WO2023102548A1 - Treatment of neurological diseases using modulators of kcnq2 gene transcripts - Google Patents

Treatment of neurological diseases using modulators of kcnq2 gene transcripts Download PDF

Info

Publication number
WO2023102548A1
WO2023102548A1 PCT/US2022/080853 US2022080853W WO2023102548A1 WO 2023102548 A1 WO2023102548 A1 WO 2023102548A1 US 2022080853 W US2022080853 W US 2022080853W WO 2023102548 A1 WO2023102548 A1 WO 2023102548A1
Authority
WO
WIPO (PCT)
Prior art keywords
oligonucleotide
linkage
spacer
seq
nos
Prior art date
Application number
PCT/US2022/080853
Other languages
French (fr)
Inventor
Sandra HINCKLEY
Duncan Brown
Daniel Elbaum
Marisa Elizabeth KAMELGARN
Original Assignee
Quralis Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Quralis Corporation filed Critical Quralis Corporation
Publication of WO2023102548A1 publication Critical patent/WO2023102548A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/315—Phosphorothioates
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/31—Chemical structure of the backbone
    • C12N2310/318—Chemical structure of the backbone where the PO2 is completely replaced, e.g. MMI or formacetal
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/32—Chemical structure of the sugar
    • C12N2310/321—2'-O-R Modification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/30—Chemical structure
    • C12N2310/33—Chemical structure of the base
    • C12N2310/334—Modified C
    • C12N2310/3341—5-Methylcytosine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00—Applications; Uses
    • C12N2320/30—Special therapeutic applications
    • C12N2320/33—Alteration of splicing

Definitions

  • This application relates generally to methods of treating neurological diseases with KCNQ2 splice-switching antisense oligonucleotides, in particular, KCNQ2 antisense oligonucleotides with one or more spacers that target a KCNQ2 transcript.
  • Motor neuron diseases are a class of neurological diseases that result in the degeneration and death of motor neurons - those neurons which coordinate voluntary movement of muscles by the brain. Motor neuron diseases may be sporadic or inherited, and may affect upper motor neurons and/or lower motor neurons. Motor neuron diseases include amyotrophic lateral sclerosis, progressive bulbar palsy, pseudobulbar palsy, primary lateral sclerosis, progressive muscular atrophy, spinal muscular atrophy, and post-polio syndrome.
  • ALS Amyotrophic lateral sclerosis
  • ALS is a group of motor neuron diseases affecting about 15,000 individuals in the United States of America. ALS is characterized by degeneration and death of upper and lower motor neurons, resulting in loss of voluntary muscle control. Motor neuron death is accompanied by muscle fasciculation and atrophy. Early symptoms of ALS include muscle cramps, muscle spasticity, muscle weakness (for example, affecting an arm, a leg, neck, or diaphragm), slurred and nasal speech, and difficulty chewing or swallowing. Loss of strength and control over movements, including those necessary for speech, eating, and breathing, eventually occur.
  • ALS occurs in individuals of all ages, but is most common in individuals between 55 to 75 years of age, with a slightly higher incidence in males. ALS can be characterized as sporadic or familial. Sporadic ALS appears to occur at random and accounts for more than 90% of all incidences of ALS. Familial ALS accounts for 5-10% of all incidences of ALS.
  • FTD refers to a spectrum of progressive neurodegenerative diseases caused by loss of neurons in frontal and temporal lobes of the brain.
  • FTD is the third most common form of dementia (following Alzheimer’s disease and dementia with Lewy bodies), and the second most common form of dementia in individuals below 65 years of age.
  • FTD is estimated to affect 50,000 to 60,000 individuals in the United States of America.
  • FTD is characterized by changes in behavior and personality, and language dysfunction.
  • Forms of FTD include behavioral variant FTD (bvFTD), semantic variant primary progressive aphasia (svPPA), and nonfluent variant primary progressive aphasia (nfvPPA).
  • ALS with FTD is characterized by symptoms associated with FTD, along with symptoms of ALS such as muscle weakness, atrophy, fasciculation, spasticity, speech impairment (dysarthria), and inability to swallow (dysphagia). Individuals usually succumb to FTD within 5 to 10 years, while ALS with FTD often results in death within 2 to 3 years of the first disease symptoms appearing. [0008] Like ALS, there is no known cure for FTD, or ALS with FTD, nor a therapeutic known to prevent or retard either disease’s progression.
  • ALS amyotrophic lateral sclerosis
  • FTD frontotemporal dementia
  • ALS with FTD Alzheimer’s disease
  • AD Alzheimer’s disease
  • PD Parkinson’s disease
  • Huntington’s disease progressive supranuclear palsy
  • brain trauma spinal cord injury
  • corticobasal degeneration CBD
  • nerve injuries e.g., brachial plexus injuries
  • neuropathies e.g., chemotherapy induced neuropathy
  • TDP43 proteinopathies e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia
  • LATE Limbic-predominant age- related TDP-43 encephalopathy
  • CARTS Cerebral Age-Related TDP-43 With Sclerosis
  • facial onset sensory and motor neuronopathy Guam Parkinson-dement
  • oligonucleotides comprising one or more spacers and comprising a sequence that is at least 85% complementary to an equal length portion of a KCNQ2 transcript.
  • the present disclosure provides KCNQ2 oligonucleotides that target a KCNQ2 transcript (for example, a KCNQ2 mRNA or KCNQ2 pre-mRNA).
  • the oligonucleotides target a transcript for the treatment of neurological diseases, including motor neuron diseases, and/or neuropathies.
  • KCNQ2 oligonucleotides can be used to treat PD, ALS, FTD, ALS with FTD, and AD.
  • the present disclosure provides a compound comprising a modified oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357-1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non-natural linkage.
  • the oligonucleotide comprises a spacer.
  • the present disclosure provides a compound comprising a modified oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357-1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non-natural linkage, and further wherein the oligonucleotide comprises a spacer.
  • the present disclosure provides an oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357- 1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non- natural linkage.
  • the oligonucleotide comprises a spacer.
  • the present disclosure provides an oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357- 1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non- natural linkage, and further wherein the oligonucleotide comprises a spacer.
  • the oligonucleotide as provided herein comprises a segment with at most 11 linked nucleosides.
  • the oligonucleotide comprises a segment with at most 10, 9, or 8 linked nucleosides. In various embodiments, the oligonucleotide comprises a segment with at most 7 linked nucleosides. In various embodiments, the oligonucleotide comprises a segment with at most 6, 5, 4, 3, or 2 linked nucleosides. In various embodiments, every segment of the oligonucleotide comprises at most 7 linked nucleosides.
  • the oligonucleotide comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353- 854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • the oligonucleotide comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • the oligonucleotide comprises a sequence that shares at least 95% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • the oligonucleotide comprises a sequence that shares 100% identity with an equal length portion of any one of SEQ ID NOs: 1- 176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • the oligonucleotide comprises a segment with at most 11 linked nucleosides or at most 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • the oligonucleotide comprises a segment with at most 6, 5, 4, 3, or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353- 854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • the oligonucleotide comprises a segment with at most 6, 5, 4, 3, or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353- 854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • the oligonucleotide is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 19 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 23 oligonucleotide units in length.
  • the spacer is a nucleoside-replacement group comprising a non-sugar substitute that is incapable of linking to a nucleotide base. [0022] In various embodiments, the spacer is located between positions 10 and 15 of the oligonucleotide.
  • the spacer is located between positions 7 and 11 of the oligonucleotide.
  • the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 14 and 22 of the oligonucleotide.
  • the spacer and the second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases in the oligonucleotide.
  • the spacer is located between positions 7 and 9 of the oligonucleotide, and wherein the second spacer is located between positions 15 and 18 of the oligonucleotide.
  • the spacer is located at position 8 of the oligonucleotide, and wherein the second spacer is located at position 16 of the oligonucleotide.
  • the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 21 and 24 of the oligonucleotide. [0023] In various embodiments, the spacer is located between positions 2 and 5 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 8 and 12 of the oligonucleotide.
  • the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 18 and 22 of the oligonucleotide.
  • the oligonucleotide further comprises a second spacer and a third spacer, wherein the three spacers are located at positions in the oligonucleotide such that each segment of the oligonucleotide has at most 7 linked nucleosides.
  • at least two of the three spacers are adjacent to a guanine nucleobase.
  • each of the at least two of the three spacers immediately precede a guanine nucleobase.
  • each of the first, second or third spacers is a nucleoside- replacement group comprising a non-sugar substitute wherein the non-sugar substitute does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal or hemiaminal moiety and is incapable of forming a covalent bond with a nucleotide base.
  • each of the first, second or third spacers is independently represented by Formula (X), wherein: Formula (X) A is an optionally substituted 4-8 member monocyclic cycloalkyl group or a 4-8 member monocyclic heterocyclyl group, wherein the heterocyclyl group contains 1 or 2 heteroatoms selected from O, S and N, provided that A is not capable of forming a covalent bond to a nucleobase; and the symbol represents the point of connection to an internucleoside linkage.
  • each of the first, second or third spacers is independently represented by Formula (Xa), wherein: Formula (Xa).
  • ring A is an optionally substituted 4-8 member monocyclic cycloalkyl group selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; or a 4-8 member monocyclic heterocyclyl group, selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl.
  • ring A is tetrahydrofuranyl.
  • each of the first, second or third spacers is independently represented by Formula I, wherein: Formula (I) X is selected from -CH 2 -- and -O-; and n is 0, 1, 2 or 3.
  • each of the first, second or third spacers is independently represented by Formula I’, wherein: Formula (I’) X is selected from -CH2-- and -O-; and n is 0, 1, 2 or 3.
  • each of the first, second or third spacers is independently represented by Formula (Ia), wherein: Formula (Ia); and , 1, 2 or 3.
  • each of the first, second or third spacers is independently represented by Formula (Ia’), wherein: Formula (Ia’); and 0, 1, 2 or 3.
  • each of the first, second or third spacers is independently represented by Formula II, wherein: Formula (II); and elected from -CH2- and -O-.
  • each of the first, second or third spacers is independently represented by Formula II’, wherein: Formula (II’); and elected from -CH2- and -O-.
  • each of the first, second or third spacers is independently represented by Formula (Iia), wherein: Formula (Iia).
  • each of the first, second or third spacers is independently represented by Formula (Iia’), wherein: Formula (Iia’).
  • the spacer is represented by Formula (IIi), wherein: Formula (IIi) X is selected from -CH 2 - and -O-.
  • the spacer is represented by Formula (IIi’), wherein: Formula (IIi’) X is selected from -CH2-and -O.
  • the spacer is represented by Formula (IIib), wherein: Formula (IIib).
  • the spacer is represented by Formula (Iiib’), wherein: Formula (IIib’).
  • each of the first, second or third spacers is independently represented by Formula III, wherein: Formula (III); and elected from -CH2- and -O-.
  • each of the first, second or third spacers is independently represented by Formula III’, wherein: Formula (III’); and elected from -CH 2 - and -O-.
  • each of the first, second or third spacers is independently represented by Formula (IIIa), wherein: Formula (IIIa).
  • each of the first, second or third spacers is independently represented by Formula (IIIa’), wherein:
  • the oligonucleotide comprising the spacer has a GC content of at least 10%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 20%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 25%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 30%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 40%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 50%.
  • the oligonucleotide is between 12 and 40 oligonucleotide units in length.
  • At least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotri ester linkage, an alkylphosphonate linkage, a 3 -methoxy propyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3' amino ribose, or 5' amino ribo
  • PMO phosphorodia
  • one or more nucleoside linkages that link a base at position 3 or position 4 of the oligonucleotide are phosphodiester linkages. In various embodiments, only one nucleoside linkage that links a base at position 3 or position 4 of the oligonucleotide is a phosphodiester linkage. In various embodiments, nucleoside linkages that link bases at both position 3 and position 4 of the oligonucleotide are phosphodiester linkages. In various embodiments, one or more bases immediately preceding a spacer in the oligonucleotide are linked through phosphodiester bonds.
  • only the base immediately preceding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond.
  • the base immediately preceding the spacer in the oligonucleotide is further linked to a further preceding base through a phosphodiester bond.
  • the oligonucleotide comprises a second spacer, wherein a base immediately preceding the second spacer is linked to a further preceding base through a phosphodiester bond.
  • one or more bases immediately succeeding a spacer in the oligonucleotide are linked through phosphodiester bonds.
  • only the base immediately succeeding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond.
  • two bases immediately preceding the spacer in the oligonucleotide are linked through phosphodiester bonds.
  • one or more bases immediately preceding a spacer in the oligonucleotide are linked through phosphodiester bonds and wherein one or more bases immediately succeeding the spacer in the oligonucleotide are linked through phosphodiester bonds.
  • one base immediately preceding the spacer and one base immediately succeeding the spacer are linked through phosphodiester bonds.
  • the oligonucleotide includes a second spacer, and wherein one or more bases immediately preceding the second spacer in the oligonucleotide are linked through phosphodiester bonds and wherein one or more bases immediately succeeding the second spacer in the oligonucleotide are linked through phosphodiester bonds. In various embodiments, one base immediately preceding the second spacer and one base immediately succeeding the second spacer are linked through phosphodiester bonds. In various embodiments, the oligonucleotide comprises a range of bases that are linked through phosphodiester bonds, the range of bases comprising at least two bases.
  • the oligonucleotide comprises a range of bases that are linked through phosphodiester bonds, the range of bases comprising at least five bases. In various embodiments, the oligonucleotide comprises two or more spacers, and wherein the range of bases are positioned between the at least two spacers.
  • a compound comprising an oligonucleotide comprising a nucleobase sequence that shares at least 90% identity to an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • an oligonucleotide comprising a nucleobase sequence that shares at least 90% identity to an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • the nucleobase sequence shares at least 95% identity to an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • the nucleobase sequence shares at least 100% identity to an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • the oligonucleotide is any one of a 19mer, 21mer, 23mer, or 25mer.
  • an internucleoside linkage of the oligonucleotide is a modified internucleoside linkage.
  • the modified internucleoside linkage of the oligonucleotide is a phosphorothioate linkage.
  • all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.
  • the phosphorothioate linkage is in one of a Rp configuration or a Sp configuration.
  • the oligonucleotide comprises at least one modified sugar moiety.
  • the modified sugar moiety is one of a 2'-OMe modified sugar moiety, bicyclic sugar moiety, 2’-O-(2-methoxyethyl) (MOE), 2'-deoxy-2'-fluoro nucleoside, 2’-fluoro- ⁇ -D- arabinonucleoside, locked nucleic acid (LNA), a tricyclic nucleic acid (tcDNA) (e.g., tricyclic nucleic acid with ethyl (2’O-CH2-CH2-4’C) as the bridge or tricyclic nucleic acid with methyl substituted methyl (2’O-CH(CH2)-4’C) bridge), constrained ethyl 2’-4’-bridged nucleic acid (cEt), S-cEt, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA).
  • MOE 2-methoxye
  • the oligonucleotide exhibits at least a 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase of full length KCNQ2 protein. In various embodiments, the oligonucleotide exhibits at least a 100% increase of full length KCNQ2 protein. In various embodiments, the oligonucleotide exhibits at least a 200% increase of full length KCNQ2 protein. In various embodiments, the oligonucleotide exhibits at least a 300% increase of full length KCNQ2 protein. In various embodiments, the oligonucleotide exhibits at least a 400% increase of full length KCNQ2 protein.
  • increase of the full length KCNQ2 protein is measured in comparison to a reduced level of full length KCNQ2 protein achieved using a TDP43 antisense oligonucleotide.
  • the oligonucleotide exhibits at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full length KCNQ2 protein.
  • the oligonucleotide exhibits at least a 50%, 60%, 70%, 80%, or 90% reduction of a mis-spliced KCNQ2 transcript.
  • a method of treating a neurological disease and/or a neuropathy in a patient in need thereof comprising administering to the patient an oligonucleotide of any of the oligonucleotides disclosed above.
  • the neurological disease selected from the group consisting of: amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), and TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia, Limbic-predominant age-related TDP-43 encephalopathy (LATE)), Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, epilepsy/sei
  • ALS
  • the neurological disease is AD. In various embodiments, the neurological disease is PD. In various embodiments, the neurological disease is ALS. In various embodiments, the neurological disease is FTD. In various embodiments, the neurological disease is ALS with FTD. In various embodiments, the neuropathy is chemotherapy induced neuropathy. [0055] Additionally disclosed is a method of restoring axonal outgrowth and/or regeneration of a neuron, the method comprising exposing the motor neuron to an oligonucleotide of any of the oligonucleotides disclosed above.
  • the method comprising exposing the cell to an oligonucleotide of any of the oligonucleotides disclosed above.
  • the neuron is a neuron of a patient in need of treatment of a neurological disease and/or a neuropathy.
  • the neuropathy is chemotherapy induced neuropathy.
  • the exposing is performed in vivo or ex vivo.
  • the exposing comprises administering the oligonucleotide to a patient in need thereof.
  • the oligonucleotide is administered topically, parenterally, intrathecally, intrathalamically, intracisternally, orally, rectally, buccally, sublingually, vaginally, pulmonarily, intratracheally, intranasally, transdermally, or intraduodenally.
  • the oligonucleotide is administered orally.
  • a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamically or intracisternally.
  • the patient is a human.
  • a pharmaceutical composition comprising the oligonucleotide of any one of the oligonucleotides disclosed above, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.
  • the pharmaceutical composition is suitable for topical, intrathecal, intrathalamic, intracisternal, intracerebroventricular, parenteral, oral, pulmonary, intratracheal, intranasal, transdermal, rectal, buccal, sublingual, vaginal, or intraduodenal administration.
  • the neurological disease is selected from from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Parkinson’s Disease with dementia, dementia with lewy bodies, synucleinopathies, Huntington’s disease, Brachial plexus injuries, peripheral nerve injuries, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, tuberous sclerosis complex, Pick’s Disease, tauopathies, primary age-related tauopathy, Down Syndrome, epilepsy/seizure disorder, depression, traumatic brain injury (TBI), chronic traumatic encephalopathy (CTE), HIV-associated neurocognitive disorders (HAND), multisystem atrophy, amnestic mild
  • the neurological disease is ALS. In various embodiments, the neurological disease is FTD. In various embodiments, the neurological disease is ALS with FTD. In various embodiments, the neurological disease is AD. In various embodiments, the neurological disease is PD. In various embodiments, the neuropathy is chemotherapy induced neuropathy. In various embodiments, the pharmaceutical composition is administered topically, parenterally, orally, pulmonarily, rectally, buccally, sublingually, vaginally, intratracheally, intranasally, intracisternally, intrathecally, intrathalamically, intravenously, intramuscularly, transdermally, or intraduodenally.
  • the pharmaceutical composition is administered intrathecally, intrathalamically intracerebroventricularly, or intracisternally.
  • a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamically or intracisternally.
  • the patient is human.
  • a method for treating a neurological disease in a subject in need thereof comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alky
  • oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5 or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphospho
  • a method for treating FTD in a subject in need thereof comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphospho
  • a method for treating ALS with FTD in a subject in need thereof comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs:1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphospho
  • one or more nucleoside linkages that link a base at position 3 or position 4 of the oligonucleotide are phosphodiester linkages. In various embodiments, only one nucleoside linkage that links a base at position 3 or position 4 of the oligonucleotide is a phosphodiester linkage. In various embodiments, nucleoside linkages that link bases at both position 3 and position 4 of the oligonucleotide are phosphodiester linkages. In various embodiments, one or more bases immediately preceding a spacer in the oligonucleotide are linked through phosphodiester bonds.
  • only the base immediately preceding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond.
  • the base immediately preceding the spacer in the oligonucleotide is further linked to a further preceding base through a phosphodiester bond.
  • the oligonucleotide comprises a second spacer, wherein a base immediately preceding the second spacer is linked to a further preceding base through a phosphodiester bond.
  • one or more bases immediately succeeding a spacer in the oligonucleotide are linked through phosphodiester bonds.
  • only the base immediately succeeding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond.
  • two bases immediately preceding the spacer in the oligonucleotide are linked through phosphodiester bonds.
  • one or more bases immediately preceding a spacer in the oligonucleotide are linked through phosphodiester bonds and wherein one or more bases immediately succeeding the spacer in the oligonucleotide are linked through phosphodiester bonds.
  • one base immediately preceding the spacer and one base immediately succeeding the spacer are linked through phosphodiester bonds.
  • the oligonucleotide includes a second spacer, and wherein one or more bases immediately preceding the second spacer in the oligonucleotide are linked through phosphodiester bonds and wherein one or more bases immediately succeeding the second spacer in the oligonucleotide are linked through phosphodiester bonds. In various embodiments, one base immediately preceding the second spacer and one base immediately succeeding the second spacer are linked through phosphodiester bonds. In various embodiments, the oligonucleotide comprises a range of bases that are linked through phosphodiester bonds, the range of bases comprising at least two bases.
  • the oligonucleotide comprises a range of bases that are linked through phosphodiester bonds, the range of bases comprising at least five bases. In various embodiments, the oligonucleotide comprises two or more spacers, and wherein the range of bases are positioned between the at least two spacers. In various embodiments, the oligonucleotide is any one of a 19mer, 21mer, 23mer, or 25mer. [0064] In various embodiments, at least one (i.e., one or more) internucleoside linkage of the oligonucleotide is a phosphorothioate linkage.
  • all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.
