WO2024000092A1

WO2024000092A1 - Active component of anti-oral cancer drug and use thereof

Info

Publication number: WO2024000092A1
Application number: PCT/CN2022/101408
Authority: WO
Inventors: 隋梅花; 陈宇; 陆欢; 李晨; 吴昊
Original assignee: 浙江大学
Priority date: 2022-06-27
Filing date: 2022-06-27
Publication date: 2024-01-04

Abstract

Provided are an active component of a drug for treating/preventing oral cancer and a use thereof. The active component is miRNA-X as represented by SEQ ID NOs. 1-6, a combination thereof, a derivative thereof, or the like. The active component can be involved in regulating gene expression, and has the effect of treating/preventing oral cancer. These active miRNAs may regulate the early development of immune cells and affect the development and differentiation of immune cells, may be involved in regulating the immune function, and has a treatment/prevention effect on oral cancer, high transfection efficiency in liposomes, and a remarkable anti-cancer effect after being transfected.

Description

Active ingredients of anti-oral tumor drugs and their uses

Technical field

The invention belongs to the field of medical technology and relates to the use of relevant active ingredients in preparing drugs for the treatment/prevention of oral tumors.

Background technique

Oral cancer (Oral Cancer) is a relatively common malignant tumor that seriously threatens health and quality of life, and is highly prevalent in Asia. According to statistics made by GLOBOCAN in 2020, there were 37,713 new cases of oral cancer worldwide, of which 65.8% were in Asia. The global mortality rate of oral cancer patients in 2020 was 177,757 cases, of which Asia accounted for 74%. Treatment of oral tumors mainly includes surgical resection, radiation therapy, chemotherapy or a combination of several anti-cancer therapies. In recent years, although oral cancer has made great progress in imaging diagnosis, surgical technology, radiotherapy, chemotherapy, and systemic therapy, the 5-year survival rate of oral cancer patients is still not ideal. Of particular concern is the failure to improve survival rates from oral cancer over the past three decades. One of the main reasons is that the first-line chemotherapy drugs used to treat oral tumors will induce drug resistance in the tumors. Drug-resistant oral tumors are not only more resistant to anti-cancer treatments, but also have higher risk of proliferation and invasion. The ability also increases, causing cancer lesions to infiltrate into adjacent tissues and even metastasize to distant sites. Multi-drug combinations are often used clinically to overcome the resistance of tumor cells to a single drug. However, the emergence of tumor multidrug resistance significantly weakens the benefits of combination treatment strategies. Therefore, it is crucial to find new active ingredients with anti-oral tumor effects and develop new drugs for the clinical treatment of oral tumors and patient prognosis. As one of the candidate drug types for the treatment of various human diseases, including tumors, miRNA is a type of endogenous small RNA with a length of about 20-24 nucleotides, which has a variety of important regulations in the human body. The use of miRNA alone and in combination therapy is expected to alleviate or overcome the drug resistance problem of difficult tumors. There have been relevant clinical studies, but they are limited to a small number of cancer types such as lymphoma and melanoma.

Natural killer cells (NK cells) are derived from bone marrow lymphoid stem cells and can induce cytolytic activity of virus-infected cells and tumor cells (without prior sensitization or activation). NK-92 is a human NK cell line whose growth and proliferation are dependent on IL-2. NK-92MI is an IL-2-independent NK cell line derived from the NK-92 cell line and obtained by gene transfection. Two human NK cell lines can achieve stable, large-scale, and long-term expansion conveniently and economically, and have been proven to be cytotoxic to many malignant tumors.

Extracellular Vesicles (EVs) are a general term for various vesicles with membrane structures released by cells. Scientists first isolated extracellular vesicles carrying parent cell components from sheep reticulocytes in 1983, and they are widely found in body fluids. Because exosomes carry important biological molecules such as nucleic acids and lipids, they have great clinical application potential in the early diagnosis, prognosis and treatment of cancer. In addition, exosomes serve as drug delivery vehicles for the transfer of miRNA and therapeutic agents to target cells. Compared with synthetic carriers, these nanovesicles have higher safety and stability, which provides opportunities for targeted drug delivery in cancer treatment. possible.

