WO2023102859A1 - Method for acquiring active ingredient of anti-hematologic tumor drug and use thereof - Google Patents

Abstract

Disclosed is a method for acquiring an active ingredient of a drug capable of treating/preventing hematologic tumors. The method comprises performing three-stage separation on extracellular vesicles, which are secreted by NK-92 cells and NK-92MI cells, to obtain two groups of extracellular vesicles with three sizes: a large size, a medium size and a small size; and then, activity screening is performed on a large sample consisting of miRNA sequences of NK-92 cells and NK-92MI cells and miRNA sequences of the two groups of extracellular vesicles to obtain active miRNA having a strong ability to kill hematologic tumor cells. The active miRNA participates in the regulation of gene expression, regulates the early development of immune cells, affects the development and differentiation of immune cells, and has an effect of treating/preventing hematologic tumors. Moreover, the transfection efficiency of the active miRNA in the liposome is high, and an anti-tumor effect obtained after transfection is obvious.

Description

Method for obtaining active ingredient of anti-hematological tumor drug and use thereof technical field

The invention belongs to the technical field of medicine and relates to the use of related active ingredients in the preparation of medicines for treating/preventing leukemia.

Background technique

Hematological malignant tumors (Hematological Malignant Tumors) are malignant diseases of the blood system, which are characterized by high-grade malignancy and differentiation disorders, including acute and chronic leukemia and lymphoma. Chronic myelocytic leukemia (CML) is a malignant myeloproliferative neoplasm that occurs on pluripotent hematopoietic stem cells. It is characterized by the production of a large number of immature white blood cells, which accumulate in the bone marrow, inhibit the normal hematopoietic function of the bone marrow, and can spread throughout the body through the blood, resulting in anemia, easy bleeding, infection, and organ infiltration in patients. Currently, the treatment methods for leukemia mainly include chemotherapy, local radiotherapy, targeted therapy, traditional Chinese medicine therapy, and bone marrow transplantation. Therefore, there is an urgent need for new active ingredients and new drugs that can effectively treat/prevent hematological tumors/leukemia clinically.

Natural killer cells (Natural Killer cells, NK cells) are derived from bone marrow lymphoid stem cells and are mainly distributed in tissues and organs such as bone marrow, peripheral blood, liver, spleen, lung and lymph nodes. NK cells are different from T cells and B cells, and are a type of lymphocytes that can non-specifically kill tumor cells and virus-infected cells without prior sensitization. NK-92 is a human-derived NK cell line whose growth and proliferation depend on IL-2, and NK-92MI is an IL-2-independent NK cell line derived from NK-92 cell line and obtained through gene transfection. The two human-derived NK cell lines can achieve stable, large-scale, and long-term expansion conveniently and economically, and have been proven to be cytotoxic to many malignant tumors. Extracellular vesicles (EVs) are a general term for various vesicles with membrane structures released by cells. Scientists first isolated extracellular vesicles carrying parental cell components from sheep reticulocytes in 1983, and extracellular vesicles were subsequently discovered and reported in body fluids such as blood, urine, amniotic fluid, and saliva. Extracellular vesicles usually carry important biologically active substances in the mother cell, such as proteins, mRNA, miRNA, and lipids, which can regulate cell functions and participate in intercellular communication by binding to target cells.

The present invention utilizes two human NK cell strains NK-92 and NK-92MI as sources for obtaining extracellular vesicles secreted by NK cells.

Contents of the invention

In view of the above-mentioned background technology, the object of the present invention is to provide a method for obtaining the active ingredient and its use in the preparation of a medicine for treating/preventing leukemia.

After research, the present invention provides the following technical solution: a method for obtaining active ingredients for preparing anti-hematological tumor drugs, comprising:

1) Analyze the differential expression of the following 8 groups of miRNAs, and screen out the miRNAs with significant multiples of difference or high average expression levels; the 8 groups of miRNAs are: miRNAs expressed by NK-92, miRNAs expressed by NK-92 MI, miRNA expressed in vesicle LEV, miRNA expressed in NK-92 extracellular vesicle SEV, miRNA expressed in NK-92 extracellular vesicle EXO, miRNA expressed in NK-92 MI extracellular vesicle LEV, NK-92 MI extracellular miRNA expressed by vesicle SEV, miRNA expressed by NK-92 MI extracellular vesicle EXO.

