WO2023109935A1

WO2023109935A1 - Dsrna, and preparation method therefor and use thereof

Info

Publication number: WO2023109935A1
Application number: PCT/CN2022/139481
Authority: WO
Inventors: 侯哲; 张建羽; 李云飞; 张瑱; 林晓燕; 耿俊; 黄龙飞; 周雅琴; 吕珍珍
Original assignee: 上海拓界生物医药科技有限公司
Priority date: 2021-12-16
Filing date: 2022-12-16
Publication date: 2023-06-22
Also published as: WO2023109945A1; CN118355121A; TW202333751A; CN118541482A; TW202340466A

Abstract

The present invention relates to a dsRNA, and a preparation method therefor and the use thereof, and also relates to a pharmaceutical composition comprising the dsRNA, or a cell or a kit. The dsRNA can interfere with the expression of the HSD17B13 gene, and prevent and/or treat related diseases.

Description

A kind of dsRNA, its preparation method and application

This disclosure claims the priority of Chinese patent application 202111542323.X with an application date of December 16, 2021, and this disclosure cites the full text of the above-mentioned Chinese patent application.

technical field

The present disclosure relates to a dsRNA that can be targeted and delivered into cells to play the role of RNA interference. The present disclosure also relates to preparation methods and applications of dsRNA.

Background technique

RNA interference (RNAi) is an effective way to silence gene expression. According to statistics, more than 80% of the disease-related proteins in the human body cannot be targeted by current conventional small molecule drugs and biological macromolecular preparations, and are non-druggable proteins. Using RNA interference technology, we can design appropriate siRNA based on the mRNA encoding these proteins, specifically target the target mRNA and degrade the target mRNA, so as to inhibit the production of related proteins. Therefore, siRNA has a very important prospect of drug development. However, in order to achieve the RNA interference effect for therapeutic purposes in vivo, it is necessary to deliver siRNA molecules to specific cells in vivo.

Conjugating siRNA with a targeting ligand, using the targeting ligand and the receptor molecular structure on the surface of the cell membrane, and endocytosis into the cell is an effective drug delivery method. For example, asialoglycoprotein receptor (ASGPR) is a receptor specifically expressed in hepatocytes, which has high abundance on the surface of hepatocytes and is characterized by rapid intracellular and extracellular transitions. Monosaccharide and polysaccharide molecules such as galactose, galactosamine, and N-acetylgalactosamine have high affinity for ASGPR. It was reported in the literature (10.16476/j.pibb.2015.0028) that the use of galactosamine molecular clusters (GalNAc) can effectively deliver RNA to hepatocytes, and GalNAc molecules designed as trivalent or tetravalent molecular clusters can significantly increase the concentration of monovalent or divalent GalNAc. Ability of the molecule to target hepatocytes.

Different molecular cluster structures and different connection methods with RNA will obviously affect the activity of siRNA in vivo. Higher activity means better therapeutic effect, or lower dosage. Under the same drug effect, Lower dosage also means lower toxicity. Therefore, it is of great significance to rationally design the covalent linking method of targeting ligand and siRNA.

Contents of the invention

In a first aspect, the present disclosure provides a double-stranded ribonucleic acid (dsRNA) comprising siRNA and one or more ligands conjugated thereto, the siRNA comprising a sense strand and an antisense strand, the antisense strand At least one nucleotide position from the 2nd to the 8th position of the 5' end contains a chemical modification represented by formula (I), a tautomer or a pharmaceutically acceptable salt thereof:

Wherein: Y is selected from O, NH and S;

Each X is independently selected from CR ₄ (R ₄ '), S, NR ₅ and NH-CO, wherein R ₄ , R ₄ ', R ₅ are independently H or C ₁ -C ₆ alkyl;

J ₂ is H or C ₁ -C ₆ alkyl;

n=0, 1 or 2; m=0, 1 or 2; s=0 or 1;

R ₃ is selected from H, OH, halogen, NH ₂ , C ₁ -C ₆ alkyl, C ₁ -C ₆ alkoxy, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, S-CH ₃ , NCH ₃ (CH ₃ ), OCH ₂ CH ₂ OCH ₃ , -O-alkylamino and (CH ₂ ) _p R ₆ ; wherein R ₆ is selected from OH, halogen, methoxy, ethoxy, N ₃ , C ₂ -C ₆ alkenyl and C ₂ -C ₆ alkynyl, p=1, 2 or 3;

Q ₁ is

Q ₂ is R ₂ ; or Q ₁ is R ₂ and Q ₂ is

in:

R ₁ is selected from H, C ₁ -C ₆ alkyl, C ₁ -C ₆ alkoxy, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl and (CH ₂ ) _q R ₇ ; wherein R ₇ selected from OH, halogen, methoxy, ethoxy, N ₃ , C ₂ -C ₆ alkenyl and C ₂ -C ₆ alkynyl, q=1, 2 or 3;

J ₁ is H or C ₁ -C ₆ alkyl;

R ₂ is selected from H, OH, halogen, NH ₂ , C ₁ -C ₆ alkyl, C ₁ -C ₆ alkoxy, C ₂ -C ₆ alkenyl, C ₂ -C ₆ alkynyl, S-CH ₃ , NCH ₃ (CH ₃ ), OCH ₂ CH ₂ OCH ₃ , -O-alkylamino and (CH ₂ ) _r R ₈ ; wherein R ₈ is selected from OH, halogen, methoxy, ethoxy, N ₃ , C ₂ -C ₆ alkenyl and C ₂ -C ₆ alkynyl, r=1, 2 or 3;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is a base;

The chemical modification represented by the formula (I), its tautomer or its pharmaceutically acceptable salt modification is not

The ligand is a compound represented by formula (II) or a pharmaceutically acceptable salt thereof,

Wherein, _L is a C ₁ -C ₃₀ alkyl chain, or contains a C ₁ -C ₃₀ alkyl chain interrupted by one or more oxygen, sulfur, nitrogen atoms or C=O;

R ₁₁ and R ₁₂ are independently a chemical bond, NR ₁₆ , C=O or -OC(=O)-;

Q ₃ is

is a single or double bond, and when

When it is a single bond, R ₁₃ is independently CR ₁₇ R ₁₈ , NR ₁₆ , O or S, when

When it is a double bond, R ₁₃ is independently CR ₁₉ or N;

R ₁₄ is independently CR ₁₉ or N;

Ring A is cycloalkyl, heterocycloalkyl, aryl or heteroaryl, present or absent, and when ring A exists, R ₁₅ is independently CR ₁₉ or N, and when ring A does not exist, R ₁₅ independently CR ₁₇ R ₁₈ , NR ₁₆ or O;

R ₁₆ and R ₁₉ are independently hydrogen, deuterium, alkyl, alkoxy, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, SR', S(=O)R', S(=O ) ₂ R', S(=O) ₂ NR'(R"), NR'(R"), C(=O)R', C(=O)OR' or C(=O)NR'(R ”), the alkyl, alkoxy, cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally replaced by one or more selected from halogen, hydroxyl, oxo, nitro, cyano, C _1-6 alkyl, C _1-6 alkoxy, C _3-7 cycloalkyl, 3-12 membered heterocycloalkyl, 6-12 membered aryl, 5-12 membered heteroaryl, SR', S (=O)R', S(=O) ₂ R', S(=O) ₂ NR'(R"), NR'(R"), C(=O)R', C(=O)OR 'and C(=O)NR'(R") replaced by groups in;

R ₁₇ and R ₁₈ are independently hydrogen, deuterium, alkyl, alkoxy, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, SR', S(=O)R', S(=O ) ₂ R', S(=O) ₂ NR'(R"), NR'(R"), C(=O)R', C(=O)OR' or C(=O)NR'(R ”), the alkyl, alkoxy, cycloalkyl, heterocycloalkyl, aryl or heteroaryl are optionally replaced by one or more selected from halogen, hydroxyl, oxo, nitro, cyano, C _1-6 alkyl, C _1-6 alkoxy, C _3-7 cycloalkyl, 3-12 membered heterocycloalkyl, 6-12 membered aryl, 5-12 membered heteroaryl, SR', S (=O)R', S(=O) ₂ R', S(=O) ₂ NR'(R"), NR'(R"), C(=O)R', C(=O)OR 'and C(=O)NR'(R") replaced by groups in;

R' and R" are independently hydrogen, deuterium, hydroxyl, alkyl, alkoxy, cycloalkyl, heterocycloalkyl, aryl or heteroaryl, the alkyl, alkoxy, cycloalkyl, Heterocycloalkyl, aryl or heteroaryl is optionally substituted by one or more substituents selected from halogen, hydroxy, oxo, nitro and cyano;

m1, n1, p1 and q1 are independently 0, 1, 2, 3 or 4;

B1 is

R _b1 , R _b2 , R _b3 , R _b4 , R _b5 , R _b6 and R _b7 are independently -C(=O)-, -NHC(=O)-, -C(=O)O-, -C (=O)-(CH ₂ ) _z8 -O- or -NHC(=O)-(CH ₂ ) _z9 -O-;

z1, z2, z3, z4, z5, z6, z7, z8 and z9 are independently an integer of 0-10;

L ₂ is a C ₁ -C ₃₀ alkyl chain, or contains a C ₁ -C ₃₀ alkyl chain interrupted by one or more oxygen, sulfur, nitrogen atoms or C=O;

r1 is an integer of 1-10.

In some embodiments (some groups or features are defined as follows, undefined groups or features are as described in any other scheme, hereinafter referred to as "in some embodiments"), when X is NH-CO, _R1 is not H.

In some embodiments, the chemical modification represented by formula (I), its tautomer, or a pharmaceutically acceptable salt thereof is replaced with a 2'-methoxy modification.

In some embodiments, the chemical modification shown in formula (I) is selected from the chemical modification shown in formula (I-1):

Wherein: Y is selected from O, NH and S;

Each J ₁ and J ₂ are independently H or C ₁ -C ₆ alkyl;

n=0, 1 or 2; m=0, 1 or 2; s=0 or 1;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is as defined in formula (I).

In some embodiments, B is selected from the group consisting of purine bases, pyrimidine bases, indole, 5-nitroindole, and 3-nitropyrrole.

In some embodiments, B is selected from adenine, guanine, isoguanine, hypoxanthine, xanthine, C2 modified purine, N8 modified purine, 2,6-diaminopurine, 6-dimethylamino Purine, 2-aminopurine, N6-alkyladenine, O6-alkylguanine, 7-deazapurine, cytosine, 5-methylcytosine, isocytosine, pseudocytosine, uracil, pseudourine Pyrimidine, 2-thiouridine, 4-thiouridine, C5-modified pyrimidine, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

In some embodiments, B is selected from adenine, guanine, 2,6-diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5- Nitroindole and 3-nitropyrrole.

In some embodiments, B is the same base as if the nucleotide at that position on the antisense strand was unmodified.

In some embodiments, the chemical modification shown in formula (I) is selected from the chemical modification shown in formula (I-2):

Wherein Y is selected from O, NH and S;

n=0, 1 or 2; m=0, 1 or 2; s=0 or 1;

Each J ₁ and J ₂ are independently H or C ₁ -C ₆ alkyl;

R ₂ is selected from H, C ₁ -C ₆ alkyl, C ₁ -C ₆ alkoxy, S-CH ₃ , NCH ₃ (CH ₃ ), OCH ₂ CH ₂ OCH ₃ , -O-alkylamino and ( CH ₂ ) _r R ₈ ; wherein R ₈ is selected from OH, halogen, methoxy, ethoxy, N ₃ , C ₂ -C ₆ alkenyl and C ₂ -C ₆ alkynyl; r=1, 2 or 3 ;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is as defined in formula (I).

In some embodiments, each X is independently selected from CR ₄ (R ₄ '), S, NR ₅ and NH-CO, wherein R ₄ , R ₄ ', R ₅ are each independently H or C ₁ -C ₃ alkyl groups;

n=0, 1 or 2; m=0, 1 or 2; s=0 or 1;

Each J ₁ and J ₂ are independently H or C ₁ -C ₃ alkyl;

R ₃ is selected from H, OH, halogen, NH ₂ , C ₁ -C ₃ alkyl, C ₁ -C ₃ alkoxy, C ₂ -C ₄ alkenyl, C ₂ -C ₄ alkynyl, S-CH ₃ , NCH ₃ (CH ₃ ), OCH ₂ CH ₂ OCH ₃ , -O-alkylamino and (CH ₂ ) _p R ₆ ; wherein R ₆ is selected from OH, halogen, methoxy, ethoxy, N ₃ , C ₂ -C ₆ alkenyl and C ₂ -C ₆ alkynyl, p=1, 2 or 3;

R ₁ is selected from H, C ₁ -C ₃ alkyl, C ₁ -C ₃ alkoxy, C ₂ -C ₄ alkenyl, C ₂ -C ₄ alkynyl and (CH ₂ ) _q R ₇ ; wherein R ₇ selected from OH, halogen, methoxy, ethoxy, N ₃ , C ₂ -C ₄ alkenyl and C ₂ -C ₄ alkynyl, q=1, 2 or 3;

R ₂ is selected from H, OH, halogen, NH ₂ , C ₁ -C ₃ alkyl, C ₁ -C ₃ alkoxy, C ₂ -C ₄ alkenyl, C ₂ -C ₄ alkynyl, S-CH ₃ , NCH ₃ (CH ₃ ), OCH ₂ CH ₂ OCH ₃ , -O-alkylamino and (CH ₂ ) _r R ₈ ; wherein R ₈ is selected from OH, halogen, methoxy, ethoxy, N ₃ , C ₂ -C ₄ alkenyl and C ₂ -C ₄ alkynyl, r=1, 2 or 3;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is as defined in formula (I).

In some embodiments, each X is independently selected from CR ₄ (R ₄ '), S, NR ₅ , and NH-CO, wherein R ₄ , R ₄ ', and R ₅ are each independently H, methyl, ethyl radical, n-propyl or isopropyl;

n=0, 1 or 2; m=0, 1 or 2; s=0 or 1;

Each J ₁ and J ₂ are independently H or methyl;

R ₃ is selected from H, OH, F, Cl, NH ₂ , methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, Allyl, ethynyl, propargyl, S-CH ₃ , NCH ₃ (CH ₃ ), OCH ₂ CH ₂ OCH ₃ , -O-methylamino, -O-ethylamino, and (CH ₂ ) _p R ₆ ; wherein R ₆ is selected from OH, F, Cl, methoxy, ethoxy, N ₃ , vinyl, allyl, ethynyl and propargyl, p=1 or 2;

_R is selected from H, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, allyl, ethynyl, propargyl and (CH ₂ ) _q R ₇ ; wherein R ₇ is selected from OH, F, Cl, methoxy, ethoxy, N ₃ , vinyl, allyl, ethynyl and propargyl, q=1 or 2;

R ₂ is selected from H, OH, F, Cl, NH ₂ , methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, vinyl, Allyl, ethynyl, propargyl, S-CH ₃ , NCH ₃ (CH ₃ ), OCH ₂ CH ₂ OCH ₃ , -O-methylamino, -O-ethylamino, and (CH ₂ ) _r R ₈ ; wherein R ₈ is selected from OH, F, Cl, methoxy, ethoxy, N ₃ , vinyl, allyl, ethynyl and propargyl, r=1 or 2;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is as defined in formula (I).

n=0, 1 or 2; m=0, 1 or 2; s=0 or 1;

Each J ₁ and J ₂ are independently H or methyl;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is as defined in formula (I).

In some embodiments, Y is O or NH; each X is independently selected from NH-CO, _CH and NH;

n=0 or 1; m=0 or 1; s=0 or 1;

Each of J ₁ and J ₂ is independently H;

R ₁ is selected from H, methyl and CH ₂ OH;

R ₂ is selected from H, OH, NH ₂ , methyl and CH ₂ OH;

R ₃ is selected from H, OH, NH ₂ , methyl and CH ₂ OH;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is as defined in formula (I).

n=0 or 1; m=0 or 1; s=0 or 1;

Each of J ₁ and J ₂ is independently H;

R ₁ is selected from H, methyl and CH ₂ OH;

R ₂ is selected from H, methyl and CH ₂ OH;

R ₃ is selected from H, OH, NH ₂ , methyl and CH ₂ OH;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is as defined in formula (I).

In some embodiments, Y is O or NH;

Each X is independently selected from CR ₄ (R ₄ '), NR ₅ and NH-CO, R ₄ , R ₄ ', R ₅ are independently H or C ₁ -C ₆ alkyl;

J ₂ is H or C ₁ -C ₆ alkyl;

n=0 or 1; m=0 or 1; s=0 or 1;

R ₃ is selected from H, OH, NH ₂ , C ₁ -C ₆ alkyl, C ₁ -C ₆ alkoxy and (CH ₂ ) _p R ₆ ; R ₆ is selected from OH, methoxy and ethoxy, p = 1, 2 or 3;

Q ₁ is

Q ₂ is R ₂ ; or Q ₁ is R ₂ and Q ₂ is

R ₁ is selected from H, OH, C ₁ -C ₆ alkyl, C ₁ -C ₆ alkoxy and (CH ₂ ) _q R ₇ ; R ₇ is selected from OH, methoxy and ethoxy, q=1 , 2 or 3;

J ₁ is H or C ₁ -C ₆ alkyl;

R ₂ is selected from H, OH, C ₁ -C ₆ alkyl, C ₁ -C ₆ alkoxy and (CH ₂ ) _r R ₈ ; R ₈ is selected from OH, methoxy and ethoxy, r=1 , 2 or 3;

Optionally, R ₁ and R ₂ are directly connected to form a 3-6 membered ring;

B is a base;

In some embodiments, X is independently selected from CR ₄ (R ₄ ′) and NH—CO.

In some embodiments, X is independently selected from CR ₄ (R ₄ ′).

In some embodiments, R ₃ is selected from H, C ₁ -C ₆ alkyl, and (CH ₂ ) _p R ₆ .

In some embodiments, R ₃ is selected from H and C ₁ -C ₆ alkyl.

In some embodiments, R ₁ is selected from H, C ₁ -C ₆ alkyl, and (CH ₂ ) _q R ₇ .

In some embodiments, R ₁ is selected from H and C ₁ -C ₆ alkyl.

In some embodiments, R ₂ is selected from H, OH, C ₁ -C ₆ alkyl, and (CH ₂ ) _r R ₈ .

In some embodiments, R ₂ is selected from H, C ₁ -C ₆ alkyl, and (CH ₂ ) _r R ₈ .

In some embodiments, Y is O;

Each X is independently selected from CR ₄ (R ₄ ') and NH-CO, R ₄ and R ₄ ' are independently H or C ₁ -C ₆ alkyl;

J ₂ is H or C ₁ -C ₆ alkyl;

R ₃ is selected from H, C ₁ -C ₆ alkyl and (CH ₂ ) _p R ₆ ; R ₆ is selected from OH, p=1, 2 or 3;

Q ₁ is

Q ₂ is R ₂ ; or Q ₁ is R ₂ and Q ₂ is

R ₁ is selected from H, C ₁ -C ₆ alkyl and (CH ₂ ) _q R ₇ ; R ₇ is selected from OH, q=1, 2 or 3;

J ₁ is H or C ₁ -C ₆ alkyl;

R ₂ is selected from H, OH, C ₁ -C ₆ alkyl and (CH ₂ ) _r R ₈ ; R ₈ is selected from OH, r=1, 2 or 3;

Optionally, R ₁ and R ₂ are directly connected to form a 5-6 membered ring;

B is a base.

