WO2023113109A1 - 상하부 구조의 이중 웰을 이용한 지방 유래 줄기세포의 분리 방법 - Google Patents

상하부 구조의 이중 웰을 이용한 지방 유래 줄기세포의 분리 방법 Download PDF

Info

Publication number
WO2023113109A1
WO2023113109A1 PCT/KR2022/004901 KR2022004901W WO2023113109A1 WO 2023113109 A1 WO2023113109 A1 WO 2023113109A1 KR 2022004901 W KR2022004901 W KR 2022004901W WO 2023113109 A1 WO2023113109 A1 WO 2023113109A1
Authority
WO
WIPO (PCT)
Prior art keywords
medium
well
stem cells
adipose tissue
adipose
Prior art date
Application number
PCT/KR2022/004901
Other languages
English (en)
French (fr)
Inventor
심태진
김지훈
홍인기
김종필
이경민
정정일
김문정
Original Assignee
주식회사 프롬바이오
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 주식회사 프롬바이오 filed Critical 주식회사 프롬바이오
Publication of WO2023113109A1 publication Critical patent/WO2023113109A1/ko

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12M—APPARATUS FOR ENZYMOLOGY OR MICROBIOLOGY; APPARATUS FOR CULTURING MICROORGANISMS FOR PRODUCING BIOMASS, FOR GROWING CELLS OR FOR OBTAINING FERMENTATION OR METABOLIC PRODUCTS, i.e. BIOREACTORS OR FERMENTERS
    • C12M1/00—Apparatus for enzymology or microbiology
    • C12M1/12—Apparatus for enzymology or microbiology with sterilisation, filtration or dialysis means
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues

