fragment thereof such as the polynucleotide sequences described in International Patent Publication No. WO2013/120500 and International Patent Publication No. WO2013/120627, the content of each of which is incorporated herein by reference in its entirety.
  • the nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal can code for an allergenic antigen or an autoimmune self-antigen such as the polynucleotide sequences described in International Patent Publication No. WO2013/120498 and International Patent Publication No. WO2013/120626, the content of each of which is incorporated herein by reference in its entirety.
  • a payload nucleic acid molecule described herein contains only canonical nucleotides selected from A (adenosine) , G (guanosine) , C (cytosine) , U (uridine) , and T (thymidine) .
  • canonical nucleotides selected from A (adenosine) , G (guanosine) , C (cytosine) , U (uridine) , and T (thymidine) .
  • Examples of such as useful properties in the context of the present disclosure include but are not limited to increased stability of the nucleic acid molecule, reduced immunogenicity of the nucleic acid molecule in inducing innate immune responses, enhanced production of protein encoded by the nucleic acid molecule, increased intracellular delivery and/or retention of the nucleic acid molecule, and/or reduced cellular toxicity of the nucleic acid molecule, etc.
  • a payload nucleic acid molecule comprises at least one functional nucleotide analog as described herein.
  • the functional nucleotide analog contains at least one chemical modification to the nucleobase, the sugar group and/or the phosphate group.
  • a payload nucleic acid molecule comprising at least one functional nucleotide analog contains at least one chemical modification to the nucleobases, the sugar groups, and/or the internucleoside linkage. Exemplary chemical modifications to the nucleobases, sugar groups, or internucleoside linkages of a nucleic acid molecule are provided herein.
  • ranging from 0%to 100%of all nucleotides in a payload nucleic acid molecule can be functional nucleotide analogs as described herein.
  • afunctional nucleotide analog can be present at any position (s) of a nucleic acid molecule, including the 5’-terminus, 3’-terminus, and/or one or more internal positions.
  • a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and/or different types internucleoside linkages (e.g., backbone structures) .
  • nucleotide analogs as described herein.
  • all nucleotides of a kind e.g., all purine-containing nucleotides as a kind, or all pyrimidine-containing nucleotides as a kind, or all A, G, C, T or U as a kind
  • a payload nucleic acid molecule can be functional nucleotide analogs as described herein.
  • a functional nucleotide analog can be present at any position (s) of a nucleic acid molecule, including the 5’-terminus, 3’-terminus, and/or one or more internal positions.
  • a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and/or different types internucleoside linkages (e.g., backbone structures) .
  • a functional nucleotide analog contains a non-canonical nucleobase.
  • canonical nucleobases e.g., adenine, guanine, uracil, thymine, and cytosine
  • Exemplary modification to nucleobases include but are not limited to one or more substitutions or modifications including but not limited to alkyl, aryl, halo, oxo, hydroxyl, alkyloxy, and/or thio substitutions; one or more fused or open rings, oxidation, and/or reduction.
  • the non-canonical nucleobase is a modified uracil.
  • Exemplary nucleobases and nucleosides having an modified uracil include pseudouridine ( ⁇ ) , pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza-uracil, 2-thio-uracil (s 2 U) , 4-thio-uracil (s 4 U) , 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho 5 U) , 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo-uracil) , 3-methyl-uracil (m 3 U) , 5-methoxy-uracil (mo 5 U) , uracil 5-oxyacetic acid (cmo 5 U) , uracil
  • the non-canonical nucleobase is a modified cytosine.
  • exemplary nucleobases and nucleosides having a modified cytosine include 5-aza-cytosine, 6-aza-cytosine, pseudoisocytidine, 3-methyl-cytosine (m3C) , N4-acetyl-cytosine (ac4C) , 5-formyl-cytosine (f5C) , N4-methyl-cytosine (m4C) , 5-methyl-cytosine (m5C) , 5-halo-cytosine (e.g., 5- iodo-cytosine) , 5-hydroxymethyl-cytosine (hm5C) , 1-methyl-pseudoisocytidine, pyrrolo-cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C) , 2-thio-5-methyl-cytosine, 4-thio-p
  • the non-canonical nucleobase is a modified adenine.
  • Exemplary nucleobases and nucleosides having an alternative adenine include 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine) , 6-halo-purine (e.g., 6-chloro-purine) , 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1-methyl-adenine (m1A) , 2-methyl-adenine (m2A) , N6-methyl-adenine,
  • the non-canonical nucleobase is a modified guanine.
  • Exemplary nucleobases and nucleosides having a modified guanine include inosine (I) , 1-methyl-inosine (m1I) , wyosine (imG) , methylwyosine (mimG) , 4-demethyl-wyosine (imG-14) , isowyosine (imG2) , wybutosine (yW) , peroxywybutosine (o2yW) , hydroxywybutosine (OHyW) , undermodified hydroxywybutosine (OHyW*) , 7-deaza-guanine, queuosine (Q) , epoxyqueuosine (oQ) , galactosyl-queuosine (galQ) , mannosyl-queuosine (manQ) , 7-cyano-7
  • the non-canonical nucleobase of a functional nucleotide analog can be independently a purine, a pyrimidine, a purine or pyrimidine analog.
  • the non-canonical nucleobase can be modified adenine, cytosine, guanine, uracil, or hypoxanthine.
  • the non-canonical nucleobase can also include, for example, naturally-occurring and synthetic derivatives of a base, including pyrazolo [3, 4-d] pyrimidines, 5-methylcytosine (5-me-C) , 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil) , 4-thiouracil, 8-halo (e.g., 8-bromo) , 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8
  • a functional nucleotide analog contains a non-canonical sugar group.
  • the non-canonical sugar group can be a 5-carbon or 6-carbon sugar (such as pentose, ribose, arabinose, xylose, glucose, galactose, or a deoxy derivative thereof) with one or more substitutions, such as a halo group, a hydroxy group, a thiol group, an alkyl group, an alkoxy group, an alkenyloxy group, an alkynyloxy group, an cycloalkyl group, an aminoalkoxy group, an alkoxyalkoxy group, an hydroxyalkoxy group, an amino group, an azido group, an aryl group, an aminoalkyl group, an aminoalkenyl group, an aminoalkynyl group, etc.
  • RNA molecules contains the ribose sugar group, which is a 5-membered ring having an oxygen.
  • exemplary, non-limiting alternative nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene) ; addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl) ; ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane) ; ring expansion of ribose (e.g., to form a 6-or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino (that also has a phosphoramidate backbone
  • the sugar group contains one or more carbons that possess the opposite stereochemical configuration of the corresponding carbon in ribose.
  • a nucleic acid molecule can include nucleotides containing, e.g., arabinose or L-ribose, as the sugar.
  • the nucleic acid molecule includes at least one nucleoside wherein the sugar is L-ribose, 2’-O-methyl-ribose, 2’-fluoro-ribose, arabinose, hexitol, an LNA, or a PNA.
  • the payload nucleic acid molecule of the present disclosure can contain one or more modified internucleoside linkage (e.g., phosphate backbone) .
  • Backbone phosphate groups can be altered by replacing one or more of the oxygen atoms with a different substituent.
  • the functional nucleotide analogs can include the replacement of an unaltered phosphate moiety with another internucleoside linkage as described herein.
  • alternative phosphate groups include, but are not limited to, phosphorothioate, phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters.
  • Phosphorodithioates have both non-linking oxygens replaced by sulfur.
  • the phosphate linker can also be altered by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates) , sulfur (bridged phosphorothioates) , and carbon (bridged methylene-phosphonates) .
  • the alternative nucleosides and nucleotides can include the replacement of one or more of the non-bridging oxygens with a borane moiety (BH 3 ) , sulfur (thio) , methyl, ethyl, and/or methoxy.
  • a borane moiety BH 3
  • sulfur (thio) a sulfur (thio)
  • methyl ethyl
  • methoxy e.g., methyl, ethyl
  • methoxy e.g., a methoxy
  • two non-bridging oxygens at the same position e.g., the alpha ( ⁇ ) , beta ( ⁇ ) or gamma ( ⁇ ) position
  • a sulfur (thio) and a methoxy e.g., the alpha ( ⁇ ) , beta ( ⁇ ) or gamma ( ⁇ ) position
  • the replacement of one or more of the oxygen atoms at the position of the phosphate moiety is provided to confer stability (such as against exonucleases and endonucleases) to RNA and DNA through the unnatural phosphorothioate backbone linkages.
  • Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in a cellular environment.
  • internucleoside linkages that may be employed according to the present disclosure, including internucleoside linkages which do not contain a phosphorous atom, are described herein.
  • nucleic acid molecules e.g., mRNA
  • compositions, formulations and/or methods associated therewith that can be used in connection with the present disclosure further include those described in WO2002/098443, WO2003/051401, WO2008/052770, WO2009127230, WO2006122828, WO2008/083949, WO2010088927, WO2010/037539, WO2004/004743, WO2005/016376, WO2006/024518, WO2007/095976, WO2008/014979, WO2008/077592, WO2009/030481, WO2009/095226, WO2011069586, WO2011026641, WO2011/144358, WO2012019780, WO2012013326, WO2012089338, WO2012113513, WO2012116811, WO2012116810, WO2013113502, WO2013113501, WO2013113736, WO2013143698
  • nucleic acid molecules as described herein can by isolated or synthesized using methods known in the art.
  • DNA or RNA molecules to be used in connection with the present disclosure are chemically synthesized.
  • DNA or RNA molecules to be used in connection with the present disclosure are isolated from a natural source.
  • mRNA molecules to be used in connection with the present disclosure are biosynthesized using a host cell.
  • an mRNA is produced by transcribing a corresponding DNA sequencing using a host cell.
  • aDNA sequence encoding an mRNA sequence is incorporated into an expression vector, which vector is then introduced into a host cell (e.g., E. coli) using methods known in the art. The host cell is then cultured under a suitable condition to produce mRNA transcripts.
  • a cell-free (in vitro) transcription system comprising enzymes of the transcription machinery of a host cell can be used to produce mRNA transcripts.
  • An exemplary cell-free transcription reaction system is described in the present disclosure.
  • nucleic acid molecules described herein are formulated for in vitro and in vivo delivery.
  • the nucleic acid molecule is formulated into a lipid-containing composition.
  • the lipid-containing composition forms lipid nanoparticles enclosing the nucleic acid molecule within a lipid shell.
  • the lipid shells protects the nucleic acid molecules from degradation.
  • the lipid nanoparticles also facilitate transportation of the enclosed nucleic acid molecules into intracellular compartments and/or machinery to exert an intended therapeutic of prophylactic function.
  • nucleic acids when present in the lipid nanoparticles, are resistant in aqueous solution to degradation with a nuclease.
  • Lipid nanoparticles comprising nucleic acids and their method of preparation are known in the art, such as those disclosed in, e.g., U.S. Patent Publication No. 2004/0142025, U.S. Patent Publication No. 2007/0042031, PCT Publication No. WO 2017/004143, PCT Publication No. WO 2015/199952, PCT Publication No. WO 2013/016058, and PCT Publication No. WO 2013/086373, the full disclosures of each of which are herein incorporated by reference in their entirety for all purposes.
  • the largest dimension of a nanoparticle composition provided herein is 1 ⁇ m or shorter (e.g., ⁇ 1 ⁇ m, ⁇ 900 nm, ⁇ 800 nm, ⁇ 700 nm, ⁇ 600 nm, ⁇ 500 nm, ⁇ 400 nm, ⁇ 300 nm, ⁇ 200 nm, ⁇ 175 nm, ⁇ 150 nm, ⁇ 125 nm, ⁇ 100 nm, ⁇ 75 nm, ⁇ 50 nm, or shorter) , such as when measured by dynamic light scattering (DLS) , transmission electron microscopy, scanning electron microscopy, or another method.
  • the lipid nanoparticle provided herein has at least one dimension that is in the range of from about 40 to about 200 nm. In one embodiment, the at least one dimension is in the range of from about 40 to about 100 nm.
  • Nanoparticle compositions that can be used in connection with the present disclosure include, for example, lipid nanoparticles (LNPs) , nano liproprotein particles, liposomes, lipid vesicles, and lipoplexes.
  • nanoparticle compositions are vesicles including one or more lipid bilayers.
  • a nanoparticle composition includes two or more concentric bilayers separated by aqueous compartments. Lipid bilayers may be functionalized and/or crosslinked to one another. Lipid bilayers may include one or more ligands, proteins, or channels.
  • nanoparticle compositions as described comprise a lipid component including at least one lipid, such as a compound according to one of Series 01-07 of lipids (and sub-formulas thereof) as described herein.
  • ananoparticle composition may include a lipid component including one of compounds provided herein.
  • Nanoparticle compositions may also include one or more other lipid or non-lipid components as described below.
  • Cationic lipids include the following Series 01-04 of lipids (and sub-formulas thereof) .
  • G 1 and G 2 are each independently a bond, C 2 -C 12 alkylene, or C 2 -C 12 alkenylene, wherein one or more-CH 2 -in the alkylene or alkenylene is optionally replaced by-O-;
  • R 1 and R 2 are each independently C 6 -C 32 alkyl or C 6 -C 32 alkenyl
  • R a , R b , R d , and R e are each independently H, C 1 -C 24 alkyl, or C 2 -C 24 alkenyl;
  • R c and R f are each independently C 1 -C 32 alkyl or C 2 -C 32 alkenyl
  • G 3 is C 2 -C 24 alkylene, C 2 -C 24 alkenylene, C 3 -C 8 cycloalkylene, or C 3 -C 8 cycloalkenylene;
  • R 3 is-N (R 4 ) R 5 ;
  • R 4 is C 3 -C 8 cycloalkyl, C 3 -C 8 cycloalkenyl, 4-to 8-membered heterocyclyl, or C 6 -C 10 aryl; or R 4 , G 3 or part of G 3 , together with the nitrogen to which they are attached form a cyclic moiety;
  • R 5 is C 1 -C 12 alkyl or C 3 -C 8 cycloalkyl; or R 4 , R 5 , together with the nitrogen to which they are attached form a cyclic moiety;
  • x 0, 1 or 2;
  • alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocyclyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
  • G 1 and G 2 are each independently a bond, C 2 -C 12 alkylene, or C 2 -C 12 alkenylene, wherein one or more-CH 2 -in the alkylene or alkenylene is optionally replaced by-O-;
  • R 1 and R 2 are each independently C 6 -C 32 alkyl or C 6 -C 32 alkenyl
  • R a , R b , R d , and R e are each independently H, C 1 -C 24 alkyl, or C 2 -C 24 alkenyl;
  • R c and R f are each independently C 1 -C 32 alkyl or C 2 -C 32 alkenyl
  • G 4 is a bond, C 1 -C 23 alkylene, C 2 -C 23 alkenylene, C 3 -C 8 cycloalkylene, or C 3 -C 8 cycloalkenylene;
  • R 3 is-N (R 4 ) R 5 ;
  • R 4 is C 1 -C 12 alkyl, C 3 -C 8 cycloalkyl, C 3 -C 8 cycloalkenyl, 4-to 8-membered heterocyclyl, or C 6 -C 10 aryl; or R 4 , G 3 or part of G 3 , together with the nitrogen to which they are attached form a cyclic moiety;
  • R 5 is C 1 -C 12 alkyl or C 3 -C 8 cycloalkyl; or R 4 , R 5 , together with the nitrogen to which they are attached form a cyclic moiety;
  • x 0, 1 or 2;
  • alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocyclyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
  • the compound is a compound in Table 6, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
  • G 1 and G 2 are each independently a bond, C 2 -C 12 alkylene, or C 2 -C 12 alkenylene, wherein one or more-CH 2 -in G 1 and G 2 is optionally replaced by-O-;
  • R 1 and R 2 are each independently C 6 -C 24 alkyl or C 6 -C 24 alkenyl
  • R a , R b , R d , and R e are each independently H, C 1 -C 24 alkyl, or C 2 -C 24 alkenyl;
  • R c and R f are each independently C 1 -C 24 alkyl or C 2 -C 24 alkenyl
  • G 3 is C 2 -C 12 alkylene or C 2 -C 12 alkenylene, wherein part or all of alkylene or alkenylene is optionally replaced by C 3 -C 8 cycloalkylene, C 3 -C 8 cycloalkenylene, C 3 -C 8 cycloalkynylene, 4-to 8-membered heterocyclylene, C 6 -C 10 arylene, or 5-to 10-membered heteroarylene;
  • R 3 is hydrogen, C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 2 -C 12 alkynyl, C 3 -C 8 cycloalkyl, C 3 -C 8 cycloalkenyl, C 3 -C 8 cycloalkynyl, 4-to 8-membered heterocyclyl, C 6 -C 10 aryl, or 5-to 10-membered heteroaryl; or R 3 , G 1 or part of G 1 , together with the nitrogen to which they are attached form a cyclic moiety; or R 3 , G 3 or part of G 3 , together with the nitrogen to which they are attached form a cyclic moiety;
  • R 4 is C 1 -C 12 alkyl or C 3 -C 8 cycloalkyl
  • x 0, 1, or 2;
  • n 1 or 2;
  • n 1 or 2;
  • alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, cycloalkynylene, heterocyclylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
  • the compound is a compound in Table 7, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
  • G 1 and G 2 are each independently a bond, C 2 -C 12 alkylene, or C 2 -C 12 alkenylene;
  • R 1 and R 2 are each independently C 5 -C 32 alkyl or C 5 -C 32 alkenyl
  • R a , R b , R d , and R e are each independently H, C 1 -C 24 alkyl, or C 2 -C 24 alkenyl;
  • R c and R f are each independently C 1 -C 32 alkyl or C 2 -C 32 alkenyl
  • R 0 is C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 3 -C 8 cycloalkyl, C 3 -C 8 cycloalkenyl, C 6 -C 10 aryl, or 4-to 8-membered heterocycloalkyl;
  • G 3 is C 2 -C 12 alkylene or C 2 -C 12 alkenylene
  • R 4 is C 1 -C 12 alkyl, C 2 -C 12 alkenyl, C 3 -C 8 cycloalkyl, C 3 -C 8 cycloalkenyl, C 6 -C 10 aryl, or 4-to 8-membered heterocycloalkyl;
  • R 5 is C 1 -C 12 alkyl, C 3 -C 8 cycloalkyl, C 3 -C 8 cycloalkenyl, C 6 -C 10 aryl, or 4-to 8-membered heterocycloalkyl;
  • x 0, 1, or 2;
  • s is 0 or 1;
  • each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, alkylene, alkenylene, arylene, and heteroarylene, is independently optionally substituted.
  • the compound is a compound in Table 8, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
  • any embodiment of the compounds provided herein, as set forth above, and any specific substituent and/or variable in the compound provided herein, as set forth above, may be independently combined with other embodiments and/or substituents and/or variables of the compounds to form embodiments not specifically set forth above.
  • substituents and/or variables may be listed for any particular group or variable, it is understood that each individual substituent and/or variable may be deleted from the particular embodiment and/or claim and that the remaining list of substituents and/or variables will be considered to be within the scope of embodiments provided herein.
  • the LNP comprises one or more polymer conjugated lipids, such as PEGylated lipids (PEG lipids) .
  • PEG lipids PEGylated lipids
  • a polymer conjugated lipid component in a nanoparticle composition can improve of colloidal stability and/or reduce protein absorption of the nanoparticles.
  • Exemplary cationic lipids that can be used in connection with the present disclosure include but are not limited to PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof.
  • a PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, Ceramide-PEG2000, or Chol-PEG2000.
  • the polymer conjugated lipid is a pegylated lipid.
  • some embodiments include a pegylated diacylglycerol (PEG-DAG) such as 1- (monomethoxy-polyethyleneglycol) -2, 3-dimyristoylglycerol (PEG-DMG) , a pegylated phosphatidylethanoloamine (PEG-PE) , a PEG succinate diacylglycerol (PEG-S-DAG) such as 4-O- (2’, 3’-di (tetradecanoyloxy) propyl-1-O- ( ⁇ -methoxy (polyethoxy) ethyl) butanedioate (PEG-S-DMG) , a pegylated ceramide (PEG-cer) , or a PEG dialkoxypropylcarbamate such as ⁇ -methoxy (polyethoxy) ethyl
  • the polymer conjugated lipid is present in a concentration ranging from 1.0 to 2.5 molar percent. In one embodiment, the polymer conjugated lipid is present in a concentration of about 1.7 molar percent. In one embodiment, the polymer conjugated lipid is present in a concentration of about 1.5 molar percent.
  • the molar ratio of cationic lipid to the polymer conjugated lipid ranges from about 35: 1 to about 25: 1. In one embodiment, the molar ratio of cationic lipid to polymer conjugated lipid ranges from about 100: 1 to about 20: 1.
  • the molar ratio of cationic lipid to the polymer conjugated lipid ranges from about 35: 1 to about 25: 1. In one embodiment, the molar ratio of cationic lipid to polymer conjugated lipid ranges from about 100: 1 to about 20: 1.
  • the pegylated lipid has the following Formula:
  • R 12 and R 13 are each independently a straight or branched, saturated or unsaturated alkyl chain containing from 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester bonds; and w has a mean value ranging from 30 to 60.
  • R 12 and R 13 are each independently straight, saturated alkyl chains containing from 12 to 16 carbon atoms.
  • the average w ranges from 42 to 55, for example, the average w is 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55. In some specific embodiments, the average w is about49.
  • the pegylated lipid has the following Formula:
  • Polymer conjugated lipids also include the following Series 05 of lipids (and sub-formulas thereof) .
  • the polymer conjugated lipid is a compound of Formula (05-I) :
  • L is a lipid
  • X is a linker
  • each R 3 is independently H or C 1 -C 6 alkyl
  • each Y 1 is independently a bond, O, S, or NR a ;
  • each G 4 is independently a bond or C 1 -C 12 alkylene, wherein one or more-CH 2 -is independently optionally replaced by-O-, -S-, or-NR a -;
  • each G 5 is independently a bond or C 1 -C 12 alkylene, wherein one or more-CH 2 -is independently optionally replaced by-O-, -S-, or-NR a -;
  • each R a is independently H, C 1 -C 12 alkyl, or C 2 -C 12 alkenyl
  • one of Z 1 and Z 2 is a positively charged moiety and the other of Z 1 and Z 2 is a negatively charged moiety;
  • n is an integer from 2 to 100;
  • each alkyl, alkenyl, alkylene, aryl, and heteroaryl is independently optionally substituted.
  • any embodiment of the compounds provided herein, as set forth above, and any specific substituent and/or variable in the compound provided herein, as set forth above, may be independently combined with other embodiments and/or substituents and/or variables of the compounds to form embodiments not specifically set forth above.
  • substituents and/or variables may be listed for any particular group or variable, it is understood that each individual substituent and/or variable may be deleted from the particular embodiment and/or claim and that the remaining list of substituents and/or variables will be considered to be within the scope of embodiments provided herein.
  • the lipid component of a nanoparticle composition can include one or more structural lipids.
  • structural lipids can stabilize the amphiphilic structure of a nanoparticle, such as but not limited to the lipid bilayer structure of a nanoparticle.
  • Exemplary structural lipids that can be used in connection with the present disclosure include but are not limited to cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, and mixtures thereof.
  • the structural lipid is cholesterol.
  • the structural lipid includes cholesterol and a corticosteroid (such as prednisolone, dexamethasone, prednisone, and hydrocortisone) , or a combination thereof.
  • the lipid nanoparticles provided herein comprise a steroid or steroid analogue.
  • the steroid or steroid analogue is cholesterol.
  • the steroid is present in a concentration ranging from 39 to 49 molar percent, 40 to 46 molar percent, from40 to 44 molar percent, from40 to 42 molar percent, from42 to 44 molar percent, or from44 to 46 molar percent.
  • the steroid is present in a concentration of 40, 41, 42, 43, 44, 45, or 46 molar percent.
  • the molar ratio of cationic lipid to the steroid ranges from 1.0: 0.9 to 1.0: 1.2, or from 1.0: 1.0 to 1.0: 1.2. In one embodiment, the molar ratio of cationic lipid to cholesterol ranges from about 5: 1 to 1: 1. In one embodiment, the steroid is present in a concentration ranging from 32 to 40 mol percent of the steroid.
  • the molar ratio of cationic lipid to the steroid ranges from 1.0: 0.9 to 1.0: 1.2, or from 1.0: 1.0 to 1.0: 1.2. In one embodiment, the molar ratio of cationic lipid to cholesterol ranges from about 5: 1 to 1: 1. In one embodiment, the steroid is present in a concentration ranging from 32 to 40 mol percent of the steroid.
  • the lipid component of a nanoparticle composition can include one or more phospholipids, such as one or more (poly) unsaturated lipids.
  • phospholipids may assemble into one or more lipid bilayers structures.
  • Exemplary phospholipids that can form part of the present nanoparticle composition include but are not limited to 1, 2-distearoyl-sn-glycero-3-phosphocholine (DSPC) , 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) , 1, 2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC) , 1, 2-dimyristoyl-sn-glycero-phosphocholine (DMPC) , 1, 2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) , 1, 2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) , 1, 2-diundecanoyl-sn-glycero-phosphocholine (DUPC) , 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) , 1, 2-di-O
  • Additional exemplary neutral lipids include, for example, dipalmitoylphosphatidylglycerol (DPPG) , palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4- (N-maleimidomethyl) -cyclohexane-1carboxylate (DOPE-mal) , dipalmitoyl phosphatidyl ethanolamine (DPPE) , dimyristoylphosphoethanolamine (DMPE) , distearoyl-phosphatidylethanolamine (DSPE) , 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearioyl-2-oleoylphosphatidyethanol amine (SOPE) , and 1, 2-dielaidoyl-sn-glycero-3-phophoethanolamine (transDOPE) .
  • DPPG dipalmitoylphosphatidylglycerol
  • the neutral lipid is 1, 2-distearoyl-sn-glycero-3phosphocholine (DSPC) .
  • the neutral lipid is selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM.
  • the neutral lipid is phosphatidylcholine (PC) , phosphatidylethanolamine (PE) phosphatidylserine (PS) , phosphatidic acid (PA) , or phosphatidylglycerol (PG) .
  • PC phosphatidylcholine
  • PE phosphatidylethanolamine
  • PS phosphatidylserine
  • PA phosphatidic acid
  • PG phosphatidylglycerol
  • phospholipids that can form part of the present nanoparticle composition also include those described in WO2017/112865, the entire content of which is hereby incorporated by reference in its entirety.
  • nanoparticle compositions described herein can include at least one lipid component and one or more additional components, such as a therapeutic and/or prophylactic agent (e.g., the therapeutic nucleic acid described herein) .
  • Ananoparticle composition may be designed for one or more specific applications or targets.
  • the elements of a nanoparticle composition may be selected based on a particular application or target, and/or based on the efficacy, toxicity, expense, ease of use, availability, or other feature of one or more elements.
  • the particular formulation of a nanoparticle composition may be selected for a particular application or target according to, for example, the efficacy and toxicity of particular combinations of elements.
  • the lipid component of a nanoparticle composition may include, for example, a lipid according to one of formulae (I) to (IV) (and sub-formulas thereof) described herein, a phospholipid (such as an unsaturated lipid, e.g., DOPE or DSPC) , a PEG lipid, and a structural lipid.
  • a phospholipid such as an unsaturated lipid, e.g., DOPE or DSPC
  • PEG lipid e.g., PEG lipid
  • structural lipid e.g., a structural lipid.
  • the elements of the lipid component may be provided in specific fractions.
  • a nanoparticle compositions comprising a cationic or ionizable lipid compound provided herein, a therapeutic agent, and one or more excipients.
  • cationic or ionizable lipid compound comprises a compound according to one of Formulae (I) to (IV) (and sub-formulas thereof) as described herein, and optionally one or more additional ionizable lipid compounds.
  • the one or more excipients are selected from neutral lipids, steroids, and polymer conjugated lipids.
  • the therapeutic agent is encapsulated within or associated with the lipid nanoparticle.
  • nanoparticle composition comprising:
  • mol percent refers to a component’s molar percentage relative to total mols of all lipid components in the LNP (i.e., total mols of cationic lipid (s) , the neutral lipid, the steroid and the polymer conjugated lipid) .
  • the lipid nanoparticle comprises from 41 to 49 mol percent, from 41 to 48 mol percent, from 42 to 48 mol percent, from 43 to 48 mol percent, from 44 to 48 mol percent, from 45 to 48 mol percent, from 46 to 48 mol percent, or from 47.2 to 47.8 mol percent of the cationic lipid. In one embodiment, the lipid nanoparticle comprises about 47.0, 47.1, 47.2, 47.3, 47.4, 47.5, 47.6, 47.7, 47.8, 47.9 or 48.0 mol percent of the cationic lipid.
  • the neutral lipid is present in a concentration ranging from 5 to 15 mol percent, 7 to 13 mol percent, or 9 to 11 mol percent. In one embodiment, the neutral lipid is present in a concentration of about 9.5, 10 or 10.5 mol percent. In one embodiment, the molar ratio of the cationic lipid to the neutral lipid ranges from about 4.1: 1.0 to about 4.9: 1.0, from about 4.5: 1.0 to about 4.8: 1.0, or from about 4.7: 1.0 to 4.8: 1.0.
  • the steroid is present in a concentration ranging from 39 to 49 molar percent, 40 to 46 molar percent, from 40 to 44 molar percent, from 40 to 42 molar percent, from 42 to 44 molar percent, or from 44 to 46 molar percent. In one embodiment, the steroid is present in a concentration of 40, 41, 42, 43, 44, 45, or 46 molar percent. In one embodiment, the molar ratio of cationic lipid to the steroid ranges from 1.0: 0.9 to 1.0: 1.2, or from 1.0: 1.0 to 1.0: 1.2. In one embodiment, the steroid is cholesterol.
  • the therapeutic agent to lipid ratio in the LNP i.e., N/P, were N represents the moles of cationic lipid and P represents the moles of phosphate present as part of the nucleic acid backbone
  • N/P ranges from 6: 1 to 20: 1 or 2: 1 to 12: 1.
  • Exemplary N/P ranges include about 3: 1. About 6: 1, about 12: 1 and about 22: 1.
  • lipid nanoparticle comprising:
  • a cationic lipid having an effective pKa greater than 6.0; ii) from 5 to 15 mol percent of a neutral lipid;
  • a therapeutic agent or a pharmaceutically acceptable salt or prodrug thereof, wherein the mol percent is determined based on total mol of lipid present in the lipid nanoparticle.
  • the cationic lipid can be any of a number of lipid species which carry a net positive charge at a selected pH, such as physiological pH. Exemplary cationic lipids are described herein below.
  • the cationic lipid has a pKa greater than 6.25.
  • the cationic lipid has a pKa greater than 6.5.
  • the cationic lipid has a pKa greater than 6.1, greater than 6.2, greater than 6.3, greater than 6.35, greater than 6.4, greater than 6.45, greater than 6.55, greater than 6.6, greater than 6.65, or greater than 6.7.
  • the lipid nanoparticle comprises from 40 to 45 mol percent of the cationic lipid. In one embodiment, the lipid nanoparticle comprises from 45 to 50 mole percent of the cationic lipid.
  • the molar ratio of the cationic lipid to the neutral lipid ranges from about 2: 1 to about 8: 1. In one embodiment, the lipid nanoparticle comprises from 5 to 10 mol percent of the neutral lipid.
  • Exemplary anionic lipids include, but are not limited to, phosphatidylglycerol, dioleoylphosphatidylglycerol (DOPG) , dipalmitoylphosphatidylglycerol (DPPG) or 1, 2-distearoyl-sn-glycero-3-phospho- (1'-rac-glycerol) (DSPG) .
  • DOPG dioleoylphosphatidylglycerol
  • DPPG dipalmitoylphosphatidylglycerol
  • DSPG 1, 2-distearoyl-sn-glycero-3-phospho- (1'-rac-glycerol
  • the lipid nanoparticle comprises from 1 to 10 mole percent of the anionic lipid. In one embodiment, the lipid nanoparticle comprises from 1 to 5 mole percent of the anionic lipid. In one embodiment, the lipid nanoparticle comprises from 1 to 9 mole percent, from 1 to 8 mole percent, from 1 to 7 mole percent, or from 1 to 6 mole percent of the anionic lipid. In one embodiment, the mol ratio of anionic lipid to neutral lipid ranges from 1: 1 to 1: 10.
  • the steroid cholesterol In one embodiment, the steroid cholesterol. In one embodiment, the molar ratio of the cationic lipid to cholesterol ranges from about 5: 1 to 1: 1. In one embodiment, the lipid nanoparticle comprises from 32 to 40 mol percent of the steroid.
  • the sum of the mol percent of neutral lipid and mol percent of anionic lipid ranges from 5 to 15 mol percent. In one embodiment, wherein the sum of the mol percent of neutral lipid and mol percent of anionic lipid ranges from 7 to 12 mol percent.
  • the mol ratio of anionic lipid to neutral lipid ranges from 1: 1 to 1: 10. In one embodiment, the sum of the mol percent of neutral lipid and mol percent steroid ranges from 35 to 45 mol percent.
  • the lipid nanoparticle comprises:
  • the lipid nanoparticle comprises from 1.0 to 2.5 mol percent of the conjugated lipid. In one embodiment, the polymer conjugated lipid is present in a concentration of about 1.5 mol percent.
  • the neutral lipid is present in a concentration ranging from 5 to 15 mol percent, 7 to 13 mol percent, or 9 to 11 mol percent. In one embodiment, the neutral lipid is present in a concentration of about 9.5, 10 or 10.5 mol percent. In one embodiment, the molar ratio of the cationic lipid to the neutral lipid ranges from about 4.1: 1.0 to about 4.9: 1.0, from about 4.5: 1.0 to about 4.8: 1.0, or from about 4.7: 1.0 to 4.8: 1.0.
  • the steroid is cholesterol. In some embodiments, the steroid is present in a concentration ranging from 39 to 49 molar percent, 40 to 46 molar percent, from 40 to 44 molar percent, from 40 to 42 molar percent, from 42 to 44 molar percent, or from 44 to 46 molar percent. In one embodiment, the steroid is present in a concentration of 40, 41, 42, 43, 44, 45, or 46 molar percent. In certain embodiments, the molar ratio of cationic lipid to the steroid ranges from 1.0: 0.9 to 1.0: 1.2, or from 1.0: 1.0 to 1.0: 1.2.
  • the molar ratio of cationic lipid to steroid ranges from 5: 1 to 1: 1.
  • the lipid nanoparticle comprises from 1.0 to 2.5 mol percent of the conjugated lipid. In one embodiment, the polymer conjugated lipid is present in a concentration of about 1.5 mol percent.
  • the molar ratio of cationic lipid to polymer conjugated lipid ranges from about 100: 1 to about 20: 1. In one embodiment, the molar ratio of cationic lipid to the polymer conjugated lipid ranges from about 35: 1 to about 25: 1.
  • the molar ratio of cationic lipid to polymer conjugated lipid ranges from about 100: 1 to about 20: 1. In one embodiment, the molar ratio of cationic lipid to the polymer conjugated lipid ranges from about 35: 1 to about 25: 1.
  • the lipid nanoparticle has a mean diameter ranging from 50 nm to 100 nm, or from 60 nm to 85 nm.
  • the composition comprises a cationic lipid provided herein, DSPC, cholesterol, and PEG-lipid, and mRNA.
  • the a cationic lipid provided herein, DSPC, cholesterol, and PEG-lipid are at a molar ratio of about 50: 10: 38.5: 1.5.
  • Nanoparticle compositions can be designed for one or more specific applications or targets.
  • a nanoparticle composition can be designed to deliver a therapeutic and/or prophylactic agent such as an RNA to a particular cell, tissue, organ, or system or group thereof in a mammal’s body.
  • Physiochemical properties of nanoparticle compositions can be altered in order to increase selectivity for particular bodily targets. For instance, particle sizes can be adjusted based on the fenestration sizes of different organs.
  • the therapeutic and/or prophylactic agent included in a nanoparticle composition can also be selected based on the desired delivery target or targets.
  • ananoparticle composition can include an mRNA encoding a polypeptide of interest capable of being translated within a cell to produce the polypeptide of interest.
  • a composition can be designed to be specifically delivered to a particular organ.
  • acomposition can be designed to be specifically delivered to a mammalian liver.
  • the amount of a therapeutic and/or prophylactic agent in a nanoparticle composition can depend on the size, composition, desired target and/or application, or other properties of the nanoparticle composition as well as on the properties of the therapeutic and/or prophylactic agent.
  • the amount of an RNA useful in a nanoparticle composition can depend on the size, sequence, and other characteristics of the RNA.
  • the relative amounts of a therapeutic and/or prophylactic agent and other elements (e.g., lipids) in a nanoparticle composition can also vary.
  • the wt/wt ratio of the lipid component to a therapeutic and/or prophylactic agent in a nanoparticle composition can be from about 5: 1 to about 60: 1, such as about 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, 10: 1, 11: 1, 12: 1, 13: 1, 14: 1, 15: 1, 16: 1, 17: 1, 18: 1, 19: 1, 20: 1, 22: 1, 25: 1, 30: 1, 35: 1, 40: 1, 45: 1, 50: 1, and 60: 1.
  • the wt/wt ratio of the lipid component to a therapeutic and/or prophylactic agent can be from about 10: 1 to about 40: 1.
  • the wt/wt ratio is about 20: 1.
  • the amount of a therapeutic and/or prophylactic agent in a nanoparticle composition can, for example, be measured using absorption spectroscopy (e.g., ultraviolet-visible spectroscopy) .
  • a nanoparticle composition includes one or more RNAs, and the one or more RNAs, lipids, and amounts thereof can be selected to provide a specific N: P ratio.
  • the N: P ratio of the composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in an RNA. In some embodiments, a lower N: P ratio is selected.
  • the one or more RNA, lipids, and amounts thereof can be selected to provide an N: P ratio from about 2: 1 to about 30: 1, such as 2: 1, 3: 1, 4: 1, 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, 10: 1, 12: 1, 14: 1, 16: 1, 18: 1, 20: 1, 22: 1, 24: 1, 26: 1, 28: 1, or 30: 1.
  • the N: P ratio can be from about 2: 1 to about 8: 1.
  • the N: P ratio is from about 5: 1 to about 8: 1.
  • the N: P ratio may be about 5.0: 1, about 5.5: 1, about 5.67: 1, about 6.0: 1, about 6.5: 1, or about 7.0: 1.
  • the N: P ratio may be about 5.67: 1.
  • the physical properties of a nanoparticle composition can depend on the components thereof.
  • a nanoparticle composition including cholesterol as a structural lipid can have different characteristics compared to a nanoparticle composition that includes a different structural lipid.
  • the characteristics of a nanoparticle composition can depend on the absolute or relative amounts of its components. For instance, a nanoparticle composition including a higher molar fraction of a phospholipid may have different characteristics than a nanoparticle composition including a lower molar fraction of a phospholipid. Characteristics may also vary depending on the method and conditions of preparation of the nanoparticle composition.
  • Nanoparticle compositions may be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) may be used to examine the morphology and size distribution of a nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titrations) may be used to measure zeta potentials. Dynamic light scattering may also be utilized to determine particle sizes. Instruments such as the Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, Worcestershire, UK) may also be used to measure multiple characteristics of a nanoparticle composition, such as particle size, polydispersity index, and zeta potential.
  • microscopy e.g., transmission electron microscopy or scanning electron microscopy
  • Dynamic light scattering or potentiometry e.g., potentiometric titrations
  • Dynamic light scattering may also be utilized to determine particle sizes.
  • Instruments such as the Ze
  • the mean size of a nanoparticle composition can be between 10s of nm and 100s of nm.
  • the mean size can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm.
  • the mean size of a nanoparticle composition can be from about 50 nm to about 100 nm, from about 50 nm to about 90 nm, from about 50 nm to about 80 nm,from about 50 nm to about 70 nm, from about 50 nm to about 60 nm, from about 60 nm to about 100 nm, from about 60 nm to about 90 nm, from about 60 nm to about 80 nm, from about 60 nm to about 70 nm, from about 70 nm to about 100 nm, from about 70 nm to about 90 nm, from about 70 nm to about 80 nm, from about 80 nm to about 100 nm, from about 80 nm to about 90 nm, or from about 90 nm to about 100 nm.
  • the mean size of a nanoparticle composition can be from about 70 nm to about 100 nm. In some embodiments, the mean size can be about 80
  • a nanoparticle composition can be relatively homogenous.
  • a polydispersity index can be used to indicate the homogeneity of a nanoparticle composition, e.g., the particle size distribution of the nanoparticle compositions.
  • a small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution.
  • a nanoparticle composition can have a polydispersity index from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25.
  • the polydispersity index of a nanoparticle composition can be from about 0.10 to about 0.20.
  • the zeta potential of a nanoparticle composition can be used to indicate the electrokinetic potential of the composition.
  • the zeta potential can describe the surface charge of a nanoparticle composition.
  • Nanoparticle compositions with relatively low charges, positive or negative, are generally desirable, as more highly charged species can interact undesirably with cells, tissues, and other elements in the body.
  • the zeta potential of a nanoparticle composition can be from about-10 mV to about+20 mV, from about -10 mV to about+15 mV, from about-10 mV to about+10 mV, from about-10 mV to about+5 mV,from about-10 mV to about 0 mV, from about-10 mV to about-5 mV, from about-5 mV to about+20 mV, from about-5 mV to about+15 mV, from about-5 mV to about+10 mV, from about-5 mV to about+5 mV, from about-5 mV to about 0 mV, from about 0 mV to about+20 mV, from about 0 mV to about+15 mV, from about 0 mV to about+10 mV, from about 0 mV to about+5 mV, from about+5 mV to about+20 mV, from about 0 mV to about+
  • the efficiency of encapsulation of a therapeutic and/or prophylactic agent describes the amount of therapeutic and/or prophylactic agent that is encapsulated or otherwise associated with a nanoparticle composition af ter preparation, relative to the initial amount provided.
  • the encapsulation efficiency is desirably high (e.g., close to 100%) .
  • the encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and/or prophylactic agent in a solution containing the nanoparticle composition before and after breaking up the nanoparticle composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and/or prophylactic agent (e.g., RNA) in a solution.
  • free therapeutic and/or prophylactic agent e.g., RNA
  • the encapsulation efficiency of a therapeutic and/or prophylactic agent can be at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%.
  • the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.
  • a nanoparticle composition can optionally comprise one or more coatings.
  • a nanoparticle composition can be formulated in a capsule, film, or tablet having a coating.
  • a capsule, film, or tablet including a composition described herein can have any useful size, tensile strength, hardness, or density.
  • nanoparticle compositions can be formulated in whole or in part as pharmaceutical compositions.
  • Pharmaceutical compositions can include one or more nanoparticle compositions.
  • a pharmaceutical composition can include one or more nanoparticle compositions including one or more different therapeutic and/or prophylactic agents.
  • Pharmaceutical compositions can further include one or more pharmaceutically acceptable excipients or accessory ingredients such as those described herein.
  • General guidelines for the formulation and manufacture of pharmaceutical compositions and agents are available, for example, in Remington’s The Science and Practice of Pharmacy, 21 st Edition, A. R. Gennaro; Lippincott, Williams&Wilkins, Baltimore, Md., 2006.
  • excipients and accessory ingredients can be used in any pharmaceutical composition, except insofar as any conventional excipient or accessory ingredient can be incompatible with one or more components of a nanoparticle composition.
  • An excipient or accessory ingredient can be incompatible with a component of a nanoparticle composition if its combination with the component can result in any undesirable biological effect or otherwise deleterious effect.
  • one or more excipients or accessory ingredients can make up greater than 50%of the total mass or volume of a pharmaceutical composition including a nanoparticle composition.
  • the one or more excipients or accessory ingredients can make up 50%, 60%, 70%, 80%, 90%, or more of a pharmaceuticalcomposition.
  • a pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%pure.
  • an excipient is approved for use in humans and for veterinary use.
  • an excipient is approved by United States Food and Drug Administration.
  • an excipient is pharmaceutical grade.
  • an excipient meets the standards of the United States Pharmacopoeia (USP) , the European Pharmacopoeia (EP) , the British Pharmacopoeia, and/or the International Pharmacopoeia.
  • a pharmaceutical composition in accordance with the present disclosure will vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered.
  • a pharmaceutical composition can comprise between 0.1%and 100% (wt/wt) of one or more nanoparticle compositions.
  • the nanoparticle compositions and/or pharmaceutical compositions of the disclosure are refrigerated or frozen for storage and/or shipment (e.g., being stored at a temperature of 4°C. or lower, such as a temperature between about-150°C and about 0°C or between about-80°C and about-20°C (e.g., about-5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70°C, -80°C, -90°C, -130°C or-150°C) .
  • a temperature of 4°C. or lower such as a temperature between about-150°C and about 0°C or between about-80°C and about-20°C (e.g., about-5°C, -10°C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C, -70
  • the pharmaceutical composition comprising a compound of any of Formulae (I) to (IV) (and sub-formulas thereof) is a solution that is refrigerated for storage and/or shipment at, for example, about-20°C, -30°C, -40°C, -50°C, -60°C, -70°C, or-80°C
  • the disclosure also relates to a method of increasing stability of the nanoparticle compositions and/or pharmaceutical compositions comprising a compound of any of Formulae (I) to (IV) (and sub-formulas thereof) by storing the nanoparticle compositions and/or pharmaceutical compositions at a temperature of 4°C or lower, such as a temperature between about-150°C and about 0°C or between about-80°C and about-20°C, e.g., about-5°C, -10 °C, -15°C, -20°C, -25°C, -30°C, -40°C, -50°C, -60°C,
  • the nanoparticle compositions and/or pharmaceutical compositions disclosed herein are stable for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months, e.g., at a temperature of 4°C or lower (e.g., between about 4°C and-20°C) .
  • the formulation is stabilized for at least 4 weeks at about 4°C
  • the pharmaceutical composition of the disclosure comprises a nanoparticle composition disclosed herein and a pharmaceutically acceptable carrier selected from one or more of Tris, an acetate (e.g., sodium acetate) , an citrate (e.g., sodium citrate) , saline, PBS, and sucrose.
  • the pharmaceutical composition of the disclosure has a pH value between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9 or 8.0, or between 7.5 and 8 or between 7 and 7.8) .
  • a pharmaceutical composition of the disclosure comprises a nanoparticle composition disclosed herein, Tris, saline and sucrose, and has a pH of about 7.5-8, which is suitable for storage and/or shipment at, for example, about-20 °C
  • a pharmaceutical composition of the disclosure comprises a nanoparticle composition disclosed herein and PBS and has a pH of about 7-7.8, suitable for storage and/or shipment at, for example, about 4°C or lower.
  • Stability, ” “stabilized, ” and “stable” in the context of the present disclosure refers to the resistance of nanoparticle compositions and/or pharmaceutical compositions disclosed herein to chemical or physical changes (e.g., degradation, particle size change, aggregation, change in encapsulation, etc. ) under given manufacturing, preparation, transportation, storage and/or in-use conditions, e.g., when stress is applied such as shear force, freeze/thaw stress, etc.
  • Nanoparticle compositions and/or pharmaceutical compositions including one or more nanoparticle compositions can be administered to any patient or subject, including those patients or subjects that can benefit from a therapeutic effect provided by the delivery of a therapeutic and/or prophylactic agent to one or more particular cells, tissues, organs, or systems or groups thereof, such as the renal system.
  • a therapeutic and/or prophylactic agent to one or more particular cells, tissues, organs, or systems or groups thereof, such as the renal system.
  • compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with merely ordinary, if any, experimentation.
  • Subjects to which administration of the compositions is contemplated include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cattle, pigs, hoses, sheep, cats, dogs, mice, and/or rats.
  • a pharmaceutical composition including one or more nanoparticle compositions can be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include bringing the active ingredient into association with an excipient and/or one or more other accessory ingredients, and then, if desirable or necessary, dividing, shaping, and/or packaging the product into a desired single-or multi-dose unit.
  • a pharmaceutical composition in accordance with the present disclosure can be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses.
  • a “unit dose” is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient (e.g., nanoparticle composition) .
  • the amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
  • compositions can be prepared in a variety of forms suitable for a variety of routes and methods of administration.
  • pharmaceutical compositions can be prepared in liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs) , injectable forms, solid dosage forms (e.g., capsules, tablets, pills, powders, and granules) , dosage forms for topical and/or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and patches) , suspensions, powders, and other forms.
  • liquid dosage forms e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs
  • injectable forms e.g., solid dosage forms (e.g., capsules, tablets, pills, powders, and granules)
  • Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and/or elixirs.
  • liquid dosage forms can comprise inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1, 3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils) , glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
  • inert diluents commonly used in the
  • oral compositions can include additional therapeutic and/or prophylactic agents, additional agents such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and/or perfuming agents.
  • additional agents such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and/or perfuming agents.
  • solubilizing agents such as Cremophor TM , alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers, and/or combinations thereof.
  • Injectable preparations for example, sterile injectable aqueous or oleaginous suspensions can be formulated according to the known art using suitable dispersing agents, wetting agents, and/or suspending agents.
  • Sterile injectable preparations can be sterile injectable solutions, suspensions, and/or emulsions in nontoxic parenterally acceptable diluents and/or solvents, for example, as a solution in 1, 3-butanediol.
  • the acceptable vehicles and solvents that can be employed are water, Ringer’s solution, U.S.P., and isotonic sodium chloride solution.
  • Sterile, fixed oils are conventionally employed as a solvent or suspending medium.
  • any bland fixed oil can be employed including synthetic mono-or diglycerides.
  • Fatty acids such as oleic acid can be used in the preparation of injectables.
  • Injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, and/or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
  • the disclosure features methods of delivering a therapeutic and/or prophylactic agent to a mammalian cell or organ, producing a polypeptide of interest in a mammalian cell, and treating a disease or disorder in a mammal in need thereof comprising administering to a mammal and/or contacting a mammalian cell with a nanoparticle composition including a therapeutic and/or prophylactic agent.
  • provided herein are also methods for managing, preventing and treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject.
  • the disease or disorder being managed, prevented or treated with the methods described herein is caused by influenza viruses or by infection with influenza viruses.
  • the disease or disorder being managed, prevented or treated with the methods described herein is flu.
  • Flu is a contagious respiratory illness, often infects the nose, throat, and sometimes the lungs. It can cause disease that ranges in severity from sub-clinical infection to primary viral pneumonia which can result in death.
  • the clinical effects of infection vary with the virulence of the influenza strain and the exposure, history, age, and immune status of the host.
  • the present method for managing, preventing and treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject comprises administering to the subject a therapeutic effective amount of a set of at least four therapeutic nucleic acids as described herein.
  • the therapeutic nucleic acids are mRNA molecules as described herein.
  • the present method for managing, preventing and treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject comprises administering to the subject a therapeutic effective amount of a therapeutic composition comprising a set of at least four therapeutic nucleic acids as described herein.
  • the therapeutic nucleic acids are mRNA molecules as described herein.
  • the present method for managing, preventing and treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject comprises administering to the subject a therapeutic effective amount of a vaccine composition comprising a set of at least four therapeutic nucleic acids as described herein.
  • the therapeutic nucleic acids are mRNA molecules as described herein.
  • the present method for managing, preventing and treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject comprises administering to the subject a therapeutic effective amount of a lipid-containing composition comprising a set of at least four therapeutic nucleic acids as described herein.
  • the therapeutic nucleic acids are mRNA molecules as described herein.
  • the present method for managing, preventing and treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject comprises administering to the subject a therapeutic effective amount of a lipid-containing composition comprising a set of at least four therapeutic nucleic acids as described herein, wherein the lipid-containing composition is formulated as a lipid nanoparticle encapsulating the therapeutic nucleic acids in a lipid shell.
  • the therapeutic nucleic acids are mRNA molecules as described herein.
  • the cells in the subject effectively intake the lipid-containing composition (e.g., lipid nanoparticles) described herein upon administration.
  • lipid-containing composition (e.g., lipid nanoparticles) described herein are endocytosed by cells of the subject.
  • a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein
  • the cells in the subject uptake and express the administered therapeutic nucleic acids to produce peptides or polypeptides encoded by the nucleic acids.
  • the encoded peptides or polypeptides are derived from influenza viruses causing the disease or disorder being managed, prevented, or treated by the method.
  • a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, one or more immune responses against influenza viruses is elicited in the subject.
  • the elicited immune response comprises one or more adaptive immune responses against influenza viruses.
  • the elicited immune response comprises one or more innate immune responses against influenza viruses.
  • the one or more immune responses can be in the form of, e.g., an antibody response (humoral response) or a cellular immune response, e.g., cytokine secretion (e.g., interferon-gamma) , helper activity or cellular cytotoxicity.
  • an antibody response humidity response
  • a cellular immune response e.g., cytokine secretion (e.g., interferon-gamma)
  • helper activity e.g., helper activity or cellular cytotoxicity.
  • an activation marker on immune cells expression of a co-stimulatory receptor on immune cells, expression of a ligand for a co-stimulatory receptor, cytokine secretion, infiltration of immune cells (e.g., T-lymphocytes, B lymphocytes and/or NK cells) to a infected cell, production of antibody specifically recognizing one or more viral proteins (e.g., the viral peptide or protein encoded by the therapeutic nucleic acid) , effector function, T cell activation, T cell differentiation, T cell proliferation, B cell differentiation, B cell proliferation, and/or NK cell proliferation is induced, activated and/or enhanced.
  • activation and proliferation of myeloid-derived suppressor cell (MDSC) and Treg cells are inhibited.
  • MDSC myeloid-derived suppressor cell
  • a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein,
  • a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, one or more populations of lymphocytes producing cytokines is increased in the subject.
  • the lymphocytes are CD4 + T cells and/or CD8 + T cells.
  • the cytokine is one or more of IFN- ⁇ , TNF- ⁇ , IL-2, and IL-4.
  • the proportion of IFN-g and IL-2 expressing CD4+cells is increased.
  • the proportion of IL-4 expressing CD4+cells is increased.
  • the proportion of IFN-g and IL-2 expressing CD8+cells is increased.
  • the neutralizing antibody specifically binds to one or more epitopes of the influenza virus HA protein and inhibits or reduces one or more HA protein function or activity.
  • the neutralizing antibody binds to one or more viral proteins present on a viral particle or the surface of infected cells, and mark the viral particles or infected cells for destruction by the subject’s immune system.
  • endocytosis of viral particles by white blood cells e.g., macrophage
  • ADCC antibody-dependent cell-mediated cytotoxicity
  • ADCP antibody-dependent cellular phagocytosis
  • CDC complement dependent cytotoxicity
  • the composition of the present disclosure can further comprise one or more additional therapeutic agents.
  • the additional therapeutic agent is an adjuvant capable of bolstering immunogenicity of the composition (e.g., a genetic vaccine) .
  • the additional therapeutic agent is an immune modulator that enhances immune responses in a subject.
  • the adjuvant and the therapeutic nucleic acid in the composition can have a synergistic action in eliciting an immune response in a subject.
  • the additional therapeutic agent and the therapeutic nucleic acid of the present disclosure can be co-formulated in one composition.
  • the additional therapeutic agent can be formulated as part of the composition comprising the therapeutic nucleic acid of the present disclosure.
  • the additional therapeutic agent and therapeutic nucleic acid of the present disclosure can be formulated as separate compositions or dose units for co-administration either sequentially or simultaneously to a subject.
  • the therapeutic nucleic acid of the present disclosure is formulated as part of a lipid-containing composition as described in Section 5.4, and the additional therapeutic agent is formulated as a separate composition.
  • the therapeutic nucleic acid of the present disclosure is formulated as part of a lipid-containing composition as described in Section 5.4, wherein the additional therapeutic agent is also formulated as part of the lipid-containing composition.
  • the therapeutic nucleic acid of the present disclosure is formulated so that the therapeutic nucleic acid is encapsulated in a lipid shell of a lipid nanoparticle as described in Section 5.4, and the additional therapeutic agent is formulated as a separate composition.
  • the therapeutic nucleic acid of the present disclosure is formulated so that the therapeutic nucleic acid is encapsulated in a lipid shell of a lipid nanoparticle as described in Section 5.4, wherein the lipid nanoparticles also enclose the additional therapeutic agent molecule or a nucleic acid encoding the additional therapeutic agent molecule.
  • the therapeutic nucleic acid of the present disclosure is formulated so that the therapeutic nucleic acid is encapsulated in a lipid shell of a lipid nanoparticle as described in Section 5.4, wherein the lipid nanoparticles and the additional therapeutic agent are formulated into a single composition.
  • the additional therapeutic agent is an adjuvant.
  • the adjuvant comprises an agent that promotes maturation of dendritic cells (DCs) in a vaccinated subject, such as but not limited to lipopolysaccharides, TNF-alpha or CD40 ligand.
  • the adjuvant is an agent that recognized by the immune system of the vaccinated subject as a “danger signal, ” such as LPS, GP96, etc.
  • the adjuvant comprises an immunostimulating cytokine such as but not limited to IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, INF-alpha, IFN-beta, INF-gamma, GM-CSF, G-CSF, M-CSF, LT-beta or TNF-alpha, growth factors, such as hGH.
  • an immunostimulating cytokine such as but not limited to IL-1, IL-2, IL-3, IL-4, IL-5, IL-6
  • the adjuvant comprises a compound known as capable of eliciting an innate immune response.
  • a compound known as capable of eliciting an innate immune response is toll-like receptor ligands, such as ligands of human Toll-like receptors TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, and ligands of murine Toll-like receptors TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11, TLR12 or TLR13.
  • Another exemplar class of such compounds are immuno-stimulating nucleic acids, such as oligonucleotides containing the CpG motif.
  • CpG containing nucleic acids can be DNA (CpG-DNA) or RNA (CpG-RNA) molecules.
  • a CpG-RNA or CpG-DNA can be a single-stranded CpG-DNA (ss CpG-DNA) , a double-stranded CpG-DNA (dsDNA) , a single-stranded CpG-RNA (ss CpG-RNA) or a double-stranded CpG-RNA (ds CpG-RNA) .
  • the CpG nucleic acid is in the form of CpG-RNA.
  • the CpG nucleic acid is in the form of single-stranded CpG-RNA (ss CpG-RNA) .
  • the CpG nucleic acid contains at least one or more (mitogenic) cytosine/guanine dinucleotide sequence (s) (CpG motif (s) ) .
  • at least one CpG motif contained in these sequences i.e., the C (cytosine) and/or the G (guanine) forming the CpG motif
  • the additional therapeutic agent is an immune modulator that activate, boost or restore normal immune functions.
  • the immune modulator is an agonist of a co-stimulatory signal of an immune cell, such as a T-lymphocyte, NK cell or antigen-presenting cell (e.g., a dendritic cell or macrophage) .
  • the immune modulator is an antagonist of an inhibitory signal of an immune cell, such as a T-lymphocyte, NK cell or antigen-presenting cell (e.g., a dendritic cell or macrophage) .
  • the agonist of a co-stimulatory signal is an agonist of a co-stimulatory molecule (e.g., co-stimulatory receptor) found on immune cells, such as, T-lymphocytes (e.g., CD4+or CD8+T-lymphocytes) , NK cells and/or antigen-presenting cells (e.g., dendritic cells or macrophages) .
  • a co-stimulatory molecule e.g., co-stimulatory receptor
  • immune cells such as, T-lymphocytes (e.g., CD4+or CD8+T-lymphocytes) , NK cells and/or antigen-presenting cells (e.g., dendritic cells or macrophages) .
  • co-stimulatory molecules include glucocorticoid-induced tumor necrosis factor receptor (GITR) , Inducible T-cell costimulator (ICOS or CD278) , OX40 (CD134) , CD27, CD28, 4-IBB (CD137) , CD40, lymphotoxin alpha (LT alpha) , LIGHT (lymphotoxin-like, exhibits inducible expression, and competes with herpes simplex virus glycoprotein D for HVEM, a receptor expressed by T lymphocytes) , CD226, cytotoxic and regulatory T cell molecule (CRT AM) , death receptor 3 (DR3) , lymphotoxin-beta receptor (LTBR) , transmembrane activator and CAML interactor (TACI) , B cell-activating factor receptor (BAFFR) , and B cell maturation protein (BCMA) .
  • GITR glucocorticoid-induced tumor necrosis factor receptor
  • ICOS or CD278 In
  • the agonist of a co-stimulatory receptor is an antibody or antigen-binding fragment thereof that specifically binds to the co-stimulatory receptor.
  • co-stimulatory receptors include GITR, ICOS, OX40, CD27, CD28, 4-1BB, CD40, , LT alpha, LIGHT, CD226, CRT AM, DR3, LTBR, TACI, BAFFR, and BCMA.
  • the antibody is a monoclonal antibody.
  • the antibody is an sc-Fv.
  • the antibody is a bispecific antibody that binds to two receptors on an immune cell.
  • the bispecific antibody binds to a receptor on an immune cell and to another receptor on a virus infected diseased cell.
  • the antibody is a human or humanized antibody.
  • the agonist of a co-stimulatory receptor is a ligand of the co-stimulatory receptor or a functional derivative thereof.
  • the ligand is fragment of a native ligand.
  • native ligands include ICOSL, B7RP1, CD137L, OX40L, CD70, herpes virus entry mediator (HVEM) , CD80, and CD86.
  • HVEM herpes virus entry mediator
  • the antagonist is an antagonist of an inhibitory molecule (e.g., inhibitory receptor) found on immune cells, such as, e.g., T-lymphocytes (e.g., CD4+or CD8+T-lymphocytes) , NK cells and/or antigen-presenting cells (e.g., dendritic cells or macrophages) .
  • an inhibitory molecule e.g., inhibitory receptor
  • immune cells such as, e.g., T-lymphocytes (e.g., CD4+or CD8+T-lymphocytes) , NK cells and/or antigen-presenting cells (e.g., dendritic cells or macrophages) .
  • inhibitory molecules include cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4 or CD52) , programmed cell death protein 1 (PD1 or CD279) , B and T-lymphocyte attenuator (BTLA) , killer cell immunoglobulin-like receptor (KIR) , lymphocyte activation gene 3 (LAG3) , T-cell membrane protein 3 (TIM3) , CD 160, adenosine A2a receptor (A2aR) , T cell immunoreceptor with immunoglobulin and ITIM domains (TIGIT) , leukocyte-associated immunoglobulin-like receptor 1 (LAIR1) , and CD 160.
  • CTLA-4 or CD52 cytotoxic T-lymphocyte-associated antigen 4
  • PD1 or CD279 programmed cell death protein 1
  • B and T-lymphocyte attenuator (BTLA) killer cell immunoglobulin-like receptor
  • KIR killer cell immunoglobulin-like receptor
  • LAG3 lymphocyte activation gene 3
  • the antagonist of an inhibitory receptor is an antibody (or an antigen-binding fragment) that specifically binds to the native ligand for the inhibitory receptor and blocks the native ligand from binding to the inhibitory receptor and transducing an inhibitory signal (s) .
  • the antibody is a monoclonal antibody.
  • the antibody is an sc-Fv.
  • the antibody is a bispecific antibody that binds to two receptors on an immune cell.
  • the bispecific antibody binds to a receptor on an immune cell and to another receptor on a virus infected diseased cell.
  • the antibody is a human or humanized antibody.
  • the antagonist of an inhibitory receptor is a soluble receptor or a functional derivative thereof that specifically binds to the native ligand for the inhibitory receptor and blocks the native ligand from binding to the inhibitory receptor and transducing an inhibitory signal (s) .
  • native ligands for inhibitory receptors include PDL-1, PDL-2, B7-H3, B7-H4, HVEM, Gal9 and adenosine.
  • inhibitory receptors that bind to a native ligand include CTLA-4, PD-1, BTLA, KIR, LAG3, TIM3, and A2aR.
  • the antagonist of an inhibitory receptor is an antibody (or an antigen-binding fragment) or ligand that binds to the inhibitory receptor, but does not transduce an inhibitory signal (s) .
  • inhibitory receptors include CTLA-4, PD1, BTLA, KIR, LAG3, TIM3, and A2aR.
  • the antibody is a monoclonal antibody.
  • the antibody is an scFv.
  • the antibody is a human or humanized antibody.
  • a specific example of an antibody to inhibitory receptor is anti-CTLA-4 antibody (Leach DR, et al. Science 1996; 271: 1734-1736) .
  • Another example of an antibody to inhibitory receptor is anti-PD-1 antibody (Topalian SL, NEJM 2012; 28:3167-75) .
  • a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein is administered to a subject in need thereof.
  • a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein is administered to a human subject.
  • a subject administered with a set of at least four therapeutic nucleic acid described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein or a combination therapy described herein is an elderly human.
  • a subject administered with a set of at least four therapeutic nucleic acid described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein or a combination therapy described herein is a human adult.
  • a subject administered with a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein or a combination therapy described herein is human child.
  • a subject administered with a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein or a combination therapy described herein is human toddler.
  • a subject administered with a set of at least four therapeutic nucleic acid described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein or a combination therapy described herein is human infant.
  • a subject administered with a set of at least four therapeutic nucleic acid described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein or a combination therapy described herein is administered to a non-human mammal.
  • a lipid-containing composition e.g., lipid nanoparticles
  • a subject administered with a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or the combination therapy described herein is administered to a subject exhibiting at least one symptom associated with influenza virus infection.
  • the subject receiving administration of a set of at least four therapeutic nucleic acid described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein exhibits one or more symptoms of flu, including fever or feeling feverish/chills, cough, sore throat, runny or stuffy nose, muscle or body aches, headaches, fatigue (tiredness) .
  • a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy as described herein is administered to a subject that is asymptomatic for influenza virus infection.
  • a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein is administered to a subject who is at risk of, or susceptible to, influenza virus infection.
  • a subject at risk of, or susceptible to, influenza virus infection is an elderly human.
  • a subject at risk of, or susceptible to, influenza virus infection is a human adult.
  • a subject at risk of, or susceptible to, influenza virus infection is a human child.
  • a subject at risk of, or susceptible to, influenza virus infection is a human adult toddler. In some embodiments, a subject at risk of, or susceptible to, influenza virus infection is a human adult infant. In some embodiments, a subject at risk of, or susceptible to, influenza virus infection is a human subject having existing health condition that affects the subject’s immune system. In some embodiments, a subject at risk of, or susceptible to, influenza virus infection is a human subject having existing health condition that affects the subject’s major organs. In some embodiments, a subject at risk of, or susceptible to, influenza virus infection is a human subject having existing health condition that affects the subject’s lung function.
  • a subject at risk of, or susceptible to, influenza virus infection is an elderly human subject having an existing health condition that affects the subject’s immune system, or a major organ, such as lung function.
  • a subject at risk of, or susceptible to, influenza virus infection can be either exhibiting symptoms of influenza virus infection or asymptomatic for influenza virus infection.
  • a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein is administered to a subject who has been diagnosed positive for influenza virus infection.
  • the subject diagnosed positive for influenza virus infection is asymptomatic for influenza virus infection, and the diagnosis is based on detecting the presence of a viral nucleic acid or protein from a sample taken from the subject. In some embodiments, the diagnosis is based on clinical symptoms exhibited by the patient.
  • Exemplary symptoms that may serve as the basis of diagnosis include but are not limited to upper respiratory tract infection, lower respiratory tract infection, lung infection, renal infection, liver infection, enteric infection, hepatic infection, neurologic infections, respiratory syndrome, pneumonia, gastroenteritis, encephalomyelitis, encephalitis, sarcoidosis, diarrhea, hepatitis, and demyelinating disease.
  • the diagnosis is based on a subject’s exhibited clinical symptom combined with the subject’s history of being in contact with a geographical location, population, and/or individual considered of having a high risk of carrying influenza viruses, such as another individual diagnosed positive for influenza virus infection.
  • a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein is administered to a subject who has not previously received administration of the therapeutic nucleic acids, the vaccine composition, the lipid-containing composition (e.g., lipid nanoparticles) , or the combination therapy.
  • a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein is administered to a subject who has previously received administration of the therapeutic nucleic acids, the vaccine composition, the lipid-containing composition (e.g., lipid nanoparticles) , or the combination therapy.
  • the subject has been previously administered a set of at least four therapeutic nucleic acid described herein, the vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, the lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or the combination therapy as described herein once, twice, three times or more.
  • the vaccine composition comprising the set of at least four therapeutic nucleic acids described herein
  • the lipid-containing composition e.g., lipid nanoparticles
  • a set of at least four therapeutic nucleic acid described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein is administered to a subject who has received a therapy prior to administration of the therapeutic nucleic acids, the vaccine composition, the lipid-containing composition (e.g., lipid nanoparticles) , or the combination therapy.
  • the subject administered with a set of at least four therapeutic nucleic acid described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein experienced adverse side effects to a prior therapy or a prior therapy was discontinued due to unacceptable levels of toxicity to the subject.
  • therapeutic nucleic acids or a composition thereof which will be effective in the management, prevention and/or treatment of infectious disease will depend on the nature of the disease being treated, the route of administration, the general health of the subject, etc. and should be decided according to the judgment of a medical practitioner. Standard clinical techniques, such as in vitro assays, may optionally be employed to help identify optimal dosage ranges. Nevertheless, suitable dosage ranges of the therapeutic nucleic acids as described herein for administration are generally about 0.001 mg, 0.005 mg, 0.01 mg, 0.05 mg. 0.1 mg. 0.5 mg,1.0 mg, 2.0 mg.
  • the therapeutic nucleic acids or a composition thereof can be administered to a subject once, twice, three, four or more times with intervals as often as needed. Effective doses may be extrapolated from dose response curves derived from in vitro or animal model test systems.
  • a set of at least four therapeutic nucleic acids or a composition thereof is administered to a subject as a single dose followed by a second dose 1 to 6 weeks, 1 to 5 weeks, 1 to 4 weeks, 1 to 3 weeks, 1 to 2 weeks later.
  • booster inoculations may be administered to the subject at 6 to 12 month intervals following the second inoculation.
  • administration of a set of at least four therapeutic nucleic acids or a composition thereof may be repeated and the administrations may be separated by at least 1 day, 2 days, 3 days, 5 days, 6 says, 7 days, 10 days, 14 days, 15 days, 21 days, 28 days, 30 days, 45 days, 2 months, 75 days, 3 months, or at least 6 months.
  • administration of a set of at least four therapeutic nucleic acids or a composition thereof may be repeated and the administrations may be separated by 1 to 14 days, 1 to 7 days, 7 to 14 days, 1 to 30 days, 15 to 30 days, 15 to 45 days, 15 to 75 days, 15 to 90 days, 1 to 3 months, 3 to 6 months, 3 to 12 months, or 6 to 12 months.
  • a first set of at least four therapeutic nucleic acids or a composition thereof is administered to a subject followed by the administration of a second set of at least four therapeutic nucleic acids or a composition thereof.
  • the first and second sets of at least four therapeutic nucleic acids or compositions thereof may be separated by at least 1 day, 2 days, 3 days, 5 days, 6 days, 7 days, 10 days, 14 days, 15 days, 21 days, 28 days, 30 days, 45 days, 2 months, 75 days, 3 months, or at least 6 months.
  • the first and second sets of at least four therapeutic nucleic acids or compositions thereof may be separated by 1 to 14 days, 1 to 7 days, 7 to 14 days, 1 to 30 days, 15 to 30 days, 15 to 45 days, 15 to 75 days, 15 to 90 days, 1 to 3 months, 3 to 6 months, 3 to 12 months, or 6 to 12 months.
  • a set of at least four therapeutic nucleic acids or composition thereof is administered to a subject in combination with one or more additional therapies, such as a therapy described in Section 5.5.2.
  • the dosage of the other one or more additional therapies will depend upon various factors including, e.g., the therapy, the nature of the infectious disease, the route of administration, the general health of the subject, etc. and should be decided according to the judgment of a medical practitioner.
  • the dose of the other therapy is the dose and/or frequency of administration of the therapy recommended for the therapy for use as a single agent is used in accordance with the methods disclosed herein.
  • the dose of the other therapy is a lower dose and/or less frequent administration of the therapy than recommended for the therapy for use as a single agent is used in accordance with the methods disclosed herein.
  • Recommended doses for approved therapies can be found in the Physician’s Desk Reference.
  • a set of at least four therapeutic nucleic acids or composition thereof is administered to a subject concurrently with the administration of one or more additional therapies.
  • a set of at least four therapeutic nucleic acids or composition thereof is administered to a subject every 3 to 7 days, 1 to 6 weeks, 1 to 5 weeks, 1 to 4 weeks, 2 to 4 weeks, 1 to 3 weeks, or 1 to 2 weeks and one or more additional therapies (such as described in Section 5.5.2) is administered every 3 to 7 days, 1 to 6 weeks, 1 to 5 weeks, 1 to 4 weeks, 1 to 3 weeks, or 1 to 2 weeks.
  • a set of at least four therapeutic nucleic acids or composition thereof is administered to a subject every 1 to 2 weeks and one or more additional therapies (such as described in Section 5.5.2) is administered every 2 to 4 weeks. In some embodiments, a set of at least four therapeutic nucleic acids or composition thereof is administered to a subject every week and one or more additional therapies (such as described in Section 5.5.2) is administered every 2 weeks.
  • HPLC purification is carried out on an Waters 2767 equipped with a diode array detector (DAD) on an Inertsil Pre-C8 OBD column, generally with water containing 0.1%TFA as solvent A and acetonitrile as solvent B.
  • DAD diode array detector
  • LCMS analysis is conducted on a Shimadzu (LC-MS2020) System. Chromatography is performed on a SunFire C18, generally with water containing 0.1%formic acid as solvent A and acetonitrile containing 0.1%formic acid as solvent B.
  • Example 01-1 Preparation of Compound 01-1 (i.e. Compound 1 in the following scheme) .
  • Example 01-2 Preparation of Compound 01-2 (i.e. Compound2 in the following scheme) .
  • Example 01-3 Preparation of Compound01-20 (i.e. Compound20 in the following scheme) .
  • Example 01-4 Preparation of Compound01-21 (i.e. Compound21 in the following scheme) .
  • Example 01-5 Preparation of Compound 01-102 (i.e. Compound 102 in the following scheme)
  • Example 01-6 Preparation of Compound 01-108 (i.e. Compound 108 in the following scheme)
  • Example 01-7 Preparation of Compound 01-106 (i.e. Compound 106 in the following scheme) .
  • Example 03-2 Preparation of Compound 03-1 (i.e. Compound 1 in the following scheme) .
  • Example 03-3 Preparation of Compound 03-3.
  • Example 03-4 Preparation of Compound 03-10 (i.e. Compound 10 in the following scheme) .
  • Example 03-5 Preparation of Compound 03-11 (i.e. Compound 11 in the following scheme) .
  • Example 03-6 Preparation of Compound 03-15 (i.e. Compound 15 in the following scheme) .
  • Example 04-2 Preparation of Compound 04-1 (i.e. Compound 1 in the following scheme) .
  • Example 04-3 Preparation of Compound04-2 (i.e. Compound2 in the following scheme) .
  • Example 04-4 Preparation of Compound 04-7 (i.e. Compound7 in the following scheme) .
  • Example 04-5 Preparation of Compound 04-8 (i.e. Compound 8 in the following scheme) .
  • Example 04-6 Preparation of Compound 04-65 (i.e. Compound 65 in the following scheme) .
  • Example 04-8 Preparation of Compound 04-69 (i.e. Compound 69 in the following scheme) .
  • Example B1 mRNA synthesis and purification.
  • IVT plasmid pJ241 (constructed in house, contains a kanamycin resistance gene, a T7 promoter sequence, a poly (A) track, and a unique type-IIS restriction site downstream of poly (A) sequence) containing the target sequence (e.g., SEQ ID NOs: 5-8) encoding the HA protein or immunogenic fragment (e.g., SEQ ID NOs: 1-4) , 5’-UTR (e.g., SEQ ID NO: 19-26) , 3’-UTR (e.g., SEQ ID NO: 27-36) , signal peptide (e.g., SEQ ID NOs: 9-11, 15, 17) and polyA was linearized with type-IIS restriction enzyme digestion.
  • target sequence e.g., SEQ ID NOs: 5-8
  • 5’-UTR e.g., SEQ ID NO: 19-26
  • 3’-UTR e.g., SEQ ID NO: 27-36
  • the reaction mixture was incubated at 37°Cfor 6 hours followed by addition of 1 ⁇ l of DNase I (RNase-free, 1 U/ ⁇ L) to remove the DNA template, incubate for 30 minutes at 37°C.
  • the synthesized RNA was purified by adding 0.5 volume of 7.5 M LiCl, 50 mM EDTA and incubating at-20°C for 45 minutes, followed by centrifugation at 4°C for 15 minutes at 13800 g to pellet the mRNA. Then the supernatant was removed and the pellet was rinsed twice with 500 ⁇ L of ice cold 70%ethanol, mRNA was resuspended in nuclease-free H 2 O, adjusted concentration to 1 mg/mL, and stored at-20°C.
  • DNase I RNase-free, 1 U/ ⁇ L
  • mRNA Capping Each 10 ⁇ g uncapped mRNA was heated at 65°C for 10 minutes, placed on ice for 5 minutes, and mixed with 10 U Vaccinia Capping Enzyme, 50 U mRNA Cap 2′-O-Methyltransferase, 0.2 mM SAM, 0.5 mM GTP and 1 U RNase inhibitor, and incubated at 37°C for 60 minutes to generate cap1 modification structure.
  • the modified mRNA was precipitated by LiCl as previously described and the RNA was resuspended in nuclease-free H 2 O, and stored at-20°C.
  • RNA was purified by high performance liquid chromatography (HPLC) using a C4 column (5 ⁇ m) (10 mm ⁇ 250 mm column) .
  • TEAA triethylammonium acetate
  • mRNA molecules were successfully produced by the in vitro transcription and maturation processes described above and were purified from the reaction system using HPLC (data not shown) .
  • Example B2 In vitro transfection and antigen expression analysis.
  • Example B1 Different mRNA molecules encoding the HA protein produced in Example B1 were transfected into expression cell lines such as HEK293T cultured cells to evaluate efficiency of in vitro expression of the mRNA molecules.
  • HEK293T cells were seeded into 6-well clear TC-treated plate (Corning, #3516) . After the cells grow to ⁇ 80%confluence, mRNA-lipid complex was assembled by preparing 3 ⁇ g mRNA with 3 ⁇ l 2000 (Invitrogen, #11668019) mixed in 94 ⁇ l Opti-MEM TM I Reduced Serum Medium (Gibco, #11058021) . Total volume of One hundred microliter mixture was added into each well. The plate was incubated in humidified 5%CO 2 incubator at 37°C for 18-24 hours.
  • the cells were resuspended with PBS/1%BSA, adjusted to 1x10 5 /well in a 96-well microplate. After two times wash, one hundred microliter of the working solution of the primary antibody to H1N1/H3N2/BV/BY HA (Sino Biological, #11055-MM04T/11056-MM03/11053-MM06/11053-MM09) was added to each well to suspend the cells. The microplate was incubated at 4°C for 1 hour in dark. Then, the microplate was centrifuged at 300 xg for 5 minutes at 4°C, and the supernatant was discarded. The cells were washed twice with 180 ⁇ L PBS/1%BSA each.
  • mRNA molecule encoding the HA protein effectively entered HEK293T cells and expressed the HA protein as detected with anti-HA primary antibodies.
  • SEQ ID NO: 44 was selected as the H1N1 mRNA top candidate for the highest in vitro expression level and used as H1N1 composition in subsequent animal study 1.
  • SEQ ID NO: 52 was a further optimized sequence and used as H1N1 composition in subsequent animal study2.
  • H3N2 (A/Hong Kong/45/2019) encoding mRNA SEQ ID NO: 53 showed slightly higher in vitro expression level when compared to SEQ ID NO: 49.
  • H3N2 encoding mRNA was switched to 2022-23 WHO recommended southern hemisphere H3N2 virus strain A/Darwin/6/2021 and SEQ ID NO: 55 was selected as the top candidate due to in vitro expression level.
  • BV B/Washington/02/2019
  • encoding mRNA SEQ ID NO: 57 showed advantage when compared to SEQ ID NO: 50 in HEK293T cell expression.
  • virus strain switched BV B/Austria/1359417/2021
  • encoding mRNA SEQ ID NO: 59 was selected out of 3 codon optimized mRNAs due to the expression level consistency.
  • BY encoding mRNA SEQ ID NO: 63 was selected as the top candidate with the highest in vitro expression level.
  • LNPs containing mRNA were prepared according to the following procedure with a lipid prepared according to the procedure provided in Examples 01 to 04 above and mRNA (e.g., SEQ ID Nos: 43-56) prepared according to the procedure provided in Example B1 above.
  • the LNPs were prepared at a total lipid to mRNA weight ratio of approximately 10: 1 to 30: 1 by mixing the ethanolic lipid solution with the aqueous mRNA solution at a volume ratio of 1: 3 using a microfluidic apparatus, total flow rate ranging from 9-30mL/min. Ethanol were thereby removed and replaced by DPBS using dialysis. Finally, the lipid nanoparticles were filtered through a 0.2 ⁇ m sterile filter.
  • Lipid nanoparticle size were determined by dynamic light scattering using a Malvern Zetasizer Nano ZS (Malvern UK) using a 173o backscatter detection mode.
  • the encapsulation efficiency of lipid nanoparticles were determined using a Quant-it Ribogreen RNA quantification assay kit (Thermo Fisher Scientific, UK) according to the manufacturer’s instructions.
  • LNP formulations correlates with the delivery efficiency of LNPs for nucleic acids in vivo.
  • the apparent pKa of each formulation was determined using an assay based on fluorescence of 2- (p-toluidino) -6-napthalene sulfonic acid (TNS) .
  • LNP formulations comprising of cationic lipid/DSPC/cholesterol/DMG-PEG (50/10/38.5/1.5 mol%) in PBS were prepared as described above.
  • TNS was prepared as a 300uM stock solution in distilled water.
  • LNP formulations were diluted to 0.1mg/ml total lipid in 3 mL of buffered solutions containing 50 mM sodium citrate, 50 mM sodium phosphate, 50 mM sodium borate, and 30mM sodium chloride where the pH ranged from 3 to 9.
  • An aliquot of the TNS solution was added to give a final concentration of 0.1mg/ml and following vortex mixing fluorescence intensity was measured at room temperature in a Molecular Devices Spectramax iD3 spectrometer using excitation and mission wavelengths of 325 nm and 435 nm.
  • a sigmoidal best fit analysis was applied to the fluorescence data and the pKa value was measured as the pH giving rise to half–maximal fluorescent intensity.
  • Example B4 Antigen immunogenicity and cytokine induction
  • the purpose of the following experiment was to evaluate the immunogenicity of the HA protein expressed from the HA-mRNA-LNP of the present invention.
  • mice Female BALB/c mice, received the test antigen (8 ⁇ g/100 ⁇ L per mouse or 2 ⁇ g/100 ⁇ L per mouse) via a single point intramuscular injection on the right hind limb on day 0. A same dose of the test vaccine was vaccinated again on day 14.
  • Table 17 The detailed administration methods, dosing amounts and administration routes were shown in the following Table 17:
  • mice On Days 0, 14, 21, 28, 42, 70 and 98, whole blood samples were collected for determing the HA-specific IgG titers in the serum. On Day 98, mice were sacrificed and spleen cells were harvested.
  • ELISA Flat-bottom, 96-well plates (Costar, 42592) were coated with recombinant HA protein (H1N1, #40717-V08H; H3N2, #40789-V08H; BV, #40722-V08H; BY, #40498-V08B; all from Sinobiological) at 0.01 ⁇ g/mL, 0.05 ⁇ g/mL or 0.1 ⁇ g/mL to a volume of 100 ⁇ l per well. Plates were stored overnight at 4°C. The following morning, plates were washed three times with PBS containing 0.1%Tween 20 (PBS-T) .
  • PBS-T 0.1%Tween 20
  • blocking buffer (5%BSA in PBS) was added to each well and plates were left at room temperature (RT) for 1 h. Blocking buffer was removed from wells, and fresh blocking buffer was added to ensure a final volume of 100 ⁇ L per well. Mouse sera were added and a 2-fold serial dilution was performed in the plate, leaving last lane blank to account for edge effects. The plate was stored at RT for 1 h.
  • Results are shown in Figures 5A to 5G.
  • 5A serum IgG titer against A/H1N1;
  • 5B serum IgG1 titer against A/H1N1;
  • 5C serum IgG2a titer against A/H1N1;
  • 5D serum IgG, IgG1 and IgG2a titers against A/H3N2;
  • 5E serum IgG, IgG1 and IgG2a titers against B/Washington/02/2019 (B/Victoria) ;
  • 5F serum IgG, IgG1 and IgG2a titers against B/PHUKET/3073/2013 (B/Yamagata) ;
  • 5G serum IgG titer against A/H1N1 stalk region ChiH1/6 HA. Significance was calculated using unpaired t-test. ns, not significant; *, p ⁇ 0.05; **, p ⁇ 0.0
  • Elispot Single cells were isolated from mice splenocytes, lysed, passed through 70 ⁇ m strainer, adjusted to 6E6 viable cells/mL and resuspended in complete medium (RPMI1640 with 10%FBS) . ELISpot plates were prepared according to the instructions provided by the manufacturer (Mabtech, 3511-4APW-2, 3321-4HST-2, 3311-4APW-2, 3441-4APW-2) by washing with PBS 4 times and conditioned at RT for 30 minutes with complete medium.
  • Results are shown in Figures 6A to 6D.
  • 6A secretion of IFN- ⁇
  • 6B secretion of TNF- ⁇
  • 6C secretion of IL-2
  • 6D secretion of IL-4.
  • Data are shown as mean ⁇ SEM. Significance was calculated using one-way ANOVA (6A and 6D) or unpaired t-test (6B and 6C) . n.s., not significant; *, p ⁇ 0.05; **, p ⁇ 0.01; ***, p ⁇ 0.001; ****, p ⁇ 0.0001.
  • LNPs containing four mRNAs were prepared according to the procedure provided in Example B3 above with a lipid prepared according to the procedure provided in Examples 01 to 04 above and four mRNAs each prepared according to the procedure provided in Example B1 above.
  • Example B6 Antigen immunogenicity and cytokine induction (quadrivalent)
  • Example B4 The purpose of the following experiment was to evaluate the immunogenicity of the HA protein expressed from the HA-mRNA-LNP (quadrivalent) of the present invention. Assays described in Example B4 were performed with the HA-mRNA-LNP (quadrivalent) prepared in Example B5.
  • Example B7 In vivo immunization study
  • mice 60 female Balb/c mice (aged 6-8 weeks, Beijing Vital River Laboratory Animal Technology Co., Ltd. ) were randomly distributed into 6 groups (10 mice/group) and were injected intramuscularly (im) with 1 ⁇ g (monovalent) or 4 ⁇ g (quadrivalent) of vaccines in 100 ⁇ l volume at day 0 and day14.
  • mice in each group were sacrificed and harvested for spleens for analyzing cytokine-secreting T cell response using the enzyme-linked immunospot (ELISpot) assay.
  • enzyme-linked immunospot enzyme-linked immunospot
  • the four mRNAs (SEQ ID NO: 44, 49, 50 and 61) were mixed in a molar ratio of 1: 1: 1: 1 to form the quadrivalent antigen.
  • the LNP used comprises i) between about 30 to 55 mol percent of a cationic lipid; ii) between about 5 to 40 mol percent of a phospholipid; iii) between about 20 to 50 mol percent of a steroid; and iv) a polymer conjugated lipid.
  • mice 35 female Balb/c mice (aged 6-8 weeks) were randomly distributed into 7 groups (5 mice/group) and were injected intramuscularly (im) with 1 ⁇ g (monovalent) , 1.5 ⁇ g (quadrivalent) , or 4 ⁇ g (quadrivalent) of vaccines in 50 ⁇ l volume at day 0 and day 21.
  • mice in each group were sacrificed and harvested for spleens for analyzing T cell response using ICS (intracellular cytokine staining) .