The present invention utilizes two human NK cell lines, NK-92 and NK-92MI, as sources of extracellular vesicles secreted by NK cells.

Contents of the invention

In view of the above background technology, the object of the present invention is to provide an active ingredient and its use in preparing drugs for treating/preventing oral tumors.

After research, the present invention provides the following technical solution: an active ingredient for preparing anti-oral tumor drugs, selected from one of the following:

(a) miRNA-X whose sequence is shown in any one of SEQ ID NO. 1 to SEQ ID NO. 6, or any combination of said miRNA-X, or modified miRNA-X derivatives;

SEQ ID NO.1(bta-miR-2478-L-2):ATCCCACTTCTGACACCA;

SEQ ID NO.2(hsa-miR-1260a):ATCCCACCTCTGCCACCA;

SEQ ID NO.3(hsa-miR-197-3p):TTCACCACCTTCTCCACCCAGC;

SEQ ID NO.4(hsa-miR-296-5p):AGGGCCCCCCCTCAATCCTGT;

SEQ ID NO.5(hsa-miR-339-5p):TCCCTGTCCTCCAGGAGCTCACG;

SEQ ID NO.6(hsa-miR-223-3p):TGTCAGTTTGTCAAATACCCCA

(b) Precursor miRNA, which can be processed in the host into the miRNA-X described in (a);

(c) polynucleotide, which can be transcribed by the host to form the precursor miRNA described in (b) and processed to form the microRNA described in (a);

(d) an expression vector containing the microRNA of miRNA-X described in (a), or the precursor miRNA described in (b), or the polynucleotide described in (c);

(e) An agonist of the microRNA described in (a).

Experimental studies have found that the combined use of miRNA-X shown in SEQ ID NO.1 and SEQ ID NO.3 has a more significant inhibitory effect on oral tumor cells:

Specifically, the agonist is selected from the following group: substances that promote the expression of miRNA-X and substances that increase the activity of miRNA-X.

The present invention also provides the use of the above-mentioned active ingredient. The active ingredient is used to prepare a medicine. The medicine is used to treat/prevent oral tumors. The medicine may also contain the above-mentioned active ingredients and pharmaceutically acceptable carriers.

Specifically, the preparation form of the drug is freeze-dried powder injection, microneedle, injection, tablet, patch, capsule, oral suspension, or microspheres for interventional embolization.

Specifically, the drug delivery methods include: reprinting method, drug loading method, direct naked RNA injection method, liposome wrapped RNA direct injection method, nanomaterial assembly method and other cationic material complex delivery methods, as well as bacterial-carrying plasmid expression RNA method, virus packaging expression RNA method and other delivery methods.

The beneficial effects of the present invention are: for the first time, the present invention performs three-stage separation of extracellular vesicles secreted by NK-92 cells and NK-92MI cells, and obtains two groups of extracellular vesicles including large, medium and small sizes, and then uses NK- A large sample consisting of the miRNA sequences of 92 cells, NK-92MI cells and the miRNA sequences of two groups of extracellular vesicles was screened for activity, and active miRNAs with strong killing effect on oral tumor cells were obtained. The active miRNA obtained by the present invention can participate in regulating the expression of genes and has certain advantages in the treatment/prevention of oral tumors, especially when SEQ ID NO.1 and SEQ ID NO.3 are used in combination, the advantages are more significant; these active miRNAs It may regulate the early development of immune cells and affect the development and differentiation of immune cells; active miRNA may participate in the regulation of immune function and have a therapeutic/preventive effect on oral tumors. The active miRNA proposed by the present invention has high transfection efficiency in liposomes and has significant anti-tumor effect after transfection.

