WO2023111686A2 - Aptamers and small molecule ligands - Google Patents
Aptamers and small molecule ligands Download PDFInfo
- Publication number
- WO2023111686A2 WO2023111686A2 PCT/IB2022/000762 IB2022000762W WO2023111686A2 WO 2023111686 A2 WO2023111686 A2 WO 2023111686A2 IB 2022000762 W IB2022000762 W IB 2022000762W WO 2023111686 A2 WO2023111686 A2 WO 2023111686A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- aptamer
- nucleotide
- alkyl
- sequence
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/115—Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D241/00—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings
- C07D241/36—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings condensed with carbocyclic rings or ring systems
- C07D241/38—Heterocyclic compounds containing 1,4-diazine or hydrogenated 1,4-diazine rings condensed with carbocyclic rings or ring systems with only hydrogen or carbon atoms directly attached to the ring nitrogen atoms
- C07D241/40—Benzopyrazines
- C07D241/42—Benzopyrazines with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached to carbon atoms of the hetero ring
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
- C07D401/02—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings
- C07D401/12—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing two hetero rings linked by a chain containing hetero atoms as chain links
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D401/00—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom
- C07D401/14—Heterocyclic compounds containing two or more hetero rings, having nitrogen atoms as the only ring hetero atoms, at least one ring being a six-membered ring with only one nitrogen atom containing three or more hetero rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
- C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
- C07D471/04—Ortho-condensed systems
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
- C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
- C07D487/04—Ortho-condensed systems
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
- C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
- C07D487/08—Bridged systems
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D487/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00
- C07D487/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, not provided for by groups C07D451/00 - C07D477/00 in which the condensed system contains two hetero rings
- C07D487/10—Spiro-condensed systems
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/635—Externally inducible repressor mediated regulation of gene expression, e.g. tetR inducible by tetracyline
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C40—COMBINATORIAL TECHNOLOGY
- C40B—COMBINATORIAL CHEMISTRY; LIBRARIES, e.g. CHEMICAL LIBRARIES
- C40B40/00—Libraries per se, e.g. arrays, mixtures
- C40B40/04—Libraries containing only organic compounds
- C40B40/06—Libraries containing nucleotides or polynucleotides, or derivatives thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/16—Aptamers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/30—Chemical structure
- C12N2310/35—Nature of the modification
- C12N2310/351—Conjugate
- C12N2310/3519—Fusion with another nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
- C12N2310/531—Stem-loop; Hairpin
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/10—Applications; Uses in screening processes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/33—Alteration of splicing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2840/00—Vectors comprising a special translation-regulating system
- C12N2840/002—Vectors comprising a special translation-regulating system controllable or inducible
Definitions
- APTAMERS AND SMALL MOLECULE LIGANDS FIELD [0001]
- the present disclosure relates to oligonucleotide aptamers that bind to certain small molecules and methods of generating aptamers that bind to the small molecules.
- riboswitches and polynucleotide cassettes for regulating the expression of a target gene wherein the polynucleotide cassettes comprise the aptamers disclosed herein.
- small molecules that are modulators of target gene expression where the target gene contains a riboswitch comprising an aptamer described herein.
- RNA aptamers are oligonucleotides that bind to a target ligand with high affinity and specificity. These nucleic acid sequences have proven to be of high therapeutic and diagnostic value with recent FDA approval of the first aptamer drug and additional ones in the clinical pipelines. Their high degree of specificity and versatility have established RNA aptamers as one of the pivotal tools of the emerging RNA nanotechnology field in the fight against human diseases including cancer, viral infections and other diseases. [0003] In addition, aptamers may be utilized as part of a riboswitch that has certain effects in the presence or absence of an aptamer ligand.
- riboswitches may be used to regulate gene expression in response to the presence or absence of the aptamer ligand.
- aptamers/ligands derived from prokaryotic sources or generated using in vitro selection methods often fail to demonstrate the functionality required for the expression of therapeutic targets genes in eukaryotic systems.
- the ligand for the aptamer may be a cellular molecule that would not be appropriate for use in systems for regulating a therapeutic gene product, for example, because presence of the ligand would interfere in the regulation of target gene expression, or because the ligand is not otherwise appropriate for administration to cell or tissue.
- aptamer sequences that bind to small molecules of Formula I to XXII, including those listed in Table A, and analogs or derivatives thereof.
- riboswitches and polynucleotide cassettes for regulating the expression of a target gene, wherein the polynucleotide cassettes comprise the aptamers disclosed herein.
- aptamers comprising the aptamer encoding sequence disclosed herein.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCAT CGACCCX 7 X 8 X 9 X 10 X 11 X 12 CCTX 13 X 14 X 15 CCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGX 22 X 23 C AGGGAG (SEQ ID NO:2); wherein: X 1 is C or T; X 2 is any nucleotide; X 3 is any nucleotide; X 4 is G or T; X 5 is A, G, or T; X 6 is A or G; X 7 is A or T; X 8 is A, C, or T; X 9 is A, C, or T; X 10 is any nucleotide; X 11 is any nucleotide or no nucleotide; X 12 is A; X 13 is A,
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCAT CGACCCX 7 X 8 X 9 X 10 X 11 X 12 CCTX 13 X 14 X 15 CCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGX 22 X 23 C AGGGAG (SEQ ID NO:2); wherein: X 1 is C or T; X 2 is any nucleotide; X 3 is any nucleotide; X 4 is G or T; X 5 is A, G, or T; X 6 is A or G; X 7 is A; X 8 is A, C, or T; X 9 is A, C, or T; X 10 is any nucleotide; X 11 is any nucleotide or no nucleotide; X 12 is A; X 13 is
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCX 7 X 8 X 9 X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4); wherein: X 7 is A, G, or T; X 8 is any nucleotide; X 9 is any nucleotide; X 10 is any nucleotide; X 11 is any nucleotide or no nucleotide; X 12 is A, C, or T (taken together SEQ ID NO:683).
- X 7 -X 12 are not simultaneously A, T, T, G, C, and A, respectively.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCX 7 X 8 X 9 X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4); wherein: X 7 is A or T; X 8 is A, C, or T; X 9 is A, C, or T; X 10 is any nucleotide; X 11 is any nucleotide or no nucleotide; and X 12 is A (taken together SEQ ID NO:684).
- X 7 -X 12 are not simultaneously A, T, T, G, C, and A, respectively.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCX 7 X 8 X 9 X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4); wherein: X 7 is A; X 8 is A, C, or T; X 9 is A, C, or T; X 10 is any nucleotide; X 11 is any nucleotide or no nucleotide; and X 12 is A (taken together SEQ ID NO:685).
- X 7 -X 12 are not simultaneously A, T, T, G, C, and A, respectively.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCAT CGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:3); wherein: X 1 is C, G, or T; X 2 is any nucleotide; X 3 is any nucleotide; X 4 is any nucleotide; X 5 is any nucleotide; and X 6 is any nucleotide (taken together SEQ ID NO:686).
- X 1 -X 6 are not simultaneously C, A, T, C, G, and A, respectively.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCAT CGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:3); wherein: X 1 is C or T; X 2 is any nucleotide; X 3 is any nucleotide; X 4 is any nucleotide; X 5 is A, G, or T; and X 6 is any nucleotide (taken together SEQ ID NO:687).
- X 1 -X 6 are not simultaneously C, A, T, C, G, and A, respectively.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCAT CGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:3); wherein: X 1 is C or T; X 2 is any nucleotide; X 3 is any nucleotide; X 4 is G or T; X 5 is A, G, or T; and X 6 is A or G (taken together SEQ ID NO:688).
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCATTGCACCTX 13 X 14 X 15 CCGGATCATGCCGGX 22 X 23 CAGGGAG (SEQ ID NO:5); wherein: X 13 , X 14 , X 15 , X 22 , and X 23 is any nucleotide. [0020] In embodiments, X 13 , X 14 , X 15 , X 22 , and X 23 are not simultaneously G, A, T, C, and G, respectively.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCATTGCACCTX 13 X 14 X 15 CCGGATCATGCCGGX 22 X 23 CAGGGAG (SEQ ID NO:5); wherein: X 13 is A, C, or G; X 14 is any nucleotide; X 15 is C, G, or T; X 22 is T; and X 23 is A, G, or T (taken together SEQ ID NO:689).
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO:6); wherein: X 16 is any nucleotide; X 17 is any nucleotide; X 18 is any nucleotide; X 19 is any nucleotide; X 20 is any nucleotide; and X 21 is C, G, T (taken together SEQ ID NO:690).
- X 16 -X 21 are not simultaneously A, T, C, A, T, and G, respectively.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO:6); wherein: X 16 is G or T; X 17 is A or T; X 18 is any nucleotide; X 19 is A or G; X 20 is A, G, T; and X 21 is C, G, T (taken together SEQ ID NO:691).
- the aptamer encoding sequence comprises a sequence that is at least 95% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 1 and 7-558. In embodiments, the aptamer encoding sequence comprises a sequence that is is selected from the group consisting of SEQ ID NOs: 1 and 7-558. [0026] In embodiments, the aptamer encoding sequence comprises a sequence that is at least 95% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-17, 89-96, 174-349, and 358-583.
- the aptamer encoding sequence comprises a sequence that is selected from the group consisting of SEQ ID NOs: 7- 17, 89-96, 174-349, and 358-583. [0027] In embodiments, the aptamer encoding sequence comprises a sequence that is at least 95% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-11, 89-94, 174-349, and 358-447. In embodiments, the aptamer encoding sequence comprises a sequence that is selected from the group consisting of SEQ ID NOs: 7- 11, 89-94, 174-349, and 358-447.
- the aptamer encoding sequence comprises a sequence that is at least 95% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 174, 358, 363, and 378. In embodiments, the aptamer encoding sequence comprises a sequence that is selected from the group consisting of SEQ ID NOs: 174, 358, 363, and 378. [0029] In embodiments, the aptamer sequence disclosed herein, further comprises additional sequence at the 5′ and 3′ ends that is complementary and capable of forming part of the aptamer P1 stem.
- this P1 stem of the aptamer is, comprises, or overlaps with the effector region of the riboswitches disclosed herein.
- the aptamer P1 stem comprises a 5′ splice site sequence of a 3′ intron and sequence complementary thereto.
- the P1 stem may comprise A G G G T G A G T; A A A G T A A G C; G C A G TA A G T; G A G G T G T G G; A/C A G G T A/G A G T; N A G G T A/G A G T; N A G G T A A G T; A/C A/T G G T A N G T; or N A G/A G T A A G T (where N can be A, G, C, or T).
- the aptamers disclosed herein bind to one or more of the small molecules of Formula I to XXII, including those listed in Table A.
- the disclosure provides the RNA aptamer encoded by the aptamer encoding sequences disclosed herein. [0032] In one aspect, the disclosure provides nucleic acid sequence encoding a recombinant riboswitch for the regulation of target gene expression in response to a small molecule, wherein the riboswitch comprises an aptamer disclosed herein.
- the disclosure provides a polynucleotide cassette for regulating the expression of a target gene, wherein the polynucleotide cassette comprises a sequence encoding an aptamer that binds to a small molecule, wherein the aptamer encoding sequence comprises an aptamer encoding sequence disclosed herein.
- the polynucleotide cassette comprises sequence encoding: (a) a riboswitch; and (b) an alternatively-spliced exon, flanked by a 5′ intron and a 3′ intron, wherein the riboswitch comprises (i) an effector region comprising a stem forming sequence that includes the 5′ splice site sequence of the 3′ intron (and sequence complementary to the 5′ splice site sequence of the 3′ intron), and (ii) the aptamer comprises an aptamer sequence disclosed herein; and wherein the alternatively-spliced exon comprises a stop codon that is in-frame with the target gene when the alternatively-spliced exon is spliced into the target gene mRNA.
- the effector stem is, or comprises, a P1 stem of the aptamers disclosed herein.
- the effector stem comprises a first sequence that is linked to the 5′ end of the aptamers disclosed herein and a second sequence that is linked to the 3′ end of the aptamers disclosed herein.
- the polynucleotide cassette is located in the protein coding sequence of the target gene. In embodiments, the polynucleotide cassette is located in an untranslated region of the target gene or in an intron of the target gene.
- the small molecule has the structure according to Formula I: wherein X 1 , X 2 , and X 3 are, in each instance, independently selected from CR 1 , CHR 1 , N, NH, O and S, wherein adjacent X 1 , X 2 , and X 3 are not simultaneously selected to be O or S; the dashed lines represent optional double bonds; Y 1 , Y 2 , and Y 3 are, in each instance, independently selected from CR 2 and N; n is 1 or 2, wherein when n is 1, only one of the dashed lines is a double bond; L-A is or L is selected from
- the small molecule has a structure according to Formula II-XXII, including, e.g., a structure provided in Table A.
- the disclosure provides a vector comprising a polynucleotide cassette, an aptamer encoding sequence/aptamer sequence, or riboswitch disclosed herein.
- the vector is a viral vector or a non-viral vector.
- the viral vector is an adenoviral vector, an adeno-associated virus vector, and a lentiviral vector.
- the disclosure provides a cell comprising a vector, a polynucleotide cassette, an aptamer encoding sequence/aptamer sequence, or riboswitch disclosed herein.
- the disclosure also provides methods for modulating the expression of a target gene using a polynucleotide cassette, an aptamer encoding sequence/aptamer sequence, or riboswitch disclosed herein, by provided to a cell or tissue a small molecule of Formula I- XXII, including, e.g., a small molecule provided in Table A.
- Figures 1a-1d Figures 1a-1d.
- TPP aptamer homologous sequence regulates gene expression in response to TPP and fursultiamine.
- Fig.1a schematics of the synthetic riboswitch cassette containing intron-alternative exon-aptamer-intron.
- Fig.1b In the presence of aptamer ligand, aptamer ligand binding facilitates for the formation of hairpin stem that sequesters the accessibility of the 5’ splice site (5’ ss) of the alternative exon, resulting in the exclusion of the stop codon containing alternative exon and target gene expression.
- Riboswitch 12C6-1 regulates luciferase gene expression in response to TPP (Fig.1c) and fursultiamine (Fig.1d) treatment.
- HEK 293 cells were transfected with luciferase construct containing 12C6-1 riboswitch.
- the transfected cells were treated with TPP or fursultiamine at the indicated concentrations.
- the fold induction was calculated as the quotient of the luciferase activity obtained from cells treated with compounds divided by the luciferase activity obtained from cells without compound treatment.
- Figures 2a-2d Figures 2a-2d.
- Comp.004 activates TPP aptamer riboswitches in regulating luciferase expression in HEK 293 cells.
- Cells were transfected with the indicated riboswitch constructs and treated with various concentration of Comp.004.
- Luciferase activity was measured 20 hours post compound treatment, and fold induction was calculated as the quotient of the luciferase activity obtained from cells treated with compounds divided by the luciferase activity obtained from cells without treatment.
- Riboswitch containing E.Coli thiM or Alishewanella tabrizica thiC aptamer (Fig.2a, 2b) or 12C6-1 aptamer (Fig.2c, 2d) regulates luciferase expression in response to Comp.004 treatment.
- Fig.3a The predicated secondary structure of the 12C6-1 aptamer sequence with the flanking C and the U1 binding sequence at the 5′ end and the flanking G and the complementary sequence of U1 binding site at the 3′ end, respectively.
- Fig.3b 12C6-1 parent sequence and the template sequence for each aptamer library with N denoting a random base.
- Figures 4a-4e Riboswitches containing aptamers derived from 12C-1 regulate luciferase expression in HEK 293 cells in response to treatment with Comp.004 (Figs.4a, 4b, and 4c) and analogues (Figs.4d and 4e).
- Fig.4d Compounds analogous to Comp.004 (Comps.003, 005, 008, 009, and 011) bind 12C6-1 and activate derivative riboswitches in regulating Luciferase expression. The fold induction was calculated as the quotient of the luciferase activity obtained from cells treated with compounds divided by the luciferase activity obtained from cells without treatment.
- Fig.4e Additional analogues (Comps.012, 013, 014, 015, 016, 018, and 019) regulate expression in a dose-dependent fashion.
- Figures 5a-5d Riboswitch-regulated expression of mouse Epo gene and human growth hormone gene in mammalian cells.
- Fig.5a Riboswitch 12G6 and 1C11 regulate mEpo expression in AML12 cells in response to Comp.004 treatment.
- Fig.5b the fold induction of mEpo by Comp.004. The fold induction was calculated as the quotient of the mEpo level obtained from cells treated with Comp.004 divided by mEpo level obtained from cells without compound treatment.
- Fig.5c Riboswitch regulates mEpo expression in C1C12 cells in response to Comp.004 treatment.
- Fig.5d Riboswitch regulates mEpo expression in HEK 293 cells in response to Comp.004 treatment.
- Figures 6a-6d Riboswitch-regulated luciferase expression in the muscle and liver in mice.
- Fig.6a Bioluminescence image of a representative mouse from each AAV-injected group before and after Comp.004 treatment.
- Fig.6c Balb/c mice were injected intravenously (I.V.) with the indicated amounts of AAV8.Luci.Con1 (non- regulatable) or AAV8.Luci.12G6 (regulatable) and administered orally with the indicated doses of Comp.004.
- Fig.6d shows luciferase expression in liver from AAV8.Luci.Con1 and AAV8.Luci.12G6 following dose of 30 mg/kg Comp.004.
- Figures 7a-7c Riboswitch-regulated luciferase expression in the muscle in mice.
- Figs.7a-7b Balb/c mice were injected intramuscularly (I.M.) with AAV8.Luci.Con1 (non-regulatable) or AAV8.Luci.12G6 (regulatable) and administered orally with the indicated doses of Comp.004. The luciferase activity was measured at the indicated time points post compound oral dosing.