Abstract

Provided herein are therapeutic nucleic acid molecules, e.g., a set of at least four therapeutic nucleic acid molecules, for managing, preventing and/or treating a disease or disorder caused by influenza viruses or by infection therewith. Also provided herein are therapeutic compositions, including vaccines and lipid nanoparticles, comprising the therapeutic nucleic acids and related therapeutic methods and uses.

Description

QUADRIVALENT MRNA VACCINES FOR INFLUENZA VIRUSES 1. FIELD
The present disclosure generally relates to nucleic acid molecules that can be used for the management, prevention, and treatment of a disease or disorder caused by influenza viruses or by infection therewith. The present disclosure also relates to lipid-containing compositions, including vaccines, of the nucleic acid molecules.
2. BACKGROUND
Influenza viruses belong to the family Orthomyxoviridae, and their genomes consist of segments of negative‐sense RNA.  1 They are divided into A, B, C and D types, the latter of which was isolated from pigs exhibiting influenza‐like symptoms in April 2011. 2 In humans, mainly the A and B types cause disease, and the A type causes more severe illness than the B type.  3, 4 Influenza A viruses are further categorized according to the antigenicity of their surface antigens, haemagglutinin (HA) and neuraminidase (NA) , and there are 18 HA and 11 NA serotypes.  5, 6 Influenza B viruses have diverged into only two antigenically distinguishable lineages, Victoria and Yamagata, since the 1970s.  3 Current influenza viruses circulating in humans are mainly A/H1N1 and A/H3N2 and the B/Victoria and B/Yamagata lineages.  7
Human influenza virus infections cause a significant public health and economic burden worldwide. According to a World Health Organization estimate, annual epidemics cause 2-5 million severe cases and 250 000 to 500 000 deaths globally.  8 The European Centre for Disease Control (ECDC) estimates that seasonal influenza virus infections cause 38 500 annual excess deaths in Europe.  9 In the USA seasonal influenza virus infections are responsible for 24 000 deaths per year on average (3000-49 000 per season for seasons between 1976 and 2007)  10 with annual attack rates that can reach high percentages (e.g. predicted30.5%of the population in the 2012/13 season) .  11 In addition, new pandemics occur in irregular intervals when novel influenza virus subtypes enter the human population and gain the ability to transmit from human to human efficiently. Pandemics are usually more severe than annual epidemics and have previously claimed up to 50 million lives as during the H1N1 pandemic of 1918. 12  Pandemics also occurred in 1957 (H2N2, 'Asian flu' ) , 1968 (H3N2, 'Hong Kong flu' ) and2009 (H1N1, 's wine flu' ) .  13
Vaccination is considered the most effective method for controlling influenza.  14 Through continuous antigenic drift, that is, the accumulation of point mutations in the surface antigens, influenza viruses can escape immunity,  15 which is why yearly vaccination is required. Seasonal influenza vaccines have been steadily developed since the 1940s, and currently marketed preventive vaccines differ in type (whole, split, recombinant and subunit inactivated, and live-attenuated types) and the substrate used for production (embryonated eggs or cells) .  16
Quadrivalent inactivated influenza virus vaccines (QIVs) are most commonly administered to the public, but effectiveness of these vaccines lies in the range of 10%–60%due to a variety of factors, including poor immunogenicity and strain mismatches. Regarding this issue, in vitro-transcribed messenger RNA (mRNA) -based vaccines have shown promising efficacy against cancer and especially infectious diseases. For example, Moderna has finished a phase I study in 2019, which demonstrated both safety and robust immune responses to mRNA vaccines against H10N8 and H7N9 influenza viruses.
Moreover, the lengthy timeline from the start of vaccine production to influenza season itself allows time for mutations to occur and change the predominantly circulating influenza strains, resulting in a mismatch between the year’s vaccine and circulating strains. Unlike most vaccines that take several months for production, mRNA vaccine production is incredibly fast once the genetic sequence of the pathogen is known.
3. SUMMARY
Provided herein are therapeutic nucleic acid molecules (e.g., a set of at least four therapeutic nucleic acid molecules) useful for the prevention, management and treatment of a disease or disorder cause by influenza viruses or by infection with influenza viruses. Also provided herein are pharmaceutical composition comprising the therapeutic nucleic acid molecules (e.g., a set of at least four therapeutic nucleic acid molecules) , including pharmaceutical composition formulated as lipid nanoparticles and related therapeutic methods and uses for preventing, managing and treating of a disease or disorder cause by influenza viruses or by infection with influenza viruses. As demonstrated in the present application, a  mulitiple sets of four mRNA molecules (i.e., the quadrivalent mRNA vaccines) have been shown to induce higher IgG and HAI antibody titer responses, as well as a stronger cellular immune response than the inactivated vaccine. Moreover, the quadrivalent vaccine has shown a strong potency comparable to the individual monovalent vaccine.
In one aspect, provided herein are non-naturally occurring nucleic acid molecules, e.g., a set of at least four non-naturally occurring nucleic acid molecules, that can be used for the prevention, management and treatment of a disease or disorder cause by influenza viruses or by infection with influenza viruses.
In some embodiments, the non-naturally occurring nucleic acid molecule comprises a coding nucleotide sequence encoding the HA protein of an influenza virus (e.g., A/H1N1, A/H3N2, B/Victoria, or B/Yamagata) , or an immunogenic fragment thereof. In some embodiments, the set of at least four non-naturally occurring nucleic acid molecules comprise: (1) a first non-naturally occurring nucleic acid molecule comprising a first coding nucleotide sequence encoding a first HA protein of an influenza virus of A/H1N1, or an immunogenic fragment thereof; (2) a second non-naturally occurring nucleic acid molecule comprising a second coding nucleotide sequence encoding a second HA protein of an influenza virus of A/H3N2, or an immunogenic fragment thereof; (3) a third non-naturally occurring nucleic acid molecule comprising a third coding nucleotide sequence encoding a third HA protein of an influenza virus of B/Victoria, or an immunogenic fragment thereof; and (4) a fourth non-naturally occurring nucleic acid molecule comprising a fourth coding nucleotide sequence encoding a fourth HA protein of an influenza virus of B/Yamagata, or an immunogenic fragment thereof. In some embodiments, the HA protein consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 1, 2, 3, or 4. In some embodiments, the first HA protein consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the first HA protein consists of, essentially consists of or comprises the amino acid sequence set forth in SEQ ID NO: 1. In some embodiments, the second HA protein consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to the amino acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 64. In some embodiments, the second HA protein consists of, essentially consists of or comprises the amino acid sequence set forth in SEQ ID NO: 2 or SEQ ID NO: 64. In some embodiments, the third HA protein consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 3 or 65. In some embodiments, the third HA protein consists of, essentially consists of or comprises the amino acid sequence set forth in SEQ ID NO: 3 or 65. In some embodiments, the fourth HA protein consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 4. In some embodiments, the fourth HA protein consists of, essentially consists of or comprises the amino acid sequence set forth in SEQ ID NO: 4. In some embodiments, the coding nucleotide sequence consists of, essentially consists of or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 5, 6, 7, or 8. In some embodiments, the first coding nucleotide sequence consists of, essentially consists of or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 5. In some embodiments, the first coding nucleotide sequence consists of, essentially consists of or comprises the nucleotide sequence set forth in SEQ ID NO: 5. In some embodiments, the second coding nucleotide sequence consists of, essentially consists of or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 6 or 66. In some embodiments, the second coding nucleotide sequence consists of, essentially consists of or comprises the nucleotide sequence set forth in SEQ ID NO: 6 or 66. In some embodiments, the third coding nucleotide sequence consists of, essentially consists of or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 7 or 67. In some embodiments, the third coding nucleotide sequence  consists of, essentially consists of or comprises the nucleotide sequence set forth in SEQ ID NO: 7 or 67. In some embodiments, the fourth coding nucleotide sequence consists of, essentially consists of or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 8. In some embodiments, the fourth coding nucleotide sequence consists of, essentially consists of or comprises the nucleotide sequence set forth in SEQ ID NO: 8. In some embodiments, the coding nucleotide sequence has been codon optimized for expression in cells of a subject. In some embodiments, the subject is a non-human mammal. In some embodiments, the subject is a human. In some embodiments, the HA protein or immunogenic fragment is fused to the native signal peptide. In some embodiments, the first HA protein or immunogenic fragment is fused to the first signal peptide. In some embodiments, the second HA protein or immunogenic fragment is fused to the second signal peptide. In some embodiments, the third HA protein or immunogenic fragment is fused to the third signal peptide. In some embodiments, the fourth HA protein or immunogenic fragment is fused to the fourth signal peptide. In some embodiments, the sigal peptide consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 9, 10, or 11. In some embodiments, the first sigal peptide consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 9. In some embodiments, the second sigal peptide consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 10. In some embodiments, the third sigal peptide consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 11. In some embodiments, the fourth sigal peptide consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 11. In some embodiments, the sigal peptide is encoded by a coding nucleotide sequence consisting of, essentially consisting of or comprising  a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 12, 13, or 14. In some embodiments, the first sigal peptide is encoded by a coding nucleotide sequence consisting of, essentially consisting of or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 12. In some embodiments, the second sigal peptide is encoded by a coding nucleotide sequence consisting of, essentially consisting of or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 13. In some embodiments, the third sigal peptide is encoded by a coding nucleotide sequence consisting of, essentially consisting of or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 14. In some embodiments, the fourth sigal peptide is encoded by a coding nucleotide sequence consisting of, essentially consisting of or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 14. In some embodiments, the HA protein or immunogenic fragment is fused to a heterologous polypeptide. In some embodiments, the heterologous polypeptide is selected from a Fc region of human immunoglobulin, a signal peptide, and a peptide facilitating multimerization of the fusion protein. In some embodiments, the signal peptide is a signal peptide from IgE or tPA. In some embodiments, the sigal peptide consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 15. In some embodiments, the sigal peptide is encoded by a coding nucleotide sequence consisting of, essentially consisting of or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 16. In some embodiments, the sigal peptide consists of, essentially consists of or comprises an amino acid sequence having at least about  90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 17. In some embodiments, the sigal peptide is encoded by a coding nucleotide sequence consisting of, essentially consisting of or comprising a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 18. In some embodiments, the multimerization is dimerization or trimerization. In some embodiments, the non-naturally occurring nucleic acid further comprises a 5’ untranslated region (5’-UTR) , wherein the 5’-UTR comprises the sequence set forth in any one of SEQ ID NOS: 19-26. In some embodiments, the non-naturally occurring nucleic acid further comprises a 3’ untranslated region (3’-UTR) , wherein the 3’-UTR comprises the sequence set forth in any one of SEQ ID NOS: 27-34. In some embodiments, the 3’-UTR further comprises a poly-A tail or a polyadenylation signal. In some embodiments, the non-naturally occurring nucleic acid comprises one or more functional nucleotide analogs that are selected from pseudouridine (psd) , 1-methyl-pseudouridine (m1) and 5-methylcytosine. In some embodiments, the nucleic acid is DNA or mRNA.
In some embodiments, disclosed herein are vectors or cells comprising the non-naturally occurring nucleic acid molecule or the set of at least four non-naturally occurring nucleic acid molecules (e.g., in a molar ratio of 1: 1: 1: 1) as described herein. In some embodiments, disclosed herein are compositions comprising the non-naturally occurring nucleic acid molecule or the set of at least four non-naturally occurring nucleic acid molecules (e.g., in a molar ratio of 1: 1: 1: 1) as described herein.
In some embodiments of the composition described herein, the composition further comprises at least one lipid described herein. In some embodiments of the composition described herein, the composition further comprises at least a first lipid (e.g., a cationic lipid) described herein and optionally a second lipid (e.g., a polymer lipid) described herein.
In some embodiments, the first lipid is a compound according to Formula (01-I) or (01-II) ; or a compound listed in Table 6; or a compound according to Formula (03-I) ; or a compound listed in Table 7; or a compound according to Formula (04-I) ; or a compound listed in Table 8.
In some embodiments, the composition is formulated as lipid nanoparticles encapsulating the nucleic acid in a lipid shell. In some embodiments, the composition is a pharmaceutical composition. In some embodiments, the composition is a vaccine.
In one aspect, provided herein are methods for managing, preventing or treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject, comprising administering to the subject a therapeutically effective amount of the non-naturally occurring nucleic acid or the set of at least four non-naturally occurring nucleic acid molecules (e.g., in a molar ratio of 1: 1: 1: 1) as described herein, or a therapeutically effective amount of the pharmaceutical composition as described herein.
In some embodiments of the method described herein, the subject is a human or a non-human mammal. In some embodiments, the subject is a human adult, a human child or a human toddler. In some embodiments, the subject has the disease or disorder. In some embodiments, the subject is at risk of, or is susceptible to, infection by influenza viruses. In some embodiments, the subject is an elderly human. In some embodiments, subject has been diagnosed positive for infection by influenza viruses. In some embodiments, the subject is asymptomatic.
In some embodiments of the method described herein, the method comprises administering lipid nanoparticles encapsulating the nucleic acids to the subject, and wherein the lipid nanoparticles are endocytosed by the cells in the subject. In some embodiments, the nucleic acids are expressed by the cells in the subject.
In some embodiments of the method described herein, an immune response against influenza viruses is elicited in the subject. In some embodiments, the immune response comprises production of cytokine in lymphocytes. In some embodiments, the immune response comprises increased proportion of cytokine-expressing lymphocytes. In some embodiments, the lymphocytes are CD4 +T cells and/or CD8 +T cells and/or splenocytes. In some embodiments, the cytokine is one or more of IFN-γ, TNF-α, IL-2, and IL-4. In some embodiments, the production of cytokines in lymphocytes is increased. In some embodiments, the immune response comprises production of an antibody (e.g., one or more of pan-IgG, IgG1, and IgG2a) specifically binds to the viral HA proteins encoded by the nucleic acids. In some embodiments,  the antibody is a neutralizing antibody against influenza viruses or cells infected by influenza viruses. In some embodiments, the serum titer of the antibody is increased in the subject.
In some embodiments of the method described herein, antibody binds to a viral particle or an infected cell and mark the viral particle of infected cell for destruction by the immune system of the subject. In some embodiments, endocytosis of viral particles bound by the antibody is induced or enhanced. In some embodiments, antibody-dependent cell-mediated cytotoxicity (ADCC) against infected cells in the subject is induced or enhanced. In some embodiments, antibody-dependent cellular phagocytosis (ADCP) against infected cells in the subject is induced or enhanced. In some embodiments, complement dependent cytotoxicity (CDC) against infected cells in the subject is induced or enhanced.
In some embodiments of the method described herein, the disease or disorder caused by influenza viruses is flu. Flu is a contagious respiratory illness, often infects the nose, throat, and sometimes the lungs. It can cause disease that ranges in severity from sub-clinical infection to primary viral pneumonia which can result in death. The clinical effects of infection vary with the virulence of the influenza strain and the exposure, history, age, and immune status of the host.
In one aspect, provided herein is the non-naturally occurring nucleic acid or the set of at least four non-naturally occurring nucleic acid molecules (e.g., in a molar ratio of 1: 1: 1: 1) as described herein, or a therapeutically effective amount of the pharmaceutical composition as described herein, for use in managing, preventing or treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject.
In one aspect, provided herein is the use of the non-naturally occurring nucleic acid or the set of at least four non-naturally occurring nucleic acid molecules (e.g., in a molar ratio of 1: 1: 1: 1) as described herein, or a therapeutically effective amount of the pharmaceutical composition as described herein, in the manufacture of a lipid nanoparticles encapsulating the nucleic acids or a vaccine for managing, preventing or treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject.
In some embodiments of the use described herein, the subject is a human or a non-human mammal. In some embodiments, the subject is a human adult, a human child or a human toddler. In some embodiments, the subject has the disease or disorder. In some embodiments,  the subject is at risk of, or is susceptible to, infection by influenza viruses. In some embodiments, the subject is an elderly human. In some embodiments, subject has been diagnosed positive for infection by influenza viruses. In some embodiments, the subject is asymptomatic.
In some embodiments of the use described herein, the disease or disorder caused by influenza viruses is flu.
4. BRIEF DESCRIPTION OF THE FIGURES
FIGs. 1-4 show cell surface expression of the HA protein by different mRNA constructs (shown by sequence identifiers) or negative control, as determined by FACS.
FIGs. 5A to 5G show serum HA-specific IgG production induced by vaccination with different mRNA vaccines (shown by sequence identifiers) or PBS.
FIGs. 6A to 6D show cytokine secretion induced by vaccination with different mRNA vaccines (shown by sequence identifiers) or PBS.
FIG. 7 shows serum IgG titer against H1N1 HA on Day 21 and Day 35 induced by vaccination with mRNA vaccine SEQ ID NO: 44 vs quadrivalent vaccine.
FIG. 8 shows serum IgG titer against H3N2 HA on Day 21 and Day 35 induced by vaccination with mRNA vaccine SEQ ID NO: 49 vs quadrivalent vaccine.
FIG. 9 shows serum IgG titer against B/Victoria HA on Day 21 and Day 35 induced by vaccination with mRNA vaccine SEQ ID NO: 50 vs quadrivalent vaccine.
FIG. 10 shows serum IgG titer against B/Yamagata HA on Day 21 and Day 35 induced by vaccination with mRNA vaccine SEQ ID NO: 61 vs quadrivalent vaccine.
FIG. 11 shows the secretion of IFN-γ by T cells in the mouse vaccinated with the respective antigens (SEQ ID NO: 44 vs quadrivalent) or PBS.
FIG. 12 shows the secretion of IL-2 by T cells in the mouse vaccinated with the respective antigens (SEQ ID NO: 44 vs quadrivalent) or PBS.
FIG. 13 shows the secretion of IL-4 by T cells in the mouse vaccinated with the respective antigens (SEQ ID NO: 44 vs quadrivalent) or PBS.
FIG. 14 shows HAI titer against H1N1 virus induced by the respectice vaccines on Day 21 and Day 28.
FIG. 15 shows HAI titer against H3N2 virus induced by the respectice vaccines on Day 21 and Day 28.
FIG. 16 shows HAI titer against BV virus induced by the respectice vaccines on Day 21 and Day 28.
FIG. 17 shows HAI titer against BY virus induced by the respectice vaccines on Day 21 and Day 28.
FIG. 18 shows CD8+T cell cytokine release under stimulation of H1N1 peptide pool
FIG. 19 shows CD4+T cell cytokine release under stimulation of H1N1 peptide pool
5. DETAILED DESCRIPTION
Provided herein are therapeutic nucleic acid molecules (e.g., a set of at least four therapeutic nucleic acid molecules) useful for the prevention, management and treatment of a disease or disorder cause by influenza viruses or by infection with influenza viruses. Also provided herein are pharmaceutical composition comprising the therapeutic nucleic acid molecules (e.g., a set of at least four therapeutic nucleic acid molecules) , including pharmaceutical composition formulated as lipid nanoparticles and related therapeutic methods and uses for preventing, managing and treating of a disease or disorder cause by influenza viruses or by infection with influenza viruses. Additional features of the present disclosure will become apparent to those skilled in the art upon consideration of the following detailed description of particular embodiments.
5.1 General Techniques
Techniques and procedures described or referenced herein include those that are generally well understood and/or commonly employed using conventional methodology by those skilled in the art, such as, for example, the widely utilized methodologies described in Sambrook et al., Molecular Cloning: A Laboratory Manual (3d ed. 2001) ; Current Protocols in Molecular Biology (Ausubel et al. eds., 2003) .
5.2 Terminology
Unless described otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art. For purposes of interpreting this specification, the following description of terms will apply and whenever appropriate, terms used in the singular will also include the plural and vice versa. All patents, applications, published applications, and other publications are incorporated by reference in their entirety. In the event that any description of terms set forth conflicts with any document incorporated herein by reference, the description of term set forth below shall control.
As used herein and unless otherwise specified, the term “lipid” refers to a group of organic compounds that include, but are not limited to, esters of fatty acids and are generally characterized by being poorly soluble in water, but soluble in many nonpolar organic solvents. While lipids generally have poor solubility in water, there are certain categories of lipids (e.g., lipids modified by polar groups, e.g., DMG-PEG2000) that have limited aqueous solubility and can dissolve in water under certain conditions. Known types of lipids include biological molecules such as fatty acids, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, triglycerides, and phospholipids. Lipids can be divided into at least three classes: (1) “simple lipids, ” which include fats and oils as well as waxes; (2) “compound lipids, ” which include phospholipids and glycolipids (e.g., DMPE-PEG2000) ; and (3) “derived lipids” such as steroids. Further, as used herein, lipids also encompass lipidoid compounds. The term “lipidoid compound, ” also simply “lipidoid” , refers to a lipid-like compound (e.g. an amphiphilic compound with lipid-like physical properties) .
The term “lipid nanoparticle” or “LNP” refers to a particle having at least one dimension on the order of nanometers (nm) (e.g., 1 to 1,000 nm) , which contains one or more types of lipid molecules. The LNP provided herein can further contain at least one non-lipid payload molecule (e.g., one or more nucleic acid molecules) . In some embodiments, the LNP comprises a non-lipid payload molecule either partially or completely encapsulated inside a lipid shell. Particularly, in some embodiments, wherein the payload is a negatively charged molecule (e.g., mRNA encoding a viral protein) , and the lipid components of the LNP comprise at least one cationic lipid. Without being bound by the theory, it is contemplated that the cationic lipids can interact with the negatively charged payload molecules and facilitates incorporation and/or encapsulation of the payload into the LNP during LNP formation. Other  lipids that can form part of a LNP as provided herein include but are not limited to neutral lipids and charged lipids, such as steroids, polymer conjugated lipids, and various zwitterionic lipids. In certain embodiments, a LNP according to the present disclosure comprises one or more lipids of Formula (01-I) , (01-II) , (03-I) and (04-I) (and sub-formulas thereof) as described herein..
The term “cationic lipid” refers to a lipid that is either positively charged at any pH value or hydrogen ion activity of its environment, or capable of being positively charged in response to the pH value or hydrogen ion activity of its environment (e.g., the environment of its intended use) . Thus, the term “cationic” encompasses both “permanently cationic” and “cationisable. ” In certain embodiments, the positive charge in a cationic lipid results from the presence of a quaternary nitrogen atom. In certain embodiments, the cationic lipid comprises a zwitterionic lipid that assumes a positive charge in the environment of its intended use (e.g., at physiological pH) . In certain embodiments, the cationic lipid is one or more lipids of Formula (01-I) , (01-II) , (03-I) and (04-I) (and sub-formulas thereof) as described herein.
The term “polymer conjugated lipid” refers to a molecule comprising both a lipid portion and a polymer portion. An example of a polymer conjugated lipid is a pegylated lipid (PEG-lipid) , in which the polymer portion comprises a polyethylene glycol.
The term “neutral lipid” encompasses any lipid molecules existing in uncharged forms or neutral zwitterionic forms at a selected pH value or within a selected pH range. In some embodiments, the selected useful pH value or range corresponds to the pH condition in an environment of the intended uses of the lipids, such as the physiological pH. As non-limiting examples, neutral lipids that can be used in connection with the present disclosure include, but are not limited to, phosphotidylcholines such as 1, 2-distearoyl-sn-glycero-3-phosphocholine (DSPC) , 1, 2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) , 1, 2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC) , 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) , 1, 2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) , phophatidylethanolamines such as 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) , 2- ( (2, 3-bis (oleoyloxy) propyl) dimethylammonio) ethyl hydrogen phosphate (DOCP) , sphingomyelins (SM) , ceramides, steroids such as sterols and their derivatives. Neutral lipids as provided herein may be synthetic or derived (isolated or modified) from a natural source or compound.
The term “charged lipid” encompasses any lipid molecules that exist in either positively charged or negatively charged forms at a selected pH or within a selected pH range. In some embodiments, the selected pH value or range corresponds to the pH condition in an environment of the intended uses of the lipids, such as the physiological pH. As non-limiting examples, charged lipids that can be used in connection with the present disclosure include, but are not limited to, phosphatidylserines, phosphatidic acids, phosphatidylglycerols, phosphatidylinositols, sterol hemisuccinates, dialkyl trimethylarnmonium-propanes, (e.g., DOTAP, DOTMA) , dialkyl dimethylaminopropanes, ethyl phosphocholines, dimethylaminoethane carbamoyl sterols (e.g., DC-Chol) , 1, 2-dioleoyl-sn-glycero-3-phospho-L-serine sodium salt (DOPS-Na) , 1, 2-dioleoyl-sn-glycero-3-phospho- (1'-rac-glycerol) sodium salt (DOPG-Na) , and 1, 2-dioleoyl-sn-glycero-3-phosphate sodium salt (DOPA-Na) . Charged lipids as provided herein may be synthetic or derived (isolated or modified) from a natural source or compound.
As used herein, and unless otherwise specified, the term “alkyl” refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, which is saturated. In one embodiment, the alkyl group has, for example, from one to twenty-four carbon atoms (C 1-C 24 alkyl) , four to twenty carbon atoms (C 4-C 20 alkyl) , six to sixteen carbon atoms (C 6-C 16 alkyl) , six to nine carbon atoms (C 6-C 9 alkyl) , one to fifteen carbon atoms (C 1-C 15 alkyl) , one to twelve carbon atoms (C 1-C 12 alkyl) , one to eight carbon atoms (C 1-C 8 alkyl) or one to six carbon atoms (C 1-C 6 alkyl) and which is attached to the rest of the molecule by a single bond. Examples of alkyl groups include, but are not limited to, methyl, ethyl, n-propyl, 1-methylethyl (isopropyl) , n-butyl, n-pentyl, 1, 1-dimethylethyl (t-butyl) , 3-methylhexyl, 2-methylhexyl, and the like. Unless otherwise specified, an alkyl group is optionally substituted.
As used herein, and unless otherwise specified, the term “alkenyl” refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, which contains one or more carbon-carbon double bonds. The term “alkenyl” also embraces radicals having “cis” and “trans” configurations, or alternatively, “E” and “Z” configurations, as appreciated by those of ordinary skill in the art. In one embodiment, the alkenyl group has, , for example, from two to twenty-four carbon atoms (C 2-C 24 alkenyl) , four to twenty carbon atoms (C 4-C 20 alkenyl) , six to sixteen carbon atoms (C 6-C 16 alkenyl) , six to nine carbon atoms (C 6-C 9 alkenyl) , two to fifteen carbon atoms (C 2-C 15 alkenyl) , two to twelve carbon atoms (C 2- C 12 alkenyl) , two to eight carbon atoms (C 2-C 8 alkenyl) or two to six carbon atoms (C 2-C 6 alkenyl) and which is attached to the rest of the molecule by a single bond. Examples of alkenyl groups include, but are not limited to, ethenyl, prop-1-enyl, but-1-enyl, pent-1-enyl, penta-1, 4-dienyl, and the like. Unless otherwise specified, an alkenyl group is optionally substituted.
As used herein, and unless otherwise specified, the term “alkynyl” refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms, which contains one or more carbon-carbon triple bonds. In one embodiment, the alkynyl group has, for example, from two to twenty-four carbon atoms (C 2-C 24 alkynyl) , four to twenty carbon atoms (C 4-C 20 alkynyl) , six to sixteen carbon atoms (C 6-C 16 alkynyl) , six to nine carbon atoms (C 6-C 9 alkynyl) , two to fifteen carbon atoms (C 2-C 15 alkynyl) , two to twelve carbon atoms (C 2-C 12 alkynyl) , two to eight carbon atoms (C 2-C 8 alkynyl) or two to six carbon atoms (C 2-C 6 alkynyl) and which is attached to the rest of the molecule by a single bond. Examples of alkynyl groups include, but are not limited to, ethynyl, propynyl, butynyl, pentynyl, and the like. Unless otherwise specified, an alkynyl group is optionally substituted.
As used herein, and unless otherwise specified, the term “alkylene” or “alkylene chain” refers to a straight or branched divalent hydrocarbon chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen, which is saturated. In one embodiment, the alkylene has, for example, from one to twenty-four carbon atoms (C 1-C 24 alkylene) , one to fifteen carbon atoms (C 1-C 15 alkylene) , one to twelve carbon atoms (C 1-C 12 alkylene) , one to eight carbon atoms (C 1-C 8 alkylene) , one to six carbon atoms (C 1-C 6 alkylene) , two to four carbon atoms (C 2-C 4 alkylene) , one to two carbon atoms (C 1-C 2 alkylene) . Examples of alkylene groups include, but are not limited to, methylene, ethylene, propylene, n-butylene, and the like. The alkylene chain is attached to the rest of the molecule through a single bond and to the radical group through a single bond. The points of attachment of the alkylene chain to the rest of the molecule and to the radical group can be through one carbon or any two carbons within the chain. Unless otherwise specified, an alkylene chain is optionally substituted.
As used herein, and unless otherwise specified, the term “alkenylene” refers to a straight or branched divalent hydrocarbon chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen, which contains one or more carbon-carbon  double bonds. In one embodiment, the alkenylene has, for example, from two to twenty-four carbon atoms (C 2-C 24 alkenylene) , two to fifteen carbon atoms (C 2-C 15 alkenylene) , two to twelve carbon atoms (C 2-C 12 alkenylene) , two to eight carbon atoms (C 2-C 8 alkenylene) , two to six carbon atoms (C 2-C 6 alkenylene) or two to four carbon atoms (C 2-C 4 alkenylene) . Examples of alkenylene include, but are not limited to, ethenylene, propenylene, n-butenylene, and the like. The alkenylene is attached to the rest of the molecule through a single or double bond and to the radical group through a single or double bond. The points of attachment of the alkenylene to the rest of the molecule and to the radical group can be through one carbon or any two carbons within the chain. Unless otherwise specified, an alkenylene is optionally substituted.
As used herein, and unless otherwise specified, the term “cycloalkyl” refers to a non-aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms, and which is saturated. Cycloalkyl group may include fused or bridged ring systems. In one embodiment, the cycloalkyl has, for example, from 3 to 15 ring carbon atoms (C 3-C 15 cycloalkyl) , from 3 to 10 ring carbon atoms (C 3-C 10 cycloalkyl) , or from 3 to 8 ring carbon atoms (C 3-C 8 cycloalkyl) . The cycloalkyl is attached to the rest of the molecule by a single bond. Examples of monocyclic cycloalkyl radicals include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Examples of polycyclic cycloalkyl radicals include, but are not limited to, adamantyl, norbornyl, decalinyl, 7, 7-dimethyl-bicyclo [2.2.1] heptanyl, and the like. Unless otherwise specified, a cycloalkyl group is optionally substituted.
As used herein, and unless otherwise specified, the term “cycloalkylene” is a divalent cycloalkyl group. Unless otherwise specified, a cycloalkylene group isoptionally substituted.
As used herein, and unless otherwise specified, the term “cycloalkenyl” refers to a non-aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms, and which includes one or more carbon-carbon double bonds. Cycloalkenyl may include fused or bridged ring systems. In one embodiment, the cycloalkenyl has, for example, from 3 to 15 ring carbon atoms (C 3-C 15 cycloalkenyl) , from 3 to 10 ring carbon atoms (C 3-C 10 cycloalkenyl) , or from 3 to 8 ring carbon atoms (C 3-C 8 cycloalkenyl) . The cycloalkenyl is attached to the rest of the molecule by a single bond. Examples of monocyclic cycloalkenyl radicals include, but are not limited to, cyclopropenyl, cyclobutenyl,  cyclopentenyl, cyclohexenyl, cycloheptenyl, cyclooctenyl, and the like. Unless otherwise specified, a cycloalkenyl group is optionally substituted.
As used herein, and unless otherwise specified, the term “cycloalkenylene” is a divalent cycloalkenyl group. Unless otherwise specified, a cycloalkenylene group is optionally substituted.
As used herein, and unless otherwise specified, the term “heterocyclyl” refers to a non-aromatic radical monocyclic or polycyclic moiety that contains one or more (e.g., one, one or two, one to three, or one to four) heteroatoms independently selected from nitrogen, oxygen, phosphorous, and sulfur. The heterocyclyl may be attached to the main structure at any heteroatom or carbon atom. A heterocyclyl group can be a monocyclic, bicyclic, tricyclic, tetracyclic, or other polycyclic ring system, wherein the polycyclic ring systems can be a fused, bridged or spiro ring system. Heterocyclyl polycyclic ring systems can include one or more heteroatoms in one or more rings. A heterocyclyl group can be saturated or partially unsaturated. Saturated heterocycloalkyl groups can be termed “heterocycloalkyl” . Partially unsaturated heterocycloalkyl groups can be termed “heterocycloalkenyl” if the heterocyclyl contains at least one double bond, or “heterocycloalkynyl” if the heterocyclyl contains at least one triple bond. In one embodiment, the heterocyclyl has, for example, 3 to 18 ring atoms (3-to 18-membered heterocyclyl) , 4 to 18 ring atoms (4-to 18-membered heterocyclyl) , 5 to 18 ring atoms (3-to 18-membered heterocyclyl) , 4 to 8 ring atoms (4-to 8-membered heterocyclyl) , or 5 to 8 ring atoms (5-to 8-membered heterocyclyl) . Whenever it appears herein, a numerical range such as “3 to 18” refers to each integer in the given range; e.g., “3 to 18 ring atoms” means that the heterocyclyl group can consist of 3 ring atoms, 4 ring atoms, 5 ring atoms, 6 ring atoms, 7 ring atoms, 8 ring atoms, 9 ring atoms, 10 ring atoms, etc., up to and including 18 ring atoms. Examples of heterocyclyl groups include, but are not limited to, imidazolyl, imidazolidinyl, oxazolyl, oxazolidinyl, thiazolyl, thiazolidinyl, pyrazolidinyl, pyrazolyl, isoxazolidinyl, isoxazolyl, isothiazolidinyl, isothiazolyl, morpholinyl, pyrrolyl, pyrrolidinyl, furyl, tetrahydrofuryl, thiophenyl, pyridinyl, piperidinyl, quinolyl, and isoquinolyl. Unless otherwise specified, a heterocyclyl group is optionally substituted.
As used herein, and unless otherwise specified, the term “heterocyclylene” is a divalent heterocyclyl group. Unless otherwise specified, a heterocyclylene group is optionally substituted
As used herein, and unless otherwise specified, the term “aryl” refers to a monocyclic aromatic group and/or multicyclic monovalent aromatic group that contain at least one aromatic hydrocarbon ring. In certain embodiments, the aryl has from 6 to 18 ring carbon atoms (C 6-C 18 aryl) , from 6 to 14 ring carbon atoms (C 6-C 14 aryl) , or from 6 to 10 ring carbon atoms (C 6-C 10 aryl) . Examples of aryl groups include, but are not limited to, phenyl, naphthyl, fluorenyl, azulenyl, anthryl, phenanthryl, pyrenyl, biphenyl, and terphenyl. The term “aryl” also refers to bicyclic, tricyclic, or other multicyclic hydrocarbon rings, where at least one of the rings is aromatic and the others of which may be saturated, partially unsaturated, or aromatic, for example, dihydronaphthyl, indenyl, indanyl, or tetrahydronaphthyl (tetralinyl) . Unless otherwise specified, an aryl group is optionally substituted.
As used herein, and unless otherwise specified, the term “arylene” is a divalent aryl group. Unless otherwise specified, an arylene group is optionally substituted.
As used herein, and unless otherwise specified, the term “heteroaryl” refers to a monocyclic aromatic group and/or multicyclic aromatic group that contains at least one aromatic ring, wherein at least one aromatic ring contains one or more (e.g., one, one or two, one to three, or one to four) heteroatoms independently selected from O, S, and N. The heteroaryl may be attached to the main structure at any heteroatom or carbon atom. In certain embodiments, the heteroaryl has from 5 to 20, from 5 to 15, or from 5 to 10 ring atoms. The term “heteroaryl” also refers to bicyclic, tricyclic, or other multicyclic rings, where at least one of the rings is aromatic and the others of which may be saturated, partially unsaturated, or aromatic, wherein at least one aromatic ring contains one or more heteroatoms independently selected from O, S, and N. Examples of monocyclic heteroaryl groups include, but are not limited to, pyrrolyl, pyrazolyl, pyrazolinyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, thiadiazolyl, isothiazolyl, furanyl, thienyl, oxadiazolyl, pyridyl, pyrazinyl, pyrimidinyl, pyridazinyl, and triazinyl. Examples of bicyclic heteroaryl groups include, but are not limited to,indolyl, benzothiazolyl, benzoxazolyl, benzothienyl, quinolinyl, tetrahydroisoquinolinyl, isoquinolinyl, benzimidazolyl, benzopyranyl, indolizinyl, benzofuranyl, isobenzofuranyl, chromonyl, coumarinyl, cinnolinyl, quinoxalinyl, indazolyl, purinyl, pyrrolopyridinyl, furopyridinyl, thienopyridinyl, dihydroisoindolyl, and tetrahydroquinolinyl. Examples of tricyclic heteroaryl groups include, but are not limited to, carbazolyl, benzindolyl,  phenanthrollinyl, acridinyl, phenanthridinyl, and xanthenyl. Unless otherwise specified, aheteroaryl group is optionally substituted.
As used herein, and unless otherwise specified, the term “heteroarylene” is a divalent heteroaryl group. Unless otherwise specified, a heteroarylene group is optionally substituted.
When the groups described herein are said to be “substituted, ” they may be substituted with any appropriate substituent or substituents. Illustrative examples of substituents include, but are not limited to, those found in the exemplary compounds and embodiments provided herein, as well as: a halogen atom such as F, CI, Br, or I; cyano; oxo (=O) ; hydroxyl (-OH) ; alkyl; alkenyl; alkynyl; cycloalkyl; aryl; - (C=O) OR’ ; -O (C=O) R’; -C (=O) R’; -OR’; -S (O)  xR’; -S-SR’; -C (=O) SR’; -SC (=O) R’; -NR’R’; -NR’C (=O) R’; -C (=O) NR’R’; -NR’C (=O) NR’R’; -OC (=O) NR’R’; -NR’C (=O) OR’; -NR’S (O)  xNR’R’; -NR’S (O)  xR’; and-S (O)  xNR’R’, wherein: R’ is, at each occurrence, independently H, C 1-C 15 alkyl or cycloalkyl, and x is 0, 1 or 2. In some embodiments the substituent is a C 1-C 12 alkyl group. In other embodiments, the substituent is a cycloalkyl group. In other embodiments, the substituent is a halo group, such as fluoro. In other embodiments, the substituent is an oxo group. In other embodiments, the substituent is a hydroxyl group. In other embodiments, the substituent is an alkoxy group (-OR’) . In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amino group (-NR’R’) .
As used herein, and unless otherwise specified, the term “optional” or “optionally” (e.g., optionally substituted) means that the subsequently described event of circumstances may or may not occur, and that the description includes instances where said event or circumstance occurs and instances in which it does not. For example, “optionally substituted alkyl” means that the alkyl radical may or may not be substituted and that the description includes both substituted alkyl radicals and alkyl radicals having no substitution.
As used herein, and unless otherwise specified, the term “prodrug” of a biologically active compound refers to a compound that may be converted under physiological conditions or by solvolysis to the biologically active compound. In one embodiment, the term “prodrug” refers to a metabolic precursor of the biologically active compound that is pharmaceutically acceptable. A prodrug may be inactive when administered to a subject in need thereof, but is converted in vivo to the biologically active compound. Prodrugs are typically rapidly  transformed in vivo to yield the parent biologically active compound, for example, by hydrolysis in blood. The prodrug compound often offers advantages of solubility, tissue compatibility or delayed release in a mammalian organism (see, Bundgard, H., Design of Prodrugs (1985) , pp. 7-9, 21-24 (Elsevier, Amsterdam) ) . A discussion of prodrugs is provided in Higuchi, T., et al., A.C.S. Symposium Series, Vol. 14, and in Bioreversible Carriers in Drug Design, Ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.
In one embodiment, the term “prodrug” is also meant to include any covalently bonded carriers, which release the active compound in vivo when such prodrug is administered to a mammalian subject. Prodrugs of a compound may be prepared by modifying functional groups present in the compound in such a way that the modifications are cleaved, either in routine manipulation or in vivo, to the parent compound. Prodrugs include compounds wherein a hydroxyl, amino or mercapto group is bonded to any group that, when the prodrug of the compound is administered to a mammalian subject, cleaves to form a free hydroxyl, free amino or free mercapto group, respectively.
Examples of prodrugs include, but are not limited to, acetate, formate and benzoate derivatives of alcohol or amide derivatives of amine functional groups in the compounds provided herein.
As used herein, and unless otherwise specified, the term “pharmaceutically acceptable salt” includes both acid and base addition salts.
Examples of pharmaceutically acceptable acid addition salts include, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, and organic acids such as, but not limited to, acetic acid, 2, 2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor-10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecylsulfuric acid, ethane-1, 2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxo-glutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-1, 5-disulfonic acid,  naphthalene-2-sulfonic acid, 1-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, trifluoroacetic acid, undecylenic acid, and the like.
Examples of pharmaceutically acceptable base addition salt include, but are not limited to, salts prepared from addition of an inorganic base or an organic base to a free acid compound. Salts derived from inorganic bases include, but are not limited to, the sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. In one embodiment, the inorganic salts are the ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine, tromethamine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins and the like. In one embodiment, the organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine.
A compound provided herein may contain one or more asymmetric centers and may thus give rise to enantiomers, diastereomers, and other stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R) -or (S) -or, as (D) -or (L) -for amino acids. Unless otherwise specified, a compound provided herein is meant to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-) , (R) -and(S) -, or (D) -and (L) -isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, for example, chromatography and fractional crystallization. Conventional techniques for the preparation/isolation of individual enantiomers include chiral synthesis from a suitable optically pure precursor or resolution of the racemate (or the racemate of a salt or derivative) using, for example, chiral high pressure liquid chromatography (HPLC) . When the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended  that the compounds include both E and Z geometric isomers. Likewise, all tautomeric forms are also intended to be included.
As used herein, and unless otherwise specified, the term “isomer” refers to different compounds that have the same molecular formula. “Stereoisomers” are isomers that differ only in the way the atoms are arranged in space. “Atropisomers” are stereoisomers from hindered rotation about single bonds. “Enantiomers” are a pair of stereoisomers that are non-superimposable mirror images of each other. A mixture of a pair of enantiomers in any proportion can be known as a “racemic” mixture. “Diastereoisomers” are stereoisomers that have at least two asymmetric atoms, but which are not mirror-images of each other.
“Stereoisomers” can also include E and Z isomers, or a mixture thereof, and cis and trans isomers or a mixture thereof. In certain embodiments, a compound described herein is isolated as either the E or Z isomer. In other embodiments, a compound described herein is a mixture of the E and Z isomers.
“Tautomers” refers to isomeric forms of a compound that are in equilibrium with each other. The concentrations of the isomeric forms will depend on the environment the compound is found in and may be different depending upon, for example, whether the compound is a solid or is in an organic or aqueous solution.
It should also be noted a compound described herein can contain unnatural proportions of atomic isotopes at one or more of the atoms. For example, the compounds may be radiolabeled with radioactive isotopes, such as for example tritium ( 3H) , iodine-125 ( 125I) , sulfur-35 ( 35S) , or carbon-14 ( 14C) , or may be isotopically enriched, such as with deuterium ( 2H) , carbon-13 ( 13C) , or nitrogen-15 ( 15N) . As used herein, an “isotopolog” is an isotopically enriched compound. The term “isotopically enriched” refers to an atom having an isotopic composition other than the natural isotopic composition of that atom. “Isotopically enriched” may also refer to a compound containing at least one atom having an isotopic composition other than the natural isotopic composition of that atom. The term “isotopic composition” refers to the amount of each isotope present for a given atom. Radiolabeled and isotopically enriched compounds are useful as therapeutic agents, e.g., cancer therapeutic agents, research reagents, e.g., binding assay reagents, and diagnostic agents, e.g., in vivo imaging agents. All isotopic variations of a compound described herein, whether radioactive or not, are intended to be encompassed within the scope of the embodiments provided herein. In some embodiments,  there are provided isotopologs of a compound described herein, for example, the isotopologs are deuterium, carbon-13, and/or nitrogen-15 enriched. As used herein, “deuterated” , means a compound wherein at least one hydrogen (H) has been replaced by deuterium (indicated by D or  2H) , that is, the compound is enriched in deuterium in at least one position.
It should be noted that if there is a discrepancy between a depicted structure and a name for that structure, the depicted structure is to be accorded more weight.
As used herein, and unless otherwise specified, the term “pharmaceutically acceptable carrier, diluent or excipient” includes without limitation any adjuvant, carrier, excipient, glidant, sweetening agent, diluent, preservative, dye/colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, or emulsifier which has been approved by the United States Food and Drug Administration as being acceptable for use in humans or domestic animals.
The term “composition” is intended to encompass a product containing the specified ingredients (e.g., a mRNA molecule provided herein) in, optionally, the specified amounts.
The term “polynucleotide” or “nucleic acid, ” as used interchangeably herein, refers to polymers of nucleotides of any length and includes, e.g., DNA and RNA. The nucleotides can be deoxyribonucleotides, ribonucleotides, modified nucleotides or bases, and/or their analogs, or any substrate that can be incorporated into a polymer by DNA or RNA polymerase or by a synthetic reaction. A polynucleotide may comprise modified nucleotides, such as methylated nucleotides and their analogs. Nucleic acid can be in either single-or double-stranded forms. As used herein and unless otherwise specified, “nucleic acid” also includes nucleic acid mimics such as locked nucleic acids (LNAs) , peptide nucleic acids (PNAs) , and morpholinos. “Oligonucleotide, ” as used herein, refers to short synthetic polynucleotides that are generally, but not necessarily, fewer than about 200 nucleotides in length. The terms “oligonucleotide” and “polynucleotide” are not mutually exclusive. The description above for polynucleotides is equally and fully applicable to oligonucleotides. Unless specified otherwise, the left-hand end of any single-stranded polynucleotide sequence disclosed herein is the 5’ end; the left-hand direction of double-stranded polynucleotide sequences is referred to as the 5’ direction. The direction of 5’ to 3’ addition of nascent RNA transcripts is referred to as the transcription direction; sequence regions on the DNA strand having the same sequence as the RNA transcript that are 5’ to the 5’ end of the RNA transcript are referred to as “upstream sequences” ; sequence regions on the DNA strand having the same sequence as the RNA transcript that are 3’ to the 3’ end of the RNA transcript are referred to as “downstream sequences. ”
As used herein, the term “non-naturally occurring” when used in reference to a nucleic acid molecule as described herein is intended to mean that the nucleic acid molecule is not found in nature. A non-naturally occurring nucleic acid encoding a viral peptide or protein contains at least one genetic alternation or chemical modification not normally found in a naturally occurring strain of the virus, including wild-type strains of the virus. Genetic alterations include, for example, modifications introducing expressible nucleic acid sequences encoding peptides or polypeptides heterologous to the virus, other nucleic acid additions, nucleic acid deletions, nucleic acid substitution, and/or other functional disruption of the virus’ genetic material. Such modifications include, for example, modifications in the coding regions and functional fragments thereof, for heterologous, homologous or both heterologous and homologous polypeptides for the viral species. Additional modifications include, for example, modifications in non-coding regulatory regions in which the modifications alter expression of a gene or operon. Additional modifications also include, for example, incorporation of a nucleic acid sequence into a vector, such as a plasmid or an artificial chromosome. Chemical modifications include, for example, one or more functional nucleotide analog as described herein.
An “isolated nucleic acid” is a nucleic acid, for example, an RNA, DNA, or a mixed nucleic acids, which is substantially separated from other genome DNA sequences as well as proteins or complexes such as ribosomes and polymerases, which naturally accompany a native sequence. An “isolated” nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule. Moreover, an“isolated” nucleic acid molecule, such as an mRNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized. In a specific embodiment, one or more nucleic acid molecules encoding an antigen as described herein are isolated or purified. The term embraces nucleic acid sequences that have been removed from their naturally occurring environment, and includes recombinant or cloned DNA or RNA isolates and chemically synthesized analogues or analogues biologically synthesized  by heterologous systems. A substantially pure molecule may include isolated forms of the molecule.
The term “encoding nucleic acid” or grammatical equivalents thereof as it is used in reference to nucleic acid molecule encompasses (a) a nucleic acid molecule in its native state or when manipulated by methods well known to those skilled in the art that can be transcribed to produce mRNA which is then translated into a peptide and/or polypeptide, and (b) the mRNA molecule itself. The antisense strand is the complement of such a nucleic acid molecule, and the encoding sequence can be deduced therefrom. The term “coding region” refers to a portion in an encoding nucleic acid sequence that is translated into a peptide or polypeptide. The term “untranslated region” or “UTR” refers to the portion of an encoding nucleic acid that is not translated into a peptide or polypeptide. Depending on the orientation of a UTR with respect to the coding region of a nucleic acid molecule, a UTR is referred to as the 5’-UTR if located to the 5’-end of a coding region, and a UTR is referred to as the 3’-UTR if located to the 3’-end of a coding region.
The term “mRNA” as used herein refers to a message RNA molecule comprising one or more open reading frame (ORF) that can be translated by a cell or an organism provided with the mRNA to produce one or more peptide or protein product. The region containing the one or more ORFs is referred to as the coding region of the mRNA molecule. In certain embodiments, the mRNA molecule further comprises one or more untranslated regions (UTRs) .
In certain embodiments, the mRNA is a monocistronic mRNA that comprises only one ORF. In certain embodiments, the monocistronic mRNA encodes a peptide or protein comprising at least one epitope of a selected antigen (e.g., a pathogenic antigen or a tumor associated antigen) . In other embodiments, the mRNA is a multicistronic mRNA that comprises two or more ORFs. In certain embodiments, the multiecistronic mRNA encodes two or more peptides or proteins that can be the same or different from each other. In certain embodiments, each peptide or protein encoded by a multicistronic mRNA comprises at least one epitope of a selected antigen. In certain embodiments, different peptide or protein encoded by a multicistronic mRNA each comprises at least one epitope of different antigens. In any of the embodiments described herein, the at least one epitope can be at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10 epitopes of an antigen.
The term “nucleobases” encompasses purines and pyrimidines, including natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural or synthetic analogs or derivatives thereof.