Description of drawings

Figure 1 Flowchart of extracting extracellular vesicles of different sizes from two cell lines, NK-92 and NK-92MI;

Figure 2 Electron microscopy images of extracellular vesicles of different sizes secreted by NK-92 and NK-92MI cell lines;

Figure 3 Particle size diagram of extracellular vesicles of different sizes secreted by NK-92 and NK-92MI cell lines;

Figure 4 Picture of the anti-oral tumor effects of NK-92 and NK-92MI cell lines;

Figure 5 miRNA biosignature analysis chart of NK-92 and NK-92MI cell lines;

Figure 6 The effect of extracellular vesicles of different sizes secreted by NK-92 and NK-92MI cell lines against oral tumors;

Figure 7. Analysis of miRNA biosynthesis of extracellular vesicles of different sizes secreted by NK-92 and NK-92MI cell lines respectively;

Figure 8 Transfection effect diagram of active miRNA-X mimics (mimics) and miRNA-X inhibitors (inhibitors);

Figure 9 shows the anti-oral tumor effects after transfection of active miRNA-X mimics (mimics) and miRNA-X inhibitors (inhibitors);

Figure 10 shows the anti-oral tumor effects after combined transfection with active miRNA-X mimics.

Detailed ways

The preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings. Experimental methods without specifying specific conditions in the preferred embodiments are usually carried out according to conventional conditions or according to the conditions recommended by the reagent manufacturer.

Example 1. Screening of active miRNA-X

In this example, the cell lines used were all human cell lines, all purchased from the National Collection of Authenticated Cell Cultures, National Model and Characteristic Experimental Cell Resource Bank, Chinese Academy of Sciences.

The culture medium components used for the human immune cell line NK-92 are: MEM-α (Hyclone, UT, USA) supplemented with 12.5% horse serum (Gibco, CA, USA) and 12.5% fetal calf serum (Gibco, CA, USA) ), and 0.2mM myo-inositol (Sigma, DA, DE), 0.1mM β-mercaptoethanol (Sigma, DA, DE), 0.02mM folic acid (Sigma, DA, DE) and 200U/mL recombinant IL-2 (Novoprotein, SHH, CN).

The composition of the culture medium of the human immune cell line NK-92MI is similar to that of the above-mentioned NK-92 cell line, but does not contain recombinant IL-2.

Human oral tumor cell line KB was cultured in DMEM medium (Gibco, CA, USA) containing 10% normal fetal calf serum and 1% penicillin-streptomycin (Yeasen, SHH, CN).

All cell lines were cultured in a cell culture incubator (Thermo Fisher Scientific, MA, USA) maintained at 37°C, containing 5% _CO2 and in a humidified environment.

1.1 Isolation, acquisition and purification of extracellular vesicles (EVs)

Preparation of exosome-free culture medium: Mix serum (containing a 1:1 mixture of horse serum and fetal calf serum) and MEM-α culture medium at a volume ratio of 1:4, and distribute evenly into ultracentrifuge tubes (specifications: 25×89mm) and balanced, put the ultracentrifuge tube into an ultracentrifuge and centrifuge at 120000 g for 16 hours at 4°C (ultracentrifuge rotor: SW32Ti, Beckman, CA, USA), and collect the supernatant after centrifugation The liquid is the culture medium without exosomes.

NK-92 and NK-92MI cell lines were cultured in the above-mentioned exosome-free culture medium (EVs-free culture medium) for 2-3 days respectively, and then the following three parts of experimental operations were performed to obtain extracellular vesicles respectively. LEV (Large Extracellular Vesicle), extracellular vesicle EXO (Exosome) and extracellular vesicle SEV (Small Extracellular Vesicle).