2) The miRNAs screened in step 1 are sorted based on the difference multiple or average expression level, and the active miR-X with high difference multiple or high average expression level is screened out.

Further, the present invention provides methods for obtaining the above-mentioned extracellular vesicles LEV, SEV and EXO of NK-92, and the extracellular vesicles LEV, SEV and EXO of NK-92MI, specifically:

(1) Collect the culture medium of NK-92 or NK-92MI cells cultured for 24-48 hours into a 50mL centrifuge tube, and centrifuge at 400g for 10min at 4°C to remove dead cells and collect the upper solution; Centrifuge at a centrifugal force of 2000 g for 20 min to further remove dead cells and cell debris, and collect the supernatant.

(2) The supernatant collected in step (1) was centrifuged at 4° C. for 30 min at a centrifugal force of 10,000 g to obtain a precipitate as LEV, and the supernatant was collected. Add 40 mL of phosphate buffered saline (PBS) to the centrifuge tube containing the precipitate, wash 1-2 times (4°C, centrifuge at 10,000 g for 30 min), and store the obtained LEV at -80°C.

(3) Transfer the supernatant obtained in step (2) to an ultracentrifuge tube, centrifuge at 110,000 g for 70 min at 4°C, and the precipitate is EXO. Use PBS to centrifuge at 110,000 g for 70 min at 4°C For washing, wash the precipitate 1-2 times, and finally mix it with 50 μL PBS, and store the obtained EXO at -80 °C.

(4) Centrifuge the supernatant obtained in step (3) with a centrifugal force of 167,200g for 16 hours at 4°C, and the precipitate is SEV. The obtained precipitate is washed with PBS at a centrifugal force of 167,200g for 4 hours at 4°C, and the precipitate is washed for 2- 3 times, finally mixed with 50 μL PBS, and stored the obtained SEV at -80 °C.

Based on the above method at least the following active ingredients can be obtained:

(a) miR-X whose sequence is shown in any one of SEQ ID NO.1 to SEQ ID NO.6, or a modified miR-X derivative;

SEQ ID NO.1(bta-miR-2478-L-2): ATCCCACTTCTGACACCA;

SEQ ID NO.2(hsa-miR-1260a): ATCCCACCTCTGCCACCA;

SEQ ID NO.3(hsa-miR-197-3p):TTCACCACCTTCTCCACCCAGC;

SEQ ID NO.4(hsa-miR-296-5p): AGGGCCCCCCCTCAATCCTGT;

SEQ ID NO.5(hsa-miR-339-5p): TCCCTGTCCTCCAGGAGCTCACG;

SEQ ID NO.6(hsa-miR-223-3p):TGTCAGTTTGTCAAATACCCCA

(b) precursor miRNA, which can be processed into miR-X described in (a) in the host;

(c) a polynucleotide, which can be transcribed by the host to form the precursor miRNA described in (b), and processed to form the microRNA described in (a);

(d) an expression vector, which contains the microRNA of miR-X described in (a), or the precursor miRNA described in (b), or the polynucleotide described in (c);

(e) an agonist of the microRNA described in (a).

Specifically, the agonist in (e) is selected from the group consisting of substances that promote the expression of miR-X and substances that increase the activity of miR-X.

The present invention also provides the use of the above-mentioned active ingredient, the active ingredient is used for preparing a medicine, and the medicine is used for treating/preventing hematological tumors.

The present invention also provides a pharmaceutical composition, which contains the above active ingredients and a pharmaceutically acceptable carrier.

Specifically, the preparation form of the pharmaceutical composition is freeze-dried powder injection, microneedle, injection, tablet, patch, capsule, oral suspension, or microspheres for interventional embolization.

Specifically, the delivery methods of the pharmaceutical composition include: transshipment method, drug loading method, direct naked RNA injection method, liposome-encapsulated RNA direct injection method, nanomaterial assembly method and other cationic material complex delivery methods, and bacteria carrying plasmids Delivery methods such as expression RNA method, viral packaging expression RNA method, etc.