The term “functional nucleotide analog” as used herein refers to a modified version of a canonical nucleotide A, G, C, U or T that (a) retains the base-pairing properties of the corresponding canonical nucleotide, and (b) contains at least one chemical modification to (i) the nucleobase, (ii) the sugar group, (iii) the phosphate group, or (iv) any combinations of (i) to (iii) , of the corresponding natural nucleotide. As used herein, base pairing encompasses not only the canonical Watson-Crick adenine-thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between canonical nucleotides and functional nucleotide analogs or between a pair of functional nucleotide analogs, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a modified nucleobase and a canonical nucleobase or between two complementary modified nucleobase structures. For example, a functional analog of guanosine (G) retains the ability to base-pair with cytosine (C) or a functional analog of cytosine. One example of such non-canonical base pairing is the base pairing between the modified nucleotide inosine and adenine, cytosine, or uracil. As described herein, a functional nucleotide analog can be either naturally occurring or non-naturally occurring. Accordingly, a nucleic acid molecule containing a functional nucleotide analog can have at least one modified nucleobase, sugar group and/or internucleoside linkage. Exemplary chemical modifications to the nucleobases, sugar groups, or internucleoside linkages of a nucleic acid molecule are provided herein.
The terms “translational enhancer element, ” “TEE” and “translational enhancers” as used herein refers to an region in a nucleic acid molecule that functions to promotes translation of a coding sequence of the nucleic acid into a protein or peptide product, such as via cap-dependent or cap-independent translation. A TEE typically locates in the UTR region of a nucleic acid molecule (e.g., mRNA) and enhance the translational level of a coding sequence located either upstream or downstream. For example, a TEE in a 5’-UTR of a nucleic acid molecule can locate between the promoter and the starting codon of the nucleic acid molecule. Various TEE sequences are known in the art (Wellensiek et al. Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug; 10 (8) : 747–750; Chappell et al. PNAS June 29, 2004 101 (26) 9590-9594) . Some TEEs are known to  be conserved across multiple species (Pánek et al. Nucleic Acids Research, Volume 41,  Issue  16, 1 September 2013, Pages 7625–7634) .
As used herein, the term “stem-loop sequence” refers to a single-stranded polynucleotide sequence having at least two regions that are complementary or substantially complementary to each other when read in opposite directions, and thus capable of base-pairing with each other to form at least one double helix and an unpaired loop. The resulting structure is known as a stem-loop structure, a hairpin, or a hairpin loop, which is a secondary structure found in many RNA molecules.
The term “peptide” as used herein refers to a polymer containing between two and fifty (2-50) amino acid residues linked by one or more covalent peptide bond (s) . The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally occurring amino acid (e.g., an amino acid analog or non-natural amino acid) .
The terms “polypeptide” and “protein” are used interchangeably herein to refer to a polymer of greater than fifty (50) amino acid residues linked by covalent peptide bonds. That is, a description directed to a polypeptide applies equally to a description of a protein, and vice versa. The terms apply to naturally occurring amino acid polymers as well as amino acid polymers in which one or more amino acid residues is a non-naturally occurring amino acid (e.g., an amino acid analog) . As used herein, the terms encompass amino acid chains of any length, including full length proteins (e.g., antigens) .
In the context of a peptide or polypeptide, the term “derivative” as used herein refers to a peptide or polypeptide that comprises an amino acid sequence of the viral peptide or protein, or a fragment of a viral peptide or protein, which has been altered by the introduction of amino acid residue substitutions, deletions, or additions. The term “derivative” as used herein also refers to a viral peptide or protein, or a fragment of a viral peptide or protein, which has been chemically modified, e.g., by the covalent attachment of any type of molecule to the polypeptide. For example, but not by way of limitation, a viral peptide or protein or a fragment of the viral peptide or protein may be chemically modified, e.g., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, chemical cleavage, formulation, metabolic synthesis of tunicamycin, linkage to a cellular ligand or other protein, etc. The derivatives are modified in a manner that  is different from naturally occurring or starting peptide or polypeptides, either in the type or location of the molecules attached. Derivatives further include deletion of one or more chemical groups which are naturally present on the viral peptide or protein. Further, aderivative of a viral peptide or protein or a fragment of a viral peptide or protein may contain one or more non-classical amino acids. In specific embodiments, a derivative is a functional derivative of the native or unmodified peptide or polypeptide from which it was derived.
The term “functional derivative” refers to a derivative that retains one or more functions or activities of the naturally occurring or starting peptide or polypeptide from which it was derived. For example, a functional derivative of a influenza virus S protein may retain the ability to bind one or more of its receptors on a host cell. For example, a functional derivative of a influenza virus N protein may retain the ability to bind RNA or the package viral genome.
The term “identity” refers to a relationship between the sequences of two or more polypeptide molecules or two or more nucleic acid molecules, as determined by aligning and comparing the sequences. “Percent (%) amino acid sequence identity” with respect to a reference polypeptide sequence is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, BLAST-2, ALIGN, or MEGALIGN (DNAStar, Inc. ) software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
A “modification” of an amino acid residue/position refers to a change of a primary amino acid sequence as compared to a starting amino acid sequence, wherein the change results from a sequence alteration involving said amino acid residue/position. For example, typical modifications include substitution of the residue with another amino acid (e.g., a conservative or non-conservative substitution) , insertion of one or more (e.g., generally fewer than 5, 4, or 3) amino acids adjacent to said residue/position, and/or deletion of said residue/position.
In the context of a peptide or polypeptide, the term “fragment” as used herein refers to a peptide or polypeptide that comprises less than the full length amino acid sequence. Such a fragment may arise, for example, from a truncation at the amino terminus, a truncation at the carboxy terminus, and/or an internal deletion of a residue (s) from the amino acid sequence. Fragments may, for example, result from alternative RNA splicing or from in vivo protease activity. In certain embodiments, fragments refers to polypeptides comprising an amino acid sequence of at least 5 contiguous amino acid residues, at least 10 contiguous amino acid residues, at least 15 contiguous amino acid residues, at least 20 contiguous amino acid residues, at least 25 contiguous amino acid residues, at least 30 contiguous amino acid residues, at least 40 contiguous amino acid residues, at least 50 contiguous amino acid residues, at least 60 contiguous amino residues, at least 70 contiguous amino acid residues, at least 80 contiguous amino acid residues, at least 90 contiguous amino acid residues, at least contiguous 100 amino acid residues, at least 125 contiguous amino acid residues, at least 150 contiguous amino acid residues, at least 175 contiguous amino acid residues, at least 200 contiguous amino acid residues, at least 250, at least 300, at least 350, at least 400, at least 450, at least 500, at least 550, at least 600, at least 650, at least 700, at least 750, at least 800, at least 850, at least 900, or at least 950 contiguous amino acid residues of the amino acid sequence of a polypeptide. In a specific embodiment, a fragment of a polypeptide retains at least 1, at least 2, at least 3, or more functions of the polypeptide.
The term “immunogenic fragment” as used herein in the context of a peptide or polypeptide (e.g., a protein) , refers to a fragment of a peptide or polypeptide that retains the ability of the peptide or polypeptide in eliciting an immune response upon contacting the immune system of a mammal, including innate immune responses and/or adaptive immune responses. In some embodiments, an immunogenic fragment of a peptide or polypeptide can be an epitope.
The term “antigen” refers to a substance that can be recognized by the immune system of a subject (including by the adaptive immune system) , and is capable of triggering an immune response after the subject is contacted with the antigen (including an antigen-specific immune response) . In certain embodiments, the antigen is a protein associated with a diseased cell, such as a cell infected by a pathogen or a neoplastic cell (e.g., tumor associated antigen (TAA) ) .
An “epitope” is the site on the surface of an antigen molecule to which a single antibody molecule binds, such as a localized region on the surface of an antigen that is capable of being bound to one or more antigen binding regions of an antibody, and that has antigenic or immunogenic activity in an animal, such as a mammal (e.g., a human) , that is capable of eliciting an immune response. An epitope having immunogenic activity is a portion of a polypeptide that elicits an antibody response in an animal. An epitope having antigenic activity is a portion of a polypeptide to which an antibody binds as determined by any method well known in the art, including, for example, by an immunoassay. Antigenic epitopes need not necessarily be immunogenic. Epitopes often consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and have specific three dimensional structural characteristics as well as specific charge characteristics. Antibody epitopes may be linear epitopes or conformational epitopes. Linear epitopes are formed by a continuous sequence of amino acids in a protein. Conformational epitopes are formed of amino acids that are discontinuous in the protein sequence, but which are brought together upon folding of the protein into its three-dimensional structure. Induced epitopes are formed when the three dimensional structure of the protein is in an altered conformation, such as following activation or binding of another protein or ligand. In certain embodiments, an epitope is a three-dimensional surface feature of a polypeptide. In other embodiments, an epitope is linear feature of a polypeptide. Generally an antigen has several or many different epitopes and may react with many different antibodies.
The term “heterologous” refers an entity not found in nature to be associated with (e.g., encoded by and/or expressed by the genome of) a naturally occurring influenza virus. The term “homologous” refers an entity found in nature to be associated with (e.g., encoded by and/or expressed by the genome of) a naturally occurring influenza virus.
The term “genetic vaccine” as used herein refers to a therapeutic or prophylactic composition comprising at least one nucleic acid molecule encoding an antigen associated with a target disease (e.g., an infectious disease or a neoplastic disease) . Administration of the vaccine to a subject ( “vaccination” ) allows for the production of the encoded peptide or protein, thereby eliciting an immune response against the target disease in the subject. In certain embodiments, the immune response comprises adaptive immune response, such as the production of antibodies against the encoded antigen, and/or activation and proliferations of  immune cells capable of specifically eliminating diseased cells expressing the antigen. In certain embodiments, the immune response further comprises innate immune response. According to the present disclosure, a vaccine can be administered to a subject either before or after the onset of clinical symptoms of the target disease. In some embodiments, vaccination of a healthy or asymptomatic subject renders the vaccinated subject immune or less susceptible to the development of the target disease. In some embodiments, vaccination of a subject showing symptoms of the disease improves the condition of, or treats, the disease in the vaccinated subject.
The term “vector” refers to a substance that is used to carry or include a nucleic acid sequence, including for example, a nucleic acid sequence encoding a viral peptide or protein as described herein, in order to introduce a nucleic acid sequence into a host cell, or serve as a transcription template to carry out in vitro transcription reaction in a cell-free system to produce mRNA. Vectors applicable for use include, for example, expression vectors, plasmids, phage vectors, viral vectors, episomes, and artificial chromosomes, which can include selection sequences or markers operable for stable integration into a host cell’s chromosome. Additionally, the vectors can include one or more selectable marker genes and appropriate transcription or translation control sequences. Selectable marker genes that can be included, for example, provide resistance to antibiotics or toxins, complement auxotrophic deficiencies, or supply critical nutrients not in the culture media. Transcription or translation control sequences can include constitutive and inducible promoters, transcription enhancers, transcription terminators, and the like, which are well known in the art. When two or more nucleic acid molecules are to be co-transcribed or co-translated (e.g., nucleic acid molecules encoding two or more different viral peptides or proteins) , both nucleic acid molecules can be inserted, for example, into a single expression vector or in separate expression vectors. For single vector transcription and/or translation, the encoding nucleic acids can be operationally linked to one common transcription or translation control sequence or linked to different transcription or translation control sequences, such as one inducible promoter and one constitutive promoter. The introduction of nucleic acid molecules into a host cell can be confirmed using methods well known in the art. Such methods include, for example, nucleic acid analysis such as Northern blots or polymerase chain reaction (PCR) amplification of mRNA, immunoblotting for expression of gene products, or other suitable analytical methods to test the expression of an  introduced nucleic acid sequence or its corresponding gene product. It is understood by those skilled in the art that the nucleic acid molecules are expressed in a sufficient amount to produce a desired product (e.g., a mRNA transcript of the nucleic acid as described herein) , and it is further understood that expression levels can be optimized to obtain sufficient expression using methods well known in the art.
The terms “innate immune response” and “innate immunity” are recognized in the art, and refer to non-specific defense mechanism a body’s immune system initiates upon recognition of pathogen-associated molecular patterns, which involves different forms of cellular activities, including cytokine production and cell death through various pathways. As used herein, innate immune responses include, without limitation, increased production of inflammation cytokines (e.g., type I interferon or IL-10 production) , activation of the NFκB pathway, increased proliferation, maturation, differentiation and/or survival of immune cells, and in some cases, induction of cell apoptosis. Activation of the innate immunity can be detected using methods known in the art, such as measuring the (NF) -κB activation.
The terms “adaptive immune response” and “adaptive immunity” are recognized in the art, and refer to antigen-specific defense mechanism a body’s immune system initiates upon recognition of a specific antigen, which include both humoral response and cell-mediated responses. As used herein, adaptive immune responses include cellular responses that is triggered and/or augmented by a vaccine composition, such as a genetic composition described herein. In some embodiments, the vaccine composition comprises an antigen that is the target of the antigen-specific adaptive immune response. In other embodiments, the vaccine composition, upon administration, allows the production in an immunized subject of an antigen that is the target of the antigen-specific adaptive immune response. Activation of an adaptive immune response can be detected using methods known in the art, such as measuring the antigen-specific antibody production, or the level of antigen-specific cell-mediated cytotoxicity.
“Antibody-dependent cell-mediated cytotoxicity” or “ADCC” refers to a form of cytotoxicity in which secreted immunoglobulin bound onto Fc receptors (FcRs) present on certain cytotoxic cells (e.g., Natural Killer (NK) cells, neutrophils, and macrophages) enable these cytotoxic effector cells to bind specifically to an antigen-bearing target cell and subsequently kill the target cell with cytotoxins. The antibodies “arm” the cytotoxic cells and are absolutely required for such killing. NK cells, the primary cells for mediating ADCC,  express FcγRIII only, whereas monocytes express FcγRI, FcγRII, and FcγRIII. FcR expression on hematopoietic cells is known (see, e.g., Ravetch and Kinet, 1991, Annu. Rev. Immunol. 9: 457-92) . To assess ADCC activity of a molecule of interest, an in vitro ADCC assay (see, e.g., US Pat. Nos. 5,500,362 and 5,821,337) can be performed. Useful effector cells for such assays include peripheral blood mononuclear cells (PBMC) and Natural Killer (NK) cells. Alternatively or additionally, ADCC activity of the molecule of interest may be assessed in vivo, for example, in an animal model (see, e.g., Clynes et al., 1998, Proc. Natl. Acad. Sci. USA 95: 652-56) . Antibodies with little or no ADCC activity may be selected for use.
“Antibody-dependent cellular phagocytosis” or “ADCP” refers to the destruction of target cells via monocyte or macrophage-mediated phagocytosis when immunoglobulin bound onto Fc receptors (FcRs) present on certain phagocytotic cells (e.g., neutrophils, monocytes, and macrophages) enable these phagocytotic cells to bind specifically to an antigen-bearing target cell and subsequently kill the target cell. To assess ADCP activity of a molecule of interest, an in vitro ADCP assay (see, e.g., Bracher et al., 2007, J. Immunol. Methods 323: 160-71) can be performed. Useful phagocytotic cells for such assays include peripheral blood mononuclear cells (PBMC) , purified monocytes from PBMC, or U937 cells differentiated to the mononuclear type. Alternatively or additionally, ADCP activity of the molecule of interest may be assessed in vivo, for example, in an animal model (see, e.g., Wallace et al., 2001, J. Immunol. Methods 248: 167-82) . Antibodies with little or no ADCP activity may be selected for use.
“Fc receptor” or “FcR” describes a receptor that binds to the Fc region of an antibody. An exemplary FcR is a native sequence human FcR. Moreover, an exemplary FcR is one that binds an IgG antibody (e.g., a gamma receptor) and includes receptors of the FcγRI, FcγRII, and FcγRIII subclasses, including allelic variants and alternatively spliced forms of these receptors. FcγRII receptors include FcγRIIA (an “activating receptor” ) and FcγRIIB (an “inhibiting receptor” ) , which have similar amino acid sequences that differ primarily in the cytoplasmic domains thereof (see, e.g., 
Figure PCTCN2022143721-appb-000001
1997, Annu. Rev. Immunol. 15: 203-34) . Various FcRs are known (see, e.g., Ravetch and Kinet, 1991, Annu. Rev. Immunol. 9: 457-92; Capel et al., 1994, Immunomethods 4: 25-34; and de Haas et al., 1995, J. Lab. Clin. Med. 126: 330-41) . Other FcRs, including those to be identified in the future, are encompassed by the term “FcR” herein. The term also includes the neonatal receptor, FcRn, which is responsible  for the transfer of maternal IgGs to the fetus (see, e.g., Guyer et al., 1976, J. Immunol. 117: 587-93; and Kim et al., 1994, Eu. J. Immunol. 24: 2429-34) . Antibody variants with improved or diminished binding to FcRs have been described (see, e.g., WO 2000/42072; U.S. Pat. Nos. 7,183,387; 7,332,581; and 7.335,742; Shields et al. 2001, J. Biol. Chem. 9 (2) : 6591-604) .
“Complement dependent cytotoxicity” or “CDC” refers to the lysis of a target cell in the presence of complement. Activation of the classical complement pathway is initiated by the binding of the first component of the complement system (C1q) to antibodies (of the appropriate subclass) which are bound to their cognate antigen. To assess complement activation, a CDC assay (see, e.g., Gazzano-Santoro et al., 1996, J. Immunol. Methods 202: 163) may be performed. Polypeptide variants with altered Fc region amino acid sequences (polypeptides with a variant Fc region) and increased or decreased C1q binding capability have been described (see, e.g., US Pat. No. 6,194,551; WO 1999/51642; Idusogie et al., 2000, J. Immunol. 164: 4178-84) . Antibodies with little or no CDC activity may be selected for use.
The term “antibody” is intended to include a polypeptide product of B cells within the immunoglobulin class of polypeptides that is able to bind to a specific molecular antigen and is composed of two identical pairs of polypeptide chains, wherein each pair has one heavy chain (about 50-70 kDa) and one light chain (about 25 kDa) , each amino-terminal portion of each chain includes a variable region of about 100 to about 130 or more amino acids, and each carboxy-terminal portion of each chain includes a constant region. See, e.g., Antibody Engineering (Borrebaeck ed., 2d ed. 1995) ; and Kuby, Immunology (3d ed. 1997) . In specific embodiments, the specific molecular antigen can be bound by an antibody provided herein, including a polypeptide, a fragment or an epitope thereof. Antibodies also include, but are not limited to, synthetic antibodies, recombinantly produced antibodies, camelized antibodies, intrabodies, anti-idiotypic (anti-Id) antibodies, and functional fragments of any of the above, which refers to a portion of an antibody heavy or light chain polypeptide that retains some or all of the binding activity of the antibody from which the fragment was derived. Non-limiting examples of functional fragments include single-chain Fvs (scFv) (e.g., including monospecific, bispecific, etc. ) , Fab fragments, F (ab’) fragments, F (ab)  2 fragments, F (ab’)  2 fragments, disulfide-linked Fvs (dsFv) , Fd fragments, Fv fragments, diabody, triabody, tetrabody, and minibody. In particular, antibodies provided herein include immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, for example, antigen-binding  domains or molecules that contain an antigen-binding site (e.g., one or more CDRs of an antibody) . Such antibody fragments can be found in, for example, Harlow and Lane, Antibodies: A Laboratory Manual (1989) ; Mol. Biology and Biotechnology: A Comprehensive Desk Reference (Myers ed., 1995) ; Huston et al., 1993, Cell Biophysics 22: 189-224; Plückthun and Skerra, 1989, Meth. Enzymol. 178: 497-515; and Day, Advanced Immunochemistry (2d ed. 1990) . The antibodies provided herein can be of any class (e.g., IgG, IgE, IgM, IgD, and IgA) or any subclass (e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2) of immunoglobulin molecule.
The term “administer” or “administration” refers to the act of injecting or otherwise physically delivering a substance as it exists outside the body (e.g., a lipid nanoparticle composition as described herein) into a patient, such as by mucosal, intradermal, intravenous, intramuscular delivery, and/or any other method of physical delivery described herein or known in the art. When a disease, disorder, condition, or a symptom thereof, is being treated, administration of the substance typically occurs after the onset of the disease, disorder, condition, or symptoms thereof. When a disease, disorder, condition, or symptoms thereof, are being prevented, administration of the substance typically occurs before the onset of the disease, disorder, condition, or symptoms thereof.
“Chronic” administration refers to administration of the agent (s) in a continuous mode (e.g., for a period of time such as days, weeks, months, or years) as opposed to an acute mode, so as to maintain the initial therapeutic effect (activity) for an extended period of time. “Intermittent” administration is treatment that is not consecutively done without interruption, but rather is cyclic in nature.
The term “targeted delivery” or the verb form “target” as used herein refers to the process that promotes the arrival of a delivered agent (such as a therapeutic payload molecule in a lipid nanoparticle composition as described herein) at a specific organ, tissue, cell and/or intracellular compartment (referred to as the targeted location) more than any other organ, tissue, cell or intracellular compartment (referred to as the non-target location) . Targeted delivery can be detected using methods known in the art, for example, by comparing the concentration of the delivered agent in a targeted cell population with the concentration of the delivered agent at a non-target cell population after systemic administration. In certain embodiments, targeted delivery results in at least 2 fold higher concentration at a targeted location as compared to a non-target location.
An “effective amount” is generally an amount sufficient to reduce the severity and/or frequency of symptoms, eliminate the symptoms and/or underlying cause, prevent the occurrence of symptoms and/or their underlying cause, and/or improve or remediate the damage that results from or is associated with a disease, disorder, or condition, including, for example, infection and neoplasia. In some embodiments, the effective amount is a therapeutically effective amount or a prophylactically effective amount.
The term “therapeutically effective amount” as used herein refers to the amount of an agent (e.g., a vaccine composition) that is sufficient to reduce and/or ameliorate the severity and/or duration of a given disease, disorder, or condition, and/or a symptom related thereto (e.g., an infectious disease such as caused by viral infection, or a neoplastic disease such as cancer) . A“therapeutically effective amount” of a substance/molecule/agent of the present disclosure (e.g., the lipid nanoparticle composition as described herein) may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the substance/molecule/agent to elicit a desired response in the individual. A therapeutically effective amount encompasses an amount in which any toxic or detrimental effects of the substance/molecule/agent are outweighed by the therapeutically beneficial effects. In certain embodiments, the term “therapeutically effective amount” refers to an amount of a lipid nanoparticle composition as described herein or a therapeutic or prophylactic agent contained therein (e.g., a therapeutic mRNA) effective to “treat” a disease, disorder, or condition, in a subject or mammal.
A “prophylactically effective amount” is an amount of a pharmaceutical composition that, when administered to a subject, will have the intended prophylactic effect, e.g., preventing, delaying, or reducing the likelihood of the onset (or reoccurrence) of a disease, disorder, condition, or associated symptom (s) (e.g., an infectious disease such as caused by viral infection, or a neoplastic disease such as cancer) . Typically, but not necessarily, since a prophylactic dose is used in subjects prior to or at an earlier stage of a disease, disorder, or condition, aprophylactically effective amount may be less than a therapeutically effective amount. The full therapeutic or prophylactic effect does not necessarily occur by administration of one dose, and may occur only after administration of a series of doses. Thus, a therapeutically or prophylactically effective amount may be administered in one or more administrations.
The terms “prevent, ” “preventing, ” and “prevention” refer to reducing the likelihood of the onset (or recurrence) of a disease, disorder, condition, or associated symptom (s) (e.g., an infectious disease such as caused by viral infection, or a neoplastic disease such as cancer) .
The terms “manage, ” “managing, ” and “management” refer to the beneficial effects that a subject derives from a therapy (e.g., a prophylactic or therapeutic agent) , which does not result in a cure of the disease. In certain embodiments, a subject is administered one or more therapies (e.g., prophylactic or therapeutic agents, such as a lipid nanoparticle composition as described herein) to “manage” an infectious or neoplastic disease, one or more symptoms thereof, so as to prevent the progression or worsening of the disease.
The term “prophylactic agent” refers to any agent that can totally or partially inhibit the development, recurrence, onset, or spread of disease and/or symptom related thereto in a subject.
The term “therapeutic agent” refers to any agent that can be used in treating, preventing, or alleviating a disease, disorder, or condition, including in the treatment, prevention, or alleviation of one or more symptoms of a disease, disorder, or condition and/or a symptom related thereto.
The term “therapy” refers to any protocol, method, and/or agent that can be used in the prevention, management, treatment, and/or amelioration of a disease, disorder, or condition. In certain embodiments, the terms “therapies” and “therapy” refer to a biological therapy, supportive therapy, and/or other therapies useful in the prevention, management, treatment, and/or amelioration of a disease, disorder, or condition, known to one of skill in the art such as medical personnel.
As used herein, a “prophylactically effective serum titer” is the serum titer of an antibody in a subject (e.g., a human) , that totally or partially inhibits the development, recurrence, onset, or spread of a disease, disorder, or condition, and/or symptom related thereto in the subject.
In certain embodiments, a “therapeutically effective serum titer” is the serum titer of an antibody in a subject (e.g., a human) , that reduces the severity, the duration, and/or the symptoms associated with a disease, disorder, or condition, in the subject.
The term “serum titer” refers to an average serum titer in a subject from multiple samples (e.g., at multiple time points) or in a population of at least 10, at least 20, at least 40 subjects, up to about 100, 1000, or more.
The term “side effects” encompasses unwanted and/or adverse effects of a therapy (e.g., a prophylactic or therapeutic agent) . Unwanted effects are not necessarily adverse. An adverse effect from a therapy (e.g., a prophylactic or therapeutic agent) might be harmful, uncomfortable, or risky. Examples of side effects include, diarrhea, cough, gastroenteritis, wheezing, nausea, vomiting, anorexia, abdominal cramping, fever, pain, loss of body weight, dehydration, alopecia, dyspenea, insomnia, dizziness, mucositis, nerve and muscle effects, fatigue, dry mouth, loss of appetite, rashes or swellings at the site of administration, flu-like symptoms such as fever, chills, and fatigue, digestive tract problems, and allergic reactions. Additional undesired effects experienced by patients are numerous and known in the art. Many are described in Physician’s Desk Reference (68th ed. 2014) .
The terms “subject” and “patient” may be used interchangeably. As used herein, in certain embodiments, a subject is a mammal, such as a non-primate (e.g., cow, pig, horse, cat, dog, rat, etc. ) or a primate (e.g., monkey and human) . In specific embodiments, the subject is a human. In one embodiment, the subject is a mammal (e.g., a human) having an infectious disease or neoplastic disease. In another embodiment, the subject is a mammal (e.g., a human) at risk of developing an infectious disease or neoplastic disease.
The term “elderly human” refers to a human 65 years or older. The term “human adult” refers to a human that is 18 years or older. The term “human child” refers to a human that is 1 year to 18 years old. The term “human toddler” refers to a human that is 1 year to 3 years old. The term “human infant” refers to a newborn to 1 year old year human.
The term “detectable probe” refers to a composition that provides a detectable signal. The term includes, without limitation, any fluorophore, chromophore, radiolabel, enzyme, antibody or antibody fragment, and the like, that provide a detectable signal via its activity.
The term “detectable agent” refers to a substance that can be used to ascertain the existence or presence of a desired molecule, such as an antigen encoded by an mRNA molecule as described herein, in a sample or subject. A detectable agent can be a substance that is capable of being visualized or a substance that is otherwise able to be determined and/or measured (e.g., by quantitation) .
“Substantially all” refers to at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or about 100%.
As used herein, and unless otherwise indicated, the term “about” or “approximately” means an acceptable error for a particular value as determined by one of ordinary skill in the art, which depends in part on how the value is measured or determined. In certain embodiments, the term “about” or “approximately” means within 1, 2, 3, or 4 standard deviations. In certain embodiments, the term “about” or “approximately” means within 20%, 15%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, 0.5%, 0.05%, or less of a given value or range.
The singular terms “a, ” “an, ” and “the” as used herein include the plural (e.g., four) reference unless the context clearly indicates otherwise.
All publications, patent applications, accession numbers, and other references cited in this specification are herein incorporated by reference in their entirety as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference. The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided can be different from the actual publication dates which can need to be independently confirmed.
A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, the descriptions in the Experimental section and examples are intended to illustrate but not limit the scope of invention described in the claims.
5.3 Therapeutic Nucleic Acids
In one aspect, provided herein are therapeutic nucleic acid molecules for the management, prevention and treatment of influenza virus infection. In some embodiments, the therapeutic nucleic acid encodes a peptide or polypeptide, which upon administration into a subject in need thereof, is expressed by the cells in the subject to produce the encoded peptide or polypeptide. In some embodiments, the therapeutic nucleic acid molecules are DNA molecules. In other embodiments, the therapeutic nucleic acid molecules are RNA molecules. In particular embodiments, the therapeutic nucleic acid molecules are mRNA molecules.
In some embodiments, the therapeutic nucleic acid molecule is formulated in a vaccine composition. In some embodiments, the vaccine composition is a genetic vaccine as  described herein. In some embodiments, the vaccine composition comprises an mRNA molecule as described herein.
In some embodiments, the mRNA molecule of the present disclosure encodes a peptide or polypeptide of interest, including any naturally or non-naturally occurring or otherwise modified polypeptide. A peptide or polypeptide encoded by an mRNA may be of any size and may have any secondary structure or activity. In some embodiments, the polypeptide encoded by an mRNA payload can have a therapeutic effect when expressed in a cell.
In some embodiment, the mRNA molecule of the present disclosure comprises at least one coding region encoding a peptide or polypeptide of interest (e.g., an open reading frame (ORF) ) . In some embodiments, the nucleic acid molecule further comprises at least one untranslated region (UTR) . In particular embodiments, the untranslated region (UTR) is located upstream (to the 5’-end) of the coding region, and is referred to herein as the 5’-UTR. In particular embodiments, the untranslated region (UTR) is located downstream (to the 3’-end) of the coding region, and is referred to herein as the 3’-UTR. In particular embodiments, the nucleic acid molecule comprises both a 5’-UTR and a 3’-UTR. In some embodiments, the 5’-UTR comprises a 5’-Cap structure. In some embodiments, the nucleic acid molecule comprises a Kozak sequence (e.g., in the 5’-UTR) . In some embodiments, the nucleic acid molecule comprises a poly-A region (e.g., in the 3’-UTR) . In some embodiments, the nucleic acid molecule comprises a polyadenylation signal (e.g., in the 3’-UTR) . In some embodiments, the nucleic acid molecule comprises stabilizing region (e.g., in the 3’-UTR) . In some embodiments, the nucleic acid molecule comprises a secondary structure. In some embodiments, the secondary structure is a stem-loop. In some embodiments, the nucleic acid molecule comprises a stem-loop sequence (e.g., in the 5’-UTR and/or the 3’-UTR) . In some embodiments, the nucleic acid molecule comprises one or more intronic regions capable of being excised during splicing. In a specific embodiment, the nucleic acid molecule comprises one or more region selected from a 5’-UTR, and a coding region. In a specific embodiment, the nucleic acid molecule comprises one or more region selected from a coding region and a 3’-UTR. In a specific embodiment, the nucleic acid molecule comprises one or more region selected from a 5’-UTR, a coding region, and a 3’-UTR.
5.3.1 Coding Region
In some embodiments, the nucleic acid molecule of the present disclosure comprises at least one coding region. In some embodiments, the coding region is an open reading frame (ORF) that encodes for a single peptide or protein. In some embodiments, the coding region comprises at least two ORFs, each encoding a peptide or protein. In those embodiments where the coding region comprises more than one ORFs, the encoded peptides and/or proteins can be the same as or different from each other. In some embodiments, the multiple ORFs in a coding region are separated by non-coding sequences. In specific embodiments, a non-coding sequence separating two ORFs comprises an internal ribosome entry sites (IRES) .
Without being bound by the theory, it is contemplated that an internal ribosome entry sites (IRES) can act as the sole ribosome binding site, or serve as one of multiple ribosome binding sites of an mRNA. An mRNA molecule containing more than one functional ribosome binding site can encode several peptides or proteins that are translated independently by the ribosomes (e.g., multicistronic mRNA) . Accordingly, in some embodiments, the nucleic acid molecule of the present disclosure (e.g., mRNA) comprises one or more internal ribosome entry sites (IRES) . Examples of IRES sequences that can be used in connection with the present disclosure include, without limitation, those from picomaviruses (e.g., FMDV) , pest viruses (CFFV) , polio viruses (PV) , encephalomyocarditis viruses (ECMV) , foot-and-mouth disease viruses (FMDV) , hepatitis C viruses (HCV) , classical swine fever viruses (CSFV) , murine leukemia virus (MLV) , simian immune deficiency viruses (SIV) or cricket paralysis viruses (CrPV) .
In various embodiments, the nucleic acid molecule of the present disclosure encodes for at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more than 10 peptides or proteins. Peptides and proteins encoded by a nucleic acid molecule can be the same or different. In some embodiments, the nucleic acid molecule of the present disclosure encodes a dipeptide (e.g., camosine and anserine) . In some embodiments, the nucleic acid molecule encodes a tripeptide. In some embodiments, the nucleic acid molecule encodes a tetrapeptide. In some embodiments, the nucleic acid molecule encodes a pentapeptide. In some embodiments, the nucleic acid molecule encodes a hexapeptide. In some embodiments, the nucleic acid molecule encodes a heptapeptide. In some embodiments, the nucleic acid molecule encodes an octapeptide. In some embodiments, the nucleic acid molecule encodes a nonapeptide. In some embodiments, the nucleic acid molecule encodes a  decapeptide. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide that has at least about 15 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide that has at least about 50 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide that has at least about 100 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide that has at least about 150 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide that has at least about 300 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide that has at least about 500 amino acids. In some embodiments, the nucleic acid molecule encodes a peptide or polypeptide that has at least about 1000 amino acids.
In some embodiments, the nucleic acid molecule of the present disclosure is at least about 30 nucleotides (nt) in length. In some embodiments, the nucleic acid molecule is at least about 35 nt in length. In some embodiments, the nucleic acid molecule is at least about 40 nt in length. In some embodiments, the nucleic acid molecule is at least about 45 nt in length. In some embodiments the nucleic acid molecule is at least about 50 nt in length. In some embodiments, the nucleic acid molecule is at least about 55 nt in length. In some embodiments, the nucleic acid molecule is at least about 60 nt in length. In some embodiments, the nucleic acid molecule is at least about 65 nt in length. In some embodiments, the nucleic acid molecule is at least about 70 nt in length. In some embodiments, the nucleic acid molecule is at least about 75 nt in length. In some embodiments, the nucleic acid molecule is at least about 80 nt in length. In some embodiments the nucleic acid molecule is at least about 85 nt in length. In some embodiments, the nucleic acid molecule is at least about 90 nt in length. In some embodiments, the nucleic acid molecule is at least about 95 nt in length. In some embodiments, the nucleic acid molecule is at least about 100 nt in length. In some embodiments, the nucleic acid molecule is at least about 120 nt in length. In some embodiments, the nucleic acid molecule is at least about 140 nt in length. In some embodiments, the nucleic acid molecule is at least about 160 nt in length. In some embodiments, the nucleic acid molecule is at least about 180 nt in length. In some embodiments, the nucleic acid molecule is at least about 200 nt in length. In some embodiments, the nucleic acid molecule is at least about 250 nt in length. In some embodiments, the nucleic acid molecule is at least about 300 nt in length. In some embodiments, the nucleic acid molecule is at least about 400 nt in length. In some embodiments, the nucleic acid molecule is at least  about 500 nt in length. In some embodiments, the nucleic acid molecule is at least about 600 nt in length. In some embodiments, the nucleic acid molecule is at least about 700 nt in length. In some embodiments, the nucleic acid molecule is at least about 800 nt in length. In some embodiments, the nucleic acid molecule is at least about 900 nt in length. In some embodiments, the nucleic acid molecule is at least about 1000 nt in length. In some embodiments, the nucleic acid molecule is at least about 1100 nt in length. In some embodiments, the nucleic acid molecule is at least about 1200 nt in length. In some embodiments, the nucleic acid molecule is at least about 1300 nt in length. In some embodiments, the nucleic acid molecule is at least about 1400 nt in length. In some embodiments, the nucleic acid molecule is at least about 1500 nt in length. In some embodiments, the nucleic acid molecule is at least about 1600 nt in length. In some embodiments, the nucleic acid molecule is at least about 1700 nt in length. In some embodiments, the nucleic acid molecule is at least about 1800 nt in length. In some embodiments, the nucleic acid molecule is at least about 1900 nt in length. In some embodiments, the nucleic acid molecule is at least about 2000 nt in length. In some embodiments, the nucleic acid molecule is at least about 2500 nt in length. In some embodiments, the nucleic acid molecule is at least about 3000 nt in length. In some embodiments, the nucleic acid molecule is at least about 3500 nt in length. In some embodiments, the nucleic acid molecule is at least about 4000 nt in length. In some embodiments, the nucleic acid molecule is at least about 4500 nt in length. In some embodiments, the nucleic acid molecule is at least about 5000 nt in length.
In specific embodiments, the therapeutic nucleic acid of the present disclosure are formulated as a vaccine composition (e.g., a genetic vaccine) as described herein. In some embodiments, the therapeutic nucleic acid encodes a peptide or protein capable of eliciting immunity against one or more target conditions or disease. In some embodiments, the target condition is related to or caused by infection by a pathogen, such as influenza viruses. In some embodiments, the therapeutic nucleic acid sequence (e.g., mRNA) encoding a pathogenic protein characteristic for the pathogen, or an immunogenic fragment (e.g., epitope) or derivative thereof. The vaccine, upon administration to a vaccinated subject, allows for expression of the encoded pathogenic protein (or the immunogenic fragment or derivative thereof) , thereby eliciting immunity in the subject against the pathogen.
In specific embodiments, provided herein are therapeutic compositions (e.g., vaccine compositions) for the management, prevention and treatment of a diseases or disorder caused by influenza viruses or by infection with influenza viruses.
Accordingly, in some embodiments, provided herein are therapeutic nucleic acids encoding a viral peptide or protein derived from influenza viruses. In some embodiments, the nucleic acid encodes a viral peptide or protein derived from influenza viruses, where the viral peptide or protein is one or more selected from (a) the HA protein, (b) the NA protein, (c) an immunogenic fragment of any one of (a) to (b) , and (d) a functional derivative of any one of (a) to (b) .
Accordingly, in some embodiments, the therapeutic nucleic acid of the present disclosure encodes the influenza virus HA protein, or an immunogenic fragment of the HA protein, or a functional derivative of the HA protein or the immunogenic fragment thereof. Table 1 shows exemplary influenza virus native antigen sequences.
Table 1 Exemplary sequences of influenza virus antigens.
Figure PCTCN2022143721-appb-000002
Figure PCTCN2022143721-appb-000003
Figure PCTCN2022143721-appb-000004
Figure PCTCN2022143721-appb-000005
Figure PCTCN2022143721-appb-000006
Figure PCTCN2022143721-appb-000007
Figure PCTCN2022143721-appb-000008
Figure PCTCN2022143721-appb-000009
Note: sequences in the parentheses are signal peptides.
In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the HA protein has an amino acid sequence of SEQ ID NO: 1. In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the therapeutic nucleic acid comprises a DNA coding sequence of SEQ ID NO: 5. In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the HA protein has an amino acid sequence of SEQ ID NO: 2 OR SEQ ID NO: 64. In particular  embodiments, the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the therapeutic nucleic acid comprises a DNA coding sequence of SEQ ID NO: 6 or 66. In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the HA protein has an amino acid sequence of SEQ ID NO: 3 or 65. In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the therapeutic nucleic acid comprises a DNA coding sequence of SEQ ID NO: 7 or 67. In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the HA protein has an amino acid sequence of SEQ ID NO: 4. In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes the HA protein of influenza viruses, wherein the therapeutic nucleic acid comprises a DNA coding sequence of SEQ ID NO: 8. In some embodiments, the RNA sequence is in vitro transcribed. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes an immunogenic fragment of the HA protein of influenza viruses. In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes a functional derivative of the HA protein of influenza viruses. In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes a functional derivative of an immunogenic fragment of the HA protein of influenza viruses.
In particular embodiments, the influenza virus HA protein is a mutant.
Without being bound by the theory, it is contemplated that in some embodiments, the therapeutic nucleic acid of the present disclosure encodes a fusion protein comprising the influenza virus HA protein or an immunogenic fragment thereof fused to a trimmerization peptide, such that the fusion protein is capable of forming a trimeric complex comprising three copies of the HA protein or immunogenic fragment thereof. In some embodiments, the HA protein or immunogenic fragment thereof is fused to a trimmerization peptide via a peptidic linker. Table 2 shows exemplary trimmerization peptide and linker peptide that can be used in connection with the present disclosure, and sequences of fusion proteins.
Table 2 Exemplary sequences of linker peptides and trimmerization peptides.
Figure PCTCN2022143721-appb-000010
Figure PCTCN2022143721-appb-000011
In some embodiments, the therapeutic nucleic acid encodes a fusion protein comprising the HA protein of influenza viruses or a functional derivative thereof fused to a trimmerization peptide. In some embodiments, the fusion between the HA protein and the trimmerization peptide is via a peptide linker. In specific embodiments, the peptide linker comprises the amino acid sequence of SEQ ID NO: 37. In some embodiments, the trimmerization peptide comprises the amino acid sequence of SEQ ID NO: 39.
In particular embodiments, the therapeutic nucleic acid encodes a fusion protein comprising the HA protein of influenza viruses fused to a trimmerization peptide, wherein the nucleic acid comprises a DNA coding sequence. In particular embodiments, the therapeutic nucleic acid encodes a fusion protein comprising the HA protein of influenza viruses fused to a trimmerization peptide, wherein the nucleic acid comprises a RNA sequence transcribed from the DNA coding sequence. In some embodiments, the RNA sequence is in vitro transcribed. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
Without being bound by the theory, it is contemplated that a fusion protein comprising a viral peptide or polypeptide fused to an immunoglobulin Fc region can enhance immunogenicity of the viral peptide or polypeptide. Accordingly, in some embodiments, the therapeutic nucleic acid molecule of the present disclosure encodes a fusion protein comprising a viral peptide or protein derived from influenza viruses fused with an Fc region of an immunoglobulin. In particular embodiments, the viral peptide or protein is one or more selected  from (a) the HA protein, (b) the NA protein, (c) an immunogenic fragment of any one of (a) to (b) , and (d) a functional derivative of any one of (a) to (b) . In particular embodiments, the immunoglobulin is human immunoglobulin (Ig) . In particular embodiments, the immunoglobulin is human IgG, IgA, IgD, IgE, or IgM. In particular embodiments, the immunoglobulin is human IgG1, IgG2, IgG3 or IgG4. In some embodiments, the immunoglobulin Fc is fused to the N terminus of the viral peptide or polypeptide. In other embodiments, the immunoglobulin Fc is fused to the C terminus of the viral peptide or polypeptide.
Without being bound by theory, it is contemplated that a signal peptide can mediate transportation of a polypeptide fused thereto to particular locations of a cell. Accordingly, in some embodiments, the therapeutic nucleic acid molecule of the present disclosure encodes a fusion protein comprising a viral peptide or protein fused to a signal peptide. In particular embodiments, the viral peptide or protein is one or more selected from (a) the HA protein, (b) the NA protein, (c) an immunogenic fragment of any one of (a) to (b) , and (d) a functional derivative of any one of (a) to (b) . In some embodiments, the signal peptide is fused to the N terminus of the viral peptide or polypeptide. In other embodiments, the signal peptide is fused to the C terminus of the viral peptide or polypeptide. Table 3 shows exemplary sequences for signal peptides that can be use in connection with the present disclosure, and exemplary influenza virus antigenic sequences comprising the signal peptides.
Table 3: Exemplary sequences of signal peptides.
Figure PCTCN2022143721-appb-000012
Figure PCTCN2022143721-appb-000013
In particular embodiments, the signal peptide is encoded by a gene of the influenza virus from which the viral peptide or polypeptide is derived. In particular embodiments, a signal peptide encoded by a gene of influenza virus is fused to a viral peptide or polypeptide encoded by a different gene of influenza viruses. In other embodiments, a signal peptide encoded by a gene of influenza viruses is fused to a viral peptide or polypeptide encoded by the same gene of influenza viruses. In various embodiments, the viral peptide or protein is one or more selected from (a) the HA protein, (b) the NA protein, (c) an immunogenic fragment of any one of (a) to (b) , and (d) a functional derivative of any one of (a) to (b) .
In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes the HA protein or immunogenic fragment of influenza viruses without the native signal peptide. In particular embodiments, the encoded HA protein or immunogenic fragment comprises a signal peptide having an amino acid sequence of SEQ ID NO: 15 or 17. In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes the HA protein or immunogenic fragment of influenza viruses having a signal peptide, and wherein the therapeutic nucleic acid comprises a DNA coding sequence of SEQ ID NO: 16 or 18. In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes the HA protein or immunogenic fragment of influenza viruses having a signal peptide, and wherein the therapeutic nucleic acid comprises a RNA sequence transcribed from the DNA coding sequence of SEQ ID NO: 16 or 18. In some embodiments, the RNA sequence is in vitro transcribed. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In particular embodiments, the therapeutic nucleic acid of the present disclosure encodes the ectodomain (ECD) of the HA protein of influenza viruses having a signal peptide.  In some embodiments, the RNA sequence is in vitro transcribed. In particular embodiments, the nucleic acid molecule is an mRNA molecule.
In other embodiments, the signal peptide is encoded by an exogenous gene sequence that does not present in influenza viruses from which the viral peptide or polypeptide is derived. In some embodiments, a heterologous signal peptide replaces a homologous signal peptide in the fusion protein encoded by the nucleic acid molecule of the present disclosure. In specific embodiments, the signal peptide is encoded by a mammalian gene. In specific embodiments, the signal peptide is encoded by human Immunoglobulin gene. In specific embodiments, the signal peptide is encoded by human IgE gene. For example, in some embodiments, a signal peptide having amino acid sequence of MDWTWILFLVAAATRVHS (SEQ ID NO: 15) is fused to the viral peptide or polypeptide encoded by the nucleic acid molecule of the present disclosure. In various embodiments, the viral peptide or protein is one or more selected from (a) the HA protein, (b) the NA protein, (c) an immunogenic fragment of any one of (a) to (b) , and (d) a functional derivative of any one of (a) to (b) .
5.3.2 5’-Cap Structure
Without being bound by the theory, it is contemplated that, a 5’-cap structure of a polynucleotide is involved in nuclear export and increasing polynucleotide stability and binds the mRNA Cap Binding Protein (CBP) , which is responsible for polynucleotide stability in the cell and translation competency through the association of CBP with poly-A binding protein to form the mature cyclic mRNA species. The 5’-cap structure further assists the removal of 5’-proximal introns removal during mRNA splicing. Accordingly, in some embodiments, the nucleic acid molecules of the present disclosure comprise a 5’-cap structure.
Nucleic acid molecules may be 5’-end capped by the endogenous transcription machinery of a cell to generate a 5’-ppp-5’-triphosphate linkage between a terminal guanosine cap residue and the 5’-terminal transcribed sense nucleotide of the polynucleotide. This 5’-guanylate cap may then be methylated to generate an N7-methyl-guanylate residue. The ribose sugars of the terminal and/or anteterminal transcribed nucleotides of the 5’ end of the polynucleotide may optionally also be 2’-O-methylated. 5’-decapping through hydrolysis and cleavage of the guanylate cap structure may target a nucleic acid molecule, such as an mRNA molecule, for degradation.
In some embodiments, the nucleic acid molecules of the present disclosure comprise one or more alterations to the natural 5’-cap structure generated by the endogenous process. Without being bound by the theory, a modification on the 5’-cap may increase the stability of polynucleotide, increase the half-life of the polynucleotide, and could increase the polynucleotide translational efficiency.
Exemplary alterations to the natural 5’-Cap structure include generation of a non-hydrolyzable cap structure preventing decapping and thus increasing polynucleotide half-life. In some embodiments, because cap structure hydrolysis requires cleavage of 5’-ppp-5’ phosphorodiester linkages, in some embodiments, modified nucleotides may be used during the capping reaction. For example, in some embodiments, a Vaccinia Capping Enzyme from New England Biolabs (Ipswich, Mass. ) may be used withα-thio-guanosine nucleotides according to the manufacturer’s instructions to create a phosphorothioate linkage in the 5’-ppp-5’ cap. Additional modified guanosine nucleotides may be used, such asα-methyl-phosphonate and seleno-phosphate nucleotides.