1.1.1 Isolation and acquisition of extracellular vesicles LEV: ① Collect the culture medium of the two cell lines after 2-3 days of culture, centrifuge at 4°C with a centrifugal force of 400g for 10 minutes, and collect the supernatant; ② Place the supernatant in Centrifuge at 2000g for 20 minutes at 4°C, discard the precipitate at the bottom (the precipitate is cells and debris), and collect the supernatant; ③ Centrifuge the obtained supernatant at 10000g for 30 minutes at 4°C, and then centrifuge to obtain The precipitate was washed with phosphate buffered saline (PBS) at 10,000g for 30 minutes at 4°C. The final precipitates were LEV derived from two immune cell lines, namely NK-92 LEV and NK-92MI LEV. (Figure 2A, D; Figure 3A, D); ④ Use 50-100μL PBS to gently pipette, dissolve and mix the LEV precipitate, and store it at -80°C.

1.1.2 Isolation and acquisition of extracellular vesicles EXO: ① Use a sterile filter with a diameter of 0.22 μm to use the supernatant obtained after centrifugation at 10,000 g for 30 minutes at 4°C in 1.1.1. Experimental operation ③ Filter, and collect the filtered liquids respectively; ② Centrifuge the filtered liquids at 110000g for 70 min at 4°C (ultracentrifuge rotor: SW32Ti), and collect the obtained precipitates; ③ Re-use the obtained precipitates with PBS. Wash the suspension, centrifuge and wash at 110000g for 70 minutes at 4°C, and repeat the experimental operation of resuspension and washing in PBS 1-2 times. Finally, the precipitate is obtained as EXO derived from the two immune cell lines, namely NK-92EXO. and NK-92MI EXO (Figure 2B, E; Figure 3B, E); ④ Use 50-100μL PBS to gently pipette, dissolve and mix the EXO precipitate, and store it at -80°C.

1.1.3 Isolation and acquisition of extracellular vesicles SEV: ①Centrifuge the liquid collected after filtration in 1.1.2. Experimental operation ① at 4°C with a centrifugal force of 110000g for 70 min, and collect the precipitate in 1.1.2. Experimental operation ② for While isolating and obtaining extracellular vesicles EXO, collect the supernatants separately; ② Centrifuge the obtained supernatants at 167000g for 16 hours at 4°C, and collect the obtained precipitates; ③ Use the obtained precipitates to Resuspend by washing with PBS, centrifuging and washing at 167000g for 4 hours at 4°C, and repeating the experimental operations of resuspension and washing with PBS 2-3 times. Finally, the precipitate is obtained as SEV derived from two immune cell lines, namely NK. -92 SEV and NK-92MI SEV (Figure 2 C, F; Figure 3 C, F); ④ Gently pipette, dissolve and mix the EXO precipitate with 50-100 μL PBS respectively, and store at -80°C.

A summary of the processes for isolating and obtaining the above different types of extracellular vesicles is shown in Figure 1. The transmission electron microscopy and particle size characterization of the obtained extracellular vesicles are shown in Figures 2 and 3 respectively.

After using the above experimental method to separate and obtain two groups of six types of extracellular vesicles, the RNA adsorbed on the vesicle surface was further removed through the following experimental process: the various EVs obtained were resuspended in PBS, and an appropriate amount of RNase was added ( RNase A, Ambion, TX, USA), so that the final concentration of RNase A was 1U/mL, and then various extracellular vesicle solutions containing RNase A were incubated in a 37°C water bath (JingHong, SHH, CN) for 20 min. This experimental procedure follows the guidelines of the International Society for Extracellular Vesicles (ISEV). 1.2 miRNA sequencing and bioinformatics analysis of human cell lines NK-92 and NK-92MI and their secreted extracellular vesicles

1.2.1 miRNA sequencing of NK-92 and NK-92MI cell lines

We used a total RNA purification kit (NorgenBiotek Corp, Thorold, ON, Canada) to extract total RNA (including all miRNAs and small RNAs) from NK-92 and NK-92MI cultured cell samples respectively; Bioanalyzer 2100 (Agilent, CA, USA) to analyze the quality and quantity of the obtained RNA, and ensure that the RIN value is >7.0; take 1 μg of total RNA from the RNA samples extracted from the two cell lines, and use the TruSeq small molecule RNA sample preparation kit (Illumina, SD, USA) Prepare a small molecule RNA library; follow the operating instructions provided by the manufacturer of IlluminaHiSeq 2500 (Hanyu, SHH, China), and entrust Lianchuan Biological Co., Ltd. (LC Sciences, HZ, CN) to perform separate analysis of the miRNA in the above two cell line samples. 50bp single-end sequencing.