  • the oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357-1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, wherein the oligonucleotide comprises a spacer and wherein the oligonucleotide is capable of increasing, restoring, or stabilizing expression of the KCNQ2 mRNA capable of translation of a functional KCNQ2 and/or activity and/or function of KCNQ2 protein in a cell or a human patient of an immune-mediated demyelinating disease, and wherein the level of increase, restoration, or stabilization of expression and/or activity and/or function is sufficient for use of the oligonu
  • the oligonucleotide comprises one or more chiral centers and/or double bonds. In various embodiments, the oligonucleotide exist as stereoisomers selected from geometric isomers, enantiomers, and diastereomers. [0067] Additionally disclosed herein is a method of treating a neurological disease and/or a neuropathy in a patient in need thereof, the method comprising administering to a patient in need thereof a therapeutically effective amount of a pharmaceutical composition disclosed above, in combination with a second therapeutic agent.
  • the second therapeutic agent is selected from Riluzole (Rilutek), PrimeC (combination of celecoxib and ciprofloxacin), Edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitor, antipsychotic agents, cholinesterase inhibitors, memantine, benzodiazepine antianxiety drugs, AMX0035 (ELYBRIO), ZILUCOPLAN (RA101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078, and BIIB105), BIIB100, levodopa/carbidopa, dopaminergic agents (e.g., ropinirole, pramipexole, rotigotine), medroxyprosterone, KCNQ2/KCNQ3 openers (e.g., retigabine, XEN1101,
  • a method of treating a neurological disease and/or a neuropathy in a patient in need thereof comprising administering to a patient in need thereof a therapeutically effective amount of a pharmaceutical composition disclosed above, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non-natural linkage, wherein the oligonucleotide comprises a spacer, and wherein the oligonucleotide further comprises a targeting or conjugate moiety selected from cholesterol, lipoic acid, panthothenic acid, polyethylene glycol, and an antibody for crossing the blood brain barrier.
  • the spacer is a nucleoside-replacement group comprising a non- sugar substitute that is incapable of linking to a nucleotide base.
  • the spacer is located at position 8 of the oligonucleotide, and wherein the second spacer is located at position 16 of the oligonucleotide.
  • the spacer is located between positions 10 and 15 of the oligonucleotide.
  • the spacer is located between positions 7 and 11 of the oligonucleotide.
  • the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 14 and 22 of the oligonucleotide.
  • the spacer and the second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases in the oligonucleotide. In various embodiments, the spacer is located between positions 7 and 9 of the oligonucleotide, and wherein the second spacer is located between positions 15 and 18 of the oligonucleotide. [0070] In various embodiments, the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 21 and 24 of the oligonucleotide. In various embodiments, the spacer is located between positions 2 and 5 of the oligonucleotide.
  • the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 8 and 12 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 18 and 22 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer and a third spacer, wherein the three spacers are located at positions in the oligonucleotide such that each segment of the oligonucleotide has at most 7 linked nucleosides.
  • each of the first, second or third spacers is a nucleoside-replacement group comprising a non-sugar substitute wherein the non-sugar substitute does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal or hemiaminal moiety and is incapable of forming a covalent bond with a nucleotide base.
  • each of the first, second or third spacers is independently represented by Formula (X), wherein: Formula (X) A is an optionally substituted 4-8 member monocyclic cycloalkyl group or a 4-8 member monocyclic heterocyclyl group, wherein the heterocyclyl group contains 1 or 2 heteroatoms selected from O, S and N, provided that A is not capable of forming a covalent bond to a nucleobase; and the symbol represents the point of connection to an internucleoside linkage.
  • each of the first, second or third spacers is independently represented by Formula (Xa), wherein: Formula (Xa).
  • ring A is an optionally substituted 4-8 member monocyclic cycloalkyl group selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; or a 4-8 member monocyclic heterocyclyl group, selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl.
  • ring A is tetrahydrofuranyl.
  • each of the first, second or third spacers is independently represented by Formula (I), wherein: Formula (I) X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.
  • the spacer or the second spacer is represented by Formula (I’), wherein:
  • X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.
  • each of the first, second or third spacers is independently represented by Formula (la), wherein: Formula (la); and n is 0, 1, 2 or 3.
  • each of the first, second or third spacers is independently represented by Formula (la’), wherein: Formula (la’); and n is 0, 1, 2 or 3.
  • each of the first, second or third spacers is independently represented by Formula II, wherein:
  • X is selected from -CH 2 - and -O-.
  • each of the first, second or third spacers is independently represented by Formula II’, wherein:
  • X is selected from -CH 2 - and -O-.
  • each of the first, second or third spacers is independently represented by Formula (lia), wherein: [0086] In further embodiments, each of the first, second or third spacers is independently represented by Formula (lia’), wherein:
  • the spacer is represented by Formula (Hi), wherein: Formula (IIi)
  • X is selected from -CH2- and -O-.
  • the spacer is represented by Formula (IIi’), wherein: Formula (IIi’) X is selected from -CH 2 -and -O. [0089] In some embodiments, the spacer is represented by Formula (IIib), wherein: Formula (IIib). [0090] In some embodiments, the spacer is represented by Formula (Iiib’), wherein: Formula (IIib’). [0091] In various embodiments, each of the first, second or third spacers is independently represented by Formula III, wherein: Formula (III); and elected from -CH 2 - and -O-.
  • each of the first, second or third spacers is independently represented by Formula III’, wherein: Formula (III’); and elected from -CH 2 - and -O-.
  • each of the first, second or third spacers is independently represented by Formula (IIIa), wherein: Formula (IIIa).
  • ther embodiments, each of the first, second or third spacers is independently represented by Formula (IIIa’), wherein: Formula (IIIa’).
  • the oligonucleotide comprising the spacer has a GC content of at least 10%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 20%.
  • the oligonucleotide comprising the spacer has a GC content of at least 25%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 30%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 40%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 50%.
  • AON antisense oligonucleotide
  • oligonucleotides capable of targeting a region of a transcript transcribed from a gene. In various embodiments, such oligonucleotides target a KCNQ2 transcript.
  • oligonucleotides including antisense oligonucleotide sequences, and methods for treating neurological diseases, such as amyotrophic lateral sclerosis and frontotemporal dementia, and/or neuropathies such as chemotherapy induced neuropathy, using same.
  • the oligonucleotides target a sequence of KCNQ2 transcripts resulting in the reduction of levels of mis-spliced KCNQ2 transcripts.
  • compositions comprising KCNQ2 oligonucleotides that target a region of KCNQ2 transcripts, for treating neurological diseases and/or neuropathies; and manufacture of medicaments containing a disclosed KCNQ2 oligonucleotide that targets a region of KCNQ2 transcripts to be used in treating a neurological disease and/or neuropathy.
  • the terms “treat,” “treatment,” “treating,” and the like are used herein to generally mean obtaining a desired pharmacological and/or physiological effect. The effect may be therapeutic in terms of partially or completely curing a disease and/or adverse effect attributed to the disease.
  • treatment covers any treatment of a disease in a mammal, particularly a human, and includes: (a) inhibiting the disease, i.e., preventing the disease from increasing in severity or scope; (b) relieving the disease, i.e., causing partial or complete amelioration of the disease; or (c) preventing relapse of the disease, i.e., preventing the disease from returning to an active state following previous successful treatment of symptoms of the disease or treatment of the disease.
  • Preventing includes delaying the onset of clinical symptoms, complications, or biochemical indicia of the state, disorder, disease, or condition developing in a subject that may be afflicted with or predisposed to the state, disorder, disease, or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder, disease, or condition. “Preventing” includes prophylactically treating a state, disorder, disease, or condition in or developing in a subject, including prophylactically treating clinical symptoms, complications, or biochemical indicia of the state, disorder, disease, or condition in or developing in a subject.
  • compositions refers to a composition comprising at least one biologically active compound, for example, a KCNQ2 antisense oligonucleotide (AON), as disclosed herein formulated together with one or more pharmaceutically acceptable excipients.
  • AON KCNQ2 antisense oligonucleotide
  • “Individual,” “patient,” or “subject” are used interchangeably and include any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, or non-human primates, and most preferably humans.
  • the compounds of the invention can be administered to a mammal, such as a human, but can also be other mammals such as an animal in need of veterinary treatment, e.g., domestic animals (e.g., dogs, cats, and the like), farm animals (e.g., cows, sheep, pigs, horses, and the like) and laboratory animals (e.g., rats, mice, guinea pigs, non-human primates, and the like).
  • the mammal treated in the methods of the invention is desirably a mammal in whom modulation of KCNQ2 expression and/or activity is desired.
  • KCNQ2 also known as Kv7.2, KCNA11, HNSPC, ENB1, BNFC, Potassium Channel, Voltage Gated KQT-Like Subfamily Q, Member 2, Neuroblastoma-Specific Potassium Channel Subunit Alpha KvLQT2, Potassium Voltage-Gated Channel Subfamily KQT Member 2 refers to the gene or gene products (e.g., protein or mRNA transcript (including pre- mRNA) encoded by the gene) identified by any one of SEQ ID NOs: 1357-1370 and allelic variants thereof, as well as orthologs found in non-human species (e.g., non-human primates or mice).
  • KCNQ2 transcript refers to a KCNQ2 transcript.
  • Such a KCNQ2 transcript can be a KCNQ2 pre-mRNA sequence or a KCNQ2 mature RNA sequence.
  • KCNQ2 transcript sequences are shown to contain thymine (T), but one of skill in the art will appreciate that thymine (T) can generally be replaced with uracil (U) in RNA sequences.
  • KCNQ2 oligonucleotide refers to an oligonucleotide that is capable of increasing, restoring, or stabilizing full- length KCNQ2 activity e.g., full length KCNQ2 expression, for example, full length KCNQ2 mRNA and/or full length KCNQ2 protein expression.
  • a KCNQ2 oligonucleotide reduces the level of mis-spliced KCNQ2 transcripts by targeting a KCNQ2 transcript (e.g., KCNQ2 pre-mRNA or mis-spliced KCNQ2 with a target sequence).
  • a KCNQ2 oligonucleotide comprises a sequence that is at least 85% complementary to an equal length portion of a transcript comprising a sequence at least 90% identity to any one of SEQ ID NOs: 1357-1370 or a contiguous 15 to 50 nucleobase portion to any one of SEQ ID NO: 1357- 1370.
  • KCNQ2 target sequences are shown to contain thymine (T), but one of skill in the art will appreciate that thymine (T) can generally be replaced with uracil (U) in RNA sequences.
  • KCNQ2 oligonucleotides are characterized by having one or more spacers, where each spacer divides up the KCNQ2 oligonucleotide into segments of linked nucleosides.
  • KCNQ2 oligonucleotides have two spacers.
  • KCNQ2 oligonucleotides have two segments of linked nucleosides separated by one spacer.
  • KCNQ2 oligonucleotides have three segments of linked nucleosides separated by two spacers. In such embodiments, KCNQ2 oligonucleotides have one segment with at most 7 linked nucleosides.
  • a KCNQ2 oligonucleotide may have, from the 5’ to the 3’ end, 5 linked nucleosides, followed by a spacer, 10 linked nucleosides, followed by a second spacer, and 8 linked nucleosides.
  • the first segment of 5 linked nucleosides satisfies the one segment with at most 7 linked nucleosides.
  • KCNQ2 oligonucleotides have three spacers that divide the KCNQ2 oligonucleotide into four segments.
  • each of the four segments of the KCNQ2 oligonucleotide have at most 7 linked nucleosides.
  • KCNQ2 oligonucleotide encompasses a “KCNQ2 parent oligonucleotide,” a “KCNQ2 oligonucleotide with one or more spacers” (e.g., KCNQ2 oligonucleotide with two spacers or a KCNQ2 oligonucleotide with three spacers), a “KCNQ2 oligonucleotide variant with one or more spacers.”
  • KCNQ2 oligonucleotides include oligonucleotides comprising a sequence of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353- 854, SEQ ID NOs: 1371-1546, SEQ ID NO: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • KCNQ2 parent oligonucleotide refers to an oligonucleotide that targets a KCNQ2 transcript and is capable of increasing, restoring, or stabilizing full-length KCNQ2 activity e.g., full length KCNQ2 expression, for example, full length KCNQ2 mRNA and/or full length KCNQ2 protein expression.
  • KCNQ2 parent oligonucleotides do not include a spacer.
  • Examples of KCNQ2 parent oligonucleotides include oligonucleotides comprising a sequence of any one of SEQ ID NOs: 1-176 and SEQ ID NOs: 353-854.
  • KCNQ2 oligonucleotide with spacers and KCNQ2 oligonucleotide variants are described in relation to a corresponding KCNQ2 parent oligonucleotide.
  • KCNQ2 oligonucleotide variant refers to a KCNQ2 oligonucleotide that represents a modified version of a corresponding KCNQ2 parent oligonucleotide.
  • a KCNQ2 oligonucleotide variant represents a shortened version of a KCNQ2 parent oligonucleotide.
  • a KCNQ2 oligonucleotide variant is any one of a 15mer, 16mer, 17mer, 18mer 19mer, 20mer, 21mer, 22mer, 23mer, 24mer, 25mer, 26mer, or 27mer.
  • KCNQ2 oligonucleotide variants include oligonucleotides comprising a sequence of any one of SEQ ID NOs: 1371-1546, and SEQ ID NO: 1723-2224.
  • KCNQ2 oligonucleotide variants comprise one or more spacers.
  • Such KCNQ2 oligonucleotide variants comprise a sequence of any one of SEQ ID NOs: 2794-2801, SEQ ID NOs: 2802-2830 and SEQ ID NO: 2831-2855.
  • the term “oligonucleotide with one or more spacers” or “oligonucleotide comprising a spacer” refers to an oligonucleotide with at least one spacer.
  • An oligonucleotide with one or more spacers can, in various embodiments, include one spacer, two spacers, three spacers, four spacer, five spacers, six spacers, seven spacers, eight spacers, nine spacers, or ten spacers.
  • an oligonucleotide comprising one or more spacers includes at least one segment with at most 7 linked nucleosides.
  • an oligonucleotide comprising a spacer can include a segment with 7 linked nucleosides, followed by a spacer, a second segment with 9 linked nucleosides, followed by a second spacer, and a third segment with 7 linked nucleosides.
  • the first segment of 7 linked nucleosides and the third segment of 7 linked nucleosides each represents segments with at most 7 linked nucleosides.
  • an oligonucleotide comprising a spacer can include a segment with 10 linked nucleosides, followed by a spacer, a second segment with 10 linked nucleosides, followed by a second spacer, and a third segment with 3 linked nucleosides.
  • the third segment of 3 linked nucleosides represents the segment with at most 7 linked nucleosides.
  • an oligonucleotide with one or more spacers includes multiple segments with at most 7 linked nucleosides.
  • every segment of an oligonucleotide with one or more spacers has at most 7 linked nucleosides.
  • the oligonucleotide may be a 23mer and include two spacers that divide the 23mer into three separate segments of 7 linked nucleosides each. Therefore, each segment of the oligonucleotide has at most 7 linked nucleosides.
  • KCNQ2 oligonucleotides comprising one or more spacers are described in reference to a corresponding KCNQ2 parent oligonucleotide or a corresponding KCNQ2 oligonucleotide variant.
  • Example KCNQ2 oligonucleotides comprising one or spacers include any of the sequences in Tables 3A, 3B, 4 and 5, SEQ ID NOs: 2794-2801, SEQ ID NOs: 2802- 2830 and SEQ ID NO: 2831-2855.
  • one or more spacers may be located at one or more positions of an oligonucleotide.
  • a spacer may be located between a first position and a second position of the oligonucleotide.
  • a spacer located between a first position and second position encompasses the spacer being located at the first position, located at the second position, or located at any position of the oligonucleotide sandwiched by the first position and the second position.
  • therapeutically effective amount means the amount of an oligonucleotide that will elicit the biological or medical response of a tissue, system, animal or human that is being sought by the researcher, veterinarian, medical doctor, or other clinician.
  • the oligonucleotide comprises a sequence that is at least 85% complementary to an equal length portion of a transcript comprising a sequence at least 90% identity to any one of SEQ ID NO: 1357-1370, or a contiguous 15 to 50 nucleobase portion to any one of SEQ ID NO: 1357-1370.
  • the oligonucleotide is administered in therapeutically effective amounts to treat and/or prevent a disease, condition, disorder, or state, for example, a neurological disease and/or a neuropathy.
  • a therapeutically effective amount of an oligonucleotide is the quantity required to achieve a desired therapeutic and/or prophylactic effect, such as an amount which results in the prevention of or a decrease in the symptoms associated with a disease associated with reduced KCNQ2 activity in the motor neurons.
  • a KCNQ2 oligonucleotide that targets a KCNQ2 transcript refers to a KCNQ2 oligonucleotide that binds to a KCNQ2 transcript.
  • pharmaceutically acceptable salt(s) refers to salts of acidic or basic groups that may be present in a KCNQ2 oligonucleotide used in the present compositions.
  • a KCNQ2 oligonucleotide included in the present compositions that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids.
  • the acids that may be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including but not limited to malate, oxalate, chloride, bromide, iodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesul
  • a KCNQ2 oligonucleotide included in the present compositions that include an amino moiety may form pharmaceutically acceptable salts with various amino acids, in addition to the acids mentioned above.
  • Compounds included in the present compositions that are acidic in nature are capable of forming base salts with various pharmacologically acceptable cations. Examples of such salts include alkali metal or alkaline earth metal salts and, particularly, calcium, magnesium, sodium, and lithium salts.
  • Pharmaceutically acceptable salts of the disclosure include, for example, pharmaceutically acceptable salts of KCNQ2 oligonucleotides that include a sequence of any of SEQ ID NOs: 1- 176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NO: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • a KCNQ2 oligonucleotide of the disclosure may contain one or more chiral centers, groups, linkages, and/or double bonds and, therefore, exist as stereoisomers, such as geometric isomers, enantiomers or diastereomers.
  • stereoisomers when used herein consist of all geometric isomers, enantiomers or diastereomers. These compounds may be designated by the symbols “R” or “S” (or “Rp” or “Sp”) depending on the configuration of substituents around the stereogenic atom, for example, a stereogenic carbon, phosphorous, or sulfur atom.
  • Rp or Sp substituents around the stereogenic atom
  • one or more linkages of the compound may have a Rp or Sp configuration (e.g., one or more phosphorothioate linkages have either a Rp or Sp configuration).
  • each phosphorothioate linkage may be independent of another phosphorothioate linkage (e.g., one phosphorothioate linkage has a Rp configuration and a second phosphorothioate linkage has a Sp configuration).
  • the KCNQ2 oligonucleotide can have a mixed configuration of phosphorothioate linkages.
  • the KCNQ2 oligonucleotide may have five phosphorothioate linkages in a Rp configuration, followed by fifteen phosphorothioate linkages in a Sp configuration, followed by five phosphorothioate linkages in a Rp configuration.
  • Stereoisomers include enantiomers and diastereomers. Mixtures of enantiomers or diastereomers may be designated “( ⁇ )” in nomenclature, but the skilled artisan will recognize that a structure may denote a chiral center implicitly.
  • Individual stereoisomers of a KCNQ2 oligonucleotide of the present invention can be prepared synthetically from commercially available starting materials that contain asymmetric or stereogenic centers, or by preparation of racemic mixtures followed by resolution methods well known to those of ordinary skill in the art.
  • Stereoisomeric mixtures can also be resolved into their component stereoisomers by well-known methods, such as chiral-phase gas chromatography, chiral-phase super critical fluid chromatography, chiral-phase simulated moving bed chromatography, chiral-phase high performance liquid chromatography, crystallizing the compound as a chiral salt complex, or crystallizing the compound in a chiral solvent.
  • Stereoisomers can also be obtained from stereomerically-pure intermediates, reagents, and catalysts by well-known asymmetric synthetic methods.
  • the KCNQ2 oligonucleotide disclosed herein can exist in solvated as well as unsolvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the invention embrace both solvated and unsolvated forms.
  • the disclosure also embraces isotopically labeled compounds of the invention (i.e., isotopically labeled KCNQ2 oligonucleotide) which are identical to those recited herein, except that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number abundantly found in nature.
  • isotopes examples include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine and chlorine, such as 2 H, 3 H, 11 C, 13 C, 14 C, 15 N, 18 O, 17 O, 31 P, 32 P, 33 P, 35 S, 18 F, and 36 Cl, respectively.
  • Certain isotopically labeled disclosed compounds e.g., those labeled with 3 H, 14 C, or 35 S
  • Tritiated (i.e., 3 H), carbon-14 (i.e., 14 C), or 35 S isotopes are particularly preferred for their ease of preparation and detectability.
  • 2’-O-(2-methoxyethyl) refers to an O-methoxyethyl modification of the 2’ position of a furanose ring.
  • a 2’-O-(2- methoxyethyl) is used interchangeably as “2’-O-methoxyethyl” in the present disclosure.
  • a sugar moiety in a nucleoside modified with 2’-MOE is a modified sugar.
  • “2’-MOE nucleoside” (also 2’-O-(2-methoxyethyl) nucleoside) means a nucleoside comprising a 2’-MOE modified sugar moiety.
  • “2’-substituted nucleoside” means a nucleoside comprising a substituent at the 2’-position of the furanose ring other than H or OH.
  • 2’ substituted nucleosides include nucleosides with bicyclic sugar modifications.