Additional exemplary alterations to the natural 5’-Cap structure also include modification at the 2’-and/or 3’-position of a capped guanosine triphosphate (GTP) , areplacement of the sugar ring oxygen (that produced the carbocyclic ring) with a methylene moiety (CH 2) , a modification at the triphosphate bridge moiety of the cap structure, or a modification at the nucleobase (G) moiety.
Additional exemplary alterations to the natural 5’-cap structure include, but are not limited to, 2’-O-methylation of the ribose sugars of 5’-terminal and/or 5’-anteterminal nucleotides of the polynucleotide (as mentioned above) on the 2’-hydroxy group of the sugar. Multiple distinct 5’-cap structures can be used to generate the 5’-cap of a polynucleotide, such as an mRNA molecule. Additional exemplary 5’-Cap structures that can be used in connection with the present disclosure further include those described in International Patent Publication Nos. WO2008127688, WO 2008016473, and WO 2011015347, the entire contents of each of which are incorporated herein by reference.
In various embodiments, 5’-terminal caps can include cap analogs. Cap analogs, which herein are also referred to as synthetic cap analogs, chemical caps, chemical cap analogs, or structural or functional cap analogs, differ from natural (i.e., endogenous, wild-type, or physiological) 5’-caps in their chemical structure, while retaining cap function. Cap analogs may  be chemically (i.e., non-enzymatically) or enzymatically synthesized and/linked to a polynucleotide.
For example, the Anti-Reverse Cap Analog (ARCA) cap contains two guanosines linked by a 5’-5’-triphosphate group, wherein one guanosine contains an N7-methyl group as well as a 3’-O-methyl group (i.e., N7, 3’-O-dimethyl-guanosine-5’-triphosphate-5’-guanosine, m 7G-3’ mppp-G, which may equivalently be designated3’ O-Me-m7G (5’) ppp (5’) G) . The 3’-O atom of the other, unaltered, guanosine becomes linked to the 5’-terminal nucleotide of the capped polynucleotide (e.g., an mRNA) . The N7-and 3’-O-methlyated guanosine provides the terminal moiety of the capped polynucleotide (e.g., mRNA) . Another exemplary cap structure is mCAP, which is similar to ARCA but has a 2’-O-methyl group on guanosine (i.e., N7, 2’-O-dimethyl-guanosine-5’-triphosphate-5’-guanosine, m 7Gm-ppp-G) .
In some embodiments, a cap analog can be a dinucleotide cap analog. As a non-limiting example, the dinucleotide cap analog may be modified at different phosphate positions with a boranophosphate group or a phophoroselenoate group such as the dinucleotide cap analogs described in U.S. Patent No.: 8,519,110, the entire content of which is herein incorporated by reference in its entirety.
In some embodiments, a cap analog can be a N7- (4-chlorophenoxyethyl) substituted dinucleotide cap analog known in the art and/or described herein. Non-limiting examples of N7- (4-chlorophenoxyethyl) substituted dinucleotide cap analogs include a N7- (4-chlorophenoxyethyl) -G (5’) ppp (5’) G and a N7- (4-chlorophenoxyethyl) -m3’-OG (5’) ppp (5’) G cap analog (see, e.g., the various cap analogs and the methods of synthesizing cap analogs described in Kore et al. Bioorganic&Medicinal Chemistry 2013 21: 4570-4574; the entire content of which is herein incorporated by reference) . In other embodiments, a cap analog useful in connection with the nucleic acid molecules of the present disclosure is a 4-chloro/bromophenoxyethyl analog.
In various embodiments, a cap analog can include a guanosine analog. Useful guanosine analogs include but are not limited to inosine, N1-methyl-guanosine, 2’-fluoro-guanosine, 7-deaza-guanosine, 8-oxo-guanosine, 2-amino-guanosine, LNA-guanosine, and 2-azido-guanosine.
Without being bound by the theory, it is contemplated that while cap analogs allow for the concomitant capping of a polynucleotide in an in vitro transcription reaction, up to 20% of transcripts remain uncapped. This, as well as the structural differences of a cap analog from the natural 5’-cap structures of polynucleotides produced by the endogenous transcription machinery of a cell, may lead to reduced translational competency and reduced cellular stability.
Accordingly, in some embodiments, a nucleic acid molecule of the present disclosure can also be capped post-transcriptionally, using enzymes, in order to generate more authentic 5’-cap structures. As used herein, the phrase “more authentic” refers to a feature that closely mirrors or mimics, either structurally or functionally, an endogenous or wild type feature. That is, a “more authentic” feature is better representative of an endogenous, wild-type, natural or physiological cellular function, and/or structure as compared to synthetic features or analogs of the prior art, or which outperforms the corresponding endogenous, wild-type, natural, or physiological feature in one or more respects. Non-limiting examples of more authentic 5’-cap structures useful in connection with the nucleic acid molecules of the present disclosure are those which, among other things, have enhanced binding of cap binding proteins, increased half-life, reduced susceptibility to 5’-endonucleases, and/or reduced 5’-decapping, as compared to synthetic 5’-cap structures known in the art (or to a wild-type, natural or physiological 5’-cap structure) . For example, in some embodiments, recombinant Vaccinia Virus Capping Enzyme and recombinant 2’-O-methyltransferase enzyme can create a canonical 5’-5’-triphosphate linkage between the 5’-terminal nucleotide of a polynucleotide and a guanosine cap nucleotide wherein the cap guanosine contains an N7-methylation and the 5’-terminal nucleotide of the polynucleotide contains a 2’-O-methyl. Such a structure is termed the Cap1 structure. This cap results in a higher translational-competency, cellular stability, and a reduced activation of cellular pro-inflammatory cytokines, as compared, e.g., to other 5’ cap analog structures known in the art. Other exemplary cap structures include 7mG (5’) ppp (5’) N, pN2p (Cap 0) , 7mG (5’) ppp (5’) NlmpNp (Cap 1) , 7mG (5’) -ppp (5’) NlmpN2mp (Cap 2) , and m (7) Gpppm (3) (6, 6, 2’) Apm (2’) Apm (2’) Cpm (2) (3, 2’) Up (Cap 4) .
Without being bound by the theory, it is contemplated that the nucleic acid molecules of the present disclosure can be capped post-transcriptionally, and because this process is more efficient, nearly 100%of the nucleic acid molecules may be capped.
5.3.3 Untranslated Regions (UTRs)
In some embodiments, the nucleic acid molecules of the present disclosure comprise one or more untranslated regions (UTRs) . In some embodiments, an UTR is positioned upstream  to a coding region in the nucleic acid molecule, and is termed 5’-UTR. In some embodiments, an UTR is positioned downstream to a coding region in the nucleic acid molecule, and is termed 3’-UTR. The sequence of an UTR can be homologous or heterologous to the sequence of the coding region found in a nucleic acid molecule. Multiple UTRs can be included in a nucleic acid molecule and can be of the same or different sequences, and/or genetic origin. According to the present disclosure, any portion of UTRs in a nucleic acid molecule (including none) can be codon optimized and any may independently contain one or more different structural or chemical modification, before and/or after codon optimization.
In some embodiments, a nucleic acid molecule of the present disclosure (e.g., mRNA) comprises UTRs and coding regions that are homologous with respect to each other. In other embodiments, a nucleic acid molecule of the present disclosure (e.g., mRNA) comprises UTRs and coding regions that are heterologous with respect to each other. In some embodiments, to monitor the activity of a UTR sequence, a nucleic acid molecule comprising the UTR and a coding sequence of a detectable probe can be administered in vitro (e.g., cell or tissue culture) or in vivo (e.g., to a subject) , and an effect of the UTR sequence (e.g., modulation on the expression level, cellular localization of the encoded product, or half-life of the encoded product) can be measured using methods known in the art.
In some embodiments, the UTR of a nucleic acid molecule of the present disclosure (e.g., mRNA) comprises at least one translation enhancer element (TEE) that functions to increase the amount of polypeptide or protein produced from the nucleic acid molecule. In some embodiments, the TEE is located in the 5’-UTR of the nucleic acid molecule. In other embodiments, the TEE is located at the 3’-UTR of the nucleic acid molecule. In yet other embodiments, at least two TEE are located at the 5’-UTR and 3’-UTR of the nucleic acid molecule respectively. In some embodiments, a nucleic acid molecule of the present disclosure (e.g., mRNA) can comprise one or more copies of a TEE sequence or comprise more than one different TEE sequences. In some embodiments, different TEE sequences that are present in a nucleic acid molecule of the present disclosure can be homologues or heterologous with respect to one another.
Various TEE sequences that are known in the art and can be used in connection with the present disclosure. For example, in some embodiments, the TEE can be an internal ribosome entry site (IRES) , HCV-IRES or an IRES element. Chappell et al. Proc. Natl. Acad. Sci. USA  101: 9590-9594, 2004; Zhou et al. Proc. Natl. Acad. Sci. 102: 6273-6278, 2005. Additional internal ribosome entry site (IRES) that can be used in connection with the present disclosure include but are not limited to those described in U.S. Patent No. 7,468,275, U.S. Patent Publication No. 2007/0048776 and U.S. Patent Publication No. 2011/0124100 and International Patent Publication No. WO2007/025008 and International Patent Publication No. WO2001/055369, the content of each of which is enclosed herein by reference in its entirety. In some embodiments, the TEE can be those described in Supplemental Table 1 and in Supplemental Table 2 of Wellensiek et al Genome-wide profiling of human cap-independent translation-enhancing elements, Nature Methods, 2013 Aug; 10 (8) : 747–750; the content of which is incorporated by reference in its entirety.
Additional exemplary TEEs that can be used in connection with the present disclosure include but are not limited to the TEE sequences disclosed in U.S. Patent No. 6,310,197, U.S. Patent No. 6,849,405, U.S. Patent No. 7,456,273, U.S. Patent No. 7,183,395, U.S. Patent Publication No. 2009/0226470, U.S. Patent Publication No. 2013/0177581, U.S. Patent Publication No. 2007/0048776, U.S. Patent Publication No. 2011/0124100, U.S. Patent Publication No. 2009/0093049, International Patent Publication No. WO2009/075886, International Patent Publication No. WO2012/009644, and International Patent Publication No. WO1999/024595, International Patent Publication No. WO2007/025008, International Patent Publication No. WO2001/055371, European Patent No. 2610341, European Patent No. 2610340, the content of each of which is enclosed herein by reference in its entirety.
In various embodiments, a nucleic acid molecule of the present disclosure (e.g., mRNA) comprises at least one UTR that comprises at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18 at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55 or more than 60 TEE sequences. In some embodiments, the TEE sequences in the UTR of a nucleic acid molecule are copies of the same TEE sequence. In other embodiments, at least two TEE sequences in the UTR of a nucleic acid molecule are of different TEE sequences. In some embodiments, multiple different TEE sequences are arranged in one or more repeating patterns in the UTR region of a nucleic acid molecule. For illustrating purpose only, a repeating pattern can be, for example, ABABAB, AABBAABBAABB, ABCABCABC, or the like, where  in these exemplary patterns, each capitalized letter (A, B, or C) represents a different TEE sequence. In some embodiments, at least two TEE sequences are consecutive with one another (i.e., no spacer sequence in between) in a UTR of a nucleic acid molecule. In other embodiments, at least two TEE sequences are separated by a spacer sequence. In some embodiments, a UTR can comprise a TEE sequence-spacer sequence module that is repeated at least once, at least twice, at least 3 times, at least 4 times, at least 5 times, at least 6 times, at least 7 times, at least 8 times, at least 9 times, or more than 9 times in the UTR. In any of the embodiments described in this paragraph, the UTR can be a 5’-UTR, a 3’-UTR or both 5’-UTR and 3’-UTR of a nucleic acid molecule.
In some embodiments, the UTR of a nucleic acid molecule of the present disclosure (e.g., mRNA) comprises at least one translation suppressing element that functions to decrease the amount of polypeptide or protein produced from the nucleic acid molecule. In some embodiments, the UTR of the nucleic acid molecule comprises one or more miR sequences or fragment thereof (e.g., miR seed sequences) that are recognized by one or more microRNA. In some embodiments, the UTR of the nucleic acid molecule comprises one or more stem-loop structure that downregulates translational activity of the nucleic acid molecule. Other mechanisms for suppressing translational activities associated with a nucleic acid molecules are known in the art. In any of the embodiments described in this paragraph, the UTR can be a 5’-UTR, a 3’-UTR or both 5’-UTR and 3’-UTR of a nucleic acid molecule. Table 4 shows exemplary 5’-UTR and 3’-UTR sequences that can be used in connection with the present disclosure.
Table 4 Exemplary Untranslated Region (UTR) Sequences.
Figure PCTCN2022143721-appb-000014
Figure PCTCN2022143721-appb-000015
In specific embodiments, the nucleic acid molecule of the present disclose comprises a 5’-UTR selected from SEQ ID NOS: 19-26. In specific embodiments, the nucleic acid molecule of the present disclose comprises a 3’-UTR selected from SEQ ID NOS: 27-34. In specific embodiments, the nucleic acid molecule of the present disclose comprises a 5’-UTR selected from SEQ ID NOS: 19-26 and a 3’-UTR selected from SEQ ID NOS: 27-34. In any of  the embodiments described in this paragraph, the nucleic acid molecule may further comprise a coding region having a sequence as described herein, such as any of the DNA coding sequences in Tables 1 to 4 or equivalent RNA sequences thereof. In particular embodiments, the nucleic acid molecules described in this paragraph can be RNA molecules in vitro transcribed.
Table 5 Exemplary mRNA constructs
Figure PCTCN2022143721-appb-000016
Figure PCTCN2022143721-appb-000017
Figure PCTCN2022143721-appb-000018
Figure PCTCN2022143721-appb-000019
Figure PCTCN2022143721-appb-000020
Figure PCTCN2022143721-appb-000021
Figure PCTCN2022143721-appb-000022
Figure PCTCN2022143721-appb-000023
Figure PCTCN2022143721-appb-000024
Figure PCTCN2022143721-appb-000025
Figure PCTCN2022143721-appb-000026
Figure PCTCN2022143721-appb-000027
Figure PCTCN2022143721-appb-000028
A n=150mer of A, or 110mer of A, for example.
5.3.4 The Polyadenylation (Poly-A) Regions
During natural RNA processing, a long chain of adenosine nucleotides (poly-A region) is normally added to messenger RNA (mRNA) molecules to increase the stability of the  molecule. Immediately after transcription, the 3’-end of the transcript is cleaved to free a 3’-hydroxy. Then poly-A polymerase adds a chain of adenosine nucleotides to the RNA. The process, called polyadenylation, adds a poly-A region that is between 100 and 250 residues long. Without being bound by the theory, it is contemplated that a poly-A region can confer various advantages to the nucleic acid molecule of the present disclosure.
Accordingly, in some embodiments, a nucleic acid molecule of the present disclosure (e.g., an mRNA) comprises a polyadenylation signal. In some embodiments, a nucleic acid molecule of the present disclosure (e.g., an mRNA) comprises one or more polyadenylation (poly-A) regions. In some embodiments, a poly-A region is composed entirely of adenine nucleotides or functional analogs thereof. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 3’-end. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 5’-end. In some embodiments, the nucleic acid molecule comprises at least one poly-A region at its 5’-end and at least one poly-A region at its 3’-end.
According to the present disclosure, the poly-A region can have varied lengths in different embodiments. Particularly, in some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 30 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 35 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 40 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 45 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 50 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 55 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 60 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 65 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 70 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 75 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 80 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the  present disclosure is at least 85 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 90 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 95 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 100 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 110 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 120 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 130 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 140 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 150 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 160 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 170 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 180 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 190 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 200 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 225 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 250 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 275 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 300 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 350 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 400 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 450 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 500 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 600 nucleotides in length. In some embodiments, the poly-A  region of a nucleic acid molecule of the present disclosure is at least 700 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 800 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 900 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1000 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1100 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1200 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1300 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1400 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1500 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1600 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1700 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1800 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 1900 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2000 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2250 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2500 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 2750 nucleotides in length. In some embodiments, the poly-A region of a nucleic acid molecule of the present disclosure is at least 3000 nucleotides in length.
In some embodiments, length of a poly-A region in a nucleic acid molecule can be selected based on the overall length of the nucleic acid molecule, or a portion thereof (such as the length of the coding region or the length of an open reading frame of the nucleic acid molecule, etc. ) . For example, in some embodiments, the poly-A region accounts for about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%or more of the total length of nucleic acid molecule containing the poly-A region.
Without being bound by the theory, it is contemplated that certain RNA-binding proteins can bind to the poly-A region located at the 3’-end of an mRNA molecule. These poly-A binding proteins (PABP) can modulate mRNA expression, such as interacting with translation initiation machinery in a cell and/or protecting the 3’-poly-A tails from degradation. Accordingly, in some embodiments, in some embodiments, the nucleic acid molecule of the present disclosure (e.g., mRNA) comprises at least one binding site for poly-A binding protein (PABP) . In other embodiments, the nucleic acid molecule is conjugated or complex with a PABP before loaded into a delivery vehicle (e.g., lipid nanoparticles) .
In some embodiments, the nucleic acid molecule of the present disclosure (e.g., mRNA) comprises a poly-A-G Quartet. The G-quartet is a cyclic hydrogen bonded array of four guanosine nucleotides that can be formed by G-rich sequences in both DNA and RNA. In this embodiment, the G-quartet is incorporated at the end of the poly-A region. The resultant polynucleotides (e.g., mRNA) may be assayed for stability, protein production and other parameters including half-life at various time points. It has been discovered that the polyA-G quartet structure results in protein production equivalent to at least 75%of that seen using a poly-A region of 120 nucleotides alone.
In some embodiments, the nucleic acid molecule of the present disclosure (e.g., mRNA) may include a poly-A region and may be stabilized by the addition of a 3’-stabilizing region. In some embodiments, the 3’-stabilizing region which may be used to stabilize a nucleic acid molecule (e.g., mRNA) including the poly-A or poly-A-G Quartet structures as described in International Patent Publication No. WO2013/103659, the content of which is incorporated herein by reference in its entirety.
In other embodiments, the 3’-stabilizing region which may be used in connection with the nucleic acid molecules of the present disclosure include a chain termination nucleoside such as but is not limited to 3’-deoxyadenosine (cordycepin) , 3’-deoxyuridine, 3’-deoxycytosine, 3’-deoxyguanosine, 3’-deoxythymine, 2’, 3’-dideoxynucleosides, such as 2’, 3’-dideoxyadenosine, 2’, 3’-dideoxyuridine, 2’, 3’-dideoxycytosine, 2’, 3’-dideoxyguanosine, 2’, 3’-dideoxythymine, a 2’-deoxynucleoside, or an O-methylnucleoside, 3’-deoxynucleoside, 2’, 3’-dideoxynucleoside 3’-O-methylnucleosides, 3’-O-ethylnucleosides, 3’-arabinosides, and other alternative nucleosides known in the art and/or described herein.
5.3.5 Secondary Structure
Without being bound by the theory, it is contemplated that a stem-loop structure can direct RNA folding, protect structural stability of a nucleic acid molecule (e.g., mRNA) , provide recognition sites for RNA binding proteins, and serve as a substrate for enzymatic reactions. For example, the incorporation of a miR sequence and/or a TEE sequence changes the shape of the stem loop region which may increase and/or decrease translation (Kedde et al. A Pumilio-induced RNA structure switch in p27-3’ UTR controls miR-221 and miR-222 accessibility. Nat Cell Biol., 2010 Oct; 12 (10) : 1014-20, the content of which is herein incorporated by reference in its entirety) .
Accordingly, in some embodiments, the nucleic acid molecules as described herein (e.g., mRNA) or a portion thereof may assume a stem-loop structure, such as but is not limited to a histone stem loop. In some embodiments, the stem-loop structure is formed from a stem-loop sequence that is about 25 or about 26 nucleotides in length such as, but not limited to, those as described in International Patent Publication No. WO2013/103659, the content of which is incorporated herein by reference in its entirety. Additional examples of stem-loop sequences include those described in International Patent Publication No. WO2012/019780 and International Patent Publication No. WO201502667, the contents of which are incorporated herein by reference. In some embodiments, the step-loop sequence comprises a TEE as described herein. In some embodiments, the step-loop sequence comprises a miR sequence as described herein. In specific embodiments, the stem loop sequence may include a miR-122 seed sequence. In specific embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCTCTTTTCAGAGCCACCA (SEQ ID NO: 41) . In other embodiments, the nucleic acid molecule comprises the stem-loop sequence CAAAGGCUCUUUUCAGAGCCACCA (SEQ ID NO: 42) .
In some embodiments, the nucleic acid molecule of the present disclosure (e.g., mRNA) comprises a stem-loop sequence located upstream (to the 5’-end) of the coding region in a nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 5’-UTR of the nucleic acid molecule. In some embodiments, the nucleic acid molecule of the present disclosure (e.g., mRNA) comprises a stem-loop sequence located downstream (to the 3’-end) of the coding region in a nucleic acid molecule. In some embodiments, the stem-loop sequence is located within the 3’-UTR of the nucleic acid molecule. In some cases, a nucleic acid  molecule can contain more than one stem-loop sequences. In some embodiment, the nucleic acid molecule comprises at least one stem-loop sequence in the 5’-UTR, and at least one stem-loop sequence in the 3’-UTR.
In some embodiments, a nucleic acid molecule comprising a stem-loop structure further comprises a stabilization region. In some embodiment, the stabilization region comprises at least one chain terminating nucleoside that functions to slow down degradation and thus increases the half-life of the nucleic acid molecule. Exemplary chain terminating nucleoside that can be used in connection with the present disclosure include but are not limited to 3’-deoxyadenosine (cordycepin) , 3’-deoxyuridine, 3’-deoxycytosine, 3’-deoxyguanosine, 3’-deoxythymine, 2’, 3’-dideoxynucleosides, such as 2’, 3’-dideoxyadenosine, 2’, 3’-dideoxyuridine, 2’, 3’-dideoxycytosine, 2’, 3’-dideoxyguanosine, 2’, 3’-dideoxythymine, a 2’-deoxynucleoside, or an O-methylnucleoside, 3’-deoxynucleoside, 2’, 3’-dideoxynucleoside 3’-O-methylnucleosides, 3’-O-ethylnucleosides, 3’-arabinosides, and other alternative nucleosides known in the art and/or described herein. In other embodiments, a stem-loop structure may be stabilized by an alteration to the 3’-region of the polynucleotide that can prevent and/or inhibit the addition of oligio (U) (International Patent Publication No. WO2013/103659, incorporated herein by reference in its entirety) .
In some embodiments, a nucleic acid molecule of the present disclosure comprises at least one stem-loop sequence and a poly-A region or polyadenylation signal. Non-limiting examples of polynucleotide sequences comprising at least one stem-loop sequence and a poly-Aregion or a polyadenylation signal include those described in International Patent Publication No. WO2013/120497, International Patent Publication No. WO2013/120629, International Patent Publication No. WO2013/120500, International Patent Publication No. WO2013/120627, International Patent Publication No. WO2013/120498, International Patent Publication No. WO2013/120626, International Patent Publication No. WO2013/120499 and International Patent Publication No. WO2013/120628, the content of each of which is incorporated herein by reference in its entirety.
In some embodiments, the nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal can encode for a pathogen antigen or fragment thereof such as the polynucleotide sequences described in International Patent Publication No.  WO2013/120499 and International Patent Publication No. WO2013/120628, the content of each of which is incorporated herein by reference in its entirety.
In some embodiments, the nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal can encode for a therapeutic protein such as the polynucleotide sequences described in International Patent Publication No. WO2013/120497 and International Patent Publication No. WO2013/120629, the content of each of which is incorporated herein by reference in its entirety.
In some embodiments, the nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal can encode for a tumor antigen or fragment thereof such as the polynucleotide sequences described in International Patent Publication No. WO2013/120500 and International Patent Publication No. WO2013/120627, the content of each of which is incorporated herein by reference in its entirety.
In some embodiments, the nucleic acid molecule comprising a stem-loop sequence and a poly-A region or a polyadenylation signal can code for an allergenic antigen or an autoimmune self-antigen such as the polynucleotide sequences described in International Patent Publication No. WO2013/120498 and International Patent Publication No. WO2013/120626, the content of each of which is incorporated herein by reference in its entirety.
5.3.6 Functional nucleotide analogs
In some embodiments, a payload nucleic acid molecule described herein contains only canonical nucleotides selected from A (adenosine) , G (guanosine) , C (cytosine) , U (uridine) , and T (thymidine) . Without being bound by the theory, it is contemplated that certain functional nucleotide analogs can confer useful properties to a nucleic acid molecule. Examples of such as useful properties in the context of the present disclosure include but are not limited to increased stability of the nucleic acid molecule, reduced immunogenicity of the nucleic acid molecule in inducing innate immune responses, enhanced production of protein encoded by the nucleic acid molecule, increased intracellular delivery and/or retention of the nucleic acid molecule, and/or reduced cellular toxicity of the nucleic acid molecule, etc.
Accordingly, in some embodiments, a payload nucleic acid molecule comprises at least one functional nucleotide analog as described herein. In some embodiments, the functional nucleotide analog contains at least one chemical modification to the nucleobase, the sugar group  and/or the phosphate group. Accordingly, a payload nucleic acid molecule comprising at least one functional nucleotide analog contains at least one chemical modification to the nucleobases, the sugar groups, and/or the internucleoside linkage. Exemplary chemical modifications to the nucleobases, sugar groups, or internucleoside linkages of a nucleic acid molecule are provided herein.
As described herein, ranging from 0%to 100%of all nucleotides in a payload nucleic acid molecule can be functional nucleotide analogs as described herein. For example, in various embodiments, from about 1%to about 20%, from about 1%to about 25%, from about 1%to about 50%, from about 1%to about 60%, from about 1%to about 70%, from about 1%to about 80%, from about 1%to about 90%, from about 1%to about 95%, from about 10%to about 20%, from about 10%to about 25%, from about 10%to about 50%, from about 10%to about 60%, from about 10%to about 70%, from about 10%to about 80%, from about 10%to about 90%, from about 10%to about 95%, from about 10%to about 100%, from about 20%to about 25%, from about 20%to about 50%, from about 20%to about 60%, from about 20%to about 70%, from about 20%to about 80%, from about 20%to about 90%, from about 20%to about 95%, from about 20%to about 100%, from about 50%to about 60%, from about 50%to about 70%, from about 50%to about 80%, from about 50%to about 90%, from about 50%to about 95%, from about 50%to about 100%, from about 70%to about 80%, from about 70%to about 90%, from about 70%to about 95%, from about 70%to about 100%, from about 80%to about 90%, from about 80%to about 95%, from about 80%to about 100%, from about 90%to about 95%, from about 90%to about 100%, or from about 95%to about 100%of all nucleotides in a nucleic acid molecule are functional nucleotide analogs described herein. In any of these embodiments, afunctional nucleotide analog can be present at any position (s) of a nucleic acid molecule, including the 5’-terminus, 3’-terminus, and/or one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and/or different types internucleoside linkages (e.g., backbone structures) .
As described herein, ranging from 0%to 100%of all nucleotides of a kind (e.g., all purine-containing nucleotides as a kind, or all pyrimidine-containing nucleotides as a kind, or all A, G, C, T or U as a kind) in a payload nucleic acid molecule can be functional nucleotide analogs as described herein. For example, in various embodiments, from about 1%to about 20%,  from about 1%to about 25%, from about 1%to about 50%, from about 1%to about 60%, from about 1%to about 70%, from about 1%to about 80%, from about 1%to about 90%, from about 1%to about 95%, from about 10%to about 20%, from about 10%to about 25%, from about 10%to about 50%, from about 10%to about 60%, from about 10%to about 70%, from about 10%to about 80%, from about 10%to about 90%, from about 10%to about95%, from about 10%to about 100%, from about 20%to about 25%, from about 20%to about 50%, from about 20%to about 60%, from about 20%to about 70%, from about 20%to about 80%, from about 20%to about90%, from about 20%to about 95%, from about 20%to about 100%, from about 50%to about 60%, from about 50%to about 70%, from about 50%to about 80%, from about 50%to about90%, from about 50%to about 95%, from about 50%to about 100%, from about70%to about 80%, from about 70%to about 90%, from about 70%to about95%, from about 70%to about 100%, from about 80%to about 90%, from about 80%to about 95%, from about 80%to about 100%, from about 90%to about 95%, from about 90%to about 100%, or from about95%to about 100%of a kind of nucleotides in a nucleic acid molecule are functional nucleotide analogs described herein. In any of these embodiments, a functional nucleotide analog can be present at any position (s) of a nucleic acid molecule, including the 5’-terminus, 3’-terminus, and/or one or more internal positions. In some embodiments, a single nucleic acid molecule can contain different sugar modifications, different nucleobase modifications, and/or different types internucleoside linkages (e.g., backbone structures) .
5.3.7 Modification to Nucleobases
In some embodiments, a functional nucleotide analog contains a non-canonical nucleobase. In some embodiments, canonical nucleobases (e.g., adenine, guanine, uracil, thymine, and cytosine) in a nucleotide can be modified or replaced to provide one or more functional analogs of the nucleotide. Exemplary modification to nucleobases include but are not limited to one or more substitutions or modifications including but not limited to alkyl, aryl, halo, oxo, hydroxyl, alkyloxy, and/or thio substitutions; one or more fused or open rings, oxidation, and/or reduction.
In some embodiments, the non-canonical nucleobase is a modified uracil. Exemplary nucleobases and nucleosides having an modified uracil include pseudouridine (ψ) , pyridin-4-one ribonucleoside, 5-aza-uracil, 6-aza-uracil, 2-thio-5-aza-uracil, 2-thio-uracil (s 2U) , 4-thio-uracil  (s 4U) , 4-thio-pseudouridine, 2-thio-pseudouridine, 5-hydroxy-uracil (ho 5U) , 5-aminoallyl-uracil, 5-halo-uracil (e.g., 5-iodo-uracil or 5-bromo-uracil) , 3-methyl-uracil (m 3U) , 5-methoxy-uracil (mo 5U) , uracil 5-oxyacetic acid (cmo 5U) , uracil 5-oxyacetic acid methyl ester (mcmo 5U) , 5-carboxymethyl-uracil (cm 5U) , 1-carboxymethyl-pseudouridine, 5-carboxyhydroxymethyl-uracil (chm 5U) , 5-carboxyhydroxymethyl-uracil methyl ester (mchm 5U) , 5-methoxycarbonylmethyl-uracil (mcm 5U) , 5-methoxycarbonylmethyl-2-thio-uracil (mcm 5s 2U) , 5-aminomethyl-2-thio-uracil (nm 5s 2U) , 5-methylaminomethyl-uracil (mnm 5U) , 5-methylaminomethyl-2-thio-uracil (mnm 5s 2U) , 5-methylaminomethyl-2-seleno-uracil (mnm 5se 2U) , 5-carbamoylmethyl-uracil (ncm 5U) , 5-carboxymethylaminomethyl-uracil (cmnm 5U) , 5-carboxymethylaminomethyl-2-thio-uracil (cmnm 5s 2U) , 5-propynyl-uracil, 1-propynyl-pseudouracil, 5-taurinomethyl-uracil (τm 5U) , 1-taurinomethyl-pseudouridine, 5-taurinomethyl-2-thio-uracil (τm 55s 2U) , 1-taurinomethyl-4-thio-pseudouridine, 5-methyl-uracil (m 5U, i.e., having the nucleobase deoxythymine) , 1-methyl-pseudouridine (m 1ψ) , 1-ethyl-pseudouridine (Et 1ψ) , 5-methyl-2-thio-uracil (m 5s 2U) , 1-methyl-4-thio-pseudouridine (m 1s 4ψ) , 4-thio-1-methyl-pseudouridine, 3-methyl-pseudouridine (m 3ψ) , 2-thio-1-methyl-pseudouridine, 1-methyl-1-deaza-pseudouridine, 2-thio-1-methyl-1-deaza-pseudouridine, dihydrouracil (D) , dihydropseudouridine, 5, 6-dihydrouracil, 5-methyl-dihydrouracil (m 5D) , 2-thio-dihydrouracil, 2-thio-dihydropseudouridine, 2-methoxy-uracil, 2-methoxy-4-thio-uracil, 4-methoxy-pseudouridine, 4-methoxy-2-thio-pseudouridine, N1-methyl-pseudouridine, 3- (3-amino-3-carboxypropyl) uracil (acp 3U) , 1-methyl-3- (3-amino-3-carboxypropyl) pseudouridine (acp 3ψ) , 5- (isopentenylaminomethyl) uracil (m 5U) , 5- (isopentenylaminomethyl) -2-thio-uracil (m 5s 2U) , 5, 2’-O-dimethyl-uridine (m 5Um) , 2-thio-2’-O-methyl-uridine (s 2Um) , 5-methoxycarbonylmethyl-2’-O-methyl-uridine (mcm 5Um) , 5-carbamoylmethyl-2’-O-methyl-uridine (ncm 5Um) , 5-carboxymethylaminomethyl-2’-O-methyl-uridine (cmnm 5Um) , 3, 2’-O-dimethyl-uridine (m 3Um) , and 5- (isopentenylaminomethyl) -2’-O-methyl-uridine (inm 5Um) , 1-thio-uracil, deoxythymidine, 5- (2-carbomethoxyvinyl) -uracil, 5- (carbamoylhydroxymethyl) -uracil, 5-carbamoylmethyl-2-thio-uracil, 5-carboxymethyl-2-thio-uracil, 5-cyanomethyl-uracil, 5-methoxy-2-thio-uracil, and 5- [3- (1-E-propenylamino) ] uracil.
In some embodiments, the non-canonical nucleobase is a modified cytosine. Exemplary nucleobases and nucleosides having a modified cytosine include 5-aza-cytosine, 6-aza-cytosine, pseudoisocytidine, 3-methyl-cytosine (m3C) , N4-acetyl-cytosine (ac4C) , 5-formyl-cytosine (f5C) , N4-methyl-cytosine (m4C) , 5-methyl-cytosine (m5C) , 5-halo-cytosine (e.g., 5- iodo-cytosine) , 5-hydroxymethyl-cytosine (hm5C) , 1-methyl-pseudoisocytidine, pyrrolo-cytosine, pyrrolo-pseudoisocytidine, 2-thio-cytosine (s2C) , 2-thio-5-methyl-cytosine, 4-thio-pseudoisocytidine, 4-thio-1-methyl-pseudoisocytidine, 4-thio-1-methyl-1-deaza-pseudoisocytidine, 1-methyl-1-deaza-pseudoisocytidine, zebularine, 5-aza-zebularine, 5-methyl-zebularine, 5-aza-2-thio-zebularine, 2-thio-zebularine, 2-methoxy-cytosine, 2-methoxy-5-methyl-cytosine, 4-methoxy-pseudoisocytidine, 4-methoxy-1-methyl-pseudoisocytidine, lysidine (k2C) , 5, 2’-O-dimethyl-cytidine (m5Cm) , N4-acetyl-2’-O-methyl-cytidine (ac4Cm) , N4, 2’-O-dimethyl-cytidine (m4Cm) , 5-formyl-2’-O-methyl-cytidine (fSCm) , N4, N4, 2’-O-trimethyl-cytidine (m42Cm) , 1-thio-cytosine, 5-hydroxy-cytosine, 5- (3-azidopropyl) -cytosine, and 5- (2-azidoethyl) -cytosine.
In some embodiments, the non-canonical nucleobase is a modified adenine. Exemplary nucleobases and nucleosides having an alternative adenine include 2-amino-purine, 2, 6-diaminopurine, 2-amino-6-halo-purine (e.g., 2-amino-6-chloro-purine) , 6-halo-purine (e.g., 6-chloro-purine) , 2-amino-6-methyl-purine, 8-azido-adenine, 7-deaza-adenine, 7-deaza-8-aza-adenine, 7-deaza-2-amino-purine, 7-deaza-8-aza-2-amino-purine, 7-deaza-2, 6-diaminopurine, 7-deaza-8-aza-2, 6-diaminopurine, 1-methyl-adenine (m1A) , 2-methyl-adenine (m2A) , N6-methyl-adenine (m6A) , 2-methylthio-N6-methyl-adenine (ms2m6A) , N6-isopentenyl-adenine (i6A) , 2-methylthio-N6-isopentenyl-adenine (ms2i6A) , N6- (cis-hydroxyisopentenyl) adenine (io6A) , 2-methylthio-N6- (cis-hydroxyisopentenyl) adenine (ms2io6A) , N6-glycinylcarbamoyl-adenine (g6A) , N6-threonylcarbamoyl-adenine (t6A) , N6-methyl-N6-threonylcarbamoyl-adenine (m6t6A) , 2-methylthio-N6-threonylcarbamoyl-adenine (ms2g6A) , N6, N6-dimethyl-adenine (m62A) , N6-hydroxynorvalylcarbamoyl-adenine (hn6A) , 2-methylthio-N6-hydroxynorvalylcarbamoyl-adenine (ms2hn6A) , N6-acetyl-adenine (ac6A) , 7-methyl-adenine, 2-methylthio-adenine, 2-methoxy-adenine, N6, 2’-O-dimethyl-adenosine (m6Am) , N6, N6, 2’-O-trimethyl-adenosine (m62Am) , 1, 2’-O-dimethyl-adenosine (m1Am) , 2-amino-N6-methyl-purine, 1-thio-adenine, 8-azido-adenine, N6- (19-amino-pentaoxanonadecyl) -adenine, 2, 8-dimethyl-adenine, N6-formyl-adenine, and N6-hydroxymethyl-adenine.
In some embodiments, the non-canonical nucleobase is a modified guanine. Exemplary nucleobases and nucleosides having a modified guanine include inosine (I) , 1-methyl-inosine (m1I) , wyosine (imG) , methylwyosine (mimG) , 4-demethyl-wyosine (imG-14) , isowyosine (imG2) , wybutosine (yW) , peroxywybutosine (o2yW) , hydroxywybutosine (OHyW) ,  undermodified hydroxywybutosine (OHyW*) , 7-deaza-guanine, queuosine (Q) , epoxyqueuosine (oQ) , galactosyl-queuosine (galQ) , mannosyl-queuosine (manQ) , 7-cyano-7-deaza-guanine (preQO) , 7-aminomethyl-7-deaza-guanine (preQ1) , archaeosine (G+) , 7-deaza-8-aza-guanine, 6-thio-guanine, 6-thio-7-deaza-guanine, 6-thio-7-deaza-8-aza-guanine, 7-methyl-guanine (m7G) , 6-thio-7-methyl-guanine, 7-methyl-inosine, 6-methoxy-guanine, 1-methyl-guanine (m1G) , N2-methyl-guanine (m2G) , N2, N2-dimethyl-guanine (m22G) , N2, 7-dimethyl-guanine (m2, 7G) , N2, N2, 7-dimethyl-guanine (m2, 2, 7G) , 8-oxo-guanine, 7-methyl-8-oxo-guanine, 1-methyl-6-thio-guanine, N2-methyl-6-thio-guanine, N2, N2-dimethyl-6-thio-guanine, N2-methyl-2’-O-methyl-guanosine (m2Gm) , N2, N2-dimethyl-2’-O-methyl-guanosine (m22Gm) , 1-methyl-2’-O-methyl-guanosine (m1Gm) , N2, 7-dimethyl-2’-O-methyl-guanosine (m2, 7Gm) , 2’-O-methyl-inosine (Im) , 1, 2’-O-dimethyl-inosine (m1Im) , 1-thio-guanine, and O-6-methyl-guanine.
In some embodiments, the non-canonical nucleobase of a functional nucleotide analog can be independently a purine, a pyrimidine, a purine or pyrimidine analog. For example, in some embodiments, the non-canonical nucleobase can be modified adenine, cytosine, guanine, uracil, or hypoxanthine. In other embodiments, the non-canonical nucleobase can also include, for example, naturally-occurring and synthetic derivatives of a base, including pyrazolo [3, 4-d] pyrimidines, 5-methylcytosine (5-me-C) , 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil) , 4-thiouracil, 8-halo (e.g., 8-bromo) , 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxy and other 8-substituted adenines and guanines, 5-halo particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, deazaguanine, 7-deazaguanine, 3-deazaguanine, deazaadenine, 7-deazaadenine, 3-deazaadenine, pyrazolo [3, 4-d] pyrimidine, imidazo [1, 5-a] 1, 3, 5 triazinones, 9-deazapurines, imidazo [4, 5-d] pyrazines, thiazolo [4, 5-d] pyrimidines, pyrazin-2-ones, 1, 2, 4-triazine, pyridazine; or 1, 3, 5 triazine.
5.3.8 Modification to the Sugar
In some embodiments, a functional nucleotide analog contains a non-canonical sugar group. In various embodiments, the non-canonical sugar group can be a 5-carbon or 6-carbon  sugar (such as pentose, ribose, arabinose, xylose, glucose, galactose, or a deoxy derivative thereof) with one or more substitutions, such as a halo group, a hydroxy group, a thiol group, an alkyl group, an alkoxy group, an alkenyloxy group, an alkynyloxy group, an cycloalkyl group, an aminoalkoxy group, an alkoxyalkoxy group, an hydroxyalkoxy group, an amino group, an azido group, an aryl group, an aminoalkyl group, an aminoalkenyl group, an aminoalkynyl group, etc.
Generally, RNA molecules contains the ribose sugar group, which is a 5-membered ring having an oxygen. Exemplary, non-limiting alternative nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene) ; addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl) ; ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane) ; ring expansion of ribose (e.g., to form a 6-or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino (that also has a phosphoramidate backbone) ) ; multicyclic forms (e.g., tricyclo and “unlocked” forms, such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where ribose is replaced by glycol units attached to phosphodiester bonds) , threose nucleic acid (TNA, where ribose is replace withα-L-threofuranosyl- (3’→2’) ) , and peptide nucleic acid (PNA, where 2-amino-ethyl-glycine linkages replace the ribose and phosphodiester backbone) .
In some embodiments, the sugar group contains one or more carbons that possess the opposite stereochemical configuration of the corresponding carbon in ribose. Thus, a nucleic acid molecule can include nucleotides containing, e.g., arabinose or L-ribose, as the sugar. In some embodiments, the nucleic acid molecule includes at least one nucleoside wherein the sugar is L-ribose, 2’-O-methyl-ribose, 2’-fluoro-ribose, arabinose, hexitol, an LNA, or a PNA.
5.3.9 Modifications to the Internucleoside Linkage
In some embodiments, the payload nucleic acid molecule of the present disclosure can contain one or more modified internucleoside linkage (e.g., phosphate backbone) . Backbone phosphate groups can be altered by replacing one or more of the oxygen atoms with a different substituent.
In some embodiments, the functional nucleotide analogs can include the replacement of an unaltered phosphate moiety with another internucleoside linkage as described herein. Examples of alternative phosphate groups include, but are not limited to, phosphorothioate,  phosphoroselenates, boranophosphates, boranophosphate esters, hydrogen phosphonates, phosphoramidates, phosphorodiamidates, alkyl or aryl phosphonates, and phosphotriesters. Phosphorodithioates have both non-linking oxygens replaced by sulfur. The phosphate linker can also be altered by the replacement of a linking oxygen with nitrogen (bridged phosphoramidates) , sulfur (bridged phosphorothioates) , and carbon (bridged methylene-phosphonates) .
The alternative nucleosides and nucleotides can include the replacement of one or more of the non-bridging oxygens with a borane moiety (BH 3) , sulfur (thio) , methyl, ethyl, and/or methoxy. As a non-limiting example, two non-bridging oxygens at the same position (e.g., the alpha (α) , beta (β) or gamma (γ) position) can be replaced with a sulfur (thio) and a methoxy. The replacement of one or more of the oxygen atoms at the position of the phosphate moiety (e.g., α-thio phosphate) is provided to confer stability (such as against exonucleases and endonucleases) to RNA and DNA through the unnatural phosphorothioate backbone linkages. Phosphorothioate DNA and RNA have increased nuclease resistance and subsequently a longer half-life in a cellular environment.
Other internucleoside linkages that may be employed according to the present disclosure, including internucleoside linkages which do not contain a phosphorous atom, are described herein.
Additional examples of nucleic acid molecules (e.g., mRNA) , compositions, formulations and/or methods associated therewith that can be used in connection with the present disclosure further include those described in WO2002/098443, WO2003/051401, WO2008/052770, WO2009127230, WO2006122828, WO2008/083949, WO2010088927, WO2010/037539, WO2004/004743, WO2005/016376, WO2006/024518, WO2007/095976, WO2008/014979, WO2008/077592, WO2009/030481, WO2009/095226, WO2011069586, WO2011026641, WO2011/144358, WO2012019780, WO2012013326, WO2012089338, WO2012113513, WO2012116811, WO2012116810, WO2013113502, WO2013113501, WO2013113736, WO2013143698, WO2013143699, WO2013143700, WO2013/120626, WO2013120627, WO2013120628, WO2013120629, WO2013174409, WO2014127917, WO2015/024669, WO2015/024668, WO2015/024667, WO2015/024665, WO2015/024666, WO2015/024664, WO2015101415, WO2015101414, WO2015024667, WO2015062738, WO2015101416, the content of each of which is incorporated herein in its entirety.
Therapeutic nucleic acid molecules as described herein can by isolated or synthesized using methods known in the art. In some embodiments, DNA or RNA molecules to be used in connection with the present disclosure are chemically synthesized. In other embodiments, DNA or RNA molecules to be used in connection with the present disclosure are isolated from a natural source.
In some embodiments, mRNA molecules to be used in connection with the present disclosure are biosynthesized using a host cell. In particular embodiments, an mRNA is produced by transcribing a corresponding DNA sequencing using a host cell. In some embodiments, aDNA sequence encoding an mRNA sequence is incorporated into an expression vector, which vector is then introduced into a host cell (e.g., E. coli) using methods known in the art. The host cell is then cultured under a suitable condition to produce mRNA transcripts. Other methods for producing an mRNA molecule from an encoding DNA are known in the art. For example, in some embodiments, a cell-free (in vitro) transcription system comprising enzymes of the transcription machinery of a host cell can be used to produce mRNA transcripts. An exemplary cell-free transcription reaction system is described in the present disclosure.
5.4 Nanoparticle Compositions
In one aspect, nucleic acid molecules described herein are formulated for in vitro and in vivo delivery. Particularly, in some embodiments the nucleic acid molecule is formulated into a lipid-containing composition. In some embodiments, the lipid-containing composition forms lipid nanoparticles enclosing the nucleic acid molecule within a lipid shell. In some embodiments, the lipid shells protects the nucleic acid molecules from degradation. In some embodiments, the lipid nanoparticles also facilitate transportation of the enclosed nucleic acid molecules into intracellular compartments and/or machinery to exert an intended therapeutic of prophylactic function. In certain embodiments, nucleic acids, when present in the lipid nanoparticles, are resistant in aqueous solution to degradation with a nuclease. Lipid nanoparticles comprising nucleic acids and their method of preparation are known in the art, such as those disclosed in, e.g., U.S. Patent Publication No. 2004/0142025, U.S. Patent Publication No. 2007/0042031, PCT Publication No. WO 2017/004143, PCT Publication No. WO 2015/199952, PCT Publication No. WO 2013/016058, and PCT Publication No. WO  2013/086373, the full disclosures of each of which are herein incorporated by reference in their entirety for all purposes.
In some embodiments, the largest dimension of a nanoparticle composition provided herein is 1μm or shorter (e.g., ≤1μm, ≤900 nm, ≤800 nm, ≤700 nm, ≤600 nm, ≤500 nm, ≤400 nm,≤300 nm, ≤200 nm, ≤175 nm, ≤150 nm, ≤125 nm, ≤100 nm, ≤75 nm, ≤50 nm, or shorter) , such as when measured by dynamic light scattering (DLS) , transmission electron microscopy, scanning electron microscopy, or another method. In one embodiment, the lipid nanoparticle provided herein has at least one dimension that is in the range of from about 40 to about 200 nm. In one embodiment, the at least one dimension is in the range of from about 40 to about 100 nm.
Nanoparticle compositions that can be used in connection with the present disclosure include, for example, lipid nanoparticles (LNPs) , nano liproprotein particles, liposomes, lipid vesicles, and lipoplexes. In some embodiments, nanoparticle compositions are vesicles including one or more lipid bilayers. In some embodiments, a nanoparticle composition includes two or more concentric bilayers separated by aqueous compartments. Lipid bilayers may be functionalized and/or crosslinked to one another. Lipid bilayers may include one or more ligands, proteins, or channels.
In some embodiments, nanoparticle compositions as described comprise a lipid component including at least one lipid, such as a compound according to one of Series 01-07 of lipids (and sub-formulas thereof) as described herein. For example, in some embodiments, ananoparticle composition may include a lipid component including one of compounds provided herein. Nanoparticle compositions may also include one or more other lipid or non-lipid components as described below.
5.4.1 Cationic Lipids
Cationic lipids include the following Series 01-04 of lipids (and sub-formulas thereof) .
Series 01 of Lipids
In one embodiment, provided herein is a compound of Formula (01-I) :
Figure PCTCN2022143721-appb-000029
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein:
G 1 and G 2 are each independently a bond, C 2-C 12 alkylene, or C 2-C 12 alkenylene, wherein one or more-CH 2-in the alkylene or alkenylene is optionally replaced by-O-;
L 1 is–OC (=O) R 1, -C (=O) OR 1, -OC (=O) OR 1, -C (=O) R 1, -OR 1, -S (O)  xR 1, -S-SR 1, -C (=O) SR 1, -SC (=O) R 1, -NR aC (=O) R 1, -C (=O) NR bR c, -NR aC (=O) NR bR c, -OC (=O) NR bR c, - NR aC (=O) OR 1, -SC (=S) R 1, -C (=S) SR 1, -C (=S) R 1, -CH (OH) R 1, -P (=O) (OR b) (OR c) , - (C 6-C 10 arylene) -R 1, - (6-to 10-membered heteroarylene) -R 1, or R 1;
L 2 is–OC (=O) R 2, -C (=O) OR 2, -OC (=O) OR 2, -C (=O) R 2, -OR 2, -S (O)  xR 2, -S-SR 2, -C (=O) SR 2, -SC (=O) R 2, -NR dC (=O) R 2, -C (=O) NR eR f, -NR dC (=O) NR eR f, -OC (=O) NR eR f, -NR dC (=O) OR 2, -SC (=S) R 2, -C (=S) SR 2, -C (=S) R 2, -CH (OH) R 2, -P (=O) (OR e) (OR f) , - (C 6-C 10 arylene) -R 2, - (6-to 10-membered heteroarylene) -R 2, or R 2;
R 1 and R 2 are each independently C 6-C 32 alkyl or C 6-C 32 alkenyl;
R a, R b, R d, and R e are each independently H, C 1-C 24 alkyl, or C 2-C 24 alkenyl;
R c and R f are each independently C 1-C 32 alkyl or C 2-C 32 alkenyl;
G 3 is C 2-C 24 alkylene, C 2-C 24 alkenylene, C 3-C 8 cycloalkylene, or C 3-C 8 cycloalkenylene;
R 3 is-N (R 4) R 5;
R 4 is C 3-C 8 cycloalkyl, C 3-C 8 cycloalkenyl, 4-to 8-membered heterocyclyl, or C 6-C 10 aryl; or R 4, G 3 or part of G 3, together with the nitrogen to which they are attached form a cyclic moiety;
R 5 is C 1-C 12 alkyl or C 3-C 8 cycloalkyl; or R 4, R 5, together with the nitrogen to which they are attached form a cyclic moiety;
x is 0, 1 or 2; and
wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocyclyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
In one embodiment, provided herein is a compound of Formula (01-II) :
Figure PCTCN2022143721-appb-000030
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein:
Figure PCTCN2022143721-appb-000031
is a single bond or a double bond;
G 1 and G 2 are each independently a bond, C 2-C 12 alkylene, or C 2-C 12 alkenylene, wherein one or more-CH 2-in the alkylene or alkenylene is optionally replaced by-O-;
L 1 is–OC (=O) R 1, -C (=O) OR 1, -OC (=O) OR 1, -C (=O) R 1, -OR 1, -S (O)  xR 1, -S-SR 1, -C (=O) SR 1, -SC (=O) R 1, -NR aC (=O) R 1, -C (=O) NR bR c, -NR aC (=O) NR bR c, -OC (=O) NR bR c, -NR aC (=O) OR 1, -SC (=S) R 1, -C (=S) SR 1, -C (=S) R 1, -CH (OH) R 1, -P (=O) (OR b) (OR c) , - (C 6-C 10 arylene) -R 1, - (6-to 10-membered heteroarylene) -R 1, or R 1;
L 2 is–OC (=O) R 2, -C (=O) OR 2, -OC (=O) OR 2, -C (=O) R 2, -OR 2, -S (O)  xR 2, -S-SR 2, -C (=O) SR 2, -SC (=O) R 2, -NR dC (=O) R 2, -C (=O) NR eR f, -NR dC (=O) NR eR f, -OC (=O) NR eR f, -NR dC (=O) OR 2, -SC (=S) R 2, -C (=S) SR 2, -C (=S) R 2, -CH (OH) R 2, -P (=O) (OR e) (OR f) , - (C 6-C 10 arylene) -R 2, - (6-to 10-membered heteroarylene) -R 2, or R 2;
R 1 and R 2 are each independently C 6-C 32 alkyl or C 6-C 32 alkenyl;
R a, R b, R d, and R e are each independently H, C 1-C 24 alkyl, or C 2-C 24 alkenyl;
R c and R f are each independently C 1-C 32 alkyl or C 2-C 32 alkenyl;
G 4 is a bond, C 1-C 23 alkylene, C 2-C 23 alkenylene, C 3-C 8 cycloalkylene, or C 3-C 8 cycloalkenylene;
R 3 is-N (R 4) R 5;
R 4 is C 1-C 12 alkyl, C 3-C 8 cycloalkyl, C 3-C 8 cycloalkenyl, 4-to 8-membered heterocyclyl, or C 6-C 10 aryl; or R 4, G 3 or part of G 3, together with the nitrogen to which they are attached form a cyclic moiety;
R 5 is C 1-C 12 alkyl or C 3-C 8 cycloalkyl; or R 4, R 5, together with the nitrogen to which they are attached form a cyclic moiety;
x is 0, 1 or 2; and
wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocyclyl, aryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound in Table 6, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
Table 6.
Figure PCTCN2022143721-appb-000032
Figure PCTCN2022143721-appb-000033
Series 03 of Lipids
In one embodiment, provided herein is a compound of Formula (03-I) :
Figure PCTCN2022143721-appb-000034
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein:
G 1 and G 2 are each independently a bond, C 2-C 12 alkylene, or C 2-C 12 alkenylene, wherein one or more-CH 2-in G 1 and G 2 is optionally replaced by-O-;
each L 1 is independently–OC (=O) R 1, -C (=O) OR 1, -OC (=O) OR 1, -C (=O) R 1, -OR 1, -S (O)  xR 1, -S-SR 1, -C (=O) SR 1, -SC (=O) R 1, -NR aC (=O) R 1, -C (=O) NR bR c, -NR aC (=O) NR bR c, -OC (=O) NR bR c, -NR aC (=O) OR 1, -SC (=S) R 1, -C (=S) SR 1, -C (=S) R 1, -CH (OH) R 1, -P (=O) (OR b) (OR c) , -NR aP (=O) (OR b) (OR c) , - (C 6-C 10 arylene) -R 1, - (6-to 10-membered heteroarylene) -R 1, - (4-to 8-membered heterocyclylene) -R 1, or R 1;
each L 2 is independently–OC (=O) R 2, -C (=O) OR 2, -OC (=O) OR 2, -C (=O) R 2, -OR 2, -S (O)  xR 2, -S-SR 2, -C (=O) SR 2, -SC (=O) R 2, -NR dC (=O) R 2, -C (=O) NR eR f, -NR dC (=O) NR eR f, -OC (=O) NR eR f, -NR dC (=O) OR 2, -SC (=S) R 2, -C (=S) SR 2, -C (=S) R 2, -CH (OH) R 2, -P (=O) (OR e) (OR f) , -NR dP (=O) (OR e) (OR f) , - (C 6-C 10 arylene) -R 2, - (6-to 10-membered heteroarylene) -R 2, - (4-to 8-membered heterocyclylene) -R 2, or R 2;
R 1 and R 2 are each independently C 6-C 24 alkyl or C 6-C 24 alkenyl;
R a, R b, R d, and R e are each independently H, C 1-C 24 alkyl, or C 2-C 24 alkenyl;
R c and R f are each independently C 1-C 24 alkyl or C 2-C 24 alkenyl;
G 3 is C 2-C 12 alkylene or C 2-C 12 alkenylene, wherein part or all of alkylene or alkenylene is optionally replaced by C 3-C 8 cycloalkylene, C 3-C 8 cycloalkenylene, C 3-C 8 cycloalkynylene, 4-to 8-membered heterocyclylene, C 6-C 10 arylene, or 5-to 10-membered heteroarylene;
R 3 is hydrogen, C 1-C 12 alkyl, C 2-C 12 alkenyl, C 2-C 12 alkynyl, C 3-C 8 cycloalkyl, C 3-C 8 cycloalkenyl, C 3-C 8 cycloalkynyl, 4-to 8-membered heterocyclyl, C 6-C 10 aryl, or 5-to 10-membered heteroaryl; or R 3, G 1 or part of G 1, together with the nitrogen to which they are attached form a cyclic moiety; or R 3, G 3 or part of G 3, together with the nitrogen to which they are attached form a cyclic moiety;
R 4 is C 1-C 12 alkyl or C 3-C 8 cycloalkyl;
x is 0, 1, or 2;
n is 1 or 2;
m is 1 or 2; and
wherein each alkyl, alkenyl, alkynyl, cycloalkyl, cycloalkenyl, cycloalkynyl, heterocyclyl, aryl, heteroaryl, alkylene, alkenylene, cycloalkylene, cycloalkenylene, cycloalkynylene, heterocyclylene, arylene, heteroarylene, and cyclic moiety is independently optionally substituted.
In one embodiment, the compound is a compound in Table 7, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
Table 7.
Figure PCTCN2022143721-appb-000035
Series 04 of Lipids
In one embodiment, provided herein is a compound of Formula (04-I) :
Figure PCTCN2022143721-appb-000036