The beneficial effect of the present invention is that: the present invention for the first time performs tertiary separation on extracellular vesicles secreted by NK-92 cells and NK-92MI cells, and obtains two groups of extracellular vesicles including three sizes of large, medium and small, and then uses NK- The miRNA sequences of 92 cells and NK-92MI cells and the miRNA sequences of two groups of extracellular vesicles were screened for activity, and active miRNAs with strong lethality to hematological tumor cells were obtained. The active miRNAs obtained by the present invention can participate in the regulation of gene expression, and have certain advantages in the treatment/prevention of hematological tumors; these active miRNAs may regulate the early development of immune cells and affect the development and differentiation of immune cells; active miRNAs may participate in immune function The regulation of , has therapeutic/preventive effects on hematological malignancies. The active miRNA proposed by the invention has high transfection efficiency in the liposome, and the anti-tumor effect after transfection is remarkable.

Description of drawings

Figure 1 Flowchart for the extraction of extracellular vesicles of different sizes from two cell lines, NK-92 and NK-92MI;

Figure 2. Electron micrographs of extracellular vesicles of different sizes secreted by NK-92 and NK-92MI cell lines;

Figure 3. The particle size diagram of extracellular vesicles of different sizes secreted by NK-92 and NK-92MI cell lines;

Figure 4. Anti-hematological tumor effects of NK-92 and NK-92MI cell lines;

Figure 5. miRNA bioinformatics analysis chart of NK-92 and NK-92MI cell lines;

Fig. 6 Anti-hematological tumor effects of extracellular vesicles of different sizes secreted by NK-92 and NK-92MI cell lines;

Figure 7 Bioinformatics analysis of extracellular vesicles with different sizes secreted by NK-92 and NK-92MI cell lines;

Figure 8 active miRNA-X mimics (mimic) and miRNA-X inhibitors (inhibitor) transfection effect diagram;

Fig. 9 Effect diagram of anti-hematological tumor after transfection of active miRNA-X mimics (mimics) and miRNA-X inhibitors (inhibitors).

Detailed ways

Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The experimental methods for which specific conditions are not indicated in the preferred embodiments are usually carried out according to conventional conditions, or according to the conditions suggested by the reagent manufacturer.

Example 1. Active miRNA-X screening

In this example, the cell lines used are all human-derived cell lines, all of which were purchased from the National Collection of Authenticated Cell Cultures (National Collection of Authenticated Cell Cultures, National Model and Characteristic Experimental Cell Resource Bank).

The culture medium composition used by the human immune cell line NK-92 is: MEM-α (Hyclone, UT, USA) supplemented with 12.5% horse serum (Gibco, CA, USA) and 12.5% fetal bovine serum (Gibco, CA, USA) ), and 0.2mM inositol (Sigma, DA, DE), 0.1mM β-mercaptoethanol (Sigma, DA, DE), 0.02mM folic acid (Sigma, DA, DE) and 200U/mL recombinant IL-2 (Novoprotein, SHH, CN).

The composition of the culture solution of the human immune cell line NK-92MI is similar to that of the above-mentioned NK-92 cell line, but does not contain recombinant IL-2.

Human leukemia cell line K562 was cultured in RPMI-1640 medium (Gibco, CA, USA) containing 10% normal fetal bovine serum and 1% penicillin-streptomycin (Yeasen, SHH, CN).

All cell lines were cultured in a cell culture incubator (Thermo Fisher Scientific, MA, USA) maintained at 37°C, containing 5% CO ₂ and a humid environment.

1.1 Isolation, acquisition and purification of extracellular vesicles (EVs)

Preparation of exosome-free culture medium: After mixing serum (containing 1:1 mixed horse serum and fetal bovine serum) and MEM-α culture medium at a volume ratio of 1:4, evenly distribute them into ultracentrifuge tubes (specifications: 25×89mm) and leveled, put the ultracentrifuge tube into an ultracentrifuge and centrifuge at 120,000g for 16h at 4°C (ultracentrifuge rotor: SW32 Ti, Beckman, CA, USA), and the supernatant collected after centrifugation The supernatant is the culture medium without exosomes.

NK-92 and NK-92MI cell lines were cultured in the above-mentioned exosome-free culture medium (EVs-free culture medium) for 2-3 days, and then the following three experimental operations were performed to obtain extracellular vesicles respectively LEV (Large Extracellular Vesicle), EXO (Exosome) and SEV (Small Extracellular Vesicle).