In some embodiments, Y is O;

Each X is independently selected from CR ₄ (R ₄ '), R ₄ and R ₄ ' are independently H or C ₁ -C ₆ alkyl;

J ₂ is H;

R ₃ is selected from H and C ₁ -C ₆ alkyl;

Q ₁ is

Q ₂ is R ₂ ; or Q ₁ is R ₂ and Q ₂ is

R ₁ is selected from H and C ₁ -C ₆ alkyl;

J ₁ is H or C ₁ -C ₆ alkyl;

R ₂ is selected from H, C ₁ -C ₆ alkyl and (CH ₂ ) _r R ₈ ; R ₈ is selected from OH, r=1, 2 or 3;

Optionally, R ₁ and R ₂ are directly connected to form a 5-6 membered ring;

B is a base.

In some embodiments, Y is O.

In some embodiments, X is independently selected from CR ₄ (R ₄ '), NR ₅ and NH-CO, R ₄ , R ₄ ', and R ₅ are independently H, methyl, ethyl, n-propyl or isopropyl. In some embodiments, X is independently selected from NH—CO, CH ₂ and NH. In some embodiments, X is independently selected from NH—CO and CH ₂ . In some embodiments, X is _CH2 .

In some embodiments, J ₂ is H or methyl. In some embodiments, J is _H.

In some embodiments, R ₃ is selected from H, OH, NH ₂ , methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, and ( CH ₂ ) _p R ₆ , R ₆ is selected from OH, methoxy and ethoxy, p=1 or 2. In some embodiments, R ₃ is selected from H, methyl, ethyl, n-propyl, isopropyl, and (CH ₂ ) _p R ₆ , R ₆ is selected from OH, and p=1 or 2. In some embodiments, _R is selected from H and methyl.

In some embodiments, R ₁ is selected from H, OH, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, and (CH ₂ ) _q R ₇ , R ₇ is selected from OH, q=1 or 2. In some embodiments, R ₁ is selected from H, methyl, ethyl, n-propyl, isopropyl, and (CH ₂ ) _q R ₇ , R ₇ is selected from OH, and q=1 or 2. In some embodiments, R ₁ is selected from H and methyl.

In some embodiments, R _is selected from H, OH, methyl, ethyl, n-propyl, isopropyl, methoxy, ethoxy, n-propoxy, isopropoxy, and (CH ₂ ) _r R ₈ , R ₈ is selected from OH, r=1 or 2. In some embodiments, R ₂ is selected from H, OH, methyl, ethyl, n-propyl, isopropyl, and (CH ₂ ) _r R ₈ , R ₈ is selected from OH, and r=1 or 2. In some embodiments, _R2 is selected from H, methyl, and _CH2OH .

In some embodiments, _R1 and _R2 are directly linked to form a 5-6 membered ring. In some embodiments, R _and _R are directly connected to form a 3-6 membered cycloalkyl. In some embodiments, R ₁ and R ₂ are directly connected to form cyclopentyl or cyclohexyl.

In some embodiments, the chemical modification represented by the formula (I) is selected from any of the following structures:

Wherein: B is selected from purine base, pyrimidine base, indole, 5-nitroindole and 3-nitropyrrole.

In some embodiments, the nucleotide comprising the chemical modification represented by formula (I), its tautomer or a pharmaceutically acceptable salt thereof is selected from the group consisting of the chemical modification represented by formula (I'), its Nucleotides of tautomers or pharmaceutically acceptable salts thereof,

Wherein: Y is selected from O, NH and S;

J ₂ is H or C ₁ -C ₆ alkyl;

n=0, 1 or 2; m=0, 1 or 2; s=0 or 1;

Q _1' is

Q _2' is R ₂ ; or Q _1' is R ₂ and Q _2' is

in:

J ₁ is H or C ₁ -C ₆ alkyl;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is a base;

M is O or S;

The chemical modification represented by the formula (I'), its tautomer or its pharmaceutically acceptable salt is not

In some embodiments, when X is NH-CO, _R is not H.

In some embodiments, the chemical modification shown in formula (I') is selected from the chemical modification shown in formula (I'-1):

Wherein: Y is selected from O, NH and S;

Each J ₁ and J ₂ are independently H or C ₁ -C ₆ alkyl;

n=0, 1 or 2; m=0, 1 or 2; s=0 or 1;

M is O or S;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is as defined in formula (I').

In some embodiments, the chemical modification shown in formula (I') is selected from the chemical modification shown in formula (I'-2):

Wherein, Y is selected from O, NH and S;

n=0, 1 or 2; m=0, 1 or 2; s=0 or 1;

Each J ₁ and J ₂ are independently H or C ₁ -C ₆ alkyl;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

M is O or S;

B is as defined in formula (I').

n=0, 1 or 2; m=0, 1 or 2; s=0 or 1;

Each J ₁ and J ₂ are independently H or C ₁ -C ₃ alkyl;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is as defined in formula (I').

n=0, 1 or 2; m=0, 1 or 2; s=0 or 1;

Each J ₁ and J ₂ are independently H or methyl;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is as defined in formula (I').

n=0, 1 or 2; m=0, 1 or 2; s=0 or 1;

Each J ₁ and J ₂ are independently H or methyl;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is as defined in formula (I').

n=0 or 1; m=0 or 1; s=0 or 1;

Each of J ₁ and J ₂ is independently H;

R ₁ is selected from H, methyl and CH ₂ OH;

R ₂ is selected from H, OH, NH ₂ , methyl and CH ₂ OH;

R ₃ is selected from H, OH, NH ₂ , methyl and CH ₂ OH;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is as defined in formula (I').

n=0 or 1; m=0 or 1; s=0 or 1;

Each of J ₁ and J ₂ is independently H;

R ₁ is selected from H, methyl and CH ₂ OH;

R ₂ is selected from H, methyl and CH ₂ OH;

R ₃ is selected from H, OH, NH ₂ , methyl and CH ₂ OH;

Optionally, R ₁ and R ₂ are directly connected to form a ring;

B is as defined in formula (I').

In some embodiments, Y is O or NH;

J ₂ is H or C ₁ -C ₆ alkyl;

n=0 or 1; m=0 or 1; s=0 or 1;

Q _1' is

Q _2' is R ₂ ; or Q _1' is R ₂ and Q _2' is

J ₁ is H or C ₁ -C ₆ alkyl;

Optionally, R ₁ and R ₂ are directly connected to form a 3-6 membered ring;

M is O or S;

B is a base;

In some embodiments, X is independently selected from CR ₄ (R ₄ ′).

In some embodiments, R ₃ is selected from H and C ₁ -C ₆ alkyl.

In some embodiments, R ₁ is selected from H and C ₁ -C ₆ alkyl.

In some embodiments, Y is O;

J ₂ is H or C ₁ -C ₆ alkyl;

Q _1' is

Q _2' is R ₂ ; or Q _1' is R ₂ and Q _2' is

J ₁ is H or C ₁ -C ₆ alkyl;

Optionally, R ₁ and R ₂ are directly connected to form a 5-6 membered ring;

M is O or S;

B is a base.

In some embodiments, Y is O;

J ₂ is H;

R ₃ is selected from H and C ₁ -C ₆ alkyl;

Q _1' is

Q _2' is R ₂ ; or Q _1' is R ₂ and Q _2' is

R ₁ is selected from H and C ₁ -C ₆ alkyl;

J ₁ is H or C ₁ -C ₆ alkyl;

Optionally, R ₁ and R ₂ are directly connected to form a 5-6 membered ring;

M is O or S;

B is a base.

In some embodiments, Y is O.

In some embodiments, J ₂ is H or methyl. In some embodiments, J is _H.

In some embodiments, the chemical modification represented by the formula (I') is selected from any of the following structures:

Among them: M is O or S;

B is selected from purine bases, pyrimidine bases, indole, 5-nitroindole and 3-nitropyrrole.

Among them: M is O or S;

Among them: M is O or S;

and those in which the adenine in their structure is replaced by guanine, cytosine, uracil or thymine.

In some embodiments, B is the same as the base of the antisense strand when the nucleotide at this position is unmodified.

In some embodiments, L _is a C ₁ -C ₃₀ alkyl chain, or comprises a C ₁ -C ₃₀ alkyl chain interrupted by one or more oxygen, sulfur, nitrogen atoms, or C=O;

R ₁₁ and R ₁₂ are independently chemical bonds, NR ₁₆ or C=O;

Q ₃ is

R ₁₃ is CR ₁₇ R ₁₈ , NR ₁₆ , O or S;

R ₁₄ is CR ₁₉ ;

R ₁₅ is independently CR ₁₇ R ₁₈ , NR ₁₆ or O;

R ₁₆ to R ₁₉ are independently hydrogen, deuterium or alkyl;

m1, p1 and q1 are independently 0, 1, 2, 3 or 4;

B1 is

R _b5 , R _b6 and R _b7 are independently -C(=O)-, -NHC(=O)-, -C(=O)O-, -C(=O)-(CH ₂ ) _z8 -O -or-NHC(=O)-(CH ₂ ) _z9 -O-;

z5, z6, z7, z8 and z9 are independently an integer of 0-10;

r1 is an integer of 1-10.

In some embodiments, L ₁ is -(CH ₂ ) _j11 -C(=O)-(CH ₂ ) _j12 -;

R ₁₁ and R ₁₂ are independently chemical bonds, NR ₁₆ or C=O;

R ₁₆ is hydrogen or C _1-6 alkyl;

Q ₃ is

R ₁₃ is CR ₁₇ R ₁₈ or O;

R ₁₄ is CR ₁₉ ;

R ₁₅ is independently CR ₁₇ R ₁₈ or O;

R ₁₆ to R ₁₉ are independently hydrogen or alkyl;

m1, p1 and q1 are independently 0 or 1;

B1 is

R _b5 , R _b6 and R _b7 are independently -C(=O)-(CH ₂ ) _z8 -O- or -NHC(=O)-(CH ₂ ) _z9 -O-;

z8 and z9 are independently an integer of 0-10;

L ₂ is -(CH ₂ ) _j15 -(OCH ₂ CH ₂ ) _1-4 -(CH ₂ ) _j16 - or

j15 and j16 are independently an integer of 0-4;

r1 is 3, 4, 5 or 6.

In some embodiments, L ₁ can be L ₃ or L ₃ -R ₁₁₀ -R ₁₁₁ -L ₃ , wherein L ₃ is independently a C ₁ -C ₁₂ alkyl chain, -(CH ₂ ) _j11 -C( ＝O)-(CH ₂ ) _j12 -or-(CH ₂ ) _j13 -(CH ₂ CH ₂ O) _1-4 -(CH ₂ ) _j14 -, R ₁₁₀ and R ₁₁₁ are independently chemical bonds, -NR ₁₁₂ - , -C(=O)- or -OC(=O)-, R ₁₁₂ is hydrogen or C ₁ -C ₁₂ alkyl, j11, j12, j13 and j14 are independently integers of 0-10. In some embodiments, j11, j12, j13, and j14 are independently integers from 0-2 or 4-10. In some embodiments, j11, j12, j13, and j14 are independently 0, 1, 2, 6, 7, 8, 9, or 10.

In some embodiments, L ₁ can be -(CH ₂ ) _j11 -C(=O)-(CH ₂ ) _j12 -, j11 and j12 are as defined in the previous scheme.

In some embodiments, _L can be

The definition of j12 is the same as that described in the previous scheme, wherein the terminal a1 is connected to B1, and the terminal b1 is connected to _R11 .

In some embodiments, _L can be

Wherein, terminal a1 is connected to _B1 , and terminal b1 is connected to _R11 .

In some embodiments, R ₁₁ can be a chemical bond and R ₁₂ can be C=O.

In some embodiments, R ₁₁ can be a chemical bond and R ₁₂ can be NR ₁₆ , and the definition of R ₁₆ is the same as described in any of the previous schemes.

In some embodiments, R ₁₁ can be a chemical bond and R ₁₂ can be -OC(=O)-.

In some embodiments, R ₁₁ can be NR ₁₆ and R ₁₂ can be C=O, and R ₁₆ is as defined in the preceding scheme.

In some embodiments, R ₁ can be NR ₁₆ and R ₁₂ can be -OC(=O)-, and R ₁₆ is as defined in any preceding scheme.

In some embodiments, R ₁₂ can be NR ₁₆ and R ₁₁ can be C=O, and R ₁₆ is as defined in the preceding scheme.

In some embodiments, R ₁₂ can be NR ₁₆ and R ₁₁ can be -OC(=O)-, and R ₁₆ is as defined in the preceding scheme.

In some embodiments, R ₁₁ can be NH and R ₁₂ can be C=O.

In some embodiments, R ₁₂ can be NH and R ₁₁ can be C=O.

In some embodiments, R ₁₆ can be hydrogen or C _1-6 alkyl.

In some embodiments, R ₁₆ can be hydrogen, methyl, ethyl, propyl, or isopropyl.

In some embodiments, R ₁₆ can be hydrogen.

In some embodiments, R ₁₇ and R ₁₈ can be hydrogen.

In some embodiments, R ₁₉ can be hydrogen.

In some embodiments, ring A, when present, can be a C _6-12 aryl.

In some embodiments, ring A can be phenyl.

In some embodiments, m1 can be 0 or 1.

In some embodiments, m1 can be 3.

In some embodiments, n1 can be 0 or 1.

In some embodiments, p1 and q1 are independently 0 or 1.

In some embodiments, p1=1 and q1=1.

In some embodiments, p1=1 and q1=0.

In some embodiments, p1=0 and q1=1.

In some embodiments, p1=0 and q1=0.

In some embodiments, z1, z2, z3, z4, z5, z6, z7, z8, and z9 can independently be an integer from 0-4. In some embodiments, z1, z2, z3, z4, z5, z6, z7, z8, and z9 can be 0, 1, or 2 independently.

In some embodiments, B ₁ can be

R _b1 , R _b2 , R _b3 and R _b4 are independently -C(=O)- or -NHC(=O)-, the N atom is connected to L ₁ , and the definitions of z1, z2, z3 and z4 are the same as those of the previous scheme mentioned.

In some embodiments, B ₁ can be

R _b1 , R _b2 , R _b3 and R _b4 are independently -C(=O)- or -NHC(=O)-, N atom is connected to L ₁ , R _b1 , R _b3 and R _b4 are the same, z1, z2 , z3 and z4 are defined as described in the previous scheme.

In some embodiments, B ₁ can be

In some embodiments, B ₁ can be

In some embodiments, B ₁ can be

R _b5 , R _b6 and R _b7 are independently -C(=O)-(CH ₂ ) _z8 -O- or -NHC(=O)-(CH ₂ ) _z9 -O-, the N atom is connected to L ₁ , The definitions of z5, z6, z7, z8 and z9 are the same as those described in the previous scheme.

In some embodiments, B ₁ can be

R _b5 , R _b6 and R _b7 are independently -C(=O)-(CH ₂ ) _z8 -O- or -NHC(=O)-(CH ₂ ) _z9 -O-, the N atom is connected to L ₁ , R _b5 , R _b6 and R _b7 are the same, and the definitions of z5, z6, z7, z8 and z9 are the same as those described in the previous scheme.

In some embodiments, B ₁ can be

In some embodiments, L ₂ can be L ₄ or L ₄ -R ₁₃ -R ₁₄ -L ₄ , wherein L ₄ is independently a C ₁ -C ₁₂ alkyl chain or -(CH ₂ ) _j15 -(OCH ₂ CH ₂ ) _1-4 -(CH ₂ ) _j16 -, R ₁₁₃ and R ₁₁₄ are independently a chemical bond, -NR ₁₁₅ -, -C(=O)- or -OC(=O)-, R ₁₁₅ is independently is hydrogen or C ₁ -C ₁₂ alkyl, j15 and j16 are independently an integer of 0-10. In some embodiments, j15 and j16 are independently integers from 0-6. In some embodiments, j15 and j16 are 0, 1, 2, 3 or 4 independently.

In some embodiments, L ₂ can be -(CH ₂ ) _j15 -(OCH ₂ CH ₂ ) _1-4 -(CH ₂ ) _j16 -, j15 and j16 are as defined in the previous scheme.

In some embodiments, _L2 can be

Among them, the left side is connected with O atom, and the right side is connected with _B1 .

In some embodiments, L ₂ can be a C ₁ -C ₁₂ alkyl chain.

In some embodiments, _L2 can be

Among them, the a3 end is connected to the O atom, and the b3 end is connected to the _B1 .

In some embodiments, _L2 can be

In some embodiments, r1 can be 3, 4, 5 or 6. In some embodiments, r1 can be 3.

In some embodiments, _Q3 can be

In some embodiments, _Q3 can be

Wherein, the definitions of R ₁₃ , R ₁₄ , R ₁₅ and n1 are the same as those described in the previous scheme.

In some embodiments,

Can be

Wherein, the definitions of R ₁₃ , R ₁₄ , R ₁₅ , p1 and q1 are the same as those described in the previous scheme.

In some embodiments,

Can be

In some embodiments,

Can be

In some embodiments,

Can be

In some embodiments,

Can be

The definitions of p1 and q1 are the same as those described in the previous scheme.

In some embodiments,

Can be

In some embodiments,

Can be

In some embodiments,

Can be

In some embodiments,

Can be

Wherein, the definitions of R ₁₃ , R ₁₄ , n1, p1 and q1 are the same as those described in the previous scheme.

In some embodiments,

Can be

In some embodiments,

Can be

In some embodiments,

Can be

The definitions of n1, p1 and q1 are the same as those described in the previous scheme.

In some embodiments,

Can be

In some embodiments, the ligand can be any of the following structures or a pharmaceutically acceptable salt thereof,

In some embodiments, the ligand can be the following structure or a pharmaceutically acceptable salt thereof,

In some embodiments, the chemical modification represented by the formula (I) is

B is selected from guanine, adenine, cytosine and uracil; and the ligand is any of the following structures or a pharmaceutically acceptable salt thereof,

B is selected from guanine, adenine, cytosine and uracil, and the ligand is any of the following structures or a pharmaceutically acceptable salt thereof,

B is selected from guanine, adenine, cytosine and uracil; and, the ligand is the following structure or a pharmaceutically acceptable salt thereof,

In some embodiments, the N- Acetyl-galactosamine moiety.

In some embodiments, the siRNA and the ligand are covalently or non-covalently linked.

In some embodiments, the 3' end and/or the 5' end of the sense strand is conjugated to the ligand.

In some embodiments, the 3' end of the sense strand is conjugated to the ligand.

In some embodiments, the ligand is attached to the end of the siRNA via a phosphate group or a phosphorothioate group.

In some embodiments, the ligand is attached to the end of the siRNA via a phosphodiester group or a phosphorothioate group.

In some embodiments, the ligand is attached to the end of the siRNA via a phosphodiester group.

In some embodiments, the ligand is indirectly linked to the end of the siRNA via a phosphate group or a phosphorothioate group.

In some embodiments, the ligand is directly attached to the end of the siRNA via a phosphate group or a phosphorothioate group.

In some embodiments, the ligand is directly linked to the 3' end of the sense strand of the siRNA via a phosphate group or a phosphorothioate group.

In some embodiments, the phosphate group is a phosphate monoester group or a phosphodiester group. In some embodiments, the phosphate group is a phosphodiester group.

In some embodiments, the phosphorothioate group is a phosphorothioate monoester group or a phosphorothioate diester group. In some embodiments, the phosphorothioate group is a phosphorothioate diester group.

In some embodiments, in order to promote the entry of siRNA into cells, a lipophilic group such as cholesterol can be introduced at the end of the sense strand of the siRNA. The lipophilic group includes binding with a small interfering nucleic acid with a covalent bond, such as introducing cholesterol, Lipoproteins, vitamin E, etc., in order to facilitate the interaction with intracellular mRNA through the cell membrane composed of lipid bilayers. At the same time, siRNA can also be modified by non-covalent bonds, such as binding phospholipid molecules, polypeptides, and cationic polymers through hydrophobic bonds or ionic bonds to increase stability and biological activity.