or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof, wherein:
G 1 and G 2 are each independently a bond, C 2-C 12 alkylene, or C 2-C 12 alkenylene;
L 1 is–OC (=O) R 1, -C (=O) OR 1, -OC (=O) OR 1, -C (=O) R 1, -OR 1, -S (O)  xR 1, -S-SR 1, -C (=O) SR 1, -SC (=O) R 1, -NR aC (=O) R 1, -C (=O) NR bR c, -NR aC (=O) NR bR c, -OC (=O) NR bR c, -NR aC (=O) OR 1, -SC (=S) R 1, -C (=S) SR 1, -C (=S) R 1, -CH (OH) R 1, -P (=O) (OR b) (OR c) , - (C 6-C 10 arylene) -R 1, - (6-to 10-membered heteroarylene) -R 1, or R 1;
L 2 is–OC (=O) R 2, -C (=O) OR 2, -OC (=O) OR 2, -C (=O) R 2, -OR 2, -S (O)  xR 2, -S-SR 2, -C (=O) SR 2, -SC (=O) R 2, -NR dC (=O) R 2, -C (=O) NR eR f, -NR dC (=O) NR eR f, -OC (=O) NR eR f, -NR dC (=O) OR 2, -SC (=S) R 2, -C (=S) SR 2, -C (=S) R 2, -CH (OH) R 2, -P (=O) (OR e) (OR f) , - (C 6-C 10 arylene) -R 2, - (6-to 10-membered heteroarylene) -R 2, or R 2;
R 1 and R 2 are each independently C 5-C 32alkyl or C 5-C 32alkenyl;
R a, R b, R d, and R e are each independently H, C 1-C 24alkyl, or C 2-C 24alkenyl;
R c and R f are each independently C 1-C 32 alkyl or C 2-C 32 alkenyl;
R 0 is C 1-C 12 alkyl, C 2-C 12 alkenyl, C 3-C 8 cycloalkyl, C 3-C 8 cycloalkenyl, C 6-C 10 aryl, or 4-to 8-membered heterocycloalkyl;
G 3 is C 2-C 12 alkylene or C 2-C 12 alkenylene;
R 4 is C 1-C 12 alkyl, C 2-C 12 alkenyl, C 3-C 8 cycloalkyl, C 3-C 8 cycloalkenyl, C 6-C 10 aryl, or 4-to 8-membered heterocycloalkyl;
R 5 is C 1-C 12 alkyl, C 3-C 8 cycloalkyl, C 3-C 8 cycloalkenyl, C 6-C 10 aryl, or 4-to 8-membered heterocycloalkyl;
x is 0, 1, or 2;
s is 0 or 1; and
wherein each alkyl, alkenyl, cycloalkyl, cycloalkenyl, heterocycloalkyl, aryl, alkylene, alkenylene, arylene, and heteroarylene, is independently optionally substituted.
In one embodiment, the compound is a compound in Table 8, or a pharmaceutically acceptable salt, prodrug or stereoisomer thereof.
Table 8.
Figure PCTCN2022143721-appb-000037
Figure PCTCN2022143721-appb-000038
It is understood that any embodiment of the compounds provided herein, as set forth above, and any specific substituent and/or variable in the compound provided herein, as set forth above, may be independently combined with other embodiments and/or substituents and/or variables of the compounds to form embodiments not specifically set forth above. In addition, in the event that a list of substituents and/or variables is listed for any particular group or variable, it is understood that each individual substituent and/or variable may be deleted from the particular embodiment and/or claim and that the remaining list of substituents and/or variables will be considered to be within the scope of embodiments provided herein.
It is understood that in the present description, combinations of substituents and/or variables of the depicted formulae are permissible only if such contributions result in stable compounds.
5.4.2 Polymer conjugated lipid
In some embodiments, the LNP comprises one or more polymer conjugated lipids, such as PEGylated lipids (PEG lipids) . Without being bound by the theory, it is contemplated that a polymer conjugated lipid component in a nanoparticle composition can improve of colloidal stability and/or reduce protein absorption of the nanoparticles. Exemplary cationic lipids that can be used in connection with the present disclosure include but are not limited to  PEG-modified phosphatidylethanolamines, PEG-modified phosphatidic acids, PEG-modified ceramides, PEG-modified dialkylamines, PEG-modified diacylglycerols, PEG-modified dialkylglycerols, and mixtures thereof. For example, a PEG lipid may be PEG-c-DOMG, PEG-DMG, PEG-DLPE, PEG-DMPE, PEG-DPPC, PEG-DSPE, Ceramide-PEG2000, or Chol-PEG2000.
In some embodiments, the polymer conjugated lipid is a pegylated lipid. For example, some embodiments include a pegylated diacylglycerol (PEG-DAG) such as 1- (monomethoxy-polyethyleneglycol) -2, 3-dimyristoylglycerol (PEG-DMG) , a pegylated phosphatidylethanoloamine (PEG-PE) , a PEG succinate diacylglycerol (PEG-S-DAG) such as 4-O- (2’, 3’-di (tetradecanoyloxy) propyl-1-O- (ω-methoxy (polyethoxy) ethyl) butanedioate (PEG-S-DMG) , a pegylated ceramide (PEG-cer) , or a PEG dialkoxypropylcarbamate such as ω-methoxy (polyethoxy) ethyl-N- (2, 3-di (tetradecanoxy) propyl) carbamate or 2, 3-di (tetradecanoxy) propyl-N- (ω-methoxy (polyethoxy) ethyl) carbamate.
In some embodiments, the polymer conjugated lipid is present in a concentration ranging from 1.0 to 2.5 molar percent. In one embodiment, the polymer conjugated lipid is present in a concentration of about 1.7 molar percent. In one embodiment, the polymer conjugated lipid is present in a concentration of about 1.5 molar percent.
In some embodiments, the molar ratio of cationic lipid to the polymer conjugated lipid ranges from about 35: 1 to about 25: 1. In one embodiment, the molar ratio of cationic lipid to polymer conjugated lipid ranges from about 100: 1 to about 20: 1.
In some embodiments, the molar ratio of cationic lipid to the polymer conjugated lipid ranges from about 35: 1 to about 25: 1. In one embodiment, the molar ratio of cationic lipid to polymer conjugated lipid ranges from about 100: 1 to about 20: 1.
In some embodiments, the pegylated lipid has the following Formula:
Figure PCTCN2022143721-appb-000039
or a pharmaceutically acceptable salt, tautomer or stereoisomer thereof, wherein:
R 12 and R 13 are each independently a straight or branched, saturated or unsaturated alkyl chain containing from 10 to 30 carbon atoms, wherein the alkyl chain is optionally interrupted by one or more ester bonds; and w has a mean value ranging from 30 to 60.
In some embodiments, R 12 and R 13 are each independently straight, saturated alkyl chains containing from 12 to 16 carbon atoms. In other embodiments, the average w ranges from 42 to 55, for example, the average w is 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55. In some specific embodiments, the average w is about49.
In some embodiments, the pegylated lipid has the following Formula:
Figure PCTCN2022143721-appb-000040
wherein the average w is about 49.
Polymer conjugated lipids also include the following Series 05 of lipids (and sub-formulas thereof) .
a. Series 05 of Lipids
In some embodiments, the polymer conjugated lipid is a compound of Formula (05-I) :
Figure PCTCN2022143721-appb-000041
or a pharmaceutically acceptable salt or stereoisomer thereof, wherein:
L is a lipid;
X is a linker;
each R 3 is independently H or C 1-C 6 alkyl;
each Y 1 is independently a bond, O, S, or NR a;
each G 4 is independently a bond or C 1-C 12 alkylene, wherein one or more-CH 2-is independently optionally replaced by-O-, -S-, or-NR a-;
each G 5 is independently a bond or C 1-C 12 alkylene, wherein one or more-CH 2-is independently optionally replaced by-O-, -S-, or-NR a-;
each R a is independently H, C 1-C 12 alkyl, or C 2-C 12 alkenyl;
one of Z 1 and Z 2 is a positively charged moiety and the other of Z 1 and Z 2 is a negatively charged moiety;
n is an integer from 2 to 100;
T is hydrogen, halogen, alkyl, alkenyl, -OR”, -SR”, -COOR”, -OCOR”, -NR”R”, -N + (R”)  3, -P + (R”)  3, -S-C (=S) -S-R”, -S-C (=S) -O-R”, -S-C (=S) -NR”R”, -S-C (=S) -aryl, cyano, azido, aryl, heteroaryl, or a targeting group, wherein each occurrence of R” is independently hydrogen or alkyl; and
wherein each alkyl, alkenyl, alkylene, aryl, and heteroaryl is independently optionally substituted.
It is understood that any embodiment of the compounds provided herein, as set forth above, and any specific substituent and/or variable in the compound provided herein, as set forth above, may be independently combined with other embodiments and/or substituents and/or variables of the compounds to form embodiments not specifically set forth above. In addition, in the event that a list of substituents and/or variables is listed for any particular group or variable, it is understood that each individual substituent and/or variable may be deleted from the particular embodiment and/or claim and that the remaining list of substituents and/or variables will be considered to be within the scope of embodiments provided herein.
i. Structural Lipids
In some embodiments, the lipid component of a nanoparticle composition can include one or more structural lipids. Without being bound by the theory, it is contemplated that structural lipids can stabilize the amphiphilic structure of a nanoparticle, such as but not limited to the lipid bilayer structure of a nanoparticle. Exemplary structural lipids that can be used in connection with the present disclosure include but are not limited to cholesterol, fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatidine, tomatine, ursolic acid, alpha-tocopherol, and mixtures thereof. In certain embodiments, the structural lipid is cholesterol. In some embodiments, the structural lipid includes cholesterol and a corticosteroid (such as prednisolone, dexamethasone, prednisone, and hydrocortisone) , or a combination thereof.
In one embodiment, the lipid nanoparticles provided herein comprise a steroid or steroid analogue. In one embodiment, the steroid or steroid analogue is cholesterol. In one embodiment, the steroid is present in a concentration ranging from 39 to 49 molar percent, 40 to 46 molar percent, from40 to 44 molar percent, from40 to 42 molar percent, from42 to 44 molar percent, or from44 to 46 molar percent. In one embodiment, the steroid is present in a concentration of 40, 41, 42, 43, 44, 45, or 46 molar percent.
In one embodiment, the molar ratio of cationic lipid to the steroid ranges from 1.0: 0.9 to 1.0: 1.2, or from 1.0: 1.0 to 1.0: 1.2. In one embodiment, the molar ratio of cationic lipid to  cholesterol ranges from about 5: 1 to 1: 1. In one embodiment, the steroid is present in a concentration ranging from 32 to 40 mol percent of the steroid.
In one embodiment, the molar ratio of cationic lipid to the steroid ranges from 1.0: 0.9 to 1.0: 1.2, or from 1.0: 1.0 to 1.0: 1.2. In one embodiment, the molar ratio of cationic lipid to cholesterol ranges from about 5: 1 to 1: 1. In one embodiment, the steroid is present in a concentration ranging from 32 to 40 mol percent of the steroid.
5.4.3 Phospholipids
In some embodiments, the lipid component of a nanoparticle composition can include one or more phospholipids, such as one or more (poly) unsaturated lipids. Without being bound by the theory, it is contemplated that phospholipids may assemble into one or more lipid bilayers structures. Exemplary phospholipids that can form part of the present nanoparticle composition include but are not limited to 1, 2-distearoyl-sn-glycero-3-phosphocholine (DSPC) , 1, 2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE) , 1, 2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC) , 1, 2-dimyristoyl-sn-glycero-phosphocholine (DMPC) , 1, 2-dioleoyl-sn-glycero-3-phosphocholine (DOPC) , 1, 2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) , 1, 2-diundecanoyl-sn-glycero-phosphocholine (DUPC) , 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) , 1, 2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18: 0 Diether PC) , 1-oleoyl-2-cholesterylhemisuccinoyl-sn-glycero-3-phosphocholine (OChemsPC) , 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC) , 1, 2-dilinolenoyl-sn-glycero-3-phosphocholine, 1, 2-diarachidonoyl-sn-glycero-3-phosphocholine, 1, 2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1, 2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0 PE) , 1, 2-distearoyl-sn-glycero-3-phosphoethanolamine, 1, 2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1, 2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1, 2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1, 2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1, 2-dioleoyl-sn-glycero-3-phospho-rac- (1-glycerol) sodium salt (DOPG) , and sphingomyelin. In certain embodiments, a nanoparticle composition includes DSPC. In certain embodiments, ananoparticle composition includes DOPE. In some embodiments, a nanoparticle composition includes both DSPC and DOPE.
Additional exemplary neutral lipids include, for example, dipalmitoylphosphatidylglycerol (DPPG) , palmitoyloleoyl-phosphatidylethanolamine (POPE) and dioleoyl-phosphatidylethanolamine 4- (N-maleimidomethyl) -cyclohexane-1carboxylate (DOPE-mal) , dipalmitoyl phosphatidyl ethanolamine (DPPE) , dimyristoylphosphoethanolamine (DMPE) , distearoyl-phosphatidylethanolamine (DSPE) , 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, 1-stearioyl-2-oleoylphosphatidyethanol amine (SOPE) , and 1, 2-dielaidoyl-sn-glycero-3-phophoethanolamine (transDOPE) . In one embodiment, the neutral lipid is 1, 2-distearoyl-sn-glycero-3phosphocholine (DSPC) . In one embodiment, the neutral lipid is selected from DSPC, DPPC, DMPC, DOPC, POPC, DOPE and SM.
In one embodiment, the neutral lipid is phosphatidylcholine (PC) , phosphatidylethanolamine (PE) phosphatidylserine (PS) , phosphatidic acid (PA) , or phosphatidylglycerol (PG) .
Additionally phospholipids that can form part of the present nanoparticle composition also include those described in WO2017/112865, the entire content of which is hereby incorporated by reference in its entirety.
5.4.4 Formulation
According to the present disclosure, nanoparticle compositions described herein can include at least one lipid component and one or more additional components, such as a therapeutic and/or prophylactic agent (e.g., the therapeutic nucleic acid described herein) . Ananoparticle composition may be designed for one or more specific applications or targets. The elements of a nanoparticle composition may be selected based on a particular application or target, and/or based on the efficacy, toxicity, expense, ease of use, availability, or other feature of one or more elements. Similarly, the particular formulation of a nanoparticle composition may be selected for a particular application or target according to, for example, the efficacy and toxicity of particular combinations of elements.
The lipid component of a nanoparticle composition may include, for example, a lipid according to one of formulae (I) to (IV) (and sub-formulas thereof) described herein, a phospholipid (such as an unsaturated lipid, e.g., DOPE or DSPC) , a PEG lipid, and a structural lipid. The elements of the lipid component may be provided in specific fractions.
In one embodiment, provided herein is a nanoparticle compositions comprising a cationic or ionizable lipid compound provided herein, a therapeutic agent, and one or more excipients. In one embodiment, cationic or ionizable lipid compound comprises a compound according to one of Formulae (I) to (IV) (and sub-formulas thereof) as described herein, and optionally one or more additional ionizable lipid compounds. In one embodiment, the one or more excipients are selected from neutral lipids, steroids, and polymer conjugated lipids. In one embodiment, the therapeutic agent is encapsulated within or associated with the lipid nanoparticle.
In one embodiment, provided herein is a nanoparticle composition (lipid nanoparticle) comprising:
i) between 40 and 50 mol percent of a cationic lipid;
ii) a neutral lipid;
iii) a steroid;
iv) a polymer conjugated lipid; and
v) a therapeutic agent.
As used herein, “mol percent” refers to a component’s molar percentage relative to total mols of all lipid components in the LNP (i.e., total mols of cationic lipid (s) , the neutral lipid, the steroid and the polymer conjugated lipid) .
In one embodiment, the lipid nanoparticle comprises from 41 to 49 mol percent, from 41 to 48 mol percent, from 42 to 48 mol percent, from 43 to 48 mol percent, from 44 to 48 mol percent, from 45 to 48 mol percent, from 46 to 48 mol percent, or from 47.2 to 47.8 mol percent of the cationic lipid. In one embodiment, the lipid nanoparticle comprises about 47.0, 47.1, 47.2, 47.3, 47.4, 47.5, 47.6, 47.7, 47.8, 47.9 or 48.0 mol percent of the cationic lipid.
In one embodiment, the neutral lipid is present in a concentration ranging from 5 to 15 mol percent, 7 to 13 mol percent, or 9 to 11 mol percent. In one embodiment, the neutral lipid is present in a concentration of about 9.5, 10 or 10.5 mol percent. In one embodiment, the molar ratio of the cationic lipid to the neutral lipid ranges from about 4.1: 1.0 to about 4.9: 1.0, from about 4.5: 1.0 to about 4.8: 1.0, or from about 4.7: 1.0 to 4.8: 1.0.
In one embodiment, the steroid is present in a concentration ranging from 39 to 49 molar percent, 40 to 46 molar percent, from 40 to 44 molar percent, from 40 to 42 molar percent, from 42 to 44 molar percent, or from 44 to 46 molar percent. In one embodiment, the steroid is present in a concentration of 40, 41, 42, 43, 44, 45, or 46 molar percent. In one embodiment, the molar ratio of cationic lipid to the steroid ranges from 1.0: 0.9 to 1.0: 1.2, or from 1.0: 1.0 to 1.0: 1.2. In one embodiment, the steroid is cholesterol.
In one embodiment, the therapeutic agent to lipid ratio in the LNP (i.e., N/P, were N represents the moles of cationic lipid and P represents the moles of phosphate present as part of the nucleic acid backbone) range from 2: 1 to 30: 1, for example 3: 1 to 22: 1. In one embodiment, N/P ranges from 6: 1 to 20: 1 or 2: 1 to 12: 1. Exemplary N/P ranges include about 3: 1. About 6: 1, about 12: 1 and about 22: 1.
In one embodiment, provided herein is a lipid nanoparticle comprising:
i) a cationic lipid having an effective pKa greater than 6.0; ii) from 5 to 15 mol percent of a neutral lipid;
iii) from 1 to 15 mol percent of an anionic lipid;
iv) from 30 to 45 mol percent of a steroid;
v) a polymer conjugated lipid; and
vi) a therapeutic agent, or a pharmaceutically acceptable salt or prodrug thereof, wherein the mol percent is determined based on total mol of lipid present in the lipid nanoparticle.
In one embodiment, the cationic lipid can be any of a number of lipid species which carry a net positive charge at a selected pH, such as physiological pH. Exemplary cationic lipids are described herein below. In one embodiment, the cationic lipid has a pKa greater than 6.25. In one embodiment, the cationic lipid has a pKa greater than 6.5. In one embodiment, the cationic lipid has a pKa greater than 6.1, greater than 6.2, greater than 6.3, greater than 6.35, greater than 6.4, greater than 6.45, greater than 6.55, greater than 6.6, greater than 6.65, or greater than 6.7.
In one embodiment, the lipid nanoparticle comprises from 40 to 45 mol percent of the cationic lipid. In one embodiment, the lipid nanoparticle comprises from 45 to 50 mole percent of the cationic lipid.
In one embodiment, the molar ratio of the cationic lipid to the neutral lipid ranges from about 2: 1 to about 8: 1. In one embodiment, the lipid nanoparticle comprises from 5 to 10 mol percent of the neutral lipid.
Exemplary anionic lipids include, but are not limited to, phosphatidylglycerol, dioleoylphosphatidylglycerol (DOPG) , dipalmitoylphosphatidylglycerol (DPPG) or 1, 2-distearoyl-sn-glycero-3-phospho- (1'-rac-glycerol) (DSPG) .
In one embodiment, the lipid nanoparticle comprises from 1 to 10 mole percent of the anionic lipid. In one embodiment, the lipid nanoparticle comprises from 1 to 5 mole percent of the anionic lipid. In one embodiment, the lipid nanoparticle comprises from 1 to 9 mole percent, from 1 to 8 mole percent, from 1 to 7 mole percent, or from 1 to 6 mole percent of the anionic lipid. In one embodiment, the mol ratio of anionic lipid to neutral lipid ranges from 1: 1 to 1: 10.
In one embodiment, the steroid cholesterol. In one embodiment, the molar ratio of the cationic lipid to cholesterol ranges from about 5: 1 to 1: 1. In one embodiment, the lipid nanoparticle comprises from 32 to 40 mol percent of the steroid.
In one embodiment, the sum of the mol percent of neutral lipid and mol percent of anionic lipid ranges from 5 to 15 mol percent. In one embodiment, wherein the sum of the mol percent of neutral lipid and mol percent of anionic lipid ranges from 7 to 12 mol percent.
In one embodiment, the mol ratio of anionic lipid to neutral lipid ranges from 1: 1 to 1: 10. In one embodiment, the sum of the mol percent of neutral lipid and mol percent steroid ranges from 35 to 45 mol percent.
In one embodiment, the lipid nanoparticle comprises:
i) from 45 to 55 mol percent of the cationic lipid;
ii) from 5 to 10 mol percent of the neutral lipid;
iii) from 1 to 5 mol percent of the anionic lipid; and
iv) from 32 to 40 mol percent of the steroid.
In one embodiment, the lipid nanoparticle comprises from 1.0 to 2.5 mol percent of the conjugated lipid. In one embodiment, the polymer conjugated lipid is present in a concentration of about 1.5 mol percent.
In one embodiment, the neutral lipid is present in a concentration ranging from 5 to 15 mol percent, 7 to 13 mol percent, or 9 to 11 mol percent. In one embodiment, the neutral lipid is present in a concentration of about 9.5, 10 or 10.5 mol percent. In one embodiment, the molar ratio of the cationic lipid to the neutral lipid ranges from about 4.1: 1.0 to about 4.9: 1.0, from about 4.5: 1.0 to about 4.8: 1.0, or from about 4.7: 1.0 to 4.8: 1.0.
In one embodiment, the steroid is cholesterol. In some embodiments, the steroid is present in a concentration ranging from 39 to 49 molar percent, 40 to 46 molar percent, from 40 to 44 molar percent, from 40 to 42 molar percent, from 42 to 44 molar percent, or from 44 to 46 molar percent. In one embodiment, the steroid is present in a concentration of 40, 41, 42, 43, 44, 45, or 46 molar percent. In certain embodiments, the molar ratio of cationic lipid to the steroid ranges from 1.0: 0.9 to 1.0: 1.2, or from 1.0: 1.0 to 1.0: 1.2.
In one embodiment, the molar ratio of cationic lipid to steroid ranges from 5: 1 to 1: 1.
In one embodiment, the lipid nanoparticle comprises from 1.0 to 2.5 mol percent of the conjugated lipid. In one embodiment, the polymer conjugated lipid is present in a concentration of about 1.5 mol percent.
In one embodiment, the molar ratio of cationic lipid to polymer conjugated lipid ranges from about 100: 1 to about 20: 1. In one embodiment, the molar ratio of cationic lipid to the polymer conjugated lipid ranges from about 35: 1 to about 25: 1.
In one embodiment, the molar ratio of cationic lipid to polymer conjugated lipid ranges from about 100: 1 to about 20: 1. In one embodiment, the molar ratio of cationic lipid to the polymer conjugated lipid ranges from about 35: 1 to about 25: 1.
In one embodiment, the lipid nanoparticle has a mean diameter ranging from 50 nm to 100 nm, or from 60 nm to 85 nm.
In one embodiment, the composition comprises a cationic lipid provided herein, DSPC, cholesterol, and PEG-lipid, and mRNA. In one embodiment, the a cationic lipid provided herein, DSPC, cholesterol, and PEG-lipid are at a molar ratio of about 50: 10: 38.5: 1.5.
Nanoparticle compositions can be designed for one or more specific applications or targets. For example, a nanoparticle composition can be designed to deliver a therapeutic and/or prophylactic agent such as an RNA to a particular cell, tissue, organ, or system or group thereof in a mammal’s body. Physiochemical properties of nanoparticle compositions can be altered in order to increase selectivity for particular bodily targets. For instance, particle sizes can be adjusted based on the fenestration sizes of different organs. The therapeutic and/or prophylactic agent included in a nanoparticle composition can also be selected based on the desired delivery target or targets. For example, a therapeutic and/or prophylactic agent can be selected for a particular indication, condition, disease, or disorder and/or for delivery to a particular cell, tissue, organ, or system or group thereof (e.g., localized or specific delivery) . In certain embodiments, ananoparticle composition can include an mRNA encoding a polypeptide of interest capable of being translated within a cell to produce the polypeptide of interest. Such a composition can be designed to be specifically delivered to a particular organ. In certain embodiments, acomposition can be designed to be specifically delivered to a mammalian liver.
The amount of a therapeutic and/or prophylactic agent in a nanoparticle composition can depend on the size, composition, desired target and/or application, or other properties of the nanoparticle composition as well as on the properties of the therapeutic and/or prophylactic agent. For example, the amount of an RNA useful in a nanoparticle composition can depend on the size, sequence, and other characteristics of the RNA. The relative amounts of a therapeutic and/or prophylactic agent and other elements (e.g., lipids) in a nanoparticle composition can also vary.  In some embodiments, the wt/wt ratio of the lipid component to a therapeutic and/or prophylactic agent in a nanoparticle composition can be from about 5: 1 to about 60: 1, such as about 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, 10: 1, 11: 1, 12: 1, 13: 1, 14: 1, 15: 1, 16: 1, 17: 1, 18: 1, 19: 1, 20: 1, 22: 1, 25: 1, 30: 1, 35: 1, 40: 1, 45: 1, 50: 1, and 60: 1. For example, the wt/wt ratio of the lipid component to a therapeutic and/or prophylactic agent can be from about 10: 1 to about 40: 1. In certain embodiments, the wt/wt ratio is about 20: 1. The amount of a therapeutic and/or prophylactic agent in a nanoparticle composition can, for example, be measured using absorption spectroscopy (e.g., ultraviolet-visible spectroscopy) .
In some embodiments, a nanoparticle composition includes one or more RNAs, and the one or more RNAs, lipids, and amounts thereof can be selected to provide a specific N: P ratio. The N: P ratio of the composition refers to the molar ratio of nitrogen atoms in one or more lipids to the number of phosphate groups in an RNA. In some embodiments, a lower N: P ratio is selected. The one or more RNA, lipids, and amounts thereof can be selected to provide an N: P ratio from about 2: 1 to about 30: 1, such as 2: 1, 3: 1, 4: 1, 5: 1, 6: 1, 7: 1, 8: 1, 9: 1, 10: 1, 12: 1, 14: 1, 16: 1, 18: 1, 20: 1, 22: 1, 24: 1, 26: 1, 28: 1, or 30: 1. In certain embodiments, the N: P ratio can be from about 2: 1 to about 8: 1. In other embodiments, the N: P ratio is from about 5: 1 to about 8: 1. For example, the N: P ratio may be about 5.0: 1, about 5.5: 1, about 5.67: 1, about 6.0: 1, about 6.5: 1, or about 7.0: 1. For example, the N: P ratio may be about 5.67: 1.
The physical properties of a nanoparticle composition can depend on the components thereof. For example, a nanoparticle composition including cholesterol as a structural lipid can have different characteristics compared to a nanoparticle composition that includes a different structural lipid. Similarly, the characteristics of a nanoparticle composition can depend on the absolute or relative amounts of its components. For instance, a nanoparticle composition including a higher molar fraction of a phospholipid may have different characteristics than a nanoparticle composition including a lower molar fraction of a phospholipid. Characteristics may also vary depending on the method and conditions of preparation of the nanoparticle composition.
Nanoparticle compositions may be characterized by a variety of methods. For example, microscopy (e.g., transmission electron microscopy or scanning electron microscopy) may be used to examine the morphology and size distribution of a nanoparticle composition. Dynamic light scattering or potentiometry (e.g., potentiometric titrations) may be used to measure zeta potentials. Dynamic light scattering may also be utilized to determine particle sizes.  Instruments such as the Zetasizer Nano ZS (Malvem Instruments Ltd, Malvem, Worcestershire, UK) may also be used to measure multiple characteristics of a nanoparticle composition, such as particle size, polydispersity index, and zeta potential.
In various embodiments, the mean size of a nanoparticle composition can be between 10s of nm and 100s of nm. For example, the mean size can be from about 40 nm to about 150 nm, such as about 40 nm, 45 nm, 50 nm, 55 nm, 60 nm, 65 nm, 70 nm, 75 nm, 80 nm, 85 nm, 90 nm, 95 nm, 100 nm, 105 nm, 110 nm, 115 nm, 120 nm, 125 nm, 130 nm, 135 nm, 140 nm, 145 nm, or 150 nm. In some embodiments, the mean size of a nanoparticle composition can be from about 50 nm to about 100 nm, from about 50 nm to about 90 nm, from about 50 nm to about 80 nm,from about 50 nm to about 70 nm, from about 50 nm to about 60 nm, from about 60 nm to about 100 nm, from about 60 nm to about 90 nm, from about 60 nm to about 80 nm, from about 60 nm to about 70 nm, from about 70 nm to about 100 nm, from about 70 nm to about 90 nm, from about 70 nm to about 80 nm, from about 80 nm to about 100 nm, from about 80 nm to about 90 nm, or from about 90 nm to about 100 nm. In certain embodiments, the mean size of a nanoparticle composition can be from about 70 nm to about 100 nm. In some embodiments, the mean size can be about 80 nm. In other embodiments, the mean size can be about 100 nm.
A nanoparticle composition can be relatively homogenous. A polydispersity index can be used to indicate the homogeneity of a nanoparticle composition, e.g., the particle size distribution of the nanoparticle compositions. A small (e.g., less than 0.3) polydispersity index generally indicates a narrow particle size distribution. A nanoparticle composition can have a polydispersity index from about 0 to about 0.25, such as 0.01, 0.02, 0.03, 0.04, 0.05, 0.06, 0.07, 0.08, 0.09, 0.10, 0.11, 0.12, 0.13, 0.14, 0.15, 0.16, 0.17, 0.18, 0.19, 0.20, 0.21, 0.22, 0.23, 0.24, or 0.25. In some embodiments, the polydispersity index of a nanoparticle composition can be from about 0.10 to about 0.20.
The zeta potential of a nanoparticle composition can be used to indicate the electrokinetic potential of the composition. For example, the zeta potential can describe the surface charge of a nanoparticle composition. Nanoparticle compositions with relatively low charges, positive or negative, are generally desirable, as more highly charged species can interact undesirably with cells, tissues, and other elements in the body. In some embodiments, the zeta potential of a nanoparticle composition can be from about-10 mV to about+20 mV, from about -10 mV to about+15 mV, from about-10 mV to about+10 mV, from about-10 mV to about+5  mV,from about-10 mV to about 0 mV, from about-10 mV to about-5 mV, from about-5 mV to about+20 mV, from about-5 mV to about+15 mV, from about-5 mV to about+10 mV, from about-5 mV to about+5 mV, from about-5 mV to about 0 mV, from about 0 mV to about+20 mV, from about 0 mV to about+15 mV, from about 0 mV to about+10 mV, from about 0 mV to about+5 mV, from about+5 mV to about+20 mV, from about+5 mV to about+15 mV, or from about+5 mV to about+10 mV.
The efficiency of encapsulation of a therapeutic and/or prophylactic agent describes the amount of therapeutic and/or prophylactic agent that is encapsulated or otherwise associated with a nanoparticle composition af ter preparation, relative to the initial amount provided. The encapsulation efficiency is desirably high (e.g., close to 100%) . The encapsulation efficiency can be measured, for example, by comparing the amount of therapeutic and/or prophylactic agent in a solution containing the nanoparticle composition before and after breaking up the nanoparticle composition with one or more organic solvents or detergents. Fluorescence can be used to measure the amount of free therapeutic and/or prophylactic agent (e.g., RNA) in a solution. For the nanoparticle compositions described herein, the encapsulation efficiency of a therapeutic and/or prophylactic agent can be at least 50%, for example 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%. In some embodiments, the encapsulation efficiency can be at least 80%. In certain embodiments, the encapsulation efficiency can be at least 90%.
A nanoparticle composition can optionally comprise one or more coatings. For example, a nanoparticle composition can be formulated in a capsule, film, or tablet having a coating. A capsule, film, or tablet including a composition described herein can have any useful size, tensile strength, hardness, or density.
5.4.5 Pharmaceutical Compositions
According to the present disclosure, nanoparticle compositions can be formulated in whole or in part as pharmaceutical compositions. Pharmaceutical compositions can include one or more nanoparticle compositions. For example, a pharmaceutical composition can include one or more nanoparticle compositions including one or more different therapeutic and/or prophylactic agents. Pharmaceutical compositions can further include one or more pharmaceutically acceptable excipients or accessory ingredients such as those described herein. General guidelines for the formulation and manufacture of pharmaceutical compositions and  agents are available, for example, in Remington’s The Science and Practice of Pharmacy, 21 st Edition, A. R. Gennaro; Lippincott, Williams&Wilkins, Baltimore, Md., 2006. Conventional excipients and accessory ingredients can be used in any pharmaceutical composition, except insofar as any conventional excipient or accessory ingredient can be incompatible with one or more components of a nanoparticle composition. An excipient or accessory ingredient can be incompatible with a component of a nanoparticle composition if its combination with the component can result in any undesirable biological effect or otherwise deleterious effect.
In some embodiments, one or more excipients or accessory ingredients can make up greater than 50%of the total mass or volume of a pharmaceutical composition including a nanoparticle composition. For example, the one or more excipients or accessory ingredients can make up 50%, 60%, 70%, 80%, 90%, or more of a pharmaceuticalcomposition. In some embodiments, a pharmaceutically acceptable excipient is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100%pure. In some embodiments, an excipient is approved for use in humans and for veterinary use. In some embodiments, an excipient is approved by United States Food and Drug Administration. In some embodiments, an excipient is pharmaceutical grade. In some embodiments, an excipient meets the standards of the United States Pharmacopoeia (USP) , the European Pharmacopoeia (EP) , the British Pharmacopoeia, and/or the International Pharmacopoeia.
Relative amounts of the one or more nanoparticle compositions, the one or more pharmaceutically acceptable excipients, and/or any additional ingredients in a pharmaceutical composition in accordance with the present disclosure will vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, a pharmaceutical composition can comprise between 0.1%and 100% (wt/wt) of one or more nanoparticle compositions.
In certain embodiments, the nanoparticle compositions and/or pharmaceutical compositions of the disclosure are refrigerated or frozen for storage and/or shipment (e.g., being stored at a temperature of 4℃. or lower, such as a temperature between about-150℃ and about 0℃ or between about-80℃ and about-20℃ (e.g., about-5℃, -10℃, -15℃, -20℃, -25℃, -30℃, -40℃, -50℃, -60℃, -70℃, -80℃, -90℃, -130℃ or-150℃) . For example, the pharmaceutical composition comprising a compound of any of Formulae (I) to (IV) (and sub-formulas thereof) is a solution that is refrigerated for storage and/or shipment at, for  example, about-20℃, -30℃, -40℃, -50℃, -60℃, -70℃, or-80℃ In certain embodiments, the disclosure also relates to a method of increasing stability of the nanoparticle compositions and/or pharmaceutical compositions comprising a compound of any of Formulae (I) to (IV) (and sub-formulas thereof) by storing the nanoparticle compositions and/or pharmaceutical compositions at a temperature of 4℃ or lower, such as a temperature between about-150℃ and about 0℃ or between about-80℃ and about-20℃, e.g., about-5℃, -10 ℃, -15℃, -20℃, -25℃, -30℃, -40℃, -50℃, -60℃, -70℃, -80℃, -90℃, -130℃ or -150℃) . For example, the nanoparticle compositions and/or pharmaceutical compositions disclosed herein are stable for about at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 1 month, at least 2 months, at least 4 months, at least 6 months, at least 8 months, at least 10 months, at least 12 months, at least 14 months, at least 16 months, at least 18 months, at least 20 months, at least 22 months, or at least 24 months, e.g., at a temperature of 4℃ or lower (e.g., between about 4℃ and-20℃) . In one embodiment, the formulation is stabilized for at least 4 weeks at about 4℃ In certain embodiments, the pharmaceutical composition of the disclosure comprises a nanoparticle composition disclosed herein and a pharmaceutically acceptable carrier selected from one or more of Tris, an acetate (e.g., sodium acetate) , an citrate (e.g., sodium citrate) , saline, PBS, and sucrose. In certain embodiments, the pharmaceutical composition of the disclosure has a pH value between about 7 and 8 (e.g., 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9 or 8.0, or between 7.5 and 8 or between 7 and 7.8) . For example, a pharmaceutical composition of the disclosure comprises a nanoparticle composition disclosed herein, Tris, saline and sucrose, and has a pH of about 7.5-8, which is suitable for storage and/or shipment at, for example, about-20 ℃ For example, a pharmaceutical composition of the disclosure comprises a nanoparticle composition disclosed herein and PBS and has a pH of about 7-7.8, suitable for storage and/or shipment at, for example, about 4℃ or lower. “Stability, ” “stabilized, ” and “stable” in the context of the present disclosure refers to the resistance of nanoparticle compositions and/or pharmaceutical compositions disclosed herein to chemical or physical changes (e.g., degradation, particle size change, aggregation, change in encapsulation, etc. ) under given manufacturing, preparation, transportation, storage and/or in-use conditions, e.g., when stress is applied such as shear force, freeze/thaw stress, etc.
Nanoparticle compositions and/or pharmaceutical compositions including one or more nanoparticle compositions can be administered to any patient or subject, including those patients or subjects that can benefit from a therapeutic effect provided by the delivery of a therapeutic and/or prophylactic agent to one or more particular cells, tissues, organs, or systems or groups thereof, such as the renal system. Although the descriptions provided herein of nanoparticle compositions and pharmaceutical compositions including nanoparticle compositions are principally directed to compositions which are suitable for administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to any other mammal. Modification of compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary pharmacologist can design and/or perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the compositions is contemplated include, but are not limited to, humans, other primates, and other mammals, including commercially relevant mammals such as cattle, pigs, hoses, sheep, cats, dogs, mice, and/or rats.
A pharmaceutical composition including one or more nanoparticle compositions can be prepared by any method known or hereafter developed in the art of pharmacology. In general, such preparatory methods include bringing the active ingredient into association with an excipient and/or one or more other accessory ingredients, and then, if desirable or necessary, dividing, shaping, and/or packaging the product into a desired single-or multi-dose unit.
A pharmaceutical composition in accordance with the present disclosure can be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses. As used herein, a “unit dose” is discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient (e.g., nanoparticle composition) . The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.
Pharmaceutical compositions can be prepared in a variety of forms suitable for a variety of routes and methods of administration. For example, pharmaceutical compositions can be prepared in liquid dosage forms (e.g., emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and elixirs) , injectable forms, solid dosage forms (e.g., capsules, tablets,  pills, powders, and granules) , dosage forms for topical and/or transdermal administration (e.g., ointments, pastes, creams, lotions, gels, powders, solutions, sprays, inhalants, and patches) , suspensions, powders, and other forms.
Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, nanoemulsions, solutions, suspensions, syrups, and/or elixirs. In addition to active ingredients, liquid dosage forms can comprise inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1, 3-butylene glycol, dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils) , glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, oral compositions can include additional therapeutic and/or prophylactic agents, additional agents such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and/or perfuming agents. In certain embodiments for parenteral administration, compositions are mixed with solubilizing agents such as Cremophor TM, alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers, and/or combinations thereof.
Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions can be formulated according to the known art using suitable dispersing agents, wetting agents, and/or suspending agents. Sterile injectable preparations can be sterile injectable solutions, suspensions, and/or emulsions in nontoxic parenterally acceptable diluents and/or solvents, for example, as a solution in 1, 3-butanediol. Among the acceptable vehicles and solvents that can be employed are water, Ringer’s solution, U.S.P., and isotonic sodium chloride solution. Sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono-or diglycerides. Fatty acids such as oleic acid can be used in the preparation of injectables.
Injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, and/or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.
The disclosure features methods of delivering a therapeutic and/or prophylactic agent to a mammalian cell or organ, producing a polypeptide of interest in a mammalian cell, and treating a disease or disorder in a mammal in need thereof comprising administering to a mammal and/or contacting a mammalian cell with a nanoparticle composition including a therapeutic and/or prophylactic agent.
5.5 Methods
In one aspect, provided herein are also methods for managing, preventing and treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject. In some embodiments, the disease or disorder being managed, prevented or treated with the methods described herein is caused by influenza viruses or by infection with influenza viruses.
In specific embodiments, the disease or disorder being managed, prevented or treated with the methods described herein is flu. Flu is a contagious respiratory illness, often infects the nose, throat, and sometimes the lungs. It can cause disease that ranges in severity from sub-clinical infection to primary viral pneumonia which can result in death. The clinical effects of infection vary with the virulence of the influenza strain and the exposure, history, age, and immune status of the host.
In some embodiments, the present method for managing, preventing and treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject comprises administering to the subject a therapeutic effective amount of a set of at least four therapeutic nucleic acids as described herein. In specific embodiments, the therapeutic nucleic acids are mRNA molecules as described herein.
In some embodiments, the present method for managing, preventing and treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject comprises administering to the subject a therapeutic effective amount of a therapeutic composition comprising a set of at least four therapeutic nucleic acids as described herein. In specific embodiments, the therapeutic nucleic acids are mRNA molecules as described herein.
In some embodiments, the present method for managing, preventing and treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject comprises administering to the subject a therapeutic effective amount of a vaccine composition  comprising a set of at least four therapeutic nucleic acids as described herein. In specific embodiments, the therapeutic nucleic acids are mRNA molecules as described herein.
In some embodiments, the present method for managing, preventing and treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject comprises administering to the subject a therapeutic effective amount of a lipid-containing composition comprising a set of at least four therapeutic nucleic acids as described herein. In specific embodiments, the therapeutic nucleic acids are mRNA molecules as described herein.
In some embodiments, the present method for managing, preventing and treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject comprises administering to the subject a therapeutic effective amount of a lipid-containing composition comprising a set of at least four therapeutic nucleic acids as described herein, wherein the lipid-containing composition is formulated as a lipid nanoparticle encapsulating the therapeutic nucleic acids in a lipid shell. In specific embodiments, the therapeutic nucleic acids are mRNA molecules as described herein. In specific embodiments, the cells in the subject effectively intake the lipid-containing composition (e.g., lipid nanoparticles) described herein upon administration. In specific embodiments, lipid-containing composition (e.g., lipid nanoparticles) described herein are endocytosed by cells of the subject.
In some embodiments, upon administration to a subject in need thereof of the set of at least four therapeutic nucleic acids as described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, the cells in the subject uptake and express the administered therapeutic nucleic acids to produce peptides or polypeptides encoded by the nucleic acids. In some embodiments, the encoded peptides or polypeptides are derived from influenza viruses causing the disease or disorder being managed, prevented, or treated by the method.
5.5.1 Immune responses
In some embodiments, upon administration to a subject in need thereof of the set of at least four therapeutic nucleic acids as described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, one or more immune responses against influenza viruses is elicited in the subject. In some  embodiments, the elicited immune response comprises one or more adaptive immune responses against influenza viruses. In some embodiments, the elicited immune response comprises one or more innate immune responses against influenza viruses. The one or more immune responses can be in the form of, e.g., an antibody response (humoral response) or a cellular immune response, e.g., cytokine secretion (e.g., interferon-gamma) , helper activity or cellular cytotoxicity. In some embodiments, expression of an activation marker on immune cells, expression of a co-stimulatory receptor on immune cells, expression of a ligand for a co-stimulatory receptor, cytokine secretion, infiltration of immune cells (e.g., T-lymphocytes, B lymphocytes and/or NK cells) to a infected cell, production of antibody specifically recognizing one or more viral proteins (e.g., the viral peptide or protein encoded by the therapeutic nucleic acid) , effector function, T cell activation, T cell differentiation, T cell proliferation, B cell differentiation, B cell proliferation, and/or NK cell proliferation is induced, activated and/or enhanced. In some embodiments, activation and proliferation of myeloid-derived suppressor cell (MDSC) and Treg cells are inhibited.
In some embodiments, upon administration to a subject in need thereof of the set of at least four therapeutic nucleic acids as described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein,
In some embodiments, upon administration to a subject in need thereof of the set of at least four therapeutic nucleic acids as described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, one or more populations of lymphocytes producing cytokines is increased in the subject. In some embodiments, the lymphocytes are CD4 +T cells and/or CD8 +T cells. In some embodiments, the cytokine is one or more of IFN-γ, TNF-α, IL-2, and IL-4. In some embodiments, the proportion of IFN-g and IL-2 expressing CD4+cells is increased. In some embodiments, the proportion of IL-4 expressing CD4+cells is increased. In some embodiments, the proportion of IFN-g and IL-2 expressing CD8+cells is increased.
In specific embodiments, the neutralizing antibody specifically binds to one or more epitopes of the influenza virus HA protein and inhibits or reduces one or more HA protein function or activity.
In specific embodiments, the neutralizing antibody binds to one or more viral proteins present on a viral particle or the surface of infected cells, and mark the viral particles or infected cells for destruction by the subject’s immune system. In some embodiments, endocytosis of viral particles by white blood cells (e.g., macrophage) is induced or enhanced. In some embodiments, antibody-dependent cell-mediated cytotoxicity (ADCC) against infected cells in the subject is induced or enhanced. In some embodiments, antibody-dependent cellular phagocytosis (ADCP) against infected cells in the subject is induced or enhanced. In some embodiments, complement dependent cytotoxicity (CDC) against infected cells in the subject is induced or enhanced.
5.5.2 Combination Therapy
In some embodiments, the composition of the present disclosure can further comprise one or more additional therapeutic agents. In some embodiments, the additional therapeutic agent is an adjuvant capable of bolstering immunogenicity of the composition (e.g., a genetic vaccine) . In some embodiments, the additional therapeutic agent is an immune modulator that enhances immune responses in a subject. In some embodiments, the adjuvant and the therapeutic nucleic acid in the composition can have a synergistic action in eliciting an immune response in a subject.
In some embodiments, the additional therapeutic agent and the therapeutic nucleic acid of the present disclosure can be co-formulated in one composition. For example, the additional therapeutic agent can be formulated as part of the composition comprising the therapeutic nucleic acid of the present disclosure. Alternatively, in some embodiments, the additional therapeutic agent and therapeutic nucleic acid of the present disclosure can be formulated as separate compositions or dose units for co-administration either sequentially or simultaneously to a subject.
In particular embodiments, the therapeutic nucleic acid of the present disclosure is formulated as part of a lipid-containing composition as described in Section 5.4, and the additional therapeutic agent is formulated as a separate composition. In particular embodiments, the therapeutic nucleic acid of the present disclosure is formulated as part of a lipid-containing composition as described in Section 5.4, wherein the additional therapeutic agent is also formulated as part of the lipid-containing composition.
In particular embodiments, the therapeutic nucleic acid of the present disclosure is formulated so that the therapeutic nucleic acid is encapsulated in a lipid shell of a lipid nanoparticle as described in Section 5.4, and the additional therapeutic agent is formulated as a  separate composition. In particular embodiments, the therapeutic nucleic acid of the present disclosure is formulated so that the therapeutic nucleic acid is encapsulated in a lipid shell of a lipid nanoparticle as described in Section 5.4, wherein the lipid nanoparticles also enclose the additional therapeutic agent molecule or a nucleic acid encoding the additional therapeutic agent molecule. In particular embodiments, the therapeutic nucleic acid of the present disclosure is formulated so that the therapeutic nucleic acid is encapsulated in a lipid shell of a lipid nanoparticle as described in Section 5.4, wherein the lipid nanoparticles and the additional therapeutic agent are formulated into a single composition.
In specific embodiments, the additional therapeutic agent is an adjuvant. In some embodiments, the adjuvant comprises an agent that promotes maturation of dendritic cells (DCs) in a vaccinated subject, such as but not limited to lipopolysaccharides, TNF-alpha or CD40 ligand. In some embodiments, the adjuvant is an agent that recognized by the immune system of the vaccinated subject as a “danger signal, ” such as LPS, GP96, etc.
In some embodiments, the adjuvant comprises an immunostimulating cytokine such as but not limited to IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, INF-alpha, IFN-beta, INF-gamma, GM-CSF, G-CSF, M-CSF, LT-beta or TNF-alpha, growth factors, such as hGH.
In some embodiments, the adjuvant comprises a compound known as capable of eliciting an innate immune response. One exemplary class of such compound are Toll-like receptor ligands, such as ligands of human Toll-like receptors TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, and ligands of murine Toll-like receptors TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11, TLR12 or TLR13. Another exemplar class of such compounds are immuno-stimulating nucleic acids, such as oligonucleotides containing the CpG motif. CpG containing nucleic acids can be DNA (CpG-DNA) or RNA (CpG-RNA) molecules. A CpG-RNA or CpG-DNA can be a single-stranded CpG-DNA (ss CpG-DNA) , a double-stranded CpG-DNA (dsDNA) , a single-stranded CpG-RNA (ss CpG-RNA) or a double-stranded CpG-RNA (ds CpG-RNA) . In some embodiments, the CpG nucleic acid is in the form of CpG-RNA. In particular embodiments, the CpG nucleic acid is in the form of single-stranded CpG-RNA (ss CpG-RNA) . In some embodiments, the CpG nucleic acid contains at least one or more (mitogenic) cytosine/guanine dinucleotide sequence (s) (CpG  motif (s) ) . In some embodiments, at least one CpG motif contained in these sequences (i.e., the C (cytosine) and/or the G (guanine) forming the CpG motif) is unmethylated.
In some embodiments, the additional therapeutic agent is an immune modulator that activate, boost or restore normal immune functions. In specific embodiments, the immune modulator is an agonist of a co-stimulatory signal of an immune cell, such as a T-lymphocyte, NK cell or antigen-presenting cell (e.g., a dendritic cell or macrophage) . In specific embodiments, the immune modulator is an antagonist of an inhibitory signal of an immune cell, such as a T-lymphocyte, NK cell or antigen-presenting cell (e.g., a dendritic cell or macrophage) .
Various immune cell stimulatory agents are known to one of skill in the art and can be used in connection with the present disclosure. In certain embodiments, the agonist of a co-stimulatory signal is an agonist of a co-stimulatory molecule (e.g., co-stimulatory receptor) found on immune cells, such as, T-lymphocytes (e.g., CD4+or CD8+T-lymphocytes) , NK cells and/or antigen-presenting cells (e.g., dendritic cells or macrophages) . Specific examples of co-stimulatory molecules include glucocorticoid-induced tumor necrosis factor receptor (GITR) , Inducible T-cell costimulator (ICOS or CD278) , OX40 (CD134) , CD27, CD28, 4-IBB (CD137) , CD40, lymphotoxin alpha (LT alpha) , LIGHT (lymphotoxin-like, exhibits inducible expression, and competes with herpes simplex virus glycoprotein D for HVEM, a receptor expressed by T lymphocytes) , CD226, cytotoxic and regulatory T cell molecule (CRT AM) , death receptor 3 (DR3) , lymphotoxin-beta receptor (LTBR) , transmembrane activator and CAML interactor (TACI) , B cell-activating factor receptor (BAFFR) , and B cell maturation protein (BCMA) .
In specific embodiments, the agonist of a co-stimulatory receptor is an antibody or antigen-binding fragment thereof that specifically binds to the co-stimulatory receptor. Specific examples of co-stimulatory receptors include GITR, ICOS, OX40, CD27, CD28, 4-1BB, CD40, , LT alpha, LIGHT, CD226, CRT AM, DR3, LTBR, TACI, BAFFR, and BCMA. In certain specific embodiments, the antibody is a monoclonal antibody. In other specific embodiments, the antibody is an sc-Fv. In a specific embodiment, the antibody is a bispecific antibody that binds to two receptors on an immune cell. In other embodiments, the bispecific antibody binds to a receptor on an immune cell and to another receptor on a virus infected diseased cell. In specific embodiments, the antibody is a human or humanized antibody.
In another embodiment, the agonist of a co-stimulatory receptor is a ligand of the co-stimulatory receptor or a functional derivative thereof. In certain embodiments, the ligand is  fragment of a native ligand. Specific examples of native ligands include ICOSL, B7RP1, CD137L, OX40L, CD70, herpes virus entry mediator (HVEM) , CD80, and CD86. The nucleotide sequences encoding native ligands as well as the amino acid sequences of native ligands are known in the art.
In specific embodiments, the antagonist is an antagonist of an inhibitory molecule (e.g., inhibitory receptor) found on immune cells, such as, e.g., T-lymphocytes (e.g., CD4+or CD8+T-lymphocytes) , NK cells and/or antigen-presenting cells (e.g., dendritic cells or macrophages) . Specific examples of inhibitory molecules include cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4 or CD52) , programmed cell death protein 1 (PD1 or CD279) , B and T-lymphocyte attenuator (BTLA) , killer cell immunoglobulin-like receptor (KIR) , lymphocyte activation gene 3 (LAG3) , T-cell membrane protein 3 (TIM3) , CD 160, adenosine A2a receptor (A2aR) , T cell immunoreceptor with immunoglobulin and ITIM domains (TIGIT) , leukocyte-associated immunoglobulin-like receptor 1 (LAIR1) , and CD 160.
In another embodiment, the antagonist of an inhibitory receptor is an antibody (or an antigen-binding fragment) that specifically binds to the native ligand for the inhibitory receptor and blocks the native ligand from binding to the inhibitory receptor and transducing an inhibitory signal (s) . In certain specific embodiments, the antibody is a monoclonal antibody. In other specific embodiments, the antibody is an sc-Fv. In a specific embodiment, the antibody is a bispecific antibody that binds to two receptors on an immune cell. In other embodiments, the bispecific antibody binds to a receptor on an immune cell and to another receptor on a virus infected diseased cell. In specific embodiments, the antibody is a human or humanized antibody.