1.1.1 Isolation and acquisition of extracellular vesicles LEV: ①Collect the culture fluid of the two cell lines after 2-3 days of culture, centrifuge at 4°C for 10min with a centrifugal force of 400g, and collect the supernatant; ②Put the supernatant in Centrifuge at a centrifugal force of 2000g for 20min at 4°C, discard the precipitate at the bottom (the precipitate is cells and debris), and collect the supernatant; ③Centrifuge the obtained supernatant at 10000g for 30min at 4°C, and then centrifuge to obtain The precipitates were washed with phosphate buffered saline (PBS) at 4°C with a centrifugal force of 10,000g for 30 min to wash the precipitates. The final precipitates were LEVs derived from two immune cell lines, namely NK-92 LEV and NK-92MI LEV (Figure 2A, D; Figure 3A, D); ④ Use 50-100 μL PBS to gently pipette, dissolve and mix the LEV precipitate, and store at -80 °C.

1.1.2 Isolation and acquisition of extracellular vesicles EXO: ①Use a sterile filter with a diameter of 0.22 μm to centrifuge the supernatant obtained in 1.1.1. Filter and collect the filtered liquid separately; ② Centrifuge the collected liquid after filtration at 4°C with a centrifugal force of 110,000g for 70min (ultra-centrifugal rotor: SW32 Ti), and collect the precipitate obtained separately; ③ Wash the obtained precipitate with PBS Re-wash the suspension, centrifuge and wash with a centrifugal force of 110,000g at 4°C for 70 minutes, and repeat the experimental operation of PBS resuspension and washing 1-2 times, and finally obtain the precipitate as EXO derived from two immune cell lines, namely NK- 92 EXO and NK-92MI EXO (as shown in Figure 2B, E; Figure 3B, E); ④ Gently pipette, dissolve and mix the EXO precipitate with 50-100 μL PBS respectively, and store at -80 °C.

1.1.3 Separation and acquisition of extracellular vesicles SEV: ① Centrifuge the liquid collected after filtration in 1.1.2. Experimental operation ① at 4°C with a centrifugal force of 110,000g for 70min, and collect the precipitate in 1.1.2. Experimental operation ② for While separating and obtaining extracellular vesicles EXO, the supernatants were collected separately; ②The obtained supernatants were centrifuged at 167000g for 16 hours at 4°C, and the obtained precipitates were collected; ③The obtained precipitates were respectively used Re-wash the suspension with PBS, centrifuge and wash at 4°C with a centrifugal force of 167,000g for 4 hours, and repeat the experimental operation of PBS re-suspension and washing for 2-3 times, and finally obtain the precipitate as SEV derived from two immune cell lines, namely NK -92 SEV and NK-92MI SEV (as shown in Figure 2C, F; Figure 3C, F); ④ Gently pipette, dissolve and mix the EXO precipitate with 50-100 μL PBS, respectively, and store at -80 °C.

The process summary of the separation and acquisition of the above different types of extracellular vesicles is shown in Figure 1, and the transmission electron microscope and particle size characterization of the obtained extracellular vesicles are shown in Figure 2 and Figure 3, respectively.

After the above-mentioned experimental method was used to separate and obtain two groups of extracellular vesicles, a total of 6 kinds of extracellular vesicles, the RNA adsorbed on the vesicle surface was further removed by the following experimental procedure: the obtained EVs were resuspended in PBS, and an appropriate amount of RNase ( RNase A, Ambion, TX, USA), so that the final concentration of RNase A was 1U/mL, and then various extracellular vesicle solutions containing RNase A were incubated in a 37°C water bath (JingHong, SHH, CN) for 20min. The experimental steps follow the guidelines of the International Society for Extracellular Vesicles (ISEV).

1.2 miRNA sequencing and bioinformatics analysis of human cell lines NK-92 and NK-92MI and their secreted extracellular vesicles

1.2.1 miRNA sequencing of NK-92 and NK-92MI cell lines

We used Total RNA Purification Kit (Norgen Biotek Corp, Thorold, ON, Canada) to extract total RNA (including all miRNA and small molecule RNA) of NK-92 and NK-92MI cultured cell samples; Bioanalyzer 2100 (Agilent, CA , USA) to analyze the quality and quantity of the obtained RNA, and ensure the RIN value>7.0; respectively take 1 μg total RNA from the RNA samples extracted from the two cell lines, and use the TruSeq small molecule RNA sample preparation kit (Illumina, SD, USA ) to prepare a small molecule RNA library; according to the instructions provided by the manufacturer of Illumina HiSeq 2500 (Hanyu, SHH, China), entrusted Lianchuan Biological Co., Ltd. (LC Sciences, HZ, CN) to analyze the miRNAs in the above two cell line samples 50bp single-end sequencing was carried out respectively.