  • 5-methyl cytosine means a cytosine modified with a methyl group attached to the 5 position.
  • a 5-methyl cytosine (5-MeC) is a modified nucleobase.
  • bicyclic sugar means a furanose ring modified by the bridging of two atoms.
  • a bicyclic sugar is a modified sugar.
  • bicyclic nucleoside also BNA means a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system.
  • the bridge connects the 4’-carbon and the 2’-carbon of the sugar ring.
  • cap structure or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound.
  • cEt or “constrained ethyl” means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4’-carbon and the 2’-carbon, wherein the bridge has the formula: 4’-CH(CH3)—O-2’.
  • constrained ethyl nucleoside means a nucleoside comprising a bicyclic sugar moiety comprising a 4’-CH(CH3)—O-2’ bridge.
  • cEt can be modified.
  • the cEt can be S-cEt (in an S- constrained ethyl 2’-4’-bridged nucleic acid).
  • the cEt can be R-cEt.
  • internucleoside linkage refers to the covalent linkage between adjacent nucleosides in an oligonucleotide.
  • non-natural linkage refers to a “modified internucleoside linkage.”
  • “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other.
  • “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence. As an example to the contrary, two nucleosides separated by a spacer are not contiguous.
  • locked nucleic acid or “LNA” or “LNA nucleosides” means nucleic acid monomers having a bridge (e.g., methylene, ethylene, aminooxy, or oxyimino bridge) connecting two carbon atoms between the 4’ and 2’ position of the nucleoside sugar unit, thereby forming a bicyclic sugar.
  • a bridge e.g., methylene, ethylene, aminooxy, or oxyimino bridge
  • bicyclic sugar examples include, but are not limited to (A) ⁇ -L- Methyleneoxy (4’-CH2—O-2’) LNA, (B) ⁇ -D-Methyleneoxy (4’-CH2—O-2’) LNA, (C) Ethyleneoxy (4’-(CH2)2—O-2’) LNA, (D) Aminooxy (4’-CH2—O—N(R)-2’) LNA and (E) Oxyamino (4’-CH 2 —N(R)—O-2’) LNA; wherein R is H, C 1 -C 12 alkyl, or a protecting group (see U.S. Pat. No.7,427,672, issued on Sep.23, 2008).
  • Examples of 4’-2’ bridging groups encompassed within the definition of LNA include, but are not limited to one of formulae: —[C(R 1 )( R 2 )] n —, — [C(R 1 )(R 2 )] n —O—, — C(R 1 R 2 )— N(R1)—O— or —C(R1R2)—O—N(R1)—.
  • bridging groups encompassed with the definition of LNA are 4’-CH 2 -2’, 4’-(CH 2 ) 2 -2’, 4’-(CH 2 ) 3 -2’, 4’-CH 2 —O-2’, 4’-(CH 2 ) 2 —O- 2’, 4’- CH2—O—N(R1)-2’ and 4’- CH2—N(R1)—O-2’- bridges, wherein each R1 and R2 is, independently, H, a protecting group or C 1 -C 12 alkyl.
  • LNAs in which the 2’-hydroxyl group of the ribosyl sugar ring is connected to the 4’ carbon atom of the sugar ring, thereby forming a bridge to form the bicyclic sugar moiety.
  • the bridge can be a methylene (—CH 2 —) group connecting the 2’ oxygen atom and the 4’ carbon atom, for which the term methyleneoxy (4’-CH2—O-2’) LNA is used.
  • the term ethyleneoxy (4’-CH 2 CH 2 —O-2’) LNA is used.
  • a “spacer” refers to a nucleoside-replacement group (e.g., a non- nucleoside group that replaces a nucleoside present in a KCNQ2 parent oligonucleotide).
  • the spacer is characterized by the lack of a nucleotide base and by the replacement of the nucleoside sugar moiety with a non-sugar substitute.
  • the non-sugar substitute group of a spacer lacks an aldehyde, ketone, acetal, ketal, hemiacetal or hemiketal group.
  • the non-sugar substitute group of a spacer is thus capable of connecting to the 3’ and 5’ positions of the nucleosides adjacent to the spacer through an internucleoside linker as described herein, but not capable of forming a covalent bond with a nucleotide base (i.e., not capable of linking a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide).
  • a KCNQ2 oligonucleotide with a spacer is described in relation to a KCNQ2 parent oligonucleotide, wherein the spacer replaces a nucleoside of the KCNQ2 parent oligonucleotide.
  • a spacer cannot hybridize to a nucleoside comprising a nucleobase at the corresponding position of a KCNQ2 transcript, within the numerical order of the length of the AON oligonucleotide (i.e., if the spacer is positioned after nucleoside 4 of an AON (i.e., at position 5 from the 5’-end), the spacer is not complementary to the nucleoside (A, C, G, or U) at the same corresponding position of the target KCNQ2 transcript)).
  • mismatch or a “non-complementary group” refers to the case when a group (e.g., nucleobase) of a first nucleic acid is not capable of pairing with the corresponding group (e.g., nucleobase) of a second or target nucleic acid.
  • modified internucleoside linkage refers to a substitution or any change from a naturally occurring internucleoside linkage (e.g., a phosphodiester internucleoside bond).
  • modified nucleobase means any nucleobase other than adenine, cytosine, guanine, thymine, or uracil. Examples of a modified nucleobase include 5-methyl cytosine, pseudouridine, or 5-methoxyuridine.
  • An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).
  • a “modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase.
  • a universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases.
  • Modified nucleosides include abasic nucleosides, which lack a nucleobase. However, modified nucleosides do not include spacers or other groups that are incapable of linking a nucleobase.
  • “linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked).
  • an oligonucleotide may have different segments of linked nucleosides connected through a spacer.
  • the spacer i.e., nucleoside replacement
  • the oligonucleotide may have a first segment of Y linked nucleosides (e.g., Y nucleosides that are connected in a contiguous sequence), followed by a spacer, and then a second segment of Z linked nucleosides.
  • Y linked nucleosides e.g., Y nucleosides that are connected in a contiguous sequence
  • modified oligonucleotide means an oligonucleotide comprising at least one (i.e., one or more) modified internucleoside linkage, modified sugar, and/or modified nucleobase.
  • modified sugar or “modified sugar moiety” means a modified furanosyl sugar moiety or a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide.
  • monomer means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.
  • motif means the pattern of unmodified and modified nucleosides in an antisense compound.
  • “natural sugar moiety” means a sugar moiety found in DNA (2’-H) or RNA (2’-OH).
  • naturally occurring internucleoside linkage means a 3’ to 5’ phosphodiester linkage.
  • “non-complementary nucleobases” refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.
  • nucleic acid refers to molecules composed of monomeric nucleotides.
  • a nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, non-coding RNA, small interfering ribonucleic acids (siRNA), short-hairpin RNA (shRNA), and microRNAs (miRNA).
  • RNA ribonucleic acids
  • DNA deoxyribonucleic acids
  • siRNA small interfering ribonucleic acids
  • shRNA short-hairpin RNA
  • miRNA microRNAs
  • complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a corresponding nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.
  • nucleobase sequence means the order of nucleobases independent of any sugar, linkage, and/or nucleobase modification.
  • nucleoside refers to a nucleobase linked to a sugar.
  • nucleoside also includes a “modified nucleoside” which has independently, a modified sugar moiety and/or modified nucleobase.
  • nucleoside mimetic includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, e.g., non-furanose sugar units.
  • Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by a phosphorodiamidate or other non-phosphodiester linkage).
  • Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only.
  • the tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system.
  • “Mimetic” refers to groups that are substituted for a sugar, a nucleobase, and/or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.
  • “nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside.
  • “oligomeric compound” or “oligomer” means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule.
  • oligonucleotide means a polymer of one or more segments of linked nucleosides each of which can be modified or unmodified, independent one from another.
  • hotspot region is a range of nucleobases on a target nucleic acid amenable to oligomeric compound-mediated modulation of the splicing of the target nucleic acid.
  • hybridization means the pairing or annealing of complementary oligonucleotides and/or nucleic acids.
  • Antisense therapeutics are a class of nucleic acid-based compounds that can be used to modulate a transcript, such as mRNA.
  • antisense therapeutics comprise one or more spacers and can be used to modulate a transcript that is transcribed from a gene, such as a KCNQ2 pre-mRNA.
  • Antisense therapeutics may be single- or double-stranded deoxyribonucleic acid (DNA)- based, ribonucleic acid (RNA)-based, or DNA/RNA chemical analogue compounds.
  • antisense therapeutics are designed to include a sequence that is complementary or nearly complementary to an mRNA or pre-mRNA sequence transcribed from a given gene in order to promote binding between the antisense therapeutic and the pre-mRNA or mRNA.
  • antisense therapeutics act by binding to an mRNA or pre-mRNA, thereby inhibiting protein translation, altering pre-mRNA splicing into mature mRNA (e.g., by preventing appropriate proteins such as splicing activator proteins from binding), and/or causing destruction of mRNA.
  • the antisense therapeutic sequence is complementary to a portion of a targeted gene’s or mRNA’s sense sequence.
  • antisense therapeutics described herein are oligonucleotide-based compounds that include an oligonucleotide sequence complementary to a pre-mRNA sense, or a portion thereof, and one or more spacers.
  • an oligonucleotide such as disclosed herein, may be an oligonucleotide sequence of 5 to 100 oligonucleotide units in length, for example, 10 to 60 oligonucleotide units in length, for example, 12 to 50 oligonucleotide units in length, 14 to 40 oligonucleotide units in length, 10 to 30 oligonucleotide units in length, for example, 14 to 30 oligonucleotide units in length, for example, 14 to 25 or 15 to 22 oligonucleotide units in length, or 18, 19, 20, 21, 22, 23, 24, or 25 oligonucleotide units in length.
  • an “oligonucleotide unit” refers to either a nucleoside (e.g., a nucleoside which includes a sugar and/or a nucleobase) or a nucleoside-replacement group (e.g., a spacer) of the oligonucleotide.
  • the oligonucleotides are 25 oligonucleotide units in length.
  • the oligonucleotides are 23 oligonucleotide units in length.
  • the oligonucleotides are 21 oligonucleotide units in length.
  • the oligonucleotides are 19 oligonucleotide units in length.
  • the oligonucleotide is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length.
  • the oligonucleotide is at least 18 oligonucleotide units in length.
  • the oligonucleotide is at least 19 oligonucleotide units in length.
  • the oligonucleotide is at least 20 oligonucleotide units in length.
  • the oligonucleotide is at least 21 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 22 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 23 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 24 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 25 oligonucleotide units in length.
  • AONs may include chemically modified nucleosides (for example, 2’-O-methylated nucleosides or 2’-O-(2-methoxyethyl) nucleosides) as well as modified internucleoside linkages (for example, phosphorothioate linkages).
  • AONs described herein include oligonucleotide sequences that are complementary to RNA sequences, such as KCNQ2 mRNA sequences.
  • AONs described herein can include chemically modified nucleosides and modified internucleoside linkages (for example, phosphorothioate linkages).
  • AONs described herein include one or more spacers.
  • the oligonucleotides comprise one or more spacers. In particular embodiments, the oligonucleotides comprise one spacer. In various embodiments, the oligonucleotides comprise two spacers.
  • the oligonucleotide includes 23 oligonucleotide units with 21 nucleobases and two nucleoside replacement groups (e.g., two spacers). Further embodiments of oligonucleotides with one spacer and oligonucleotides with two spacers are described herein.
  • an antisense oligonucleotide can be, but is not limited to, inhibitors of a gene transcript (for example, shRNAs, siRNAs, PNAs, LNAs, 2’-O-methyl (2’OMe) antisense oligonucleotide (AON), 2’-O-(2-methoxyethyl) (MOE) AON, or morpholino oligomers (e.g., phosphorodiamidate morpholino (PMO))), or compositions that include such compounds.
  • a gene transcript for example, shRNAs, siRNAs, PNAs, LNAs, 2’-O-methyl (2’OMe) antisense oligonucleotide (AON), 2’-O-(2-methoxyethyl) (MOE) AON, or morpholino oligomers (e.g., phosphorodiamidate morpholino (PMO))
  • PMO phosphorodiamidate morpholino
  • an oligonucleotide is an antisense oligonucleotide (AON) comprising 2’OMe (e.g., a AON comprising one or more 2’OMe modified sugar), MOE (e.g., a AON comprising one or more MOE modified sugar), peptide nucleic acids (e.g., a AON comprising one or more N-(2-aminoethyl)-glycine units linked by amide bonds or carbonyl methylene linkage as repeating units in place of a sugar-phosphate backbone), locked nucleic acids (e.g., a AON comprising one or more locked ribose, and can be a mixture of 2’-deoxy nucleotides or 2’OMe nucleotides), c-ET (e.g., a AON comprising one or more cET sugar), constrained methoxyethyl (cMOE) (e.g., a AON comprising one
  • a AON comprises one or more internucleoside linkage independently selected from a phosphorothioate linkage, phosphodiester linkage, phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, phosphorodiamidate morpholino (PMO) (morpholino) linkage, PNA linkage, or any combination of phosphorothioate linkage, phosphodiester linkage, a phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage, a phosphoramidothioate linkage, thiophosphorodiamidate linkage, phosphorodiamidate morpholino (PMO) (morpholino) linkage, and PNA linkage.
  • PMO morpholino
  • a KCNQ2 AON comprises one or more phosphorothioate linkage, phosphodiester linkage, or a combination of phosphorothioate and phosphodiester linkages.
  • PNAs Peptide nucleic acids
  • PNAs include a backbone composed of repeating N-(2-aminoethyl)- glycine units linked by peptide bonds.
  • PNAs described herein can be used as antisense therapeutics that bind to RNA sequences with high specificity and increase, restore, and/or stabilize levels (e.g., full length KCNQ2 mRNA or protein levels) and/or activity (e.g., biological activity, for example, KCNQ2 activity).
  • Locked nucleic acids are oligonucleotide sequences that include one or more modified RNA nucleotides in which the ribose moiety is modified with an extra bridge connecting the 2’ oxygen and 4’ carbon. LNAs are believed to have higher Tm’s than analogous oligonucleotide sequences.
  • LNAs described herein can be used as antisense therapeutics that bind to RNA sequences with high specificity.
  • LNAs can bind to KCNQ2 pre-RNA and reduce mis-splicing of KCNQ2 pre-mRNA, and increase, restore, and/or stabilize KCNQ2 levels (e.g., KCNQ2 mRNA or protein levels) and/or activity (e.g., biological activity, for example, KCNQ2 activity).
  • KCNQ2 levels e.g., KCNQ2 mRNA or protein levels
  • activity e.g., biological activity, for example, KCNQ2 activity.
  • Morpholino oligomers are oligonucleotide compounds that include bases attached to a backbone of methylenemorpholine rings linked through phosphorodiamidate groups.
  • morpholino oligomers of the present invention can be designed to bind to specific pre-RNA sequence of interest.
  • morpholino oligomers bind to KCNQ2 pre-RNA thereby reducing mis-splicing of pre-mRNA, and increase, restore, and/or stabilize KCNQ2 levels (e.g., KCNQ2 mRNA or protein levels) and/or activity (e.g., biological activity, for example, KCNQ2 activity).
  • KCNQ2 morpholino oligomers described herein can be used as antisense therapeutics that bind to KCNQ2 pre-mRNA sequences with high specificity and reduce mis-spliced KCNQ2 pre-mRNA, and increase, restore, and/or stabilize KCNQ2 levels (e.g., KCNQ2 mRNA or protein levels) and/or activity (e.g., biological activity, for example, KCNQ2 activity).
  • KCNQ2 morpholino oligomers described herein can be used as antisense therapeutics that bind to KCNQ2 pre-mRNA sequences with high specificity and reduce mis-spliced KCNQ2 pre-mRNA, and increase, restore, and/or stabilize KCNQ2 levels (e.g., KCNQ2 mRNA or protein levels) and/or activity (e.g., biological activity, for example, KCNQ2 activity).
  • KCNQ2 levels e.g., KCNQ2 mRNA or protein levels
  • activity e
  • KCNQ2 morpholino oligomers described herein can also be used to bind KCNQ2 pre-mRNA sequences, altering KCNQ2 pre-mRNA splicing and KCNQ2 gene expression, and increase, restore, and/or stabilize KCNQ2 levels (e.g., KCNQ2 mRNA or protein levels) and/or activity (e.g., biological activity, for example, KCNQ2 activity).
  • KCNQ2 morpholino oligomers described herein can also be used to bind KCNQ2 pre-mRNA sequences, altering KCNQ2 pre-mRNA splicing and KCNQ2 gene expression, and increase, restore, and/or stabilize KCNQ2 levels (e.g., KCNQ2 mRNA or protein levels) and/or activity (e.g., biological activity, for example, KCNQ2 activity).
  • a KCNQ2 AON includes a sequence that is at least 85% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a KCNQ2 transcript (e.g., any one of SEQ ID NOs: 1357-1370 ).
  • a KCNQ2 AON includes a sequence that is between 90-95% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a KCNQ2 transcript.( e. g., any one of SEQ ID NOs: 1357-1370 ).
  • a KCNQ2 AON includes a sequence that is between 85% and 90% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a KCNQ2 transcript (e.g., any one of SEQ ID NOs: 1357-1370 ).
  • a KCNQ2 AON includes a sequence that is between 84% to 88% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a KCNQ2 transcript (e.g., any one of SEQ ID NOs: 1357-1370 ).
  • a KCNQ2 AON includes a sequence that is between 89% to 92% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a KCNQ2 transcript (e.g., any one of SEQ ID NOs: 1357-1370 ).
  • a KCNQ2 AON includes a sequence that is between 94% to 96% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a KCNQ2 transcript e.g., SEQ ID NOs: 1357-1370 ).
  • a KCNQ2 AON comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NO: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • a KCNQ2 AON comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NO: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
  • the KCNQ2 AON comprises a spacer and has a segment having at most 7 linked nucleosides.
  • the KCNQ2 AON comprises a spacer and has a segment having at most 6, 5, 4, 3, or 2 linked nucleosides.
  • KCNQ2 AON binding specificity can be assessed via measurement of parameters such as dissociation constant, melting temperature or other criteria such as changes in protein or RNA expression levels or other assays that measure KCNQ2 activity or expression.
  • a KCNQ2 AON can include a non-duplexed oligonucleotide.
  • a KCNQ2 AON can include a duplex of two oligonucleotides where the first oligonucleotide includes a nucleobase sequence that is completely or almost completely complementary to a KCNQ2 pre-mRNA sequence and the second oligonucleotide includes a nucleobase sequence that is complementary to the nucleobase sequence of the first oligonucleotide.
  • a KCNQ2 AON can target KCNQ2 mRNAs of one or more isoforms.
  • the KCNQ2 AON includes a nucleobase sequence that is complementary to a nucleobase sequence of a KCNQ2 gene or a KCNQ2 mRNA.
  • KCNQ2 AONs described herein include antisense oligonucleotides comprising the oligonucleotide sequences listed in Table 1 below: Table 1A.
  • At least one (i.e., one or more) nucleoside linkage of the oligonucleotide sequence is independently selected from a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophospho
  • At least one (i.e., one or more) nucleoside linkage of the oligonucleotide sequence is independently selected from a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophospho
  • a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1359.
  • G T T G A [00182]
  • a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1360.
  • a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1361.
  • G T T T C C C G A G G T A T C T C [00184]
  • KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1362.
  • a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1363. T C T G T G A G AA G G G GCCA A
  • a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1364.
  • T G In various embodiments, a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1365.
  • a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1366.
  • a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1367.
  • AGC T G C G T A T (SEQ ID NO: 1367) (Source: NCBI Reference Sequence: XM_017027843.2)
  • a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1368.
  • a KCNQ2 transcript is a KCNQ2 pre-mRNA transcript.
  • a KCNQ2 pre-mRNA transcript comprises a sequence provided as SEQ ID NO: 1369. GGGCC C GG A C C CT GTG T CT GGCC G TCTA CAAGG AT C A C
  • a KCNQ2 pre-mRNA transcript comprises a sequence provided as SEQ ID NO: 1370.
  • NCBI Reference Sequence NC_000020.11 Reference GRCh38.p13 Primary Assembly is SEQ ID NO: 1370.
  • the KCNQ2 transcript shares between 90-100% identity with any one of SEQ ID NO: 1357-1368 or shares between 90-100% identity to a KCNQ2 pre-mRNA transcript comprising SEQ ID NO: 1369 or SEQ ID NO: 1370.
  • the KCNQ2 transcript shares at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 1357-1368 or shares at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with a KCNQ2 pre-mRNA transcript transcribed from SEQ ID NO: 1369 or SEQ ID NO: 1370.
  • KCNQ2 Oligonucleotides Targeting Regions of the KCNQ2 Transcript are complementary to specific regions of KCNQ2 transcripts (for example, a KCNQ2 transcript) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370
  • a KCNQ2 AON comprises a sequence that is complementary to a specific region of the KCNQ2 transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370.
  • a KCNQ2 AON comprises a sequence that is at least 85%complementary to a specific region of the KCNQ2 transcript. In some embodiments, a KCNQ2 AON comprises a sequence that is at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% complementary to a specific region of the KCNQ2 transcript. In some embodiments, a KCNQ2 AON comprises a sequence that is 90 to 99% complementary to a specific region of the KCNQ2 transcript.