Definitions

  • the present invention relates to a method for isolating adipose-derived stem cells using a double well having an upper and lower structure.
  • Stem cells are progenitor cells that have the ability to self-replicate and differentiate into various tissues by specific signals. They form organs of the human body from the developmental stage and are important for restoring the functions of organs and tissues after growth. play a role Stem cells can be largely divided into two types of stem cells: embryonic stem cells obtained from blastocysts in the early stage of development and adult stem cells obtained from adults or placentas after development has completed. (J Tissue Eng Regen Med. 2008;2(4):169-83).
  • Embryonic stem cells have excellent self-proliferation ability in an undifferentiated state, but have the potential to differentiate into all tissues, so when transplanted in vivo, unnecessary cell proliferation and cancer risk should be considered.
  • embryonic stem cells since the use of embryonic stem cells has many ethical problems in terms of using living organisms, there are many restrictions on their practical use (Stem Cell Research 2009;2(3):198-210).
  • adult stem cells have the specificity to differentiate according to the characteristics of the transplanted organ after being transplanted into the body, the flexibility to cross-differentiate into different types of cells from the original cell characteristics, and the multi-potential to differentiate into various cells. As it has been revealed that there is also sex, the possibility of cell therapy using adult stem cells is increasing.
  • Adipose tissue which occupies a significant portion of our body, consists of the stromal vascular fraction (SVF), which consists of many microvascular endothelial cells, endothelial cells, fibroblasts, muscle cells, and pre-adipocytes, in addition to fat cells. It was confirmed that stem cell-like cells exist in SVF, and that these cells are stem cells having multiple differentiation potential (Tissue Eng 2001;7:211-228; J Cell Physiol 2001;189:54-63).
  • SVF stromal vascular fraction
  • ADSCs Adipose-derived stem cells
  • Adipose tissue can be easily obtained by liposuction from recent obese patients, and liposuction, which is generally performed in clinical practice, can obtain hundreds of milliliters to thousands of milliliters at once.
  • adipose tissue obtained by liposuction or resected adipose tissue was discarded, but recently, it is used for autologous fat transplantation or used by stem cell researchers to obtain ADSCs.
  • Enzymatic isolation methods and non-enzymatic isolation methods are known to isolate stem cells from liposuction or resected adipose tissue (Aronowitz et al. SpringerPlus (2015) 4:713 ;Scientific Report, 2017, 7:10015).
  • adipose tissue or lipoaspirate is generally washed with an aqueous salt solution and treated with an enzyme such as collagenase that decomposes the extracellular matrix (ECM). After centrifugation, the upper adipose tissue, oil layer, and aqueous solution layer are discarded, and the precipitated cell layer (pellet layer) at the bottom is recovered. It is known that such an enzymatic method is expensive and has a risk of changing the characteristics of stem cells or mixing of foreign components during the enzymatic treatment process (J Vis Exp. 2019 Dec; 16(154): e59419).
  • the non-enzymatic separation method is a method of separating the cell layer from adipose tissue using shear force, centrifugal force, radiation force, and pressure instead of enzymatic digestion (Cell Regeneration (2015) 4:7) am.
  • the cell layer thus separated is called the stromal vascular fraction, which contains ADSCs (Tissue Eng 2001; 7:211-228; J Cell Physiol 2001; 189:54-63; Methods Mol Biol 2006; 325: 35-46), in order to isolate pure ADSCs, subculture is used, or antibodies that can specifically bind to proteins (antigens) present on the cell membrane surface of ADSCs and flow cytometry are used.
  • ADSCs tissue Eng 2001; 7:211-228; J Cell Physiol 2001; 189:54-63; Methods Mol Biol 2006; 325: 35-46
  • the present invention discloses a method for separating adipose-derived stem cells using double wells with upper and lower structures.
  • An object of the present invention is to provide a method for isolating adipose-derived stem cells using double wells of upper and lower structures.
  • the present invention puts the cut adipose tissue in the upper well of the double well of the upper and lower structures (the upper well is a well whose bottom surface is composed of a microporous membrane and allows cells to permeate)
  • the upper well is a well whose bottom surface is composed of a microporous membrane and allows cells to permeate
  • stem cells migrate from the adipose tissue of the upper well to the lower well and are separated.
  • the separated stem cells are separated by the enzymatic separation method of Zuk et al. Dec; 13(12): 4279-4295) or Sherman et al.'s non-enzymatic separation method (J Vis Exp.
  • the method of separating adipose-derived stem cells using the double wells of the upper and lower structures of the present invention includes: (a) placing microscopic pieces of adipose tissue on the upper wells of the double wells of the upper and lower structures, and cell cells in the upper and lower wells; and (b) recovering cells that have migrated to the lower well.
  • the double well of the upper and lower structures is composed of an upper well and a lower well, as shown in FIG. 1, and the upper well is configured to have a smaller diameter than the lower well and can be inserted into the lower well, and the upper end Since a rib is integrally formed around it, it can be detachably placed on top of the lower well.
  • the bottom surface of the upper well is made of a microporous membrane, cells can pass through the micropore and move to the lower well.
  • the micropores have a size through which adipose stem cells can pass, and the size of these micropores will generally be in the range of 3 ⁇ m to 50 ⁇ m, particularly 6 ⁇ m to 30 ⁇ m, based on the diameter.
  • the microporous membrane may be hydrophobic or hydrophilic, but is preferably made of a material that does not have a property of binding to stem cells and does not affect the differentiation or proliferative capacity of stem cells.
  • examples of such materials include alginate (ALG), carboxymethyl cellulose (CMC), viscose (VIS), silk, collagen, nanofibrillated cellulose (NFC), chitosan with derivatives (CHI), cellulose, polycarbonate, Polyester, polytetrafluoroethylene, polycaprolactone (PCL), polyethylene terephthalate (PET), polybutylene terephthalate (PBT), polypropylene (PP), polyhydroxyethyl methacrylate Latex (PHEMA), poly(N-(2-hydroxypropyl)methacrylamide) (PHPMA), polyvinyl alcohol (PVA), polyethylene oxide (PEOX), polyamidoamine (PAMAM), polyethyleneimine (PEI), etc. and may be preferably polycarbonate, polyethylene
  • the lower well may be configured in the form of a dish having a single well or may be configured in the form of a well plate having multiple wells.
  • the lower well When the lower well is configured in the form of a well plate, it may be in the form of a 6-well plate, a 12-well plate, a 24-well plate, or the like.
  • the double well of the upper and lower structures used in the present invention may be directly manufactured and used, but it may be preferable to purchase and use a commercially available product.
  • Such products include, for example, Corning Incorporated's Transwell® Permeable Supports product or SPL's SPLInsertTM product.
  • a certain period of time for example, 1 day or more or 2 days or more, particularly 5 It can be left alone for days or six or seven days or more.
  • the adipose tissue used for isolating adipose stem cells may be adipose tissue of any mammal including humans, preferably human, mouse, rat, rabbit, monkey, pig, horse, cow, sheep, It may be antelope, dog or cat adipose tissue, more preferably human, mouse, rat or monkey adipose tissue, and most preferably human adipose tissue.
  • adipose tissue can be obtained from subcutaneous fat tissue or visceral fat tissue, which is adipose tissue around organs, and can also be obtained from brown adipose tissue or white adipose tissue. .
  • the adipose tissue micro-slices with a particle diameter of 1 mm or less using an arbitrary instrument such as tweezers and medical scissors. Since the separation efficiency of stem cells will be improved so that the particle diameter of the microspheres can be reduced, it may be desirable to reduce the particle diameter of the microspheres as small as possible.
  • cell culture medium is added to the upper and lower wells to induce the migration of stem cells.
  • the cell culture medium is sufficient to cover the adipose tissue microscopic pieces in the upper wells and to the bottom of the upper wells in the lower wells. Filling above face height may be desirable.
  • This cell culture medium comprises sugars and amino acids, in particular essential amino acids, and also comprises vitamins.
  • Saccharides are preferably monosaccharides and disaccharides as the main energy source. Specifically, glucose, fructose, mannose, galactose, ribose, sorbose, ribulose, lactose, maltose, sucrose, raffinose, or a mixture of one or more thereof may be used.
  • L-glutamine provides nitrogen to NAD, NADPH, and nucleotides and serves as a secondary energy source for metabolism. Since L-glutamine is an amino acid in an unstable state and is converted over time into a form that cannot be used by cells, it may be desirable to add it to the medium immediately before use.
  • the cell culture medium of the present invention may contain vitamins such as vitamin A, vitamin B group, vitamin C, and vitamin E. Many vitamins are essential for the growth and proliferation of cells and cannot be synthesized in sufficient quantities in cells, so they need to be sufficiently supplemented in the cell culture medium.
  • B vitamins such as thiamine, riboflavin, pyridoxine, cyanocobalamin, biotin, folic acid, pantothenic acid, and nicotinamide are preferably added to promote cell growth.
  • the cell culture medium in addition to sugars, amino acids, and vitamins, albumin, which plays a role in transporting between tissues and cells by binding to salt, free fatty acids, hormones, and vitamins, or iron transport and cell adhesion, which plays an important role in Proteins such as fibronectin, serine protease inhibitor aprotinin, and fetuin may be further included.
  • the cell culture medium contains, in addition to sugars, amino acids and vitamins, sodium chloride, potassium chloride, calcium chloride, magnesium sulfate, which help to maintain osmotic balance and regulate membrane potential by providing sodium, potassium and calcium ions
  • Inorganic salts such as sodium dihydrogen phosphate may be further included.
  • the cell culture medium may contain trace elements such as copper, zinc, selenium, and tricarboxylic acid intermediates for proper cell growth and enzyme function maintenance in addition to sugars, amino acids, and vitamins.
  • the cell culture medium contains citrate, phosphate, succinate, tartrate, fumarate, gluconate, oxalate, lactate, acetate, BES (N, N-bis (2-hydroxyethyl) -2-aminoethanesulfonic buffers such as HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), trisine ((N-[tris(hydroxymethyl)methyl]glycine)), fatty acids such as oleic acid, arachidonic acid, and linoleic acid, Lipids such as cholesterol, antibiotics such as amphotericin B, kanamycin, gentamicin, streptomycin, penicillin, type 1 or type 2 collagen, fibronectin, laminin, poly-L-lysine, poly-D-lysine Such as cell adhesion factor, fibroblast growth factor (FGF), hepatocyte growth factor (HGF), transforming growth factor-
  • BES N-bis
  • the cell culture medium may be used by containing human-derived or animal-derived serum as a substitute for sugars, amino acids, proteins, lipids, growth factors, hormones, trace elements, etc. or supplementary to these components. Since there is a possibility that unknown factors, prions, viruses, etc. may be included, it may be desirable not to use it if possible.
  • the cell culture medium as described above may be directly prepared and used, or a commercially available one may be used.
  • Commercially available media such as DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10, F-12, DMEM/F12, MEM- ⁇ (Minimal Essential Medium- ⁇ ), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), MacCoy's 5A badge, AmnioMax complete badge, AminoMaxII complete badge, EBM (Endothelial Basal Medium) badge, Chang's Medium, MesenCult-XF , DMEM / HG (Dulbecco's Modified Eagle's Medium high glucose) medium, MCDB + DMEM / LG (MCDB + Dulbecco's Modified Eagle's Medium low glucose) medium, etc.,
  • the cell culture medium may contain a cryopreservative such as glycerol, keratin or gelatin hydrolysate, acetamide, DMSO, ethylene glycol, propylene glycol, polyethylene glycol, sericin, It may include isomaltooligosaccharide and the like, and may also include a chelating agent such as EDTA, EGTA, citric acid, and salicylate, or may further include a solubilizing agent, a preservative, an antioxidant, and the like.
  • a cryopreservative such as glycerol, keratin or gelatin hydrolysate, acetamide, DMSO, ethylene glycol, propylene glycol, polyethylene glycol, sericin, It may include isomaltooligosaccharide and the like, and may also include a chelating agent such as EDTA, EGTA, citric acid, and salicylate, or may further include a solubilizing agent, a preservative
  • the stem cells isolated in the lower well may be transferred to another dish and preserved using the above-described cell culture medium and/or cryopreservation agent.
  • the buffer solution is a saline solution containing citrate, phosphate, succinate, tartrate, fumarate, gluconate, oxalate, lactate, acetate, etc. as a buffer or Phosphate Buffered Saline (PBS). ), HEPES Buffered Saline, and the like.
  • the isotonic solution contains sodium chloride, potassium chloride, boric acid, sodium borate, mannitol, glycerin, propylene glycol, polyethylene, glycol, maltose, sucrose, erythritol, arabitol, xylitol, sorbitol trihalose, glucose, etc. as an isotonic agent.
  • Ringer's solution, lactated Ringer's solution, acetic acid Ringer's solution, bicarbonated Ringer's solution may be a 5% aqueous glucose solution.
  • preservation is for maintaining the cell state for a short period of time, and may be performed for 24 to 72 hours at around 4 ° C.
  • a method known in the art is performed in the temperature range of -150 ° C to -196 ° C. It can be done by cryopreservation for more than 6 months or more than 1 year depending on the method.
  • the method of the present invention is a method for separating adipose-derived stem cells by a non-enzymatic method, and has an effect of overcoming the disadvantages of the enzymatic separation method such as high cost, change in stem cell characteristics, and incorporation of foreign components.
  • FIG. 1 is a photograph of a commercially available double well of upper and lower structures used for isolating adipose-derived stem cells of the present invention.
  • ADSC adipose-derived stem cells
  • Figure 3 is a photograph observed by separating adipose-derived stem cells from adipose tissue according to each separation method and culturing them in a culture dish.
  • Figure 4 is a graph measuring the growth rate of adipose-derived stem cells obtained according to each separation method from adipose tissue.
  • Human adipose tissue used in this example was purchased from Goma Biotech Co., Ltd. (Seoul, Korea).
  • An enzyme (collagenase) to be used for separating stem cells was purchased from Sigma-Aldrich and used.
  • the method of isolating stem cells from adipose tissue using enzymes the method of Zuk et al. (Mol Biol Cell. 2002 Dec; 13(12): 4279-4295) was used with reference and modification. This method is a method in which only adipose-derived stem cells can be isolated by cutting adipose tissue into small pieces, mixing them with an enzyme (collagenase), and then culturing them. is done).
  • the method of isolating stem cells directly from adipose tissue was used by referring to and modifying the method of Sherman et al. (J Vis Exp. 2019 Dec; 16(154): e59419).
  • This method is a method in which only stem cells can be attached to a culture dish and separated and cultured by cutting adipose tissue into small pieces and placing them on a culture medium (the adipose-derived stem cells obtained by this method are indicated as "Naive" in the accompanying drawings) .
  • Isolation of stem cells using the upper and lower double wells was performed by using the SPLInsertTM product (6 Inserts/6 well Plate, Catalog # 37206) from SPL life sciences as the upper and lower double wells.
  • the microporous membrane on the bottom of the upper well is made of polyethylene terephthalate, and the micropore size is 8 ⁇ m.
  • adipose tissue microslices cut to a particle diameter of about 1 mm or less are placed, and DMEM medium is added to the upper and lower wells (the upper wells will cover the adipose tissue microslices).
  • DMEM medium was put in the lower well, and DMEM medium was put in the lower well at least at the height of the bottom of the upper well) and left for one week to induce the adipose tissue-derived stem cells to migrate to the lower well (the adipose-derived stem cells obtained by this method are shown in the accompanying drawings). marked "Transwell” in ).
  • FIG. 2 A photograph showing the separation process according to each separation method is shown in FIG. 2 .
  • CCK-8 a reagent used in the test, was purchased from Dongin Biotech Co., Ltd. (Seoul, Korea) and used, and adipose-derived stem cells were used for each method isolated in Example 1 above.
  • Adipose-derived stem cells were treated in 6 folds of 100 ul each at a concentration of 1 ⁇ 10 4 cells/well in 96-well plates and then cultured for up to 72 hours. After culturing for 3 hours under the conditions of 10 ul of CCK-8 reagent and 100 ul of adipose-derived stem cell culture medium at designated times (24, 48, 72 hours), absorbance was measured with a spectrophotometer at 540 nm. .
  • FIG. 4 As a result, as shown in FIG. 4 , when stem cells were separated from adipose tissue using double wells, it was confirmed that the proliferation rate was higher than the method using enzymes or the method of separating stem cells directly from adipose tissue. Therefore, it was found that when stem cells are separated from adipose tissue using double wells, more stable adipose-derived stem cells can be isolated and obtained.
  • A is the result of stem cells of Passage # 3 according to each separation method
  • B is the result of stem cells of Passage # 5 according to each separation method.
  • Adipose-derived stem cells according to the isolation method are inoculated into 6-well plates at a concentration of 1 ⁇ 10 5 cells/well by 1 ml, cultured for a specified period of time (24, 48, 72 hours), and then the attached cells are treated with Trizol Reagent ( Total RNA was isolated using Invitrogen). Next, cDNA was synthesized from 1 ⁇ g total RNA using SuperscriptII reverse transcriptase (Invitrogen) and oligo dT. Real-time PCR was performed by the SYBR green method using the synthesized cDNA and the primers of the adipose-derived stem cell-specific marker genes in Table 1 below.
  • SYBR Green I is an interchelator that exhibits fluorescence by binding to double-stranded DNA.
  • the interchelator binds to the double-stranded DNA synthesized by the PCR reaction and emits fluorescence, and the amount of amplification product can be measured by detecting the fluorescence intensity.
  • Primer sequences of marker genes specific for adipose-derived stem cells primer order sequence number CD73-Forward AAGTGTCGAGTGCCCCAGTTA One CD73-Reverse TGATCCGACCTTCAACTGCT 2 CD90-Forward AGTACGAGTTCAGCCTGACC 3 CD90-Reverse TCTGAGCACTGTGACGTTCT 4 CD105-Forward TCCATTGTGACCTTCAGCCT 5 CD105-Reverse CTTGGATGCCTGGAGAGTCA 6
  • the expression level of the stem cell pluripotency marker gene was examined in the same manner.