In some embodiments, the nucleotide comprising the chemical modification represented by formula (I), its tautomer or a pharmaceutically acceptable salt thereof is located at the 5th, 6th, or 5th position of the 5' end of the antisense strand No. 7.

In some embodiments, the nucleotide comprising the chemical modification represented by formula (I), its tautomer or a pharmaceutically acceptable salt thereof is located at position 7 at the 5' end of the antisense strand.

In some embodiments, when the chemical modification represented by formula (I), its tautomer or its pharmaceutically acceptable salt is modified at the 5th position of its 5' end, B is selected from adenine, guanine, 2,6-Diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

In some embodiments, when the chemical modification represented by formula (I), its tautomer or its pharmaceutically acceptable salt is modified at the 6th position of its 5' end, B is selected from adenine, guanine, 2,6-Diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

In some embodiments, when the chemical modification represented by formula (I), its tautomer or its pharmaceutically acceptable salt is modified at the 7th position of its 5' end, B is selected from adenine, guanine, 2,6-Diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

In some embodiments, when the chemical modification represented by formula (I), its tautomer or its pharmaceutically acceptable salt is modified at the 8th position of its 5' end, B is selected from adenine, guanine, 2,6-Diaminopurine, 6-dimethylaminopurine, 2-aminopurine, cytosine, uracil, thymine, indole, 5-nitroindole, and 3-nitropyrrole.

In some embodiments, B is the same as the base when the 5th nucleotide at the 5' end of the antisense strand is unmodified.

In some embodiments, B is the same as the base when the 6th nucleotide at the 5' end of the antisense strand is unmodified.

In some embodiments, B is the same as the base when the 7th nucleotide at the 5' end of the antisense strand is unmodified.

In some embodiments, B is the same as the base when the 8th nucleotide at the 5' end of the antisense strand is unmodified.

In some embodiments, at least one additional nucleotide in the sense strand and/or antisense strand is a modified nucleotide selected from the group consisting of: 2'-methoxy modified Nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-amino-modified Nucleotides, 2'-substituted amino-modified nucleotides, 2'-fluoro-modified nucleotides, 2'-deoxynucleotides, 2'-deoxy-2'-fluoro-modified nucleosides acid, 3'-deoxy-thymidine nucleotides, isonucleotides, LNA, ENA, cET, UNA, GNA; in some embodiments, the modified nucleotides are independently selected from: 2'-methoxy Modified nucleotides or 2'-fluoro modified nucleotides.

In some embodiments, the sense strand contains three consecutive nucleotides with the same modification. In some embodiments, the three nucleotides with the same modification are 2'-fluoro-modified nucleotides.

In some embodiments, the nucleotides at positions 2, 4, 6, 10, 12, 14, 16 and 18 of the antisense strand are each independently 2'- Fluoro-modified nucleotides.

In some embodiments, the antisense strand is at least partially reverse complementary to the target sequence to mediate RNA interference; in some embodiments, there are no more than 5, no More than 4, no more than 3, no more than 2, no more than 1 mismatch; in some embodiments, the antisense strand is fully reverse complementary to the target sequence.

In some embodiments, the sense strand and the antisense strand are at least partially reverse complementary to form a double-stranded region; in some embodiments, there are no more than 5 , no more than 4, no more than 3, no more than 2, no more than 1 mismatch; in some embodiments, the sense strand is fully reverse complementary to the antisense strand.

In some embodiments, the sense and antisense strands each independently have 16 to 35, 16 to 34, 17 to 34, 17 to 33, 18 to 33, 18 to 32, 18 to 31, 18 to 30, 18 to 29, 18 to 28, 18 to 27, 18 to 26, 18 to 25, 18 to 24, 18 to 23, 19 to 25, 19 to 24, or 19 to 23 nucleotides (eg, 19, 20, 21, 22, 23 nucleotides).

In some embodiments, the sense strand and the antisense strand are the same or different in length, the sense strand is 19-23 nucleotides in length, and the antisense strand is 19-26 nucleotides in length acid. In this way, the length ratio of the sense strand and the antisense strand in the dsRNA provided by the present disclosure can be 19/20, 19/21, 19/22, 19/23, 19/24, 19/25, 19/26, 20 /20, 20/21, 20/22, 20/23, 20/24, 20/25, 20/26, 21/20, 21/21, 21/22, 21/23, 21/24, 21/25 , 21/26, 22/20, 22/21, 22/22, 22/23, 22/24, 22/25, 22/26, 23/20, 23/21, 23/22, 23/23, 23 /24, 23/25 or 23/26. In some embodiments, the sense and antisense strands have a length ratio of 19/21, 21/23, or 23/25. In some embodiments, the sense strand and antisense strand have a length ratio of 19/21.

In some embodiments, the siRNA comprises one or two blunt ends.

In some embodiments, the siRNA comprises an overhang with 1 to 4 unpaired nucleotides, eg, 1, 2, 3, 4.

In some embodiments, the siRNA comprises an overhang located 3' to the antisense strand.

In some embodiments, the sense strand comprises or is selected from a nucleotide sequence (5'-3') represented by the following formula:

N _a N _a N _a N _a XN _a N _b N _b N _b N _a N _a _N _a N _a N _a N _a N _a N _a N a N _a

Wherein, each X is independently Na or N _b ; _Na is a 2'-methoxy-modified nucleotide, _and N _b is a 2'-fluoro-modified nucleotide.

5'-N _a N _a N _a N _a N _a N _a N _b N _b N _b N _a N _a N _a N _a N _a N _a N _a N _a N _a N _a -3'; or,

5'-N _a N _a N _a N _a N _b N _a N _b N _b N _b N _a N _a N _a N _a N _a N _a N _a N a N _a N _a -3 _' ;

Wherein, N _a is a 2'-methoxy-modified nucleotide, and N _b is a 2'-fluoro-modified nucleotide.

In some embodiments, the antisense strand contains or is selected from a nucleotide sequence (5'-3') as shown in the following formula:

5'-N _a 'N _b 'N _a 'N _b _' N a 'N _b 'W'N _a 'N _a 'N _b 'N _a 'N _b 'N _a 'N _b 'N _a 'N _b ' N _a'N _b'N _a'N _a'N _a' -3';

Among them, N _a 'is a 2'-methoxy-modified nucleotide, N _b ' is a 2'-fluoro-modified nucleotide; W' means that it contains the chemical modification shown in formula (I), its interconversion Isomer-modified nucleotides or pharmaceutically acceptable salts thereof.

In some specific embodiments, W' represents a nucleotide comprising a chemical modification represented by formula (I), a tautomer or a pharmaceutically acceptable salt thereof.

In some specific embodiments, the chemical modification shown in formula (I) is selected from:

Wherein: B is selected from guanine, adenine, cytosine and uracil; in some specific embodiments, the base between B and the 7th nucleotide at the 5' end of the antisense strand is not modified same.

Wherein: M is O or S; Wherein: B is selected from guanine, adenine, cytosine or uracil; The acid is the same as the base when it is not modified.

In some specific embodiments, M is S. In some specific embodiments, M is O.

In some embodiments, at least one phosphate group in the sense strand and/or the antisense strand is a phosphate group with a modification group that allows the siRNA to have an increased stability; in some embodiments, the phosphate group having a modifying group is a phosphorothioate group. In some embodiments, the phosphate group with a modifying group is a phosphorothioate group.

In some embodiments, the phosphorothioate group is present in at least one of the following positions:

Between the first nucleotide and the second nucleotide at the 5' end of the sense strand;

Between the 2nd nucleotide and the 3rd nucleotide of the 5' end of the sense strand;

Between the first nucleotide and the second nucleotide at the 5' end of the antisense strand;

Between the 2nd nucleotide and the 3rd nucleotide of the 5' end of the antisense strand;

Between the first nucleotide and the second nucleotide of the 3' end of the antisense strand; and

Between the second nucleotide and the third nucleotide at the 3' end of the antisense strand.

In some embodiments, the sense strand and/or antisense strand include multiple phosphorothioate groups present in:

Between the 1st nucleotide and the 2nd nucleotide of the 5' end of the sense strand; and,

Between the 2nd and 3rd nucleotides of the 5' end of the sense strand; and,

Between the first nucleotide and the second nucleotide of the 5' end of the antisense strand; and,

between the 2nd and 3rd nucleotides of the 5' end of the antisense strand; and,

Between the first nucleotide and the second nucleotide of the 3' end of the antisense strand; and,

In some embodiments, the sense strand comprises a nucleotide sequence represented by the following formula:

5'-NmsNmsNmNmNmNfNmNfNfNfNmNmNmNmNmNmNmNmNmNmNmNm-3', or,

5'-NmsNmsNmNmNmNmNmNfNfNfNmNmNmNmNmNmNmNmNmNmNmNm-3',

Wherein, Nm represents any nucleotide modified by 2'-methoxy, such as C, G, U, A modified by 2'-methoxy; Nf represents any nucleotide modified by 2'-fluoro, such as 2 '- Fluoro-modified C, G, U, A;

The connection between the lowercase letter s and the two nucleotides adjacent to the left and right of the letter s is a phosphorothioate group.

In some embodiments, the antisense strand comprises a nucleotide sequence represented by the following formula:

5'-Nm'sNf'sNm'Nf'Nm'Nf'W'Nm'Nm'Nf'Nm'Nf'Nm'Nf'Nm'Nf'Nm'Nf'Nm'sNm'sNm'-3';

Wherein, Nm' represents any nucleotide modified by 2'-methoxy group, such as C, G, U, A modified by 2'-methoxy group; Nf' represents any nucleotide modified by 2'-fluoro group, For example, 2'-fluoro modified C, G, U, A;

When the lowercase letter s is in the middle, it means that the two nucleotides adjacent to the left and right of the letter s are connected by phosphorothioate groups;

W' represents a modified nucleotide comprising a chemical modification represented by formula (I), its tautomer or a pharmaceutically acceptable salt thereof.

In some embodiments, the chemical modification represented by formula (I) is selected from:

Wherein: B is selected from guanine, adenine, cytosine and uracil; in some embodiments, B is the same as the base when the 7th nucleotide at the 5' end of the antisense strand is not modified.

In some embodiments, the chemical modification shown in formula (I) is selected from:

In some embodiments, M is S. In some specific embodiments, M is O.

In some embodiments, the siRNA is an siRNA targeting the 17β-hydroxysteroid dehydrogenase type 13 (HSD17B13) gene.

In some embodiments, the nucleotide sequence of the sense strand of the siRNA comprises at least 15 nucleotide sequences that differ by no more than 3 nucleotides from any of the nucleotide sequences of SEQ ID NO: 1 to SEQ ID NO: 8. consecutive nucleotides, and/or,

The nucleotide sequence of the antisense strand comprises at least 19 consecutive nucleotides differing by no more than 3 nucleotides from the nucleotide sequence of any one of SEQ ID NO: 9 to SEQ ID NO: 12.

In some embodiments, the nucleotide sequence of the sense strand of the siRNA comprises any one of the nucleotide sequences of SEQ ID NO:1 to SEQ ID NO:8, and/or, the nucleosides of the antisense strand The acid sequence comprises any one nucleotide sequence in SEQ ID NO:9 to SEQ ID NO:12;

In some embodiments, the nucleotide sequence of the siRNA is any one of the following schemes:

The nucleotide sequence of the sense strand comprises the nucleotide sequence of SEQ ID NO:8, and the nucleotide sequence of the antisense strand comprises the nucleotide sequence of SEQ ID NO:12;

The nucleotide sequence of the sense strand comprises the nucleotide sequence of SEQ ID NO:6, and the nucleotide sequence of the antisense strand comprises the nucleotide sequence of SEQ ID NO:11;

The nucleotide sequence of the sense strand comprises the nucleotide sequence of SEQ ID NO:2, and the nucleotide sequence of the antisense strand comprises the nucleotide sequence of SEQ ID NO:9;

The nucleotide sequence of the sense strand comprises the nucleotide sequence of SEQ ID NO:4, and the nucleotide sequence of the antisense strand comprises the nucleotide sequence of SEQ ID NO:10;

The nucleotide sequence of the sense strand comprises the nucleotide sequence of SEQ ID NO:7, and the nucleotide sequence of the antisense strand comprises the nucleotide sequence of SEQ ID NO:12;

The nucleotide sequence of the sense strand comprises the nucleotide sequence of SEQ ID NO:5, and the nucleotide sequence of the antisense strand comprises the nucleotide sequence of SEQ ID NO:11;

The nucleotide sequence of the sense strand comprises the nucleotide sequence of SEQ ID NO:1, and the nucleotide sequence of the antisense strand comprises the nucleotide sequence of SEQ ID NO:9; and

The nucleotide sequence of the sense strand comprises the nucleotide sequence of SEQ ID NO:3, and the nucleotide sequence of the antisense strand comprises the nucleotide sequence of SEQ ID NO:10.

In some embodiments, the siRNA is any of the following:

The nucleotide sequence of the sense strand is SEQ ID NO:8, and the nucleotide sequence of the antisense strand is SEQ ID NO:12;

The nucleotide sequence of the sense strand is SEQ ID NO:6, and the nucleotide sequence of the antisense strand is SEQ ID NO:11;

The nucleotide sequence of the sense strand is SEQ ID NO:2, and the nucleotide sequence of the antisense strand is SEQ ID NO:9;

The nucleotide sequence of the sense strand is SEQ ID NO:4, and the nucleotide sequence of the antisense strand is SEQ ID NO:10;

The nucleotide sequence of the sense strand is SEQ ID NO:7, and the nucleotide sequence of the antisense strand is SEQ ID NO:12;

The nucleotide sequence of the sense strand is SEQ ID NO:5, and the nucleotide sequence of the antisense strand is SEQ ID NO:11;

The nucleotide sequence of the sense strand is SEQ ID NO: 1, and the nucleotide sequence of the antisense strand is SEQ ID NO: 9; or

The nucleotide sequence of the sense strand is SEQ ID NO:3, and the nucleotide sequence of the antisense strand is SEQ ID NO:10.

In some embodiments, the sense strand of the dsRNA comprises the nucleotide sequence shown in any one of SEQ ID NO:13 to SEQ ID NO:20, and/or, the antisense strand comprises SEQ ID NO: 21 to the nucleotide sequence shown in any one of SEQ ID NO:24.

In some embodiments, the dsRNA is any of the following: wherein

The sense strand comprises the nucleotide sequence shown in SEQ ID NO:20, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:24;

The sense strand comprises the nucleotide sequence shown in SEQ ID NO:18, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:23;

The sense strand comprises the nucleotide sequence shown in SEQ ID NO:14, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:21;

The sense strand comprises the nucleotide sequence shown in SEQ ID NO:16, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:22;

The sense strand comprises the nucleotide sequence shown in SEQ ID NO:19, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:24;

The sense strand comprises the nucleotide sequence shown in SEQ ID NO:17, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:23;

The sense strand comprises the nucleotide sequence shown in SEQ ID NO:13, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:21;

The sense strand comprises the nucleotide sequence shown in SEQ ID NO:15, and the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:22.

In some embodiments, the dsRNA is any of the following:

The sense strand is the nucleotide sequence shown in SEQ ID NO:20, and the antisense strand is the nucleotide sequence shown in SEQ ID NO:24;

The sense strand is the nucleotide sequence shown in SEQ ID NO:18, and the antisense strand is the nucleotide sequence shown in SEQ ID NO:23;

The sense strand is the nucleotide sequence shown in SEQ ID NO:14, and the antisense strand is the nucleotide sequence shown in SEQ ID NO:21;

The sense strand is the nucleotide sequence shown in SEQ ID NO:16, and the antisense strand is the nucleotide sequence shown in SEQ ID NO:22;

The sense strand is the nucleotide sequence shown in SEQ ID NO:19, and the antisense strand is the nucleotide sequence shown in SEQ ID NO:24;

The sense strand is the nucleotide sequence shown in SEQ ID NO:17, and the antisense strand is the nucleotide sequence shown in SEQ ID NO:23;

The sense strand is the nucleotide sequence shown in SEQ ID NO:13, and the antisense strand is the nucleotide sequence shown in SEQ ID NO:21;

The sense strand is the nucleotide sequence shown in SEQ ID NO:15, and the antisense strand is the nucleotide sequence shown in SEQ ID NO:22.

In some embodiments, the sense strand of the dsRNA comprises any one of SEQ ID NO: 13 to SEQ ID NO: 20, and/or, the antisense strand comprises SEQ ID NO: 21 to SEQ ID NO: 24 any of

In some embodiments, the dsRNA is any of the following: wherein

The sense strand comprises SEQ ID NO:20, and the antisense strand comprises SEQ ID NO:24;

The sense strand comprises SEQ ID NO:18, and the antisense strand comprises SEQ ID NO:23;

The sense strand comprises SEQ ID NO:14, and the antisense strand comprises SEQ ID NO:21;

The sense strand comprises SEQ ID NO:16, and the antisense strand comprises SEQ ID NO:22;

The sense strand comprises SEQ ID NO:19, and the antisense strand comprises SEQ ID NO:24;

The sense strand comprises SEQ ID NO:17, and the antisense strand comprises SEQ ID NO:23;

The sense strand comprises SEQ ID NO:13, and the antisense strand comprises SEQ ID NO:21;

The sense strand comprises SEQ ID NO:15 and the antisense strand comprises SEQ ID NO:22.

In some embodiments, the dsRNA is any of the following:

The sense strand is selected from SEQ ID NO:20, and the antisense strand is selected from SEQ ID NO:24;

The sense strand is selected from SEQ ID NO:18, and the antisense strand is selected from SEQ ID NO:23;

The sense strand is selected from SEQ ID NO:14, and the antisense strand is selected from SEQ ID NO:21;

The sense strand is selected from SEQ ID NO:16, and the antisense strand is selected from SEQ ID NO:22;

The sense strand is selected from SEQ ID NO:19, and the antisense strand is selected from SEQ ID NO:24;

The sense strand is selected from SEQ ID NO:17, and the antisense strand is selected from SEQ ID NO:23;

The sense strand is selected from SEQ ID NO:13, and the antisense strand is selected from SEQ ID NO:21;

The sense strand is selected from SEQ ID NO:15 and the antisense strand is selected from SEQ ID NO:22.

In some embodiments, the dsRNA is any of the following:

Comprising or SEQ ID NO:20 and SEQ ID NO:24;

Comprising or SEQ ID NO: 18 and SEQ ID NO: 23;

Comprising or SEQ ID NO:14 and SEQ ID NO:21;

Comprising or SEQ ID NO:16 and SEQ ID NO:22;

Comprising or SEQ ID NO:19 and SEQ ID NO:24;

Comprising or SEQ ID NO:17 and SEQ ID NO:23;

Comprising or SEQ ID NO:13 and SEQ ID NO:21;

Comprising or SEQ ID NO:15 and SEQ ID NO:22.