  • a KCNQ2 AON comprises a sequence that is 90 to 95% complementary to a specific region of the KCNQ2 transcript. In some embodiments, a KCNQ2 AON comprises a sequence that is 95 to 99% complementary to a specific region of the KCNQ2 transcript.
  • the KCQN2 transcript is a pre- mRNA transcript and the specific region is intron 4 of the KCNQ2 pre-mRNA transcript. In various embodiments, the KCQN2 transcript is a pre-mRNA transcript and the specific region is intron 5 of the KCNQ2 pre-mRNA transcript. In various embodiments, the specific region is exon 5 of the KCNQ2 pre-mRNA transcript.
  • the KCNQ2 AON (e.g., KCNQ2 AON) has a segment that has, at most, 7 linked nucleosides. In some embodiments, the KCNQ2 AON has a segment that has, at most, 6, 5, 4, 3, or 2 linked nucleosides. The segments of the KCNQ2 AON may be separated from other segments of the KCNQ2 AON through a spacer.
  • KCNQ2 AON is complementary to a specific region of the KCNQ2 transcript (for example, a KCNQ2 transcript) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370.
  • KCNQ2 Oligonucleotide Variants [00196]
  • KCNQ2 AONs include different variants, hereafter referred to as KCNQ2 AON variants.
  • a KCNQ2 AON variant may be an oligonucleotide sequence of 5 to 100 nucleobases in length, for example, 10 to 40 nucleobases in length, for example, 14 to 40 nucleobases in length, 10 to 30 nucleobases in length, for example, 14 to 30 nucleobases in length, for example, 16 to 28 nucleobases in length, for example, 19 to 23 nucleobases in length, for example, 21 to 23 nucleobases in length, for example, or 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length.
  • a KCNQ2 AON variant may be an oligonucleotide sequence complementary to a portion of a KCNQ2 pre-mRNA sequence or a KCNQ2 gene sequence.
  • Example KCNQ2 AON variants include a nucleobase sequence selected from any one of the sequences in Tables 3A, 3B, 4 and 5, SEQ ID NOs: 2794-2801, SEQ ID NOs: 2802-2830 and SEQ ID NO: 2831-2855.
  • a KCNQ2 AON variant represents a modified version of a corresponding KCNQ2 parent oligonucleotide that includes a nucleobase sequence selected from any one of SEQ ID NOs: 1-176 and SEQ ID NOs: 353-854.
  • a KCNQ2 AON variant includes a nucleobase sequence that represents a shortened version of a nucleobase sequence of a KCNQ2 AON selected from any one of SEQ ID NOs: 1-176 and SEQ ID NOs: 353-854.
  • a variant e.g., a KCNQ2 variant
  • a shorter version e.g., 15mer, 17mer, 19mer, 21mer, or 23mer
  • a nucleobase sequence of a KCNQ2 AON variant differs from a corresponding nucleobase sequence of a KCNQ2 parent oligonucleotide in that 1, 2, 3, 4, 5, or 6 nucleotide bases are removed from one or both of the 3’ and 5’ ends of the nucleobase sequence of the KCNQ2 parent oligonucleotide.
  • the corresponding KCNQ2 AON variant may include a 23mer where two nucleotide bases were removed from one of the 3’ or 5’ end of a 25mer included in the KCNQ2 parent oligonucleotide.
  • the corresponding KCNQ2 AON variant may include a 23mer where one nucleotide base is removed from each of the 3’ and 5’ ends of the 25mer included in the KCNQ2 parent oligonucleotide. In one embodiment, the corresponding KCNQ2 AON variant may include a 21mer where two nucleotide bases are removed from each of the 3’ and 5’ ends of the 25mer included in the KCNQ2 parent oligonucleotide. In one embodiment, the corresponding KCNQ2 AON variant may include a 21mer where four nucleotide bases are removed from either the 3’ or 5’ end of the 25mer included in the KCNQ2 parent oligonucleotide.
  • the corresponding KCNQ2 AON variant may include a 19mer where three nucleotide bases are removed from each of the 3’ and 5’ ends of the 25mer included in the KCNQ2 parent oligonucleotide. In one embodiment, the corresponding KCNQ2 AON variant may include a 19mer where six nucleotide bases are removed from either the 3’ or 5’ end of the 25mer included in the KCNQ2 parent oligonucleotide. [00198] Example sequences of KCNQ2 AON variants are shown below in Tables 2A and 2B. Table 2A. KCNQ2 Oligonucleotide Variant Sequences complementary to a sequence of a KCNQ2 transcript.
  • At least one nucleoside linkage of the nucleobase sequence is selected from a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkyl
  • At least one nucleoside linkage of the nucleobase sequence is selected from a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkyl
  • antisense Oligonucleotides with One or more Locked Nucleic Acids comprise one or more locked nucleic acids (LNAs).
  • LNAs locked nucleic acids
  • an antisense oligonucleotide includes one LNA.
  • an antisense oligonucleotide includes two LNAs.
  • an antisense oligonucleotide includes three LNAs.
  • an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a LNA at a 4 th position of the antisense oligonucleotide.
  • an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a LNA at a 7 th position of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a LNA at a 9 th position of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a LNA at a 12 th position of the antisense oligonucleotide.
  • an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a LNA at a 15 th position of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a LNA at a 17 th position of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a LNA at a 20 th position of the antisense oligonucleotide.
  • antisense oligonucleotides disclosed herein comprise two LNAs located at two different positions of the antisense oligonucleotide.
  • an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a first LNA at a fourth position of the antisense oligonucleotide and a second LNA at a 20 th position of the antisense oligonucleotide.
  • an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a first LNA at a 7 th position of the antisense oligonucleotide and a second LNA at a 15 th position of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a first LNA at a 7 th position of the antisense oligonucleotide and a second LNA at a 17 th position of the antisense oligonucleotide.
  • an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a first LNA at a 9 th position of the antisense oligonucleotide and a second LNA at a 17 th position of the antisense oligonucleotide.
  • antisense oligonucleotides disclosed herein e.g., KCQN2 parent oligonucleotides and/or KCQN2 oligonucleotide variants
  • an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a first LNA at a 4 th position of the antisense oligonucleotide, a second LNA at a 12 th position of the antisense oligonucleotide, and a third LNA at a 20 th position of the antisense oligonucleotide.
  • Antisense Oligonucleotides with One or more Spacers [00203]
  • antisense oligonucleotides comprise one or more spacers.
  • an antisense oligonucleotide includes one spacer.
  • an antisense oligonucleotide includes two spacers. In particular embodiments, an antisense oligonucleotide includes three spacers.
  • a spacer refers to a nucleoside- replacement group lacking a nucleotide base and wherein the nucleoside sugar moiety is replaced by a non-sugar substitute group.
  • the non-sugar substitute group is not capable of linking to a nucleobase, but is capable of linking with the 3’ and 5’ positions of nucleosides adjacent to the spacer through an internucleoside linking group.
  • an oligonucleotide with one or more spacers may be an oligonucleotide with 5 to 100 oligonucleotide units in length, for example, 10 to 60 oligonucleotide units in length, for example, 12 to 50 oligonucleotide units in length, 14 to 40 oligonucleotide units in length, 10 to 30 oligonucleotide units in length, for example, 14 to 30 oligonucleotide units in length, for example, 14 to 25 or 15 to 22 oligonucleotide units in length, or 18, 19, 20, 21, 22, 23, 24, or 25 oligonucleotide units in length.
  • an “oligonucleotide unit” refers to either a nucleoside (e.g., a nucleoside which includes a sugar and/or a nucleobase) or a nucleoside-replacement group (e.g., a spacer) of the oligonucleotide.
  • oligonucleotides with one or more spacers are 25 oligonucleotide units in length.
  • the oligonucleotides with one or more spacers are 23 oligonucleotide units in length.
  • the oligonucleotides with one or more spacers are 21 oligonucleotide units in length. In particular embodiments, the oligonucleotides with one or more spacers are 19 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 18 oligonucleotide units in length.
  • the oligonucleotides with one or more spacers are at least 19 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 20 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 21 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 22 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 23 oligonucleotide units in length.
  • oligonucleotides with one or more spacers are at least 24 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 25 oligonucleotide units in length.
  • a KCNQ2 AON comprises a sequence that shares at least 80% identity with an equal length portion of any one of the sequences in Tables 3A, 3B, 4 and 5, SEQ ID NOs: 2794-2801, SEQ ID NOs: 2802-2830 and SEQ ID NO: 2831-2855.
  • a KCNQ2 AON comprises a sequence that shares at least 85% identity with an equal length portion of any one of the sequences in Tables 3A, 3B, 4 and 5, SEQ ID NOs: 2794- 2801, SEQ ID NOs: 2802-2830 and SEQ ID NO: 2831-2855.
  • a KCNQ2 AON comprises a sequence that shares at least 90% identity with an equal length portion of any one of the sequences in Tables 3A, 3B, 4 and 5, SEQ ID NOs: 2794-2801, SEQ ID NOs: 2802- 2830 and SEQ ID NO: 2831-2855.
  • a KCNQ2 AON comprises a sequence that shares at least 95% identity with an equal length portion of any one of the sequences in Tables 3A, 3B, 4 and 5, SEQ ID NOs: 2794-2801, SEQ ID NOs: 2802-2830 and SEQ ID NO: 2831-2855.
  • a KCNQ2 AON comprises a sequence that shares 100% identity with an equal length portion of any one of SEQ ID NOs: 2794-2801, SEQ ID NOs: 2802-2830 and SEQ ID NO: 2831-2855.
  • the spacer is of Formula (X): Formula (X) where n rng A is as defined herein.
  • the spacer is of Formula (Xa): Formula (Xa) ng A is as defined herein and the -CH 2 -O- group is on a ring A atom adjacent to the -O- group.
  • ring A of formulae (X) and (Xa) is an optionally substituted 4-8 member monocyclic cycloalkyl group (e.g.
  • ring A is cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl) or a 4-8 member monocyclic heterocyclyl group, wherein the heterocyclyl group contains 1 or 2 heteroatoms selected from O, S and N (e.g. ring A is oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, azepanyl). In some embodiments, ring A is tetrahydrofuranyl.
  • ring A is tetrahydropyranyl. In some embodiments, ring A is pyrrolidinyl. In some embodiments, ring A is cyclopentyl. In some embodiments, the monocyclic cycloalkyl or monocyclic heterocyclyl is not further substituted. In some embodiments, the cycloalkyl or heterocyclyl is further substituted with 0, 1, 2 or 3 substituents selected from halo (e.g., -F, -Cl), - Ome, -Oet -O(CH2)Ome, -O(CH2)2Ome and CN.
  • halo e.g., -F, -Cl
  • tetrahydrofuranyl is substituted with 1 or 2 substituents selected from halo (e.g., -F, -Cl), -OMe, -OEt -O(CH2)OMe, -O(CH2)2OMe and CN.
  • halo e.g., -F, -Cl
  • tetrahydrofuranyl is substituted with 2 substituents selected from halo (e.g., -F, - Cl), -OMe, -OEt -O(CH2)OMe, -O(CH2)2OMe and CN.
  • tetrahydrofuranyl is substituted with 1 substituent selected from halo (e.g., -F, -Cl), -OMe, -OEt -O(CH 2 )OMe, - O(CH2)2OMe and CN.
  • tetrahydrofuranyl is substituted with - O(CH 2 ) 2 OMe.
  • the spacer is represented by Formula (I), wherein: I) s se ecte rom -CH2- and -O-; and n is 0, 1, 2 or 3.
  • the spacer is represented by Formula (I’), wherein: ’) s se ecte rom -C 2-and -O-; and n is 0, 1, 2 or 3.
  • the spacer is represented by Formula (Ia), wherein: Formula (Ia) and n is 0, 1, 2 or 3.
  • the spacer is represented by Formula (Ia’), wherein: Formula (Ia’) and n is 0, 1, 2 or 3.
  • X is selected from -CH 2 - and -O-. In some embodiments, X is -CH2-. In other embodiments, X is -O-.
  • n is 0, 1, 2 or 3. In some embodiments, n is 0. In some embodiments, n is 1 or 2. In some embodiments, n is 1. In other embodiments, n is 2. In certain embodiments, n is 3. [00217] In some embodiments, the spacer is represented by Formula (II), wherein: Formula (II) X is selected from -CH2- and -O-. [00218] In some embodiments, the spacer is represented by Formula (II’), wherein: Formula (II’) X is selected from -CH 2 -and -O. [00219] In some embodiments, the spacer is represented by Formula (Iia), wherein: Formula (Iia).
  • the spacer is represented by Formula (Iia’), wherein: Formula (Iia’). [00221] In some embodiments, the spacer is represented by Formula (IIi), wherein: i) s se ecte rom -C 2 - and -O-. [00222] In some embodiments, the spacer is represented by Formula (IIi’), wherein: Formula (IIi’) X is selected from -CH2-and -O. [00223] In some embodiments, the spacer is represented by Formula (IIib), wherein: Formula (IIib).
  • the spacer is represented by Formula (IIib’), wherein: Formula (IIib’).
  • the spacer is represented by Formula (III), wherein: Formula (III) X is selected from -CH2- and -O-.
  • the spacer is represented by Formula (III’), wherein: Formula (III’) X is selected from -CH2-and -O.
  • the spacer is represented by Formula (IIIa), wherein: Formula (IIIa).
  • the spacer is represented by Formula (IIIa’), wherein: Formula (IIIa’).
  • the open positions of Formulae (I), (I’), (Ia), (Ia’), (II), (II’), (Iia), (Iia’), (III), (III’), (IIIa) and (IIIa’) are further substituted with 0-3 substituents independently selected from halo (e.g., -F, -Cl), -OMe, -OEt -O(CH 2 )OMe, - O(CH2)2OMe and CN.
  • Formulae (I), (I’), (Ia), (Ia’), (II), (II’), (Iia), (Iia’), (III), (III’), (IIIa) and (IIIa’) are not further substituted.
  • a KCNQ2 oligonucleotide with one or more spacers is described in reference to a corresponding KCNQ2 parent oligonucleotide or a KCNQ2 variant oligonucleotide.
  • a KCNQ2 oligonucleotide with a spacer differs from a KCNQ2 parent oligonucleotide or a KCNQ2 variant oligonucleotide in that the spacer replaces a nucleoside in the KCNQ2 parent oligonucleotide or a KCNQ2 variant oligonucleotide.
  • the “position” of the KCNQ2 oligonucleotide refers to a particular location as counted from the 5’ end of the KCNQ2 oligonucleotide.
  • the spacer replaces a nucleoside at any one of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 of the KCNQ2 parent oligonucleotide or a KCNQ2 variant oligonucleotide.
  • a spacer replaces a nucleoside at one of positions 7, 8, 11, 14, 16, 19, or 22 of the KCNQ2 parent oligonucleotide or a KCNQ2 variant oligonucleotide.
  • a KCNQ2 oligonucleotide includes one spacer that replaces a nucleoside in the KCNQ2 oligonucleotide (e.g., one spacer replaces one nucleoside of the KCNQ2 oligonucleotide).
  • the spacer replaces a nucleoside between positions 9 and 15 of the KCNQ2 oligonucleotide.
  • the spacer replaces a nucleoside between positions 9 and 12 of the KCNQ2 oligonucleotide.
  • the spacer replaces a nucleoside at position 10 of the KCNQ2 oligonucleotide.
  • the spacer replaces a nucleoside at position 11 of the KCNQ2 oligonucleotide. In particular embodiments, the spacer replaces a nucleoside at position 12 of the KCNQ2 oligonucleotide. In particular embodiments, the spacer replaces a nucleoside between positions 12 and 16 of the KCNQ2 oligonucleotide. In particular embodiments, the spacer replaces a nucleoside at position 15 of the KCNQ2 oligonucleotide. [00232] In various embodiments, a KCNQ2 oligonucleotide including one spacer has 2 segments, where at least one of the 2 segments has at most 11 linked nucleosides.
  • the KCNQ2 oligonucleotide may be 23 oligonucleotide units in length, and the spacer can be located at position 12. Therefore, the KCNQ2 oligonucleotide has 2 segments divided by the spacer, where both of the 2 segments are 11 nucleobases in length. In various embodiments, a KCNQ2 oligonucleotide including one spacer has 2 segments, where at least one of the 2 segments has at most 10 linked nucleosides. For example, the KCNQ2 oligonucleotide may be 21 oligonucleotide units in length, and the spacer can be located at position 11.
  • the KCNQ2 oligonucleotide has 2 segments divided by the spacer, where both of the 2 segments are 10 nucleobases in length.
  • the KCNQ2 oligonucleotide may be 25 oligonucleotide units in length, and the spacer can be located at position 15. Therefore, the KCNQ2 oligonucleotide has 2 segments divided by the spacer, where one of the 2 segments is 14 nucleobases in length and the second of the 2 segments is 10 nucleobases in length.
  • a KCNQ2 oligonucleotide includes two spacers that each replace a nucleoside in the KCNQ2 oligonucleotide (e.g., two spacers replace two separate nucleosides of the KCNQ2 oligonucleotide).
  • a first spacer and a second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, at least 7 nucleobases, at least 8 nucleobases, at least 9 nucleobases, or at least 10 nucleobases in the oligonucleotide.
  • a first spacer and a second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases. In particular embodiments, the first spacer and the second spacer are not adjacent to one another in the oligonucleotide. [00234] In particular embodiments, the first spacer replaces a nucleoside between positions 7 and 11 of the KCNQ2 oligonucleotide. In various embodiments, the first spacer replaces a nucleoside between positions 8 and 11, positions 9 and 11, positions 10 and 11, positions 7 and 10, positions 7 and 9, positions 7 and 8, positions 8 and 10, positions 8 and 9, or positions 9 and 10 of the KCNQ2 oligonucleotide.
  • the second spacer replaces a nucleoside between positions 14 and 22 of the KCNQ2 oligonucleotide.
  • the second spacer replaces a nucleoside between positions 15 and 22, positions 16 and 22, positions 17 and 22, position 18 and 22, position 19 and 22, positions 20 and 22, positions 21 and 22, positions 15 and 21, position 16 and 21, positions 17 and 21, positions 18 and 21, positions 19 and 21, positions 20 and 21, positions 15 and 20, positions 16 and 20, positions 17 and 20, positions 18 and 20, positions 19 and 20, positions 15 and 19, positions 16 and 19, positions 17 and 19, positions 18 and 19, positions 15 and 18, position 16 and 18, position 17 and 18, positions 15 and 17, positions 16 and 17, or positions 15 and 16 of the KCNQ2 oligonucleotide.
  • the first spacer replaces a nucleoside at position 7 of the KCNQ2 oligonucleotide and the second spacer replaces a nucleoside at position 14 of the KCNQ2 oligonucleotide. In preferred embodiments, the first spacer replaces a nucleoside at position 7 of the KCNQ2 oligonucleotide and the second spacer replaces a nucleoside at position 19 of the KCNQ2 oligonucleotide.
  • the first spacer replaces a nucleoside at position 8 of the KCNQ2 oligonucleotide and the second spacer replaces a nucleoside at position 16 of the KCNQ2 oligonucleotide. In preferred embodiments, the first spacer replaces a nucleoside at position 8 of the KCNQ2 oligonucleotide and the second spacer replaces a nucleoside at position 15 of the KCNQ2 oligonucleotide.
  • the first spacer replaces a nucleoside at position 11 of the KCNQ2 oligonucleotide and the second spacer replaces a nucleoside at position 22 of the KCNQ2 oligonucleotide. In preferred embodiments, the first spacer replaces a nucleoside at position 9 of the KCNQ2 oligonucleotide and the second spacer replaces a nucleoside at position 19 of the KCNQ2 oligonucleotide.
  • a KCNQ2 oligonucleotide includes three spacers that each replace a nucleoside in the KCNQ2 oligonucleotide (e.g., three spacers replace three separate nucleosides of the KCNQ2 oligonucleotide).
  • the first spacer replaces a nucleoside between positions 7 and 11 of the KCNQ2 oligonucleotide.
  • the second spacer replaces a nucleoside between positions 14 and 22 of the KCNQ2 oligonucleotide.
  • the third spacer replaces a nucleoside between positions 21 and 24 of the KCNQ2 oligonucleotide.
  • the first spacer replaces a nucleoside between positions 2 and 5 of the KCNQ2 oligonucleotide.
  • the second spacer replaces a nucleoside between positions 8 and 12 of the KCNQ2 oligonucleotide.
  • the third spacer replaces a nucleoside between positions 18 and 22 of the KCNQ2 oligonucleotide.
  • the three spacers in a KCNQ2 oligonucleotide are positioned such that each of the four segments of the KCNQ2 oligonucleotide are at most 7 linked nucleosides in length.
  • a KCNQ2 oligonucleotide may have a first segment with 7 linked nucleosides connected to a first spacer, then a second segment with 7 linked nucleosides connected on one end to the first spacer and connected on another end to a second spacer, then a third segment with 6 linked nucleosides connected on one end to the second spacer and connected on another end to a third spacer, then a fourth segment with 6 linked nucleosides connected to the third spacer.
  • the one or more spacers are positioned in the oligonucleotide to replace one or more adenosine or thymine nucleosides (as opposed to guanine or cytosine nucleosides).
  • the one or more spacers can replace one, two, three, four, five, six, seven, eight, or nine adenosine or thymine nucleosides in the oligonucleotide.
  • the one or more spacers are positioned in the oligonucleotide to replace one or more guanine or cytosine nucleosides (as opposed to adenosine or thymine nucleosides).