Landscapes

  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Sustainable Development (AREA)
  • Cell Biology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Immunology (AREA)
  • Developmental Biology & Embryology (AREA)
  • Rheumatology (AREA)

Abstract

본 발명은 상하부 구조의 이중 웰을 이용한 지방 유래 줄기세포의 분리 방법을 개시한다. 본 발명의 방법은 비효소적 방법에 의하여 지방 유래 줄기세포를 분리하는 방법으로서, 고비용, 줄기세포의 특성 변화, 왜래 성분의 혼입 등의 효소적 분리 방법이 가지는 단점을 극복할 수 있는 효과를 가질 수 있다.

Description

상하부 구조의 이중 웰을 이용한 지방 유래 줄기세포의 분리 방법
본 발명은 상하부 구조의 이중 웰을 이용한 지방 유래 줄기세포의 분리 방법에 관한 것이다.
줄기세포(stem cell)는 특정 신호에 의한 자기 복제 및 다양한 조직으로 분화할 수 있는 능력을 가진 전구세포로서 발생 단계에서부터 인체의 장기를 형성하고, 성장 후에는 장기 및 조직의 기능을 복원하는 데 중요한 역할을 한다. 줄기세포는 크게 두 가지 줄기세포로 나누어질 수 있으며, 발생 초기 배반포(blastocyst)에서 얻어지는 배아줄기세포(embryonic stem cell)와 발생과정이 끝난 성체 또는 태반에서 얻어지는 성체줄기세포(adult stem cell)가 있다(J Tissue Eng Regen Med. 2008;2(4):169-83).
이 두 가지 줄기세포는 서로 다른 특징을 가지고 있으며, 배아줄기세포는 미분화 상태에서 뛰어난 자가 증식 능력을 가지고 있지만 모든 조직으로 분화할 수 있는 잠재성을 가지고 있기 때문에 생체 내 이식을 한 경우 불필요한 세포의 증식과 암 발생의 가능성을 고려해야 한다. 또한 배아줄기세포의 이용은 생명체를 이용한다는 점에서 많은 윤리적인 문제를 안고 있기 때문에 실질적으로 사용하는 데 많은 제한이 따른다(Stem Cell Research 2009;2(3):198-210).
반면, 성체줄기세포는 생체 내에 이식된 후 이식된 장기의 특성에 맞게 분화하는 특이성과 본래 세포 특성과 다른 종류의 세포로 교차 분화할 수 있는 유연성을 가지고 있으며, 다양한 세포로 분화할 수 있는 다잠재성도 있다는 것이 밝혀지면서 성체줄기세포를 이용한 세포치료제의 가능성이 높아지고 있다.
우리 몸에서 상당부분을 차지하고 있는 지방조직은 지방세포 이외에 많은 미세혈관 내피세포, 내막세포, 섬유모세포, 근육세포, 지방전구세포로 구성된 기질혈관분획(stromal vascular fraction, SVF)으로 구성되며, 최근 이 SVF에 줄기세포와 유사한 형태의 세포가 존재하고 이들 세포가 다중분화능을 가지는 줄기세포라는 것이 확인되었다(Tissue Eng 2001;7:211-228; J Cell Physiol 2001;189:54-63).
지방조직은 우리 몸의 상당 부분을 차지하고 있어 많은 양의 조직 채취가 가능하기 때문에 성체줄기세포 중 가장 얻기 쉽고 풍부한 양의 세포를 얻을 수 있는 조직은 지방조직이라 할 수 있다. 지방 유래 줄기세포(adipose-derived stem cells, ADSCs)는 다른 공급원의 성체줄기세포보다 줄기세포의 특성에서 뒤떨어지지 않고, 배양 시 안정적인 성장과 증식을 보여주며, 분화를 유도하였을 때 다양한 세포로 분화가 가능한 장점을 가지고 있다. 때문에 ADSCs는 지방조직뿐만 아니라 연골, 뼈, 신경조직, 혈관조직, 간 세포, 신장, 심혈관 재생 등 다양한 조직을 재생한다는 것이 밝혀지고 있다(Tissue Eng. 2004;10(3-4):371-80; Methods Mol Biol. 2008;449:59-67).
지방조직은 최근 비만환자에서 지방흡입술에 의해 쉽게 얻을 수 있으며, 일반적으로 임상에서 이루어지는 지방흡입술은 수백 밀리리터부터 수천 밀리리터까지 한번에 얻을 수 있다. 과거에는 지방흡입술로 얻은 지방조직 혹은 절제된 지방조직들을 그냥 버렸으나 최근에는 자가지방 이식용으로 사용되거나 줄기세포 연구자들에 의해 ADSCs를 얻는데 활용되고 있다.
지방흡입물이나 절제된 지방조직에서 줄기세포를 분리하는 방법은 효소적 방법(Enzymatic isolation methods)과 비효소적 방법(Enyzme-free isolation methods)이 알려져 있다(Aronowitz et al. SpringerPlus (2015) 4:713; Scientific Report, 2017, 7:10015).
효소적 방법은 일반적으로 지방조직 또는 지방 흡입물(Lipoaspirate)을 수용성 염 용액(aqueous salt solution)으로 세척하고, 세포외기질(extracellular matrix, ECM) 등을 분해하는 콜라게나아제 등의 효소를 처리한 후 원심분리하여 상부의 지방조직이나 오일층, 수용액층 버리고 하부의 침전된 세포층(pellet 층)을 회수하는 방법이다. 이러한 효소적 방법은 고비용이며 효소 처리 과정에서 줄기세포의 특성이 변화될 위험성이나 왜래 성분의 혼입될 위험성 등을 가진다고 알려져 있다(J Vis Exp. 2019 Dec; 16(154): e59419).
비효소적 분리 방법은 효소 분해 대신에 전단력(shear force), 원심력(centrifugal force), 복사력(radiation force), 압력을 이용하여 지방조직으로부터 세포층를 분리하는 방법(Cell Regeneration (2015) 4:7)이다.
이렇게 분리된 세포층을 기질혈관분획이라 하는데, 이 기질혈관분획에 ADSCs가 포함되어 있으며(Tissue Eng 2001;7:211-228; J Cell Physiol 2001;189:54-63; Methods Mol Biol 2006;325:35-46), ADSCs를 순수 분리하기 위해서 계대배양을 하거나 ADSCs 세포막 표면에 존재하는 단백질(항원)에 특이적으로 결합할 수 있는 항체와 유세포분리기를 이용하기도 한다.
또 지방 유래 줄기세포의 비효소적 분리 방법으로서, 지방조직 절편을 배양배지에 넣어 줄기세포가 그 절편에서 이동하여 분리되도록 하는 배양배지를 이용한 방법(J Vis Exp. 2019 Dec; 16(154): e59419)도 제안되어 있다. 그러나 이 방법은 지방 유래 줄기세포 이외에도 지방조직의 다른 물질이나 지방조직 유래 다른 세포가 섞일 가능성이 매우 높은 단점이 있다.
본 발명은 비효소적 분리 방법의 하나로서, 상하부 구조의 이중 웰을 이용한 지방 유래 줄기세포의 분리 방법을 개시한다.
본 발명의 목적은 상하부 구조의 이중 웰을 이용한 지방 유래 줄기세포의 분리 방법을 제공하는 데 있다.
본 발명의 다른 목적이나 구체적인 목적은 이하에서 제시될 것이다.
본 발명은 아래의 실시예에서 확인되는 바와 같이, 상하부 구조의 이중 웰의 상부 웰(상부 웰은 그 바닥면이 미세 다공성 막으로 구성되어 세포가 투과될 수 있는 웰임)에 짤게 자른 지방조직을 올려 놓고 하부 웰은 세포 배양 배지를 넣어 일정 시간 방치할 경우, 상부 웰의 지방조직으로부터 하부 웰로 줄기세포가 이동하여 분리되는데, 그 분리된 줄기세포가 Zuk 등의 효소적 분리 방법(Mol Biol Cell. 2002 Dec; 13(12): 4279-4295)이나 Sherman 등의 비효소적 분리 방법(J Vis Exp. 2019 Dec; 16(154): e59419)에 의하여 분리된 줄기세포와 비교하여 형태적으로 차이가 없고, 그 증식율에 차이가 없으며, 또한 지방 유래 줄기세포 특이적 표지 인자인 CD73, CD90, CD105의 유전자의 발현 정도나 줄기세포 전분화능 표지 인자인 Sox2, Oct4, c-myc, Klf4, Nanog의 유전자의 발현 정도에 있어서도 특별한 차이가 없음을 확인함으로서 완성된 것이다.