1.2.2 miRNA sequencing of two groups of extracellular vesicles

In order to remove the RNase added in 1.1 and simultaneously purify extracellular vesicles, we followed the steps in 1.1 to obtain and purify the corresponding extracellular vesicles and re-ultraisolated and washed them; the same method as in 1.2.1 was used to extract various The total RNA of extracellular vesicles was collected, a small RNA library was prepared, and 50 bp single-end sequencing was performed on the miRNAs in various extracellular vesicle samples.

1.2.3 Bioinformatics analysis of miRNA sequencing results

First, bioinformatics analysis was performed on the miRNA sequencing data of human cell lines and their secreted extracellular vesicles using ACGT101-miR analysis software (LC Sciences, TX, USA). The main analysis process of the software is as follows: clean reads are obtained after quality control processing of the original data, 3' adapters are removed from the clean reads and length screening is performed to retain sequences with a base length of 18-26nt; then the remaining sequences are compared with the RNA database Sequences are compared, such as mRNA database, RFam database (including rRNA, tRNA, snRNA, snoRNA, etc.) and Repbase database (repeated sequence database), and filtered.

Secondly, based on sequencing data and bioinformatics analysis software, miRNAs with potentially important biological functions are screened. Main screening methods and processes: ① Based on DESeq2 (V 1.26.0) (R language software package), differential expression analysis was performed on the miRNA sequencing results of the two cell lines and the miRNA sequencing results of the two groups of extracellular vesicles. The miRNAs that meet the log ₂ Fold Change>1.25 and statistical analysis p-value<0.05 are used as differentially expressed miRNAs and cluster analysis is performed. From the sequencing data of the two cell lines, 15 genes with high expression levels and significant differences are screened out (NK92 compared to NK92 -MI significantly down-regulated) (Fig. 5 and Table 1), and 50 (Fig. 7 and Table 2) highly co-expressed miRNAs were screened out from the sequencing data of extracellular vesicles; ② Based on the functional miRNA should Assuming that there is an advantage in expression level, the average expression levels of miRNAs in cell lines and extracellular vesicles are calculated respectively, and the above differentially expressed miRNAs are sorted based on the average expression levels; ③ According to ① The screening of miRNAs Expression level and change fold, and finally selected 4 target miRNAs whose expression in NK-92MI was significantly higher than that of NK-92 from the preliminary screening of the above 15 cell lines. (We were the first to discover NK-92MI cells through experimental research. The anti-oral tumor effect of the strain is better than that of the NK-92 cell strain. The results are shown in Figure 4, analyzed using One-way ANOVA of GraphPad Prism software; ^* , P<0.05, ^** , P<0.01), including 1 unknown miRNA (bta-miR-2478_L-2) (the fold difference is the most obvious) and 3 known miRNAs (hsa-miR-1260a, hsa-miR-197-3p, hsa-miR-296-5p) (Figure 5). At the same time, from the preliminary screening of the above 50 extracellular vesicle miRNAs, we selected 2 target miRNAs whose expression in EXO was significantly higher than that of LEV and SEV (we were the first to find through experimental research that EXO has a significantly better anti-oral tumor effect than LEV and SEV, the results are shown in Figure 6, analyzed using GraphPad Prism software One-way ANOVA; ^* , P<0.05, ^** , P<0.01, ^*** , P<0.001), including known hsa-miR- 339-5p and hsa-miR-223-3p (Fig. 7).