  • the one or more spacers can replace one, two, three, four, five, six, seven, eight, or nine guanine or cytosine nucleosides in the oligonucleotide.
  • the spacers are positioned in the oligonucleotide to replace an equal number of adenosine/thymine nucleosides and guanine/cytosine nucleosides.
  • a first spacer in the oligonucleotide may replace an adenosine/thymine nucleoside and a second spacer in the oligonucleotide may replace a guanine/cytosine nucleoside.
  • the one or more spacers are positioned in the oligonucleotide to control the sequence content in the oligonucleotide.
  • the one or more spacers are positioned such that at least one of the spacers is located adjacent to a guanine group.
  • an oligonucleotide with spacers can include one spacer adjacent to a guanine group, two spacers adjacent to guanine groups, three spacers adjacent to guanine groups, four spacers adjacent to guanine groups, or five spacers adjacent to guanine groups. In one embodiment, if counting from the 5’ end of the oligonucleotide, a spacer immediately precedes a guanine group in the sequence.
  • an oligonucleotide with spacers can include one spacer that immediately precedes a guanine group, two spacers that each immediately precede a guanine group, three spacers that each immediately precede a guanine group, four spacers that each immediately precede a guanine group, or five spacers that each immediately precede a guanine group.
  • a guanine group is immediately succeeded by a spacer.
  • an oligonucleotide with spacers can include one spacer that immediately succeeds a guanine group, two spacers that each immediately succeed a guanine group, three spacers that each immediately succeed a guanine group, four spacers that each immediately succeed a guanine group, or five spacers that each immediately succeed a guanine group.
  • the spacers in the oligonucleotide can be positioned to maximize the number of spacers adjacent to guanine groups.
  • the one or more spacers are positioned in the oligonucleotide to replace one or more adenosine or thymine nucleosides such that the one or more spacers are located adjacent guanine groups.
  • two spacers can replace adenosine or thymine nucleosides in the oligonucleotide, each of the two spacers being located adjacent to a guanine group.
  • the KCNQ2 oligonucleotide with one or more spacers has a particular GC content.
  • GC content is the percentage of nitrogenous bases in the oligonucleotide that are either guanine (G) or cytosine (C).
  • the KCNQ2 oligonucleotide with one or more spacers has at least 10% GC content, at least 20% GC content, at least 25% GC content, at least 30% GC content, at least 35% GC content, at least 40% GC content, at least 45% GC content, at least 50% GC content, at least 55% GC content, at least 60% GC content, at least 65% GC content, at least 75% GC content, at least 80% GC content, at least 85% GC content, at least 90% GC content, or at least 95% GC content.
  • the KCNQ2 oligonucleotide with one or more spacers has at least 30% GC content. In particular embodiments, the KCNQ2 oligonucleotide with one or more spacers has at least 40% GC content. In various embodiments, the one or more spacers are positioned in the KCNQ2 oligonucleotide to maximize GC content. For example, instead of selecting a guanine or cytosine for replacement by a spacer in the KCNQ2 oligonucleotide, a thymine or adenine can be selected for replacement by a spacer.
  • a KCNQ2 oligonucleotide with spacers is designed such that 1) each segment of the KCNQ2 oligonucleotide has at most 7 linked nucleosides and 2) at least two, three, or four spacers are positioned adjacent to a guanine group.
  • a KCNQ2 oligonucleotide with spacers is designed such that 1) each segment of the KCNQ2 oligonucleotide has at most 7 linked nucleosides and 2) each of two spacers precede a guanine group.
  • the inclusion of one or more spacers in the KCNQ2 oligonucleotide does not decrease the effectiveness of the KCNQ2 oligonucleotide with the spacers in restoring full length KCNQ2 protein or full length KCNQ2 mRNA in comparison to the effect of a corresponding KCNQ2 parent oligonucleotide.
  • the inclusion of one or more spacers in the KCNQ2 oligonucleotide increases the effectiveness of the KCNQ2 oligonucleotide with the spacers in restoring full length KCNQ2 protein or full length KCNQ2 mRNA in comparison to the effect of a corresponding KCNQ2 parent oligonucleotide. In various embodiments, the inclusion of one or more spacers in the KCNQ2 oligonucleotide does not decrease the effectiveness of the KCNQ2 oligonucleotide with the spacers in reducing quantity of KCNQ2 transcripts in comparison to the effect of a corresponding KCNQ2 parent oligonucleotide.
  • the inclusion of one or more spacers in the KCNQ2 oligonucleotide increases the effectiveness of the KCNQ2 oligonucleotide with the spacers in reducing quantity of KCNQ2 transcripts in comparison to the effect of a corresponding KCNQ2 parent oligonucleotide.
  • Tables 3A, 3B, 4, and 5 document example KCNQ2 oligonucleotides with one or more spacers and their relation to corresponding KCNQ2 parent oligonucleotides.
  • Each KCNQ2 oligonucleotide is assigned a sequence name.
  • the nomenclature of the sequence name is expressed as “X_spA” (for a KCNQ2 AON with one spacer), “X_spA_spB” (for a KCNQ2 AON with two spacers), or “X_spA_spB_spC” (for a KCNQ2 AON with three spacers).
  • X refers to the length of the KCNQ2 AON
  • A refers to the position in the KCNQ2 AON where the first spacer is located
  • B refers to the position in the KCNQ2 AON where the second spacer is located
  • C refers to the position in the KCNQ2 AON where the third spacer is located.
  • KCNQ2 oligonucleotides include one spacer.
  • the KCNQ2 oligonucleotides are oligonucleotide variants, such as any one of a 23mer, 21mer, or 19mer.
  • the inclusion of a spacer divides up the KCNQ2 oligonucleotide into two separate segments, where at least one of the segments is at most 11 linked nucleosides in length.
  • the inclusion of a spacer divides up the KCNQ2 oligonucleotide into two separate segments, where at least one of the segments is at most 10 linked nucleosides in length.
  • the spacer is located between positions 10 and 15 of the oligonucleotide. In various embodiments, the spacer is located between positions 10 and 12 of the oligonucleotide. In particular embodiments, the spacer is located at position 10 of the oligonucleotide. In particular embodiments, the spacer is located at position 11 of the oligonucleotide. In particular embodiments, the spacer is located at position 12 of the oligonucleotide. In particular embodiments, the spacer is located at position 15 of the oligonucleotide.
  • Example KCNQ2 AONs with one spacer are documented below in Table 3A. Table 3 A: Identification of KCNQ2 AONs with one spacer. Here, each KCNQ2 AON has 2 segments, where at least one of the segments has at most 11 linked nucleosides.
  • KCNQ2 oligonucleotides include two spacers.
  • the inclusion of a spacer divides up the KCNQ2 oligonucleotide into three separate segments, where at least one of the segments is at most 7 linked nucleosides in length.
  • Example KCNQ2 AONs with two spacers are documented below in Table 3B.
  • Table 3B Identification of KCNQ2 AONs with two spacers.
  • each KCNQ2 AON has 3 segments, where at least one of the segments has at most 7 linked nucleosides.
  • KCNQ2 oligonucleotides include three spacers. The inclusion of three spacers divides up the KCNQ2 oligonucleotide into four separate segments. In various embodiments, the three spacers are located at different positions of the KCNQ2 oligonucleotide such that each of the segments of the KCNQ2 oligonucleotide are at most 7 linked nucleosides in length.
  • Example KCNQ2 AONs with three spacers are documented below in Table 4.
  • Table 4 Identification of KCNQ2 AONs or AON variants with three spacers. Here, each KCNQ2
  • AON has 4 segments, where each segment has at most 7 linked nucleosides.
  • othioate linkage an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3 -methoxy propyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a phosphorodiamidate (e.g, comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selen
  • KCNQ2 AONs with one or more spacers are reduced in length in comparison to the KCNQ2 AONs described above in Tables 3B and 4.
  • KCNQ2 AONs may be KCNQ2 oligonucleotide variants with one or more spacers.
  • the KCNQ2 oligonucleotide variants with one or more spacers are 23mers, 21mers, or 19mers.
  • KCNQ2 oligonucleotide variants include two spacers such that the KCNQ2 oligonucleotide variant includes three segments that are divided up by the two spacers.
  • At least one of the three segments has at most 7 linked nucleosides. In various embodiments, each of the three segments has at most 7 linked nueclosides.
  • Example KCNQ2 oligonucleotide variants with one or more spacers are shown below in Table 5.
  • each KCNQ2 AON variant has 3 segments, where each segment has at most 7 linked nucleosides.
  • PMO phosphorodiamidate
  • an antisense oligonucleotide disclosed herein e.g., KCQN2parent oligonucleotides and/or KCQN2 oligonucleotide variants
  • an antisense oligonucleotide disclosed herein e.g., KCQN2 parent oligonucleotides and/or KCQN2 oligonucleotide variants
  • an antisense oligonucleotide disclosed herein (e.g., KCQN2 parent oligonucleotides and/or KCQN2 oligonucleotide variants) comprises two spacers and three LNAs.
  • a spacer and a LNA are located adjacent to one another in an antisense oligonucleotide. For example, if counting from 5’ to 3’, a LNA can be located at a 7 th position of the antisense oligonucleotide and a spacer can be located at a 8 th position of the antisense oligonucleotide.
  • a LNA can be located at a 9 th position of the antisense oligonucleotide and a spacer can be located at a 8 th position of the antisense oligonucleotide.
  • a LNA can be located at a 15 th position of the antisense oligonucleotide and a spacer can be located at a 16 th position of the antisense oligonucleotide.
  • a LNA can be located at a 17 th position of the antisense oligonucleotide and a spacer can be located at a 16 th position of the antisense oligonucleotide.
  • a first spacer is located adjacent to a first LNA and a second spacer is located adjacent to a second LNA in an antisense oligonucleotide.
  • a first LNA can be located at a 7 th position of the antisense oligonucleotide
  • a first spacer can be located at a 8 th position of the antisense oligonucleotide
  • a second LNA can be located at a 15 th position of the antisense oligonucleotide
  • a second spacer can be located at a 16 th position of the antisense oligonucleotide.
  • a first LNA can be located at a 7 th position of the antisense oligonucleotide
  • a first spacer can be located at a 8 th position of the antisense oligonucleotide
  • a second LNA can be located at a 17 th position of the antisense oligonucleotide
  • a second spacer can be located at a 16 th position of the antisense oligonucleotide.
  • a first LNA can be located at a 9 th position of the antisense oligonucleotide
  • a first spacer can be located at a 8 th position of the antisense oligonucleotide
  • a second LNA can be located at a 17 th position of the antisense oligonucleotide
  • a second spacer can be located at a 16 th position of the antisense oligonucleotide.
  • one or more spacers and one or more LNAs are not located adjacent to one another in an antisense oligonucleotide.
  • a LNA can be located at a 4 th position of the antisense oligonucleotide and a spacer can be located at a 8 th position of the antisense oligonucleotide.
  • a LNA can be located at a 20 th position of the antisense oligonucleotide and a spacer can be located at a 16 th position of the antisense oligonucleotide.
  • a first LNA can be located at a 4 th position of the antisense oligonucleotide
  • a first spacer can be located at a 8 th position of the antisense oligonucleotide
  • a second LNA can be located at a 20 th position of the antisense oligonucleotide
  • a second spacer can be located at a 16 th position of the antisense oligonucleotide.
  • a first LNA can be located at a 4 th position of the antisense oligonucleotide
  • a first spacer can be located at a 8 th position of the antisense oligonucleotide
  • a second LNA can be located at a 12 th position of the antisense oligonucleotide
  • a second spacer can be located at a 16 th position of the antisense oligonucleotide
  • a third LNA can be located at a 20 th position of the antisense oligonucleotide.
  • KCNQ2 oligonucleotides and/or KCNQ2 parent oligonucleotides e.g., KCNQ2 oligonucleotides with sequences of any of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5) target KCNQ2 transcripts (for example, a KCNQ2 mRNA comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NO: 1357-1370 in order to increase, restore, rescue, or stabilize levels of expression of KCNQ2 mRNA that is capable of translation to produce
  • target KCNQ2 transcripts for example, a KCNQ2 mRNA
  • KCNQ2 AONs can exhibit at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase of full length KCNQ2 mRNA. In various embodiments, KCNQ2 AONs can exhibit at least a 100%, 200%, 300%, or 400% increase of full length KCNQ2 mRNA. In various embodiments, KCNQ2 AONs can exhibit at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% reduction of mis-spliced KCNQ2 mRNA. In various embodiments, KCNQ2 AONs can exhibit at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase of full length KCNQ2 protein.
  • KCNQ2 AONs can exhibit at least a 100%, 200%, 300%, or 400% increase of full length KCNQ2 protein.
  • the percent increase of the full length KCNQ2 protein is an increase in comparison to a reduced level of full length KCNQ2 protein achieved using a KCNQ2 antisense oligonucleotide.
  • a KCNQ2 antisense oligonucleotide can be used to deplete full length KCNQ2 protein followed by increase of the full length KCNQ2 protein using a KCNQ2 AON.
  • KCNQ2 AONs can exhibit at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full length KCNQ2 protein.
  • the percent rescue of full length KCNQ2 refers to the % of full length KCNQ2 following depletion using a TDP43 antisense oligonucleotide and a treatment using KCNQ2 AONs in comparison to a negative control (e.g., cells that did not undergo depletion or treatment or cells that were treated with a vehicle solution).
  • a nucleoside is a base-sugar combination.
  • nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety.
  • Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2’, 3’ or 5’ hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide.
  • the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide.
  • Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased activity.
  • Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid.
  • Modified Internucleoside Linkages [00259] The naturally occurring internucleoside linkage of RNA and DNA is a 3’ to 5’ phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.
  • Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom.
  • Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous- containing linkages are well known.
  • antisense compounds targeted to a KCNQ2 nucleic acid comprise one or more modified internucleoside linkages.
  • the modified internucleoside linkages are interspersed throughout the antisense compound. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage. In certain embodiments, the antisense compounds targeted to a KCNQ2 nucleic acid comprise at least one phosphodiester linkage and at least one phosphorothioate linkage. Modified Sugar Moieties [00262] Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified.
  • nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds.
  • nucleosides comprise chemically modified ribofuranose ring moieties.
  • chemically modified ribofuranose rings include without limitation, addition of substituent groups (including 5’ and 2’ substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R) or C(R 1 )(R 2 ) (R, R 1 and R 2 are each independently H, C 1 -C 12 alkyl or a protecting group) and combinations thereof.
  • Examples of chemically modified sugars include 2’-F-5’-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on Aug.21, 2008 for other disclosed 5’,2’-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2’-position (see published U.S. Patent Application US2005- 0130923, published on Jun.16, 2005) or alternatively 5’-substitution of a BNA (see PCT International Application WO 2007/134181 Published on Nov.22, 2007 wherein LNA is substituted with for example a 5’-methyl or a 5’-vinyl group).
  • nucleosides having modified sugar moieties include without limitation nucleosides comprising 5’-vinyl, 5’-methyl (R or 5), 4’-S, 2’-F, 2’-OCH3, 2’-OCH2CH3, 2’-O CH2 CH2F and 2’-O(CH2)2OCH3 substituent groups.
  • modified sugar moieties include a 2’-Ome modified sugar moiety, bicyclic sugar moiety, 2’-O-(2-methoxyethyl) (2’-MOE), 2’-deoxy-2’-fluoro nucleoside, 2’-fluoro- ⁇ -D-arabinonucleoside, locked nucleic acid (LNA), constrained ethyl 2’-4’-bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA).
  • LNA locked nucleic acid
  • cEt constrained ethyl 2’-4’-bridged nucleic acid
  • HNA hexitol nucleic acids
  • tricyclic analog e.g., tcDNA
  • bicyclic nucleosides refer to modified nucleosides comprising a bicyclic sugar moiety.
  • examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4’ and the 2’ ribosyl ring atoms.
  • antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4’ to 2’ bridge.
  • Examples of such 4’ to 2’ bridged bicyclic nucleosides include but are not limited to one of the formulae: 4’-(CH2)—O-2’ (LNA); 4’-(CH2)—S-2’; 4’-(CH2)2—O-2’ (ENA); 4’- CH(CH 3 )—O-2’ and 4’-CH(CH 2 OCH 3 )—O-2’ (and analogs thereof see U.S. Pat.
  • Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example ⁇ -L-ribofuranose and ⁇ -D-ribofuranose (see PCT international application PCT/DK98/00393, published on Mar.25, 1999 as WO 99/14226).
  • the bridge of a bicyclic sugar moiety is —[C(Ra)(Rb)]n—, —[— [C(R a )(R b )] n —O—, —C(R a R b )—N(R)—O— or —C(R a R b )—O—N(R)—.
  • the bridge is 4’-CH2-2’, 4’-(CH2)2-2’, 4’-(CH2)3-2’, 4’-CH2—O-2’, 4’-(CH2)2—O- 2’, 4’-CH 2 —O—N(R)-2’ and 4’-CH 2 —N(R)—O-2’-
  • each R is, independently, H, a protecting group or C1-C12 alkyl
  • each Ra and Rb is, independently, H, a protecting group, hydroxyl, C 1 -C 12 alkyl, substituted C 1 -C 12 alkyl, C 2 -C 12 alkenyl, substituted C 2 -C 12 alkenyl, C 2 - C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C 5 -C 7 alicyclic radical, substitute
  • bicyclic nucleosides are further defined by isomeric configuration.
  • a nucleoside comprising a 4’-2’ methylene-oxy bridge may be in the ⁇ -L configuration or in the ⁇ -D configuration.
  • ⁇ -L-methyleneoxy (4’-CH2—O-2’) BNA’s have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372).
  • bicyclic nucleosides include, but are not limited to, ⁇ -L- methyleneoxy (4’-CH2—O-2’) BNA, ⁇ -D-methyleneoxy (4’-CH2—O-2’) BNA, ethyleneoxy (4’- (CH 2 ) 2 —O-2) BNA, aminooxy (4’-CH 2 —O—N(R)-2’) BNA, oxyamino (4’-CH 2 —N(R)—O-2’) BNA, methyl(methyleneoxy) (4’-CH(CH3)—O-2’) BNA, methylene-thio (4’-CH2—S-2’) BNA, methylene-amino (4’-CH 2 —N(R)-2’) BNA, methyl carbocyclic (4’-CH 2 —CH(CH 3 )-2’) BNA, and propylene carbocyclic (4’-(CH2)3-2’) BNA; wherein R is H, C1-C12 al
  • the present disclosure provide, in some embodiments, methods for treating, ameliorating, or preventing a neurological disease and/or a neuropathy further include methods of administering, to a patient, a pharmaceutically acceptable composition, for example, a pharmaceutically acceptable formulation that includes one or more KCNQ2 oligonucleotides.
  • KCNQ2 oligonucleotides can increase, restore, or stabilize KCNQ2 activity, for example, KCNQ2 activity, and/or levels of KCNQ2 expression, for example, KCNQ2 mRNA and/or protein expression.
  • compositions comprising a KCNQ2 oligonucleotide formulated together with one or more pharmaceutically or cosmetically acceptable excipients.
  • formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisternal, intracerebroventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) administration, transmucosal (e.g., buccal, vaginal, and rectal), or for topical use, e.g., as part of a composition suitable for applying topically to skin and/or mucous membrane, for example, a composition in the form of a gel, a paste, a wax, a cream, a spray, a liquid, a foam, a lotion, an ointment, a topical solution, a transdermal patch, a powder, a
  • the present disclosure also provides a pharmaceutical composition
  • a KCNQ2 oligonucleotide or a pharmaceutically acceptable salt thereof for example, a KCNQ2 AON that includes a sequence of any of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371- 1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 or the sequences in Tables 3A, 3B, 4 and 5).
  • compositions comprising a KCNQ2 AON are formulated together with one or more pharmaceutically acceptable excipients.
  • Exemplary compositions provided herein include compositions comprising a KCNQ2 AON, and one or more pharmaceutically acceptable excipients.
  • Formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisternal, intracerebroventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) administration, transmucosal (e.g., buccal, vaginal, and rectal), or for topical use.
  • KCNQ2 AONs described herein can include chemically modified nucleosides, including modified ribonucleosides and modified deoxyribonucleosides.
  • Chemically modified nucleosides include, but are not limited to, uracine, uridine, 2’-O-(2-methoxyethyl) modifications, for example, 2’-O-(2-methoxyethyl)guanosine, 2’-O-(2-methoxyethyl)adenosine, 2’-O-(2- methoxyethyl)cytosine, and 2’-O-(2-methoxyethyl)thymidine.
  • mixed modalities e.g., a combination of a KCNQ2 peptide nucleic acid (PNA) and a KCNQ2 locked nucleic acid (LNA).
  • Chemically modified nucleosides also include, but are not limited to, locked nucleic acids (LNAs), 2’-O-methyl, 2’-fluoro, and 2’-fluoro- ⁇ -D-arabinonucleotide (FANA), and Fluoro Cyclohexenyl nucleic acid (F-CeNA) modifications.
  • LNAs locked nucleic acids
  • FANA 2’-O-methyl, 2’-fluoro, and 2’-fluoro- ⁇ -D-arabinonucleotide
  • FANA Fluoro Cyclohexenyl nucleic acid
  • KCNQ2 AONs described herein can include chemical modifications that promote stabilization of an oligonucleotide’s terminal 5’-phosphate and phosphatase-resistant analogs of 5′-phosphate.