전술한 바를 고려할 때, 본 발명의 상하부 구조의 이중 웰을 이용한 지방 유래 줄기세포의 분리 방법은, (a) 상하부 구조의 이중 웰의 상부 웰에 지방조직의 미세편을 올려 놓고 그 상하부 웰에 세포 배양 배지를 넣는 단계, 및 (b) 하부 웰로 이동한 세포를 회수하는 단계를 포함하여 구성된다.
본 발명에서, 상하부 구조의 이중 웰은 도 1에서 보여지는 바와 같이, 상부 웰과 하부 웰로 구성되며, 상부 웰은 그 직경이 하부 웰보다 작게 구성되어 하부 웰의 내부로 삽입될 수 있고, 그 상단 주위에 리브(rib)가 일체로 형성되어 있어 탈착 가능하게 하부 웰의 상단에 얹혀져 위치할 수 있다. 또 상부 웰은 그 바닥면이 미세 다공성 막(microporous membrane)으로 이루어져 있어 세포가 그 미세공을 투과하여 하부 웰로 이동할 수 있게 된다. 미세공은 지방 줄기세포가 통과될 수 있는 크기를 갖는데, 이러한 미세공의 크기는 일반적으로 직경(diameter) 기준 3 ㎛ 내지 50 ㎛ 범위, 특히 6 ㎛ 내지 30 ㎛ 범위가 될 것이다.
미세 다공성 막은 소수성이나 친수성 모두 무방하지만 소수성이 바람직하고, 줄기세포에 결합하는 특성을 지니고 있지 않으면서, 줄기세포의 분화능이나 증식능 등에 영향을 주지 않는 재질로 이루어진 것이 바람직하다. 그러한 재질로서는 알기네이트(ALG), 카르복시메틸 셀룰로스(CMC), 비스코스(VIS), 실크, 콜라겐, 나노피브릴화 셀룰로스(NFC), 유도체를 갖는 키토산(CHI), 셀룰로스, 폴리카보네이트(Polycarbonate), 폴리에스테르(polyester), 폴리테트라플루오로에틸렌(polytetrafluoroethylene), 폴리카프로락톤(PCL), 폴리에틸렌 테레프탈레이트(PET), 폴리부틸렌 테레프탈레이트(PBT), 폴리프로필렌(PP), 폴리히드록시에틸메타크릴레이트(PHEMA), 폴리(N-(2-히드록시프로필)메타크릴아미드)(PHPMA), 폴리비닐 알코올(PVA), 폴리에틸렌 옥사이드(PEOX), 폴리아미도아민(PAMAM), 폴리에틸렌이민(PEI) 등을 들 수 있으며, 바람직하게는 폴리카보네이트, 폴리에틸렌 테레프탈레이트, 폴리에스테르, 폴리테트라플루오로에틸렌 등일 수 있다.
상하부 구조의 이중 웰에서, 하부 웰은 단일 웰을 갖는 접시(dish) 형태로 구성될 수도 있지만, 다중의 웰을 갖는 웰 플레이트 형태로 구성될 수도 있다. 하부 웰이 웰 플레이트 형태로 구성될 경우 6 웰 플레이트, 12 웰 플레이트, 24 웰 플레이트 등의 형태일 수 있다.
본 발명에서 사용되는 상하부 구조의 이중 웰은 직접 제작하여 사용할 수 있으나 상업적으로 시판되는 제품을 구입하여 사용하는 것이 바람직할 수 있다. 그러한 제품으로서는 예컨대 코닝 인코퍼레이티드(Corning Incorporated) 사의 Transwell® Permeable Supports 제품이나 에스피엘(SPL) 사의 SPLInsert™ 제품 등을 들 수 있다.
본 발명에서, 상기 (a) 단계 즉 상부 웰에 지방조직의 미세편을 올려 놓는 단계 후에는 지방조직의 줄기세포가 하부 웰로 투과하여 이동하도록 일정 시간, 예컨대 1일 이상 또는 2일 이상, 특히 5일이나 6일 또는 7일 이상 방치될 수 있다.
또 본 발명에서, 지방 줄기 세포 분리에 이용되는 지방조직은 인간을 포함한 임의의 포유동물의 지방조직일 수 있으며, 바람직하게는 인간, 마우스, 래트, 토끼, 원숭이, 돼지, 말, 소, 양, 영양, 개 또는 고양이의 지방조직일 수 있고, 더 바람직하게는 인간, 마우스, 래트 또는 원숭이의 지방조직일 수 있으며, 가장 바람직하게는 인간 지방조직일 수 있다.
또 본 발명에서, 지방조직은 피하 지방조직(subcutaneous fat tissue)이나 기관 주위의 지방조직인 내장 지방조직(visceral fat tissue)으부터 얻어질 수 있으며, 또 갈색 지방조직이나 백색 지방조직으로부터 얻어질 수 있다.
또 본 발명에서, 지방조직 미세편은 핀셋과 의료용 가위 등 임의의 기구를 사용하여 입경 1mm 이하로 준비하는 것이 바람직하다. 미세편의 입경이 작아질 수도록 줄기세포의 분리 효율은 좋아질 것이므로 미세편의 입경의 크기는 가능한 한 작게하는 것이 바람직할 수 있다.
또 본 발명에서, 상부 웰과 하부 웰에는 줄기세포의 이동을 유도하기 위하여 세포 배양 배지를 넣게 되는데, 이러한 세포 배양 배지는 상부 웰에는 지방 조직 미세편을 충분히 덮을 정도로, 하부 웰에는 상부 웰의 바닥면 높이 이상 채워지는 것이 바람직할 수 있다.
이러한 세포 배양 배지는 당류와 아미노산 특히 필수 아미노산을 포함하고 또한 비타민을 포함하여 구성된다.
당류는 주 에너지원으로서 바람직하게는 단당류, 이당류가 사용될 수 있다. 구체적으로 글루코오스, 프럭토오스, 만노오스, 갈락토오스, 리보오스, 소르보오스, 리불로오스, 락토오스, 말토오스, 수크로오스, 라피노오스 또는 이들의 1종 이상의 혼합물이 사용될 수 있다.
아미노산은 단백질의 기본 구성요소로서, L-글루타민 등의 필수 아미노산은 세포가 스스로 합성할 수 없기 때문에 필수 성분으로서 세포 배양 배지에 포함되어야 한다. 특히 L-글루타민은 NAD, NADPH, 뉴클레오티드에 질소를 제공하고 대사를 위한 2차 에너지원 역할을 한다. L-글루타민은 불안정한 상태의 아미노산으로 시간이 지남에 따라 세포에서 사용할 수 없는 형태로 전환되기 때문에 사용 직전에 배지에 첨가하는 것이 바람직할 수 있다.
본 발명의 세포 배양 배지에는 당류와 아미노산 이외에, 비타민 A, 비타민 B군, 비타민 C, 비타민 E 등의 비타민이 포함될 수 있다. 비타민은 많은 것이 세포의 성장과 증식에 필수적이며, 세포에서 충분한 양으로 합성될 수 없으므로 세포 배양 배지에 충분히 보충될 필요가 있다. 특히 티아민, 리보플라빈, 피리독신, 시아노코발라민, 비오틴, 엽산, 판토텐산, 니코틴아미드 등의 비타민 B군은 세포의 성장 촉진을 위해 첨가되는 것이 바람직하다.
본 발명에서, 세포 배양 배지에는 당류와 아미노산, 비티민 이외에, 염분, 유리지방산, 호르몬, 비타민과 결합하여 조직과 세포 사이에서 운반하는 역할을 하는 알부민이나, 철 수송과 세포 부착에 중요한 역할을 하는 피브로넥틴이나, 세린 프로테아제의 억제제인 아프로티닌, 페투인 등의 단백질이 추가로 포함될 수도 있다.
또 본 발명에서, 세포 배양 배지에는 당류와 아미노산, 비티민 이외에, 삼투 균형을 유지하고 나트륨, 칼륨 및 칼슘 이온을 제공하여 막 전위를 조절하는 데 도움이 되는, 염화나트륨, 염화칼륨, 염화칼슘, 황산마그네슘, 인산2수소나트륨 등의 무기염류가 추가로 포함될 수도 있다.
또 본 발명에서, 세포 배양 배지에는 당류와 아미노산, 비티민 이외에, 적절한 세포 성장을 위해 그리고 효소의 기능 유지를 위해 구리, 아연, 셀레늄, 트리카르복실산 중간체 등의 미량 원소가 포함될 수도 있다.
또 본 발명에서, 세포 배양 배지에는 시트레이트, 포스페이트, 숙시네이트, 타르트레이트, 푸마레이트, 글루코네이트, 옥살레이트, 락테이트, 아세테이트, BES(N,N-bis(2-hydroxyethyl)-2-aminoethanesulfonic acid), HEPES(4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), 트리신((N-[tris(hydroxymethyl)methyl]glycine) 등의 완충제나, 올레산, 아라키돈산, 리놀산 등의 지방산이나, 콜레스테롤 등의 지질이나, 암포테리신 B, 카나마이신, 겐타마이신, 스트렙토마이신, 페니실린 등의 항생물질이나, 제1형 또는 제2형 콜라겐, 피브로넥틴, 라미닌, 폴리-L-리신, 폴리-D-리신 등의 세포 접착 인자나, 섬유아세포증식인자(FGF), 간세포증식인자(HGF), 트랜스포밍증식인자-α(TGF-α), 트랜스포밍증식인자-β(TGF-β), 혈관내피증식인자(VEGF), 액티빈 A 등의 증식인자나, 덱사메타손, 하이드로코르티손, 에스트라디올, 프로게스테론, 글루카곤, 인슐린 등의 호르몬 등이 포함될 수도 있다.