In another embodiments, the antagonist of an inhibitory receptor is a soluble receptor or a functional derivative thereof that specifically binds to the native ligand for the inhibitory receptor and blocks the native ligand from binding to the inhibitory receptor and transducing an inhibitory signal (s) . Specific examples of native ligands for inhibitory receptors include PDL-1, PDL-2, B7-H3, B7-H4, HVEM, Gal9 and adenosine. Specific examples of inhibitory receptors that bind to a native ligand include CTLA-4, PD-1, BTLA, KIR, LAG3, TIM3, and A2aR.
In another embodiment, the antagonist of an inhibitory receptor is an antibody (or an antigen-binding fragment) or ligand that binds to the inhibitory receptor, but does not transduce an inhibitory signal (s) . Specific examples of inhibitory receptors include CTLA-4, PD1, BTLA, KIR, LAG3, TIM3, and A2aR. In certain specific embodiments, the antibody is a monoclonal  antibody. In other specific embodiments, the antibody is an scFv. In particular embodiments, the antibody is a human or humanized antibody. A specific example of an antibody to inhibitory receptor is anti-CTLA-4 antibody (Leach DR, et al. Science 1996; 271: 1734-1736) . Another example of an antibody to inhibitory receptor is anti-PD-1 antibody (Topalian SL, NEJM 2012; 28:3167-75) .
5.5.3 Patientpopulation
In some embodiments, a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein is administered to a subject in need thereof.
In some embodiments, a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein is administered to a human subject. In some embodiments, a subject administered with a set of at least four therapeutic nucleic acid described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein or a combination therapy described herein is an elderly human. In some embodiments, a subject administered with a set of at least four therapeutic nucleic acid described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein or a combination therapy described herein is a human adult. In some embodiments, a subject administered with a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein or a combination therapy described herein is human child. In some embodiments, a subject administered with a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid  nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein or a combination therapy described herein is human toddler. In some embodiments, a subject administered with a set of at least four therapeutic nucleic acid described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein or a combination therapy described herein is human infant.
In some embodiments, a subject administered with a set of at least four therapeutic nucleic acid described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein or a combination therapy described herein is administered to a non-human mammal.
In some embodiments, a subject administered with a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or the combination therapy described herein is administered to a subject exhibiting at least one symptom associated with influenza virus infection. In some embodiments, the subject receiving administration of a set of at least four therapeutic nucleic acid described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein exhibits one or more symptoms of flu, including fever or feeling feverish/chills, cough, sore throat, runny or stuffy nose, muscle or body aches, headaches, fatigue (tiredness) .
In some embodiments, a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy as described herein is administered to a subject that is asymptomatic for influenza virus infection.
In some embodiments, a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least  four therapeutic nucleic acids described herein, or a combination therapy described herein is administered to a subject who is at risk of, or susceptible to, influenza virus infection. In some embodiments, a subject at risk of, or susceptible to, influenza virus infection is an elderly human. In some embodiments, a subject at risk of, or susceptible to, influenza virus infection is a human adult. In some embodiments, a subject at risk of, or susceptible to, influenza virus infection is a human child. In some embodiments, a subject at risk of, or susceptible to, influenza virus infection is a human adult toddler. In some embodiments, a subject at risk of, or susceptible to, influenza virus infection is a human adult infant. In some embodiments, a subject at risk of, or susceptible to, influenza virus infection is a human subject having existing health condition that affects the subject’s immune system. In some embodiments, a subject at risk of, or susceptible to, influenza virus infection is a human subject having existing health condition that affects the subject’s major organs. In some embodiments, a subject at risk of, or susceptible to, influenza virus infection is a human subject having existing health condition that affects the subject’s lung function. In some embodiments, a subject at risk of, or susceptible to, influenza virus infection is an elderly human subject having an existing health condition that affects the subject’s immune system, or a major organ, such as lung function. In various embodiments described in this paragraph, a subject at risk of, or susceptible to, influenza virus infection can be either exhibiting symptoms of influenza virus infection or asymptomatic for influenza virus infection.
In some embodiments, a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein is administered to a subject who has been diagnosed positive for influenza virus infection. In some embodiments, the subject diagnosed positive for influenza virus infection is asymptomatic for influenza virus infection, and the diagnosis is based on detecting the presence of a viral nucleic acid or protein from a sample taken from the subject. In some embodiments, the diagnosis is based on clinical symptoms exhibited by the patient. Exemplary symptoms that may serve as the basis of diagnosis include but are not limited to upper respiratory tract infection, lower respiratory tract infection, lung infection, renal infection, liver infection, enteric infection, hepatic infection, neurologic infections, respiratory syndrome, pneumonia, gastroenteritis, encephalomyelitis, encephalitis, sarcoidosis, diarrhea, hepatitis, and demyelinating disease. In  some embodiments, the diagnosis is based on a subject’s exhibited clinical symptom combined with the subject’s history of being in contact with a geographical location, population, and/or individual considered of having a high risk of carrying influenza viruses, such as another individual diagnosed positive for influenza virus infection.
In some embodiments, a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein is administered to a subject who has not previously received administration of the therapeutic nucleic acids, the vaccine composition, the lipid-containing composition (e.g., lipid nanoparticles) , or the combination therapy.
In some embodiments, a set of at least four therapeutic nucleic acids described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein is administered to a subject who has previously received administration of the therapeutic nucleic acids, the vaccine composition, the lipid-containing composition (e.g., lipid nanoparticles) , or the combination therapy. In specific embodiments, the subject has been previously administered a set of at least four therapeutic nucleic acid described herein, the vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, the lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or the combination therapy as described herein once, twice, three times or more.
In some embodiments, a set of at least four therapeutic nucleic acid described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein is administered to a subject who has received a therapy prior to administration of the therapeutic nucleic acids, the vaccine composition, the lipid-containing composition (e.g., lipid nanoparticles) , or the combination therapy. In some embodiments, the subject administered with a set of at least four therapeutic nucleic acid described herein, a vaccine composition comprising the set of at least four therapeutic nucleic acids described herein, a lipid-containing composition  (e.g., lipid nanoparticles) comprising the set of at least four therapeutic nucleic acids described herein, or a combination therapy described herein experienced adverse side effects to a prior therapy or a prior therapy was discontinued due to unacceptable levels of toxicity to the subject.
5.5.4 Administration Dosage and Frequency
The amount of therapeutic nucleic acids or a composition thereof which will be effective in the management, prevention and/or treatment of infectious disease will depend on the nature of the disease being treated, the route of administration, the general health of the subject, etc. and should be decided according to the judgment of a medical practitioner. Standard clinical techniques, such as in vitro assays, may optionally be employed to help identify optimal dosage ranges. Nevertheless, suitable dosage ranges of the therapeutic nucleic acids as described herein for administration are generally about 0.001 mg, 0.005 mg, 0.01 mg, 0.05 mg. 0.1 mg. 0.5 mg,1.0 mg, 2.0 mg. 3.0 mg, 4.0 mg, 5.0 mg, 10.0 mg, 0.001 mg to 10.0 mg, 0.01 mg to 1.0 mg, 0.1 mg to 1 mg, and 0.1 mg to 5.0 mg. The therapeutic nucleic acids or a composition thereof can be administered to a subject once, twice, three, four or more times with intervals as often as needed. Effective doses may be extrapolated from dose response curves derived from in vitro or animal model test systems.
In certain embodiments, a set of at least four therapeutic nucleic acids or a composition thereof is administered to a subject as a single dose followed by a second dose 1 to 6 weeks, 1 to 5 weeks, 1 to 4 weeks, 1 to 3 weeks, 1 to 2 weeks later. In accordance with these embodiments, booster inoculations may be administered to the subject at 6 to 12 month intervals following the second inoculation.
In certain embodiments, administration of a set of at least four therapeutic nucleic acids or a composition thereof may be repeated and the administrations may be separated by at least 1 day, 2 days, 3 days, 5 days, 6 says, 7 days, 10 days, 14 days, 15 days, 21 days, 28 days, 30 days, 45 days, 2 months, 75 days, 3 months, or at least 6 months. In other embodiments, administration of a set of at least four therapeutic nucleic acids or a composition thereof may be repeated and the administrations may be separated by 1 to 14 days, 1 to 7 days, 7 to 14 days, 1 to 30 days, 15 to 30 days, 15 to 45 days, 15 to 75 days, 15 to 90 days, 1 to 3 months, 3 to 6 months, 3 to 12 months, or 6 to 12 months. In some embodiments, a first set of at least four therapeutic nucleic acids or a composition thereof is administered to a subject followed by the administration of a second set of at least four therapeutic nucleic acids or a composition thereof. In certain  embodiments, the first and second sets of at least four therapeutic nucleic acids or compositions thereof may be separated by at least 1 day, 2 days, 3 days, 5 days, 6 days, 7 days, 10 days, 14 days, 15 days, 21 days, 28 days, 30 days, 45 days, 2 months, 75 days, 3 months, or at least 6 months. In other embodiments, the first and second sets of at least four therapeutic nucleic acids or compositions thereof may be separated by 1 to 14 days, 1 to 7 days, 7 to 14 days, 1 to 30 days, 15 to 30 days, 15 to 45 days, 15 to 75 days, 15 to 90 days, 1 to 3 months, 3 to 6 months, 3 to 12 months, or 6 to 12 months.
In certain embodiments, a set of at least four therapeutic nucleic acids or composition thereof is administered to a subject in combination with one or more additional therapies, such as a therapy described in Section 5.5.2. The dosage of the other one or more additional therapies will depend upon various factors including, e.g., the therapy, the nature of the infectious disease, the route of administration, the general health of the subject, etc. and should be decided according to the judgment of a medical practitioner. In specific embodiments, the dose of the other therapy is the dose and/or frequency of administration of the therapy recommended for the therapy for use as a single agent is used in accordance with the methods disclosed herein. In other embodiments, the dose of the other therapy is a lower dose and/or less frequent administration of the therapy than recommended for the therapy for use as a single agent is used in accordance with the methods disclosed herein. Recommended doses for approved therapies can be found in the Physician’s Desk Reference.
In certain embodiments, a set of at least four therapeutic nucleic acids or composition thereof is administered to a subject concurrently with the administration of one or more additional therapies. In other embodiments, a set of at least four therapeutic nucleic acids or composition thereof is administered to a subject every 3 to 7 days, 1 to 6 weeks, 1 to 5 weeks, 1 to 4 weeks, 2 to 4 weeks, 1 to 3 weeks, or 1 to 2 weeks and one or more additional therapies (such as described in Section 5.5.2) is administered every 3 to 7 days, 1 to 6 weeks, 1 to 5 weeks, 1 to 4 weeks, 1 to 3 weeks, or 1 to 2 weeks. In certain embodiments, a set of at least four therapeutic nucleic acids or composition thereof is administered to a subject every 1 to 2 weeks and one or more additional therapies (such as described in Section 5.5.2) is administered every 2 to 4 weeks. In some embodiments, a set of at least four therapeutic nucleic acids or composition thereof is administered to a subject every week and one or more additional therapies (such as described in Section 5.5.2) is administered every 2 weeks.
6. EXAMPLES
The examples in this section are offered by way of illustration, and not by way of limitation.
The following examples are provided to exemplify the preparation of series 01 of cationic lipids.
General preparative HPLC method: HPLC purification is carried out on an Waters 2767 equipped with a diode array detector (DAD) on an Inertsil Pre-C8 OBD column, generally with water containing 0.1%TFA as solvent A and acetonitrile as solvent B.
General LCMS method: LCMS analysis is conducted on a Shimadzu (LC-MS2020) System. Chromatography is performed on a SunFire C18, generally with water containing 0.1%formic acid as solvent A and acetonitrile containing 0.1%formic acid as solvent B.
Example 01-1: Preparation of Compound 01-1 (i.e. Compound 1 in the following scheme) .
Figure PCTCN2022143721-appb-000042
Compound 1
1H NMR (400 MHz, CDCl 3) δ: 0.86-0.90 (m, 12H) , 1.27 (s, 52H) , 1.46-1.67 (m, 12H) , 1.95-2.10 (m, 5H) , 2.29-2.34 (m, 5H) , 2.44-2.77 (m, 9H) , 3.30 (s, 1H) , 3.66 (s, 2H) , 3.96 (d, J=6.0Hz, 4H) . LCMS: Rt: 1.285 min; MS m/z (ESI) : 835.7 [M+H] .
Example 01-2: Preparation of Compound 01-2 (i.e. Compound2 in the following scheme) .
Figure PCTCN2022143721-appb-000043
Compound 2
1H NMR (400 MHz, CDCl 3) δ: 0.80-0.83 (m, 12H) , 0.91-1.20 (m, 4H) , 1.25 (s, 56H) , 1.54-1.59 (m, 8H) , 1.70 (s, 3H) , 1.79-1.86 (m, 6H) , 2.22-2.34 (m, 4H) , 2.74-3.06 (m, 6H) , 3.06-3.20 (m, 2H) , 3.69 (s, 1H) , 3.88-4.05 (m, 4H) . LCMS: Rt: 1.989 min; MS m/z (ESI) : 863.7 [M+H] .
Example 01-3: Preparation of Compound01-20 (i.e. Compound20 in the following scheme) .
Figure PCTCN2022143721-appb-000044
compound20
1H NMR (400 MHz, CDCl 3) : δ0.87 (t, J=8 Hz, 12H) , 1.30-1.36 (m, 54H) , 1.45-1.52 (m, 4H) , 1.56-1.68 (m, 6H) , 1.83-1.88 (m, 4H) , 1.97-2.01 (m, 2H) , 2.21-2.23 (m, 4H) , 2.43-2.56 (m, 9H) , 3.14-3.16 (m, 1H) , 3.51-3.54 (m, 2H) , 4.03-4.07 (m, 4H) . LCMS: Rt: 1.930 min; MS m/z (ESI) : 835.7 [M+H] .
Example 01-4: Preparation of Compound01-21 (i.e. Compound21 in the following scheme) .
Figure PCTCN2022143721-appb-000045
compound21
1H NMR (400 MHz, CDCl 3) δ: 0.88 (t, J=6.8 Hz, 12H) , 1.26 (s, 56H) , 1.32-1.53 (m, 4H) , 1.60-1.68 (m, 7H) , 1.72-1.89 (m, 3H) , 1.99-2.04 (m, 1H) , 2.31 (t, J=7.4 Hz, 4H) , 2.43-2.49 (m, 6H) , 2.50-2.65 (m, 4H) , 3.49-3.56 (m, 3H) , 3.97 (d, J=5.6 Hz, 4H) . LCMS: Rt: 1.02 min; MS m/z (ESI) : 879.7 [M+H]  +.
Example 01-5: Preparation of Compound 01-102 (i.e. Compound 102 in the following scheme)
Figure PCTCN2022143721-appb-000046
compound 102-4
1H NMR (400 MHz, CDCl 3) δ: 0.86-0.89 (m, 6H) , 1.26 (s, 28H) , 2.60-2.63 (m, 2H) , 3.52-3.66 (m, 5H) , 3.75-3.78 (m, 2H) , 3.98 (d, J=5.6 Hz, 2H) , 4.56 (s, 2H) , 7.27-7.34 (m, 5H) .
compound 102-5
1H NMR (400 MHz, CDCl 3) δ: 0.86-0.89 (m, 6H) , 1.26 (s, 30H) , 2.60 (t, J=6.0 Hz, 2H) , 3.57-3.59 (m, 2H) , 3.71-3.78 (m, 4H) , 4.02 (d, J=6.0 Hz, 2H) .
compound 102
1H NMR (400 MHz, CDCl 3) δ: 0.79-0.83 (m, 12H) , 1.25 (s, 58H) , 1.47-1.60 (m, 4H) , 1.88-1.95 (m, 4H) , 2.49-2.52 (m, 9H) , 2.64-2.67 (m, 4H) , 3.01 (s, 1H) , 3.46-3.49 (m, 6H) , 3.61-3.64 (m, 4H) , 3.91 (d, J=6.4 Hz, 4H) . LCMS: Rt: 1.510 min; MS m/z (ESI) : 895.7 [M+H] .
The following compounds were prepared in analogous fashion as Compound 01-102, using corresponding starting material.
Table 9.
Figure PCTCN2022143721-appb-000047
Figure PCTCN2022143721-appb-000048
Example 01-6: Preparation of Compound 01-108 (i.e. Compound 108 in the following scheme)
Figure PCTCN2022143721-appb-000049
compound 108
1H NMR (400 MHz, CDCl 3) δ: 0.87 (t, J=8 Hz, 12H) , 1.29-1.35 (m, 53H) , 1.51-1.68 (m, 10H) , 1.82-1.88 (m, 4H) , 1.97-2.07 (m, 4H) , 2.21-2.23 (m, 2H) , 2.45-2.56 (m, 10H) , 3.14-3.27 (m, 3H) , 3.52-3.55 (m, 2H) , 4.04-4.07 (m, 2H) , 5.91-5.94 (m, 1H) . LCMS: Rt: 1.009 min; MS m/z (ESI) : 834.7 [M+H] .
The following compounds were prepared in analogous fashion as Compound 01-108, using corresponding starting material.
Table 10.
Figure PCTCN2022143721-appb-000050
Figure PCTCN2022143721-appb-000051
Example 01-7: Preparation of Compound 01-106 (i.e. Compound 106 in the following scheme) .
Figure PCTCN2022143721-appb-000052
compound 106
1H NMR (400 MHz, CDCl 3) δ: 0.87 (t, J=8 Hz, 12H) , 1.22-1.46 (m, 53H) , 1.47-1.52 (m, 6H) , 1.53-1.67 (m, 6H) , 1.83-1.87 (m, 3H) , 1.98-2.01 (m, 2H) , 2.15-2.19 (m, 2H) , 2.29- 2.32 (m, 2H) , 2.42-2.55 (m, 10H) , 3.13-3.19 (m, 2H) , 3.51-3.53 (m, 2H) , 3.95-3.97 (m, 2H) , 5.56-5.57 (m, 1H) . LCMS: Rt: 0.999min; MS m/z (ESI) : 834.8 [M+H] .
The following compounds were prepared in analogous fashion as Compound 01-106, using corresponding starting material.
Table 11.
Figure PCTCN2022143721-appb-000053
Example 03-1: Preparation of Starting Materials and Intermediates.
Preparation of compound A
Figure PCTCN2022143721-appb-000054
Preparation of compound B
Figure PCTCN2022143721-appb-000055
Preparation of compound C
Figure PCTCN2022143721-appb-000056
Preparation of compound D
Figure PCTCN2022143721-appb-000057
Preparation of compound E
Figure PCTCN2022143721-appb-000058
compound E
1H NMR (400 MHz, CDCl 3) : 3.97 (d, J=6 Hz, 2H) , 3.58 (s, 1H) , 2.73-2.58 (m, 3H) , 2.45-2.40 (m, 1H) , 2.33-2.29 (m, 2H) , 1.66-1.60 (m, 2H) , 1.51-1.40 (m, 2H) , 1.39-1.34 (m, 4H) , 1.26 (s, 46H) , 0.90-0.86 (m, 9H) . LCMS: Rt: 1.083 min; MS m/z (ESI) : 568.5 [M+H]  +.
Preparation of compound F
Figure PCTCN2022143721-appb-000059
Preparation of compound G
Figure PCTCN2022143721-appb-000060
Preparation of compound H
Figure PCTCN2022143721-appb-000061
Preparation of compound K
Figure PCTCN2022143721-appb-000062
Preparation of compound L
Figure PCTCN2022143721-appb-000063
Preparation of SM2:
Figure PCTCN2022143721-appb-000064
LCMS: Rt: 1.427 min; MS m/z (ESI) : 428.5 [M+H]  +.
Preparation of SM4:
Figure PCTCN2022143721-appb-000065
LCMS: Rt: 1.000 min; MS m/z (ESI) : 442.4 [M+H]  +.
Preparation of SM9:
Figure PCTCN2022143721-appb-000066
Preparation of SM10:
Figure PCTCN2022143721-appb-000067
compound SM10-4
LCMS: Rt: 0.830 min; MS m/z (ESI) : 481.4 [M+H]  +.
SM10
LCMS: Rt: 0.860 min; MS m/z (ESI) : 499.3 [M+H]  +.
Preparation of SM11:
Figure PCTCN2022143721-appb-000068
compound SM11
LCMS: Rt: 0.890 min; MS m/z (ESI) : 428.3 [M+H]  +.
Preparation of SM:
Figure PCTCN2022143721-appb-000069
compound SM-2
1H NMR (400 MHz, CCl 3D) : 3.71 (s, 6H) , 1.88-1.84 (m, 4H) , 1.59 (s, 1H) , 1.25 (s, 19H) , 1.14-1.10 (m, 4H) , 0.89-0.86 (m, 6H) .
compound SM-3
1H NMR (400 MHz, CCl 3D) : 0.89-0.86 (m, 6H) , 1.25 (s, 22H) , 1.45-1.40 (m, 2H) , 1.59 (s, 4H) , 2.36-2.30 (m, 1H) , 3.67 (s, 3H) .
compound SM
1H NMR (400 MHz, CCl 3D) : 0.90-0.86 (m, 6H) , 1.27 (s, 27H) , 1.43 (s, 3H) , 3.54 (d,J=5.2 Hz, 2H) .
Preparation of SM15:
Figure PCTCN2022143721-appb-000070
LCMS: Rt: 0.900 min; MS m/z (ESI) : 442.3 [M+H]  +.
Preparation of SM16:
Figure PCTCN2022143721-appb-000071
LCMS: Rt: 0.810 min; MS m/z (ESI) : 444.3 [M+H]  +.
Preparation of SM18:
Figure PCTCN2022143721-appb-000072
LCMS: Rt: 0.870 min; MS m/z (ESI) : 526.5 [M+H]  +.
Preparation of SM20:
Figure PCTCN2022143721-appb-000073
compound SM20-1
LCMS: Rt: 0.950 min; MS m/z (ESI) : 482.4 [M+H]  +.
compound SM20
LCMS: Rt: 1.330min; MS m/z (ESI) : 500.3 [M+H]  +.
Preparation of SM22:
Figure PCTCN2022143721-appb-000074
compound SM22
1H NMR (400 MHz, CCl 3D) : 0.87 (t, J=8 Hz, 6H) , 1.22-1.46 (m, 24H) , 1.85-1.95 (m, 2H) , 2.22-2.34 (m, 1H) .
Preparation of SM23:
Figure PCTCN2022143721-appb-000075
compound SM23
LCMS: Rt: 0.898 min; MS m/z (ESI) : 400.3 [M+H]  +.
Preparation of SM24:
Figure PCTCN2022143721-appb-000076
Preparation of SM26:
Figure PCTCN2022143721-appb-000077
Preparation of SM30:
Figure PCTCN2022143721-appb-000078
compound SM30
LCMS: Rt: 1.010 min; MS m/z (ESI) : 402.4 [M+H]  +.
Preparation of SM34:
Figure PCTCN2022143721-appb-000079
compound SM34
LCMS: Rt: 1.620 min; MS m/z (ESI) : 399.5 [M+H]  +.
Preparation of SM38:
Figure PCTCN2022143721-appb-000080
Preparation of SM39:
Figure PCTCN2022143721-appb-000081
compound SM39
LCMS: Rt: 0.880 min; MS m/z (ESI) : 400.3 [M+H] .
Example 03-2: Preparation of Compound 03-1 (i.e. Compound 1 in the following scheme) .
Figure PCTCN2022143721-appb-000082
compound 03-1
1H NMR (400 MHz, CDCl 3) δ: 0.83-0.93 (m, 12H) , 1.04-1.16 (m, 2H) , 1.18-1.39 (m, 60H) , 1.40-1.55 (m, 3H) , 1.56-1.74 (m, 9H) , 1.86 (s, 2H) , 2.25-2.39 (m, 5H) , 2.56 (s, 3H) , 2.70 (s, 3H) , 3.62 (s, 2H) , 3.89-4.04 (m, 4H) . LCMS: Rt: 2.000 min; MS m/z (ESI) : 863.7 [M+H]  +.
Example 03-3: Preparation of Compound 03-3.
Figure PCTCN2022143721-appb-000083
compound 03-3
1H NMR (400 MHz, CDCl 3) δ: 0.48-0.50 (m, 4H) , 0.86-0.90 (m, 9H) , 1.26-1.30 (m, 45H) , 1.49-1.66 (m, 11H) , 1.72-1.77 (m, 1H) , 2.28-2.32 (m, 4H) , 2.52-2.76 (m, 10H) , 3.52-3.58 (m, 2H) , 3.96-3.98 (m, 2H) , 4.04-4.07 (m, 2H) . LCMS: Rt: 1.250 min; MS m/z (ESI) : 751.6 [M+H]  +.
The following compound was prepared in analogous fashion as Compound 03-3, using corresponding starting material.
Table 12.
Figure PCTCN2022143721-appb-000084
Example 03-4: Preparation of Compound 03-10 (i.e. Compound 10 in the following scheme) .
Figure PCTCN2022143721-appb-000085
compound 10-1
LCMS: Rt: 0.942 min; MS m/z (ESI) : 428.3 [M+H]  +.
compound 10-2
LCMS: Rt: 0.950 min; MS m/z (ESI) : 482.4 [M+H]  +.
compound 10-3
LCMS: Rt: 1.330 min; MS m/z (ESI) : 500.3 [M+H]  +.
compound 10
1H NMR (400 MHz, CDCl 3) δ: 0.86-0.89 (m, 12H) , 1.26-1.32 (m, 61H) , 1.41-1.65 (m, 12H) , 1.85-2.02 (m, 4H) , 2.28-2.61 (m, 14H) , 3.00-3.12 (m, 1H) , 3.53-3.55 (m, 2H) , 3.97 (d, J= 5.6 Hz, 4H) . LCMS: Rt: 2.520 min; MS m/z (ESI) : 891.7 [M+H]  +.
Example 03-5: Preparation of Compound 03-11 (i.e. Compound 11 in the following scheme) .
Figure PCTCN2022143721-appb-000086
compound 11-A
1H NMR (400 MHz, CDCl 3) δ: 0.86-0.90 (m, 6H) , 1.26-1.32 (m, 29H) , 3.00 (s, 3H) , 4.11-4.13 (m, 2H) .
compound 11-1
1H NMR (400 MHz, CDCl 3) δ: 0.85-0.88 (m, 6H) , 1.24-1.29 (m, 28H) , 1.82-1.89 (m, 1H) , 3.56-3.58 (m, 2H) , 7.72-7.72 (m, 2H) , 7.83-7.85 (m, 2H) .
compound 11-2
LCMS: Rt: 1.260 min; MS m/z (ESI) : 270.3 [M+H]  +.
compound 11-4
LCMS: Rt: 0.920 min; MS m/z (ESI) : 481.4 [M+H]  +.
compound 11-5
LCMS: Rt: 0.980 min; MS m/z (ESI) : 499.3 [M+H]  +.
compound 11-6
LCMS: Rt: 0.96 min; MS m/z (ESI) : 427.3 [M+H]  +.
compound 11
1H NMR (400 MHz, CDCl 3) δ: 0.86-0.90 (m, 12H) , 1.26-1.34 (m, 64H) , 1.41-1.54 (m, 6H) , 1.59-1.77 (m, 6H) , 1.99-2.07 (m, 2H) , 2.17-2.21 (m, 4H) , 2.47-2.71 (m, 10H) , 3.15-3.18 (m, 4H) , 3.55-3.62 (m, 2H) , 5.73-5.84 (m, 2H) . LCMS: Rt: 1.610 min; MS m/z (ESI) : 889.8 [M+H]  +.
Example 03-6: Preparation of Compound 03-15 (i.e. Compound 15 in the following scheme) .
Figure PCTCN2022143721-appb-000087
compound 15
1H NMR (400 MHz, CDCl 3) δ: 0.86-0.92 (m, 12H) , 1.26-1.30 (m, 67H) , 1.46-1.72 (m, 12H) , 1.98-2.09 (m, 2H) , 2.15-2.19 (m, 2H) , 2.31-2.71 (m, 8H) , 3.16-3.23 (m, 2H) , 3.56-3.66 (m, 2H) , 3.95-4.03 (m, 2H) , 7.30 (s, 1H) . LCMS: Rt: 1.68 min; MS m/z (ESI) : 890.7 [M+H]  +.
The following compound was prepared in analogous fashion as Compound 03-15, using corresponding starting material.
Table 13.
Figure PCTCN2022143721-appb-000088
Figure PCTCN2022143721-appb-000089
Example 04-1: Preparation of Starting Materials and Intermediates.
Preparation of compound A
Figure PCTCN2022143721-appb-000090
Preparation of compound B
Figure PCTCN2022143721-appb-000091
Preparation of compound C
Figure PCTCN2022143721-appb-000092
Preparation of compound D
Figure PCTCN2022143721-appb-000093
Preparation of compound E
Figure PCTCN2022143721-appb-000094
Preparation of compound F
Figure PCTCN2022143721-appb-000095
Preparation of compound G
Figure PCTCN2022143721-appb-000096
compound G-1
LCMS: Rt: 0.824 min; MS m/z (ESI) : 394.3 [M+H]  +.
compound G
LCMS: Rt: 1.750 min; MS m/z (ESI) : 732.6 [M+H]  +.
compound H
Figure PCTCN2022143721-appb-000097
compound I
Figure PCTCN2022143721-appb-000098
compound J
Figure PCTCN2022143721-appb-000099
LCMS: Rt: 1.070 min; MS m/z (ESI) : 584.4 [M+H]  +.
Preparation of compound K
Figure PCTCN2022143721-appb-000100
Preparation of compound L
Figure PCTCN2022143721-appb-000101
Preparation of compound M
Figure PCTCN2022143721-appb-000102
Preparation of compound N
Figure PCTCN2022143721-appb-000103
Preparation of compound O
Figure PCTCN2022143721-appb-000104
Preparation of compound P
Figure PCTCN2022143721-appb-000105
Preparation of compound Q
Figure PCTCN2022143721-appb-000106
compound Q-1
1H NMR (400 MHz, CCl 3D) : δ: 3.70 (s, 6 H) , 1.88-1.84 (m, 4 H) , 1.63 (s, 1 H) , 1.27 (s, 10 H) , 1.13 (s, 5 H) , 0.88-0.86 (m, 6 H) .
compound Q-2
1H NMR (400 MHz, CCl 3D) : δ: 3.67 (s, 3 H) , 2.35-2.31 (m, 1 H) , 1.61-1.54 (m, 2 H) , 1.47-1.40 (m, 2 H) , 1.26 (s, 16 H) , 0.89-0.86 (m, 6 H) .
compound Q-3
1H NMR (400 MHz, CCl 3D) : δ: 3.54 (d, J=5.2 Hz, 2 H) , 1.47-1.43 (m, 2 H) , 1.28 (s, 20 H) , 0.90-0.87 (m, 6 H) .
Preparation of compound SM2
Figure PCTCN2022143721-appb-000107
Preparation of compound R
Figure PCTCN2022143721-appb-000108
Preparation of compound S
Figure PCTCN2022143721-appb-000109
Preparation of compound SM5
Figure PCTCN2022143721-appb-000110
Preparation of compound SM6
Figure PCTCN2022143721-appb-000111
Example 04-2: Preparation of Compound 04-1 (i.e. Compound 1 in the following scheme) .
Figure PCTCN2022143721-appb-000112
compound 1-1
LCMS: Rt: 0.750 min; MS m/z (ESI) : 206.2 [M+H]  +.
compound 1-2
LCMS: Rt: 0.870 min; MS m/z (ESI) : 448.3 [M+H]  +.
compound 1-3
LCMS: Rt: 1.360 min; MS m/z (ESI) : 616.5 [M+H]  +.
compound 1
1H NMR (400 MHz, CDCl 3) δ: 0.79-0.83 (m, 6H) , 1.14-1.26 (m, 38H) , 1.47-1.61 (m, 6H) , 1.86-1.96 (m, 4H) , 2.51-2.58 (m, 4H) , 3.17 (s, 1H) , 3.32-3.44 (m, 5H) , 3.51-3.66 (m, 3H) . LCMS: Rt: 0.94 min; MS m/z (ESI) : 526.5 [M+H]  +.
Example 04-3: Preparation of Compound04-2 (i.e. Compound2 in the following scheme) .
Figure PCTCN2022143721-appb-000113
compound 2-1
LCMS: Rt: 1.340 min; MS m/z (ESI) : 630.5 [M+H]  +.
compound 2
1H NMR (400 MHz, CDCl 3) δ: 0.86-0.90 (m, 6H) , 1.25-1.33 (m, 35H) , 1.50-1.69 (m, 7H) , 1.87-1.99 (m, 1H) , 2.00-2.08 (m, 2H) , 2.33 (t, J=7.6 Hz, 2H) , 2.56-2.81 (m, 4H) , 3.17-3.27 (m, 1H) , 3.38-3.48 (m, 3H) , 3.50-3.65 (m, 3H) , 5.08-5.14 (m, 1H) . LCMS: Rt: 1.180 min; MS m/z (ESI) : 540.4 [M+H]  +.
Example 04-4: Preparation of Compound 04-7 (i.e. Compound7 in the following scheme) .
Figure PCTCN2022143721-appb-000114
compound 7-1
LCMS: Rt: 0.780 min; MS m/z (ESI) : 427.4 [M+H]  +.
compound 7
1H NMR (400 MHz, CDCl 3) δ: 0.86-0.90 (m, 9H) , 1.26-1.35 (m, 45H) , 1.41-1.67 (m, 7H) , 2.28-2.32 (m, 3H) , 2.36-2.70 (m, 11H) , 2.79-2.83 (m, 2H) , 3.35-3.46 (m, 4H) , 3.77-3.85 (m, 1H) , 3.96-3.97 (m, 2H) . LCMS: Rt: 1.220 min; MS m/z (ESI) : 669.6 [M+H]  +.
Example 04-5: Preparation of Compound 04-8 (i.e. Compound 8 in the following scheme) .
Figure PCTCN2022143721-appb-000115
compound 8-1
LCMS: Rt: 0.730 min; MS m/z (ESI) : 371.3 [M+H]  +.
Step 2: Preparation of compound8
1H NMR (400 MHz, CDCl 3) δ: 0.86-0.90 (m, 9H) , 1.25-1.27 (m, 47H) , 1.40-1.49 (m, 4H) , 1.56-1.73 (m, 8H) , 2.30 (t, J=7.6 Hz, 3H) , 2.40-2.82 (m, 10H) , 3.32-3.38 (m, 1H) , 3.43-3.46 (m, 3H) , 3.70-3.80 (m, 1H) , 3.92-3.97 (m, 2H) . LCMS: Rt: 1.090 min; MS m/z (ESI) : 709.6 [M+H]  +.
Example 04-6: Preparation of Compound 04-65 (i.e. Compound 65 in the following scheme) .
Figure PCTCN2022143721-appb-000116
compound 65
1H NMR (400 MHz, CCl 3D) : δ: 0.79-0.83 (m, 12H) , 1.23-1.27 (m, 62H) , 1.29-1.37 (m, 2H) , 1.51-1.61 (m, 2H) , 1.76-1.93 (m, 7H) , 2.13-2.16 (m, 4H) , 2.17-2.25 (m, 3H) , 2.41-2.51 (m, 7H) , 3.05-3.06 (m, 1H) , 3.52-3.54 (m. 2H) , 3.92-4.03 (m, 4H) . LCMS: Rt: 0.588 min; MS m/z(ESI) : 863.6 [M+H]  +.
The following compounds were prepared in analogous fashion as Compound 04-65, using corresponding starting material.
Table 14.
Figure PCTCN2022143721-appb-000117
Example 04-8: Preparation of Compound 04-69 (i.e. Compound 69 in the following scheme) .
Figure PCTCN2022143721-appb-000118
compound 69-1
LCMS: Rt: 1.290 min; MS m/z (ESI) : 750.7 [M+H]  +.
compound 69
1H NMR (400 MHz, CDCl3) δ: 0.83-0.92 (m, 12H) , 0.98-1.06 (m, 3H) , 1.17-1.47 (m, 52H) , 1.54-1.72 (m, 5H) , 1.78-2.06 (m, 8H) , 2.20-2.27 (m, 4H) , 2.37-2.46 (m, 4H) , 2.49-2.66 (m, 5H) , 3.01-3.12 (m, 1H) , 3.52-3.59 (m, 2H) , 3.98-4.11 (m, 4H) . LCMS: Rt: 0.093 min; MS m/z(ESI) : 821.6 [M+H]  +.
The following compounds were prepared in analogous fashion as Compound 04-69, using corresponding starting material.
Table 15.
Figure PCTCN2022143721-appb-000119
Figure PCTCN2022143721-appb-000120
Example B1: mRNA synthesis and purification.
DNA Linearization. IVT plasmid pJ241 (constructed in house, contains a kanamycin resistance gene, a T7 promoter sequence, a poly (A) track, and a unique type-IIS restriction site downstream of poly (A) sequence) containing the target sequence (e.g., SEQ ID NOs: 5-8) encoding the HA protein or immunogenic fragment (e.g., SEQ ID NOs: 1-4) , 5’-UTR (e.g., SEQ ID NO: 19-26) , 3’-UTR (e.g., SEQ ID NO: 27-36) , signal peptide (e.g., SEQ ID NOs: 9-11, 15, 17) and polyA was linearized with type-IIS restriction enzyme digestion. Every 10μg of plasmid was mixed with 10 U of Esp3I/BsmBI, incubated at 37℃for 4 hours to ensure complete linearization. The reaction was terminated by adding 1/10th volume of 3 M Na acetate (pH 5.5) and 2.5 volumes of ethanol, mix well and chill at-20℃ for 1h. Linearized DNA was precipitated by centrifugation at 13800 g for 15 minutes at 4℃, washed twice with 70%ethanol, resuspended in nuclease-free H 2O.
In vitro Transcription of mRNA. Contents of a typical 20μL reaction mixture are shown in the Table 16 below:
Table 16.
Nuclease-free H 2O Up to20μL
RNase Inhibitor (40U/μL) 0.5μL
rNTP mixture (100mM each) 8μL (10mM each final)
10X IVT Reaction Buffer 2μL
1M MgCl 2 0.8μL
0.1M DTT 2μL
100U/mL Pyrophosphatase Inorganic 0.8μL
100mM NaCl 1μL
Linearized DNA 1μg
T7 RNA Polymerase (50U/μL) 2μL
The reaction mixture was incubated at 37℃for 6 hours followed by addition of 1μl of DNase I (RNase-free, 1 U/μL) to remove the DNA template, incubate for 30 minutes at 37℃. The synthesized RNA was purified by adding 0.5 volume of 7.5 M LiCl, 50 mM EDTA and incubating at-20℃ for 45 minutes, followed by centrifugation at 4℃ for 15 minutes at 13800 g to pellet the mRNA. Then the supernatant was removed and the pellet was rinsed twice with 500 μL of ice cold 70%ethanol, mRNA was resuspended in nuclease-free H 2O, adjusted concentration to 1 mg/mL, and stored at-20℃.
mRNA Capping. Each 10μg uncapped mRNA was heated at 65℃ for 10 minutes, placed on ice for 5 minutes, and mixed with 10 U Vaccinia Capping Enzyme, 50 U mRNA Cap 2′-O-Methyltransferase, 0.2 mM SAM, 0.5 mM GTP and 1 U RNase inhibitor, and incubated at 37℃ for 60 minutes to generate cap1 modification structure. The modified mRNA was precipitated by LiCl as previously described and the RNA was resuspended in nuclease-free H 2O, and stored at-20℃.
HPLC Purification. RNA was purified by high performance liquid chromatography (HPLC) using a C4 column (5μm) (10 mm×250 mm column) . Buffer A contained 0.1 M triethylammonium acetate (TEAA) , pH=7.0 and Buffer B contained 0.1 M TEAA, pH=7.0 and 25%acetonitrile.
As expected, mRNA molecules were successfully produced by the in vitro transcription and maturation processes described above and were purified from the reaction system using HPLC (data not shown) .
Example B2: In vitro transfection and antigen expression analysis.
Different mRNA molecules encoding the HA protein produced in Example B1 were transfected into expression cell lines such as HEK293T cultured cells to evaluate efficiency of in vitro expression of the mRNA molecules.
Expression analysis by FACS.
HEK293T cells were seeded into
Figure PCTCN2022143721-appb-000121
6-well clear TC-treated plate (Corning, #3516) . After the cells grow to≥80%confluence, mRNA-lipid complex was assembled by  preparing 3μg mRNA with 3μl
Figure PCTCN2022143721-appb-000122
2000 (Invitrogen, #11668019) mixed in 94μl Opti-MEM TM I Reduced Serum Medium (Gibco, #11058021) . Total volume of One hundred microliter mixture was added into each well. The plate was incubated in humidified 5%CO 2 incubator at 37℃ for 18-24 hours.
The cells were resuspended with PBS/1%BSA, adjusted to 1x10 5/well in a 96-well microplate. After two times wash, one hundred microliter of the working solution of the primary antibody to H1N1/H3N2/BV/BY HA (Sino Biological, #11055-MM04T/11056-MM03/11053-MM06/11053-MM09) was added to each well to suspend the cells. The microplate was incubated at 4℃ for 1 hour in dark. Then, the microplate was centrifuged at 300 xg for 5 minutes at 4℃, and the supernatant was discarded. The cells were washed twice with 180μL PBS/1%BSA each. One hundred microliter of the working solution of the secondary antibody (Jackson immune Research, #115-095-164) was added to each well to suspend the cells. The microplate was incubated at 4℃ for 30 minutes in dark. Then, the microplate was centrifuged at 300 xg for 5 minutes at 4℃, and the supernatant was discarded. The cells were washed twice with 180μL PBS/1%BSA each. Then, the cells were resuspended with 100μL PBS/1%BSA, ready for flow cytometry (Agilent, NovoCyte2060R) .
As shown in Figure 1 to 4, mRNA molecule encoding the HA protein effectively entered HEK293T cells and expressed the HA protein as detected with anti-HA primary antibodies.
In figure 1A, SEQ ID NO: 44 was selected as the H1N1 mRNA top candidate for the highest in vitro expression level and used as H1N1 composition in subsequent animal study 1. In figure 2B, SEQ ID NO: 52 was a further optimized sequence and used as H1N1 composition in subsequent animal study2.
In figure 2A, H3N2 (A/Hong Kong/45/2019) encoding mRNA SEQ ID NO: 53 showed slightly higher in vitro expression level when compared to SEQ ID NO: 49. In figure 2B, H3N2 encoding mRNA was switched to 2022-23 WHO recommended southern hemisphere H3N2 virus strain A/Darwin/6/2021 and SEQ ID NO: 55 was selected as the top candidate due to in vitro expression level.
In figure 3A, BV (B/Washington/02/2019) encoding mRNA SEQ ID NO: 57 showed advantage when compared to SEQ ID NO: 50 in HEK293T cell expression. In figure 3B, virus  strain switched BV (B/Austria/1359417/2021) encoding mRNA SEQ ID NO: 59 was selected out of 3 codon optimized mRNAs due to the expression level consistency.
In figure 4, BY encoding mRNA SEQ ID NO: 63 was selected as the top candidate with the highest in vitro expression level.
Example B3. Preparation of mRNA containing LNP
LNPs containing mRNA were prepared according to the following procedure with a lipid prepared according to the procedure provided in Examples 01 to 04 above and mRNA (e.g., SEQ ID Nos: 43-56) prepared according to the procedure provided in Example B1 above.
Preparation and characterization of lipid nanoparticles
Briefly, a cationic lipid provided herein, DSPC, cholesterol, and PEG-lipid were solubilized in ethanol at a molar ratio of 50: 10: 38.5: 1.5, and mRNA were diluted in 10 to 50mM citrate buffer, pH=4. Altenatively, a cationic lipid, DSPC, cholesterol, and a polymer conjugated lipid provided herein are solubilized in ethanol at a molar ratio of 50: 10: 38.5: 1.5, and mRNA are diluted in 10 to 50mM citrate buffer, pH=4. The LNPs were prepared at a total lipid to mRNA weight ratio of approximately 10: 1 to 30: 1 by mixing the ethanolic lipid solution with the aqueous mRNA solution at a volume ratio of 1: 3 using a microfluidic apparatus, total flow rate ranging from 9-30mL/min. Ethanol were thereby removed and replaced by DPBS using dialysis. Finally, the lipid nanoparticles were filtered through a 0.2 μm sterile filter.
Lipid nanoparticle size were determined by dynamic light scattering using a Malvern Zetasizer Nano ZS (Malvern UK) using a 173o backscatter detection mode. The encapsulation efficiency of lipid nanoparticles were determined using a Quant-it Ribogreen RNA quantification assay kit (Thermo Fisher Scientific, UK) according to the manufacturer’s instructions.
As reported in literature, the apparent pKa of LNP formulations correlates with the delivery efficiency of LNPs for nucleic acids in vivo. The apparent pKa of each formulation was determined using an assay based on fluorescence of 2- (p-toluidino) -6-napthalene sulfonic acid (TNS) . LNP formulations comprising of cationic lipid/DSPC/cholesterol/DMG-PEG (50/10/38.5/1.5 mol%) in PBS were prepared as described above. TNS was prepared as a 300uM stock solution in distilled water. LNP formulations were diluted to 0.1mg/ml total lipid  in 3 mL of buffered solutions containing 50 mM sodium citrate, 50 mM sodium phosphate, 50 mM sodium borate, and 30mM sodium chloride where the pH ranged from 3 to 9. An aliquot of the TNS solution was added to give a final concentration of 0.1mg/ml and following vortex mixing fluorescence intensity was measured at room temperature in a Molecular Devices Spectramax iD3 spectrometer using excitation and mission wavelengths of 325 nm and 435 nm. A sigmoidal best fit analysis was applied to the fluorescence data and the pKa value was measured as the pH giving rise to half–maximal fluorescent intensity.
Example B4: Antigen immunogenicity and cytokine induction
The purpose of the following experiment was to evaluate the immunogenicity of the HA protein expressed from the HA-mRNA-LNP of the present invention.
The number of animals in each group and the detailed immunization routes, doses and schedules were shown in the table below. Experimental animals, female BALB/c mice, received the test antigen (8μg/100μL per mouse or 2μg/100μL per mouse) via a single point intramuscular injection on the right hind limb on day 0. A same dose of the test vaccine was vaccinated again on day 14. The detailed administration methods, dosing amounts and administration routes were shown in the following Table 17:
Table 17.
Figure PCTCN2022143721-appb-000123
Figure PCTCN2022143721-appb-000124
Note: a: The day of the first immunization was defined as day 0.
On  Days  0, 14, 21, 28, 42, 70 and 98, whole blood samples were collected for determing the HA-specific IgG titers in the serum. On Day 98, mice were sacrificed and spleen cells were harvested.
ELISA. Flat-bottom, 96-well plates (Costar, 42592) were coated with recombinant HA protein (H1N1, #40717-V08H; H3N2, #40789-V08H; BV, #40722-V08H; BY, #40498-V08B; all from Sinobiological) at 0.01μg/mL, 0.05μg/mL or 0.1μg/mL to a volume of 100μl per well. Plates were stored overnight at 4℃. The following morning, plates were washed three times with PBS containing 0.1%Tween 20 (PBS-T) . 200μl of blocking buffer (5%BSA in PBS) was added to each well and plates were left at room temperature (RT) for 1 h. Blocking buffer was removed from wells, and fresh blocking buffer was added to ensure a final volume of 100 μL per well. Mouse sera were added and a 2-fold serial dilution was performed in the plate, leaving last lane blank to account for edge effects. The plate was stored at RT for 1 h. Plates were then washed with PBS-T three times and secondary antibody (horseradish peroxidase-linked polyclonal donkey anti-mouse IgG, Jackson immune, #715-035-151; goat anti-mouse IgG, Biodragon, #BF03001X; anti-IgG1, Abcam, #ab97240; and anti-IgG2a, Abcam, #ab97245) at a dilution of 1: 20000 or 1: 50000 was added to each well to a final volume of 100μL. Plates were left at RT for 1 h, then washed three times with PBS-T. 100μL of o- phenylenediamine dihydrochloride substrate (Solarbio, #C1058) was added and quenched with 100μL of 3 M hydrochloric acid after 4-5 min of development. Plates were red on SpectraMax iD5 microplate reader at 450 nm. Data were analyzed using Prism 8.4 (GraphPad) , and the area under the curve (AUC) was calculated using a baseline of the average of all control were lower than 0.15.
Results are shown in Figures 5A to 5G. 5A, serum IgG titer against A/H1N1; 5B, serum IgG1 titer against A/H1N1; 5C, serum IgG2a titer against A/H1N1; 5D, serum IgG, IgG1 and IgG2a titers against A/H3N2; 5E, serum IgG, IgG1 and IgG2a titers against B/Washington/02/2019 (B/Victoria) ; 5F, serum IgG, IgG1 and IgG2a titers against B/PHUKET/3073/2013 (B/Yamagata) ; 5G, serum IgG titer against A/H1N1 stalk region ChiH1/6 HA. Significance was calculated using unpaired t-test. ns, not significant; *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001.
Despite of the antigen type, all mRNA vaccine candidates managed to induce high level of antigen specific serum IgG titer. For the IgG subtypes, the IgG1 and IgG2a titer in each group showed a balanced profile. H1N1 mRNA vaccine candidates also induced high level of anti-HA stalk IgG titer. All types of IgG in each group reached a notable level as early as 21 days and lasted as long as 98 days post immunization.
Elispot. Single cells were isolated from mice splenocytes, lysed, passed through 70 μm strainer, adjusted to 6E6 viable cells/mL and resuspended in complete medium (RPMI1640 with 10%FBS) . ELISpot plates were prepared according to the instructions provided by the manufacturer (Mabtech, 3511-4APW-2, 3321-4HST-2, 3311-4APW-2, 3441-4APW-2) by washing with PBS 4 times and conditioned at RT for 30 minutes with complete medium. Then cells were stimulated with 4μg/ml of either Pool FLU-H1N1HA-peptide (Genescript, #C898ZGC290-1-206) or control Concanavalin A peptide libraries (Sigma, #C2010) at 37℃ humidified incubator with 5%CO 2for 36 hours. The following day, secreted IFN-γ, TNFα, IL-2, and IL-4 was detected. In brief, plates were emptied and washed 5 times with PB S. Detection antibody at 1μg/ml was added to plates and incubated for 1 hour at room temperature. After wash, diluted streptavidin-HRP was added to plates and incubate for another hour at RT. After final wash, add TMB substrate and stop color development in deionized water after distinct spots emerge. ImmunoSpot S6 Universal-V was used to count spots.
Results are shown in Figures 6A to 6D. 6A, secretion of IFN-γ; 6B, secretion of TNF-α; 6C, secretion of IL-2; 6D, secretion of IL-4. Data are shown as mean±SEM. Significance was calculated using one-way ANOVA (6A and 6D) or unpaired t-test (6B and 6C) . n.s., not significant; *, p<0.05; **, p<0.01; ***, p<0.001; ****, p<0.0001.
For IFN-γ, TNF-α and IL-2, significant difference was observed in all test groups except for G8-Seq. 49 when compared to the PBS group. For IL-4, significant difference was observed only in G3-Seq. 44 (8μg) when compared to the PBS group.
Example B5. Preparation of mRNA containing LNP (quadrivalent)
LNPs containing four mRNAs were prepared according to the procedure provided in Example B3 above with a lipid prepared according to the procedure provided in Examples 01 to 04 above and four mRNAs each prepared according to the procedure provided in Example B1 above. The four mRNAs encoding HA from A/H1N1 (e.g., one of SEQ ID NOs: 43-48, 52) , A/H3N2 (e.g., one of SEQ ID NOs: 49, 53-56) , B/Victoria (e.g., one of SEQ ID NOs: 50, 57-60) , and B/Yamagata (e.g., one of SEQ ID NO: 51, 61-63) were mixed in a molar ratio of 1: 1: 1: 1. Particularly, for SEQ ID NO: 44, mixtures at a molar ratio of 1: 2: 2: 2 or 1: 4: 4: 4 were also prepared.
Example B6: Antigen immunogenicity and cytokine induction (quadrivalent)
The purpose of the following experiment was to evaluate the immunogenicity of the HA protein expressed from the HA-mRNA-LNP (quadrivalent) of the present invention. Assays described in Example B4 were performed with the HA-mRNA-LNP (quadrivalent) prepared in Example B5.
Example B7: In vivo immunization study
1. Animal groups
1.1 Study 1
60 female Balb/c mice (aged 6-8 weeks, Beijing Vital River Laboratory Animal Technology Co., Ltd. ) were randomly distributed into 6 groups (10 mice/group) and were injected intramuscularly (im) with 1μg (monovalent) or 4μg (quadrivalent) of vaccines in 100μl volume at day 0 and day14.
At day 21 and 35 after the first injection whole blood was collected for serum samples and subsequent antigen specific IgG titer measurement.
At  day  21, 5 mice in each group were sacrificed and harvested for spleens for analyzing cytokine-secreting T cell response using the enzyme-linked immunospot (ELISpot) assay.
Table 18. immunization design
Figure PCTCN2022143721-appb-000125
Note: The four mRNAs (SEQ ID NO: 44, 49, 50 and 61) were mixed in a molar ratio of 1: 1: 1: 1 to form the quadrivalent antigen. The LNP used comprises i) between about 30 to 55 mol percent of a cationic lipid; ii) between about 5 to 40 mol percent of a phospholipid; iii) between about 20 to 50 mol percent of a steroid; and iv) a polymer conjugated lipid.
1.2 Study 2
35 female Balb/c mice (aged 6-8 weeks) were randomly distributed into 7 groups (5 mice/group) and were injected intramuscularly (im) with 1μg (monovalent) , 1.5μg (quadrivalent) , or 4μg (quadrivalent) of vaccines in 50μl volume at day 0 and day 21.
At  day  21 and 28 after the first injection whole blood was collected for serum samples and subsequent HAI titer measurement.
At day 35, mice in each group were sacrificed and harvested for spleens for analyzing T cell response using ICS (intracellular cytokine staining) .
Table 19. immunization design
Figure PCTCN2022143721-appb-000126
Note: Trivalent Inactivated Influenza Vaccine virus strain: A/Wisconsin/588/2019 (H1N1) pdm09-like virus/A/Hong Kong/45/2019 (H3N2) -like virus; /B/Washington/02/2019 (B/Victoria lineage) -like virus
The four mRNAs (SEQ ID NO: 52, 55, 59 and 63) were mixed in a molar ratio of 1: 1: 1: 1 to form the quadrivalent antigen. The LNP used comprises i) between about 30 to 55 mol percent of a cationic lipid; ii) between about 5 to 40 mol percent of a phospholipid; iii) between about 20 to 50 mol percent of a steroid; and iv) a polymer conjugated lipid.
2. ELISA
Flat-bottom, 96-well plates (Costar, 42592) were coated with 100μl/well recombinant HA protein at 0.05μg/mL or 0.1μg/mL. Plates were stored overnight at 4℃. At the following morning, plates were washed three times with PBS containing 0.1%Tween 20 (PBS-T) (Sinopharm chemical reagent) . 200μl of blocking buffer (5%BSA (sigma) in PBS) was added into each well and plates were left at room temperature (RT) for 1 h. Blocking buffer was removed from wells, after three times wash, mouse sera with 2-fold serial dilution in a final volume of 100μL was transferred from another plate. The plate was stored at RT for 1 h. Plates were then washed with PBS-T three times and 100μl of secondary antibody (horseradish peroxidase-linked polyclonal goat anti-mouse IgG) at a dilution of 1: 50000 was added to each well. Plates were left at RT for 1 h, then washed three times with PBS-T. 100μL of o-phenylenediamine dihydrochloride substrate (Solarbio) was added and quenched with 100μL of 3 M hydrochloric acid after 4-5 min of development. Plates were read on SpectraMax iD5 microplate reader at 450 nm. Data were analyzed using Prism 8.4 (GraphPad) , and the end point titer was calculated using a baseline lower than 0.1.
The results can be summarized as follows:
1. Quadrivalent vaccine induced robust H1N1 antigen specific IgG titer on both Day21 and Day35. The IgG titer from both Day21 and Day35 induced by quadrivalent vaccine showed no significant difference from the IgG titer induced by H1N1 monovalent vaccine (Figure 7) .
2. Quadrivalent vaccine induced robust H3N2 antigen specific IgG titer on both Day21 and Day35. No significant difference was observed via a comparsion of the quadrivalent and H3N2 monovalent group (Figure 8) .
3. For B/Victoria, the HA-specific IgG titer in monovalent group was higher than the titer in quadrivalent group (day 21, p<0.05 day 35, P<0.001) (Figure 9) .
4. For B/Yamagata, the HA-specific IgG titer in monovalent group was significantly higher than the titer in quadrivalent group at day 21 (P<0.0001) and the difference between the two groups was not significant at Day35 (Figure 10) .
3. HAI assay
Sera were treated with receptor-destroying enzyme (RDE) (Denka Seiken Co., Ltd., Tokyo, Japan) and diluted with PBS to an initial dilution of 1: 10. Serially diluted (2-fold) , heat-inactivated, and RDE-treated sera from immunized mice were incubated with an equal volume of viruses (4 hemagglutinin units [HAU] per well) at room temperature for 30 min. After incubation,  an equivalent volume of Chicken Red Blood Cell (CRBC) diluted to 1%in PBS was added, and the plates were incubated at room temperature for 45 min. Hemagglutination inhibition was determined by visual inspection, and HAI titer was expressed as the reciprocal of the highest dilution of the samples with hemagglutination inhibition.
We determined HAI titers elicited 21days and 28 days after a prime-boost vaccination regimen.
1. Quadrivalent vaccine induced robust H1N1 HAI titer on Day28, we observed no significant difference between monovalent vaccine group and quadrivalent group, while the difference between quadrivalent mRNA vaccine and inactivated trivalent vaccine to H1N1 was significant (P<0.001) , mRNA Vaccine induced approximately 6-fold to inactivated influenza vaccine (Figure 14) .
2. Quadrivalent mRNA vaccine induced robust H3N2 HAI titer on Day28 and showed no noted difference compared to monovalent H3N2 mRNA vaccine.
3. HAI titer against B/Victoria of quadrivalent mRNA vaccine is slightly lower than monovalent induced HAI titer (P=0.0371) , and the difference between mRNA quadrivalent vaccine and trivalent inactivated vaccine is significant (P<0.001) .
4. Quadrivalent mRNA vaccine induced antigen specific HAI titer and no significant difference was observed between BY monovalent mRNA vaccine and quadrivalent mRNA vaccine.
4. ELISpot
Single cell suspension was prepared from mouse splenocytes and adjusted to 6x106 cells/mL in complete medium (RPMI1640 with 10%FBS) . Pre-coated ELISpot plates (Mab Tech) were washed with PBS 4 times and conditioned at RT for 30 minutes with complete medium. Then Cell stimulation was conducted by first adding 4μg/ml of either FLU-H1N1HA peptide pool (Genescript) or control Concanavalin A (sigma) into plate, and followed by prepared cell suspension. After which, place plate at 37℃humidified incubator with 5%CO 2 for 36 hours. At the following day, T cells secreting IFN-γ/IL-2/IL-4were assessed. In brief, plates were emptied and washed 5 times with PBS. Detection antibody at 1μg/ml was added into the plates and incubated for 1 hour at room temperature. After washing, Streptavidin-HRP was added into plates and incubate for another hour at RT. After final washing, Spots were revealed using TMB substrate. ImmunoSpot S6 Universal-V was used to count spots.
On Day21, H1N1 peptide pool was used as stimulus for Elispot assay. The results can be summarized as follows:
1. Both monovalent vaccine and quadrivalent vaccine induced robust Th1-biased cytokines, IFN-γand IL-2 and the number of cytokine-secreting T cells are similar in ABOP-140 group and quadrivalent group. The difference between vaccinated groups and PBS group is significant (P<0.0001) .
2. Both monovalent vaccine and quadrivalent vaccine induced low number of IL-4-secreting T cells and there is no significant difference between the two groups (P=0.7138) There is also no significant difference between the monovalent vaccine and PBS control (P=0.0503) . However, the number of IL-4-seceting T cells in quadrivalent group higher than that from PBS control group (P=0.0012)
5. T cell stimulation and intracellular cytokine staining
Mice spleens were removed immediately after euthanasia and pooled, and single-cell suspensions were prepared in RPMI medium complemented with 2%FBS. For each simulation condition, duplicate cultures of 1.5 x 10 6 splenocytes were prepared for each splenocyte pool. H1-specific T cells were stimulated with a pool of H1N1 peptides pool. The final peptide concentration for each stimulation was 2μg/mL.
All cultures contained anti-CD28 (BD Biosciences) at a final concentration of 2μg/mL, with BD Golgi-Plug Protein Transport Inhibitor (BD Biosciences) added after 2 h. After 6 h in a humidified incubator at 37℃ with 5%CO 2, cells were stained with LIVE/DEAD fixable Zombie Green dead cell stain kit (Biolegend) , washed, and stained with AF700-labeled anti-CD3, Percp/Cy5.5 labeled anti-CD4, and APC-labeled anti-CD8. Cells were washed, fixed with Perm/Wash buffer (BD Biosciences) , and stained with a mixture of PE-labeled anti-IFNγ, BV421-labeled TNF-α, APC/Cy7-labeled anti-IL-2 (BD Biosciences) , PE/Cy7-labeled anti-IL-4. Samples were processed on a Fortessa (BD Biosciences) and analyzed by FlowJo software v10.8.1. The net (%) antigen-specific CD4 or CD8 T cells were calculated as the difference between the percent cytokine-positive cells in the antigen-stimulated and unstimulated cultures. Mice were sacrificed on Day35, and splenocytes were isolated and stimulated with H1N1 peptide pool. T cell response was measured by ICS. Both H1N1 monovalent mRNA vaccine and quadrivalent mRNA vaccine induced potent T cell immune response upon H1N1 peptide pool  stimulation. For Th1-biased cytokines, IFNγ +cell population reached 3.3%in CD8 +T cells and TNFα +cell population is 2.6%. Inactivated trivalent vaccine also induced CD8 +T cell immune response in a lower frequency than the mRNA vaccinated groups. We also stained Th2-biased cytokine IL-4, but there was no difference between vaccinated group and PBS group for IL-4 T cell response (Figure. 18) .
Overall, the IFN-γ-, TNF-α-and IL-2-producing CD4+ T cell number was lower than CD8 T cells the level from all mRNA vaccinated groups was similar. Trivalent inactivated vaccine showed relatively lower CD4+T cell immune response than mRNA vacine (Figure. 19) . Overall, the mRNA vaccines induced higher IgG and HAI antibody titer responses than the inactivated vaccine. The quadrivalent vaccine did not show a significant lower potency than individual monovalent vaccine except the B/Y vaccine. mRNA vaccine groups induced a Th1-biased cellular immune response, and it induced a stronger cellular immune response than the inactivated vaccine.
References
1. Bouvier, Nicole M, and Peter Palese. “The biology of influenza viruses. ” Vaccine vol. 26 Suppl 4, Suppl 4 (2008) : D49-53. doi: 10. 1016/j. vaccine. 2008. 07. 039
2. Hause, Ben M et al. “Isolation of a novel swine influenza virus from Oklahoma in 2011 which is distantly related to human influenza C viruses. ” PLoS pathogens vol. 9, 2 (2013) : e1003176. doi: 10. 1371/journal. ppat. 1003176
3. Sharabi, Sivan et al. “Epidemiological and Virological Characterization of Influenza B Virus Infections. ” PloS one vol. 11, 8 e0161195. 17 Aug. 2016, doi: 10. 1371/journal. pone. 0161195
4. Verma, Ramesh et al. “Influenza vaccine: an effective preventive vaccine for developing countries. ” Human vaccines&immunotherapeutics vol. 8, 5 (2012) : 675-8. doi: 10. 4161/hv. 19516
5. Centers for Disease Control and Prevention, National Center for Immunization and Respiratory Diseases (NCIRD) , Influenza Type A Viruses. 2017. https: //www. cdc. gov/flu/avianflu/influenza‐a‐virussubtypes. htm. Accessed April 19, 2017.
6. Tong, Suxiang et al. “New world bats harbor diverse influenza A viruses. ” PLoS pathogens vol. 9, 10 (2013) : e1003657. doi: 10. 1371/journal. ppat. 1003657
7. Petrova, Velislava N, and Colin A Russell. “The evolution of seasonal influenza viruses. ” Nature reviews. Microbiology vol. 16, 1 (2018) : 47-60. doi: 10.1038/nrmicro. 2017. 118
8. Organization WH. WHO Fact sheet 211: Influenza. 2009. http: //www. who. int/mediacentre/factsheets/fs211/en/index. html.
9. Preaud, Emmanuelle et al. “Annual public health and economic benefits of seasonal influenza vaccination: a European estimate. ” BMC public health vol. 14 813. 7 Aug. 2014, doi: 10. 1186/1471-2458-14-813
10. Centers for Disease Control and Prevention (CDC) . “Estimates of deaths associated with seasonal influenza---United States, 1976-2007. ” MMWR. Morbidity and mortality weekly report vol. 59, 33 (2010) : 1057-62.
11. Chunara, Rumi et al. “Estimating influenza attack rates in the United States using a participatory cohort. ” Scientific reports vol. 5 9540. 2 Apr. 2015, doi: 10.1038/srep09540
12. Palese, Peter. “Influenza: old and new threats. ” Nature medicine vol. 10, 12 Suppl (2004) :S82-7. doi: 10. 1038/nm1141
13. Krammer, Florian. “Emerging influenza viruses and the prospect of a universal influenza virus vaccine. ” Biotechnologyjournal vol. 10, 5 (2015) : 690-701. doi: 10. 1002/biot. 201400393
14. Onions, David et al. “Validation of the safety of MDCK cells as a substrate for the production of a cell-derived influenza vaccine. ” Biologicals: journal of the International Association of Biological Standardization vol. 38, 5 (2010) : 544-51. doi: 10. 1016/j. biologicals. 2010. 04. 003
15. Webster, R G et al. “Evolution and ecology of influenza A viruses. ” Microbiological reviews vol. 56, 1 (1992) : 152-79. doi: 10. 1128/mr. 56. 1. 152-179. 1992
16. Barberis, I et al. “History and evolution of influenza control through vaccination: from the first monovalent vaccine to universal vaccines. ” Journal of preventive medicine and hygiene vol. 57, 3 (2016) : E115-E120.