  • Chemical modifications that promote oligonucleotide terminal 5’-phosphate stabilization or which are phosphatase-resistant analogs of 5′-phosphate include, but are not limited to, 5′-methyl phosphonate, 5′-methylenephosphonate, 5′-methylenephosphonate analogs, 5′-E-vinyl phosphonate (5′-E-VP), 5′-phosphorothioate, and 5′-C-methyl analogs.
  • KCNQ2 AONs described herein can include chemically modified nucleosides, for example, 2’ O-methyl ribonucleosides, for example, 2’ O- methyl cytidine, 2’ O-methyl guanosine, 2’ O-methyl uridine, and/or 2’ O-methyl adenosine.
  • KCNQ2 AONs described herein can include one or more chemically modified bases, including a 5-methylpyrimidine, for example, 5-methylcytosine, and/or a 5-methylpurine, for example, 5- methylguanine. Chemically modified bases can further include pseudo-uridine or 5’methoxyuridine. KCNQ2 AONs described herein can include any of the following chemically modified nucleosides: 5-methyl-2’-O-methylcytidine, 5-methyl-2’-O-methylthymidine, 5- methylcytidine, 5-methyluridine, and/or 5-methyl 2’-deoxycytidine.
  • KCNQ2 AONs described herein can include a phosphate backbone where one or more of the oligonucleoside linkages is a phosphate linkage.
  • KCNQ2 AONs described herein may include a modified oligonucleotide backbone, where one or more of the nucleoside linkages of the sequence is selected from the group consisting of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (P
  • At least one (i.e., one or more) internucleoside linkage of the oligonucleotide is a phosphorothioate linkage.
  • one, two, three, or more internucleoside linkages of the oligonucleotide is a phosphorothioate linkage.
  • all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.
  • all of the nucleotide linkages of a KCNQ2 AON of any of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 or the sequences in Tables 3A, 3B, 4 and 5 are phosphorothioate linkages.
  • one or more of the nucleotide linkages of a KCNQ2 AON of any of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 or the sequences in Tables 3A, 3B, 4 and 5 are phosphorothioate linkages.
  • nucleotide linkages of KCNQ2 AON described herein such as any of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 or the sequences in Tables 3A, 3B, 4 and 5 include a mix of phosphodiester and phosphorothioate linkages.
  • nucleoside linkages linking a base at position 3 of a KCNQ2 AON described herein are phosphodiester bonds.
  • the base at position 3 may be linked to each adjacent base (e.g., preceding base and succeeding base) through a phosphodi ester bond.
  • An example 25mer KCNQ2 AON with phosphodiester bonds linking the base at position 3 can be denoted as:
  • nucleobase in the AON can be a nucleobase analog.
  • one of the nucleoside linkages linking a base at position 3 of a KCNQ2 AON described herein is a phosphodiester bond.
  • the base at position 3 may be linked to either the preceding base or the succeeding base through a phosphodiester bond.
  • An example 25mer KCNQ2 AON with a phosphodiester bond linking the base at position 3 to a preceding base can be denoted as:
  • nucleobase in the AON can be a nucleobase analog.
  • nucleobase in the AON can be a nucleobase analog.
  • the KCNQ2 AON in addition to one of the nucleoside linkages linking a base at position 3 of a KCNQ2 AON described herein being a phosphodiester bond, the KCNQ2 AON further includes two spacers.
  • the two spacers can be positioned in the KCNQ2 AON such that the KCNQ2 AON includes a segment with at most 7 linked nucleosides.
  • An example 25mer KCNQ2 AON with two spacers and with a phosphodiester bond linking the base at position 3 to a preceding base can be denoted as:
  • Any nucleobase in the AON can be a nucleobase analog.
  • An example 25mer KCNQ2 AON with two spacers and with a phosphodiester bond linking the base at position 3 to a succeeding base can be denoted as: XXD oXXXXXXXS 1 XXXXXXXXS 2 XXXX where “Si” represents a first spacer, “S 2 ” represents a second spacer, “0” represents a phosphodiester bond and “D” represents the base at position 3.
  • Any nucleobase in the AON can be a nucleobase analog.
  • nucleoside linkages linking a base at position 4 of a KCNQ2 AON described herein are phosphodiester bonds.
  • the base at position 4 may be linked to each adjacent base (e.g., preceding base and succeeding base) through a phosphodiester bond.
  • An example 25mer KCNQ2 AON with phosphodiester bonds linking the base at position 4 can be denoted as:
  • Any nucleobase in the AON can be a nucleobase analog.
  • one of the nucleoside linkages linking a base at position 4 of a KCNQ2 AON described herein is a phosphodiester bond.
  • the base at position 4 may be linked to either the preceding base or the succeeding base through a phosphodiester bond.
  • An example 25mer KCNQ2 AON with a phosphodiester bond linking the base at position 4 to a preceding base can be denoted as:
  • nucleobase in the AON can be a nucleobase analog.
  • nucleobase in the AON can be a nucleobase analog.
  • nucleoside linkages linking both bases at position 3 and position 4 of a KCNQ2 AON described herein are phosphodiester bonds.
  • the base at position 3 may be linked to each adjacent base (e.g., preceding base and succeeding base) through a phosphodiester bond
  • the base at position 4 may be linked to each adjacent base (e.g., preceding base and succeeding base) through a phosphodiester bond.
  • An example 25mer KCNQ2 AON with phosphodiester bonds linking the bases at positions 3 and 4 can be denoted as:
  • KCNQ2 AON described herein include one or more spacers and phosphodiester bonds are located relative to the one or more spacers. In some embodiments, the Y number of bases immediately preceding a spacer are linked through phosphodiester bonds.
  • Y is one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve bases. In particular embodiments, Y is two bases.
  • the spacer can be located at various positions in the KCNQ2 AON and therefore, the 2 bases immediately preceding the spacer can vary within the KCNQ2 AON depending on where the spacer is situated.
  • the KCNQ2 AON may include more than one spacer. In some embodiments, only one of the spacers has Y number of bases immediately preceding the spacer that are linked through phosphodiester bonds. In such embodiments, the other spacers are linked to respective preceding bases through phosphorothioate bonds. In various embodiments, two of the spacers have Y number of bases immediately preceding the spacers that are linked through phosphodiester bonds. In various embodiments, each of the spacers in the KCNQ2 AON have Y number of bases immediately preceding the spacers that are linked through phosphodiester bonds. In various embodiments, all other bases of the KCNQ2 AON are linked through phosphorothioate bonds.
  • Y number of bases immediately preceding a spacer and Z number of bases immediately succeeding a spacer are linked through phosphodiester bonds.
  • Y is one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve bases.
  • Z is one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve bases.
  • Y and Z can be independent of each other.
  • Y is one base and Z is one base.
  • the spacer is located at position 15, the bases at positions 14 and 16 of the KCNQ2 AON are each linked to their respective adjacent bases through phosphodiester bonds.
  • such a KCNQ2 AON (e.g., 25mer) can be denoted as:
  • the spacer can be located at various positions in the KCNQ2 AON and therefore, the bases immediately preceding or immediately succeeding the spacer can vary within the KCNQ2 AON depending on where the spacer is situated.
  • the KCNQ2 AON may include more than one spacer.
  • only one of the spacers has Y number of bases immediately preceding the spacer and Z number of bases immediately succeeding the spacer that are linked through phosphodiester bonds.
  • the other spacers of the KCNQ2 AON are linked to respective preceding and succeeding bases through phosphorothioate bonds.
  • such a KCNQ2 AON e.g., 25mer
  • XXXXODOS 1 OEOXXXXXXXXXS 2 XXXXX where “Si” represents a first spacer, “S 2 ” represents a second spacer, “0” represents a phosphodiester bond, “D” represents a base immediately preceding the spacer, and “E” represents the base immediately succeeding the spacer.
  • Any nucleobase in the AON can be a nucleobase analog.
  • KCNQ2 AON e.g., 25mer
  • XXXXXS 1 XXXXXXXXXXODOS 2 0D0XXXXX where “Si” represents a first spacer, “S 2 ” represents a second spacer, “0” represents a phosphodiester bond, “D” represents a base immediately preceding the spacer, and “E” represents the base immediately succeeding the spacer.
  • Any nucleobase in the AON can be a nucleobase analog.
  • one of the spacers is linked to the immediately preceding base through a phosphodiester bond.
  • a KCNQ2 AON includes a first spacer that is linked to the immediately preceding base through a phosphodiester bond, which can be denoted as:
  • Any nucleobase in the AON can be a nucleobase analog.
  • a KCNQ2 AON includes a second spacer that is linked to the immediately preceding base through a phosphodiester bond, which can be denoted as:
  • Any nucleobase in the AON can be a nucleobase analog.
  • the KCNQ2 AON may be a AON variant (e.g., a 23mer, a 21mer, or a 19mer) where one of the spacers is linked to the immediately preceding base through a phosphodiester bond.
  • the KCNQ2 AON may be a 21mer with a first spacer that is linked to the immediately preceding base through a phosphodiester bond, which can be denoted as:
  • Any nucleobase in the AON can be a nucleobase analog.
  • the KCNQ2 AON may be a 21mer with a second spacer that is linked to the immediately preceding base through a phosphodiester bond, which can be denoted as:
  • Any nucleobase in the AON can be a nucleobase analog.
  • the KCNQ2 AON may be a AON variant (e.g., a 23mer, a 21mer, or a 19mer) where one of the spacers is linked to the immediately preceding base through a phosphodiester bond and the immediately preceding base is further linked to the preceding base through a phosphodiester bond.
  • An example 21mer KCNQ2 AON can be denoted as:
  • XXXEODOS 1 XXXXXS 2 XXXXX
  • Si represents a first spacer
  • S 2 represents a second spacer
  • 0 represents a phosphodiester bond
  • D represents the base immediately preceding Si
  • E represents the base immediately preceding "D.”
  • Any nucleobase in the AON can be a nucleobase analog.
  • a 21mer KCNQ2 AON can be denoted as:
  • Any nucleobase in the AON can be a nucleobase analog.
  • the KCNQ2 AON may be a AON variant (e.g., a 23mer, a 21mer, or a 19mer) where a base that immediately precedes a first spacer is linked to another base through a phosphodiester bond.
  • the base that immediately precedes the first spacer may be linked to the first spacer through a non-phosphodiester bond, such as a phosphorothioate bond.
  • a second spacer is linked to an immediately preceding base through a phosphodiester bond.
  • An example of a 21mer KCNQ2 AON can be denoted as:
  • XXXEoD S 1 XXXXXoS 2 XXXXX
  • Si represents a first spacer
  • S 2 represents a second spacer
  • 0 represents a phosphodiester bond
  • D represents the base immediately preceding Si
  • E represents the base immediately preceding “D.”
  • the base “D” is linked to the first spacer Si through a non-phosphodiester bond (e.g., phosphorothioate bond).
  • the base “D” is linked to base “E” through a phosphodiester bond.
  • the second spacer S 2 is linked to an immediately preceding base through a phosphodiester bond.
  • Any nucleobase in the AON can be a nucleobase analog.
  • Si represents a first spacer
  • S 2 represents a second spacer
  • 0 represents a phosphodiester bond
  • D represents the base immediately preceding S 2
  • E represents the base immediately preceding “D.”
  • the base “D” is linked to the second spacer S 2 through a non-phosphodiester bond (e.g., phosphorothioate bond).
  • the base “D” is linked to base “E” through a phosphodiester bond.
  • the first spacer Si is linked to an immediately preceding base through a phosphodi ester bond.
  • Any nucleobase in the AON can be a nucleobase analog.
  • one of the spacers is linked to the immediately succeeding base through a phosphodiester bond.
  • a KCNQ2 AON includes a first spacer that is linked to the immediately succeeding base through a phosphodiester bond, which can be denoted as:
  • Any nucleobase in the AON can be a nucleobase analog.
  • a KCNQ2 AON includes a second spacer that is linked to the immediately succeeding base through a phosphodiester bond, which can be denoted as:
  • Any nucleobase in the AON can be a nucleobase analog.
  • the KCNQ2 AON may be a AON variant (e.g., a 23mer, a 21mer, or a 19mer) where one of the spacers is linked to the immediately succeeding base through a phosphodiester bond.
  • the KCNQ2 AON may be a 21mer with a first spacer that is linked to the immediately succeeding base through a phosphodiester bond, which can be denoted as:
  • Any nucleobase in the AON can be a nucleobase analog.
  • the KCNQ2 AON may be a 21mer with a second spacer that is linked to the immediately succeeding base through a phosphodiester bond, which can be denoted as:
  • Any nucleobase in the AON can be a nucleobase analog.
  • two of the spacers have Y number of bases immediately preceding the spacers and Z number of bases immediately succeeding the spacers that are linked through phosphodiester bonds.
  • each of the spacers in the KCNQ2 AON have Y number of bases immediately preceding the spacers and Z number of bases immediately succeeding the spacers that are linked through phosphodi ester bonds.
  • An example of such a KCNQ2 AON (e.g., 25mer) can be denoted as:
  • XXXXODOS 1 OEOXXXXXXXXXOFOS 2 OHOXXXX
  • Si represents a first spacer
  • S 2 represents a second spacer
  • 0 represents a phosphodiester bond
  • D represents a base immediately preceding the first spacer
  • E represents the base immediately succeeding the first spacer
  • F represents a base immediately preceding the second spacer
  • H represents the base immediately succeeding the second spacer.
  • all other bases of the KCNQ2 AON are linked through phosphorothioate bonds. Any nucleobase in the AON can be a nucleobase analog.
  • KCNQ2 AON includes two or more spacers and a range of bases located between the two spacers are linked through phosphodiester bonds.
  • the range of bases include two, three, four, five, six, or seven bases linked through phosphodiester bonds.
  • the range of bases include two bases linked through phosphodiester bonds.
  • the range of bases include four bases linked through phosphodiester bonds.
  • all other bases of the KCNQ2 AON are linked through phosphorothioate bonds. Any nucleobase in the AON can be a nucleobase analog.
  • the range of bases linked through phosphodiester bonds are positioned Y number of bases succeeding the first spacer and Z number of preceding the second spacer.
  • Y is one, two, three, four, five, six, or seven bases.
  • Z is one, two, three, four, five, six, or seven bases.
  • Y and Z can be independent on each other. Any nucleobase in the AON can be a nucleobase analog.
  • Y is five bases and Z is four bases.
  • KCNQ2 AON e.g., 25mer
  • Si represents a first spacer
  • S 2 represents a second spacer
  • 0 represents a phosphodiester bond
  • the bases “D,” “E,” “F,” and “H” represent the range of bases that are linked through phosphodi ester bonds. In this example, the range of bases is located five bases after the first spacer (e.g., D is positioned five bases after the first spacer) and the range of bases is located four bases preceding the second spacer (e.g., H is positioned four bases before the second spacer).
  • Any nucleobase in the AON can be a nucleobase analog.
  • Y is four bases and Z is three bases.
  • KCNQ2 AON e.g., 23mer
  • XXXXXXXS 1 XXXODOEOXXS 2 XXXXXX
  • Si represents a first spacer
  • S 2 represents a second spacer
  • 0 represents a phosphodiester bond
  • the bases “D” and “E” represent the range of bases that are linked through phosphodiester bonds. In this example, the range of bases is located four bases after the first spacer (e.g., D is positioned four bases after the first spacer) and the range of bases is located three bases preceding the second spacer (e.g., E is positioned three bases before the second spacer).
  • the positions of the two spacers differ than shown above and therefore, the range of bases linked through phosphodiester bonds are differently positioned. In various embodiments, all other bases of the KCNQ2 AON are linked through phosphorothioate bonds. Any nucleobase in the AON can be a nucleobase analog.
  • a disclosed KCNQ2 AON may have at least one modified nucleobase, e.g., 5 -methylcytosine, and/or at least one methylphosphonate nucleotide, which is placed, for example, either at only one of the 5' or 3' ends or at both 5' and 3' ends or along the oligonucleotide sequence.
  • modified nucleobase e.g., 5 -methylcytosine
  • methylphosphonate nucleotide which is placed, for example, either at only one of the 5' or 3' ends or at both 5' and 3' ends or along the oligonucleotide sequence.
  • KCNQ2 AONs may include at least one modified sugar.
  • the sugar moiety of at least one nucleotide constituting the oligonucleotide is a ribose in which the 2'-OH group may be replaced by any one selected from the group consisting of OR, R, R'OR, SH, SR, NH2, NR2, N3, CN, F, Cl, Br, and I (wherein R is an alkyl or aryl and R ⁇ is an alkylene).
  • modified sugar moiety examples include a 2’-Ome modified sugar moiety, bicyclic sugar moiety, 2’-O-(2- methoxyethyl) (2’MOE or MOE), 2’-O-(N-methylacetamide), 2’-deoxy-2’-fluoro nucleoside, 2’- fluoro- ⁇ -D-arabinonucleoside, locked nucleic acid (LNA), constrained ethyl 2’-4’-bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA).
  • LNA locked nucleic acid
  • cEt constrained ethyl 2’-4’-bridged nucleic acid
  • HNA hexitol nucleic acids
  • tricyclic analog e.g., tcDNA
  • KCNQ2 AONs comprise 2’OMe (e.g., a KCNQ2 AON comprising one or more 2’OMe modified sugar), 2’MOE or MOE (e.g., a KCNQ2 AON comprising one or more 2’MOE modified sugar), PNA (e.g., a KCNQ2 AON comprising one or more N-(2-aminoethyl)-glycine units linked by amide bonds or carbonyl methylene linkage as repeating units in place of a sugar-phosphate backbone), LNA (e.g., a KCNQ2 AON comprising one or more locked ribose, and can be a mixture of 2’-deoxy nucleotides or 2’OMe nucleotides), c-ET (e.g., a KCNQ2 AON comprising one or more cET sugar), cMOE (e.g., a KCNQ2 AON comprising one or
  • a KCNQ2 AON comprises one or more phosphorothioate linkage, phosphodiester linkage, phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, morpholino linkage, PNA linkage, or any combination of phosphorothioate linkage, phosphodiester linkage, a phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage, morpholino linkage, and PNA linkage.
  • a KCNQ2 AON comprises one or more phosphorothioate linkage, phosphodiester linkage, or a combination of phosphorothioate and phosphodiester linkages.
  • KCNQ2 AONs with a sequence of any one of SEQ ID NOs: 1- 176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5 is a chirally controlled oligonucleotide, such as a chirally controlled oligonucleotide described in any of US Patent No.9,982,257, US Patent No.10,590,413, US 10,724,035, US 10,450,568, and PCT Publication No.
  • a KCNQ2 AON with a sequence of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5 is a chirally controlled oligonucleotide comprising a plurality of oligonucleotides of at least one type, wherein each type is defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone X-moieties (—X-L-R 1 ); wherein: the oligonucleotides of at least one type comprise one or more phosphorothioate triester internucleotidic linkages and one or more phosphate diester linkage; the
  • a KCNQ2 AON with a sequence of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 or the sequences in Tables 3A, 3B, 4 and 5 is a chirally controlled oligonucleotide comprising certain chemical modifications (e.g., 2’F (2’ Fluoro, which contains a fluorine molecule at the 2’ ribose position (instead of 2’-hydroxyl group in an RNA monomer)), 2’-Ome, phosphorothioate linkages, lipid conjugation, etc.), as described in U.S.
  • Motor neuron diseases are a group of diseases characterized by loss of function of motor neurons that coordinate voluntary movement of muscles by the brain. Motor neuron diseases may affect upper and/or lower motor neurons, and may have sporadic or familial origins. Motor neuron diseases include amyotrophic lateral sclerosis (ALS or Lou Gehrig’s disease), progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, post-polio syndrome, and ALS with frontotemporal dementia.
  • ALS amyotrophic lateral sclerosis
  • pseudobulbar palsy progressive muscular atrophy
  • primary lateral sclerosis spinal muscular atrophy
  • post-polio syndrome post-polio syndrome
  • Symptoms of motor neuron diseases include muscle decay or weakening, muscle pain, spasms, slurred speech, difficulty swallowing, loss of muscle control, joint pain, stiff limbs, difficulty breathing, drooling, and complete loss of muscle control, including over basic functions such as breathing, swallowing, eating, speaking, and limb movement. These symptoms are also sometimes accompanied by depression, loss of memory, difficulty with planning, language deficits, altered behavior, and difficulty assessing spatial relationships and/or changes in personality.
  • Motor neuron diseases can be assessed and diagnosed by a clinician of skill, for example, a neurologist, using various tools and tests.
  • ALS is a progressive motor neuron disease that disrupts signals to all voluntary muscles. ALS results in atrophy of both upper and lower motor neurons.
  • ALS Symptoms of ALS include weakening and wasting of the bulbar muscles, general and bilateral loss of strength, spasticity, muscle spasms, muscle cramps, fasciculations, slurred speech, and difficulty breathing or loss of ability to breathe. Some individuals with ALS also suffer from cognitive decline. At the molecular level, ALS is characterized by protein and RNA aggregates in the cytoplasm of motor neurons, including aggregates of the RNA-binding protein TDP43. [00321] ALS is most common in males above 40 years of age, although it can also occur in women and children. Risk of ALS is also heightened in individuals who smoke, are exposed to chemicals such as lead, or who have served in the military.
  • ALS sporadic, while only about 10% of cases are familial.