또한 본 발명에서 세포 배양 배지에는 당류, 아미노산, 단백질, 지질, 증식인자, 호르몬, 미량 원소 등을 대체하거나 또는 이들 성분들에 보조적으로 인간 유래 또는 동물 유래 혈청이 포함되어 사용될 수 있으나, 이러한 혈청에는 미지의 인자나 프리온, 바이러스 등이 포함될 가능성이 있기 때문에 가능하면 사용되지 않는 것이 바람직할 수 있다.
전술한 바의 세포 배양 배지는 직접 제조하여 사용하거나 상업적으로 시판되는 것을 사용할 수 있다. 상업적으로 시판되는 배지로서 예컨대, DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10, F-12, DMEM/F12, MEM-α (Minimal Essential Medium-α), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), MacCoy's 5A 배지, AmnioMax complete 배지, AminoMaxⅡ complete 배지, EBM (Endothelial Basal Medium) 배지, Chang's Medium, MesenCult-XF, DMEM/HG (Dulbecco's Modified Eagle's Medium high glucose)배지, 및 MCDB+DMEM/LG (MCDB +Dulbecco's Modified Eagle's Medium low glucose) 배지 등 그 조성(즉 구성성분과 함량)이 정해져 공지된 것을 사용하거나, STEMPRO™ hESC SFM 배지(Life Technologies사), mTeSR1 배지(STEMCELL Technologies 사), TeSR2 배지(STEMCELL Technologies 사), TeSR-E8 배지(STEMCELL Technologies 사), Essencial 8 배지(Life Technologies 사), hES cells용 HEScGRO™ Serum-Free Medium(Millipore 사), PluriSTEM Human ES/iPS 배지(EMD Millipore 사), NutriStem™ hESC XF 배지(Biological Industries Israel Beit-Haemek Ltd), NutriStem™ XF/FF Culture Medium(Stemgent 사), AF NutriStem™ hESC XF 배지(Biological Industries Israel Beit-Haemek Ltd) 등 줄기세포 배양용으로 특정 회사에서 제작되어 판매되는 것을 사용할 수도 있다.
본 발명에서 하부 웰에 줄기세포가 분리된 그대로 동결보존할 경우라면, 상기 세포 배양 배지는 동결 보존제 예컨대 글리세롤, 케라틴이나 젤라틴 가수분해물, 아세트아미드, DMSO, 에틸렌 글리콜, 프로필렌 글리콜, 폴리에틸렌 글리콜, 세리신, 이소말토올리고당 등을 포함할 수 있고, 또한 EDTA, EGTA, 구연산, 살리실레이트 등의 킬레이트제를 포함하거나, 추가로 용해 보조제, 보존제, 산화 방지제 등을 포함할 수도 있다.
또한 본 발명에서, 하부 웰에 분리된 줄기세포는 다른 접시(dish)로 옮기고 전술한 바의 세포 배양 배지 및/또는 동결 보존제를 사용하여 보존할 수도 있다. 여기서 세포 배양 배지 대신에 완충액이나 등장액 및/또는 동결 보존제를 사용하여 보존할 수도 있다. 여기서 완충액은 시트레이트, 포스페이트, 숙시네이트, 타르트레이트, 푸마레이트, 글루코네이트, 옥살레이트, 락테이트, 아세테이트 등을 완충제로 포함하는 생리 식염수(saline solution)나 인산 완충 생리 식염수(Phosphate Buffered Saline, PBS), HEPES 완충 생리 식염수(HEPES Buffered Saline) 등일 수 있다. 또 등장액은 염화나트륨, 염화칼륨, 붕산, 붕산나트륨, 만니톨, 글리세린, 프로필렌글리콜, 폴리에틸렌, 글리콜, 말토스, 자당, 에리쓰리톨, 아라비톨, 자일리톨, 소르비톨 트리할로즈, 포도당 등을 등장화제로 포함하는, 링거액, 젖산 링거액, 아세트산 링거액, 중탄산 링거액, 5% 글루코스 수용액일 수 있다.
일반적으로 보존은 짧은 기간 동안 세포 상태 유지를 위한 것으로 일반적으로 4℃ 전후에서 24시간 내지 72시간 이루어질 수 있으며, 이보다 장기간 보존할 경우에는 -150℃ ~ -196℃ 온도 범위에서 당업계의 공지된 방법에 따라 6개월 이상이나 1년 이상 동결보존하여 이루어질 수 있다.
전술한 바와 같이, 본 발명에 따르면 상하부 구조의 이중 웰을 이용한 지방 유래 줄기세포의 분리 방법을 제공할 수 있다.
본 발명의 방법은 비효소적 방법에 의하여 지방 유래 줄기세포를 분리하는 방법으로서, 고비용, 줄기세포의 특성 변화, 왜래 성분의 혼입 등의 효소적 분리 방법이 가지는 단점을 극복할 수 있는 효과를 가질 수 있다.
도 1은 본 발명의 지방 유래 줄기세포의 분리에 사용된, 시판되는 상하부 구조의 이중 웰의 사진이다.
도 2는 지방조직으로부터 지방 유래 줄기세포(ADSC; Adipocyte-derived stem cell)를 분리하는 방법에 대한 사진이다.
도 3은 지방조직으로부터 각 분리방법에 따라 지방 유래 줄기세포를 분리한 후 배양접시에 배양하여 관찰한 사진이다.
도 4는 지방조직으로부터 각 분리방법에 따라 얻어진 지방 유래 줄기세포의 성장률을 측정한 그래프이다.
도 5는 지방조직으로부터 각 분리방법에 따라 얻어진 지방 유래 줄기세포의 그 특이적 표지 인자인 CD73, CD90, CD105의 유전자의 발현 정도를 확인한 결과이다.
도 6은 지방조직으로부터 각 분리방법에 따라 얻어진 지방 유래 줄기세포의 전분화능 표지 인자인 Sox2, Oct4, c-myc, Klf4, Nanog의 유전자의 발현 정도를 확인한 결과이다.
이하 본 발명을 실시예를 참조하여 설명한다. 그러나 본 발명의 범위가 이러한 실시예에 한정되는 것은 아니다.
<실시예 1> 지방 유래 줄기세포의 분리 및 배양
본 실시예에서 사용한 인간 지방조직은 고마바이오텍(주)(Seoul, Korea)에서 구입하여 사용하였다.
줄기세포의 분리에 이용할 효소(Collagenase)는 시그마-알드리치(Sigma-aldrich) 사에서 구입하여 사용하였다. 효소를 이용하여 지방조직으로부터 줄기세포를 분리하는 방법은 Zuk 등의 방법(Mol Biol Cell. 2002 Dec; 13(12): 4279-4295)을 참고 및 변형하여 사용하였다. 이 방법은 지방조직을 잘게 잘라 효소(콜라게네이즈)에 섞어준 후 배양하면 지방유래 줄기세포만 분리할 수 있는 방법이다(이 방법으로 얻어진 지방 유래 줄기세포는 첨부된 도면에서 "Collagenase"로 표시되어 있음).
또 지방조직으로부터 직접 줄기세포를 분리하는 방법(Naive)은 Sherman 등의 방법(J Vis Exp. 2019 Dec; 16(154): e59419)을 참고 및 변형하여 사용하였다. 이 방법은 지방조직을 잘게 잘라 배양배지 위에 그대로 올려두면 줄기세포만 배양접시 위에 붙어 분리, 배양이 가능한 방법이다(이 방법으로 얻어진 지방 유래 줄기세포는 첨부된 도면에서 "Naive"로 표시되어 있음).