Claims (52)

  1. A set of at least four non-naturally occurring nucleic acids, comprising:
    (1) a first non-naturally occurring nucleic acid molecule comprising a first coding nucleotide sequence encoding a first HA protein of an influenza virus of A/H1N1, or an immunogenic fragment thereof;
    (2) a second non-naturally occurring nucleic acid molecule comprising a second coding nucleotide sequence encoding a second HA protein of an influenza virus of A/H3N2, or an immunogenic fragment thereof;
    (3) a third non-naturally occurring nucleic acid molecule comprising a third coding nucleotide sequence encoding a third HA protein of an influenza virus of B/Victoria, or an immunogenic fragment thereof; and
    (4) a fourth non-naturally occurring nucleic acid molecule comprising a fourth coding nucleotide sequence encoding a fourth HA protein of an influenza virus of B/Yamagata, or an immunogenic fragment thereof.
  2. The set of at least four non-naturally occurring nucleic acids of claim 1, wherein
    (1) the first HA protein consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 1; and/or
    (2) the second HA protein consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 2 or 64; and/or
    (3) the third HA protein consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 3 or 65; and/or
    (4) the fourth HA protein consists of, essentially consists of or comprises an amino acid sequence having at least about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the amino acid sequence set forth in SEQ ID NO: 4.
  3. The set of at least four non-naturally occurring nucleic acids of claim 2, wherein
    (1) the first coding nucleotide sequence consists of, essentially consists of or comprises a  nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 5; and/or
    (2) the second coding nucleotide sequence consists of, essentially consists of or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 6 or 66; and/or
    (3) the third coding nucleotide sequence consists of, essentially consists of or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 7 or 67; and/or
    (4) the fourth coding nucleotide sequence consists of, essentially consists of or comprises a nucleotide sequence having at least about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%sequence identity to the nucleotide sequence set forth in SEQ ID NO: 8.
  4. The set of at least four non-naturally occurring nucleic acids of claim 1, wherein the coding nucleotide sequences have been codon optimized for expression in cells of a subject.
  5. The set of at least four non-naturally occurring nucleic acids of claim 4, wherein the subject is a non-human mammal or a human.
  6. The set of at least four non-naturally occurring nucleic acids of any one of claims 1 to 5, wherein one, two, three or fourth of the HA proteins or immunogenic fragments are fused to the native signal peptide.
  7. The set of at least four non-naturally occurring nucleic acids of any one of claims 1 to 6, wherein one, two, three or fourth of the HA proteins or immunogenic fragments are independently fused to a heterologous polypeptide.
  8. The set of at least four non-naturally occurring nucleic acids of claim 7, wherein the heterologous polypeptide is selected from a Fc region of human immunoglobulin, a signal peptide, and a peptide facilitating multimerization of the fusion protein.
  9. The set of at least four non-naturally occurring nucleic acids of claim 8, wherein the signal peptide is a signal peptide from IgE or tPA.
  10. The set of at least four non-naturally occurring nucleic acids of any one of claims 1 to 9 each further comprising a 5’ untranslated region (5’-UTR) , wherein the 5’-UTR comprises the sequence set forth in any one of SEQ ID NOS: 19-26 independently.
  11. The set of at least four non-naturally occurring nucleic acids of any one of claims 1 to 10 each further comprising a 3’ untranslated region (3’-UTR) , wherein the 3’-UTR comprises the sequence set forth in any one of SEQ ID NOS: 27-36 independently.
  12. The set of at least four non-naturally occurring nucleic acids of claim 11, wherein the 3’-UTR further comprises a poly-A tail or a polyadenylation signal.
  13. The set of at least four non-naturally occurring nucleic acids of any one of claims 1 to 12, each comprising one or more functional nucleotide analogs that are selected from pseudouridine, 1-methyl-pseudouridine and 5-methylcytosine independently.
  14. The set of at least four non-naturally occurring nucleic acids of any one of claims 1 to 13, wherein the nucleic acid is DNA or mRNA.
  15. A vector comprising the set of at least four non-naturally occurring nucleic acids of any one of claims 1 to 14.
  16. A cell comprising the set of at least four non-naturally occurring nucleic acids of any one of claims 1 to 14.
  17. A cell comprising the vector of claim 16.
  18. A set of at least four vectors comprising:
    (1) a first vector comprising the first non-naturally occurring nucleic acid,
    (2) a second vector comprising the second non-naturally occurring nucleic acid,
    (3) a third vector comprising the third non-naturally occurring nucleic acid, and
    (4) a fourth vector comprising the fourth non-naturally occurring nucleic acid of the set of at least four non-naturally occurring nucleic acids of any one of claims 1 to 14.
  19. A set of at least four cells comprising:
    (1) a first cell comprising the first non-naturally occurring nucleic acid,
    (2) a second cell comprising the second non-naturally occurring nucleic acid,
    (3) a third cell comprising the third non-naturally occurring nucleic acid, and
    (4) a fourth cell comprising the fourth non-naturally occurring nucleic acid of the set of at least four non-naturally occurring nucleic acids of any one of claims 1 to 14.
  20. A set of at least four cells comprising:
    (1) a first cell comprising the first vector,
    (2) a second cell comprising the second vector,
    (3) a third cell comprising the third vector, and
    (4) a fourth cell comprising the fourth vector
    of the set of at least four vectors of claim 18.
  21. A cell comprising the set of at least four vectors of claim 18.
  22. A composition comprising the set of at least four non-naturally occurring nucleic acids of any one of claims 1 to 14 and at least a first lipid.
  23. The composition of claim 22, wherein the first lipid is a compound according to Formula (01-I) or (01-II) ; or a compound listed in Table 6; or a compound according to Formula (03-I) ; or a compound listed in Table 7; or a compound according to Formula (04-I) ; or a compound listed in Table 8.
  24. The composition of claim 22 or 23 further comprising a second lipid.
  25. The composition any one of claims 22 to 24 formulated as lipid nanoparticles encapsulating the nucleic acid in a lipid shell.
  26. The composition of any one of claims 22 to 25, wherein the composition is a pharmaceutical composition.
  27. The composition of any one of claims 22 to 25, wherein the composition is a vaccine.
  28. A method for managing, preventing or treating a disease or disorder caused by influenza viruses or by infection with influenza viruses in a subject, comprising administering to the subject a therapeutically effective amount of the set of at least four non-naturally occurring nucleic acids of any one of claims 1 to 14, or the composition of any one of claims 22 to 27.
  29. The method of claim 28, wherein the subject is a human or a non-human mammal.
  30. The method of claim 29, wherein the subject is a human adult, a human child or a human toddler.
  31. The method of any one of claims 28 to 30, wherein the subject has the disease or disorder.
  32. The method of any one of claims 28 to 30, wherein the subject is at risk of, or is susceptible to, infection by influenza viruses.
  33. The method of claim 32, wherein the subject is an elderly human.
  34. The method of any one of claims 28 to 31, wherein the subject has been diagnosed positive for infection by influenza viruses.
  35. The method of any one of claims 28 to 34, wherein the subject is asymptomatic.
  36. The method of any one of claims 28 to 35, wherein method comprises administering lipid nanoparticles encapsulating the nucleic acids to the subject, and wherein the lipid nanoparticles are endocytosed by the cells in the subject.
  37. The method of any one of claims 28 to 36, wherein the nucleic acids are expressed by the cells in the subject.
  38. The method of any one of claims 28 to 37, wherein an immune response against the influenza viruses is elicited in the subject.
  39. The method of claim 38, wherein the immune response comprises production of cytokine in lymphocytes.
  40. The method of claim 38, wherein the immune response comprises increased proportion of cytokine-expressing lymphocytes.
  41. The method of claim 40, wherein the lymphocytes are CD4 +T cells and/or CD8 +T cells and/or splenocytes.
  42. The method of claim 40, wherein the cytokine is one or more of IFN-γ, TNF-α, IL-2, and IL-4.
  43. The method of claim 40, wherein the production of cytokine in lymphocytes is increased.
  44. The method of claim 38, wherein the immune response comprises production of antibodies specifically binds to the viral HA proteins encoded by the nucleic acids.
  45. The method of claim 44, wherein the antibodies are neutralizing antibodies against influenza viruses or cells infected by influenza viruses.
  46. The method of claim 44 or 45, wherein the serum titer of the antibodies are increased in the subject.
  47. The method of claim 44 or 45, wherein the antibodies bind to a viral particle or an infected cell and mark the viral particle of infected cell for destruction by the immune system of the subject.
  48. The method of claim 44 or 45, wherein endocytosis of viral particles bound by the antibodies is induced or enhanced.
  49. The method of claim 44 or 45, wherein antibody-dependent cell-mediated cytotoxicity (ADCC) against infected cells in the subject is induced or enhanced.
  50. The method of any one of claims 44 to 47, wherein antibody-dependent cellular phagocytosis (ADCP) against infected cells in the subject is induced or enhanced.
  51. The method of any one of claims 44 to 50, wherein complement dependent cytotoxicity (CDC) against infected cells in the subject is induced or enhanced.
  52. The method of any one of claims 28 to 51, wherein the disease or disorder caused by influenza viruses is flu.
PCT/CN2022/143721 2021-12-31 2022-12-30 Quadrivalent mrna vaccines for influenza viruses WO2023125889A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202280007166.9A CN116670267A (en) 2021-12-31 2022-12-30 Tetravalent mRNA vaccine for influenza virus