  • causes of ALS include sporadic or inherited genetic mutations, high levels of glutamate, protein mishandling.
  • Genetic mutations associated with ALS include mutations in the genes SOD1, C9orf72, TARDBP, FUS, ANG, ATXN2, CHCHD10, CHMP2B, DCTN1, ErbB4, FIG4, HNRPA1, MATR3, NEFH, OPTN, PFN1, PRPH, SETX, SIGMAR1, SMN1, SPG11, SQSTM1, TBK1, TRPM7, TUBA4A, UBQLN2, VAPB, and VCP.
  • Frontotemporal Dementia is a form of dementia that affects the frontal and temporal lobes of the brain.
  • FTD includes frontotemporal lobar degeneration (FTLD). It has an earlier average age of onset than Alzheimer’s disease – 40 years of age.
  • Symptoms of FTD include extreme changes in behavior and personality, speech and language problems, and movement-related symptoms such as tremor, rigidity, muscle spasm, weakness, and difficulty swallowing.
  • Subtypes of FTD include behavior variant frontotemporal dementia (bvFTD), characterized by changes in personality and behavior, and primary progressive aphasia (PPA), which affects language skills, speaking, writing and comprehension.
  • bvFTD behavior variant frontotemporal dementia
  • PPA primary progressive aphasia
  • FTD is associated with tau protein accumulation (Pick bodies) and altered TDP43 function. About 30% of cases of FTD are familial, and no other risk factors other than family history of the disease are known. Genetic mutations associated with FTD include mutations in the genes C9orf72, Progranulin (GRN), microtubule-associated protein tau (MAPT), UBQLN2, VPC, CHMP2B, TARDBP, FUS, ITM2B, CHCHD10, SQSTM1, PSEN1, PSEN2, CTSF, CYP27A1, TBK1 and TBP.
  • Amyotrophic lateral sclerosis with frontotemporal dementia is a clinical syndrome in which FTD and ALS occur in the same individual.
  • mutations in C9orf72 are the most common cause of familial forms of ALS and FTD.
  • mutations in TBK1, VCP, SQSTM1, UBQLN2 and CHMP2B are also associated with ALS with FTD.
  • ALS with FTD include dramatic changes in personality, as well as muscle weakness, muscle atrophy, fasciculations, spasticity, dysarthria, dysphagia, and degeneration of the spinal cord, motor neurons, and frontal and temporal lobes of the brain.
  • ALS with FTD is characterized by the accumulation of TDP-43 and/or FUS proteins.
  • TBK1 mutations are associated with ALS, FTD, and ALS with FTD.
  • Limbic-predominant age-related TDP-43 encephalopathy is characterized by accumulation of misfolded TDP-43 protein in the brain, specifically in the limbic system. LATE is a neurological disorder that typically manifests in older patients (e.g., greater than 80 years old). LATE can be a diagnosis for dementia and LATE often mimics the symptoms of Alzheimer’s Disease including memory loss, confusion, and mood changes.
  • the disclosure contemplates, in part, treating neurological diseases including any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), and Limbic-predominant age-related TDP-43 encephalopathy (LATE) in a patient in need thereof comprising administering a KCNQ2 AON.
  • methods for treatment of a neurological disease in a patient in need thereof comprising administering a disclosed KCNQ2 AON.
  • an effective amount of a disclosed KCNQ2 oligonucleotide may be administered to a patient in need thereof to treat a neurological disease, and/or to increase, restore, or stabilize expression of KCNQ2 mRNA that is capable of translation to produce a functional KCNQ2 protein, thereby increase, restore, or stabilize KCNQ2 activity and/or function.
  • treating a neurological disease comprises at least ameliorating or reducing one symptom associated with the neurological disease (for example, reducing muscle weakness in a patient with ALS).
  • Methods of treating a neurological disease for example, ALS, FTD, or ALS with FTD
  • a neurological disease for example, ALS, FTD, or ALS with FTD
  • methods of slowing the progression of a neurological disease for example, a motor neuron disease
  • methods of treating, reducing the risk of developing, or delaying the onset of a neurological disease in a subject in need thereof comprising administering a disclosed KCNQ2 AON.
  • the methods include for example, treating a subject at risk of developing a neurological disease; e.g., administering to the subject an effective amount of a disclosed KCNQ2 AON.
  • Neurological diseases that can be treated in this manner include motor neuron diseases, ALS, FTD, ALS with FTD, progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, and post-polio syndrome.
  • Methods of preventing or treating neurological diseases form part of this disclosure. Such methods may comprise administering to a patient in need thereof or a patient at risk, a pharmaceutical preparation comprising a KCNQ2 AON disclosed herein.
  • a method of preventing or treating a neurological disease comprising administering to a patient in need thereof a KCNQ2 AON disclosed herein.
  • Patients treated using an above method may experience an increase, restoration of, or stabilization of KCNQ2 mRNA expression, which is capable of translation to produce a functional KCNQ2 protein, of at least about 5%, 10%, 20%, 30%, 40% or even 50%, thereby increase, restore, or stabilize KCNQ2 activity and/or function in a target cell (for example, a motor neuron) after administering a KCNQ2 oligonucleotide e.g. after 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 1 month, 2 months, 3, months, 4 months, 5, months, or 6 months or more.
  • a target cell for example, a motor neuron
  • administering such a KCNQ2 oligonucleotide may be on, e.g., at least a daily basis.
  • the KCNQ2 oligonucleotide may be administered orally.
  • the KCNQ2 oligonucleotide is administered intrathecally, intrathalamically, or intracisternally.
  • a KCNQ2 oligonucleotide is administered intrathecally, intrathalamically or intracisternally about every 3 months.
  • KCNQ2 oligonucleotides can be used alone or in combination with each other whereby at least two KCNQ2 oligonucleotides are used together in a single composition or as part of a treatment regimen. KCNQ2 oligonucleotides may also be used in combination with other drugs or AON for treating neurological diseases or conditions.
  • a method for treating amyotrophic lateral sclerosis (ALS) in a subject in need thereof comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate link
  • a method for treating frontotemporal dementia (FTD) in a subject in need thereof comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 or the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a
  • a method for treating amyotrophic lateral sclerosis (ALS) with frontotemporal dementia (FTD) in a subject in need thereof comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage,
  • a patient refers to any animal at risk for, suffering from or diagnosed with a neurological disease, including, but not limited to, mammals, primates, and humans.
  • the patient may be a non-human mammal such as, for example, a cat, a dog, or a horse.
  • a patient may be an individual diagnosed with a high risk of developing a neurological disease, someone who has been diagnosed with a neurological disease, someone who previously suffered from a neurological disease, or an individual evaluated for symptoms or indications of a neurological disease, for example, any of the signs or symptoms associated with neurological diseases such as: amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), and TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia, Limbic-predominant age-related TDP-43 encephalopathy (LATE)),
  • a patient in need refers to a patient suffering from any of the symptoms or manifestations of a neurological disease, a patient who may suffer from any of the symptoms or manifestations of a neurological disease, or any patient who might benefit from a method of the disclosure for treating a neurological disease.
  • a patient in need may include a patient who is diagnosed with a risk of developing a neurological disease, a patient who has suffered from a neurological disease in the past, or a patient who has previously been treated for a neurological disease.
  • Effective amount refers to the amount of an agent that is sufficient to at least partially treat a condition when administered to a patient.
  • an effective amount of a disclosed KCNQ2 oligonucleotide is the amount of the KCNQ2 oligonucleotide necessary to treat a neurological disease in a patient such that administration of the agent prevents a neurological disease from occurring in a subject, prevents neurological disease progression (e.g., prevents the onset or increased severity of symptoms of the neurological such as muscle weakening, spasms, or fasciculation), or relieves or completely ameliorates all associated symptoms of a neurological disease, i.e. causes regression of the disease.
  • Efficacy of treatment may be evaluated by means of evaluation of gross symptoms associated with a neurological disease, analysis of tissue histology, biochemical assay, imaging methods such as, for example, magnetic resonance imaging, or other known methods. For instance, efficacy of treatment may be evaluated by analyzing gross symptoms of the disease such as changes in muscle strength and control or other aspects of gross pathology associated with a neurological disease following administration, to a patient suffering from a neurological disease, a disclosed KCNQ2 oligonucleotide.
  • Efficacy of treatment may also be evaluated at the tissue or cellular level, for example, by means of obtaining a tissue biopsy (e.g., a brain, spinal, muscle, motor neuron tissue biopsy, or olfactory neurosphere cell biopsy) and evaluating gross tissue or cell morphology or staining properties. Biochemical assays that examine protein or RNA expression may also be used to evaluate efficacy of treatment.
  • a tissue biopsy e.g., a brain, spinal, muscle, motor neuron tissue biopsy, or olfactory neurosphere cell biopsy
  • Biochemical assays that examine protein or RNA expression may also be used to evaluate efficacy of treatment.
  • RNA levels may be evaluated via immunocytochemical, immunohistochemical, Western blotting, or Northern blotting methods, or methods useful for evaluating RNA levels such as quantitative or semi-quantitative polymerase chain (e.g., digital PCR (DigitalPCR, dPCR, or ddPCR), qPCR etc.) reaction.
  • quantitative or semi-quantitative polymerase chain e.g., digital PCR (DigitalPCR, dPCR, or ddPCR), qPCR etc.
  • useful biomarkers e.g., neurofilament light (NEFL), neurofilament heavy (NEFH), TDP-43 or p75 extracellular domain (p75 E
  • urinary neurotrophin receptor p75 extracellular domain is a disease progression and prognostic biomarker in amyotrophic lateral sclerosis (ALS).
  • CSF pNFH Phosphorylated neurofilament heavy chain
  • CSF pNFH as a prognostic biomarker for clinical trials, which will increase the likelihood of successfully developing a treatment for c9ALS.
  • suitable controls may be chosen to ensure a valid assessment. For instance, one can compare symptoms evaluated in a patient with a neurological disease following administration of a disclosed KCNQ2 oligonucleotide to those symptoms in the same patient prior to treatment or at an earlier point in the course of treatment or in another patient not diagnosed with the neurological disease.
  • Validation of KCNQ2 oligonucleotides may be determined by direct or indirect assessment of KCNQ2 expression levels or activity.
  • biochemical assays that measure KCNQ2 protein or RNA expression may be used to evaluate overall effect on KCNQ2 transcripts) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370.
  • 90% e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%
  • one may measure KCNQ2 protein levels in cells or tissue by Western blot to evaluate overall KCNQ2 levels.
  • KCNQ2 mRNA levels by means of Northern blot or quantitative polymerase chain reaction to determine overall effect on KCNQ2 transcripts (for example, a KCNQ2 pre-mRNA) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370.
  • a KCNQ2 pre-mRNA comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370.
  • Modulation of expression levels of KCNQ2 transcripts comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370 may also be evaluated indirectly by measuring parameters such as autophagy, endocytosis, protein aggregation, and the presence or level of expression of useful biomarkers (e.g., neurofilament light (NEFL), neurofilament heavy (NEFH), TDP-43, or p75 ECD found in plasma, spinal cord fluid, cerebrospinal fluid, extracellular vesicles (for example, CSF exosomes), blood, urine, lymphatic fluid, fecal matter, or tissue to evaluate the modulation of expression of KCNQ2 transcripts (for example, a KCNQ2 pre-mRNA ) comprising a sequence that
  • Modulation of expression levels of KCNQ2 transcripts (for example, a KCNQ2 pre-mRNA) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370 may also be evaluated indirectly by measuring parameters such as autophagy, endocytosis, protein aggregation, and the presence or level of expression of physiological biomarkers such as compound muscle action potential (CMAP). Additional measurements may include strength duration time constant (SDTC), short interval cortical inhibition (SICI), dynamometry, accurate test of limb isometric strength (ATLIS), compound muscle action potential, and ALSFRS-R.
  • SDTC strength duration time constant
  • SICI short interval cortical inhibition
  • ATLIS accurate test of limb isometric strength
  • compound muscle action potential and ALSFRS-R.
  • urinary neurotrophin receptor p75 extracellular domain is a disease progression and prognostic biomarker in amyotrophic lateral sclerosis (ALS).
  • Phosphorylated neurofilament heavy chain (pNFH) in cerebrospinal fluid (CSF) predict disease status and survival in c9ALS patients.
  • CSF pNFH as a prognostic biomarker for clinical trials, which will increase the likelihood of successfully developing a treatment for c9ALS.
  • the disclosure also provides methods of restoring expression of full length KCNQ2 transcripts in cells of a patient suffering from a neurological disease.
  • Full length KCNQ2 transcripts may be restored in any cell in which KCNQ2 expression or activity occurs, including cells of the nervous system (including the central nervous system (e.g., spinal cord or brain), the peripheral nervous system, motor neurons, glial cells, astrocytes, oligodendrocytes, microglia, the brain, the brain stem, the frontal lobes, the temporal lobes, the spinal cord), the musculoskeletal system, spinal fluid, and cerebrospinal fluid.
  • Cells of the musculoskeletal system include skeletal muscle cells (e.g., myocytes).
  • Motor neurons include upper motor neurons and lower motor neurons.
  • compositions and Routes of Administration [00343] The present disclosure also provides methods for treating a neurological disease via administration of a pharmaceutical composition comprising a disclosed KCNQ2 oligonucleotide.
  • the disclosure provides a pharmaceutical composition for use in treating a neurological disease.
  • the pharmaceutical composition may be comprised of a disclosed KCNQ2 oligonucleotide, and a pharmaceutically acceptable carrier.
  • pharmaceutical composition means, for example, a mixture containing a specified amount of a therapeutic compound, e.g., a therapeutically effective amount, of a therapeutic compound in a pharmaceutically acceptable carrier to be administered to a mammal, e.g., a human, in order to treat a neurological disease.
  • compositions comprising a disclosed KCNQ2 oligonucleotide, and a pharmaceutically acceptable carrier.
  • the disclosure provides use of a disclosed KCNQ2 oligonucleotide in the manufacture of a medicament for treating a neurological disease.
  • Medical composition has essentially the same meaning as the term “pharmaceutical composition.”
  • pharmaceutically acceptable carrier means buffers, carriers, and excipients suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • the carrier(s) should be “acceptable” in the sense of being compatible with the other ingredients of the formulations and not deleterious to the recipient.
  • Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is known in the art.
  • the pharmaceutical composition is administered orally and includes an enteric coating suitable for regulating the site of absorption of the encapsulated substances within the digestive system or gut.
  • an enteric coating can include an ethylacrylate-methacrylic acid copolymer.
  • a disclosed KCNQ2 oligonucleotide and any pharmaceutical composition thereof may be administered by one or several routes, including topically, intrathecally, intrathalamically, intracisternally, parenterally, orally, rectally, buccally, sublingually, vaginally, pulmonarily, intratracheally, intranasally, transdermally, or intraduodenally.
  • parenteral as used herein includes subcutaneous injections, intrapancreatic administration, intravenous, intracisternal, intracerebroventricular, intrathecal, intrathalamic, intramuscular, intraperitoneal, intrasternal injection or infusion techniques.
  • a disclosed KCNQ2 oligonucleotide may be administered subcutaneously to a subject.
  • a disclosed KCNQ2 oligonucleotide may be administered orally to a subject.
  • a disclosed KCNQ2 oligonucleotide may be administered directly to the nervous system, or specific regions or cells of the nervous system (e.g., the brain, brain stem, lower motor neurons, spinal cord, upper motor neurons) via parenteral administration, for example, a disclosed KCNQ2 oligonucleotide may be administered intrathecally, intrathalamically, intracisternally, or intracerebroventricularly.
  • a KCNQ2 oligonucleotide for example a KCNQ2 AON
  • a KCNQ2 oligonucleotide can be exposed to calcium-containing buffers prior to administration.
  • Such calcium-containing buffers can mitigate toxicity adverse effects of the KCNQ2 oligonucleotide.
  • Further details of exposing an example antisense oligonucleotide to calcium-containing buffers is described in Moazami, et al., Quantifying and Mitigating Motor Phenotypes Induced by Antisense Oligonucleotides in the Central Nervous System, bioRxiv 2021.02.14.431096, which is hereby incorporated by reference in its entirety.
  • a KCNQ2 oligonucleotide for example a KCNQ2 AON
  • a KCNQ2 oligonucleotide can be encapsulated in a nanoparticle coating. It is believed that nanoparticle encapsulation prevents AON degradation and enhances cellular uptake.
  • a KCNQ2 oligonucleotide is encapsulated in a coating of a cationic polymer, for example, a synthetic polymer (e.g., poly-L-lysine, polyamidoamine, a poly( ⁇ -amino ester), and polyethyleneimine) or a naturally occurring polymer (e.g., chitosan and a protamine).
  • a cationic polymer for example, a synthetic polymer (e.g., poly-L-lysine, polyamidoamine, a poly( ⁇ -amino ester), and polyethyleneimine) or a naturally occurring polymer (e.g., chito
  • a KCNQ2 oligonucleotide is encapsulated in a lipid or lipid-like material, for example, a cationic lipid, a cationic lipid-like material, or an ionizable lipid that is positively charged only at an acidic pH.
  • a lipid nanoparticle nucleotide therapy includes Exicure’s XCUR-FXN, a lipid- nanoparticle spherical nucleic acid (SNA)-based therapeutic candidate.
  • a KCNQ2 oligonucleotide is encapsulated in a lipid nanoparticle that includes hydrophobic moieties, e.g., cholesterol and/or a polyethylene glycol (PEG) lipid.
  • hydrophobic moieties e.g., cholesterol and/or a polyethylene glycol (PEG) lipid.
  • PEG polyethylene glycol
  • compositions in some embodiments, are sterile. Sterilization can be accomplished, for example, by filtration through sterile filtration membranes. Where the composition is lyophilized, filter sterilization can be conducted prior to or following lyophilization and reconstitution.
  • Parenteral Administration [00350] The pharmaceutical compositions of the disclosure can be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intracisternal, intracerebroventricular, intramuscular, subcutaneous, intrathecal, intrathalamic, intralesional, or intraperitoneal routes.
  • an aqueous composition such as an aqueous pharmaceutical composition containing a disclosed KCNQ2 oligonucleotide
  • an aqueous pharmaceutical composition containing a disclosed KCNQ2 oligonucleotide will be known to those of skill in the art in light of the present disclosure.
  • such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for using to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including normal saline, artificial cerebrospinal fluid, sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • Solutions of active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. In addition, sterile, fixed oils may be employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables.
  • the sterile injectable preparation may also be a sterile injectable solution, suspension, or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol.
  • a nontoxic parenterally acceptable diluent or solvent for example, as a solution in 1,3-butanediol.
  • acceptable vehicles and solvents that may be employed are water, Ringer’s solution, U.S.P., and isotonic sodium chloride solution.
  • a disclosed KCNQ2 antisense oligonucleotide may be suspended in a carrier fluid comprising 1% (w/v) sodium carboxymethylcellulose and 0.1% (v/v) TWEENTM 80. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • Injectable preparations for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents.
  • dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above.
  • Sterile injectable solutions of the disclosure may be prepared by incorporating a disclosed KCNQ2 antisense oligonucleotide in the required amount of the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization.
  • the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
  • the injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter.
  • the preparation of more, or highly concentrated solutions for intramuscular injection is also contemplated. In this regard, the use of DMSO as solvent is preferred as this will result in extremely rapid penetration, delivering high concentrations of the disclosed oligonucleotide to a small area.
  • Suitable preservatives for use in such a solution include benzalkonium chloride, benzethonium chloride, chlorobutanol, thimerosal and the like.
  • Suitable buffers include boric acid, sodium and potassium bicarbonate, sodium and potassium borates, sodium and potassium carbonate, sodium acetate, sodium biphosphate and the like, in amounts sufficient to maintain the pH at between about pH 6 and pH 8, and for example, between about pH 7 and pH 7.5.
  • Suitable tonicity agents are dextran 40, dextran 70, dextrose, glycerin, potassium chloride, propylene glycol, sodium chloride, and the like, such that the sodium chloride equivalent of the solution is in the range 0.9 plus or minus 0.2%.
  • Suitable antioxidants and stabilizers include sodium bisulfite, sodium metabisulfite, sodium thiosulfite, thiourea and the like.
  • Suitable wetting and clarifying agents include polysorbate 80, polysorbate 20, poloxamer 282 and tyloxapol.
  • Suitable viscosity- increasing agents include dextran 40, dextran 70, gelatin, glycerin, hydroxyethylcellulose, hydroxymethylpropylcellulose, lanolin, methylcellulose , petrolatum, polyethylene glycol, polyvinyl alcohol, polyvinylpyrrolidone, carboxymethylcellulose and the like.
  • contemplated herein are compositions suitable for oral delivery of a disclosed KCNQ2 oligonucleotide, e.g., tablets that include an enteric coating, e.g., a gastro- resistant coating, such that the compositions may deliver a KCNQ2 oligonucleotide to, e.g., the gastrointestinal tract of a patient.
  • an enteric coating e.g., a gastro- resistant coating
  • a tablet for oral administration comprises granules (e.g., is at least partially formed from granules) that include a disclosed KCNQ2 oligonucleotide, e.g., a KCNQ2 oligonucleotide represented by any SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5 that targets a KCNQ2 transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370, and pharmaceutically acceptable excipients.
  • a disclosed KCNQ2 oligonucleotide e.g., a KCNQ2 oligon
  • Such a tablet may be coated with an enteric coating.