상하부 구조의 이중 웰을 이용한 줄기세포의 분리는 그 상하부 구조의 이중 웰로서 에스피엘(SPL life sciences) 사에서 SPLInsert™ 제품(6 Inserts/6 well Plate, Catalogue# 37206)을 이용하였다. 이 SPLInsert™ 제품은 상부 웰의 바닥면의 미세 다공성 막(microporous membrane)이 폴리에틸렌 테레프탈레이트(Polyethylene terephthalate)의 재질로 되어 있으며 그 미세공의 크기는 8 ㎛이다. 상부 웰의 미세 다공성 막 위에, 핀셋과 의료용 가위를 이용하여 입경이 약 1mm 이하가 되도록 잘게 자른 지방조직 미세편을 올려 놓고, 상하부 웰에 DMEM 배지를 넣은 후(상부 웰에는 지방조직 미세편을 덮을 정도로 DMEM 배지를 넣었고 하부 웰에는 상부 웰의 바닥면 높이 이상 DMEM 배지를 넣었음) 일주일 동안 방치하여 지방조직 유래 줄기세포가 하부 웰로 이동하도록 유도하였다(이 방법으로 얻어진 지방 유래 줄기세포는 첨부된 도면에서 "Transwell"로 표시되어 있음).
상기 각 분리 방법에 따른 분리 과정을 보여주는 사진을 도 2에 나타내었다.
상기의 각 방법에 따라, 지방조직에서 줄기세포를 분리한 후, 페니실린(100 U/ml), 스트렙토마이신 (100 ug/ml) 및 10% 열비활성 혈청을 첨가한 DMEM(Dulbecco's Modified Eagle's Medium)에서 95% 공기, 5% CO2와 37℃ 조건으로 배양하였다. 배양 접시에 부착되어 세포가 자라면 0.25% 트립신/10mM EDTA를 이용하여 세포를 모으고, 1:3의 비율로 나눠 10% DMEM에서 유지하였다. 각 분리 방법에 따른 지방 유래 줄기세포의 모양은 도 3에 나타내었다. 도 3을 참조하여 보면, 각 분리 방법에 따라 얻어진 줄기세포의 모양이 서로 유사함을 알 수 있다.
<실시예 2> 분리방법에 따른 지방 유래 줄기세포의 증식
시험에서 사용된 시약인 CCK-8은 (주)동인바이오텍(Seoul, Korea)에서 구입하여 사용하였고, 지방 유래 줄기세포는 상기 실시예 1에서 분리한 각 방법별 세포를 이용하였다.
지방 유래 줄기세포를 96-well plates에 1 × 104 cells/well의 농도로 100 ul씩 6중으로 처리한 다음 최대 72시간까지 배양하였다. 지정된 시간(24, 48, 72시간)에 10 ul의 CCK-8 시약과 지방 유래 줄기세포 배양 배지 100 ul의 조건으로 3시간 동안 배양시킨 후 540 nm에서 스펙트로포토미터(spectrophotometer)로 흡광도를 측정하였다.
그 결과, 도 4에서 확인되는 바와 같이, 이중 웰을 이용하여 지방조직으로부터 줄기세포를 분리하였을 때 효소를 이용한 방법이나 지방조직으로부터 직접 줄기세포를 분리하는 방법에 비해 증식율이 높은 것을 확인할 수 있었다. 따라서 이중 웰을 이용하여 지방조직으로부터 줄기세포를 분리할 경우 더욱 안정적인 지방 유래 줄기세포를 분리하여 수득할 수 있음을 알 수 있었다. 도 4에서 A는 각 분리 방법에 따른 Passage# 3의 줄기세포에 대한 결과이고, B는 각 분리 방법에 따른 Passage# 5의 줄기세포에 대한 결과이다.
<실시예 3> 분리 방법에 따른 지방 유래 줄기세포 특이적 표지 유전자 발현양 확인
분리 방법에 따른 지방 유래 줄기세포를 6-well plates에 1 × 105 cells/well의 농도로 1 ml씩 접종하여 지정된 시간(24, 48, 72시간)동안 배양한 후 부착된 세포를 Trizol Reagent(Invitrogen)를 이용하여 Total RNA를 분리하였다. 다음 SuperscriptII reverse transcriptase (Invitrogen)와 올리고 dT를 이용하여 1 ㎍ total RNA로부터 cDNA를 합성하였다. 합성된 cDNA 및 아래 표 1의 지방 유래 줄기세포 특이적 표지 유전자의 프라이머를 이용하여 SYBR green method 방법으로 실시간 PCR(Real-time PCR)을 수행하였다. SYBR Green I는 이중가닥 DNA에 결합하여 형광을 나타내는 인터킬레이트(interchelator)이다. 인터킬레이트(Interchelator)는 PCR 반응으로 합성된 이중 가닥 DNA에 결합하여 형광을 발하며 이 형광강도를 검출하여 증폭산물의 생성량을 측정할 수 있다.
지방 유래 줄기세포의 특이적 표지 유전자의 프라이머 서열
프라이머 서열 서열번호
CD73-Forward AAGTGTCGAGTGCCCAGTTA 1
CD73-Reverse TGATCCGACCTTCAACTGCT 2
CD90-Forward AGTACGAGTTCAGCCTGACC 3
CD90-Reverse TCTGAGCACTGTGACGTTCT 4
CD105-Forward TCCATTGTGACCTTCAGCCT 5
CD105-Reverse CTTGGATGCCTGGAGAGTCA 6
지방 유래 줄기세포의 특이적 표지 유전자로 알려진 CD73, CD90, CD105의 발현량을 실시간 PCR을 이용하여 확인한 결과, 도 5에서 보여지는 바와 같이, 이중 웰을 이용하여 지방조직으로부터 줄기세포를 분리해도 기존 효소를 이용한 방법이나 직접 분리 방법과 비교하여 지방 유래 줄기세포 특이적 표지 유전자의 발현양은 상이하지 않았으며, 따라서 상하부 구조의 이중 웰을 이용하여 지방으로부터 줄기세포를 분리할 경우 지방 유래 줄기세포의 고유한 특성을 보존하면서 안정적으로 지방 유래 줄기세포 분리가 가능함을 확인할 수 있었다. 도 5에서 A 결과는 각 분리 방법에 따른 Passage# 3의 줄기세포에 대한 결과이고, B 결과는 각 분리 방법에 따른 Passage# 5의 줄기세포에 대한 결과이다.
<실시예 4> 분리방법에 따른 줄기세포 전분화능 표지 유전자 발현양 확인
상기 실시예 3에서 제조한 cDNA를 사용하여 동일한 방법으로 줄기세포 전분화능 표지 유전자의 발현양을 조사하였다.
지방 유래 줄기세포의 특이적 표지 유전자로 알려진 Sox2, Oct4, c-myc, Klf4, Nanog의 발현량을 실시간 PCR을 이용하여 확인하였으며, 각 인자의 프라이머 서열은 하기 표 2와 같다.
줄기세포 전분화능 표지 유전자의 프라이머 서열
프라이머 서열 서열번호
Sox2-Forward GCTACAGCATGATGCAGGACCA 7
Sox2-Reverse TCTGCGAGCTGGTCATGGAGTT 8
Oct4-Forward CCTGAAGCAGAAGAGGATCACC 9
Oct4-Reverse AAAGCGGCAGATGGTCGTTTGG 10
c-myc-Forward CCTGGTGCTCCATGAGGAGAC 11
c-myc-Reverse CAGACTCTGACCTTTTGCCAGG 12
Klf4-Forward CATCTCAAGGCACACCTGCGAA 13
Klf4-Reverse TCGGTCGCATTTTTGGCACTGG 14
Nanog-Forward CTCCAACATCCTGAACCTCAGC 15
Nanog-Reverse CGTCACACCATTGCTATTCTTCG 16
그 결과, 도 6에서 확인되는 바와 같이, 이중 웰을 이용하여 지방조직으로부터 줄기세포를 분리해도 기존에 사용되고 있는 효소 및 조직을 그대로 이용하는 방법과 비교하여 줄기세포 전분화능 표지 유전자의 발현양은 상이하지 않았으며, 따라서 이중 웰을 이용할 경우 지방 유래 줄기세포의 전분화능 표지 유전자의 발현에 대한 영향 없이 지방조직으로부터 안정적으로 줄기세포 분리가 가능함을 확인할 수 있었다. 도 6에서 A 결과는 각 분리 방법에 따른 Passage# 3의 줄기세포에 대한 결과이고, B 결과는 각 분리 방법에 따른 Passage# 5의 줄기세포에 대한 결과이다.
통계학적 유의성을 검증하고자 각 실험별 음성대조군 결과와의 통계 분석을 Independent T-Test를 통해 분석하였으며, 이를 p-value로 환산하여 나타내었다. 이상의 모든 통계처리는 Excel 프로그램을 이용하여 분석하였다. p-value가 0.05보다 낮은 경우를 통계학적으로 유의하게 분리하고 결과에 별표(*)로 표시하였다.