The above 6 target miRNAs are the active miRNAs described in this application, and are labeled as miRNA-X.

Table 1 Sequencing results of the top 15 miRNAs with significant expression level changes between the two cell lines NK-92/NK-92MI

Table 2 Sequencing results of 50 miRNAs with high co-expression levels of EVs in NK-92/NK-92MI

Example 2. Construction of active miRNA-X expression vector

2.1 Construction of active miRNA-X using expression vector alone

In this example, Lipofectamine 3000 liposomes were used to construct expression vectors, and the concentrations of miRNA-X mimic and mimic control were set to 60 nM. The experiment was conducted in a 96-well plate, and the total system in each well was 200 μL. The specific operations are as follows:

① Take 0.6 μL of miRNA-X mimic and an equal amount of mimic NC (NC is the sequence of a nematode miRNA) and add them to 9.4 μLopti-MEM respectively;

② Add 0.3μL Lipofectamine 3000 to 9.7μLopti-MEM, and let it sit for 5 minutes after adding;

③ Add ① to ②, pipe gently and let it stand for 15 minutes to obtain Lipofectamine 3000 liposomes expressing miRNA-X and Lipofectamine 3000 liposomes expressing mimic NC.

2.2 Construction of active miRNA-X combined expression vector

In this implementation, Lipofectamine300 liposomes were used to construct a combined expression vector. The concentration of miRNA-X mimic and mimic control was set to 60nM. The experiment was conducted in a 96-well plate, and the total system in each well was 200 μL. The specific operations are as follows:

① Take 0.6μL of miRNA-X1 mimics, miRNA-X2 mimics and mimic NC and add them to 10μLopti-MEM respectively. Among them, mimic NC prepares two copies using the same formula and method;

② Prepare two liposome solutions: add 0.6μL Lipofectamine 3000 to 20μLopti-MEM, and let it sit for 5 minutes after adding. Prepare two liposome solutions using the same formula and method;

③Add the miRNA-X1 mimics and miRNA-X2 mimics solutions prepared in ① to one portion of the liposome solution, and add two portions of the mimic NC prepared in ① to the other liposome solution; pipe gently and let stand for 15 minutes. .

The miRNA-X expression vectors constructed in the above 2.1 and 2.2, as well as the miRNA-X1 mimics and miRNA-X2 mimics expression vectors, are in fact representative dosage forms for miRNA applications, providing a basis for the subsequent preparation of various active miRNA-X mimics alone or in combination. Medications used provide an idea. Subsequently, liposome drugs containing one or more of the above active miRNA-X mimics combinations and their activators/inhibitors can be prepared, and the administration method is external application or injection.

Example 3. Active miRNA-X transfection efficiency test

In order to verify the transfection efficiency of the six miRNA-X screened in Example 1 in oral tumor cells, we conducted an in vitro transfection experiment. First, the 6 active miRNA-X identical miRNA-Xmimics (Ribo Life Science, JS, CN) selected in Example 1 were used to co-incubate with the human oral tumor cell line KB. The specific experimental steps are:

①Inoculate KB cells: Inoculate KB cells in the logarithmic growth phase into a 6-well plate at 1×10 ⁵ to 5×10 ⁵ cells/well.

② Add the Lipofectamine 3000 liposome expressing miRNA-X constructed in Example 2.1 to KB cells.

③Change the medium 4 hours after transfection, collect KB cells after continuing to culture for 48 hours, and use RT-PCR experiments to detect the transfection efficiency.

Through RT-PCR experiments to detect the expression levels of active miRNA-X in KB oral tumor cells, we confirmed that the expression levels of six types of miRNA-X increased significantly after transfection with miRNA-Xmimics (Figure 8).