- Fig.7a Bioluminescence image of a representative mouse from each AAV-injected group before and after Comp.004 treatment.
- Fig.7c Balb/c mice were injected intramuscularly with the indicated amounts of AAV8.Luci.Con1 (non-regulatable) or AAV8.Luci.12G6 (regulatable) and administered orally with the indicated doses of Comp. 004.
- Figure 8. Riboswitch-regulated mouse Epo expression in the muscle in vivo.
- FIG. 9a-9b Expression of Erythropoietin (Epo) restores hemocrit in chronic kidney disease (CKD) associated anemia in a dose response to oral small molecule.
- Epo Erythropoietin
- the effect of riboswitch-regulated expression of Epo on hematocrit was evaluated in a mouse model of chronic kidney disease (CKD)-associated anemia. After 20 doses of compound 004 by oral administration, the hematocrit of anemic mice was increased, with the biggest increase in the 100 mg/kg dose group.
- aptamer sequences that bind to, or otherwise respond to the presence of, small molecules of Formula I-XXII.
- the aptamer sequences provided herein are useful for the regulation of the expression of a target gene in response to the presence or absence of the small molecule ligand.
- recombinant riboswitches comprising the aptamer sequences disclosed herein, as well as recombinant polynucleotide cassettes for regulating the expression of a target gene, wherein the polynucleotide cassettes comprise sequences encoding the riboswitches disclosed herein.
- aptamers are single-stranded nucleic acid molecules that non-covalently bind to specific ligands with high affinity and specificity by folding into three-dimensional structures.
- Aptamer ligands include ions, small molecules, proteins, viruses, and cells.
- Aptamer ligands can be, for example, an organic compound, amino acid, steroid, carbohydrate, or nucleotide.
- Non-limiting examples of small molecule aptamer ligands include antibiotics, therapeutics, dyes, cofactors, metabolites, molecular markers, neurotransmitters, pollutants, toxins, food adulterants, carcinogens, drugs of abuse.
- aptamers are useful for the detection of small molecules.
- Application of small-molecule detection by aptamers include environmental monitoring, food safety, medicine (including diagnostics), microbiology, analytical chemistry, forensic science, agriculture, and basic biology research.
- the term "aptamer” as used herein refers to an RNA polynucleotide (or DNA sequence encoding the RNA polynucleotide) that specifically binds to a class of ligands.
- ligand refers to a molecule that is specifically bound by an aptamer. Aptamers have binding regions that are capable of forming complexes with an intended target molecule (i.e., the ligand). An aptamer will typically be between about 15 and about 200 nucleotides in length. More commonly, an aptamer will be between about 30 and about 100 nucleotides in length, for example, 70 to 90 nucleotides in length. Aptamers typically comprise multiple paired (P) regions in which the aptamer forms a stem and unpaired regions where the aptamer forms a joining (J) region or a loop (L) region.
- P paired
- the paired regions can be numbered sequentially starting at the 5' end (P1) and numbering each stem sequentially (P2, P3, etc.).
- the loops (LI, L2, etc.) are numbered based on the adjacent paired region and the joining regions are numbered according to the paired regions that they link.
- the disclosure provides an aptamer that binds to a small molecule (e.g., one or more of the small molecules disclosed herein), wherein the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCAT CGACCCX 7 X 8 X 9 X 10 X 11 X 12 CCTX 13 X 14 X 15 CCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGX 22 X 23 C AGGGAG (SEQ ID NO:2); wherein: X 1 is C G, or T; X 2 - X 5 is any nucleotide; X 6 is any nucleotideX 7 is A, G, or T; X 8 - X 10 is any nucleotide; X 11 is any nucleotide or no nucleotide; X 12 is A, C
- the disclosure provides an aptamer that binds to a small molecule, wherein the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCAT CGACCCX 7 X 8 X 9 X 10 X 11 X 12 CCTX 13 X 14 X 15 CCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGX 22 X 23 C AGGGAG (SEQ ID NO:2); wherein: X 1 is C or T; X 2 is any nucleotide; X 3 is any nucleotide; X 4 is G or T; X 5 is A, G, or T; X 6 is A or G; X
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCAT CGACCCX 7 X 8 X 9 X 10 X 11 X 12 CCTX 13 X 14 X 15 CCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGX 22 X 23 C AGGGAG (SEQ ID NO:2); wherein: X 1 is C or T; X 2 is any nucleotide; X 3 is any nucleotide; X 4 is G or T; X 5 is A, G, or T; X 6 is A or G; X 7 is A; X 8 is A, C, or T; X 9 is A, C, or T; X 10 is any nucleotide; X 11 is any nucleotide or no nucleotide; X 12 is A; X 13 is
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCX 7 X 8 X 9 X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4); wherein: X 7 is A, G, or T; X 8 is any nucleotide; X 9 is any nucleotide; X 10 is any nucleotide; X 11 is any nucleotide or no nucleotide; X 12 is A, C, or T (taken together SEQ ID NO:683).
- X 7 -X 12 are not simultaneously A, T, T, G, C, and A, respectively.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCX 7 X 8 X 9 X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4); wherein: X 7 is A or T; X 8 is A, C, or T; X 9 is A, C, or T; X 10 is any nucleotide; X 11 is any nucleotide or no nucleotide; and X 12 is A (taken together SEQ ID NO:684).
- X 7 -X 12 are not simultaneously A, T, T, G, C, and A, respectively.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCX 7 X 8 X 9 X 10 X 11 X 12 CCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:4); wherein: X 7 is A; X 8 is A, C, or T; X 9 is A, C, or T; X 10 is any nucleotide; X 11 is any nucleotide or no nucleotide; and X 12 is A (taken together SEQ ID NO:685).
- X 7 -X 12 are not simultaneously A, T, T, G, C, and A, respectively.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCAT CGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:3); wherein: X 1 is C, G, or T; X 2 is any nucleotide; X 3 is any nucleotide; X 4 is any nucleotide; X 5 is any nucleotide; and X 6 is any nucleotide (taken together SEQ ID NO:686).
- X 1 -X 6 are not simultaneously C, A, T, C, G, and A, respectively.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCAT CGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:3); wherein: X 1 is C or T; X 2 is any nucleotide; X 3 is any nucleotide; X 4 is any nucleotide; X 5 is A, G, or T; and X 6 is any nucleotide (taken together SEQ ID NO:687).
- X 1 -X 6 are not simultaneously C, A, T, C, G, and A, respectively.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGX 1 X 2 AX 3 X 4 X 5 X 6 CCAT CGACCCATTGCACCTGATCCGGATCATGCCGGCGCAGGGAG (SEQ ID NO:3); wherein: X 1 is C or T; X 2 is any nucleotide; X 3 is any nucleotide; X 4 is G or T; X 5 is A, G, or T; and X 6 is A or G (taken together SEQ ID NO:688).
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCATTGCACCTX 13 X 14 X 15 CCGGATCATGCCGGX 22 X 23 CAGGGAG (SEQ ID NO:5); wherein: X 13 , X 14 , X 15 , X 22 , and X 23 is any nucleotide. [0073] In embodiments, X 13 , X 14 , X 15 , X 22 , and X 23 are not simultaneously G, A, T, C, and G, respectively.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCATTGCACCTX 13 X 14 X 15 CCGGATCATGCCGGX 22 X 23 CAGGGAG (SEQ ID NO:5); wherein: X 13 is A, C, or G; X 14 is any nucleotide; X 15 is C, G, or T; X 22 is T; and X 23 is A, G, or T (taken together SEQ ID NO:689).
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO:6); wherein: X 16 is any nucleotide; X 17 is any nucleotide; X 18 is any nucleotide; X 19 is any nucleotide; X 20 is any nucleotide; and X 21 is C, G, T (taken together SEQ ID NO:690).
- X 16 -X 21 are not simultaneously A, T, C, A, T, and G, respectively.
- the aptamer encoding sequence comprises: CTGGGGAGTCCTTCATGCGGGGCTGAGAGGATGGAAGCAATCGACCATCGA CCCATTGCACCTGATCCGGX 16 X 17 X 18 X 19 X 20 X 21 CCGGCGCAGGGAG (SEQ ID NO:6); wherein: X 16 is G or T; X 17 is A or T; X 18 is any nucleotide; X 19 is A or G; X 20 is A, G, T; and X 21 is C, G, T (taken together SEQ ID NO:691).
- the aptamer encoding sequence comprises a sequence that is at least 95% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 1 and 7-558. In embodiments, the aptamer encoding sequence comprises a sequence that is is selected from the group consisting of SEQ ID NOs: 1 and 7-558. [0079] In embodiments, the aptamer encoding sequence comprises a sequence that is at least 95% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-17, 89-96, 174-349, and 358-583.
- the aptamer encoding sequence comprises a sequence that is is selected from the group consisting of SEQ ID NOs: 7-17, 89-96, 174-349, and 358-583. [0080] In embodiments, the aptamer encoding sequence comprises a sequence that is at least 95% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 7-11, 89-94, 174-349, and 358-447. In embodiments, the aptamer encoding sequence comprises a sequence that is is selected from the group consisting of SEQ ID NOs: 7-11, 89-94, 174-349, and 358-447.
- the aptamer encoding sequence comprises a sequence that is at least 95% identical, or at least 99% identical to a sequence selected from the group consisting of SEQ ID NOs: 174, 358, 363, and 378. In embodiments, the aptamer encoding sequence comprises a sequence that is selected from the group consisting of SEQ ID NOs: 174, 358, 363, and 378. [0082] In embodiments, the first and the last nucleotide of the aptamer encoding sequence can be any nucleotide or no nucleotide.
- the first two and the last two nucleotides of the aptamer encoding sequence can be any nucleotide or no nucleotide.
- additional sequence that is 5 ⁇ and 3 ⁇ of the aptamer encoding sequence may be present and form part of the stem forming sequence of the riboswitch.
- the disclosure provides the aptamer encoded by the aptamer encoding sequences disclosed herein.
- the ordinarily-skilled artisan would understand that the aptamers described herein may be ribonucleic acid (RNA) molecules.
- aptamers described herein are part of a longer RNA polynucleotide, including, for example, hnRNA, mRNA, siRNA, or miRNA.
- Aptamer Ligands [0086] In embodiments, an aptamer disclosed herein binds to, or otherwise responds to the presence or addition of, a small molecule (ligand) disclosed herein, including small molecules having the structure according to Formula I to XXII, including the small molecules in Table A.
- the small molecule has the structure according to Formula I: wherein X1, X2, and X3 are, in each instance, independently selected from CR1, CHR1, N, NH, O and S, wherein adjacent X 1 , X 2 , and X 3 are not simultaneously selected to be O or S; the dashed lines represent optional double bonds; Y 1 , Y 2 , and Y 3 are, in each instance, independently selected from CR 2 and N; n is 1 or 2, wherein when n is 1, only one of the dashed lines is a double bond; O L-A is , or L is selected from
- the small molecule has the structure according to Formula II: Formula (II) wherein X 1 , X 2 , and X 3 are, in each instance, independently selected from CR 1 , CHR 1 , N, NH, O and S, wherein adjacent X 1 , X 2 , and X 3 are not simultaneously selected to be O or S; the dashed lines represent optional double bonds; Y 1 , Y 2 , and Y 3 are, in each instance, independently selected from CR 2 and N; n is 1 or 2, wherein when n is 1, only one of the dashed lines is a double bond; L is selected from , and , wherein k, p, q, r, and v are independently selected from integers 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10, z is selected from integers 1, 2, 3, 4, and 5; and A is selected from and wherein X 4 , X 5 ,
- X 1 , X 2 , or X 3 is N.
- X 1 is N.
- X 2 is N.
- X 3 is N.
- two of X 1 , X 2 , and X 3 are N.
- X 1 and X 3 are N.
- at least one of Y 1 , Y 2 , and Y 3 is N.
- Y 1 is N.
- Y 2 is N.
- Y 3 is N.
- at least one of Y 1 , Y 2 , and Y 3 is CR 2 .
- Y 1 is CR 2 .
- Y 2 is CR 2 .
- Y 3 is CR 2 .
- n is 2.
- the small molecule has the structure according to Formula III: Formula (III) wherein X 2a and X 2b are independently selected from CR 1 and N; X 1 and X 3 are independently selected from CR 1 and N; L and A are as provided for Formula (II); and two of X 1 , X 2a , X 2b , and X 3 are N.
- the small molecule has the structure according to formula (IV): Formula (IV) wherein L and A are as provided for Formula (II).
- L may be selected from and [0108] As in any above embodiment of a compound, L may be selected to be [0109] In any of the above embodiments, a compound wherein q and r are 0 or 1. [0110] In any of the above embodiments, a compound wherein q is 1. [0111] In any of the above embodiments, a compound wherein r is 1. [0112] In any of the above embodiments, a compound wherein r is 0. [0113] In any of the above embodiments, a compound wherein q and r are 1. [0114] In any of the above embodiments, a compound wherein q is 1 and r is 0.
- a compound wherein m is 1.
- a compound wherein W is selected from NH, O, and N(C 1 -C 6 alkyl).
- a compound wherein W is NH.
- a compound wherein at least one of X 4 , X 5 , X 6 , and X 7 is N.
- a compound wherein X 4 is N.
- a compound wherein X 5 is N.
- a compound wherein X 6 is N.
- a compound wherein X 7 is N.
- a compound wherein X 4 and X 6 are N.
- a compound wherein X 5 and X 7 are N.
- a compound wherein X 5 or X 6 are N, and both X 4 and X 7 are independently CR 2 .
- a compound wherein A is .
- a compound wherein L is or .
- a compound wherein Y 1 , Y 2 , and Y 3 are, in each instance, independently selected from CR 2 and N, wherein R 1 is selected from -H, -Cl, -Br, -I, -F, -OH, and -NH 2 .
- R 1 is selected from -H, -Cl, -Br, -I, -F, -OH, and -NH 2 .
- a compound wherein z is 2.
- a compound wherein Y 2 is N.
- a compound wherein Y 2 is CR 2 and R 1 is selected from -H, -F, -OH, and -NH 2 .
- a compound wherein A is [0134]
- the small molecule has the structure according to formulas: or [0135] In other embodiments, the small molecule has the structure according to formulas:
- a compound wherein at least one of X 1 , X 2 , or X 3 is N.
- a compound wherein X 1 is N.
- a compound wherein X 2 is N.
- a compound wherein X 3 is N.
- a compound wherein, in each instance, two of X 1 , X 2 , and X 3 are N.
- a compound wherein X 1 and X 3 are N.
- a compound wherein at least one of Y 1 , Y 2 , and Y 3 is N.
- a compound wherein Y 1 is N.
- a compound wherein Y 2 is N.
- a compound wherein Y 3 is N.
- a compound wherein at least one of Y 1 , Y 2 , and Y 3 is CR 2 .
- a compound wherein Y 1 is CR 2 .
- a compound wherein Y 2 is CR 2 .
- a compound wherein Y 3 is CR 2 .
- a compound wherein n is 2.
- a compound wherein c, d, e, f, g, h and i are independently selected from integers 1, 2, and 3.
- a compound wherein L 1 is selected from a nd .
- a compound wherein c, d, e, and f are independently selected from integers 1, 2, and 3.
- a compound wherein c, d, and e are 1.
- a compound wherein L 1 is [0160] In the above embodiments, a compound wherein e and f are independently selected from 1, 2, and 3. [0161] In the above embodiments, a compound wherein e and f are 1 or 2. [0162] In the above embodiments, a compound wherein e is 1. [0163] In the above embodiments, a compound wherein f is 2. [0164] In the above embodiments, a compound wherein e is 1 and f is 2. [0165] In the above embodiments, a compound wherein L 1 is [0166] In the above embodiments, a compound wherein c is 1, 2, or 3. [0167] In the above embodiments, a compound wherein c is 1.
- a compound wherein c is 2 [0169] In the above embodiments, a compound wherein c is 3. [0170] In the above embodiments, a compound wherein M is selected from –NH-, -O-, and –S-. [0171] In the above embodiments, a compound wherein M is –NH-. [0172] In the above embodiments, a compound wherein c is 1 and M is –NH-. [0173] In the above embodiments, a compound wherein m is 1. [0174] In the above embodiments, a compound wherein W is selected from -NH-, -O-, and -N(C 1 -C 6 alkyl)-.
- a compound wherein W is -NH-.
- a compound wherein at least one of X 4 , X 5 , X 6 , and X 7 is N.
- a compound wherein X 4 is N.
- a compound wherein X 5 is N.
- a compound wherein X 6 is N.
- a compound wherein X 7 is N.
- a compound wherein X4 and X6 are N.
- a compound wherein X 5 and X 7 are N.
- a compound wherein X 5 or X 6 are N, and both X 4 and X 7 are independently CR 2 .
- a compound wherein A is
- the small molecule has a structure of formula (IX): Formula (IX) wherein X 1 , X 2 , and X 3 are, in each instance, independently selected from CR 1 , CHR 1 , N, NH, O and S, wherein adjacent X 1 , X 2 and X 3 are not simultaneously selected to be O or S; the dashed lines represent optional double bonds; Y 1 , Y 2 , and Y 3 are, in each instance, independently selected from CR 2 and N; R 1 and R 2 are independently selected from -H, -Cl, -Br, -I, -F, -CF 3 , -OH, -CN, -NO 2 , -NH 2 , -NH(C 1 -C 6 alkyl), -N(C 1 -C 6 alkyl) 2 , -COOH
- a compound wherein B is –NH-.
- a compound wherein y is an integer selected from 1, 2, and 3.
- a compound wherein y is 1 or 3.