In the present disclosure, according to the 5'-3' direction,

SEQ ID NO: 13 is

CmsAmsCmCmAfAmGfGfAfUmGmAmAmGmAmGmAmUmUm-NAG0052';

SEQ ID NO: 14 is

CmsAmsCmCmAmAmGfGfAfUmGmAmAmGmAmGmAmUmUm-NAG0052';

SEQ ID NO:15 is

CmsCmsAmAmGfGmAfUfGfAmAmGmAmGmAmUmUmAmUm-NAG0052';

SEQ ID NO: 16 is

CmsCmsAmAmGmGmGmAfUfGfAmAmGmAmGmAmUmUmAmUm-NAG0052';

SEQ ID NO: 17 is

CmsAmsAmAmAfAmUfCfCfAmAmGmCmAmCmAmAmGmAm-NAG0052';

SEQ ID NO: 18 is

CmsAmsAmAmAmAmAmUfCfCfAmAmGmCmAmCmAmAmGmAm-NAG0052';

SEQ ID NO: 19 is

AmsAmsAmUmGfAmAfAfUfGmAmAmUmAmAmAmUmAmAm-NAG0052';

SEQ ID NO:20 is

AmsAmsAmUmGmAmAfAfUfGmAmAmUmAmAmAmUmAmAm-NAG0052';

SEQ ID NO:21 is

AmsAfsUmCfUmCf(-)hmpNA(U)UmCmAfUmCfCmUfUmGfGmUfGmsCmsUm;

SEQ ID NO:22 is

AmsUfsAmAfUmCf(-)hmpNA(U)CmUmUfCmAfUmCfCmUfUmGfGmsUmsGm;

SEQ ID NO:23 is

UmsCfsUmUfGmUf(-)hmpNA(G)CmUmUfGmGfAmUfUmUfUmUfGmsGmsUm;

SEQ ID NO:24 is

UmsUfsAmUfUmUf(-)hmpNA(A)UmUmCfAmUfUmUfCmAfUmUfUmsUmsGm;

Among them, Af = adenine 2'-F ribonucleoside (adenine 2'-F ribonucleoside); Cf = cytosine 2'-F ribonucleoside (cytosine 2'-F ribonucleoside); Uf = uracil 2'-F Ribonucleoside (uracil 2'-F ribonucleoside); Gf = guanine 2'-F ribonucleoside (guanine 2'-F ribonucleoside); Am = adenine 2'-OMe ribonucleoside (adenine 2'-OMe ribonucleoside ); Cm=cytosine 2'-OMe ribonucleoside (cytosine 2'-OMe ribonucleoside); Gm=guanine 2'-OMe ribonucleoside (guanine2'-OMe ribonucleoside); Um=uracil 2'-OMe ribonucleoside Nucleoside (uracil 2'-OMe ribonucleoside);

s means that the two nucleotides adjacent to the left and right of the letter s are connected by phosphorothioate groups;

NAG0052' indicates

(-)hmpNA(G) means

(-)hmpNA(U) means

(-)hmpNA(A) means

In some embodiments, the dsRNA is selected from the following structures or pharmaceutically acceptable salts thereof:

Among them, Af = adenine 2'-F ribonucleoside (adenine 2'-F ribonucleoside); Cf = cytosine 2'-F ribonucleoside (cytosine 2'-F ribonucleoside); Uf = uracil 2'-F Ribonucleoside (uracil 2'-F ribonucleoside); Am = adenine 2'-OMe ribonucleoside (adenine 2'-OMe ribonucleoside); Cm = cytosine 2'-OMe ribonucleoside (cytosine 2'-OMe ribonucleoside ); Gf = guanine 2'-F ribonucleoside (guanine 2'-F ribonucleoside); Gm = guanine 2'-OMe ribonucleoside (guanine 2'-OMe ribonucleoside); Um = uracil 2'-OMe Ribonucleoside (uracil 2'-OMe ribonucleoside).

represents a phosphorothioate group,

represents a phosphodiester group,

NAG0052' indicates

(-)hmpNA(U) means

(-)hmpNA(A) means

(-)hmpNA(G) means

In some embodiments, the pharmaceutically acceptable salts can be conventional salts in the art, including but not limited to: sodium salts, potassium salts, ammonium salts, amine salts and the like.

In some embodiments, the dsRNA is selected from TRD008007, TRD008008, TRD008009, TRD008010, TRD008007-1, TRD008008-1, TRD008009-1, or TRD008010-1;

In some embodiments, the dsRNA is TRD008007, which has the following structure:

In some embodiments, the dsRNA is TRD008007-1, which has the following structure:

In some embodiments, the dsRNA is TRD008008, which has the following structure:

In some embodiments, the dsRNA is TRD008008-1, which has the following structure:

In some embodiments, the dsRNA is TRD008009, which has the following structure:

In some embodiments, the dsRNA is TRD008009-1, which has the following structure:

In some embodiments, the dsRNA is TRD008010, which has the following structure:

In some embodiments, the dsRNA is TRD008010-1, which has the following structure:

represents a phosphorothioate group,

represents a phosphodiester group,

NAG0052' indicates

(-)hmpNA(U) means

(-)hmpNA(A) means

(-)hmpNA(G) means

In another aspect, the present disclosure provides a pharmaceutical composition comprising the dsRNA described in the present disclosure.

In some embodiments, the pharmaceutical composition further comprises one or more pharmaceutically acceptable excipients. Various delivery systems are known and can be used for the dsRNA or pharmaceutical compositions of the present disclosure, such as encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the compound, receptor-mediated intracellular Endocytosis, construction of nucleic acids as part of retroviral or other vectors.

In some embodiments, the administration of the dsRNA or pharmaceutical composition of the present disclosure is conventional, and may be administered locally (e.g., by direct injection or implantation) or systemically, or orally, rectally, or gastrointestinally. The parenteral route includes but not limited to subcutaneous injection, intravenous injection, intramuscular injection, intraperitoneal injection, transdermal administration, inhalation administration (such as aerosol), mucosal administration (such as sublingual, nasal intracranial administration), intracranial administration, etc.

In some embodiments, a dsRNA or pharmaceutical composition provided herein can be administered by injection, eg, intravenous, intramuscular, intradermal, subcutaneous, intraduodenal, or intraperitoneal injection.

In some embodiments, the dsRNA or pharmaceutical compositions provided by the present disclosure can be packaged in kits.

In another aspect, the present disclosure provides an application of the dsRNA described in the present disclosure or the pharmaceutical composition described in the present disclosure in the preparation of medicine.

In some embodiments, the medicament can be used to prevent and/or treat hepatitis, liver fibrosis, nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), liver cirrhosis, alcoholic steatohepatitis Hepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, or hepatocyte necrosis.

In some embodiments, the medicament can be used to prevent and/or treat diseases related to HSD17B13 gene expression. In some embodiments, the diseases associated with HSD17B13 gene expression can be hepatitis, liver fibrosis, nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), liver cirrhosis, alcoholic fatty Acute hepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, or hepatocyte necrosis. In some embodiments, the disease associated with HSD17B13 gene expression may be chronic fibrotic liver disease. In some embodiments, the chronic fibrotic liver disease is associated with accumulation and/or expansion of lipid droplets in the liver.

In some embodiments, the effective amount or effective dose of the dsRNA or pharmaceutical composition is about 0.001 mg/kg body weight to about 200 mg/kg body weight, about 0.01 mg/kg body weight to about 100 mg/kg body weight, or about 0.5 mg /kg body weight to about 50 mg/kg body weight.

In another aspect, the present disclosure provides a use of the dsRNA described in the present disclosure or the pharmaceutical composition described in the present disclosure in the preparation of a medicament for preventing and/or treating a disease in a subject.

In some embodiments, the disease may be hepatitis, liver fibrosis, nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), liver cirrhosis, alcoholic steatohepatitis (ASH), Alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, or hepatocyte necrosis.

In some embodiments, the disease may be a disease associated with HSD17B13 gene expression. In some embodiments, the diseases associated with HSD17B13 gene expression can be hepatitis, liver fibrosis, nonalcoholic steatohepatitis (NASH), nonalcoholic fatty liver disease (NAFLD), liver cirrhosis, alcoholic fatty Acute hepatitis (ASH), alcoholic fatty liver disease (ALD), HCV-related cirrhosis, drug-induced liver injury, or hepatocyte necrosis. In some embodiments, the disease associated with HSD17B13 gene expression may be chronic fibrotic liver disease. In some embodiments, the chronic fibrotic liver disease is associated with accumulation and/or expansion of lipid droplets in the liver.

In another aspect, the present disclosure provides a method for preventing and/or treating a disease, which comprises administering to a subject an effective amount or dose of the dsRNA described in the present disclosure or the pharmaceutical composition described in the present disclosure.

In another aspect, the present disclosure provides a method for silencing HSD17B13 or its mRNA in a cell in vivo or in vitro, comprising introducing the dsRNA described in the present disclosure or the pharmaceutical composition described in the present disclosure into the cell step.

In another aspect, the present disclosure provides a method for inhibiting the expression of the target gene HSD17B13 or its mRNA, which comprises administering to a subject an effective amount or dose of the dsRNA described in the present disclosure or the pharmaceutical composition described in the present disclosure.

The dsRNA or pharmaceutical composition of the present disclosure can reduce the expression level of the target gene or its mRNA in cells, cell groups, tissues or subjects, including: administering a therapeutically effective amount of the dsRNA or pharmaceutical combination described herein to the object substances, thereby inhibiting the expression of the target gene or its mRNA in the subject.

In some embodiments, the subject has been previously identified as having pathological upregulation of the target gene HSD17B13 or mRNA thereof in the targeted cell, cell population, tissue or subject.

In another aspect, the present disclosure provides a method of delivering an oligonucleotide to the liver, which comprises administering to a subject an effective amount or dose of the dsRNA described in the present disclosure or the pharmaceutical composition described in the present disclosure.

In another aspect, the present disclosure provides an RNAi (RNA interference) agent comprising the dsRNA described in the present disclosure or the pharmaceutical composition described in the present disclosure.

In another aspect, the present disclosure also provides a cell comprising the dsRNA described in the present disclosure or the pharmaceutical composition described in the present disclosure.

In another aspect, the present disclosure also provides a kit comprising the dsRNA described in the present disclosure or the pharmaceutical composition described in the present disclosure.

In the present disclosure, the dsRNA or pharmaceutical composition of the present disclosure, when contacted with cells expressing the target gene, is detected by, for example: psiCHECK activity screening and luciferase reporter gene assay, other methods such as PCR or based on branched DNA (bDNA) , or protein-based methods, such as immunofluorescence analysis, such as Western Blot or flow cytometry, the dsRNA or pharmaceutical composition of the present disclosure can inhibit the expression of the target gene by at least 5%, at least 10%, at least 15% , at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%.

In the present disclosure, the dsRNA or pharmaceutical composition of the present disclosure, when contacted with cells expressing the target gene, is detected by, for example: psiCHECK activity screening and luciferase reporter gene assay, other methods such as PCR or based on branched DNA (bDNA) , or protein-based methods, such as immunofluorescence analysis, such as Western Blot or flow cytometry, the remaining expression percentage of the target gene mRNA caused by the dsRNA or the pharmaceutical composition of the present disclosure is not higher than 99%, not high Not higher than 95%, not higher than 90%, not higher than 85%, not higher than 80%, not higher than 75%, not higher than 70%, not higher than 65%, not higher than 60%, not higher than 55% %, not higher than 50%, not higher than 45%, not higher than 40%, not higher than 35%, not higher than 30%, not higher than 25%, not higher than 20%, not higher than 15%, or not higher than 10%.

In the present disclosure, the dsRNA or pharmaceutical composition of the present disclosure, when contacted with cells expressing the target gene, is detected by, for example: psiCHECK activity screening and luciferase reporter gene assay, other methods such as PCR or based on branched DNA (bDNA) , or protein-based methods, such as immunofluorescence assays, e.g., Western Blot, or flow cytometry, the dsRNA reduces off-target activity by at least 20%, at least 25%, or at least 30%, while maintaining on-target activity , at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or at least 75%.

In the present disclosure, the dsRNA or pharmaceutical composition of the present disclosure, when contacted with cells expressing the target gene, is detected by, for example: psiCHECK activity screening and luciferase reporter gene assay, other methods such as PCR or based on branched DNA (bDNA) , or protein-based methods, such as immunofluorescence assays, such as Western Blot, or flow cytometry, dsRNA reduces on-target activity by up to 20%, up to 19%, up to 15%, up to 10%, up to 5% or more than 1%, while reducing off-target activity by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65% %, at least 70%, or at least 75%.

In the present disclosure, when the dsRNA or the pharmaceutical composition of the present disclosure contacts the cells expressing the target gene, it can be detected by, for example, psiCHECK activity screening and luciferase reporter gene detection method, other methods such as PCR or based on branched DNA (bDNA) , or protein-based methods, such as immunofluorescence assays, e.g., Western Blot, or flow cytometry, dsRNA increases on-target activity by at least 1%, at least 5%, at least 10%, at least 15%, at least 20% , at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, or at least 80% , reducing off-target activity by at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, or At least 75%.

The present disclosure also provides a method for preparing dsRNA or a pharmaceutical composition, which includes: synthesizing the ligand, siRNA, dsRNA or pharmaceutical composition described in the present disclosure.

The present disclosure incorporates the entire text of WO2022223015A1.

Compounds of the present disclosure may exist in particular geometric or stereoisomeric forms. This disclosure contemplates all such compounds, including cis and trans isomers, (-)- and (+)-enantiomers, (R)- and (S)-enantiomers, diastereomers isomers, (D)-isomers, (L)-isomers, and their racemic and other mixtures, such as enantiomerically or diastereomerically enriched mixtures, all of which are within the scope of this disclosure. Additional asymmetric carbon atoms may be present in substituents such as alkyl groups. All such isomers, as well as mixtures thereof, are included within the scope of this disclosure. Compounds of the present disclosure containing asymmetric carbon atoms can be isolated in optically pure or racemic forms. Optically pure forms can be resolved from racemic mixtures or synthesized by using chiral starting materials or reagents.

Optically active (R)- and (S)-isomers as well as D and L-isomers can be prepared by chiral synthesis or chiral reagents or other conventional techniques. If one enantiomer of a compound of the present disclosure is desired, it can be prepared by asymmetric synthesis or derivatization with chiral auxiliary agents, wherein the resulting diastereomeric mixture is separated and the auxiliary group is cleaved to provide pure desired enantiomer. Alternatively, when the molecule contains a basic functional group (such as an amino group) or an acidic functional group (such as a carboxyl group), a diastereoisomeric salt is formed with an appropriate optically active acid or base, and then a diastereomeric salt is formed by a conventional method known in the art. Diastereomeric resolution is performed and the pure enantiomers are recovered. Furthermore, the separation of enantiomers and diastereomers is usually accomplished by the use of chromatography using chiral stationary phases, optionally in combination with chemical derivatization methods (e.g. amines to amino groups formate).

In the chemical structures of the compounds described in this disclosure, the bond

Indicates unassigned configuration, i.e. if chiral isomers exist in the chemical structure, the bond

can be

or

or both

and

Two configurations. In the chemical structures of the compounds described in this disclosure, the bond

configuration is not specified, i.e. the key

The configuration of can be E type or Z type, or contain both E and Z configurations.

Where no configuration is indicated, the compounds and intermediates of the present disclosure may also exist in different tautomeric forms and all such forms are included within the scope of the present disclosure. The term "tautomer" or "tautomeric form" refers to structural isomers of different energies that can interconvert via a low energy barrier. For example, proton tautomers (also known as prototropic tautomers) include interconversions via migration of a proton, such as keto-enol and imine-enamine, lactam-lactim isomerization . An example of a lactam-lactim equilibrium is between A and B as shown below.

All compounds in this disclosure can be drawn as Form A or Form B. All tautomeric forms are within the scope of the invention. The naming of compounds does not exclude any tautomers.

The present disclosure also includes certain isotopically labeled compounds of the disclosure that are identical to those described herein, but wherein one or more atoms are replaced by an atom of an atomic mass or mass number different from that normally found in nature. Examples of isotopes that can be incorporated into compounds of the present disclosure include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, sulfur, fluorine, iodine, and chlorine, such as ² H, ³ H, ¹¹ C, ¹³ C, ¹⁴ C, ¹³ N, ¹⁵ N, ¹⁵ O, ¹⁷ O, ¹⁸ O, ³¹ P, ³² P, ³⁵ S, ¹⁸ F, ¹²³ I, ¹²⁵ I and ³⁶ Cl, etc.

Unless otherwise stated, when a position is specifically designated as deuterium (D), the position is understood to have an abundance of deuterium (i.e., at least 10 % deuterium incorporation). Exemplary compounds having a natural abundance greater than deuterium can be at least 1000 times more abundant deuterium, at least 2000 times more abundant deuterium, at least 3000 times more abundant deuterium, at least 4000 times more abundant deuterium, at least 5000 times more abundant deuterium, at least 6000 times more abundant deuterium, or more abundant deuterium. The present disclosure also includes compounds of Formula (I), Formula (I'), Formula (II) in various deuterated forms. Each available hydrogen atom attached to a carbon atom can be independently replaced by a deuterium atom. Those skilled in the art can refer to the relevant literature to synthesize deuterated forms of formula (I), formula (I '), formula (II) compounds. Commercially available deuterated starting materials can be used when preparing deuterated forms of compounds of formula (I), formula (I'), and formula (II), or they can be synthesized using conventional techniques using deuterated reagents, including But not limited to deuterated borane, trideuterioborane tetrahydrofuran solution, deuterated lithium aluminum hydride, deuterated ethyl iodide and deuterated methyl iodide, etc.

Terminology Explanation

For easier understanding of the present disclosure, some technical and scientific terms are specifically defined below. Unless clearly defined otherwise herein, all other technical and scientific terms used herein have the meaning commonly understood by one of ordinary skill in the art to which this disclosure belongs.

As used herein, the term "HSD17B13" refers to type 13 17β hydroxysteroid dehydrogenase, a member of the 17β hydroxysteroid dehydrogenase (hsd17b) family, which catalyzes the conversion between 17-keto- and 17-hydroxysteroids. Members of this family have various functions including, for example, the reduction or oxidation of sex hormones, fatty acids, and bile acids in vivo. Members of the hsd17b family differ in their tissue distribution, subcellular localization, catalytic priority, and because they also catalyze the conversion of other substrates than steroids (such as lipids and retinoids), they have different substrate specificities . HSD17B13 is mainly expressed in the liver and localized on the surface of lipid droplets (LDs). In human subjects with uncomplicated steatosis, HSD17B13 protein expression was significantly upregulated in fatty liver LDs. When HSD17B13 protein was overexpressed, it led to an increase in the number and size of LDs in hepatocytes, and significantly increased hepatic lipogenesis and triglyceride (TG) content. Studies have shown that HSD17B13 gene expression plays an important role in the pathogenesis of nonalcoholic fatty liver disease (NAFLD) and nonalcoholic steatohepatitis (NASH). Loss-of-function mutants of HSD17B13 (rs72613567:TA) reduce alanine aminotransferase (ALT) and aspartate aminotransferase (AST) levels, while reducing inflammation and liver injury in fatty liver patients. HSD17B13 has been shown to be associated with a variety of liver diseases, including but not limited to hepatitis, liver fibrosis, nonalcoholic steatohepatitis, nonalcoholic fatty liver disease, cirrhosis, alcoholic steatohepatitis, alcoholic fatty liver disease, HCV- Associated cirrhosis, drug-induced liver injury or hepatocellular necrosis, or chronic fibroinflammatory liver disease. The HSD17B13 sequence includes: GENBANK accession number NM_001136230.3, GENBANK accession number NM_001136230.3,

As used in this disclosure, the sense strand (also known as SS, SS strand or sense strand) refers to the strand comprising a sequence identical or substantially identical to the target mRNA sequence; the antisense strand (also known as AS or AS strand) is Refers to the strand that has a sequence that is complementary to the target mRNA sequence.

In the present disclosure, the "5' region" of the sense strand or the antisense strand, that is, the "5' end" and "5' end", can be used interchangeably. For example, the 2nd to 8th nucleotides in the 5' region of the antisense strand can also be replaced with the 2nd to 8th nucleotides at the 5' end of the antisense strand. Similarly, the "3' region", "3' end" and "3' end" of the sense strand or the antisense strand can also be used interchangeably.