To further verify the transfection efficiency of the six miRNA-X inhibitors screened in Example 1, we co-incubated the corresponding six miRNA-X inhibitors (Ribo Life Science, JS, CN) with the human oral tumor cell line KB. The specific experimental steps are: inoculate KB cells in the logarithmic growth phase into a 6-well plate at 1 × 10 ⁵ to 5 × 10 ⁵ cells/well; set the concentration of miRNA-X inhibitor and inhibitor control to 120nM. Specific operations as follows:

① Take 12μL of miRNA-X inhibitor and inhibitor control and add them to 88μLopti-MEM respectively;

② Add 7.2μL Lipofectamine 3000 to 92.8μLopti-MEM, and let it sit for 5 minutes after adding;

③Then add ① to ②, pipe gently and let stand for 15 minutes. Then added to KB cells. Change the medium after 4 hours of transfection, collect KB cells after continuing to culture for 48 hours, and use RT-PCR experiments to detect the transfection efficiency;

Through RT-PCR experiments to detect the expression levels of active miRNA-X in KB oral tumor cells, we confirmed that the expression levels of six types of miRNA-X were significantly reduced after transfection with miRNA-X inhibitor (Figure 8).

From the above-mentioned miRNA-X mimics and inhibitors transfection experiments, it can be seen that the miRNA-X obtained by our screening was successfully transfected into oral tumor cells with the help of the vector system constructed by the above method, and the expression of miRNA-X in the tumor cells was consistent with the results. Expected, ideal moderating effects.

Example 4. Test of anti-oral tumor activity of active miRNA-X

To further verify that miRNA-X has anti-oral tumor effects, we co-incubated active miRNA-Xmimics/inhibitors with the KB human oral tumor cell line. The specific experimental steps are:

MiRNA-X mimics/inhibitors were transfected into KB human oral tumor cells. The transfection steps were as described in Example 3; after 4 hours of transfection, the medium of the transfection system was changed, and after continuing to culture for 48 hours, 3-(4,5 -Dimethylthiazole-2)-2,5-diphenyltetrazolium bromide (referred to as MTT, Sigma, DA, DE) to detect the survival rate of KB cells and to evaluate the effect of miRNA-X mimics/inhibitors on KB anti-tumor effects of cells.

The experimental results showed that the six miRNA-X mimics significantly inhibited tumor proliferation on KB oral tumor cells, while the miRNA-X inhibitors had no inhibitory effect on KB tumor cell proliferation (Figure 9, using GraphPad Prism software One-way ANOVA For analysis. ^** ,P<0.01; ^*** ,P<0.001.).

It can be seen that overexpression of any one of the six types of miRNA-X can significantly inhibit the proliferation of oral tumor cells and exert an anti-oral tumor effect. Those skilled in the art can predict that the active ingredients developed based on 6 kinds of miRNA-X can also significantly inhibit the proliferation of oral tumor cells and exert anti-oral tumor effects, including but not limited to: ①miRNA-X that modifies miRNA-X Derivatives; ② can be processed in the host into the precursor miRNA of the 6 kinds of miRNA-X; ③ can be transcribed by the host to form the polynucleotide of the precursor miRNA described in ②; ④ contains miRNA-X or the precursor of miRNA-X as described in ① The expression vector of a miRNA-X derivative, or the expression vector of the precursor miRNA described in ②, or the expression vector of the polynucleotide described in ③ (such as Example 2); ⑤ Promote and/or increase the expression of miRNA-X Agonist of miRNA-X activity.

Example 5. Test of anti-oral tumor activity of active miRNA-X combination therapy

In order to further verify that miRNA-X combination therapy has anti-oral tumor effects, we co-incubated the joint expression vector constructed in 2.2 with the human oral tumor cell line KB. The specific experimental steps are:

①Inoculate KB cells: Inoculate KB cells in the logarithmic growth phase into a 96-well plate at 1×10 ³ to 5×10 ³ cells/well;

② Add the Lipofectamine 3000 liposomes expressing miRNA-X1 mimics and miRNA-X2 mimics constructed in Example 2 to KB cells;

③ After continuing to culture for 48 hours, add 3-(4,5-dimethylthiazole-2)-2,5-diphenyltetrazolium bromide (MTT for short) to detect the survival rate of KB cells and to evaluate miRNA- Anti-tumor effect of X mimics combination therapy on KB cells.