- a compound wherein at least one of Y 1 , Y 2 , and Y 3 is N.
- a compound wherein Y 1 is N.
- a compound wherein Y 2 is N.
- a compound wherein Y 3 is N.
- a compound wherein at least one of Y 1 , Y 2 , and Y 3 is CR 2 .
- a compound wherein Y 1 is CR 2 .
- a compound wherein Y 2 is CR 2 .
- a compound wherein Y 3 is CR 2 .
- a compound wherein at least one of X 1 , X 2 , or X 3 is N.
- a compound wherein y is 1.
- a compound wherein y is 3.
- a compound wherein B is -NH-.
- the small molecule has a structure according to formula XIII or a pharmaceutically acceptable salt thereof, wherein X 4 is selected from CH, CR d and N; X 6 is selected from CH, CR d and N; X 7 is selected from CH, CR d and N; wherein 0 or 1 of X 4 , X 6 or X 7 is N; A is selected from the group consisting of: X a is selected from N and CH; X b is selected from O, NH, and NCH 3 ; each R a is independently selected from C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl and amino; or additionally or alternatively, two R a attached to the same carbon atom form an oxo group; or two R a attached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered hetero
- x may be selected to be 1, 2 or 3; x may be selected to be 1 or 2; or, x may be selected to be 1.
- R a may be selected to be methyl, fluoro or chloro; or R a may be selected to be methyl.
- x may be 0.
- y may be selected to be 0 or 1.
- R b may be selected from halo or methyl; or R b may be selected to be methyl.
- w may be selected from 0 or 1.
- R c may be selected from halo or methyl; or R c may be selected from F, Cl or methyl.
- each R d may be selected from halo, C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, and -CHF 2 ; or R d may be selected from CH 3 , CH 2 F, CHF 2 , CF 3 , F, Cl, Br, and OCH 3 .
- two R d on adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.
- X a may be N.
- X b may be O.
- a is selected to be a x is 1, 2 or 3; and/or two R d on adjacent ring positions are taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.
- the small molecule has a structure according to formula XIV or a pharmaceutically acceptable salt thereof, wherein A is selected from the group consisting of: and X a is selected from N and CH; each R a is independently selected from C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl and amino; or additionally or alternatively, two R a attached to the same carbon atom form an oxo group; or two R a attached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; each R b is independently selected from C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl and amino; or additionally or alternatively, two R b attached to the
- x may be selected to be 1, 2 or 3; x may be selected to be 1 or 2; or, x may be selected to be 1.
- R a may be selected to be methyl, fluoro or chloro; or R a may be selected to be methyl.
- x may be 0.
- y may be selected to be 0 or 1.
- R b may be selected from halo or methyl; or R b may be selected to be methyl.
- w may be selected from 0 or 1.
- R c may be selected from halo or methyl; or R c may be selected from F, Cl or methyl.
- z may be selected to be 1 or 2; or z may be selected to be 1.
- Each R d may be independently selected from halo, C 1 to C 3 alkyl, - OCH 3 , -CF 3 , -CH 2 F, and -CHF 2 ; or R d may be selected from CH 3 , CH 2 F, CHF 2 , CF 3 , F, Cl, Br, and OCH 3 .
- two R d on adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.
- z may be 0.
- X a may be N.
- a is selected to be x is 1, 2 or 3; and/or two R d on adjacent ring positions are taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.
- the small molecule has a structure according to formula XV or a pharmaceutically acceptable salt thereof, wherein A is selected from the group consisting of: and each R a is independently selected from C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl and amino; or additionally or alternatively, two R a attached to the same carbon atom form an oxo group; or two R a attached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; each R b is independently selected from C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl and amino; or additionally or alternatively, two R b attached to the same carbon atom form an oxo group
- x may be selected to be 1, 2 or 3; x may be selected to be 1 or 2; or, x may be selected to be 1.
- R a may be selected to be methyl, fluoro or chloro; or R a may be selected to be methyl.
- x may be 0.
- y may be selected to be 0 or 1.
- R b may be selected from halo or methyl; or R b may be selected to be methyl.
- w may be selected from 0 or 1.
- R c may be selected from halo or methyl; or R c may be selected from F, Cl or methyl.
- z may be selected to be 1 or 2; or z may be selected to be 1.
- Each R d may be independently selected from halo, C 1 to C 3 alkyl, - OCH 3 , -CF 3 , -CH 2 F, and -CHF 2 ; or R d may be selected from CH 3 , CH 2 F, CHF 2 , CF 3 , F, Cl, Br, and OCH 3 .
- two R d on adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.
- z may be 0.
- the small molecule has a structure according to formula XVI or a pharmaceutically acceptable salt thereof, wherein X 4 is selected from CH, CR d and N; X 6 is selected from CH, CR d and N; X 7 is selected from CH, CR d and N; wherein 0 or 1 of X 4 , X 6 or X 7 is N; X a is selected from N and CH; each R a is independently selected from C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl and amino; or additionally or alternatively, two R a attached to the same carbon atom form an oxo group; or two R a attached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; m is 1 or 2; x is
- x may be selected to be 1, 2 or 3; x may be selected to be 1 or 2; or, x may be selected to be 1.
- R a may be selected to be methyl, fluoro or chloro; or R a may be selected to be methyl.
- x may be 0.
- w may be selected from 0 or 1.
- R c may be selected from halo or methyl; or R c may be selected from F, Cl or methyl.
- each R d may be selected from halo, C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, and -CHF 2 ; or R d may be selected from CH 3 , CH 2 F, CHF 2 , CF 3 , F, Cl, Br, and OCH 3 .
- two R d on adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.
- X a may be N.
- X b may be O.
- x is 1, 2 or 3; and/or two R d on adjacent ring positions are taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.
- the small molecule has a structure according to formula XVII or a pharmaceutically acceptable salt thereof, wherein each R a is independently selected from C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl and amino; or additionally or alternatively, two R a attached to the same carbon atom form an oxo group; or two R a attached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; each R c is independently selected from halo, C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , - CN, hydroxyl and amino; each R d is independently selected from halo, C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH
- x may be selected to be 1, 2 or 3; x may be selected to be 1 or 2; or, x may be selected to be 1.
- R a may be selected to be methyl, fluoro or chloro; or R a may be selected to be methyl.
- x may be 0.
- w may be selected from 0 or 1.
- R c may be selected from halo or methyl; or R c may be selected from F, Cl or methyl.
- z may be selected to be 1 or 2; or z may be selected to be 1.
- Each R d may be independently selected from halo, C 1 to C 3 alkyl, - OCH 3 , -CF 3 , -CH 2 F, and -CHF 2 ; or each R d may be independently selected from CH 3 , CH 2 F, CHF 2 , CF 3 , F, Cl, Br, and OCH 3 .
- two R d on adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.
- x is 1, 2 or 3; and/or two R d on adjacent ring positions are taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.
- the small molecule has a structure according to formula XVIII a or a pharmaceutically acceptable salt thereof, wherein each R a is independently selected from methyl, halo, hydroxyl and amino; each R c is independently selected from methyl, halo, hydroxyl and amino; each R d is independently selected from methyl, halo, hydroxyl and amino; x is 0, 1, 2 or 3; w is 0, 1 or 2; and z is 0, 1 or 2. [0245] For the compounds according to formula XVIII, x may be selected to be 1, 2 or 3; x may be selected to be 1 or 2; or, x may be selected to be 1.
- R a may be selected to be methyl, fluoro or chloro; or R a may be selected to be methyl.
- x may be 0.
- w may be selected from 0 or 1.
- R c may be selected from halo or methyl; or R c may be selected from F, Cl or methyl.
- z may be selected to be 0 or 1; or z may be selected to be 1.
- the small molecule has a structure according to formula XIX: or a pharmaceutically acceptable salt thereof, wherein R a is selected from C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl and amino; or additionally or alternatively; each R c is independently selected from halo, C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , - CN, hydroxyl and amino; each R d is independently selected from halo, C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , - CN, hydroxyl and amino; alternatively, two R d on adjacent ring positions may be taken together to form a 5- or 6- membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and
- R a may be selected from methyl, halo, hydroxyl and amino; R a may be selected to be methyl, fluoro or chloro; or R a may be selected to be methyl.
- each R c may be independently selected from methyl, halo, hydroxyl and amino.
- each R d may be independently selected from methyl, halo, hydroxyl and amino.
- the small molecule has a structure according to formula XX or a pharmaceutically acceptable salt thereof, wherein X 4 is selected from CH, CR d and N; X 6 is selected from CH, CR d and N; X 7 is selected from CH, CR d and N; wherein 0 or 1 of X 4 , X 6 or X 7 is N; X b is selected from O, NH, and NCH 3 ; each R b is independently selected from C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl and amino; or additionally or alternatively, two R b attached to the same carbon atom form an oxo group; or two R b attached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; m is
- y may be selected to be 0 or 1.
- R b may be selected from halo or methyl; or R b may be selected to be methyl.
- w may be selected from 0 or 1.
- R c may be selected from halo or methyl; or R c may be selected from F, Cl or methyl.
- each R d may be selected from halo, C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, and -CHF 2 ; or R d may be selected from CH 3 , CH 2 F, CHF 2 , CF 3 , F, Cl, Br, and OCH 3 .
- two R d on adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.
- X b may be O.
- the small molecule has a structure according to formula XXI or a pharmaceutically acceptable salt thereof, wherein each R b is independently selected from C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl and amino; or additionally or alternatively, two R b attached to the same carbon atom form an oxo group; or two R b attached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; each R c is independently selected from halo, C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , - CN, hydroxyl and amino; each R d is independently selected from halo, C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH
- y may be selected to be 0 or 1.
- R b may be selected from halo or methyl; or R b may be selected to be methyl.
- w may be selected from 0 or 1.
- R c may be selected from halo or methyl; or R c may be selected from F, Cl or methyl.
- each R d may be selected from halo, C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, and -CHF 2 ; or R d may be selected from CH 3 , CH 2 F, CHF 2 , CF 3 , F, Cl, Br, and OCH 3 .
- two R d on adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.
- the small molecule has a structure according to formula XXII or a pharmaceutically acceptable salt thereof, wherein each R b is independently selected from C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , halo, hydroxyl and amino; or additionally or alternatively, two R b attached to the same carbon atom form an oxo group; or two R b attached to different carbon atoms form a 4- to 6- membered carbocyclic ring or a 4- to 6- membered heterocyclic ring having 1 or 2 heteroatoms selected from O and NH; each R c is independently selected from halo, C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, -CHF 2 , - CN, hydroxyl and amino; each R d is independently selected from halo, C 1 to C 3 alkyl, -OCH 3 ,
- y may be selected to be 0 or 1.
- R b may be selected from methyl, halo, hydroxyl and amino; or R b may be selected from halo or methyl; or R b may be selected to be methyl.
- w may be selected from 0 or 1.
- R c may be selected from methyl, halo, hydroxyl and amino; or R c may be selected from halo or methyl; or R c may be selected from F, Cl or methyl.
- each R d may be selected from halo, C 1 to C 3 alkyl, -OCH 3 , -CF 3 , -CH 2 F, and -CHF 2 ; or R d my be selected from methyl, halo, hydroxyl and amino; or R d may be selected from CH 3 , CH 2 F, CHF 2 , CF 3 , F, Cl, Br, and OCH 3 .
- two R d on adjacent ring positions may be taken together to form a 5- or 6-membered aromatic ring having from 0 to 2 heteroatoms selected from O, S, N and NH.
- the small molecule has a structure according to the compounds in Table A (or a pharmaceutically acceptable salt thereof): Table A.
- the aptamer disclosed herein binds to, or otherwise responds to the presence of one or more of the following compounds (or a pharmaceutically acceptable salt thereof): NH
- alkyl refers to the radical of saturated aliphatic groups, including straight-chain alkyl groups and branched-chain alkyl groups. In preferred embodiments, a straight chain or branched chain alkyl has 6 or fewer carbon atoms in its backbone (e.g., C 1 - C 6 for straight chain, C 3 -C 6 for branched chain).
- Alkyl groups include methyl, ethyl, propyl, isopropyl, n-butyl, iso-butyl, tert-butyl, pentyl, isopentyl, hexyl, and the like.
- substituted alkyl refers to an alkyl group which has from 1 to 4 substituents independently selected from halo, amino, amido, sulfonamido, OH, OCH 3 , nitro and CN.
- cycloalkyl refers to saturated, carbocyclic groups having from 3 to 6 carbons in the ring. Cycloalkyl groups include cyclopropyl, cyclobutyl, cyclopentyl and cyclohexyl.
- bicyclyl refers to saturated carbocyclic groups having two joined ring systems, which may be fused or bridged.
- Bicyclic groups include bicycle[2.1.1]hexane, bicycle[2.2.1]heptane, decalin, and the like.
- the term “tricyclyl” refers to saturated carbocyclic groups having three joined ring systems, which may be fused and/or bridged. Tricyclic groups include adamantane and the like.
- Carbocyclic refers to ring system that comprise only carbon atoms as ring atoms (i.e., the ring system does not have a heteroatom as a ring atom). Carbocyclic ring systems may be unsaturated, but preferred carbocyclic rings are not aromatic.
- alkenyl refers to unsaturated aliphatic groups, including straight-chain alkenyl groups and branched-chain alkenyl groups, having at least one carbon-carbon double bond. In preferred embodiments, the alkenyl group has two to six carbon atoms (e.g., C 2 -C 6 alkenyl).
- halogen or "halo” designates -F, -Cl, -Br or -I, and preferably -F, -Cl or -Br.
- alkoxyl or “alkoxy” as used herein refers to an alkyl group, as defined above, that is attached through an oxygen atom.
- alkoxyl groups include methoxy, ethoxy, propyloxy, tert-butoxy and the like.
- amine and “amino” refer to both unsubstituted and substituted amines, e.g., a moiety that can be represented by the general formula: [0275] wherein R and R' are each independently selected from H and C 1 -C 3 alkyl.
- amido refer to both unsubstituted and substituted amide substituents, e.g., a moiety that can be represented by the general formula: [0277] wherein R and R' are each independently selected from H and C 1 -C 3 alkyl.
- sulfonamide or “sulfonamido” refer to both unsubstituted and substituted sulfonamide substituents, e.g., a moiety that can be represented by the general formula: [0279] wherein R and R' are each independently selected from H and C 1 -C 3 alkyl.
- aryl as used herein includes 5- and 6-membered single-ring aromatic groups that may include from zero to four heteroatoms, for example, benzene, pyrene, pyrrole, furan, thiophene, imidazole, oxazole, thiazole, triazole, pyrazole, pyridine, pyrazine, pyridazine and pyrimidine.
- aryl heterocycles or "heteroaryl” groups.
- aryl also includes polycyclic ring systems having two or more cyclic rings in which two or more carbons are common to two adjoining rings (the rings are "fused rings") wherein at least one of the rings is aromatic. Accordingly, aryl includes 8- to 10-membered fused bicyclic aromatic groups that may include from zero to five heteroatoms, in which one or both rings are aromatic, for example napthylene, quinolone, isoquinoline, benzo[b]thiophene, tetrahydronapthelene, and the like.
- Each aryl group may be unsubstituted or may be substituted with 1 to 5 substituents selected from halogen, hydroxyl, amino, cyano, amido, sulfonamide, nitro, -SH, C 1 -C 6 alkyl, C 2 -C 6 alkenyl, C 3 -C 7 cycloalkyl, C 6 -C 10 bicyclyl, C 1 -C 6 haloalkyl, C 1 -C 6 perhaloalkyl, -O-(C 1 -C 6 alkyl), O-(C 3 -C 7 cycloalkyl), -O-(C 1 -C 6 haloalkyl), - O-(C 1 -C 6 perhaloalkyl), aryl, -O-aryl, -(C 1 -C 6 alkyl)-aryl, -O-(C 1 -C 6 alkyl)-aryl, -S-(C 1 -C 6
- heterocycle of “heterocyclyl” refer to non-aromatic heterocycles having from 1 to 3 ring heteroatoms. Preferred heterocycles are 5- and 6-membered heterocyclic groups having from 1 to 3 heteroatoms selected from the group consisting of O, N and S.
- heteroatom as used herein means an atom of any element other than carbon or hydrogen. Preferred heteroatoms are nitrogen, oxygen, and sulfur.
- substitution or “substituted with” includes the implicit proviso that such substitution is in accordance with permitted valence of the substituted atom and the substituent, and that the substitution results in a stable compound, e.g., which does not spontaneously undergo transformation such as by rearrangement, cyclization, elimination, etc.
- the aptamer ligands disclosed herein may exist in particular geometric or stereoisomeric forms well as mixtures thereof.
- Such geometric or stereoisomeric forms include, but not limited to, cis- and trans-isomers, R- and S-enantiomers, diastereomers, (D)- isomers, (L)-isomers, the racemic mixtures thereof, and other mixtures thereof. Additional asymmetric carbon atoms may be present in a substituent such as an alkyl group.
- the compounds according to Formulas I to XXII may contain an acidic or basic functional group, and accordingly may be present in a salt form.
- the salt form is a pharmaceutically acceptable salt.
- pharmaceutically-acceptable salts in this respect, refers to the relatively non-toxic, inorganic and organic acid and base addition salts of the compounds disclosed herein.
- the compounds according to Formulas I to XXII may contain one or more basic functional group, such as amino or alkylamino, and are, thus, capable of forming pharmaceutically-acceptable salts with pharmaceutically-acceptable acids.
- These salts can be prepared in situ in the administration vehicle or the dosage form manufacturing process, or by separately reacting a purified compound disclosed herein in its free base form with a suitable organic or inorganic acid, and isolating the salt thus formed during subsequent purification.