Claims (8)

  1. (a) 상하부 구조의 이중 웰의 상부 웰에 지방조직의 미세편을 올려 놓고 그 상하부 웰에 세포 배양 배지를 넣는 단계, 및 (b) 하부 웰로 이동한 세포를 회수하는 단계를 포함하는
    상하부 구조의 이중 웰을 이용한 지방 유래 줄기세포의 분리 방법.
  2. 제1항에 있어서,
    상기 상하부 구조의 이중 웰은 (i) 상부 웰과 하부 웰로 구성되며, (ii) 상부 웰은 그 직경이 하부 웰보다 작게 구성되어 하부 웰의 내부로 삽입될 수 있고, (iii) 상부 웰 상단 주위에 리브(rib)가 일체로 형성되어 있어 탈착 가능하게 하부 웰의 상단에 얹혀져 위치할 수 있으며, (iv) 상부 웰은 그 바닥면이 미세 다공성 막으로 이루어져 있어 세포가 미세공을 투과하여 하부 웰로 이동할 수 있는 구성을 가지며,
    상기 미세공은 그 크기가 직경 기준 6 ㎛ 내지 30 ㎛ 범위인 것을 특징으로 하는 방법.
  3. 제2항에 있어서,
    상기 미세 다공성 막은 폴리카보네이트, 폴리에틸렌 테레프탈레이트, 폴리에스테르 또는 폴리테트라플루오로에틸렌인 것을 특징으로 하는 방법.
  4. 제1항에 있어서,
    상기 (a) 단계 후에는 지방조직의 줄기세포가 하부 웰로 투과하여 이동하도록 1일 이상 방치되는 단계가 추가로 포함되는 것을 특징으로 하는 방법.
  5. 제1항에 있어서,
    상기 지방조직은 인간 지방조직인 것을 특징으로 하는 방법.
  6. 제1항에 있어서,
    상기 지방조직 미세편은 그 입경 1mm 이하인 것을 특징으로 하는 방법.
  7. 제1항에 있어서,
    상기 세포 배양 배지는 상부 웰에는 지방 조직 미세편을 충분히 덮을 정도로, 하부 웰에는 상부 웰의 바닥면 높이 이상 채워지는 것을 특징으로 방법.
  8. 제1항에 있어서,
    상기 세포 배양 배지는 당류 및 아미노산을 포함하고,
    상기 세포 배양 배지는 DMEM (Dulbecco's Modified Eagle's Medium), MEM (Minimal Essential Medium), BME (Basal Medium Eagle), RPMI 1640, F-10, F-12, DMEM/F12, MEM-α (Minimal Essential Medium-α), G-MEM (Glasgow's Minimal Essential Medium), IMDM (Iscove's Modified Dulbecco's Medium), MacCoy's 5A 배지, AmnioMax complete 배지, AminoMaxⅡ complete 배지, EBM (Endothelial Basal Medium) 배지, Chang's Medium, MesenCult-XF, DMEM/HG (Dulbecco's Modified Eagle's Medium high glucose)배지, 및 MCDB+DMEM/LG (MCDB +Dulbecco's Modified Eagle's Medium low glucose) 배지 중에서 선택된 것을 특징으로 하는 방법.
PCT/KR2022/004901 2021-12-17 2022-04-05 상하부 구조의 이중 웰을 이용한 지방 유래 줄기세포의 분리 방법 WO2023113109A1 (ko)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR1020210181534A KR102431623B1 (ko) 2021-12-17 2021-12-17 상하부 구조의 이중 웰을 이용한 지방 유래 줄기세포의 분리 방법
KR10-2021-0181534 2021-12-17