In the context of describing the sense strand described in the present disclosure, the term "differs from the nucleotide sequence of any one of SEQ ID NO: 1 to SEQ ID NO: 8 by no more than 3 nucleotides and contains at least 15 consecutive Nucleotide" is intended to mean that the siRNA sense strand described herein comprises at least 15 consecutive nucleotides of any sense strand in SEQ ID NO: 1 to SEQ ID NO: 8, or with SEQ ID NO: 1 to SEQ ID NO: At least 15 consecutive nucleotides of any sense strand in ID NO:8 differ by no more than 3 nucleotide sequences (optionally, differ by no more than 2 nucleotide sequences; optionally, differ by 1 nucleoside acid sequences). Optionally, the siRNA sense strand described herein comprises at least 16 contiguous nucleotides of any sense strand of SEQ ID NO: 1 to SEQ ID NO: 8, or is identical to any of SEQ ID NO: 1 to SEQ ID NO: 8 At least 16 contiguous nucleotides of a sense strand differ by no more than 3 nucleotide sequences (optionally, differ by no more than 2 nucleotide sequences, optionally, differ by 1 nucleotide sequence).

In the context of describing the antisense strand described in the present disclosure, the term "differs from any antisense strand of SEQ ID NO: 9 to SEQ ID NO: 12 by no more than 3 nucleotide sequences and contains at least 15 consecutive core Nucleotide" is intended to mean that the siRNA antisense strand described herein comprises at least 15 consecutive nucleotides of any antisense strand in SEQ ID NO: 9 to SEQ ID NO: 12, or with SEQ ID NO: 9 to At least 15 consecutive nucleotides of any antisense strand in SEQ ID NO: 12 differ by no more than 3 nucleotide sequences (optionally, differ by no more than 2 nucleotide sequences, optionally, differ by 1 Nucleotide sequence).

Unless otherwise specified, in the context of the present disclosure, "G", "C", "A", "T" and "U" respectively represent nucleotides, which respectively contain guanine, cytosine, adenine, thymidine The base with uracil; the lowercase letter d indicates that the nucleotide adjacent to the right side of the letter d is deoxyribonucleotide; the lowercase letter m indicates that the nucleotide adjacent to the left side of the letter m is 2'- A methoxy-modified nucleotide; a lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a 2'-fluoro-modified nucleotide; a lowercase letter s indicates that the two adjacent nucleotides to the left and right of the letter s The nucleotides are linked by phosphorothioate groups.

As used in this disclosure, the term "2'-fluoro (2'-F) modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced by fluorine, and "non-fluorine "Modified nucleotides" refer to nucleotides or nucleotide analogues in which the hydroxyl group at the 2' position of the ribose group of a nucleotide is replaced by a non-fluorine group.

As used in the present disclosure, the term "2'-methoxy (2'-OMe) modified nucleotide" refers to a nucleotide in which the 2'-hydroxyl group of the ribose group is substituted with a methoxy group.

In the context of the present disclosure, a "nucleotide difference" exists between a nucleotide sequence and another nucleotide sequence, which means that the base type of the nucleotide at the same position has changed between the former and the latter, For example, when a nucleotide base in the latter is A, and the corresponding nucleotide base at the same position in the former is U, C, G or T, it is recognized as a difference between the two nucleotide sequences. There is a nucleotide difference at this position. In some embodiments, when the nucleotide at the original position is replaced by an abasic nucleotide or its equivalent, it can also be considered that a nucleotide difference occurs at that position.

The term "dsRNA" refers to a double-stranded RNA molecule capable of RNA interference, comprising a sense strand and an antisense strand.

As used herein, the terms "complementary" or "reverse complementary" are used interchangeably and have the meaning known to those skilled in the art, that is, in a double-stranded nucleic acid molecule, the bases of one strand interact with the other. The bases on the strand pair up in a complementary fashion. In DNA, the purine base adenine (A) is always paired with the pyrimidine base thymine (T) (or uracil (U) in RNA); the purine base guanine (C) is always paired with the pyrimidine base Cytosine (G) is paired. Each base pair consists of a purine and a pyrimidine. When adenine on one strand always pairs with thymine (or uracil) on the other strand, and guanine always pairs with cytosine, the two strands are said to be complementary to each other, and The sequence of the chain can be deduced from the sequence. Correspondingly, "mismatch" in the art means that in a double-stranded nucleic acid, the bases at the corresponding positions are not paired in a complementary form.

The term "chemical modification" or "modification" includes all alterations of nucleotides by chemical means, such as the addition or removal of chemical moieties, or the substitution of one chemical moiety for another.

The term "base" includes any known DNA and RNA base, base analogs such as purine or pyrimidine, which also includes the natural compounds adenine, thymine, guanine, cytosine, uracil, inosine and Natural analogs. Base analogs can also be universal bases.

The terms "blunt end" or "blunt end" are used interchangeably and refer to the absence of unpaired nucleotides or nucleotide analogs at a given end of an siRNA, ie, no nucleotide overhangs. In most cases, siRNAs with both blunt-ended ends will be double-stranded throughout their entire length.

The siRNA and dsRNA provided in the present disclosure can be obtained by conventional preparation methods in the art (such as methods of solid-phase synthesis and liquid-phase synthesis). Among them, solid-phase synthesis has commercialized customized services. A modified nucleotide group can be introduced into the siRNA described in the present disclosure by using a correspondingly modified nucleoside monomer, a method for preparing a correspondingly modified nucleoside monomer and introducing a modified nucleotide group The methods of siRNA and dsRNA are also well known to those skilled in the art.

In the chemical structural formula of the present disclosure,

One or more of any group may be attached according to the scope of the invention described herein; an asterisk "*" indicates a chiral center.

Unless otherwise stated, "optionally", "optionally", "optionally" or "optionally" means that the subsequently described event or circumstance may but need not occur, and that the description includes that the event or circumstance occurs or where it does not occur. For example, "optionally, R ₁ and R ₂ are directly connected to form a ring" means that R ₁ and R ₂ are directly connected to form a ring, which can occur but not necessarily exist, and this description includes the situation where R ₁ and R ₂ are directly connected to form a ring and R ₁ and R ₂ do not form a ring.

The terms "about" and "approximately" mean that the value is within an acceptable error range for the particular value as determined by one of ordinary skill in the art, and the value depends in part on how it is measured or determined (ie, the limits of the measurement system). For example, "about" can mean within 1 or more than 1 standard deviation. Alternatively, "about" or "comprising essentially" may mean a range of up to 20%, such as between 1% and 15%, between 1% and 10%, between 1% and 5%, between 0.5% Variations of between 5% and 0.5% to 1%, and in this disclosure each instance of a number or numerical range preceded by the term "about" also include embodiments of the given number. Unless otherwise stated, when a specific value appears in the application and claims, the meaning of "about" or "comprising essentially" should be assumed to be within an acceptable error range for the specific value.

As used herein, the term "comprising" or "comprising" means including stated elements, integers or steps, but not excluding any other elements, integers or steps. Herein, when the term "comprising" or "comprises" is used, unless otherwise specified, it also covers the situation consisting of the mentioned elements, integers or steps. For example, when a reference is made to "comprising" a specific sequence, it is also intended to cover the situation consisting of that specific sequence.

Unless otherwise specified, the "compound", "chemical modification", "ligand", "dsRNA", "nucleic acid" and "RNAi" of the present disclosure can be independently salt, mixed salt or non-salt (such as free acid or in the form of the free base). When present in the form of a salt or mixed salt, it may be a pharmaceutically acceptable salt.

"Pharmaceutically acceptable salt" may be selected from inorganic salts or organic salts, and may also include pharmaceutically acceptable acid addition salts and pharmaceutically acceptable base addition salts.

"Pharmaceutically acceptable acid addition salt" refers to a salt formed with an inorganic or organic acid that retains the biological effectiveness of the free base without other side effects. Inorganic acid salts include but not limited to hydrochloride, hydrobromide, sulfate, nitrate, phosphate, etc.; organic acid salts include but not limited to formate, acetate, 2,2-dichloroacetate , Trifluoroacetate, Propionate, Caproate, Caprylate, Caprate, Undecylenate, Glycolate, Gluconate, Lactate, Sebacate, Hexanoate glutarate, malonate, oxalate, maleate, succinate, fumarate, tartrate, citrate, palmitate, stearate, oleate , cinnamate, laurate, malate, glutamate, pyroglutamate, aspartate, benzoate, mesylate, benzenesulfonate, p-toluenesulfonate , alginate, ascorbate, salicylate, 4-amino salicylate, naphthalene disulfonate, etc. These salts can be prepared by methods known in the art.

"Pharmaceutically acceptable base addition salt" refers to a salt formed with an inorganic base or an organic base that can maintain the biological effectiveness of the free acid without other side effects. Salts derived from inorganic bases include, but are not limited to, sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum, and the like. Preferred inorganic salts are ammonium, sodium, potassium, calcium and magnesium salts, preferably sodium salts. Salts derived from organic bases include, but are not limited to, those of primary, secondary, and tertiary amines, substituted amines, including natural substituted amines, cyclic amines, and basic ion exchange resins , such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, triethanolamine, dimethylethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, bicyclic Hexylamine, Lysine, Arginine, Histidine, Caffeine, Procaine, Choline, Betaine, Ethylenediamine, Glucosamine, Methylglucamine, Theobromine, Purine, Piperazine, Piperazine Pyridine, N-ethylpiperidine, polyamine resin, etc. Preferred organic bases include isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine. These salts can be prepared by methods known in the art.

"Alkyl" refers to a saturated aliphatic hydrocarbon group, such as straight chain and branched chain groups (C ₁ -C ₃₀ alkyl groups) including 1 to 30 carbon atoms, and for example, alkyl groups containing 1 to 6 carbon atoms (C ₁ -C ₆ alkyl), another example is an alkyl (C ₁ -C ₃ alkyl) having 1 to 3 carbon atoms. Non-limiting examples include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, tert-butyl, sec-butyl, n-pentyl, 1,1-dimethylpropyl, 1,2-dimethylpropyl, 2,2-dimethylpropyl and various branched isomers, etc.

The term "alkenyl" refers to a hydrocarbon group containing at least one double bond. Non-limiting examples of alkenyl include, but are not limited to, ethenyl, 1-propenyl, 2-propenyl, 1-butenyl, or 2-butenyl, and various branched isomers thereof.

The term "alkynyl" refers to a hydrocarbon group containing at least one triple bond. Non-limiting examples of alkynyl include, but are not limited to, ethynyl, 1-propynyl, 2-propynyl, 1-butynyl, or 2-butynyl, and various branched isomers thereof.

The term "alkoxy" refers to -O-(alkyl), wherein alkyl is as defined above. Non-limiting examples of alkoxy include: methoxy, ethoxy, propoxy, butoxy.

"Cycloalkyl" refers to a saturated or partially unsaturated monocyclic or polycyclic cyclic hydrocarbon substituent, the cycloalkyl ring contains 3 to 20 carbon atoms, preferably contains 3 to 6 carbon atoms, more preferably contains 5-6 carbon atom. Non-limiting examples of monocyclic cycloalkyls include cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cyclohexadienyl, etc.; multicyclic cycloalkyls include spiro Cycloalkyls of rings, parallel rings and bridged rings.

"Heterocycloalkyl" means a saturated or partially unsaturated monocyclic or polycyclic cyclic hydrocarbon substituent containing 3 to 20 ring atoms, one or more of which is selected from nitrogen, oxygen or S(O) _m (where m is an integer from 0 to 2), but excluding ring portions of -OO-, -OS- or -SS-, the remaining ring atoms being carbon. Preferably it contains 3 to 12 ring atoms, of which 1 to 4 are heteroatoms; more preferably it contains 3 to 7 ring atoms. Non-limiting examples of "heterocycloalkyl" include:

etc.

The heterocycloalkyl ring may be fused to an aryl or heteroaryl ring, wherein the ring bonded to the parent structure is a heterocycloalkyl, non-limiting examples of which include:

wait.

"Aryl" means a 6 to 14 membered all-carbon monocyclic or fused polycyclic (that is, rings sharing adjacent pairs of carbon atoms) group, preferably 6 to 12 membered, having a conjugated pi-electron system, such as phenyl and naphthyl. The aryl ring may be fused to a heteroaryl, heterocycloalkyl or cycloalkyl ring, where the ring bonded to the parent structure is an aryl ring, non-limiting examples of which include:

"Heteroaryl" refers to a heteroaromatic system comprising 1 to 4 heteroatoms, 5 to 14 ring atoms, wherein the heteroatoms are selected from oxygen, sulfur and nitrogen. The heteroaryl group is preferably 6 to 12 membered, more preferably 5 or 6 membered. For example. Non-limiting examples thereof include: imidazolyl, furyl, thienyl, thiazolyl, pyrazolyl, oxazolyl, isoxazolyl, pyrrolyl, tetrazolyl, pyridyl, pyrimidinyl , Thiadiazole, pyrazinyl, triazolyl, indazolyl, benzimidazolyl,

wait.

The heteroaryl ring may be fused to an aryl, heterocycloalkyl or cycloalkyl ring, wherein the ring bonded to the parent structure is a heteroaryl ring, non-limiting examples of which include:

The term "hydroxyl" refers to a -OH group.

The term "halogen" refers to fluorine, chlorine, bromine or iodine.

The term "cyano" refers to -CN.

The term "amino" refers to _-NH2 .

The term "nitro" refers to _-NO2 .

The term "oxo" refers to a =O substituent.

In the present disclosure, a "phosphate group" can be a phosphoric acid monoester group, a phosphoric diester group or a phosphoric acid triester group, preferably a phosphoric diester group; Group" has the same meaning.

In the present disclosure, phosphorothioate group refers to a phosphodiester group modified by replacing a non-bridging oxygen atom with a sulfur atom, which can be used

(M is an S atom) are used interchangeably.

In the present disclosure, "substitution" refers to one or more hydrogen atoms in a group, preferably at most 5, more preferably 1 to 3 hydrogen atoms are independently substituted by a corresponding number of substituents. When a substituent is keto or oxo (ie, =0), then two (2) hydrogens on the atom are replaced.

In the context of this disclosure, the group

middle

A moiety can be replaced by any group that enables linkage to adjacent nucleotides.

The term "linked", when referring to a link between two molecules, means that two molecules are connected by a covalent bond or that two molecules are associated by a non-covalent bond (for example, a hydrogen bond or an ionic bond), including direct connection, indirect connect.

The term "directly linked" means that a first compound or group is linked to a second compound or group without any intervening atoms or groups of atoms.

The term "indirectly linked" means that a first compound or group is linked to a second compound or group through an intervening group, compound or molecule (eg, a linking group).

"Pharmaceutical composition" means a mixture containing one or more compounds described herein, or a physiologically acceptable salt or prodrug thereof, and other chemical components, as well as other components such as physiologically acceptable carriers and excipients. Forming agent. The purpose of the pharmaceutical composition is to promote the administration to the organism, facilitate the absorption of the active ingredient and then exert its biological activity.

"Pharmaceutically acceptable excipients" include, but are not limited to, any adjuvants, carriers, glidants, sweeteners, Diluents, preservatives, dyes/colorants, flavor enhancers, surfactants, wetting agents, dispersing agents, suspending agents, stabilizers, isotonic agents, solvents or emulsifying agents.

As used herein, the term "inhibit", is used interchangeably with "reduce", "silence", "downregulate", "suppress" and other similar terms, and includes any level of inhibition. Inhibition can be assessed by a reduction in the absolute or relative level of one or more of these variables compared to control levels. The control level can be any type of control level used in the art, such as a pre-dose baseline level or from a similar untreated or control (eg buffer only or inert control) treated subject, cell , or sample-determined levels. For example, the residual expression of mRNA can be used to characterize the inhibition degree of siRNA on target gene expression, such as the remaining expression of mRNA is not higher than 99%, not higher than 95%, not higher than 90%, not higher than 85%, not higher than More than 80%, not more than 75%, not more than 70%, not more than 65%, not more than 60%, not more than 55%, not more than 50%, not more than 45%, not more than 40%, not higher than 35%, not higher than 30%, not higher than 25%, not higher than 20%, not higher than 15%, or not higher than 10%. The inhibition rate of target gene expression can be obtained by using

Luciferase Assay System detection, read firefly (Firefly) chemiluminescence value and Renilla (Renilla) chemiluminescence value respectively, calculate relative value Ratio=Ren/Fir, inhibition rate (%)=1-(Ratio+siRNA/Ratioreporter only) *100%; in the present disclosure, the proportion of remaining mRNA expression (or remaining activity %)=100%-inhibition rate (%).

An "effective amount" or "effective dose" includes an amount sufficient to ameliorate or prevent a symptom or condition of a medical condition. An effective amount also means an amount sufficient to permit or facilitate diagnosis. Effective amounts for a particular patient or veterinary subject may vary depending on factors such as the condition being treated, the general health of the patient, the method, route and dosage of administration, and the severity of side effects. An effective amount may be the maximum dose or dosing regimen that avoids significant side effects or toxic effects.

As used in this disclosure, "subject", "patient", "subject" or "individual" are used interchangeably and include humans or non-human animals such as mammals such as humans or monkeys.

Description of drawings

Figure 1 shows the remaining mRNA expression levels in TTR of conjugates TRD002218 and TRD007205 on day 7 after administration.

Figure 2 shows the remaining mRNA expression levels in TTR of conjugates TRD002218 and TRD007205 on day 28 after administration.

Detailed ways

The present disclosure is further described below in conjunction with examples, but these examples do not limit the scope of the present disclosure. The experimental methods not indicating the specific conditions in the embodiments of the present disclosure are usually in accordance with conventional conditions or in accordance with the conditions suggested by raw materials or commodity manufacturers. Reagents where a specific source is not stated may be obtained from any supplier of molecular biology reagents in quality/purity for molecular biology applications.

Embodiment 1: Preparation of chemical modification

1.1 Synthesis of Compound 1-1a and Compound 1-1b

Compound 1 (500 mg, 3.42 mmol) and triethylamine (Et ₃ N, 692 mg, 6.84 mmol, 0.95 mL) were dissolved in dichloromethane (DCM, 10 mL), and 4-toluenesulfonyl chloride (TsCl , 717mg, 3.76mmol) in dichloromethane (10mL) solution, after the dropwise addition, the reaction was stirred at room temperature overnight, after the reaction was completed, it was quenched with water, the aqueous phase was extracted three times with dichloromethane (15mL), and the combined organic The phase was washed with saturated aqueous sodium bicarbonate (10 mL) and then with saturated brine (20 mL), and then the solvent was evaporated to dryness under reduced pressure to obtain crude product 2 (820 mg, 80%), which was directly used in the next reaction. MS m _/ z: _C14H21O5S , [M+H] ⁺ theoretical: 301.10 found: _301.2 .

Compound 3 (239mg, 1.22mmol) was dissolved in dimethylformamide (DMF, 10mL), NaH (60% dissolved in mineral oil, 93mg, 2.33mmol) solution was added under ice-cooling, and the reaction was stirred for 30 minutes, Then compound 2 (350mg, 1.16mmol) was added dropwise. After the dropwise addition, the reaction was stirred at 60°C for 5 hours. Wash with water (10mL) three times, then with saturated brine (10mL), then evaporate the solvent to dryness under reduced pressure, and perform reverse-phase preparative HPLC (C ¹⁸ , condition: 5-50% (A:H ₂ O, B:CH ₃ CN), flow rate: 70mL/min), obtain 220mg compound 4 after freeze-drying. MS m/z _: _C19H21N5O3Na , [M+Na] ⁺ theoretical _: _390.16 , found: 390.3.