- Representative salts include the hydrobromide, hydrochloride, sulfate, bisulfate, phosphate, nitrate, acetate, valerate, oleate, palmitate, stearate, laurate, benzoate, lactate, phosphate, tosylate, citrate, maleate, fumarate, succinate, tartrate, napthylate, mesylate, glucoheptonate, lactobionate, and laurylsulphonate salts and the like (see, e.g., Berge et al. (1977) "Pharmaceutical Salts", J. Pharm. Sci.66:1-19).
- the pharmaceutically acceptable salts of the subject compounds include the conventional nontoxic salts or quaternary ammonium salts of the compounds, e.g., from non- toxic organic or inorganic acids.
- such conventional nontoxic salts include those derived from inorganic acids such as hydrochloride, hydrobromic, sulfuric, sulfamic, phosphoric, nitric, and the like; and the salts prepared from organic acids such as acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, palmitic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicyclic, sulfanilic, 2-acetoxybenzoic, fumaric, toluenesulfonic, methanesulfonic, ethane disulfonic, oxalic, isothionic, and the like.
- the compounds according to Formulas I to XXII may contain one or more acidic functional groups and, thus, are capable of forming pharmaceutically-acceptable salts with pharmaceutically-acceptable bases.
- These salts can likewise be prepared in situ in the administration vehicle or the dosage form manufacturing process, or by separately reacting the purified compound in its free acid form with a suitable base, such as the hydroxide, carbonate or bicarbonate of a pharmaceutically-acceptable metal cation, with ammonia, or with a pharmaceutically-acceptable organic primary, secondary or tertiary amine.
- a suitable base such as the hydroxide, carbonate or bicarbonate of a pharmaceutically-acceptable metal cation, with ammonia, or with a pharmaceutically-acceptable organic primary, secondary or tertiary amine.
- Representative alkali or alkaline earth salts include the lithium, sodium, potassium, calcium, magnesium, and aluminum salts and the like.
- organic amines useful for the formation of base addition salts include ethylamine, diethylamine, ethylenediamine, ethanolamine, diethanolamine, piperazine and the like (see, e.g., Berge et al., supra).
- the aptamers provided herein bind to, or otherwise respond to the presence of, one or more compounds of Formula I - XXII provided herein, and/or bind to, or otherwise respond to, a metabolite analog or derivative of a compound of Formula I - XXII.
- the specificity of the binding of an aptamer to its ligand can be defined in terms of the comparative dissociation constants (K d ) of the aptamer for its ligand as compared to the dissociation constant of the aptamer for unrelated molecules.
- the ligand may be considered to be a molecule that binds to the aptamer with greater affinity than to unrelated material.
- the K d for the aptamer with respect to its ligand will be at least about 10- fold less than the K d for the aptamer with unrelated molecules.
- the K d will be at least about 20-fold less, at least about 50-fold less, at least about 100-fold less, and at least about 200-fold less, at least about 500-fold less, at least about 1000-fold less, or at least about 10,000-fold less than the K d for the aptamer with unrelated molecules.
- Aptamers for the regulation of gene expression [0293] In some embodiments, the aptamers contemplated by the disclosure are used for the regulation of gene expression. Regulation of the expression of a target gene (e.g., a therapeutic transgene) is advantageous in a variety of situations.
- the sequence encoding the aptamer is part of a gene regulation cassette that provides the ability to regulate the expression level of a target gene in response to the presence or absence of a small molecule described herein.
- the gene regulation cassette further comprises a target gene.
- target gene refers to a transgene that is expressed in response to the presence or absence of the small molecule ligands disclosed herein due to the small molecule binding to the aptamers disclosed herein.
- the target gene comprises the coding sequence for a protein (e.g., a therapeutic protein), a miRNA, or a siRNA.
- the target gene is heterologous to the aptamer used for the regulation of target gene expression, is heterologous to the polynucleotide cassette used for the regulation of target gene and/or is heterologous to a portion of the polynucleotide cassette used for the regulation of target gene.
- the aptamers described herein can be part of a polynucleotide cassette that encodes the aptamer as part of a riboswitch.
- the terms “gene regulation cassette”, “regulatory cassette”, or “polynucleotide cassette” are used interchangeably herein.
- the presence of a small molecule that binds to an aptamer disclosed herein leads to an increase in expression of a target gene as compared to the expression of the target gene in absence of the small molecule.
- the aptamer constitutes an “on” switch.
- the expression of the target gene is increased by at least 3-fold, by at least 5-fold, by at least 10-fold, by at least 15-fold, by at least 20-fold, by at least 25-fold, by at least 30-fold, by at least 40-fold, by at least 50-fold, by at least 100-fold, by at least 1000-fold, or by at least 10,000-fold in presence of the small molecule that binds to an aptamer disclosed herein as compared to in absence of the small molecule.
- the expression of the target gene is increased by between 2-fold and 10-fold, between 5-fold and 10-fold, between 5-fold and 15-fold, between 5-fold and 20- fold, between 5-fold and 25-fold, between 5-fold and 30-fold, between 10-fold and 20-fold, between 10-fold and 30-fold, between 10-fold and 40-fold, between 10-fold and 50-fold, between 10-fold and 100-fold, between 10-fold and 500-fold, between 10-fold and 1,000- fold, between 50-fold and 100-fold, between 50-fold and 500-fold, between 50-fold and 100- fold, between 50-fold and 1,000-fold, between 100-fold and 1,000-fold, or between 100-fold and 10,000-fold in presence of the small molecule that binds to an aptamer disclosed herein as compared to in absence of the small molecule.
- the presence of a small molecule that binds to an aptamer disclosed herein leads to a decrease in expression of a target gene as compared to the expression of the target gene in the absence of the small molecule.
- the aptamer constitutes an “off” switch.
- the expression of the target gene is decreased by at least 3-fold, by at least 5-fold, by at least 10-fold, by at least 15-fold, by at least 20-fold, by at least 25-fold, by at least 30-fold, by at least 40-fold, by at least 50-fold, by at least 100-fold, by at least 1000-fold, or by at least 10,000-fold in presence of the small molecule that binds to an aptamer disclosed herein as compared to in absence of the small molecule.
- the expression of the target gene is decreased by between 2- fold and 10-fold, between 5-fold and 10-fold, between 5-fold and 15-fold, between 5-fold and 20-fold, between 5-fold and 25-fold, between 5-fold and 30-fold, between 10-fold and 20- fold, between 10-fold and 30-fold, between 10-fold and 40-fold, between 10-fold and 50-fold, between 10-fold and 100-fold, between 10-fold and 500-fold, between 10-fold and 1,000- fold, between 50-fold and 100-fold, between 50-fold and 500-fold, between 50-fold and 100- fold, between 50-fold and 1,000-fold, between 100-fold and 1,000-fold, or between 100-fold and 10,000-fold in presence of the small molecule that binds to an aptamer disclosed herein as compared to in absence of the small molecule.
- the aptamer is part of a riboswitch.
- Riboswitches are regulatory segments of an RNA polynucleotide that regulate the stability of the RNA polynucleotide and/or regulate the production of a protein from the RNA polynucleotide in response to the presence or absence of aptamer-specific ligand molecules.
- the riboswitch comprises a sensor region (e.g., the aptamer region) and an effector region that together are responsible for sensing the presence of a ligand (e.g., a small molecule) and causing an effect that leads to increased or decreased expression of the target gene.
- a ligand e.g., a small molecule
- the riboswitches described herein are recombinant, utilizing polynucleotides from two or more sources.
- the sensor and effector regions are joined by a polynucleotide linker.
- the polynucleotide linker forms a RNA stem or paired region (i.e., a region of the RNA polynucleotide that is double-stranded).
- the paired region linking the aptamer to the effector region comprises all, or some of an aptamer stem (e.g., for example all, or some of the aptamer P1 stem.).
- Riboswitches comprising aptamer sequences may be used, for example, to control the formation of rho-independent transcription termination hairpins leading to premature transcription termination. Riboswitches comprising aptamer sequences may also induce structural changes in the RNA, leading to sequestration for the ribosome binding site and inhibition of translation. Alternative riboswitch structures comprising the aptamer sequences disclosed herein can further affect the splicing of mRNA in response to the presence of the small molecule ligand.
- the aptamers described herein are encoded as part of a gene regulation cassette for the regulation of a target gene by aptamer/ligand mediated alternative splicing of the resulting RNA (e.g., pre-mRNA).
- the gene regulation cassette comprises a riboswitch comprising a sensor region (e.g., the aptamers described herein) and an effector region that together are responsible for sensing the presence of a small molecule ligand and altering splicing to an alternative exon.
- Splicing refers to the process by which an intronic sequence is removed from the nascent pre-messenger RNA (pre-mRNA) and the exons are joined together to form the mRNA.
- Splice sites are junctions between exons and introns, and are defined by different consensus sequences at the 5′ and 3′ ends of the intron (i.e., the splice donor and splice acceptor sites, respectively).
- Splicing is carried out by a large multi-component structure called the spliceosome, which is a collection of small nuclear ribonucleoproteins (snRNPs) and a diverse array of auxiliary proteins.
- snRNPs small nuclear ribonucleoproteins
- the spliceosome defines exon/intron boundaries, removes intronic sequences, and splices together the exons into a final message (e.g., the mRNA).
- a final message e.g., the mRNA
- certain exons can be included or excluded to vary the final coding message thereby changing the resulting expressed protein.
- the regulation of target gene expression is achieved by using any of the DNA constructs disclosed in WO2016/126747, which is hereby incorporated by reference in its entirety.
- the riboswitches and polynucleotide cassettes disclosed in WO2016/126747 comprise an aptamer encoding sequence described herein in place of the aptmer sequence disclosed in WO2016/126747.
- the polynucleotide cassette comprises (a) a riboswitch and (b) an alternatively-spliced exon, flanked by a 5′ intron and a 3′ intron, wherein the riboswitch comprises (i) an effector region comprising a stem forming sequence that includes the 5′ splice site sequence of the 3′ intron (and sequence complementary thereto), and (ii) an aptamer disclosed herein.
- the effector region is a stem forming region that forms the P1 stem of the aptamer (see, e.g., Fig.1b and Fig.3a where the 12C6-1 aptamer sequence is flanked by additional sequence that forms the P1 stem of the aptamer and contains the splice site sequence and sequence complementary thereto).
- the effector stem is, or comprises, the P1 stem of the aptamers disclosed herein.
- the effector stem comprises a first sequence that is linked to the 5′ end of the aptamers disclosed herein and a second sequence that is linked to the 3′ end of the aptamers disclosed herein, wherein the first or second sequence includes the 5′ splice site sequence of the 3′ intron and the other includes sequence complementary to the 5′ splice site sequence of the 3′ intron.
- the effector region comprises the intronic 5′ splice site (“5′ ss”) sequence of the intron that is immediately 3′ of the alternative exon, as well as the sequence complimentary to the 5′ ss sequence of the 3′ intron. [0304] 5′ splice site sequences are well known in the art.
- Exemplary splice site sequences include, but are not limited to: A G G
- the effector region forms a stem and thus prevents splicing to the splice donor site at the 3′ end of the alternative exon.
- the effector region is in a context that provides access to the splice donor site at the 3′ end of the alternative exon, leading to inclusion of the alternative exon in the target gene mRNA.
- the polynucleotide cassette is placed in the target gene to regulate expression of the target gene in response to a ligand.
- the alternatively-spliced exon comprises a stop codon that is in-frame with the target gene when the alternatively-spliced exon is spliced into the target gene mRNA.
- the gene regulation cassette comprises the sequence of SEQ ID NO:676, wherein -X- represents an aptamer encoding sequence disclosed herein. Lower case letters indicate paired stem sequence linking the aptamer to the remainder of the riboswitch.
- the alternative exon (underlined in SEQ ID NO:676, below) is replaced with another alternative exon sequence.
- the alternative exon is flanked by 5′ and 3′ intronic sequences.
- the 5′ and 3′ intronic sequences that can be used in the gene regulation cassettes disclosed herein can be any sequence that can be spliced out of the target gene creating either the target gene mRNA or the target gene comprising the alternative exon in the mRNA, depending upon the presence or absence of a ligand that binds the aptamer.
- the 5′ and 3′ intronic sequences each have the sequences necessary for splicing to occur, i.e., splice donor, splice acceptor and branch point sequences.
- the 5′ and 3′ intronic sequences of the gene regulation cassette are derived from one or more naturally occurring introns or portions thereof.
- the 5′ and 3′ intronic sequences are derived from a truncated human beta-globin intron 2 (IVS2 ⁇ ), from intron 2 of the human 03-globin gene, from the SV40 mRNA intron (used in pCMV-LacZ vector from Clontech Laboratories, Inc.), from intron 6 of human triose phosphate isomerase (TPI) gene (Nott Ajit, et al. RNA.2003, 9:6070617), from an intron from human factor IX (Sumiko Kurachi, et al. J. Bio. Chem.
- the alternative exon and riboswitch are engineered to be in an endogenous intron of a target gene. That is, the intron (or a substantially similar intronic sequence) naturally occurs at that position of the target gene.
- the intronic sequence immediately upstream of the alternative exon is referred to as the 5′ intron or 5′ intronic sequence
- the intronic sequence immediately downstream of the alternative exon is referred to as the 3′ intron or 3′ intronic sequence.
- the endogenous intron is modified to contain a splice acceptor sequence and splice donor sequence flanking the 5′ and 3′ ends of the alternative exon.
- the 5′ and/or 3′ introns are exogenous to the target gene.
- the splice donor and splice acceptor sites in the alternative splicing gene regulation cassette can be modified to be strengthened or weakened.
- the splice sites can be modified to be closer to the consensus for a splice donor or acceptor by standard cloning methods, site directed mutagenesis, and the like. Splice sites that are more similar to the splice consensus tend to promote splicing and are thus strengthened. Splice sites that are less similar to the splice consensus tend to hinder splicing and are thus weakened.
- the consensus for the splice donor of the most common class of introns (U2) is A/C A G ⁇ G T A/G A G T (where ⁇ denotes the exon/intron boundary).
- the consensus for the splice acceptor is C A G ⁇ G (where ⁇ denotes the exon/intron boundary).
- the 5′ intron has been modified to contain a stop codon that will be in frame with the target gene.
- the 5′ and 3′ intronic sequences can also be modified to remove cryptic slice sites, which can be identified with publicly available software (see, e.g., Kapustin, Y. et al. Nucl. Acids Res.2011.1-8).
- the lengths of the 5′ and 3′ intronic sequences can be adjusted in order to, for example, meet the size requirements for viral expression constructs. In one embodiment, the 5′ and/or 3′ intronic sequences are about 50 to about 300 nucleotides in length.
- the 5′ and/or 3′ intronic sequences are about 125 to about 240 nucleotides in length.
- the stem portion of the effector region should be of a sufficient length (and GC content) to substantially prevent alternative splicing of the alternative exon upon ligand binding the aptamer, while also allowing access to the splice site when the ligand is not present in sufficient quantities.
- the stem portion of the effector region comprises a stem sequence in addition to the 5′ splice site sequence of the 3′ intron and its complementary sequence of the 5′ splice site sequence. In embodiments, this additional stem sequence comprises a sequence from the aptamer stem.
- the length and sequence of the stem portion can be modified using known techniques in order to identify stems that allow acceptable background expression of the target gene when no ligand is present and acceptable expression levels of the target gene when the ligand is present.
- the effector region stem of the riboswitch is about 7 to about 20 base pairs in length. In one embodiment, the effector region stem is 8 to 11 base pairs in length.
- the GC base pair content of the stem can be altered to modify the stability of the stem.
- the alternative exon that is part of the alternative splicing gene regulation cassettes disclosed herein is a polynucleotide sequence capable of being transcribed to a pre-mRNA and alternatively spliced into the mRNA of the target gene.
- the alternative exon contains at least one sequence that inhibits translation such that when the alternative exon is included in the target gene mRNA, expression of the target gene from that mRNA is prevented or reduced.
- the alternative exon contains a stop codon (TGA, TAA, TAG) that is in frame with the target gene when the alternative exon is included in the target gene mRNA by splicing.
- the alternative exon comprises, in addition to a stop codon, or as an alternative to a stop codon, another sequence that reduces or substantially prevents translation when the alternative exon is incorporated by splicing into the target gene mRNA including, e.g., a microRNA binding site, which leads to degradation of the mRNA.
- the alternative exon comprises a miRNA binding sequence that results in degradation of the mRNA.
- the alternative exon encodes a polypeptide sequence which reduces the stability of the protein containing this polypeptide sequence.
- the alternative exon encodes a polypeptide sequence which directs the protein containing this polypeptide sequence for degradation.
- the basal or background level of splicing of the alternative exon can be optimized by altering exon splice enhancer (ESE) sequences and exon splice suppressor (ESS) sequences and/or by introducing ESE or ESS sequences into the alternative exon.
- ESE exon splice enhancer
- ESS exon splice suppressor
- Such changes to the sequence of the alternative exon can be accomplished using methods known in the art, including, but not limited to site directed mutagenesis.
- oligonucleotides of a desired sequence e.g., comprising all or part of the alternative exon
- Identification of ESS and ESE sequences can be accomplished by methods known in the art, including, for example using ESEfinder 3.0 (Cartegni, L. et al. ESEfinder: a web resource to identify exonic splicing enhancers. Nucleic Acid Research, 2003, 31(13): 3568-3571) and/or other available resources.
- ESEfinder 3.0 Cartegni, L. et al. ESEfinder: a web resource to identify exonic splicing enhancers. Nucleic Acid Research, 2003, 31(13): 3568-3571
- the alternative exon is a naturally-occurring exon.