1.2.2 miRNA sequencing of two sets of extracellular vesicles

In order to remove the RNase added in 1.1 and simultaneously purify the extracellular vesicles, we followed the steps of obtaining and purifying the corresponding extracellular vesicles in 1.1 to perform ultracentrifugation and washing again; the same method as in 1.2.1 was used to extract various Total RNA of extracellular vesicles, preparation of small molecule RNA libraries, and 50bp single-end sequencing of miRNAs in various extracellular vesicle samples.

1.2.3 Bioinformatics analysis of miRNA sequencing results

First, using ACGT101-miR analysis software (LC Sciences, TX, USA) to perform bioinformatics analysis on the miRNA sequencing data of human cell lines and their secreted extracellular vesicles. The main analysis process of the software is as follows: clean reads are obtained after quality control treatment of the original data, the 3' linker is removed from the clean reads and length screening is performed, and sequences with a base length of 18-26 nt are retained; then the remaining sequences are compared with the RNA database Sequences are compared, such as mRNA database, RFam database (including rRNA, tRNA, snRNA, snoRNA, etc.) and Repbase database (repeated sequence database), and filtered.

Secondly, based on the sequencing data and bioinformatics analysis software, miRNAs with potentially important biological functions were screened. Main screening methods and procedures: ①Based on DESeq2 (V 1.26.0) (R language software package), the differential expression analysis was performed on the miRNA sequencing results of the two cell lines and the miRNA sequencing results of the extracellular vesicles of the two groups, and the The miRNAs with log ₂ Fold Change>1.25 and statistical analysis p-value<0.05 were regarded as differentially expressed miRNAs and clustered, and 15 high-expression and significant differences were screened out from the sequencing data of the two cell lines (NK92 compared with NK92 -MI was significantly down-regulated) miRNAs (Figure 5 and Table 1), and 50 miRNAs with high co-expression levels (Figure 7 and Table 2) were screened out from the sequencing data of extracellular vesicles; ②Based on the functional miRNAs should Assuming that there is an advantage in the expression level, the average expression levels of miRNAs in cell lines and extracellular vesicles are calculated separately, and the above-mentioned differentially expressed miRNAs are sorted based on the average expression levels; Finally, 4 target miRNAs whose expression in NK-92MI was significantly higher than that of NK-92 were selected from the miRNAs obtained from the preliminary screening of the above 15 cell lines (we first found that NK-92MI cells The anti-hematological tumor effect of the strain is better than that of the NK-92 cell line, the results are shown in Figure 4, analyzed with GraphPad Prism software One-way ANOVA; ^* , P<0.05), including 1 unknown miRNA (bta-miR-2478_L- 2) (the most obvious fold difference) and 3 known miRNAs (hsa-miR-1260a, hsa-miR-197-3p, hsa-miR-296-5p) (Figure 5). At the same time, 2 target miRNAs whose expression in EXO was significantly higher than that of LEV and SEV were selected from the miRNAs obtained from the preliminary screening of the above 50 extracellular vesicle miRNAs (we first found through experimental research that EXO's anti-blood tumor effect was significantly better than that of LEV and SEV, the results shown in Figure 6, were analyzed with GraphPad Prism software One-way ANOVA; ^* , P<0.05, ^** , P<0.01, ^*** , P<0.001), including the known hsa-miR- 339-5p and hsa-miR-223-3p (Figure 7).

The above 6 target miRNAs are the active miRNAs described in this application, and are marked as miRNA-X.

Table 1 Sequencing results of the first 15 miRNAs whose expression levels changed significantly between NK-92/NK-92MI two cell lines

Table 2 Sequencing results of 50 miRNAs with high EVs co-expression in NK-92/NK-92MI

Example 2. Active miRNA-X expression vector construction

We expressed the above miRNA-X in Lipofectamine 3000 liposomes.

First, the initial amount of miRNA mimic is 5 nmol, add 250 μL of RNA-free water to dilute to a 20 μM stock solution, divide into 5 tubes, and store at -20°C.

Secondly, the experimental concentration of miRNA mimic and mimic control is set to 50nM, and the operation is as follows:

① Add 5 μL miRNA-X mimic and mimic control to 95 μL opti-MEM respectively;

② Add 3 μL Lipofectamine 3000 to 97 μL opti-MEM, and let stand for 5 minutes after the addition.