Compound 4 (1.50g, 4.08mmol) was dissolved in 20mL of a mixed solution of acetic acid and water (4:1) at room temperature, stirred at 60°C for 30 minutes, after the reaction was completed, the solvent was evaporated to dryness under reduced pressure, and prepared by reverse phase HPLC (C ¹⁸ , condition: 5-25% (A:H ₂ O, B:CH ₃ CN), flow rate: 70 mL/min), 1.10 g of compound 5 was obtained after lyophilization. MS m/z: _C16H18N5O3 , [M+H] ⁺ theoretical: _328.13 _, _found : 328.4.

Compound 5 (1.00g, 3.05mmol) was dissolved in pyridine (Py, 10mL), and pyridine ( 5mL) solution, after the dropwise addition, the reaction was stirred overnight at room temperature. After the reaction was completed, it was quenched with water, and the solvent was evaporated to dryness under reduced pressure. Preparative HPLC (C ¹⁸ , condition: 5-80% (A:H ₂ O, B:CH ₃ CN), flow rate: 70mL/min), 1.00g of compound 6 was obtained after freeze-drying. MS m/z _: _C37H36N5O5 , [MH] ⁺ theoretical: _630.26 _, found: 630.5. Racemate compound 6 was passed through a chiral column (Daicel

IE 250*4.6mm, 5μm, A: n-hexane, B: ethanol) resolved to obtain 410mg 6A(-) and 435mg 6B(+).

Compound 6A(-) (200mg, 0.32mmol), tetrazolium (11mg, 0.16mmol), N-methylimidazole (5mg, 0.06mmol), 3A molecular sieves (500mg) were dissolved in 10mL of acetonitrile, and added at room temperature Compound 7 (144mg, 0.48mmol), stirred overnight at room temperature. After the reaction was completed, the molecular sieves were filtered off, dichloromethane (30 mL) was added, washed three times with saturated aqueous sodium bicarbonate (10 mL), and then washed with saturated brine (20 mL), the filtrate was spin-dried and subjected to reverse-phase preparative HPLC (C ¹⁸ , condition: 5-100% (A: water, B: CH ₃ CN), flow rate: 70 mL/min), and 200 mg of compound 1-1a was obtained after lyophilization. MS m/z: C ₄₀ H ₃₉ N ₆ O ₇ P, [M-diisopropyl+OH] ⁺ theory: 747.26, found: 747.6. 1H NMR (400MHz, Acetonitrile-d ₃ ) δ7.56, 7.54 ( 2s,1H),7.36-7.27(m,2H),7.24-7.21(m,7H),6.83-6.80(m,4H),4.12-4.10(m,2H),3.75-3.68(m,10H), 3.20-2.80(m,2H),2.68-2.54(m,4H),1.22-1.04(m,18H).

Compound 6B (+) (200mg, 0.32mmol), tetrazolium (11mg, 0.16mmol), N-methylimidazole (5mg, 0.06mmol), 3A molecular sieves (500mg) were dissolved in 10mL of acetonitrile, and added at room temperature Compound 7 (144mg, 0.48mmol), stirred overnight at room temperature. After the reaction was completed, the molecular sieves were filtered off, dichloromethane (30 mL) was added, washed three times with saturated aqueous sodium bicarbonate (10 mL), and then washed with saturated brine (20 mL), the filtrate was spin-dried and subjected to reverse-phase preparative HPLC (C ¹⁸ , condition: 5-100% (A: water, B: CH ₃ CN), flow rate: 70 mL/min), and 200 mg of compound 1-1b was obtained after lyophilization. MS m/z: _C40H39N6O7P , [M-diisopropyl+OH] ⁺ _theory : _747.26 , found: 747.5.

1.2 Synthesis of compound 1-6a

Compound 1 (10g, 68.404mmol), compound 2 (15g, 62.186mmol) and triphenylphosphine (32.62g, 124.371mmol) were dissolved in anhydrous THF (30mL), and DIAD (24.656mL , 124.371 mmol). The reaction solution was reacted at 25 degrees for 12h. LCMS showed that the reaction was complete. The reaction solution was extracted with ethyl acetate (200mL) and water (200mL), the organic phase was dried and the filtrate was concentrated, and the obtained residue was purified by a forward column (DCM/MeOH=10/1) to obtain the target product 3 (20g) .

Compound 3 (20 g, 28.585 mmol) was dissolved in acetic acid (24 mL, 426.016 mmol) and H ₂ O (12 mL), and stirred at 60° C. for 1 hour. Then the reaction solution was spin-dried, THF (12 mL) and H ₂ O (12 mL) were added, and stirred at 80° C. for 7 hours. LCMS showed the reaction was complete. The reaction solution was added to ethyl acetate (200 mL) and water (100 mL) for extraction, and solid sodium carbonate was added to the aqueous phase until a large amount of solids precipitated out of the aqueous phase. The solid was filtered, washed with water, and the filter cake was pulled dry with an oil pump to obtain the target compound 5 (9g).

Under nitrogen protection, compound 5 (6.8g, 18.581mmol) was dissolved in pyridine (80mL), and TMSCl (14.250mL, 111.489mmol) was slowly added at 0°C, and stirred for 2h. Then Isobutyryl chloride (2.044 mL, 19.511 mmol) was added at 0°C and stirred at 25°C for 1 h. LCMS showed that the reaction was complete. Extracted with dichloromethane (200mL) and water (200mL), the organic phase was dried and spin-dried, and the sample was mixed, and purified by forward column (DCM:MeOH=10:1) through the column, and the peak was at 4.8%) to obtain a yellow Oily compound 6 (12g).

Under nitrogen protection, compound 6 (5.5g, 12.392mmol) was dissolved in pyridine (30mL), MOLECULAR SIEVE 4A 1/16 (7g, 12.392mmol) was added, and DMTrCl (5.04g, 14.870 mmol) solid, reacted at 25°C for 2h. TLC (PE:EtOAc=1:1, Rf=0.69) showed that the reaction had been completed. The reaction liquid and TJN200879-040-P1 are combined and processed together. The reaction solution was extracted with ethyl acetate (200mL) and water (200mL), the organic phase was dried and spin-dried, and the mixed sample was purified by a forward column (PE:EtOAc was passed through the column, and the peak was at 84%) to obtain yellow oily compound 7 (12g).

Compound 7 (12g, 15.389mmol) was dissolved in EtOAc (140mL), wet palladium on carbon Pd/C (7g, 15.389mmol) was added, and the reaction solution was reacted at 25 degrees under hydrogen (15Psi) for 2 hours. TLC (PE:EtOAc=0:1, Rf=0.09) showed that the reaction was complete. The reaction solution was filtered, and the filter cake was washed three times with ethyl acetate (30 mL), and the filtrate was collected. After the filtrate was spin-dried, 50 mL of dichloromethane and 2 mL of triethylamine were added to mix the sample and purified by forward column (DCM:MeOH=10:1 through the column, peak at 0.5%) to obtain 9 g (yellow foamy solid). The obtained racemic compound was resolved by SFC to obtain the product target compound 7A(-) (3.9g) and target compound 7B(+) (3.8g).

Compound 7A(-) (3.30g, 5.40mmol), tetrazolium (190mg, 2.70mmol), 1-methylimidazole (90mg, 1.10mmol), 3A molecular sieve (500mg) were dissolved in 30mL of acetonitrile, at room temperature Compound 8 (2.50 g, 8.10 mmol) was added and stirred at room temperature for 2 h. After the reaction was completed, molecular sieves were filtered off, DCM (150mL) was added, washed with saturated aqueous sodium bicarbonate (30mL*3), and then washed with saturated brine (30mL), the filtrate was spin-dried and subjected to reverse-phase preparative HPLC (C18, Condition : 5-100% (A: water, B: CH3CN), flow rate: 70mL/min), and 1-6a (2.9g, 66%) was obtained after lyophilization. MS m/z: C43H55N7O7P[M+H]+, theoretical: 812.38, measured: 812.5. 1H NMR (400MHz, Acetonitrile-d3) δ7.56,7.54(2s,1H),7.36-7.27(m,2H), 7.24-7.21(m,7H),6.83-6.80(m,4H),4.12-4.10(m,2H),3.75-3.68(m,10H),3.20-2.80(m,2H),2.68-2.54(m ,4H),1.22-1.04(m,18H).

1.3 Synthesis of compound 1-7a

Under the protection of nitrogen, compound 1 (5g, 23.1272mmol), compound 2 (6.76g, 46.254mmol) and triphenylphosphine (7.28g, 27.753mmol) were dissolved in 30mL of dioxane, and slowly dropped at 0°C DEAD (5.502 mL, 27.753 mmol) was added. After the dropwise addition was completed, the reaction temperature was slowly raised to 25°C to continue the reaction for 1h. Add 100mL H ₂ O and 100mL EtOAc to the reaction liquid for extraction. The organic phases were combined, dried, filtered, concentrated, mixed and passed through the column, and purified with a forward column (PE:EtOAc = 1:1 column to get the target product (4g).

Compound 3 (3.3g) was dissolved in HOAc (16mL) and H ₂ O (4mL), and heated in an oil bath at 60°C for 0.5h. The residue obtained by spinning the reaction solution to dryness was purified by a forward column (PE:EtOAc=0: 1 column), the target product 4 (3g) was obtained.

Compound 4 (3 g, 8.873 mmol) was dissolved in 5 mL of pyridine, and a solution of DMTrCl (3.91 g, 11.535 mmol) in 10 mL of pyridine was slowly added dropwise at 0° C. under nitrogen protection. After the dropwise addition, the temperature of the reaction was raised to 25° C. and the reaction was continued for 1 h. 50 mL of water and 100 mL of ethyl acetate were added to the reaction solution for extraction. The aqueous phase was extracted three times with 100 mL of ethyl acetate, and the organic phases were combined, dried, filtered, concentrated, and purified by forward column (using PE:EtOAc=2:1). The target product 5 (4g) was obtained.

Compound 5 (4g, 5.769mmol) was dissolved in methanol (10mL), and saturated NH3 methanol solution (40mL) was added, and reacted at 0°C for 6h. The reaction solution was spin-dried and purified by forward column (use PE:EtOAc=0:1 ) to get 2.4g of racemic compound. SFC resolution gave target product 6A (750mg, 100% purity) and target product 6B (400mg, 99.16% purity).

Compound 6A(-) (700mg, 1.40mmol), tetrazolium (50mg, 0.70mmol), 1-methylimidazole (23mg, 0.28mmol), 3A molecular sieves (500mg) were dissolved in 10mL of acetonitrile, and added at room temperature Compound 7 (630mg, 2.10mmol), stirred at room temperature for 2h. After the reaction was completed, molecular sieves were filtered off, DCM (50 mL) was added, washed with saturated aqueous sodium bicarbonate (10 mL*3), and then washed with saturated brine (20 mL), the filtrate was spin-dried and subjected to reverse phase preparative HPLC (C18, Condition : 5-100% (A: water B: CH ₃ CN), flow rate: 70mL/min), 1-7a (700mg, 72%) was obtained after lyophilization. MS m/z: C38H47N4O7PNa[M+Na]+, theory: 725.32, found: 725.5.

1.4 Synthesis of compound 1-8a

Compound 1 (8.5g, 76.508mmol), compound 2 (30.64g, 91.809mmol) were dissolved in DMF (150mL), CS2CO3 (29.91g, 91.809mmol) was added, and reacted under nitrogen protection at 90°C for 12h. LCMS detected that the reaction was complete. The reaction solution was filtered, spin-dried by an oil pump, and separated and purified by a forward column (80g, DCM/MeOH=10/1-5/1) to obtain the target product 3 (13.5g, 80% purity).

Compound 3 (10.5g, 35.105mmol) was dissolved in pyridine (65mL) and CH ₃ CN (65mL), and BzCl (4.894mL, 42.126mmol) was added dropwise to the solution, and reacted at 25°C for 2h. LCMS detected that most of the raw material reactions were completed, quenched by adding H ₂ O (100mL), extracted with EtOAc (100mL X 3), dried and spin-dried, and purified by column separation (combined with TJN200872-101) (80g, PE/EtOAc=10/1～ 0/1, DCM/MeOH=10/1) afforded the target product 4 (14 g, 90% purity).

Compound 4 (14 g, 36.694 mmol) was dissolved in HOAc (56 mL, 314.796 mmol) and H ₂ O (14 mL), reacted at 60° C. for 2 h, and LCMS showed that the reaction was complete. Oil pump concentration, forward column separation (40g, DCM/MeOH=1/0～5/1) gave target product 5 (8.4g, 90% purity & 2.4g, 80% purity).

Compound 5 (7.4g, 21.957mmol), DMAP (0.54g, 4.391mmol), MOLECULAR SIEVE 4A (11.1g, 2.967mmol) was dissolved in pyridine (60mL), stirred under ice bath for 10min, then DMTrCl (8.93g, 26.348mmol), the reaction was stirred for 1.8h. LCMS detected that about 19% of the raw material remained, and about 60% of the target MS. Combined (TJN200872-105&106) were purified together. Add H ₂ O (50mL) to the reaction solution, extract with DCM (50mL X 3), dry, spin dry, column separation (120g, PE/(EA:DCM:TEA=1:1:0.05)=1/0 ~0/1 to DCM/MeOH=10/1) afforded the target compound 6 (11 g, 89% purity, TJN200872-105&106&107), recovered starting material (3.0 g, 70% purity).

Compound 6 (15g, 22.041mmol) was separated by SFC (DAICEL CHIRALPAK AD (250mm*50mm, 10um); 0.1% NH ₃ H ₂ O EtOH, B: 45%-45%; 200ml/min) to obtain the target product 6A (5.33 g, 94.29% purity), the target product 6B (6.14g, 97.91% purity), compound 6 recovered 1.0g.

Compound 6B(-) (5.4g, 8.92mmol), tetrazolium (312mg, 4.46mmol), 1-methylimidazole (146mg, 1.78mmol), 3A molecular sieves (500mg) were dissolved in 40mL of acetonitrile, at room temperature Compound 7 (4g, 13.4mmol) was added and stirred at room temperature for 2h. After the reaction was completed, the molecular sieves were filtered off, DCM (200mL) was added, washed with saturated aqueous sodium bicarbonate (30mL*3), then washed with saturated brine (50mL), the filtrate was spin-dried and subjected to reverse-phase preparative HPLC (C18, Condition : 5-100% (A: water, B: CH ₃ CN), flow rate: 70mL/min), 1-8a (5.8g, 80%) was obtained after lyophilization. MS m/z: C45H51N5O7P, [M+H]+, Theoretical: 804.36, Found: 804.4.

Example 2: Synthesis of dsRNA

The synthesis of dsRNA is the same as the usual solid-phase phosphoramidite synthesis method. When synthesizing the modified nucleotide at the 5' 7th position of the AS chain, the phosphoramidite monomer synthesized above is used to replace the original nucleotide of the parent sequence. A brief description of the synthesis process is as follows: On Dr. Oligo48 synthesizer (Biolytic), start with Universal CPG carrier, and link nucleoside phosphoramidite monomers one by one according to the synthesis procedure. Except for the nucleoside phosphoramidite monomer at the 5' 7th position of the AS chain described above, other nucleoside monomer raw materials such as 2'-F RNA, 2'-O-methyl RNA and other nucleoside phosphoramidite monomers can be purchased From Shanghai Zhaowei or Suzhou Jima. Using 5-ethylthio-1H-tetrazole (ETT) as the activator (0.6M acetonitrile solution), using 0.22M PADS dissolved in acetonitrile and collidine (Suzhou Kelema) solution with a volume ratio of 1:1 As a vulcanizing agent, iodopyridine/water solution (Koroma) was used as an oxidizing agent.

After the solid-phase synthesis is completed, the oligoribonucleotide is cleaved from the solid support, and soaked at 50° C. for 16 hours using a 3:1 28% ammonia water and ethanol solution. Then centrifuged, the supernatant was transferred to another centrifuge tube, concentrated and evaporated to dryness, purified by C18 reverse chromatography, the mobile phase was 0.1M TEAA and acetonitrile, and 3% trifluoroacetic acid solution was used to remove DMTr. The target oligonucleotides were collected and freeze-dried, identified as the target product by LC-MS, and then quantified by UV (260nm).

The obtained single-stranded oligonucleotides were annealed according to the equimolar ratio and complementary pairing, and finally the obtained dsRNA was dissolved in 1×PBS and adjusted to the required concentration for the experiment.

Example 3: psiCHECK activity screening experiment

See above for dsRNA synthesis, and the plasmid was from Sangon Bioengineering (Shanghai) Co., Ltd. The psiCHECK experimental consumables are listed in Table 1.

Table 1. psiCHECK Assay Consumables and Reagents

Experimental steps: cell plating, cell transfection, wherein, the specific preparation amount of the transfection complex is shown in Table 2.

Table 2. The amount of transfection complex required for each well of a 96-well plate

the	用量/孔Dosage/hole	Opti-MEMOpti-MEM
质粒混合物Plasmid mix	0.05μL0.05μL	10μL10 μL
Lipofectamine 2000Lipofectamine 2000	0.2μL0.2 μL	10μL10 μL

Note: Lipo: 0.2 μL/well; plasmid: 0.05 μL/well; Opti-MEM: 10 μL/well.

According to Table 3, dilute to different concentrations according to different experimental requirements and use it as a working solution for future use. 24h after transfection, according to

The experimental operation scheme of Luciferase Assay System detection kit was used for detection. Calculate relative value Renilla/Firefly ratio (Ratio=Ren/Fir); Calculate inhibition rate 1-(Ratio+siRNA/Ratioreporter only)*100%=Inhibition rate (%); In this disclosure, residual activity % (also referred to as mRNA remaining expression amount % or mRNA remaining expression ratio)=100%-inhibition rate (%).

Table 3. Multiple concentration point dsRNA dilution scheme

终浓度(nM)Final concentration (nM)	加水与dsRNAAdd water and dsRNA
//	//
4040	4μL siRNA(20μM)+96μL H ₂O 4 μL siRNA (20 μM)+96 μL H ₂ O
13.3333333313.33333333	30μL dsRNA+60μL H ₂O 30 μL dsRNA + 60 μL _H2O
4.4444444444.444444444	30μL dsRNA+60μL H ₂O 30 μL dsRNA + 60 μL _H2O
1.4814814811.481481481	30μL dsRNA+60μL H ₂O 30 μL dsRNA + 60 μL _H2O
0.493827160.49382716	30μL dsRNA+60μL H ₂O 30 μL dsRNA + 60 μL _H2O
0.1646090530.164609053	30μL dsRNA+60μL H ₂O 30 μL dsRNA + 60 μL _H2O
0.0548696840.054869684	30μL dsRNA+60μL H ₂O 30 μL dsRNA + 60 μL _H2O
0.0182898950.018289895	30μL dsRNA+60μL H ₂O 30 μL dsRNA + 60 μL _H2O
0.0060966320.006096632	30μL dsRNA+60μL H ₂O 30 μL dsRNA + 60 μL _H2O
0.0020322110.002032211	30μL dsRNA+60μL H ₂O 30 μL dsRNA + 60 μL _H2O

0.000677404

30 μL dsRNA + 60 μL _H2O

Embodiment 4: Characterization of different chemical modifications

Among them: we define hmpNA from nucleotides synthesized from 2-hydroxymethyl-1,3-propanediol as the starting material;

(+)hmpNA(A) is obtained by solid-phase synthesis of the nucleoside phosphoramidite monomer 1-1b in Example 1.1, and the absolute configuration is (S)-hmpNA(A);

(-)hmpNA(A) is obtained by solid-phase synthesis of nucleoside phosphoramidite monomer 1-1a in Example 1.1, and its absolute configuration is (R)-hmpNA(A);

Similarly, replacing the base species of hmpNA, the following structure was obtained by solid-phase synthesis and the absolute configuration was confirmed:

(+)hmpNA(G), the absolute configuration is (S)-hmpNA(G);

(-)hmpNA(G), the absolute configuration is (R)-hmpNA(G);

(+)hmpNA(C), the absolute configuration is (S)-hmpNA(C);

(-)hmpNA(C), the absolute configuration is (R)-hmpNA(C);

(+)hmpNA(U), the absolute configuration is (R)-hmpNA(U);

(-)hmpNA(U), the absolute configuration is (S)-hmpNA(U).