- the alternative exon is derived from all or part of a known exon.
- derived refers to the alternative exon containing sequence that is substantially homologous to a naturally occurring exon, or a portion thereof, but may contain various mutations, such a mutations generated by altering exon splice enhancer (ESE) sequences and exon splice suppressor (ESS) sequences and/or by introducing ESE or ESS sequences into the alternative exon.
- ESE exon splice enhancer
- ESS exon splice suppressor
- homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single- stranded-specific nuclease(s), and size determination of the digested fragments.
- Two polynucleotide or two polypeptide sequences are “substantially homologous” to each other when, after optimally aligned with appropriate insertions or deletions, at least about 80%, at least about 85%, at least about 90%, and at least about 95% of the nucleotides or amino acids, respectively, match over a defined length of the molecules, as determined using the methods above.
- the alternative exon is exogenous to the target gene, although it may be derived from a sequence originating from the organism where the target gene will be expressed.
- exogenous means derived from a genotypically distinct entity from that of the rest of the entity to which it is compared or into which it is introduced or incorporated.
- a polynucleotide introduced by genetic engineering techniques into a different cell type is a heterologous polynucleotide (and, when expressed, can encode a heterologous polypeptide).
- the alternatively-spliced exon is derived from exon 2 of the human dihydrofolate reductase gene (DHFR), mutant human Wilms tumor 1 exon 5, mouse calcium/calmodulin-dependent protein kinase II delta exon 16, or SIRT1 exon 6.
- DHFR human dihydrofolate reductase gene
- mutant human Wilms tumor 1 exon 5 or calmodulin-dependent protein kinase II delta exon 16 or SIRT1 exon 6.
- the alternatively-spliced exon is, or comprises, the modified DHFR exon 2 in SEQ ID NO:677.
- the alternatively -spliced exon is, or comprises, the modified DHFR exon 2 in SEQ ID NO:678
- Aptamer-mediated cleavage by self-cleaving ribozymes [0321]
- the aptamer-mediated expression of the target gene is regulated by an aptamer-mediated modulation of small endonucleolytic ribozymes.
- a ribozyme is an RNA enzyme that catalyzes a chemical reaction.
- a ribozyme may be any small endonucleolytic ribozyme that will self-cleave in the target cell type including, but not limited to a hammerhead, hairpin, the hepatitis delta virus, the Varkud satellite, twister, twister sister, pistol or hatchet ribozyme. Accordingly, in one embodiment, provided is a riboswitch, and a gene expression cassette comprising the riboswitch that contains a ribozyme linked to an aptamer disclosed herein.
- WO2017/136608 which is incorporated in its entirety by reference herein, describes such riboswitches that activate ribozyme self-cleavage in the presence of aptamer ligand (“off” switch) or riboswitches that inhibit ribozyme self-cleavage in the presence of aptamer (“on” switch).
- aptamer/ligand binding increases the ribonuclease function of the ribozyme, leading to cleavage of the target gene RNA that contains the polynucleotide cassette, thereby reducing target gene expression.
- Examples of such an off switch include a polynucleotide cassette for the regulation of the expression of a target gene comprising a riboswitch that comprises a twister ribozyme linked by a stem to an aptamer, wherein the stem linking the twister ribozyme to the aptamer attaches to the ribozyme at the location of the P3 stem of the twister ribozyme and wherein the target gene is linked to the P1 stem of the twister ribozyme (see, e.g. Figs.1a, 1b, or 3a of WO2017/136608 and the associated text, incorporated herein by reference).
- aptamer/ligand binding inhibits the ribonuclease function of the ribozyme, decreasing cleavage of the target gene RNA that contains the polynucleotide cassette, thereby increasing target gene expression in the presence of ligand.
- Examples of an on switch include a riboswitch that comprises a twister ribozyme linked to an aptamer, wherein the aptamer is linked to the 3 ⁇ or 5' end of the twister ribozyme P1 stem, wherein when the aptamer is linked to the 3' end of the twister ribozyme P1 stem, a portion of the 3' arm of the twister ribozyme P1 stem is alternatively the 5' arm of the aptamer P1 stem, and wherein when the aptamer is linked to the 5' end of the twister ribozyme P1 stem, a portion of the 5' arm of the twister ribozyme P1 stem is alternatively the 3' arm of the aptamer P1 stem (see, e.g., Figs.6a-6b of WO2017/136608 and the associated text, incorporated herein by reference).
- the expression of a target gene is regulated by aptamer-modulated polyadenylation.
- the 3' end of almost all eukaryotic mRNAs comprises a poly(A) tail—a homopolymer of 20 to 250 adenosine residues. Because addition of the poly(A) tail to mRNA protects it from degradation, expression of a gene can be influenced by modulating the polyadenylation the corresponding mRNA.
- the expression of the target gene is regulated through aptamer- modulated accessibility of polyadenylation sequences as described in and WO2018/156658, which is incorporated in its entirety by reference herein.
- the riboswitch comprises an effector stem-loop and an aptamer described herein, wherein the effector stem-loop comprises a polyadenylation signal, and wherein the aptamer and effector stem-loop are linked by an alternatively shared stem arm comprising a sequence that is complementary to the unshared arm of the aptamer stem (e.g., the aptamer P1 stem) and to the unshared arm of the effector stem loop (see, e.g., Figs 1a, 1b, 2a, and 5a of WO2018/156658 and the associated text, incorporated herein by reference).
- the aptamer stem e.g., the aptamer P1 stem
- the effector stem-loop is positioned 3 ⁇ of the aptamer such that the alternatively shared stem arm comprises all or a portion of the 3 ⁇ aptamer stem arm and all or a portion of the 5 ⁇ arm of the effector stem. In one embodiment, the effector stem-loop is positioned 5 ⁇ of the aptamer such that the alternatively shared stem arm comprises all or a portion of the 5 ⁇ aptamer stem arm and all or a portion of the 3 ⁇ arm of the effector stem.
- the polyadenylation signal comprises AATAA or ATTAA. In one embodiment, the polyadenylation signal is AATAAA or ATTAAA. In embodiments, the polyadenylation signal is a downstream element (DSE).
- the polyadenylation signal is an upstream sequence element (USE).
- the polynucleotide cassette comprises two riboswitches, wherein the effector stem loop of the first riboswitch comprises all or part of the polyadenylation signal AATAAA or ATTAAA and the effector stem loop of the second riboswitch comprises all or part of the downstream element (DSE).
- the two riboswitches each comprise aptamers that bind the same ligand.
- the two riboswitches comprise different aptamers that bind different ligands.
- the riboswitch comprises a sensing region (e.g., an aptamer described herein) and an effector region comprising a binding site for the small nuclear ribonucleoprotein (snRNP) U1, which is part of the spliceosome.
- snRNP small nuclear ribonucleoprotein
- WO2017/136591 describes riboswitches wherein the effector region comprises a U1 snRNP binding site (and sequence complementary thereto), and is incorporated herein by reference in its entirety.
- the effector region forms a stem and sequesters the U1 snRNP binding site from binding a U1 snRNP.
- the effector region is in a context that provides access to the U1 snRNP binding site, allowing U1 snRNP to bind the mRNA and inhibit polyadenylation leading to degradation of the message.
- the U1 snRNP binding site can be any polynucleotide sequence that is capable of binding the U1 snRNP, thereby recruiting the U1 snRNP to the 3 ⁇ UTR of a target gene and suppressing polyadenylation of the target gene message.
- the U1 snRNP binding site is CAGGTAAGTA, (CAGGUAAGUA, when in the mRNA).
- the U1 snRNP binding site is a variation of this consensus sequence, including for example sequences that are shorter or have one or more nucleotides changed from the consensus sequence.
- the U1 snRNP binding site contains the sequence CAGGTAAG.
- the binding site is encoded by the sequence selected from CAGGTAAGTA, CAGGTAAGT, and CAGGTAAG.
- the U1 snRNP binding site can be any 5′ splice site sequence from a gene, e.g., the 5′ splice site from human DHFR exon 2.
- the expression of the target gene is regulated through aptamer- modulated ribonuclease cleavage.
- Ribonucleases RNases
- RNases recognize and cleave specific ribonuclease substrate sequences.
- recombinant DNA constructs that, when incorporated into the DNA of a target gene, provide the ability to regulate expression of the target gene by aptamer/ligand mediated ribonuclease cleavage of the resulting RNA.
- the aptamer encoding sequence described herein is part of a construct that contains or encodes a ribonuclease substrate sequence and a riboswitch comprising an effector region and the aptamer such that when the aptamer binds a ligand, target gene expression occurs (as described in WO2018/161053, which is incorporated in its entirety by reference herein).
- an RNase P substrate sequence is linked to a riboswitch wherein the riboswitch comprises an effector region and an aptamer described herein, wherein the effector region comprises a sequence complimentary to a portion of the RNase P substrate sequence.
- Binding of a suitable ligand to the aptamer induces structural changes in the aptamer and effector region, altering the accessibility of the ribonuclease substrate sequence for cleavage by the ribonuclease.
- the aptamer sequence is located 5 ⁇ to the RNase P substrate sequence and the effector region comprises all or part of the leader sequence and all or part of the 5 ⁇ acceptor stem sequence of the RNase P substrate sequence. See, e.g., Figs.1a, 1b, and 3b of WO2018/161053 and the associated text, incorporated herein by reference.
- the acceptor stem of the RNase P substrate and the riboswitch effector region are separated by 0, 1, 2, 3, or 4 nucleotides.
- the effector region stem includes, in addition to leader sequence (and its complement), one or more nucleotides of the acceptor stem of the RNase P substrate, and sequence complementary to the one or more nucleotides of the acceptor stem.
- the aptamer sequence of the polynucleotide cassette is located 3 ⁇ to the RNase P substrate sequence and the effector region comprises sequence complimentary to the all or part of the 3 ⁇ acceptor stem of the RNase P substrate sequence.
- the effector region sequence complimentary to the 3 ⁇ acceptor stem of the RNase P substrate is 1 to 7 nucleotides.
- the effector region stem includes 1 to 7 nucleotides of the acceptor stem and includes sequence that is complementary to this 1 to 7 nucleotides of the acceptor stem.
- the riboswitch is located 3 ⁇ of the RNase P substrate so the effector region stem and the acceptor stem of the RNase P substrate do not overlap.
- the effector region and the acceptor stem of the RNase P substrate are immediately adjacent (i.e., not overlapping).
- the effector region and the acceptor stem of the RNase P substrate are separated by 1, 2, 3, 4, 5 or more nucleotides.
- Target Gene refers to a polynucleotide that is introduced into a cell and is capable of being transcribed into RNA and translated and/or expressed under appropriate conditions.
- the target gene is endogenous to the target cell and the gene regulation cassette is positioned into the target gene (for example into an existing untranslated region or intron of the endogenous target gene).
- target gene is a polynucleotide encoding a therapeutic polypeptide.
- the target gene is exogenous to the cell in which the recombinant DNA construct is to be transcribed.
- target gene is endogenous to the cell in which the recombinant DNA construct is to be transcribed.
- the target gene may be a gene encoding a protein, or a sequence encoding a non-protein coding RNA.
- the target gene may be, for example, a gene encoding a structural protein, an enzyme, a cell signaling protein, a mitochondrial protein, a zinc finger protein, a hormone, a transport protein, a growth factor, a cytokine, an intracellular protein, an extracellular protein, a transmembrane protein, a cytoplasmic protein, a nuclear protein, a receptor molecule, an RNA binding protein, a DNA binding protein, a transcription factor, translational machinery, a channel protein, a motor protein, a cell adhesion molecule, a mitochondrial protein, a metabolic enzyme, a kinase, a phosphatase, exchange factors, a chaperone protein, and modulators of any of these.
- the target gene encodes erythropoietin (Epo), human growth hormone (hGH), transcription activator-like effector nucleases (TALEN), human insulin, CRISPR associated protein 9 (cas9), or an immunoglobulin (or portion thereof), including, e.g., a therapeutic antibody.
- the target gene is Cas9 or CasRx and the expression construct further comprises a sequence encoding a guide RNA (gRNA), for example a gRNA targeting PCSK9, which can be used to regulate expression of the gRNA target.
- gRNA guide RNA
- the target gene is PTH.
- the target gene is insulin (e.g., comprising sequence comprising the A chain, B chain and C peptide) for use in regulating insulin levels in response to a small molecule for treating diabetes.
- the target gene is a therapeutic antibody including an anti-PCSK9 antibody, anti-VEGFR2 antibody (e.g., for ophthalmological applications), anti-amyloid A ⁇ p3-42 antibody, anti-IL-17 antibody, anti-PD1 antibody, and anti-HER2 antibody.
- the target gene when the target gene is an antibody, the heavy and light chains can be expressed from a single message separated by a protein cleave site (furan, etc.) or peptide self-leaving site (e.g., 2A peptide such as T2A or P2A).
- the target gene encodes an antibody against the SARS-CoV-2 viral proteins or antigens (such as the spike protein)(e.g., casirivimab and/or imdevimab (Regeneron), or bamlanivimab and/or etesevimab (Eli Lilly)).
- the target gene encodes all or a portion of a SARS-CoV-2 spike protein, where induction of expression produces mRNA and thus functions like an inducible mRNA vaccine (mRNA-1273, Moderna or Comirnaty, Pfizer-BioNTech).
- mRNA-1273 Moderna or Comirnaty, Pfizer-BioNTech.
- the aptamers and gene regulation cassettes disclosed herein are used to regulate the expression of a target gene in eukaryotic cells for example, mammalian cells and more particularly human cells.
- the aptamers and gene regulation cassettes disclosed herein are used to regulate the expression of a target gene in the eye (including cornea and retina), central nervous system (including the brain), liver, kidney, pancreas, heart, airway, muscle, skin, lung, cartilage, testes, arteries, thymus, bone marrow, or in tumors.
- a target gene in the eye (including cornea and retina), central nervous system (including the brain), liver, kidney, pancreas, heart, airway, muscle, skin, lung, cartilage, testes, arteries, thymus, bone marrow, or in tumors.
- the recombinant DNA constructs include additional DNA elements including DNA segments that provide for the replication of the DNA in a host cell and expression of the target gene in target cells at appropriate levels.
- expression control sequences promoters, enhancers, and the like
- Vector means a recombinant plasmid, yeast artificial chromosome (YAC), mini chromosome, DNA mini-circle or virus (including virus derived sequences) that comprises a polynucleotide to be delivered into a host cell, either in vitro or in vivo.
- the recombinant vector is a viral vector or a combination of multiple viral vectors.
- Viral vectors for the expression of a target gene in a target cell, tissue, or organism are known in the art and include adenoviral (AV) vectors, adeno-associated virus (AAV) vectors, retroviral and lentiviral vectors, and Herpes simplex type 1 (HSV1) vectors.
- AV adenoviral
- AAV adeno-associated virus
- retroviral and lentiviral vectors retroviral and lentiviral vectors
- Herpes simplex type 1 (HSV1) vectors Herpes simplex type 1
- Adenoviral vectors include, for example, those based on human adenovirus type 2 and human adenovirus type 5 that have been made replication defective through deletions in the E1 and E3 regions.
- Adenoviral vectors also include helper-dependent high-capacity adenoviral vectors (also known as high-capacity, “gutless” or “gutted” vectors), which do not contain viral coding sequences. These vectors, contain the cis-acting elements needed for viral DNA replication and packaging, mainly the inverted terminal repeat sequences (ITR) and the packaging signal (CY). These helper-dependent AV vector genomes have the potential to carry from a few hundred base pairs up to approximately 36 kb of foreign DNA.
- helper-dependent AV vector genomes have the potential to carry from a few hundred base pairs up to approximately 36 kb of foreign DNA.
- Recombinant adeno-associated virus “rAAV” vectors include any vector derived from any adeno-associated virus serotype, including, without limitation, AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-7 and AAV-8, AAV-9, AAV-10, and the like.
- rAAV vectors can have one or more of the AAV wild-type genes deleted in whole or in part, preferably the Rep and/or Cap genes, but retain functional flanking ITR sequences. Functional ITR sequences are retained for the rescue, replication, packaging and potential chromosomal integration of the AAV genome.
- the ITRs need not be the wild-type nucleotide sequences, and may be altered (e.g., by the insertion, deletion or substitution of nucleotides) so long as the sequences provide for functional rescue, replication and packaging.
- other systems such as lentiviral vectors can be used.
- Lentiviral- based systems can transduce nondividing as well as dividing cells making them useful for applications targeting, for examples, the nondividing cells of the CNS.
- Lentiviral vectors are derived from the human immunodeficiency virus and, like that virus, integrate into the host genome providing the potential for very long-term gene expression.
- Polynucleotides including plasmids, YACs, minichromosomes and minicircles, carrying the target gene containing the gene regulation cassette can also be introduced into a cell or organism by nonviral vector systems using, for example, cationic lipids, polymers, or both as carriers.
- Conjugated poly-L-lysine (PLL) polymer and polyethylenimine (PEI) polymer systems can also be used to deliver the vector to cells.
- Other methods for delivering the vector to cells includes hydrodynamic injection and electroporation and use of ultrasound, both for cell culture and for organisms.
- this disclosure provides a method of modulating the expression of a target gene (e.g., a therapeutic gene) comprising (a) inserting the polynucleotide cassette comprising an aptamer disclosed herein into the target gene, (b) introducing the target gene comprising the polynucleotide cassette into a cell, and (c) exposing the cell to a small molecule ligand that specifically binds the aptamer in an amount effective to induce expression of the target gene.
- a target gene e.g., a therapeutic gene
- expression of the target gene in target cells confers a desired property to a cell into which it was introduced, or otherwise leads to a desired therapeutic outcome.