Finally, add ① to ②, gently pipette and let stand for 15 minutes to obtain Lipofectamine 3000 liposomes expressing miRNA-X.

The miRNA-X expression vector constructed above is actually a representative dosage form for miRNA application, which provides a way of thinking for the subsequent preparation of various drugs based on active miRNA-X. Subsequently, liposome drugs containing the above-mentioned active miRNA-X and its activator/inhibitor can be prepared, and the administration method is external application or injection.

Example 3. Active miRNA-X transfection efficiency test

In order to verify the transfection efficiency of the six miRNA-Xs screened in Example 1 in hematological tumor cells, we conducted an in vitro transfection experiment. First, the miRNA-X mimics (Ribo Life Science, JS, CN) identical to the 6 active miRNA-Xs screened in Example 1 were used to co-incubate with the human leukemia cell line K562, and the specific experimental steps were as follows:

① Inoculation of K562 cells: inoculate 1×10 ⁵ -5×10 ⁵ cells/well of K562 cells in the logarithmic growth phase into 6-well plates.

② Add the Lipofectamine 3000 liposome expressing miRNA-X obtained in Example 2 into K562 cells.

③ Change the medium 12 hours after transfection, collect K562 cells after continuing to culture for 48 hours, and use RT-PCR to detect the transfection efficiency.

The expression levels of active miRNA-X in K562 leukemia cells were detected by RT-PCR experiments, and we confirmed that after transfection of miRNA-X mimics, the expression levels of six miRNA-Xs were significantly increased (Figure 8).

In order to further verify the transfection efficiency of the 6 miRNA-X inhibitors screened in Example 1, we co-incubated the corresponding 6 miRNA-X inhibitors (Ribo Life Science, JS, CN) with the human leukemia cell line K562, specifically The experimental steps are as follows: K562 cells in the logarithmic growth phase are inoculated into 6-well plates at 1×10 ⁵ to 5×10 ⁵ cells/well; the initial amount of miRNA-X inhibitors is 5 nmol, and 250 μL of RNA-free water is added Diluted to 20 μM stock solution, divided into 5 tubes, and stored at -20°C. Set the concentration of miRNA-X inhibitor and inhibitor control to 100nM, and the specific operation is as follows: ①Take 10μL of miRNA-X inhibitor and inhibitor control, and add them to 90μL opti-MEM; ②Take 6μL Lipofectamine 3000 and add them to 94μL opti-MEM , after adding, let stand for 5min. Then add ① to ②, gently pipet and let stand for 15 minutes, and then add to K562 cells. The medium was changed 12 hours after transfection, and the K562 cells were collected after continuing to culture for 48 hours, and the transfection efficiency was detected by RT-PCR experiment.

The expression levels of active miRNA-X in K562 leukemia cells were detected by RT-PCR experiments, and we confirmed that after transfection with miRNA-X inhibitor, the expression levels of six miRNA-Xs were significantly decreased (Figure 8).

From the above miRNA-X mimics and inhibitors transfection experiments, it can be known that the miRNA-X obtained by our screening was successfully transfected into hematological tumor cells with the help of the carrier system constructed by the above method, and the expression of miRNA-X in the tumor cells was respectively produced. In line with expectations, the ideal moderating effect.

Example 4. Anti-hematological tumor activity test of active miRNA-X

In order to further verify that miRNA-X has anti-hematological tumor effects, we co-incubated active miRNA-X mimics/inhibitors with K562 human leukemia cell line. The specific experimental steps are:

The miRNA-X mimics/inhibitors were transfected into K562 human leukemia cells, the transfection steps were as described in Example 3; after 12 hours of transfection, the medium of the transfection system was changed, and 3-(4,5- Dimethylthiazole-2)-2,5-diphenyltetrazolium bromide (abbreviated as MTT, Sigma, DA, DE) to detect the survival rate of K562 cells and to evaluate the effect of miRNA-X mimics/inhibitors on K562 cells antitumor effect.

The experimental results show that the six miRNA-X mimics have significantly inhibited the proliferation of K562 leukemia tumor cells, while the miRNA-X inhibitors have no effect on the proliferation of K562 tumor cells (Figure 9, using GraphPad Prism software One-way ANOVA analyzed. ^** , P<0.01; ^*** , P<0.001.).