(S)-hmpNA(G), (R)-hmpNA(G), (S)-hmpNA(C), (R)-hmpNA(C), (S)-hmpNA(U) and (R)-hmpNA The absolute configuration of (U) was confirmed by X-Ray diffraction of its intermediates or derivatives.

The structure of the intermediate or derivative is:

TJ-NA067: The detection crystal is a colorless block (0.30×0.10×0.04mm3), which belongs to the monoclinic crystal system P21 space group. Cell parameters

α＝90°, β＝118.015(4)°, γ＝90°,

Z=4. The calculated density Dc=1.389g/cm3, the number of electrons in the unit cell F(000)=504.0, the linear absorption coefficient of the unit cell μ(Cu Kα)=0.840mm–1, and the diffraction experiment temperature T=150.00(11)K.

6A(+): The detection crystal is a colorless block (0.30×0.20×0.10mm3), belonging to the monoclinic crystal system P21 space group. Cell parameters

α＝90°, β＝113.876(3)°, γ＝90°,

Z=2. The calculated density Dc=0.999g/cm3, the number of electrons in the unit cell F(000)=1318.0, the linear absorption coefficient of the unit cell μ(Cu Kα)=0.570mm–1, and the diffraction experiment temperature T=100.01(18)K.

TJ-NA048: The detected crystal is colorless needle-shaped (0.30×0.04×0.04mm3), belonging to the monoclinic P1 space group. Cell parameters

α＝85.007(4)°, β＝88.052(4)°, γ＝70.532(4)°,

Z=2. The calculated density Dc = 1.366g/cm3, the number of electrons in the unit cell F(000) = 620.0, the linear absorption coefficient of the unit cell μ (Cu Kα) = 0.856mm–1, and the diffraction experiment temperature T = 150.00(13)K.

TJ-NA092: The detection crystal is a colorless prism (0.30×0.10×0.10mm3), belonging to the P1 space group of the triclinic crystal system. Cell parameters

α＝93.146(2)°, β＝101.266(2)°, γ＝96.134(2)°,

Z=2. The calculated density Dc=1.412g/cm3, the number of electrons in the unit cell F(000)=228.0, the linear absorption coefficient of the unit cell μ(Cu Kα)=0.945mm–1, and the diffraction experiment temperature T=100.00(10)K.

Example 5: Sequence-dependent experiments comprising siRNAs of different chemical modifications

GNA modification is known to be siRNA sequence dependent, so the inventors tested the experimental compounds of the present disclosure on a number of different sequences. The siRNA (sequence shown in Table 4) targeting three different genes (ANGPTL3, HBV-S, HBV-X) mRNA was used, and the compound (+) hmpNA (A), (-) hmpNA ( A) and the GNA (A) compound as a control modify the 7th position of the 5' end of the AS chain (sequence is shown in Table 5), and compare the on-target activity and off-target activity with the parent sequence.

Table 4. siRNA sequences targeting different genes

In the above table, uppercase letters G, A, C, and U represent nucleotides containing guanine, adenine, cytosine, and uracil, respectively, lowercase letter m represents 2'-methoxy modification, and lowercase letter f represents 2 '-Fluoro modification, when the lowercase letter s is in the middle, it means that the two adjacent nucleotides to the left and right of the letter s are connected by a phosphorothioate group; when the lowercase letter s is the first at the 3' end, it means that the A nucleotide terminal adjacent to the left side of the letter s is a phosphorothioate group; the same below.

Table 5. siRNA sequences containing chemical modifications targeting different genes

See Table 6 for the results of on-target activity experiments. GNA (A) showed obvious sequence dependence, and the on-target activities of different sequences were significantly different. The experimental compounds of the present disclosure do not show obvious sequence dependence, and have stronger general applicability.

The off-target activity test results are shown in Table 7. It can be seen that compared with the parent sequence, the experimental compound of the present disclosure significantly reduces the off-target activity of dsRNA.

Table 6. On-target activity results of siRNAs against different target sequences

Table 7. Off-target activity results of siRNAs against different target sequences

Embodiment 6: preparation NAG0052, L96

Compounds NAG0024 and NAG0026 were purchased from Tianjin WuXi Kangde New Drug Development Co., Ltd. Unless otherwise specified, all reagents used in the following examples are commercially available.

(1) Synthesis of compound NAG0052

The starting material Compound 1 was purchased from Jiangsu Beida Pharmaceutical Technology Co., Ltd.

The specific synthesis steps of compound NAG0052 are as follows:

Compound 2

To a solution of compound 1 (12.3 mL, 101 mmol) in THF (300 mL) was added portionwise NaH (12.2 g, 304 mmol, purity 60%) at 0°C under nitrogen protection. The mixture was stirred at 20°C for 1 hour and then cooled to 0°C again, then benzyl bromide (36.3 mL, 304 mmol) was added dropwise to the system and stirred at 20°C for 12 hours. The reaction solution was quenched with H ₂ O (100 mL), and then extracted with EtOAc (200 mL x 2). The combined organic phases were washed with saturated brine (100mL), dried over Na ₂ SO ₄ , filtered, concentrated and the residue obtained was separated by silica gel column chromatography to obtain the target compound 2 (20.0 g, 51.8 mmol, yield 51%) .

LCMS: t _R =2.615 and 2.820min in 30-90AB_7min_220&254_Shimadzu.lcm (Xtimate C18, 3um, 2.1*30mm), MS (ESI) m/z = 351.2[M+Na] ⁺ .

¹ H NMR: (400MHz, CDCl ₃ ) δppm 7.35-7.12 (m, 10H), 5.06-4.95 (m, 1H), 4.51-4.39 (m, 4H), 4.24-3.87 (m, 2H), 3.50-3.40 (m, 2H), 3.38-3.20 (m, 3H), 2.20-1.91 (m, 2H).

Compounds 3 and 4

Under nitrogen protection at 20 degrees, TMSCN (13.5mL, 101mmol) was added to a solution of compound 2 (13.0g, 33.6mmol) in DCM (300mL) at one time, followed by dropwise addition of TMSOTf (9.14mL, 50.5mmol) in DCM (30 mL) solution. The reaction solution was stirred at 20°C for 15 hours. After the reaction was completed, the system was quenched with saturated NaHCO ₃ aqueous solution (80 mL), and extracted with DCM (150 mL x 2), the combined organic phase was washed with saturated brine (80 mL), dried over Na ₂ SO ₄ , filtered and concentrated The target compound 3 (3.30 g, 9.18 mmol, yield 27%) and light yellow oily liquid compound 4 (8.50 g, 9.18 mmol, yield 70%) were obtained after separation by silica gel column chromatography.

Compound 3

¹ H NMR: (400MHz, CDCl ₃ ) δppm 7.42-7.29(m, 10H), 4.81(t, J=7.8Hz, 1H), 4.65-4.49(m, 4H), 4.30-4.21(m, 2H), 3.65-3.57 (m, 1H), 3.57-3.49 (m, 1H), 2.49-2.40 (m, 2H).

Compound 4

¹ H NMR: (400MHz, CDCl ₃ ) δppm 7.42-7.26 (m, 10H), 4.93-4.87 (m, 1H), 4.65-4.48 (m, 4H), 4.43-4.38 (m, 1H), 4.21-4.17 (m, 1H), 3.79-3.70 (m, 1H), 3.54 (d, J=4.0Hz, 1H), 2.45-2.37 (m, 2H).

Compound 5

The THF (15mL) solution of compound 4 (3.00g, 9.28mmol) was added dropwise to the THF (15mL) solution of LiAlH ₄ (0.79g, 20.9mmol) at 0 degrees under the protection of nitrogen. After the dropwise addition, the system was in React at 0°C for 1 hour. TLC (PE:EtOAc=3:1) monitored the complete disappearance of starting material. Sodium sulfate decahydrate was slowly added to the reaction liquid until it stopped bubbling. Afterwards, the reaction solution was filtered, and the filter cake was washed three times with dichloromethane (60 mL), and the filtrate was collected and spin-dried to obtain the target compound 5 (3.00 g, yield 90%).

¹ H NMR: (400MHz,DMSO-d ₆ )δppm 7.40-7.14(m,10H),4.54-4.38(m,4H),4.06-3.99(m,2H),3.91(q,J=6.4Hz,1H ), 3.48-3.37(m,2H), 2.67-2.52(m,2H), 2.21-2.18(m,1H), 1.77-1.73(m,1H).

Compound 6

Under nitrogen protection, compound 5 (3.00g, 8.25mmol) was dissolved in DCM (30mL), TEA (3.44mL, 24.7mmol) and CbzCl (1.76mL, 12.4mmol) were added, and reacted at 20°C for 2 hours. LCMS showed the reaction was complete. The reaction solution was added to dichloromethane (30 mL) and water (60 mL) for extraction. The organic phase was washed three times with water (60mL x 3), dried over anhydrous sodium sulfate, concentrated and purified by forward column (PE:EtOAc=1:1) to obtain the target compound 6 (2.5g, yield 90%).

LCMS: t _R = 0.810 min in 5-95AB_1 min, MS (ESI) m/z = 462.2 [M+H] ⁺ .

¹ H NMR: (400MHz, CDCl ₃ )δppm 7.39-7.29(m,15H),5.35(s,1H),5.15-5.01(m,2H),4.72(d,J=6.0Hz,1H),4.54- 4.40(m,3H),4.26(s,1H),4.23-4.18(m,1H),4.11-4.04(m,1H),3.54-3.41(m,3H),3.37-3.25(m,1H), 2.34-2.23 (m, 1H), 1.85-1.79 (m, 1H).

Compound 7

Under nitrogen protection, compound 6 (2.00 g, 3.90 mmol) was dissolved in DCM (5 mL), and BCl ₃ in THF (1 M, 27.3 mL) was added at -78°C for 1 hour. TLC (DCM:MeOH=10:1) monitored the complete disappearance of starting material. The reaction solution was quenched by adding methanol (20 mL) at -78°C, concentrated, and purified by a forward column (DCM:MeOH=10:1) to obtain the target compound 7 (2.00 g, yield 60%).

¹ H NMR: (400MHz, CD ₃ OD) δppm 7.41-7.23 (m, 5H), 5.08 (s, 2H), 4.25-4.07 (m, 2H), 3.85-3.75 (m, 1H), 3.63-3.56 ( m, 1H), 3.54-3.48(m, 1H), 3.30-3.27(m, 2H), 2.34-2.21(m, 1H), 1.71-1.64(m, 1H).

Compound 8

Under the protection of nitrogen, compound 7 (0.50g, 1.78mmol) was dissolved in pyridine (5mL), 4A molecular sieves (500mg) and DMTrCl (0.66mL, 2.13mmol) were added at 0 degrees, and then the temperature was raised to 20 degrees to react 1.5 Hour. TLC (PE:EtOAc=2:1) monitored the complete disappearance of starting material. The reaction solution was extracted by adding ethyl acetate (60mL) and water (60mL), the organic phase was washed three times with water (60mL x 3), dried over anhydrous sodium sulfate, concentrated, and purified by a forward column (PE:EtOAc=1:1 ), to obtain the target compound 8 (800mg, yield 90%).

¹ H NMR: (400MHz, CDCl ₃ ) δppm 7.44(d, J=7.6Hz, 2H), 7.37-7.23(m, 11H), 7.22-7.15(m, 1H), 6.84(d, J=8.8Hz, 4H),5.09(s,2H),4.31-4.17(m,2H),4.02-3.91(m,1H),3.84-3.73(m,6H),3.33(s,1H),3.28(s,1H) ,3.19-3.01(m,2H),2.34-2.25(m,1H),1.70-1.62(m,1H).

Compound 9

Compound 8 (800mg, 1.234mmol) was dissolved in EtOAc (5mL), Pd/C 10% (800mg, 7.517mmol) was added, and the reaction was carried out under H ₂ condition (15Psi) at 20°C for 1 hour. LCMS showed the reaction was complete. The reaction solution was filtered, and the filter cake was washed three times with dichloromethane (100 mL) and methanol (100 mL), concentrated, and separated by a reverse-phase column to obtain compound 9 (300 mg, 54%).

LCMS: t _R = 2.586 min in 10-80 CD_3 min MS (ESI) m/z = 450.2 [M+H] ⁺ .

Compound 11

Dissolve compound 10 (435mg, 1.780mmol) in DCM (10mL), add DIEA (0.441mL, 2.67mmol) and HATU (677mg, 1.78mmol), then add compound 9 (400mg, 0.890mmol), and react at 20 degrees 1 Hour. TLC (DCM:MeOH=10:1) monitored the completion of the reaction. The reaction solution was extracted by adding dichloromethane (60mL) and water (60mL), the organic phase was washed three times with water (60mL x 3), dried over anhydrous sodium sulfate, concentrated and purified by forward column (PE:EtOAc=0:1) , The product peak appeared at 100%) to obtain the target compound 11 (600 mg, yield 90%).

LCMS: t _R = 2.745 min in 30-90 CD_3 min, MS (ESI) m/z = 698.4 [M+Na] ⁺ .

¹ H NMR: (400MHz,CD ₃ OD)δppm 7.46-7.38(m,2H),7.35-7.24(m,6H),7.22-7.16(m,1H),6.90-6.78(m,4H),4.29- 4.21(m,2H),4.02-3.95(m,1H),3.77(s,6H),3.66-3.62(m,3H),3.41(s,1H),3.18-3.04(m,2H),2.36- 2.17 (m, 5H), 1.71-1.50 (m, 5H), 1.39-1.25 (m, 14H).

Compound 12

Compound 11 (600 mg, 0.799 mmol) was dissolved in THF (3 mL) and H ₂ O (1 mL), LiOH.H ₂ O (134 mg, 3.20 mmol) was added, and reacted at 20°C for 12 hours. TLC (DCM:MeOH=10:1) showed that the reaction was complete. The reaction solution was spin-dried, dissolved in water (5mL) and methanol (5mL), and purified by reverse column (H ₂ O:CH ₃ CN=1:1, peak at about 35%) to obtain the target compound 12 (460mg, Yield 100%, lithium salt).

LCMS: t _R = 1.346 min in 10-80 CD_3 min, MS (ESI) m/z = 684.3 [M+Na] ⁺ .

HPLC: _tR = 1.879min in 10-80CD_6min.

¹ H NMR: (400MHz, CD ₃ OD) δppm 7.47-7.39 (m, 2H), 7.35-7.24 (m, 6H), 7.22-7.15 (m, 1H), 6.91-6.79 (m, 4H), 4.31- 4.18(m,2H),4.02-3.95(m,1H),3.78(s,6H),3.44-3.33(m,2H),3.18-3.04(m,2H),2.35-2.27(m,1H), 2.24-2.10 (m, 4H), 1.70-1.51 (m, 5H), 1.31-1.23 (m, 12H).

Compound 13

At room temperature, under the protection of nitrogen, the compound NAG0024 (271 mg, 0.151 mmol) was dissolved in anhydrous THF (2 mL) and anhydrous DMF (4 mL), and 3A molecular sieves were added, followed by addition of compound 12 (100 mg, 0.151 mmol), HOBt ( 25mg, 0.181mmol), DCC (38mg, 0.181mmol) and DIEA (39mg, 0.302mmol). The reaction solution was reacted at 45°C for 16h. After LC-MS showed that the reaction was complete, it was quenched with water and filtered. After the filtrate was concentrated, it was purified by C18 reverse phase column (H ₂ O/MeCN) to obtain compound 13 (210 mg, yield 57%).

Compound NAG0052

At room temperature, compound 13 (230 mg, 0.094 mmol) was dissolved in pyridine (5 mL), molecular sieves were added, DMAP (12 mg, 0.283 mmol) and succinic anhydride (28 mg, 0.283 mmol) were added. Under nitrogen protection, stir at 50°C for 16 hours. LCMS detected that the reaction was complete, filtered and spin-dried. After purification by C18 reverse-phase column, secondary purification by preparative HPLC gave the target compound NAG0052 (123 mg, 0.048 mmol, yield 51%).

MS (ESI) m/z = 2535.3 [M-1] ^- . Theory: 2536.2.

¹ H NMR (400MHz,Acetonitrile-d ₃ )δ7.48-7.43(m,2H),7.37-7.12(m,11H),7.00-6.85(m,10H),6.66(s,1H),5.31(dd ,J=3.4,1.1Hz,3H),5.20-5.13(m,1H),5.05(dd,J=11.3,3.4Hz,3H),4.56(d,J=8.5Hz,3H),4.30(dd, J=7.7,5.3Hz,1H),4.18-3.93(m,14H),3.79(s,10H),3.65(q,J=4.7,3.6Hz,13H),3.56-3.07(m,24H),2.56 (s,6H),2.37(t,J=5.8Hz,10H),2.17(t,J=7.5Hz,9H),2.02-1.96(m,20H),1.88(s,8H),1.82-1.73( m, 2H), 1.60 (dt, J = 15.0, 7.3 Hz, 16H), 1.27 (s, 13H).

(2) Synthesis of L96

Compound L96 having the above structural formula was prepared according to the method described in patent application WO2014025805A1.

Example 7: Synthesis of dsRNA

1. Self-made resin with carrier

The compound NAG0052 (157mg, 0.062mmol) containing a carboxylic acid group was dissolved in anhydrous DMF (3mL). After the substrate was completely dissolved, anhydrous acetonitrile (4mL), DIEA (0.03mL, 0.154mmol, 2.5eq ) and HBTU (35mg, 0.093mmol, 1.5eq). After the reaction solution was mixed evenly, macroporous amine methyl resin (476mg, blank load was 0.41mmol/g, target load was 0.1mmol/g) was added. The reaction solution was placed on a shaker (temperature: 25° C., rotation speed: 200 rpm) and shaken overnight. The reaction liquid was filtered, and the filter cake was washed successively with DCM and anhydrous acetonitrile, and the solid was collected and dried overnight in vacuum.

The above solid was dispersed in anhydrous acetonitrile (5 mL), and pyridine (0.18 mL), DMAP (3 mg), NMI (0.12 mL) and CapB1 (2.68 mL) were added sequentially. The reaction solution was placed on a shaker (temperature: 25° C., rotation speed: 200 rpm) and shaken for 2 h. The reaction liquid was filtered, and the filter cake was washed with anhydrous acetonitrile, and the solid was collected and vacuum-dried overnight to obtain a resin with a carrier. The loading capacity was determined to be 0.1 mmol/g.

2. For the NAG0052 that has been connected to the resin, use the resin as a starting point, and connect the nucleoside monomers one by one from the 3'-5' direction according to the sequence of nucleotide arrangement. Each connection of a nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or sulfurization. The operation is conventional in the art.

The compound NAG0052 is connected to the sequence through solid-phase synthesis, and after aminolysis, the structure of NAG0052 loses some functional groups to become NAG0052'.

The prepared dsRNA had the sense and antisense strands shown in Table 8 and Table 9.