- a gene regulation cassette comprising an aptamer disclosed herein is inserted into the protein coding sequence of the target gene (rather than in the 5′ or 3′ untranslated regions).
- a single gene regulation cassette comprising an aptamer disclosed herein is inserted into the target gene.
- 2, 3, 4, or more gene regulation cassettes are inserted in the target gene, wherein one or more gene regulation cassettes comprise an aptamer disclosed herein.
- two gene regulation cassettes are inserted into the target gene, wherein one or both gene regulation cassettes comprise an aptamer disclosed herein.
- multiple gene regulation cassettes When multiple gene regulation cassettes are inserted into a target gene, they each can contain the same aptamer such that a single ligand can be used to modulate target gene expression. In other embodiments, multiple gene regulation cassettes are inserted into a target gene, each can contain a different aptamer so that exposure to multiple different small molecule ligands modulates target gene expression.
- Methods of Treatment and Pharmaceutical Compositions [0349] In one aspect, provided is a method of regulating the level of a therapeutic protein delivered by gene therapy.
- the therapeutic gene sequence containing a regulatory cassette comprising an aptamer disclosed herein is delivered to the target cells in the body, e.g., by a vector.
- the cell specificity of the target gene expression may be controlled by a promoter and/or other elements within the vector and/or by the capsid of the viral vector. Delivery of the vector construct containing the target gene, and the transfection of the target tissues resulting in stable transfection of the regulated target gene, is the first step in producing the therapeutic protein. However, due to an aptamer within the target gene sequence, the target gene is not expressed at significant levels, i.e., it is in the “off state” in the absence of the specific ligand that binds to the aptamer contained within in the regulatory cassette riboswitch. Only when the aptamer specific ligand is administered is the target gene expression activated.
- the delivery of the vector construct containing the target gene and the delivery of the activating ligand generally are separated in time.
- the delivery of the activating ligand will control when the target gene is expressed, as well as the level of protein expression.
- the ligand may be delivered by a number of routes including, but not limited to, intravitreal, intraocular, inhalation, subcutaneous, intramuscular, intradermal, intralesion, topical, intraperitoneal, intravenous (IV), intra-arterial, perivascular, intracerebral, intracerebroventricular, oral, sublingual, sublabial, buccal, nasal, intrathoracic, intracardiac, intrathecal, epidural, intraosseous, or intraarticular.
- the timing of delivery of the ligand will depend on the requirement for activation of the target gene. For example, if the therapeutic protein encoded by the target gene is required constantly, an oral small molecule ligand may be delivered daily, or multiple times a day, to ensure continual activation of the target gene, and thus continual expression of the therapeutic protein. If the target gene has a long acting effect, the inducing ligand may be dosed less frequently, for example, once a week, every other week, once a month.
- This aptamers described herein in the context of a gene regulation cassette comprising a riboswitch allow the expression of a therapeutic transgene to be controlled temporally, in a manner determined by the temporal dosing of the ligand specific to the aptamer.
- the expression of the therapeutic transgene only on ligand administration increases the safety of a gene therapy treatment by allowing the target gene to be off in the absence of the ligand.
- Different aptamers can be used in multiple riboswitches to allow different ligands to up-regulate or down-regulate the expression of a target gene.
- each therapeutic gene containing a regulatory cassette will have a specific aptamer within the cassette that will be activated by a specific small molecule. This means that each therapeutic gene can be activated only by the ligand specific to the aptamer housed within it. In these embodiments, each ligand will only activate one therapeutic gene. This allows for the possibility that several different “target genes” may be delivered to one individual and each will be activated on delivery of the specific ligand for the aptamer contained within the regulatory cassette housed in each target gene.
- the aptamers disclosed herein in the context of a riboswitch allow any therapeutic protein whose gene can be delivered to the body (such as erythropoietin (EPO) or a therapeutic antibody) to be produced by the body when the activating ligand is delivered.
- This method of therapeutic protein delivery may replace the manufacture of such therapeutic proteins outside of the body which are then injected or infused, e.g., antibodies used in cancer or to block inflammatory or autoimmune disease.
- the body containing the regulated target gene becomes the biologics manufacturing factory, which is switched on when the gene- specific ligand is administered.
- the target protein may be a nuclease that can target and edit a particular DNA sequence.
- nucleases include CasRx, Cas9, zinc finger containing nucleases, or TALENs.
- the nuclease protein may be required for only a short period of time that is sufficient to edit the target endogenous genes. However, if an unregulated nuclease gene is delivered to the body, this protein may be present for the rest of the life of the cell. In the case of nucleases, there is an increasing risk of off-target editing the longer the nuclease is present. Regulation of expression of such proteins has a significant safety advantage. In this case, vector containing the nuclease target gene containing a regulatory cassette could be delivered to the appropriate cells in the body.
- the target gene is in the “off” state in the absence of the cassette-specific ligand, so no nuclease is produced. Only when the activating ligand is administered, is the nuclease produced. When sufficient time has elapsed allowing sufficient editing to occur, the ligand will be withdrawn and not administered again. Thus the nuclease gene is thereafter in the “off” state and no further nuclease is produced and editing stops.
- This approach may be used to correct genetic conditions, including a number of inherited retinopathies such as LCA10 caused by mutations in CEP290 and Stargardts disease caused by mutations in ABCA4.
- a regulated target gene encoding a therapeutic protein which is activated only on specific ligand administration may be used to regulate therapeutic genes to treat many different types of diseases, e.g., cancer with therapeutic antibodies, immune disorders with immune modulatory proteins or antibodies, metabolic diseases, rare diseases such as PNH with anti-C5 antibodies or antibody fragments as the regulated gene, or ocular angiogenesis with therapeutic antibodies, and dry AMD with immune modulatory proteins.
- diseases e.g., cancer with therapeutic antibodies, immune disorders with immune modulatory proteins or antibodies, metabolic diseases, rare diseases such as PNH with anti-C5 antibodies or antibody fragments as the regulated gene, or ocular angiogenesis with therapeutic antibodies, and dry AMD with immune modulatory proteins.
- a wide variety of specific target genes allowing for the treatment of a wide variety of specific diseases and conditions, are suitable for use as a target gene whose expression can be regulated using an aptamer/ligand described herein.
- insulin or an insulin analog may be used as the target gene to treat type I diabetes, type II diabetes, or metabolic syndrome
- human growth hormone may be used as the target gene to treat children with growth disorders or growth hormone- deficient adults
- erythropoietin preferably human erythropoietin
- Additional target genes compatibles with the aptamers and gene expression cassettes disclosed herein include, but are not limited to, cyclic nucleotide-gated cation channel alpha-3 (CNGA3) and cyclic nucleotide-gated cation channel beta-3 (CNGB3) for the treatment of achromatopsia, retinoid isomerohydrolase (RPE65) for the treatment of retinitis pigmentosa or Leber’s congential amaurosis, X-linked retinitis pigmentosa GTPase regulator (RPGR) for the treatment of X-linked retinitis pigmentosa, glutamic acid decarboxylase (GAD) including for the treatment of Parkinson's disease, regulator of nonsense transcripts 1 (UPF1) for the treatment amyotrophic lateral sclerosis, and aquaporin for the treatment of radiation-induced xerostomia and Sjogren’s syndrome.
- CNGA3 cyclic nucleotide-gate
- Additional target genes include ArchT (archaerhodopsin from Halorubrum strain TP009), Jaws (cruxhalorhodopsin derived from Haloarcula (Halobacterium) salinarum (strain Shark)), iC1C2 (a variant of a C1C2 chimaera between channel rhodopsins ChR1 and ChR2 from Chlamydomonas reinhardtii), or Rgs9-anchor protein (R9AP), a critical component of GTPase complex that mediates the deactivation of phototransduction cascade.
- ArchT archaerhodopsin from Halorubrum strain TP009
- Jaws crudexhalorhodopsin derived from Haloarcula (Halobacterium) salinarum (strain Shark)
- iC1C2 a variant of a C1C2 chimaera between channel rhodopsins ChR1 and ChR2
- the expression constructs comprising an aptamer disclosed herein may be especially suitable for treating diseases caused by single gene defects such as cystic fibrosis, hemophilia, muscular dystrophy, thalassemia, or sickle cell anemia.
- human ⁇ -, ⁇ -, ⁇ -, or ⁇ -globin may be used as the target gene to treat ⁇ -thalassemia or sickle cell anemia; human Factor VIII or Factor IX may be used as the target gene to treat hemophilia A or hemophilia B.
- the expression constructs/small molecules disclosed herein may be used to treat, prevent, or lessen the severity of a viral disease.
- the disclosure provides a method for treating, preventing, or lessening the severity of COVID-19 by expressing antibodies against the SARS-CoV-2 viral proteins or antigens (e.g., spike protein) in response to administration of a small molecule ligand.
- the disclosure provides a method for preventing (or lessening the severity of) infection by SARS- CoV-2 by expressing the spike protein (or multiple serotype spike proteins) or portions thereof, using the gene regulation cassettes described herein and administering ligand.
- the target gene is an antibody against the SARS-CoV-2 viral proteins or antigens (such as the spike protein).
- the target gene encodes all or a portion of one or more SARS-CoV-2 spike proteins, where induction of expression produces mRNA and thus functions like an inducible mRNA vaccine.
- the expression construct is part of an AAV viral genome and the AAV vector comprising the expression construct is administered to, e.g., the muscle of a subject followed by administration of the ligand.
- the disclosure provides a method for restoring hemocrit and a method of treating anemia by expression of Epo from a gene regulation construct described herein, wherein a vector comprising an Epo gene regulation construct is administered to the subject in need thereof followed by administration of a small molecule ligand described herein.
- the anemia is due to chronic kidney disease in the subject.
- the disclosure provides a method for restoring hemocrit and a method of treating chronic kidney disease by expression of Epo from a gene regulation construct described herein, wherein a vector comprising an Epo gene regulation construct is administered to the subject in need thereof followed by administration of a small molecule ligand described herein.
- the small molecules described herein are generally combined with one or more pharmaceutically acceptable carriers to form pharmaceutical compositions suitable for administration to a patient.
- Pharmaceutically acceptable carriers include solvents, binders, diluents, disintegrants, lubricants, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, generally used in the pharmaceutical arts.
- Pharmaceutical compositions may be in the form of tablets, pills, capsules, troches, eye drops, and the like, and are formulated to be compatible with their intended route of administration. Examples of routes of administration include parenteral, e.g., intravenous, intradermal, intranasal, subcutaneous, oral, inhalation, transdermal (topical), transmucosal, and ocular.
- the pharmaceutical compositions comprising compounds of I-XVI are administered to a patient in a dosing schedule such that an amount of the compound sufficient to desirably regulate the target gene is delivered to the patient.
- the dosage form is a tablet, pill, or the like
- the pharmaceutical composition comprises from 0.1 mg to 10 g of the compound; from 0.5 mg to 5 g of the compound; from 1 mg to 1 g of the compound; from 2 mg to 750 mg of the compound; from 5 mg to 500 mg of the compound; from 10 mg to 250 mg of the compound; or from 150 mg to 300 mg of the compound.
- the pharmaceutical compositions may be dosed once per day or multiple times per day (e.g., 2, 3, 4, 5, or more times per day).
- compositions may be dosed less often than once per day, e.g., once every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 days, or once a month or once every few months.
- the pharmaceutical compositions may be administered to a patient only a small number of times, e.g., once, twice, three times, etc.
- a method of treating a patient in need of increased expression of a therapeutic protein encoded by a target gene comprising administering to the patient a pharmaceutical composition comprising a ligand, which an aptamer disclosed herein binds to or otherwise responds to, wherein the patient previously had been administered a recombinant DNA comprising the target gene, and where the target gene contains a gene regulation cassette disclosed herein that provides the ability to regulate expression of the target gene by the ligand of the aptamer.
- a pharmaceutical composition comprising a ligand, which an aptamer disclosed herein binds to or otherwise responds to, for use in a method of treating a patient in need of increased expression of a therapeutic protein encoded by a target gene, wherein the patient previously had been administered a recombinant DNA comprising the target gene, and where the target gene contains a gene regulation cassette disclosed herein that provides the ability to regulate expression of the target gene by the ligand of the aptamer.
- Aptamers for detection and/or diagnostic uses [0367] A wide range of detection and diagnostic agents can be linked to aptamers through chimerical or physical conjugation.
- aptamers can be incorporated in biosensors, microfluidic devices and other detection platforms.
- the aptamer is conjugated to a polyalkylene glycol moiety, including, but not limited to, polyethylene glycol (PEG), polypropylene glycol (PPG), polyoxyethylated glycerol (POG) and other polyoxyethylated polyols, polyvinyl alcohol (PVA) and other polyalkylene oxides, polyoxyethylated sorbitol, or polyoxyethylated glucose.
- PEG polyethylene glycol
- PPG polypropylene glycol
- POG polyoxyethylated glycerol
- PVA polyvinyl alcohol
- the aptamer is conjugated to a detectable moiety, including, but not limited to, fluorescent moieties or labels, imaging agents, radioisotopic moieties, radiopaque moieties, and the like, e.g. detectable labels such as biotin, fluorophores, chromophores, spin resonance probes, nanoparticles (including, but not limited to gold, magnetic, and superparamagnetic nanoparticles), quantum dots, radiolabels.
- exemplary fluorophores include fluorescent dyes (e.g. fluorescein, rhodamine, and the like) and other luminescent molecules (e.g. luminal).
- a fluorophore may be environmentally-sensitive such that its fluorescence changes if it is located close to one or more residues in the modified protein that undergo structural changes upon binding a substrate (e.g. dansyl probes).
- exemplary radiolabels include small molecules containing atoms with one or more low sensitivity nuclei ( 13 C, 15 N, 2 H, 125 I, 123 I, 99 Tc, 43 K, 52 Fe, 67 Ga, 68 Ga, 111 In and the like). Other useful moieties are known in the art.
- the aptamer is conjugated to a therapeutic moiety, including, but not limited to, an anti-inflammatory agent, anti-cancer agent, anti- neurodegenerative agent, anti-infective agent, or generally a therapeutic agent.
- a therapeutic moiety including, but not limited to, an anti-inflammatory agent, anti-cancer agent, anti- neurodegenerative agent, anti-infective agent, or generally a therapeutic agent.
- Methods for Identifying an Aptamer That Binds to a Compound [0371] Disclosed herein are methods for identifying an aptamer that binds to a compound of Formula I-XXII, or otherwise modulates target gene expression when part of a riboswitch, in response to the addition of, or exposure to, the compound of Formula I-XXII.
- the method comprises the steps of: (i) selecting a parent aptamer sequence; (ii) generating an aptamer library comprising sequence encoding the aptamer selected in (i), wherein one or more nucleotides in the aptamer encoding sequence are randomly mutated at one or more positions that correspond to one or more unpaired regions in the aptamer, wherein the mutated aptamer sequences are in the context of a riboswitch that controls the expression of a reporter gene; (iii) screening the library from (ii) for aptamers having increased regulation (e.g., higher fold induction or repression) of the target gene expression in response to a compound disclosed herein compared to the parent aptamer sequence; (iv) optionally repeating steps (ii) and (iii) on an aptamer identified in step (iii) rather than an aptamer selected in step (i).
- the parent aptamer sequence may be a TPP aptamer, including known TPP aptamer sequence or may be a putative TPP aptamer identified by searching for homologous sequences in available databases.
- the parent aptamer sequence may be an aptamer sequence disclosed herein, e.g., [0373]
- the step of selecting a parent aptamer sequence can involve, for example, (i) identifying a putative TPP aptamer; (ii) inserting the aptamer into a riboswitch that modulates the expression of a target gene (for example a reporter gene); and (iii) exposing the riboswitch/target gene construct to a thiamine or TPP analog or derivative (e.g., the compounds described herein).
- Putative TPP aptamers can be identified from an appropriate sequence database such as the Rfam database, which is a collection of RNA families, each represented by multiple sequence alignments, consensus secondary structures and covariance models (CMs).
- the putative TPP aptamer is identified from the Rfam TPP riboswitch family RF00059.
- the putative TPP aptamer has a sequence that is at least 85%, at least 90%, at least 95%, at least 96%, at least 97% at least 98% or at least 99% identical to thiC thiM
- the putative TPP aptamer can be inserted into a riboswitch using techniques known to the ordinarily skilled artisan.
- the responsiveness of the aptamer to the presence of TPP and one or more thiamine or TPP analogs or derivatives can be tested in cell culture and/or in a cell-free system.
- the cell culture system is a eukaryotic cell culture including, e.g., a mammalian, a plant, or an insect cell culture.
- one or more nucleotide positions of the sequence encoding the aptamer are randomized. Areas of the sequence that can be randomized include J2-4; L3a; P4/J4-5 to J5- 4; and L5.
- the nucleotide positions for randomization can be selected based on the structure of the parent aptamer sequence.
- the predicted secondary structure can be obtained using available programs such as RNAfold (http://rna.tbi.univie.ac.at/cgi- bin/RNAWebSuite/RNAfold.cgi) and/or by comparison to the crystal structure of a related aptamer (e.g., the E. coli thiM riboswitch in Edwards, TE & Ferré-D'Amaré, AR, Structure. 2006 Sep;14(9):1459-68).
- a related aptamer e.g., the E. coli thiM riboswitch in Edwards, TE & Ferré-D'Amaré, AR, Structure. 2006 Sep;14(9):1459-68.
- unpaired regions of the aptamer including loop (L) regions (e.g., L3 and/or L5) and joining (J) regions (e.g., J3-2 (joining paired regions P3 and P2), J2-4, and/or J4-5), can be identified, and one or more nucleotides in one or more unpaired regions can be randomized to generate a library of aptamers.