It can be seen that overexpressing any one of the six miRNA-Xs can significantly inhibit the proliferation of hematological tumor cells and play an anti-hematologic tumor effect. Those skilled in the art can foresee that the active ingredients developed based on the six miRNA-X can also significantly inhibit the proliferation of hematological tumor cells and play an anti-hematologic tumor effect, including but not limited to: ①miR-X modified by miR-X Derivatives; ② can be processed into the precursor miRNA of the aforementioned 6 miR-X in the host; ③ can be transcribed by the host to form the polynucleotide of the precursor miRNA described in ②; ④ contain miR-X or described in ① The expression vector of miR-X derivatives, or the expression vector of the precursor miRNA described in ②, or the expression vector of the polynucleotide described in ③ (as in Example 2); ⑤ Promote miR-X expression and/or increase Agonist of miR-X activity.

Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that it can be described in terms of form and Various changes may be made in the details without departing from the scope of the invention defined by the claims.

Claims (8)

1. A method for obtaining an active ingredient of a drug for treating/preventing hematological tumors, characterized by comprising:

   1) The following 8 groups of miRNAs were analyzed for differential expression, and miRNAs with high expression levels and significant differences were screened out; the 8 groups of miRNAs were: miRNAs expressed in NK-92 cells, miRNAs expressed in NK-92 MI cells, miRNA expressed in vesicle LEV (Large Extracellular Vesicle), miRNA expressed in NK-92 extracellular vesicle EXO (Exosome), miRNA expressed in NK-92 extracellular vesicle SEV (Small Extracellular Vesicle), NK-92 MI extracellular miRNA expressed by vesicle LEV, miRNA expressed by NK-92 MI extracellular vesicle EXO, miRNA expressed by NK-92 MI extracellular vesicle SEV;

   2) The miRNAs screened in step 1 are sorted based on the multiple of difference or the level of average expression, and the active miRNA-X with high multiple of difference or high average expression is screened out.
2. The method according to claim 1, wherein the NK-92/NK-92MI extracellular vesicles LEV, SEV and EXO are obtained by the following method:

   (1) Collect the culture medium of NK-92/NK-92MI cells cultured for 24-48 hours into a 50mL centrifuge tube, centrifuge to remove dead cells and cell debris, and collect the supernatant.

   (2) The supernatant collected in step (1) was centrifuged at 4° C. for 30 min at a centrifugal force of 10,000 g to obtain a precipitate as LEV, and the supernatant was collected.

   (3) Transfer the supernatant obtained in step (2) to an ultracentrifuge tube, and centrifuge at a centrifugal force of 110,000 g for 70 min at 4°C to obtain precipitated EXO, and collect the supernatant.

   (4) The supernatant obtained in step (3) was centrifuged at 4° C. with a centrifugal force of 167,200 g for 16 hours to obtain precipitated SEV.
3. An active ingredient of a drug for treating/preventing blood tumors, characterized in that the active ingredient is selected from at least one of the following:

   (a) miR-X whose sequence is shown in any one of SEQ ID NO.1 to SEQ ID NO.6, or a modified miR-X derivative;

   (b) precursor miRNA, which can be processed into miR-X described in (a) in the host;

   (c) a polynucleotide, which can be transcribed by the host to form the precursor miRNA described in (b), and processed to form the miRNA described in (a);

   (d) an expression vector containing the miRNA of miR-X described in (a), or the precursor miRNA described in (b), or the polynucleotide described in (c);

   (e) an agonist of the miRNA described in (a).
4. The active ingredient according to claim 3, wherein the agonist in (e) is selected from the group consisting of substances that promote the expression of miR-X and substances that increase the activity of miR-X.
5. The use of the active ingredient according to claim 3, the active ingredient is used for preparing a medicine, and the medicine is used for treating/preventing blood tumors.
6. A pharmaceutical composition, characterized in that the pharmaceutical composition contains the active ingredient according to claim 3, and a pharmaceutically acceptable vehicle or carrier.
7. The composition according to claim 6, wherein the preparation form of the pharmaceutical composition is freeze-dried powder injection, microneedle, injection, tablet, patch, capsule, oral suspension or interventional embolism. microspheres etc.
8. The composition according to claim 6, wherein the delivery methods of the pharmaceutical composition include: reprinting method, drug loading method, direct naked RNA injection method, liposome-encapsulated RNA direct injection method and nanomaterial assembly method Delivery methods such as cationic material complexes, as well as delivery methods such as bacteria carrying plasmid expression RNA methods, virus packaging expression RNA methods, etc.

Images