Table 8. dsRNA list

dsRNA编号dsRNA ID	有义链编号Sense strand number	反义链编号Antisense strand number
TRD002218TRD002218	TJR4373-SSTJR4373-SS	TJR0414-ASTJR0414-AS
TRD007205TRD007205	TJR013485STJR013485S	TJR0414-ASTJR0414-AS

Table 9. Nucleic acid sequences of sense strand and antisense strand

Table 10. Structure of dsRNA:

Among them, the conjugate TRD002218 is used as a reference positive compound, and Z represents siRNA.

Example 8: Inhibition of dsRNA on target gene mRNA expression in vivo

This experiment investigates the inhibitory efficiency of the disclosed dsRNA conjugated with different structures on the expression of target gene mRNA in vivo

Male 6-8 week-old C57BL/6 mice were randomly divided into 6 groups, 3 at each time point, and each group was given TRD007205, reference positive TRD002218 and PBS.

All animals were dosed according to their total body weight, and were administered once by subcutaneous injection. The dose of dsRNA (based on the amount of siRNA) was 1 mg/kg, and the volume of administration was 5 mL/kg. After 7 days and 28 days of administration, the mice were sacrificed, the liver was collected, and preserved with RNA later (Sigma Aldrich); then the liver tissue was homogenized with a tissue homogenizer, and then the tissue RNA extraction kit (Fanzhi Medical Technology, FG0412) was used The total RNA of the liver tissue was extracted according to the operation steps marked in the operation manual. The total RNA was reverse-transcribed into cDNA, and the expression of TTR mRNA in liver tissue was detected by real-time fluorescent quantitative PCR method. In the fluorescent quantitative PCR method, glyceraldehyde 3-phosphate dehydrogenase (GAPDH) gene was used as an internal reference gene, and Taqman probe primers for TTR and GAPDH were used to detect the mRNA expression levels of TTR and GAPDH, respectively.

Table 11. Grouping information of experimental compounds in mice:

Table 12. The sequences of the detection primers are as follows:

TTR mRNA expression was calculated according to the following equation:

TTR mRNA expression=[(TTR mRNA expression of test group/GAPDH mRNA expression of test group)/(TTR mRNA expression of control group/GAPDH mRNA expression of control group)]×100%.

After 7 days and 28 days of administration, the in vivo inhibition efficiencies of dsRNA conjugated with different structures of the present disclosure on target gene mRNA expression are shown in Figure 1 and Figure 2, respectively. It can be seen from the results in Figure 1 that the conjugate TRD007205 has a good effect on the expression inhibition of TTR mRNA 7 days after administration. It can be seen from Figure 2 that after 28 days of administration, TRD007205 has a better inhibitory effect on target gene mRNA expression than TRD002218.

Example 9: Synthetic dsRNA

1. Self-made resin with carrier

Concrete operation is the same as embodiment 7.

2. Use the resin with NAG0052 as the starting point, and connect the nucleoside monomers one by one from the 3'-5' direction according to the sequence of nucleotide arrangement. Each connection of a nucleoside monomer includes four steps of deprotection, coupling, capping, oxidation or sulfurization. Specifically refer to the synthetic method of embodiment 2.

The prepared dsRNA had the sense and antisense strands shown in Table 13 and Table 14. Table 15 is the naked sequence corresponding to the dsRNA. In Table 16 are positive control compounds.

Table 13. dsRNA list

Table 14. Sense and antisense strands of dsRNA

in,

(-)hmpNA(A) is obtained by solid-phase synthesis of nucleoside phosphoramidite monomer 1-1a in Section 1.1 of Example; (+)hmpNA(A) is an optical isomer;

(‐)hmpNA(G) is obtained by solid-phase synthesis of nucleoside phosphoramidite monomer 1‐6a in Section 1.6 of Example; (+)hmpNA(G) is an optical isomer;

(‐)hmpNA(U) is obtained by solid-phase synthesis of nucleoside phosphoramidite monomer 1‐7a in Section 1.7 of Example; (+)hmpNA(U) is an optical isomer.

The structure of NAG0052' is:

The naked sequence corresponding to the sense strand and antisense strand of table 15.dsRNA

Table 16. Positive Control Compound Sequence Information

TRD006597 was prepared with reference to WO2020061177A1;

The structures of NAG37 and IB are shown below, respectively:

In HEK293A cells, 11 concentration gradients were used to screen dsRNAs for in vitro molecular simulation on-target activity.

Human HSD17B13 gene was used to construct the corresponding target sequence of siRNA and inserted into psiCHECK-2 plasmid. The plasmid contains Renilla luciferase gene and Firefly luciferase gene. As a dual reporter gene system, the target sequence of dsRNA is inserted into the 3'UTR region of the Renilla luciferase gene, and the activity of dsRNA on the target sequence can be detected by the detection of the expression of Renilla luciferase calibrated by firefly luciferase For reflection, Dual-Luciferase Reporter Assay System (Promega, E2940) was used for detection.

HEK293A cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C and 5% CO ₂ . 24 hours before transfection, HEK293A cells were seeded in a 96-well plate at a seeding density of 8× ¹⁰ cells per well and 100 μL of medium per well.

According to the instructions, cells were co-transfected with dsRNA and corresponding plasmids using Lipofectamine2000 (ThermoFisher, 11668019). Lipofectamine2000 was used in 0.2 μL per well, and the amount of plasmid transfection was 20 ng per well. For the target sequence plasmid, dsRNA has a total of 11 concentration points, the final concentration of the highest concentration point is 20nM, 3-fold serial dilution, 20nM, 6.6667nM, 2.2222nM, 0.7407nM, 0.2469nM, 0.0823nM, 0.0274nM, 0.0091nM, 0.0030nM, 0.0010nM and 0.0003nM. 24h after transfection, the target level was detected by Dual-Luciferase Reporter Assay System (Promega, E2940). The on-target activities of the detected sequences are shown in Table 17.

Table 17. psi-CHECK screening results for target activity of dsRNA

N/A means not applicable

The above results indicated that, compared with TRD006597 and TJR100347, compounds TRD008007, TRD008008, TRD008009, TRD008010, and TRD008010-1 had a higher level of on-target inhibitory activity against the HSD17B13 gene in the psiCHECK system.

Example 10: Inhibition of dsRNA on human HSD17B13 in primary human hepatocytes (PHH) - inhibition activity at 7 concentration points

The dsRNA was screened for PHH activity in primary human hepatocytes (PHH) using 7 concentration gradients. Each dsRNA sample was transfected with a constant concentration of 20 nM, 5-fold serial dilution and 7 concentration points.

PHH cells (Novabiosis, nHP Hepatocytes) were cryopreserved in liquid nitrogen. 24 hours before transfection, the PHH cells were resuscitated and seeded in 96-well plates at a seeding density of 3×10 ⁴ cells per well and 80 μL of medium per well.

Referring to the product instruction manual, use Lipofectamine RNAi MAX (ThermoFisher, 13778150) to transfect dsRNA, and the gradient final concentration of dsRNA transfection is 10nM, 2nM, 0.4nM, 0.08nM, 0.016nM, 0.0032nM and 0.00064nM. After 24 hours of treatment, use the high-throughput cell RNA extraction kit (Fanzhi, FG0417) to perform total cellular RNA extraction, RNA reverse transcription experiment (Takara, 6210B) and quantitative real-time PCR detection (ThermoFisher, 4444557) to determine human HSD17B13 The mRNA level of human HSD17B13 was corrected according to the level of GAPDH internal reference gene.

Among them, in the quantitative real-time PCR detection, the probe Q-PCR detection experiment is used, and the primer information is shown in Table 18.

Table 18. Taqman primer information table

引物名称Primer name	SEQ ID NOSEQ ID NO	引物序列Primer sequence
hGAPDH-PF1-MGBhGAPDH-PF1-MGB	5353	GACCCCTTCATTGACCTCAACTACGACCCTTCATTGACCTCAACTAC
hGAPDH-PR1-MGBhGAPDH-PR1-MGB	5454	TTGACGGTGCCATGGAATTTTTGACGGTGCCATGGAATTT
hGAPDH-P1-MGBhGAPDH-P1-MGB	5555	TTACATGTTCCAATATGATTCCTTACATGTTCCAATATGATTCC

Table 19. HSD probe primer information is as follows:

引物名称Primer name	品牌brand	货号Item No.
HSD17B13Human probeHSD17B13 Human probe	ThermoThermo	Hs01068199_mlHs01068199_ml

Results analysis method

After the Q-PCR detection experiment is completed, the corresponding Ct value can be obtained according to the threshold automatically set by the system, and the expression of a certain gene can be relatively quantified by comparing the Ct value: the comparison Ct refers to the difference between the Ct value and the internal reference gene Ct value ^ΔΔCt =[(target gene of Ct experimental group-internal reference of Ct experimental group)-(target gene of Ct control group-internal reference of Ct control group)]. Inhibition rate (%)=(1-remaining amount of target gene expression)*100%.

Results are expressed as percent remaining human HSD17B13 mRNA expression relative to control dsRNA-treated cells. See Table 20 for the _IC50 results of the inhibition rate.

The results showed that the reference compound TRD006597, compounds TRD008007, TRD008008, TRD008009, and TRD008010 had a high level of on-target inhibitory activity on the HSD17B13 gene in PHH cells.

Table 20.dsRNA multi-dose inhibitory activity in PHH cells

Example 11. Inhibition of human HSD17B13 by dsRNA in primary human hepatocytes (PHH) - multi-concentration point inhibitory activity

The dsRNA in Table 21 was synthesized, and the dsRNA was screened for primary human hepatocytes (PHH) activity in primary human hepatocytes (PHH) using multiple concentration gradients.

Table 21. The modified sense and antisense strands of dsRNA

The lowercase letter m indicates that the nucleotide adjacent to the upstream of the letter m is a 2'-methoxy-modified nucleotide; the lowercase letter f indicates that the nucleotide adjacent to the upstream of the letter f is a 2'-fluoro modified nucleotide of nucleotides;

When the lowercase letter s is in the middle, it means that the connection between the two adjacent nucleotides on both sides of the letter s is a phosphorothioate group connection;

When the lowercase letter s is the first at the 3' end, it means that a nucleotide terminal adjacent to the upstream of the letter s is a phosphorothioate group.

NAG1 looks like this:

The primary human hepatocytes (PHH) were cryopreserved in liquid nitrogen. 24 hours before transfection, the primary human hepatocytes (PHH) were resuscitated and inoculated in a 96-well plate at a seeding density of ⁴ ×104 cells per well. Wells with 100 μl medium.

Refer to the product instruction manual, use Lipofectamine RNAi MAX (ThermoFisher, 13778150) to transfect dsRNA, set 11 or 7 concentration points of dsRNA, the final concentration of the highest concentration point is 10nM, 3-fold or 5-fold serial dilution. After 24 hours of treatment, the high-throughput cellular RNA extraction kit was used for total cellular RNA extraction, RNA reverse transcription experiment and quantitative real-time PCR detection to measure the mRNA level of human HSD17B13, and correct the mRNA level of human HSD17B13 according to the level of GAPDH internal reference gene .

Results are expressed as percent remaining human HSD17B13 mRNA expression relative to control siRNA-treated cells. See Table 22 and Table 23 for the _IC50 results of the inhibition rate.

Table 22.dsRNA inhibits the activity of 11 concentrations of human HSD17B13 in primary human hepatocytes (PHH)

Table 23. Conjugated siRNA inhibits activity of 7 concentrations of human HSD17B13 in primary human hepatocytes (PHH)

Claims

A double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises siRNA and one or more ligands conjugated thereto, the siRNA comprises a sense strand and an antisense strand, and the antisense strand is at its 5' At least one nucleotide position from the 2nd to the 8th position of the region contains a chemical modification represented by formula (I), its tautomer or a pharmaceutically acceptable salt thereof:

The chemical modification shown in the formula (I) is selected from any of the following structures:

B are each independently selected from the bases corresponding to the 2nd to 8th positions at the 5' end of the antisense strand;

The ligand is selected from the following structures or pharmaceutically acceptable salts thereof:

The siRNA is an siRNA targeting type 13 17β-hydroxysteroid dehydrogenase (HSD17B13).
The dsRNA according to claim 1, wherein the sense strand of the siRNA comprises at least 15 consecutive nucleotides, and differs from any nucleotide sequence in SEQ ID NO:1 to SEQ ID NO:8. more than 3 nucleotides, and/or,

The antisense strand of the siRNA comprises at least 19 consecutive nucleotides, and differs from any nucleotide sequence in SEQ ID NO:9 to SEQ ID NO:12 by no more than 3 nucleotides;

Preferably, the sense strand of the siRNA comprises the nucleotide sequence of any one of SEQ ID NO:1 to SEQ ID NO:8, and/or,

The antisense strand of the siRNA comprises the nucleotide sequence of any one of SEQ ID NO:9 to SEQ ID NO:12;

More preferably,

The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:8, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:12;

The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:6, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:11;

The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:2, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:9;

The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:4, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:10;

The sense strand of the siRNA comprises SEQ ID NO:7, and the antisense strand of the siRNA comprises SEQ ID NO:12;

The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:5, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:11;

The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:1, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:9; or

The sense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:3, and the antisense strand of the siRNA comprises the nucleotide sequence shown in SEQ ID NO:10.
The dsRNA of claim 1 or 2, wherein the 3' end of the sense strand of the siRNA is conjugated to the ligand.
The dsRNA according to any one of claims 1-3, wherein the ligand is connected to the 3' end of the sense strand of the siRNA through a phosphate group or a phosphorothioate group; ester groups or phosphorothioate groups, more preferably through phosphodiester groups.
The dsRNA according to any one of claims 1-4, wherein the chemical modification shown in formula (I), its tautomer or its pharmaceutically acceptable salt modified nucleotide is located on the antisense strand The 5th, 6th or 7th position at the 5' end, preferably at the 7th position.
The dsRNA according to any one of claims 1-5, wherein,

At least one additional nucleotide in the sense and/or antisense strand of the siRNA is a modified nucleotide.
The dsRNA according to any one of claims 1-6, wherein,

The sense strand of the siRNA contains the nucleotide sequence shown in the following formula:

5'-N a N a N a N a N a N a N b N b N b N a N a N a N a N a N a N a N a N a N a -3'; or,

5'-N a N a N a N a N b N a N b N b N b N a N a N a N a N a N a N a N a N a N a -3 ' ;

Wherein, N a is a 2'-methoxy-modified nucleotide, and N b is a 2'-fluoro-modified nucleotide.
The dsRNA according to any one of claims 1-7, wherein the antisense strand contains a nucleotide sequence as shown in the following formula:

5'-N a 'N b 'N a 'N b ' N a 'N b 'W'N a 'N a 'N b 'N a 'N b 'N a 'N b 'N a 'N b ' N a'N b'N a'N a'N a' -3';

N a 'is a 2'-methoxy-modified nucleotide, and N b ' is a 2'-fluoro-modified nucleotide;

W' represents the chemical modification shown in formula (I), its tautomer or a pharmaceutically acceptable salt modified nucleotide, the chemical modification shown in formula (I) is selected from:

Wherein: B is identical with the base when the 7th nucleotide at the 5' end of the antisense strand is not modified.
The dsRNA according to any one of claims 1-8, wherein at least one phosphate group in the sense strand and/or antisense strand is a phosphate group with a modification group; preferably, the The phosphate group of the modifying group is a phosphorothioate group.
The dsRNA of claim 9, wherein the phosphorothioate group is present in at least one of the following positions:

Between the first nucleotide and the second nucleotide at the 5' end of the sense strand;

Between the 2nd nucleotide and the 3rd nucleotide of the 5' end of the sense strand;

Between the first nucleotide and the second nucleotide at the 5' end of the antisense strand;

Between the 2nd nucleotide and the 3rd nucleotide of the 5' end of the antisense strand;

Between the first nucleotide and the second nucleotide of the 3' end of the antisense strand; and

Between the 2nd nucleotide and the 3rd nucleotide of the 3' end of the antisense strand;

Preferably,

The sense strand and/or the antisense strand include a plurality of phosphorothioate groups present in:

Between the 1st nucleotide and the 2nd nucleotide of the 5' end of the sense strand; and,

Between the 2nd and 3rd nucleotides of the 5' end of the sense strand; and,

Between the first nucleotide and the second nucleotide of the 5' end of the antisense strand; and,

between the 2nd and 3rd nucleotides of the 5' end of the antisense strand; and,

Between the first nucleotide and the second nucleotide of the 3' end of the antisense strand; and,

Between the second nucleotide and the third nucleotide at the 3' end of the antisense strand.
A dsRNA, wherein,

The dsRNA is any of the following schemes:

comprising the sense strand set forth in SEQ ID NO:20 and the antisense strand set forth in SEQ ID NO:24; or,

comprising the sense strand set forth in SEQ ID NO:18 and the antisense strand set forth in SEQ ID NO:23; or,

comprising the sense strand set forth in SEQ ID NO:14 and the antisense strand set forth in SEQ ID NO:21; or,

comprising the sense strand set forth in SEQ ID NO:16 and the antisense strand set forth in SEQ ID NO:22; or,

comprising the sense strand set forth in SEQ ID NO:19 and the antisense strand set forth in SEQ ID NO:24; or,

comprising the sense strand set forth in SEQ ID NO:17 and the antisense strand set forth in SEQ ID NO:23; or,

comprising the sense strand set forth in SEQ ID NO:13 and the antisense strand set forth in SEQ ID NO:21; or,

Contains the sense strand shown in SEQ ID NO:15 and the antisense strand shown in SEQ ID NO:22.
The dsRNA according to any one of claims 1-11, wherein the dsRNA is selected from any of the following structures or pharmaceutically acceptable salts thereof:

Wherein, Af=Adenine 2'-F ribonucleoside; Cf=Cytosine 2'-F ribonucleoside; Uf=Uracil 2'-F ribonucleoside; Am=Adenine 2'-OMe ribonucleoside; Cm=cytosine 2'-OMe ribonucleoside; Gf=guanine 2'-F ribonucleoside; Gm=guanine 2'-OMe ribonucleoside; Um=uridine 2'-OMe ribonucleoside;

represents a phosphorothioate group,
represents a phosphodiester group,

NAG0052' indicates

(-)hmpNA(U) means

(-)hmpNA(A) means

(-)hmpNA(G) means
A pharmaceutical composition comprising the dsRNA according to any one of claims 1-12; preferably, the pharmaceutical composition further comprises one or more pharmaceutically acceptable excipients.
A dsRNA as described in any one of claims 1-12 or the application of the pharmaceutical composition as described in claim 13 in the preparation of medicine; Said dsRNA medicine is used for preventing and/or treating hepatitis, liver fibrosis , nonalcoholic steatohepatitis, nonalcoholic fatty liver disease, cirrhosis, alcoholic steatohepatitis, alcoholic fatty liver disease, HCV-related cirrhosis, drug-induced liver injury or hepatocellular necrosis, or chronic fibroinflammatory liver disease .
A method for inhibiting the expression of target gene HSD17B13, comprising administering to a subject a therapeutically effective amount or an effective dose of the dsRNA according to any one of claims 1-12 or the pharmaceutical composition according to claim 13.
A method of delivering oligonucleotides to the liver, comprising administering to a subject an effective amount or an effective dose of the dsRNA according to any one of claims 1-12 or the pharmaceutical composition according to claim 13 .
A cell comprising the dsRNA of any one of claims 1-12.
A kit comprising the dsRNA according to any one of claims 1-12 or the pharmaceutical composition according to any one of claim 13.
A carrier comprising the dsRNA according to any one of claims 1-12.
A method for preparing dsRNA or a pharmaceutical composition, comprising: synthesizing the dsRNA according to any one of claims 1-12 or the pharmaceutical composition according to claim 13.