- one or more nucleotides adjacent to one or more unpaired regions are randomized.
- one or more nucleotides in a paired (P) region can be randomized.
- one or more nucleotides in an unpaired or paired region can be added or deleted.
- the mutagenized aptamer sequences can be provided as a library of aptamer sequences in the context of a riboswitch.
- the aptamer library is provided in the context of a riboswitch as part of a gene expression cassette disclosed herein.
- the aptamer encoding sequences containing one or more mutations can be tested for responsiveness to the presence of one or more compounds described herein.
- Aptamers that are responsive to the desired compound can be further mutagenized by randomizing nucleotides. The nucleotides at selected positions, for example unpaired regions, can be randomized and a library created as described above.
- Reporter proteins encoded by the reporter genes used in the methods disclosed herein are proteins that can be assayed by detecting characteristics of the reporter protein, such as enzymatic activity or spectrophotometric characteristics, or indirectly, such as with antibody-based assays.
- reporter gene products include, but are not limited to, puromycin resistance marker (pac), 3-galactosidase, luciferase, orotidine 5'-phosphate decarboxylase (URA3), arginine permease CAN1, galactokinase (GAL1), beta-galactosidase (LacZ), or chloramphenicol acetyl transferase (CAT).
- detectable signals include cell surface markers, including, but not limited to CD4.
- Reporter genes suitable for the use in the methods for identifying aptamers disclosed herein also include fluorescent proteins (e.g., green fluorescent protein (GFP) and its derivatives), or proteins fused to a fluorescent tag.
- fluorescent proteins e.g., green fluorescent protein (GFP) and its derivatives
- fluorescent tags and proteins include, but are not limited to, (3-F)Tyr-EGFP, A44-KR, aacuGFP1, aacuGFP2, aceGFP, aceGFP-G222E-Y220L, aceGFP-h, AcGFP1, AdRed, AdRed-C148S, aeurGFP, afraGFP, alajGFP1, alajGFP2, alajGFP3, amCyan1, amFP486, amFP495, amFP506, amFP515, amilFP484, amilFP490, amilFP497, amilFP504, amilFP512, amilFP513, amilFP593, amilFP597, anm1GFP1, anm1GFP2, anm2CP, anobCFP1, anobCFP2, anobGFP, apulFP483, AQ14, AQ143, Aquamarine, asCP562, asFP499, AsRed2, asulCP, aten
- kits or articles of manufacture for use in the methods described herein.
- the kits comprise the compositions described herein (e.g., compositions for delivery of a vector comprising the target gene containing the gene regulation cassette) in suitable packaging.
- Suitable packaging for compositions such as ocular compositions for injection
- compositions such as ocular compositions for injection
- vials such as sealed vials
- vessels such as ampules, bottles, jars
- flexible packaging e.g., sealed Mylar or plastic bags
- kits comprising the compositions described herein. These kits may further comprise instruction(s) on methods of using the composition, such as uses described herein.
- kits described herein may further include other materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and package inserts with instructions for performing the administration of the composition or performing any methods described herein.
- the kit comprises an rAAV for the expression of a target gene comprising a gene regulation cassette containing an aptamer sequence described herein, a pharmaceutically acceptable carrier suitable for injection, and one or more of: a buffer, a diluent, a filter, a needle, a syringe, and a package insert with instructions for performing the injections.
- the kit is suitable for intraocular injection, intramuscular injection, intravenous injection and the like.
- Example 1 A TPP aptamer homologous sequence regulates gene expression in mammalian cells in response to thiamine pyrophosphate (TPP) and vitamin B1 analogs
- TPP thiamine pyrophosphate
- Riboswitch construct Aptamers were synthesized by Integrated DNA Technologies, Inc.
- the synthesized aptamer sequence here referred to as aptamer sequence 12C6-1, contains a putative TPP aptamer sequence (AP008955.1/944373-944459; CP030117.1/ 954080-954166; CP023474.1/ 977011-977097) with C at 5 ⁇ end and a complementary G at 3 ⁇ end flanking the putative TPP aptamer sequence: Golden Gate cloning strategy (New England Biolabs, NEB) was used to clone the synthesized aptamer sequences into an intron-exon-intron cassette to replace the guanine aptamer in the G17 riboswitch cassette (see SEQ ID NO: 15 recited in WO 2016/126747, which is incorporated herein in its entirety) to generate riboswitch construct Luci-12C6-1.
- Transfection 3.5x10 4 human embryonic kidney (HEK) 293 cells were plated in a 96-well flat bottom plate the day before transfection. Plasmid DNA (500 ng) was added to a tube or a 96-well U-bottom plate. Separately, TransIT-293 reagent (Mirus; 1.4 ⁇ L) was added to 50 ⁇ L Optimum I media (Life Technologies) and allowed to sit for 5 minutes at room temperature (RT). Then, 50 ⁇ L of this diluted transfection reagent was added to the DNA, mixed, and incubated at RT for 20 min. Finally, 7 ⁇ L of this solution was added to a well of cells in the 96-well plate.
- HEK human embryonic kidney
- luciferase activity was expressed as mean arbitrary light units (ALU) ⁇ S.D., and fold induction was calculated as the quotient of the luciferase activity obtained from cells with TPP or analog compound treatment divided by the luciferase activity obtained from cells without TPP or analog compound treatment.
- ALU mean arbitrary light units
- TPP aptamer homologous sequence (AP008955.1/944373-944459; CP030117.1/ 954080-954166; CP023474.1/ 977011-977097) was identified from a RNA family database RF00059 (http://rfam.xfam.org/family/RF00059), and was tested in the alternative splicing based synthetic aptamer riboswitch system for regulation of target gene expression in response to TPP treatment.
- This synthetic riboswitch system contains an intron- alternative exon-riboswitch-intron cassette in which ligand binding to the aptamer portion of the riboswitch controls the accessibility of the 5 ⁇ splice site of the 3 ⁇ intron, therefore allowing for regulation of the expression of a target gene through modulating alternative splicing ( Figure 1a).
- ligand binding presumably brings close the 5 ⁇ and 3 ⁇ ends of the aptamers sequence which includes the adjacent U1 binding site and its complementary sequence, stabilizing a 9 bp stem structure that sequesters the accessibility of the 5 ⁇ splice site, allowing splicing occur between the exons of the transgene and subsequence transgene gene expression.
- HEK 293 cells were transfected with luciferase construct containing 12C6-1 riboswitch (Luci-12C6-1) and treated with TPP for increased luciferase expression.
- Example 2 Synthetic riboswitches comprising thiamine pyrophosphate (TPP)-responsive aptamers regulate gene expression in response to Comp.004
- TPP thiamine pyrophosphate
- TPP aptamer from Alishewanella tabrizica thiC gene (Microbiol Res.2017 Jan; 195:71-80) was tested in TPPz riboswitch construct (SEQ ID No.86 as described in 62/994, 135).
- TPPz riboswitch construct SEQ ID No.86 as described in 62/994, 135.
- both TPPm and TPPz riboswitches regulate luciferase expression in responding to Comp.004 treatment in dose-dependent manner. This observation indicates that Comp. 004 binds TPP aptamer in mammalian cells.
- TPPz riboswitch construct shows much higher gene regulation activity in responding to Comp.004 treatment.
- TPPz riboswitch construct generated 26-fold increase in luciferase expression when treated with 50 ⁇ M Comp.004, whereas TPPm construct expressed only 4.1 increase in luciferase expression at the same concentration of Comp.004.
- Example 3 Generation of riboswitches comprising re-engineered aptamer sequences that have enhanced reactivity to Comp.004
- Experimental procedure [0403] Cloning of riboswitch constructs containing 12C6-1 variant aptamer sequences: 12C6-1 aptamer sequence was used as template, and nucleobases were randomized at certain position in the sequence. Aptamers incorporating random mutagenesis were synthesized by Integrated DNA Technologies, Inc.
- aptamer libraries N1, N2, N3, N4 and N5 were generated by randomizing nucleotides at positions in J2-4, J2-3/J3-3a/J3a-2/P3, L3a, J4-5/J5-4/P4 and L5 regions of the parent 12C6-1 sequence, respectively (see Figures 3a and 3b).
- Single bacterial colonies were picked and plasmids containing variant riboswitch constructs were screened in HEK 293 cells for improved gene regulation activity in response to 25 ⁇ M Comp.004 as compared to parent riboswitch construct Luci-12C6-1.
- Nucleobases at 5 positions in P4/J4-5/J5-4 region were randomized, generating 1024 variant aptamer sequences in library N4.
- 864 riboswitches were screened against Comp.004 treatment, with approximately 46.2% of the screened riboswitch constructs inducing greater than 500-fold increase in luciferase expression in response to Comp.004 treatment.
- Riboswitch constructs containing re-engineered aptamer sequences N4-1C11, N5- 12E5 and N5-12G6 were further validated for their enhanced riboswitch activity. As shown in Figure 4a, all three riboswitches increased luciferase activity when treated with 0.01 ⁇ M Comp.004, and induced 16-, 8- and 36-fold, respectively, increase in luciferase expression, in response to 0.1 ⁇ M Comp.004 treatment. The induced expression of luciferase increased in a dose-dependent manner ( Figure 4b, 4c).
- Example 4 Synthetic riboswitch regulates expression of various target genes in response to Comp.004 in mammalian cells
- Riboswitch constructs The alternative splicing riboswitch cassette containing aptamers N5-12G6 or N4-1C11 was inserted between nucleotide position 307 and 308 in the mouse erythropoietin cDNA sequence, generating constructs mEpo-12G6 and mEpo-1C11. Expression of the erythropoietin gene was driven by CASI promoter.
- the intron-exon-intron cassette without aptamer sequence was inserted at the same position in the cDNA of mEpo gene to create construct mEpo-Con1, serving as a control for constitutive target gene expression.
- N5-12G6 riboswitch cassette was inserted between nucleotide position 424 and 425 in the cDNA of human growth hormone (hGH) gene driven under CMV promoter.
- Enzyme-linked immunosorbent assay (ELISA) for mouse erythropoietin (mEpo) AML-12 cells or C2C12 cells were transfected as described in Example 1 with TransIT-X2 transfection reagent (Mirus Bio).
- ELISA for human growth hormone (hGH) HEK 293 cells were transfected as described in Example 1 with TransIT-293 transfection reagent (Mirus Bio). Four hours after transfection, the transfected cells were treated with or without Comp.004 at the indicated doses.
- riboswitch cassette containing re-engineered aptamer sequences N5-12G6 and N4-1C11 were inserted into the cDNA sequence of murine erythropoietin (mEpo) and the cDNA sequence of human growth hormone gene (hGH), generating regulatable constructs for these two genes.
- mEpo murine erythropoietin
- hGH human growth hormone gene
- Example 5 Synthetic riboswitches regulate gene expression in vivo in mice
- AAV adeno-associated viral vector
- mice were transduced with an adeno-associated viral vector (AAV) carrying an engineered riboswitch, which was inserted into the gene for the reporter protein luciferase.
- AAV2.8 viral particle production The AAV8 particles used for the transduction of mice comprised a viral genome derived from AAV2 and a capsid derived from AAV8.
- mice received a single tail vein injection or single intra-muscular injection in hind limb quadricep of 5x10 10 , 1.0 x 10 11 or 2.5 x 10 11 genome copies (GC) of the receptive AAV8 viral particle.
- Comp.004 was formulated in 0.5% methylcellulose (MC): 0.25% Tween® 80 in deionized (DI) water for oral administration.
- MC methylcellulose
- DI deionized
- mice were subjected to two additional rounds of dosing and imaging cycles as follows: Day 37 (post AAV administration): 30 mg/kg; day 44: 100 mg/kg.
- Day 37 post AAV administration
- day 44 100 mg/kg.
- mEpo regulated mouse erythropoietin
- each female Balb/c mouse was injected in the quadricep muscle with 1.0 x 10 11 , 5x10 10 , 1x10 10 , or 5x10 9 GC of AAV8 vectors containing riboswitch N5-12G6 regulated mEpo gene (AAV8.mEpo.12G6).
- mice were treated with Comp.004 formulated in 0.5% methylcellulose (MC): 0.25% Tween® 80 in deionized (DI) water via oral gavage.16 hours post oral dosing, mice were subjected to submandibular blood collection.10 fold diluted serum was used to measure mouse serum Epo using ELISA (Invitrogen
- Chronic kidney disease-associated anima male C57Bl/6 mice were injected intramuscularly with 2.5 x 10 10 vg or 1.0 x 10 10 vg of AAV8.mEpo.12G6 per mouse.
- mice were treated daily with 50 mg/kg adenine (Sigma) via oral gavage for total 28 treatment in 5 weeks. Hematocrit was measured after Adenine treatment and before small molecule inducer treatment and monitored every 7 to 10 days post daily small molecule inducer oral dosing.
- Noninvasive live animal bioluminescence imaging Before imaging, mice were anesthetized with 2% isoflurane and injected with 150 mg/kg body weight of D-luciferin luciferase substrate.
- mice were treated with compound via oral gavage 4 weeks post AAV injection.6 hours after a single dose of compound (10 mg/kg) treatment, luciferase activity was significantly increased in mice injected AAV vectors containing a luciferase gene comprising riboswitch 12G6 when compared with the luciferase signal prior to compound treatment, whereas the luciferase expression did not change significantly after compound administration in the group of mice injected with the same dose of non-regulatable control vector Con1 (see Figures 6a and 6b). With single administration of the compound inducer, the induced luciferase activity was highest at 6 hr post dosing, and decreased at 24 hr.
- the luciferase signal returned to baseline level (prior to dosing), indicating the on-and-off state of transgene expression in the presence and absence of the compound inducer and the reversibility of the riboswitch gene regulation system. Subsequent dosing with higher doses in the same mice induced further elevated luciferase signal, indicating dose dependency. Similar results were observed in the mice injected intramuscularly with AAV8.Luci.12G6 vector ( Figure 7a and 7b).
- Luciferase expression from the AAV8.Luci.12G6 exhibited tighter regulation with lower background expression levels in absence of Comp.004, while luciferase expression from the AAV8.Luci.1B6 exhibited looser regulation with higher background expression levels in absence of Comp.004, but also higher peak luciferase expression in response to Comp.004 ( Figures 6c and 7c).
- the ability of riboswitch in regulating gene expression in animal was further evaluated using mouse erythropoietin gene (mEpo). Mice were injected in the muscle with 1 x10 11 GC of AAV8 vectors containing the mEpo gene with 12G6 riboswitch cassette.
- mice treated with 30 mg/kg Compd.004 the serum vector-expressed mEpo was elevated when compared to mice without compound dosing. Moreover, the serum vector expressed mEpo level was further elevated with higher doses of compound treatment and amount of AAV administered, indicating a dose-dependent increase in transgene expression along the increase of the compound inducer (Figure 8).
- the effect of riboswitch-regulated expression of Epo on hematocrit was evaluated in a mouse model of chronic kidney disease (CKD)- associated anemia. After 20 doses of compound 004 by oral administration, the hematocrit of anemic mice was increased, with the biggest increase in the 100 mg/kg dose group.
- CKD chronic kidney disease
- Riboswitch constructs Alternative splicing riboswitch cassette containing aptamers N5-12G6 was inserted between nucleotide position 181 and 182 in human parathyroid hormone (hPTH) cDNA sequence, generating constructs hPTH-12G6. Expression of the erythropoietin gene was driven by CASI promoter.
- Enzyme-linked immunosorbent assay (ELISA) for human PTH HEK 293 cells were transfected as described in Example 1 with TransIT-293 transfection reagent (Mirus Bio). Four hours after transfection, the transfected cells were treated with or without Compound 004 at the indicated doses.
- AAV2.9 viral particle production The AAV9 particles used for the transduction of mice comprised a viral genome derived from AAV2 (ITR) and a capsid derived from AAV9.
- the hPTH-12G6 was cloned into AAV plasmid backbone with CASI promoter, and the AAV plasmid was packaged into AAV9 capsid, generating vector AAV9.hPTH-12G6 (Signagen) [0443]
- Compound 004 was formulated in 0.5% methylcellulose (MC): 0.25% Tween® 80 in deionized (DI) water for oral administration.30 days after AAV vector delivery, mice were treated orally via oral gavage with 0 mg/kg, 30 mg/kg, 100 mg/kg or 300 mg/kg Comp. 004 for 3 days. [0444] Results: [0445] As with luciferase gene or Epo gene, riboswitch 12G6 regulated hPTH expression in dose dependent manner ( Figure 10a).
- Step 1.5-Fluoro-7-vinylquinoxaline A mixture of 7-bromo-5-fluoroquinoxaline (814 mg, 3.59 mmol, 1.00 equiv), potassium trifluoro (vinyl) boranuide (961 mg, 7.17 mmol, 2.00 equiv), Pd(dppf)Cl 2.
- Step 2.8-Fluoroquinoxaline-6-carbaldehyde To a solution of 5-fluoro-7-vinylquinoxaline (536 mg, 3.08 mmol, 1.00 equiv) in THF (10.7 mL) and H 2 O (5.36 mL) was added OsO 4 (117 mg, 462 ⁇ mol, 24.0 ⁇ L, 0.15 equiv) and NaIO 4 (3.29 g, 15.4 mmol, 853 ⁇ L, 5.00 equiv). The mixture was stirred at 15 °C for 2 h.
- tert-Butyl 4-(3-(((8-fluoroquinoxalin-6-yl)methyl)amino)pyridin-4- yl)piperazine-1-carboxylate [0458] To a solution of tert-butyl (E)-4-(3-(((8-fluoroquinoxalin-6- yl)methylene)amino)pyridin-4-yl)piperazine-1-carboxylate (619 mg, 1.42 mmol, 1.00 equiv) in MeOH (10 mL) was added NaBH 4 (107 mg, 2.84 mmol, 2.00 equiv).