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CNPCT/CN2021/143599 2021-12-31
CN2021143599 2021-12-31

Publications (1)

Publication Number Publication Date
WO2023125889A1 true WO2023125889A1 (en) 2023-07-06

Family

ID=86998103

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CN2022/143721 WO2023125889A1 (en) 2021-12-31 2022-12-30 Quadrivalent mrna vaccines for influenza viruses

Country Status (2)

Country Link
CN (1) CN116670267A (en)
WO (1) WO2023125889A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023164556A3 (en) * 2022-02-23 2023-10-05 Wisconsin Alumni Research Foundation Broadly protective influenza b virus vaccines

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2017191258A1 (en) * 2016-05-04 2017-11-09 Curevac Ag Influenza mrna vaccines
CN109310751A (en) * 2015-10-22 2019-02-05 摩登纳特斯有限公司 Wide spectrum influenza virus vaccine
CN112955176A (en) * 2018-07-13 2021-06-11 乔治亚大学研究基金会 Broadly reactive immunogens to H3 influenza virus, compositions and methods of use thereof

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109310751A (en) * 2015-10-22 2019-02-05 摩登纳特斯有限公司 Wide spectrum influenza virus vaccine
WO2017191258A1 (en) * 2016-05-04 2017-11-09 Curevac Ag Influenza mrna vaccines
CN112955176A (en) * 2018-07-13 2021-06-11 乔治亚大学研究基金会 Broadly reactive immunogens to H3 influenza virus, compositions and methods of use thereof

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
CHEN,Y.F. ET AL.: "Construction of multiple epitope rFPV against H3, H5, H7, H9 Subtype influenza A Vinus", IMMUNOLOGICAL JOURNAL, vol. 23, no. 05, 30 December 2007 (2007-12-30) *
JIA,L.L. ET AL.: "Construction and immunogenicity of multi-epitopes recombinants", JOURNAL OF GUANGXI AGRIC．AND BIOL．SCIENCE, vol. 25, no. S1, 30 September 2006 (2006-09-30) *
LI, Q.X. ET AL.: "Progress on Research of Multivalent Avian Influenza Epitopes vaccine", POULTRY SCIENCE, no. 05, 10 May 2013 (2013-05-10) *
YAN-YANG TAO, JING-XIN LI, YUE-MEI HU, YUAN-SHENG HU, GANG ZENG & FENG-CAI ZHU: "Quadrivalent influenza vaccine (Sinovac Biotech) for seasonal influenza prophylaxis", EXPERT REVIEW OF VACCINES, FUTURE DRUGS, LONDON, GB, vol. 20, no. 1, 1 February 2021 (2021-02-01), GB , pages 1 - 11, XP009547833, ISSN: 1476-0584, DOI: 10.1080/14760584.2021.1875823 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023164556A3 (en) * 2022-02-23 2023-10-05 Wisconsin Alumni Research Foundation Broadly protective influenza b virus vaccines

Also Published As

Publication number Publication date
CN116670267A (en) 2023-08-29

Similar Documents

Publication Publication Date Title
WO2021204179A1 (en) Nucleic acid vaccines for coronavirus
WO2022152109A2 (en) Lipid compounds and lipid nanoparticle compositions
US20230053437A1 (en) Lipid compounds and lipid nanoparticle compositions
WO2022152141A2 (en) Polymer conjugated lipid compounds and lipid nanoparticle compositions
WO2023125889A1 (en) Quadrivalent mrna vaccines for influenza viruses
WO2023151570A1 (en) Nucleic acid vaccines for rabies
WO2023098842A1 (en) NUCLEIC ACID VACCINES FOR CORONAVIRUS BASED ON SEQUENCES DERIVED FROM SARS-CoV-2 OMICRON STRAIN
WO2023056911A1 (en) MULTIVALENT NUCLEIC ACID VACCINES FOR CORONAVIRUS BASED ON SEQUENCES DERIVED FROM SARS-CoV-2 BETA AND DELTA STRAINS
AU2022207550A1 (en) Lipid compounds and lipid nanoparticle compositions
WO2023056915A1 (en) Polynucleotides encoding interleukin-12 (il-12) and related composition and methods thereof
WO2023056917A1 (en) Lipid compounds and lipid nanoparticle compositions
WO2023138611A1 (en) Lipid compounds and lipid nanoparticle compositions
WO2022247755A1 (en) Lipid compounds and lipid nanoparticle compositions
WO2023056913A1 (en) NUCLEIC ACID VACCINES FOR CORONAVIRUS BASED ON SEQUENCES DERIVED FROM SARS-CoV-2 DELTA STRAIN
WO2023056912A1 (en) Nucleic acid vaccines for vzv
WO2024067861A1 (en) MULTIVALENT NUCLEIC ACID VACCINES FOR CORONAVIRUS BASED ON SEQUENCES DERIVED FROM SARS-CoV-2 DELTA AND OMICRON STRAINS
WO2023006062A1 (en) Nucleic acid vaccines for mutant coronavirus
EP4162950A1 (en) Nucleic acid vaccines for coronavirus
WO2024037578A1 (en) Composition of lipid nanoparticles
WO2024037577A1 (en) Composition of lipid nanoparticles
EP4164753A1 (en) Lipid compounds and lipid nanoparticle compositions
WO2023096963A1 (en) Varicella-zoster virus immunogen compositions and their uses

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 202280007166.9

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22915138

Country of ref document: EP

Kind code of ref document: A1