Publications (1)

Publication Number Publication Date
WO2023113109A1 true WO2023113109A1 (ko) 2023-06-22

Family

ID=82803341

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/004901 WO2023113109A1 (ko) 2021-12-17 2022-04-05 상하부 구조의 이중 웰을 이용한 지방 유래 줄기세포의 분리 방법

Country Status (2)

Country Link
KR (2) KR102431623B1 (ko)
WO (1) WO2023113109A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2007289076A (ja) * 2006-04-25 2007-11-08 Kaneka Corp 脂肪組織から幹細胞を採取するのに適した細胞分離装置、およびその方法
KR20160009420A (ko) * 2014-07-16 2016-01-26 연세대학교 산학협력단 트랜스웰 및 케모카인을 이용한 줄기세포의 분리 방법

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2007289076A (ja) * 2006-04-25 2007-11-08 Kaneka Corp 脂肪組織から幹細胞を採取するのに適した細胞分離装置、およびその方法
KR20160009420A (ko) * 2014-07-16 2016-01-26 연세대학교 산학협력단 트랜스웰 및 케모카인을 이용한 줄기세포의 분리 방법

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HONG KI-SUNG, BAE DAEKYEONG, CHOI YOUNGSOK, KANG SUN-WOONG, MOON SUNG-HWAN, LEE HOON TAEK, CHUNG HYUNG-MIN: "A Porous Membrane-Mediated Isolation of Mesenchymal Stem Cells from Human Embryonic Stem Cells", TISSUE ENGINEERING. PART C, METHODS DEC 2008, MARY ANN LIEBERT, INC. PUBLISHERS, US, vol. 21, no. 3, 1 March 2015 (2015-03-01), US , pages 322 - 329, XP055847372, ISSN: 1937-3384, DOI: 10.1089/ten.tec.2014.0171 *
SHERMAN LAUREN S., CONDÉ-GREEN ALEXANDRA, NAALDIJK YAHAIRA, LEE EDWARD S., RAMESHWAR PRANELA: "An Enzyme-free Method for Isolation and Expansion of Human Adipose-derived Mesenchymal Stem Cells", JOURNAL OF VISUALIZED EXPERIMENTS, no. 154, XP093073615, DOI: 10.3791/59419 *
SUN JIN BAEK, KANG SUNG KEUN, RA JEONG CHAN: "In vitro migration capacity of human adipose tissue-derived mesenchymal stem cells reflects their expression of receptors for chemokines and growth factors", EXPERIMENTAL AND MOLECULAR MEDICINE, vol. 43, no. 10, 1 January 2011 (2011-01-01), pages 596 - 603, XP055063632, ISSN: 12263613, DOI: 10.3858/emm.2011.43.10.069 *

Also Published As

Publication number Publication date
KR102431623B1 (ko) 2022-08-11
KR102511984B1 (ko) 2023-03-21

Similar Documents

Publication Publication Date Title
US10568911B2 (en) Multipotent stem cells and uses thereof
Teramura et al. Induction of mesenchymal progenitor cells with chondrogenic property from mouse-induced pluripotent stem cells
KR100973453B1 (ko) 인간 배아 줄기 세포에서 유래되는 연골세포 전구체
Hoffmann et al. Comparison of in vitro‐cultivation of human mesenchymal stroma/stem cells derived from bone marrow and umbilical cord
US20230125741A1 (en) Media and methods for producing mesenchymal stem cells
WO2015105357A1 (ko) 영양막 기저층으로부터 유래된 줄기세포 및 이를 포함하는 세포치료제
WO2019088480A2 (ko) 에티오나마이드를 이용한 줄기세포 이동성 향상 방법
KR20210044749A (ko) 무혈청 배지 조성물
WO2012133942A1 (ja) 生体の臍帯又は脂肪組織から単離できる多能性幹細胞
KR100677054B1 (ko) 제대혈로부터 다분화능 전구세포를 분리하여 배양하는 방법 및 이의 분화 유도방법
EP2250254A1 (en) Method of producing progenitor cells from differentiated cells
WO2019198962A1 (ko) 소변유래줄기세포로부터 제작된 유도만능줄기세포의 증식 및 분화 촉진 방법
WO2023113109A1 (ko) 상하부 구조의 이중 웰을 이용한 지방 유래 줄기세포의 분리 방법
KR102644886B1 (ko) 근육 유래 전구체 세포로부터 분화된 세포를 수득하는 방법
JP2007000077A (ja) 付着性動物細胞の無血清培養方法及び付着性動物細胞の無血清培養用培地
WO2019221477A1 (ko) 전구세포 배양액 및 다층 그래핀 필름을 포함하는 줄기세포 분화 촉진용 조성물 및 이의 용도
KR102030906B1 (ko) Hla 동형접합체의 제대혈단핵구세포 유래 인간전분화능세포를 이용한 연골세포 분화용 조성물 제조방법
Rajput et al. Expansion of human umbilical cord derived mesenchymal stem cells in regenerative medicine
US20190264174A1 (en) Method of cultivation of human salivary gland cells
WO2023080281A1 (ko) 펙틴과 알라닌을 이용한 세포 동결 보존용 조성물 및 이를 이용한 세포 동결 보존 방법
KR20180112547A (ko) 역분화 줄기세포의 지속적인 계대배양을 통한 중간엽 줄기세포로의 분화방법
US20220356451A1 (en) Methods to reprogram somatic cells to alternative cell fates or primitive cell states
WO2017051970A1 (ko) 중간엽 줄기세포로부터 유도된 만능 줄기세포를 췌장의 베타세포로 분화시키는 방법
CN117625550A (zh) 用于制备抗衰老的重编程干细胞的试剂盒及制备方法
WO2011055886A1 (ko) 인간 배아 줄기 세포 또는 역분화 만능 줄기세포의 배양방법

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22907582

Country of ref document: EP

Kind code of ref document: A1