- Step 2.6-Bromo-7-chloroquinoxaline To a solution of 4-bromo-5-chlorocyclohexa-3,5-diene-1,2-diamine (4.11 g, 18.6 mmol, 1.00 equiv) in EtOH (164 mL) was added oxaldehyde (5.38 g, 37.1 mmol, 40% purity, 2.00 equiv). The mixture was stirred at 15 °C for 12 h, cooled to 15 °C, and filtered. The filter cake was washed with EtOH (10 mL ⁇ 2) and dried to provide the title compound (2.70 g, crude) as a yellow solid.
- Step 3.6-Chloro-7-vinylquinoxaline A mixture of 6-bromo-7-chloroquinoxaline (1.00 g, 4.11 mmol, 1.00 equiv), potassium trifluoro (vinyl) boranuide (1.10 g, 8.21 mmol, 2.00 equiv), Pd (dppf)Cl 2 .
- Step 4.7-Chloroquinoxaline-6-carbaldehyde To a solution of 6-chloro-7-vinylquinoxaline (534 mg, 2.80 mmol, 1.00 equiv) in THF (10.7 mL) and H 2 O (5.34 mL) was added OsO 4 (107 mg, 420 ⁇ mol, 21.80 ⁇ L, 0.15 equiv) and NaIO 4 (3.00 g, 14.0 mmol, 776 ⁇ L, 5.00 equiv). The mixture was stirred at 15 °C for 0.5 h.
- tert-Butyl 4-(3-(((7-chloroquinoxalin-6-yl)methyl)amino)pyridin-4- yl)piperazine-1-carboxylate [0474] To a solution of tert-butyl (E)-4-(3-(((7-chloroquinoxalin-6- yl)methylene)amino)pyridin-4-yl)piperazine-1-carboxylate (489 mg, 1.08 mmol, 1.00 equiv) in MeOH (8.0 mL) was added NaBH 4 (81.7 mg, 2.16 mmol, 2.00 equiv).
- Example 9 4-(1,4-Diazepan-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Comp.014) HN [0479] Step 1.4-Bromo-N-(quinoxalin-6-ylmethyl)pyridin-3-amine [0480] To a solution of quinoxaline-6-carbaldehyde (5.00 g, 28.9 mmol, 1.00 equiv) and 4-bromopyridin-3-amine (5.94 g, 37.6 mmol, 1.30 equiv) in THF (100 mL) was added Ti(i- PrO) 4 (16.4 g, 57.8 mmol, 17.1 mL, 2.00 eq).
- Step 2.4-(1,4-Diazepan-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine M173
- 4-bromo-N-(quinoxalin-6-ylmethyl)pyridin-3-amine 200 mg, 634.6 ⁇ mol, 1.00 equiv
- tert-butyl 1,4-diazepane-1-carboxylate 1.90 mmol, 3.00 equiv
- DIPEA 328.1 mg, 2.54 mmol, 442.1 ⁇ L, 4.00 equiv
- the reaction mixture was directly purified by Pre- HPLC (HCl condition) without workup.
- the purified product was dissolved in MeOH (1.00 mL) followed by addition of HCl/MeOH (4.0 M, 1.00 mL, 35.7 equiv).
- the mixture was stirred at 20 °C for 1 h and was purified by prep-HPLC (HCl condition) to give the title compound (116.8 mg, 36.5%) as a brown solid.
- Example 10 4-(2-Methylpiperazin-1-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Comp. 015) [0485] To a solution of 4-bromo-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (200 mg, 634 ⁇ mol, 1.00 equiv) and tert-butyl 3-methylpiperazine-1-carboxylate (1.90 mmol, 3.00 equiv) in NMP (2.00 mL) was added DIPEA (328 mg, 2.54 mmol, 442.1 ⁇ L, 4.00 equiv). The mixture was stirred at 180 °C for 8 h.
- tert-Butyl 4-(3-aminopyridin-4-yl)piperidine-1-carboxylate B [0494] A mixture of tert-butyl 3'-amino-3,6-dihydro-[4,4'-bipyridine]-1(2H)-carboxylate (0.70 g, 2.54 mmol, 1.00 equiv) and Pd/C (0.10 g, 2.54 mmol, 10% purity, 1.00 equiv) in MeOH (10.0 mL) was stirred at 25 °C for 2 h under H 2 (15 psi). The mixture was filtered and washed with MeOH (10 mL).
- Step 4.4-(Piperidin-4-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine [0498] To a solution of tert-butyl 4-(3-((quinoxalin-6-ylmethyl)amino)pyridin-4- yl)piperidine-1-carboxylate (48.3 mg, 115 ⁇ mol, 1.00 equiv) in MeOH (1.00 mL) was added HCl/MeOH (4.00 M, 1.00 mL, 34.7 equiv). The mixture was stirred at 20 °C for 1 h and concentrated to provide the title compound (35.0 mg, 82.0%) as a brown oil.
- Example 13 4-(Pyrrolidin-3-yloxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Comp.018) [0501] Step 1. tert-Butyl 3-((3-nitropyridin-4-yl)oxy)pyrrolidine-1-carboxylate [0502] To a mixture of 4-chloro-3-nitropyridine (1.00 g, 6.31 mmol, 1.00 equiv) and tert- butyl 3-hydroxypyrrolidine-1-carboxylate (1.18 g, 6.31 mmol, 1.00 equiv) in THF (10.0 mL) was added t-BuOK (2.12 g, 18.9 mmol, 3.00 equiv) at 0 °C.
- tert-Butyl 3-((3-aminopyridin-4-yl)oxy)pyrrolidine-1-carboxylate [0504] To a solution of tert-butyl 3-((3-nitropyridin-4-yl)oxy)pyrrolidine-1-carboxylate (1.50 g, 4.85 mmol, 1.00 equiv) and NH 4 Cl (1.30 g, 24.3 mmol, 5.00 equiv) in EtOH (25.0 mL) and H 2 O (25.0 mL) was added Fe (1.35 g, 24.3 mmol, 5.00 equiv). The mixture was stirred at 45 °C for 1 h and was filtered.
- Step 4.4-(Pyrrolidin-3-yloxy)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine [0508] To a solution of t-butyl 3-((3-((quinoxalin-6-ylmethyl)amino)pyridin-4- yl)oxy)pyrrolidine-1-carboxylate (100 mg, 237 ⁇ mol, 1.00 equiv) in dioxane (2.00 mL) was added HCl/dioxane (2.00 mL). The mixture was stirred at 20 °C for 1 h and was concentrated to provide the title compound (50.0 mg, 64.2%) as a dark solid.
- tert-Butyl 4-(3-chloro-5-((quinoxalin-6-ylmethyl)amino)pyridin-4- yl)piperazine-1-carboxylate A mixture of tert-butyl 4-(3-amino-5-chloropyridin-4-yl)piperazine-1-carboxylate (200 mg, 639 ⁇ mol, 1.00 equiv), quinoxaline-6-carbaldehyde (101 mg, 639 ⁇ mol, 1.00 equiv), AcOH (57.6 mg, 959 ⁇ mol, 54.8 ⁇ L, 1.50 equiv) and 4A MS (0.5 g) in EtOH (1.00 mL) was stirred at 80 °C for 12 h.
- tert-butyl 4-(3-chloro-5-((quinoxalin-6-ylmethyl)amino)pyridin-4- yl)piperazine-1-carboxylate 250 mg, 549 ⁇ mol, 1.00 equiv
- dioxane 5.00 mL
- HCl/dioxane 4.00 M, 1.00 mL, 7.28 equiv
- Example 25 [0551] 4-(2,5-diazabicyclo[2.2.1]heptan-2-yl)-N-(quinoxalin-6-ylmethyl)pyridin-3-amine (Comp.030) [0552] 1 H NMR (400 MHz, D 2 O) ⁇ 8.85 (s, 2H), 8.10 - 8.08 (m, 1H), 8.02 (s, 1H), 7.91 - 7.89 (m, 1H), 7.86 - 7.84 (m, 1H), 7.56 (s, 1H), 7.01 -7.00 (m, 1H), 5.14 (s, 1H), 4.65 - 4.59 (m, 3H), 4.20 - 4.16 (m, 1H), 3.87 - 3.84 (m, 1H), 3.65 - 3.62 (m, 1H), 3.53 - 3.50 (m, 1H), 2.35 - 2.32 (m, 1H), 2.18 - 2.15 (m, 1H).
- Example 43 [0605] 4-(piperazin-1-yl)-3-((quinoxalin-6-ylmethyl)amino)benzonitrile (Comp.048) [0606] Example 44 [0607] N-((8-chloroquinoxalin-6-yl)methyl)-4-(piperazin-1-yl)pyridin-3-amine (Comp.
- Example 137 [0886] (S)-N-((7-fluoroquinoxalin-6-yl)methyl)-4-(3-methylpiperazin-1-yl)-5- (trifluoromethyl)pyridin-3-amine (Comp.142) [0887]
Landscapes
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- General Health & Medical Sciences (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Saccharide Compounds (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (9)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2022409938A AU2022409938A1 (en) | 2021-12-15 | 2022-12-15 | Aptamers and small molecule ligands |
| JP2024535970A JP2024546954A (ja) | 2021-12-15 | 2022-12-15 | アプタマー及び小分子リガンド |
| US18/719,538 US20250101436A1 (en) | 2021-12-15 | 2022-12-15 | Aptamers and small molecule ligands |
| CA3239306A CA3239306A1 (en) | 2021-12-15 | 2022-12-15 | Aptamers and small molecule ligands |
| KR1020247022021A KR20240133703A (ko) | 2021-12-15 | 2022-12-15 | 압타머 및 소분자 리간드 |
| CN202280091789.9A CN118786217A (zh) | 2021-12-15 | 2022-12-15 | 适体和小分子配体 |
| IL313463A IL313463A (en) | 2021-12-15 | 2022-12-15 | Small molecule aptamers and ligands |
| EP22865937.1A EP4448769A2 (en) | 2021-12-15 | 2022-12-15 | Aptamers and small molecule ligands |
| MX2024007448A MX2024007448A (es) | 2021-12-15 | 2022-12-15 | Aptameros y ligandos de moleculas peque?as. |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202163361400P | 2021-12-15 | 2021-12-15 | |
| US63/361,400 | 2021-12-15 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2023111686A2 true WO2023111686A2 (en) | 2023-06-22 |
| WO2023111686A3 WO2023111686A3 (en) | 2023-08-17 |
Family
ID=85511135
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2022/000762 Ceased WO2023111686A2 (en) | 2021-12-15 | 2022-12-15 | Aptamers and small molecule ligands |
Country Status (10)
| Country | Link |
|---|---|
| US (1) | US20250101436A1 (https=) |
| EP (1) | EP4448769A2 (https=) |
| JP (1) | JP2024546954A (https=) |
| KR (1) | KR20240133703A (https=) |
| CN (1) | CN118786217A (https=) |
| AU (1) | AU2022409938A1 (https=) |
| CA (1) | CA3239306A1 (https=) |
| IL (1) | IL313463A (https=) |
| MX (1) | MX2024007448A (https=) |
| WO (1) | WO2023111686A2 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024256870A1 (en) | 2023-06-14 | 2024-12-19 | Meiragtx Uk Ii Limited | Small molecule ligands and aptamers |
| WO2025027580A1 (en) | 2023-08-01 | 2025-02-06 | Meiragtx Uk Ii Limited | Riboswitch-regulated expression of chimeric antigen receptors |
| WO2025212263A1 (en) * | 2024-04-05 | 2025-10-09 | The University Of North Carolina At Chapel Hill | Quinoxaline containing rna-targeting ligands, compositions thereof, and methods of making and using the same |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2614150A1 (en) * | 2010-09-07 | 2013-07-17 | Yeda Research and Development Co. Ltd. | Thiamine pyrophosphate (tpp) riboswitch mutants producing vitamin b1 enriched food and feed crops |
| KR102699584B1 (ko) * | 2015-02-02 | 2024-08-28 | 메이라지티엑스 유케이 Ii 리미티드 | 대안적 스플라이싱의 압타머 매개 조절에 의한 유전자 발현 제어 |
| ES2954929T3 (es) * | 2016-02-02 | 2023-11-27 | Meiragtx Uk Ii Ltd | Regulación de expresión génica mediante control mediado por aptámeros de ribozimas de autocorte |
| SG11201908043UA (en) * | 2017-03-02 | 2019-09-27 | Meiragtx Uk Ii Limited | Regulation of gene expression by aptamer-modulated rnase p cleavage |
| BR112022019284A2 (pt) * | 2020-03-24 | 2023-02-14 | Meiragtx Uk Ii Ltd | Aptâmeros que se ligam a análogos e derivados de tiamina |
-
2022
- 2022-12-15 CA CA3239306A patent/CA3239306A1/en active Pending
- 2022-12-15 EP EP22865937.1A patent/EP4448769A2/en active Pending
- 2022-12-15 AU AU2022409938A patent/AU2022409938A1/en active Pending
- 2022-12-15 US US18/719,538 patent/US20250101436A1/en active Pending
- 2022-12-15 IL IL313463A patent/IL313463A/en unknown
- 2022-12-15 WO PCT/IB2022/000762 patent/WO2023111686A2/en not_active Ceased
- 2022-12-15 CN CN202280091789.9A patent/CN118786217A/zh active Pending
- 2022-12-15 KR KR1020247022021A patent/KR20240133703A/ko active Pending
- 2022-12-15 JP JP2024535970A patent/JP2024546954A/ja active Pending
- 2022-12-15 MX MX2024007448A patent/MX2024007448A/es unknown
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024256870A1 (en) | 2023-06-14 | 2024-12-19 | Meiragtx Uk Ii Limited | Small molecule ligands and aptamers |
| WO2025027580A1 (en) | 2023-08-01 | 2025-02-06 | Meiragtx Uk Ii Limited | Riboswitch-regulated expression of chimeric antigen receptors |
| WO2025212263A1 (en) * | 2024-04-05 | 2025-10-09 | The University Of North Carolina At Chapel Hill | Quinoxaline containing rna-targeting ligands, compositions thereof, and methods of making and using the same |
Also Published As
| Publication number | Publication date |
|---|---|
| CA3239306A1 (en) | 2023-06-22 |
| CN118786217A (zh) | 2024-10-15 |
| WO2023111686A3 (en) | 2023-08-17 |
| MX2024007448A (es) | 2024-07-22 |
| EP4448769A2 (en) | 2024-10-23 |
| JP2024546954A (ja) | 2024-12-26 |
| KR20240133703A (ko) | 2024-09-04 |
| IL313463A (en) | 2024-08-01 |
| US20250101436A1 (en) | 2025-03-27 |
| AU2022409938A1 (en) | 2024-07-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2022409938A1 (en) | Aptamers and small molecule ligands | |
| CN114990143B (zh) | 通过对选择性剪接进行适体介导的调节来实现的基因表达调控 | |
| JP2022508203A (ja) | Glp-1rアゴニスト及びその使用 | |
| AU2021243743B2 (en) | Aptamers that bind thiamine analogs and derivatives | |
| CA3135563A1 (en) | Substituted 5-cyclopropyl-1h-pyrazol-3-yl-amine derivatives as selective cdk12/13 inhibitors | |
| WO2017072319A1 (en) | Derivatives of porphyrins, their process of preparation and their use for treating viral infections | |
| CN103781791A (zh) | 具有噁唑并[4,5-c]吡啶环的羧酸衍生物 | |
| CN121712756A (zh) | 小分子配体和适体 | |
| EA049048B1 (ru) | Аптамеры, которые связывают аналоги и производные тиамина | |
| JP2024506387A (ja) | 腎線維症を治療するためのオキサジアゾリルジヒドロピラノ[2,3‐b]ピリジン系HIPK2阻害剤 | |
| CN103781790A (zh) | 具有噁唑并[5,4-b]吡啶环的羧酸衍生物 | |
| KR20260003718A (ko) | 소분자 조절 대체 스플라이싱 | |
| WO2026085222A2 (en) | Small-molecule regulated alternative splicing | |
| WO2025235331A1 (en) | Bifunctional compounds containing pyrazolopyrimidine derivatives for degrading certain cyclin-dependent kinase via ubiquitin proteasome pathway | |
| CN103570688B (zh) | 2,5-二氨甲基吡嗪类化合物、其药物组合物、制备方法和用途 | |
| WO2025137393A1 (en) | Bifunctional compounds containing pyrido[2,3-d]pyrimidin-7(8h)-one derivatives for degrading cyclin-dependent kinases 2, 4, and 6 via ubiquitin proteasome pathway | |
| BR112020001978A2 (pt) | derivados de tiazolopiridina como antagonistas de receptor de adenosina |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22865937 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 3239306 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 313463 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12024551447 Country of ref document: PH |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2024535970 Country of ref document: JP Ref document number: MX/A/2024/007448 Country of ref document: MX |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112024012038 Country of ref document: BR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022409938 Country of ref document: AU Ref document number: 812411 Country of ref document: NZ Ref document number: AU2022409938 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202417053306 Country of ref document: IN Ref document number: 202491559 Country of ref document: EA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022865937 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2022865937 Country of ref document: EP Effective date: 20240715 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11202404111Q Country of ref document: SG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202280091789.9 Country of ref document: CN |
|
| ENP | Entry into the national phase |
Ref document number: 112024012038 Country of ref document: BR Kind code of ref document: A2 Effective date: 20240613 |
|
| WWP | Wipo information: published in national office |
Ref document number: 18719538 Country of ref document: US |