Experimental results show that the combination of different miRNA-X can produce good inhibitory/killing effects on KB cells. For example, there were statistically significant differences in the survival rates of cancer cells between the three miRNA combination groups and the NC control group (Figure 10, analyzed using GraphPad Prism software One-way ANOVA. *, P<0.05; **, P<0.01 ;***,P<0.001). On the other hand, there are differences in the anti-oral cancer effects of different combinations of miRNA-X, and specific combinations can more effectively inhibit/kill KB cells. For example, bta-miR-2478-L-2 combined with hsa-miR-197-3p is more effective against oral cancer than bta-miR-2478-L-2 and hsa-miR-197-3p used alone. The activity was significantly improved: compared with bta-miR-2478-L-2 alone, it increased by 100.98% (P<0.001), and compared with hsa-miR-197-3p alone, it increased by 38.12% (P<0.01) ).

Different from the combined effect of bta-miR-2478-L-2 and hsa-miR-197-3p, the anti-cancer activity of bta-miR-2478-L-2 combined with hsa-miR-339-5p is higher than The anti-cancer activity of hsa-miR-339-5p alone (P<0.05) is similar to that of bta-miR-2478-L-2 alone; hsa-miR-339-5p and hsa-miR-223 The anti-cancer activity of the combination of -3p was higher than that of hsa-miR-339-5p alone (P<0.05), but similar to the anti-cancer activity of hsa-miR-223-3p alone.

The degree of enhancement or weakening of the above anti-cancer activity is calculated by the following formula: (average anti-cancer effect of the single use group - average anti-cancer effect of the combination group)/average anti-cancer effect of the single use group × 100%.

Finally, it should be noted that the above preferred embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail through the above preferred embodiments, those skilled in the art should understand that it can be implemented in the form and Various changes can be made to the details without departing from the scope of the invention as defined by the claims.

Claims

An active ingredient for treating/preventing oral cancer drugs, characterized in that the active ingredient is selected from at least one of the following:

(a) miRNA-X whose sequence is shown in any one of SEQ ID NO. 1 to SEQ ID NO. 6, or any combination of said miRNA-X, or modified derivatives of miRNA-X;

(b) Precursor miRNA, which can be processed in the host into the miRNA-X described in (a);

(c) polynucleotide, which can be transcribed by the host to form the precursor miRNA described in (b) and processed to form the miRNA described in (a);

(d) an expression vector containing the miRNA of miRNA-X described in (a), or the precursor miRNA described in (b), or the polynucleotide described in (c);

(e) An agonist of the miRNA described in (a).
The active ingredient according to claim 1, characterized in that the combination of the miRNA-X is: a combination of the miRNA-X shown in SEQ ID NO.1 and SEQ ID NO.3.
The active ingredient according to claim 1 or 2, characterized in that the agonist is selected from the group consisting of substances that promote the expression of miRNA-X and substances that increase the activity of miRNA-X.
The use of active ingredients as claimed in claim 1 or 2, wherein the active ingredients are used to prepare a medicine, and the medicine is used to treat/prevent oral tumors.
The use according to claim 4, characterized in that the medicine contains the active ingredient according to claim 1 or 2, and a pharmaceutically acceptable solvent or carrier.
The use according to claim 4, characterized in that the drug is in the form of freeze-dried powder injections, microneedles, injections, tablets, patches, capsules, oral suspensions or microspheres for interventional embolization, etc. .
The use according to claim 4, characterized in that the delivery methods of the drug include: reprinting method, drug loading method, direct naked RNA injection method, liposome wrapped RNA direct injection method and nanomaterial assembly method and other cationic materials Complex delivery method, as well as bacterial carrying plasmid expression RNA method, virus packaging expression RNA method and other delivery methods.