  • Contemplated tablets may include pharmaceutically acceptable excipients such as fillers, binders, disintegrants, and/or lubricants, as well as coloring agents, release agents, coating agents, sweetening, flavoring such as wintergreen, orange, xylitol, sorbitol, fructose, and maltodextrin, and perfuming agents, preservatives and/or antioxidants.
  • contemplated pharmaceutical formulations include an intra- granular phase that includes a disclosed KCNQ2 oligonucleotide, e.g., a KCNQ2 oligonucleotide represented by any of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5 that targets a KCNQ2 transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370, and a pharmaceutically acceptable salt.
  • a disclosed KCNQ2 oligonucleotide e.g., a KCNQ2 oligonucleotide represented by any of SEQ ID NOs: 1-
  • contemplated pharmaceutical formulations include an intra-granular phase that includes a disclosed KCNQ2 oligonucleotide, e.g., a KCNQ2 oligonucleotide represented by any of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5 that targets a KCNQ2 transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NO: 1357-1370, and a pharmaceutically acceptable filler.
  • a disclosed KCNQ2 oligonucleotide e.g., a KCNQ2 oligonucleotide represented by any of SEQ ID NOs: 1-176
  • a disclosed KCNQ2 oligonucleotide and a filler may be blended together, optionally, with other excipients, and formed into granules.
  • the intragranular phase may be formed using wet granulation, e.g., a liquid (e.g., water) is added to the blended KCNQ2 oligonucleotide and filler, and then the combination is dried, milled and/or sieved to produce granules.
  • a liquid e.g., water
  • contemplated formulations include an extra-granular phase, which may include one or more pharmaceutically acceptable excipients, and which may be blended with the intragranular phase to form a disclosed formulation.
  • a disclosed formulation may include an intragranular phase that includes a filler.
  • Exemplary fillers include, but are not limited to, cellulose, gelatin, calcium phosphate, lactose, sucrose, glucose, mannitol, sorbitol, microcrystalline cellulose, pectin, polyacrylates, dextrose, cellulose acetate, hydroxypropylmethyl cellulose, partially pre-gelatinized starch, calcium carbonate, and others including combinations thereof.
  • a disclosed formulation may include an intragranular phase and/or an extragranular phase that includes a binder, which may generally function to hold the ingredients of the pharmaceutical formulation together.
  • binders of the disclosure may include, but are not limited to, the following: starches, sugars, cellulose or modified cellulose such as hydroxypropyl cellulose, lactose, pre-gelatinized maize starch, polyvinyl pyrrolidone, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, low substituted hydroxypropyl cellulose, sodium carboxymethyl cellulose, methyl cellulose, ethyl cellulose, sugar alcohols and others including combinations thereof.
  • Contemplated formulations may include a disintegrant such as but not limited to, starch, cellulose, crosslinked polyvinyl pyrrolidone, sodium starch glycolate, sodium carboxymethyl cellulose, alginates, corn starch, crosmellose sodium, crosslinked carboxymethyl cellulose, low substituted hydroxypropyl cellulose, acacia, and others including combinations thereof.
  • a disintegrant such as but not limited to, starch, cellulose, crosslinked polyvinyl pyrrolidone, sodium starch glycolate, sodium carboxymethyl cellulose, alginates, corn starch, crosmellose sodium, crosslinked carboxymethyl cellulose, low substituted hydroxypropyl cellulose, acacia, and others including combinations thereof.
  • a disintegrant such as but not limited to, starch, cellulose, crosslinked polyvinyl pyrrolidone, sodium starch glycolate, sodium carboxymethyl cellulose, alginates, corn starch, crosmellose sodium, crosslinked carboxymethyl
  • a contemplated formulation includes an intra-granular phase comprising a disclosed KCNQ2 oligonucleotide and excipients chosen from: mannitol, microcrystalline cellulose, hydroxypropylmethyl cellulose, and sodium starch glycolate or combinations thereof, and an extra-granular phase comprising one or more of: microcrystalline cellulose, sodium starch glycolate, and magnesium stearate or mixtures thereof.
  • a contemplated formulation may include a lubricant, e.g. an extra- granular phase may contain a lubricant.
  • Lubricants include but are not limited to talc, silica, fats, stearin, magnesium stearate, calcium phosphate, silicone dioxide, calcium silicate, calcium phosphate, colloidal silicon dioxide, metallic stearates, hydrogenated vegetable oil, corn starch, sodium benzoate, polyethylene glycols, sodium acetate, calcium stearate, sodium lauryl sulfate, sodium chloride, magnesium lauryl sulfate, talc, and stearic acid.
  • the pharmaceutical formulation comprises an enteric coating.
  • enteric coatings create a barrier for the oral medication that controls the location at which the drug is absorbed along the digestive track.
  • Enteric coatings may include a polymer that disintegrates at different rates according to pH.
  • Enteric coatings may include for example, cellulose acetate phthalate, methyl acrylate-methacrylic acid copolymers, cellulose acetate succinate, hydroxylpropylmethyl cellulose phthalate, methyl methacrylate-methacrylic acid copolymers, ethylacrylate-methacrylic acid copolymers, methacrylic acid copolymer type C, polyvinyl acetate-phthalate, and cellulose acetate phthalate.
  • Exemplary enteric coatings include Opadry ® AMB, Acryl-EZE ® , Eudragit ® grades.
  • an enteric coating may comprise about 5% to about 10%, about 5% to about 20%, 8% to about 15%, about 8% to about 20%, about 10% to about 20%, or about 12% to about 20%, or about 18% of a contemplated tablet by weight.
  • enteric coatings may include an ethylacrylate-methacrylic acid copolymer.
  • a tablet is provided that comprises or consists essentially of about 0.5% to about 70%, e.g., about 0.5% to about 10%, or about 1% to about 20%, by weight of a disclosed KCNQ2 oligonucleotide or a pharmaceutically acceptable salt thereof.
  • Such a tablet may include for example, about 0.5% to about 60% by weight of mannitol, e.g., about 30% to about 50% by weight mannitol, e.g., about 40% by weight mannitol; and/or about 20% to about 40% by weight of microcrystalline cellulose, or about 10% to about 30% by weight of microcrystalline cellulose.
  • a disclosed tablet may comprise an intragranular phase that includes about 30% to about 60%, e.g.
  • a disclosed KCNQ2 oligonucleotide about 30% to about 50%, or alternatively, about 5% to about 15% by weight mannitol, about 5% to about 15% microcrystalline cellulose, about 0% to about 4%, or about 1% to about 7% hydroxypropylmethylcellulose, and about 0% to about 4%, e.g., about 2% to about 4% sodium starch glycolate by weight.
  • a pharmaceutical tablet formulation for oral administration of a disclosed KCNQ2 oligonucleotide comprises an intra-granular phase, wherein the intra-granular phase includes a disclosed KCNQ2 AON or a pharmaceutically acceptable salt thereof (such as a sodium salt), and a pharmaceutically acceptable filler, and which may also include an extra-granular phase, that may include a pharmaceutically acceptable excipient such as a disintegrant.
  • the extra-granular phase may include components chosen from microcrystalline cellulose, magnesium stearate, and mixtures thereof.
  • the pharmaceutical composition may also include an enteric coating of about 12% to 20% by weight of the tablet.
  • a pharmaceutically acceptable tablet for oral use may comprise about 0.5% to 10% by weight of a disclosed KCNQ2 AON, e.g., a disclosed KCNQ2 AON or a pharmaceutically acceptable salt thereof, about 30% to 50% by weight mannitol, about 10% to 30% by weight microcrystalline cellulose, and an enteric coating comprising an ethylacrylate-methacrylic acid copolymer.
  • a disclosed KCNQ2 AON e.g., a disclosed KCNQ2 AON or a pharmaceutically acceptable salt thereof
  • enteric coating comprising an ethylacrylate-methacrylic acid copolymer.
  • a pharmaceutically acceptable tablet for oral use may comprise an intra-granular phase, comprising about 5 to about 10% by weight of a disclosed KCNQ2 AON, e.g., a disclosed KCNQ2 AON or a pharmaceutically acceptable salt thereof, about 40% by weight mannitol, about 8% by weight microcrystalline cellulose, about 5% by weight hydroxypropylmethyl cellulose, and about 2% by weight sodium starch glycolate; an extra- granular phase comprising about 17% by weight microcrystalline cellulose, about 2% by weight sodium starch glycolate, about 0.4% by weight magnesium stearate; and an enteric coating over the tablet comprising an ethylacrylate-methacrylic acid copolymer.
  • a disclosed KCNQ2 AON e.g., a disclosed KCNQ2 AON or a pharmaceutically acceptable salt thereof
  • the pharmaceutical composition may contain an enteric coating comprising about 13% or about 15%, 16%, 17% or 18% by weight, e.g., AcyrlEZE® (see, e.g., PCT Publication No. WO 2010/054826, which is hereby incorporated by reference in its entirety).
  • an enteric coating comprising about 13% or about 15%, 16%, 17% or 18% by weight, e.g., AcyrlEZE® (see, e.g., PCT Publication No. WO 2010/054826, which is hereby incorporated by reference in its entirety).
  • the rate at which the coating dissolves and the active ingredient is released is its dissolution rate.
  • a contemplated tablet may have a dissolution profile, e.g., when tested in a USP/EP Type 2 apparatus (paddle) at 100 rpm and 37 °C in a phosphate buffer with a pH of 7.2, of about 50% to about 100% of the KCNQ2 oligonucleotide releasing after about 120 minutes to about 240 minutes, for example after 180 minutes.
  • a contemplated tablet may have a dissolution profile, e.g., when tested in a USP/EP Type 2 apparatus (paddle) at 100 rpm and 37 °C in diluted HCl with a pH of 1.0, where substantially none of the KCNQ2 oligonucleotide is released after 120 minutes.
  • a contemplated tablet in another embodiment, may have a dissolution profile, e.g., when tested in USP/EP Type 2 apparatus (paddle) at 100 rpm and 37 °C in a phosphate buffer with a pH of 6.6, of about 10% to about 30%, or not more than about 50% of the KCNQ2 oligonucleotide releasing after 30 minutes.
  • methods provided herein may further include administering at least one other agent that is directed to treatment of diseases and disorders disclosed herein.
  • contemplated other agents may be co-administered (e.g., sequentially or simultaneously).
  • methods described herein include administering at least 1 ⁇ g, at least 5 ⁇ g, at least 10 ⁇ g, at least 20 ⁇ g, at least 30 ⁇ g, at least 40 ⁇ g, at least 50 ⁇ g, at least 60 ⁇ g, at least 70 ⁇ g, at least 80 ⁇ g, at least 90 ⁇ g, or at least 100 ⁇ g of a KCNQ2 antisense oligonucleotide e.g., a KCNQ2 oligonucleotide.
  • methods include administering from 10 mg to 500 mg, from 1 mg to 10 mg, from 10 mg to 20 mg, from 20 mg to 30 mg, from 30 mg to 40 mg, from 40 mg to 50 mg, from 50 mg to 60 mg, from 60 mg to 70 mg, from 70 mg to 80 mg, from 80 mg to 90 mg, from 90 mg to 100 mg, from 100 mg to 150 mg, from 150 mg to 200 mg, from 200 mg to 250 mg, from 250 mg to 300 mg, from 300 mg to 350 mg, from 350 mg to 400 mg, from 400 mg to 450 mg, from 450 mg to 500 mg, from 500 mg to 600 mg, from 600 mg to 700 mg, from 700 mg to 800 mg, from 800 mg to 900 mg, from 900 mg to 1 g, from 1 mg to 50 mg, from 20 mg to 40 mg, or from 1 mg to 500 mg of a KCNQ2 antisense oligonucleotide.
  • methods described herein include administering formulations that include about 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1 g, 1.5 g, 2.0 g, 2.5 g, 3.0 g, 3.5 g, 4.0 g, 4.5 g, or 5.0 g of a disclosed KCNQ2 oligonucleotide.
  • a formulation may include about 40 mg, 80 mg, or 160 mg of a disclosed KCNQ2 oligonucleotide. In some embodiments, a formulation may include at least 100 ⁇ g of a disclosed KCNQ2 oligonucleotide. For example, formulations may include about 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 1 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, or 30 mg of a disclosed KCNQ2 oligonucleotide.
  • the amount administered will depend on variables such as the type and extent of disease or indication to be treated, the overall health and size of the patient, the in vivo potency of the KCNQ2 oligonucleotide, the pharmaceutical formulation, and the route of administration.
  • the initial dosage can be increased beyond the upper level in order to rapidly achieve the desired blood-level or tissue level. Alternatively, the initial dosage can be smaller than the optimum, and the dosage may be progressively increased during the course of treatment.
  • Human dosage can be optimized, e.g., in a conventional Phase I dose escalation study. Dosing frequency can vary, depending on factors such as route of administration, dosage amount and the disease being treated. Exemplary dosing frequencies are once per day, once per week and once every two weeks.
  • dosing is once per day for 7 days. In some embodiments, dosing is once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, or once every 12 weeks. In some embodiments, dosing is once a month to every three months. In some embodiments, dosing is once every 2 weeks for three dose, then monthly, bimonthly, or every three or four months.
  • the combination therapy of the disclosed oligonucleotide and the one or more additional therapies can, in some embodiments, be synergistic in treating any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), and TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Parkinson’s disease, Parkinson’s disease with or without dementia, Limbic-predominant age-related TDP-43 encephalopathy (LATE)),Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam
  • Example additional therapies include any of Riluzole (Rilutek), PrimeC, Edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitor, antipsychotic agents, cholinesterase inhibitors, memantine, benzodiazepine antianxiety drugs, AMX0035 (ELYBRIO), ZILUCOPLAN (RA101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078, and BIIB105), BIIB100, levodopa/carbidopa, dopaminergic agents (e.g., ropinirole, pramipexole, rotigotine), medroxyprosterone, KCNQ2/KCNQ3 openers (e.g., retigabine, XEN1101, or QRL-101), bioactive scaffolds, anticonvulsants and psycho
  • Additional therapies can further include breathing care, physical therapy, occupational therapy, speech therapy, and nutritional support.
  • an additional therapy can be a second antisense oligonucleotide.
  • the second antisense oligonucleotide may target a KCNQ2 transcript (e.g., KCNQ2 pre-mRNA, mature KCNQ2 mRNA) to modulate the expression levels of full length KCNQ2 protein.
  • Non-limiting examples of therapies for Parkinson’s disease include: deep brain stimulation, levodopa and carbidopa (duopa, rytary, Sinemet, inbrija), istradefylline (nourianz), safinamide (xadago), pramipexole (Mirapex), rotigotine (neupro), ropinirole (requip), amantadine (gocovri, Symmetrel, osmolex), benztropine (Cogentin), trihexyphenidyl (artane), selegiline (eldepryl, zelapar), rasagiline, entacapone (comtan), opicapone (ongentys), tolcapone (tasmar), apomorphine (apokyn, kynmobi), exenatide, lingzhi, BIIB054, BIIB094, Caffeine, sarizotan, and
  • Non-limiting examples of therapies for Alzheimer’s disease include aducanamab (Aduhlem), memantine (Namenda), Donepezil (Aricept), Rivastigmine (Exelon), Galantamine (razadyne), Namzeric, Suvorexant (belsomra), and lecanemab.
  • a non-limiting example of a therapy for amyotrophic lateral sclerosis (ALS) is pridopidine.
  • Non-limiting examples of therapies for frontotemporal dementia include olanzapine (Zyprexa), quetiapine (Seroquel), SSRIs (citalopram (Cipramil), dapoxetine (Priligy), escitalopram (Cipralex), fluoxetine (Prozac or Oxactin), fluvoxamine (Faverin), paroxetine (Seroxat), sertraline (Lustral), vortioxetine (Brintellix)), divalproex sodium (Depakote), carbamazepine (Tegretol), and medroxyprogestrone.
  • Non-limiting examples of therapies for spinal cord injury includes bioactive scaffolds, such as bioactive scaffolds with enhanced supramolecular motion. Further details of example bioactive scaffolds as therapies for spinal cord injury is described in Alvarez et al., “Bioactive scaffolds with enhanced supramolecular motion promote recovery from spinal cord injury.” Science, 374, 848-856 (2021), which is hereby incorporated by reference in its entirety.
  • the disclosed oligonucleotide and the one or more additional therapies can be conjugated to one another and provided in a conjugated form. Further description regarding conjugates involving the disclosed oligonucleotide is described below.
  • the disclosed oligonucleotide and one or more additional therapies are provided concurrently. In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided simultaneously. In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided sequentially.
  • Non-limiting examples of therapies for epilepsy include Brivaracetam (briviact), cannabidiol (epidiolex), carbamazepine (carbatrol, Tegretol), cenobamate (xcopri), diazepam (valium), lorazepam (Ativan), clonazepam (klonopin), eslicarbazepine (aptiom), ethosuximide (zarontin), felbamate (felbatol), fenfluramine (fintepla), lacosamide (VIMPAT), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (oxtellar xr, Trileptal), perampanel (fycompa), phenobarbital, phenytoin (dilantin), pregabalin (lyrica), tiagabine (gabitril), topiramate (topamax), valpro
  • oligomeric compounds which comprise an oligonucleotide (e.g., KCNQ2 oligonucleotide) and optionally one or more conjugate groups and/or terminal groups.
  • Conjugate groups include one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide.
  • Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position.
  • conjugate groups are attached to the 2’-position of a nucleoside of a modified oligonucleotide.
  • conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3’ and/or 5’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’- end of oligonucleotides.
  • terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.
  • Conjugate Groups [00387] In certain embodiments, a KCNQ2 AON is covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance.
  • conjugate groups modify the circulation time (e.g., increase) of the oligonucleotides in the bloodstream such that increased concentrations of the oligonucleotides are delivered to the brain.
  • conjugate groups modify the residence time (e.g., increase residence time) of the oligonucleotides in a target organ (e.g., brain) such that increased residence time of the oligonucleotides improves their performance (e.g., efficacy).
  • conjugate groups increase the delivery of the oligonucleotide to the brain through the blood brain barrier and/or brain parenchyma (e.g., through receptor mediated transcytosis).
  • conjugate groups enable the oligonucleotide to target a specific organ (e.g., the brain).
  • conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide.
  • Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem.
  • a thioether e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl.
  • Acids Res., 1990, 18, 3777-3783 a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp.
  • Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, dyes, bile acids, and phenylbutyric acid.
  • conjugate moieties are selected from a peptide, a lipid, N- acetylgalactosamine (GalNAc), cholesterol, vitamin E, lipoic acid, panthothenic acid, polyethylene glycol, an antibody (e.g., an antibody for crossing the blood brain barrier such as anti-transferrin receptor antibody), or a cell-penetrating peptide (e.g., transactivator of transcription (TAT) and penetratine).
  • GalNAc N- acetylgalactosamine
  • TAT transactivator of transcription
  • a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)- pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethacin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.
  • an active drug substance for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)- pranoprofen, carprofen,
  • Conjugate Linkers are attached to a KCNQ2 AON through conjugate linkers.
  • the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond).
  • the conjugate linker comprises a chain structure, such as a hydrocarbon chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.
  • a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group.
  • conjugate linker includes at least one neutral linking group.
  • conjugate linkers including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein.
  • a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups.
  • bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.
  • conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- l-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA).
  • conjugate linkers include but are not limited to substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C 2 -C 10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.
  • conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides.
  • conjugate linkers comprise 3 linker-nucleosides.
  • linker-nucleosides are modified nucleosides.
  • linker-nucleosides comprise a modified sugar moiety.
  • linker-nucleosides are unmodified.
  • linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine.
  • a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N -benzoyl-5 -methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds.
  • cleavable bonds are phosphodiester bonds.
  • linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker- nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid.
  • a conjugate group it is desirable for a conjugate group to be cleaved from the KCNQ2 AON.
  • oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide.
  • certain conjugate linkers may comprise one or more cleavable moieties.
  • a cleavable moiety is a cleavable bond.
  • a cleavable moiety is a group of atoms comprising at least one cleavable bond.
  • a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds.
  • a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome.
  • a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.
  • a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide.
  • a cleavable bond is one or both of the esters of a phosphodiester.
  • a cleavable moiety comprises a phosphate or phosphodiester.
  • the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.
  • a cleavable moiety comprises or consists of one or more linker- nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds.
  • cleavable bonds are unmodified phosphodiester bonds.
  • a cleavable moiety is 2’-deoxy nucleoside that is attached to either the 3’ or 5’- terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage.
  • the cleavable moiety is 2’-deoxy adenosine.
  • Terminal Groups [00400]
  • oligomeric compounds comprise one or more terminal groups.
  • oligomeric compounds comprise a stabilized 5’-phosphate.
  • Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but not limited to 5’- vinylphosphonates.
  • terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides.
  • terminal groups comprise one or more 2’-linked nucleosides.
  • the 2’-linked nucleoside is an abasic nucleoside.
  • terminal groups comprise one or more spacers.
  • the disclosure also provides a method of diagnosing a patient with a neurological disease that relies upon detecting levels of KCNQ2 expression signal in one or more biological samples of a patient.
  • KCNQ2 expression signal can refer to any indication of KCNQ2 gene expression, or gene or gene product activity.
  • KCNQ2 gene products include RNA (e.g., mRNA), peptides, and proteins.
  • KCNQ2 gene expression that can be assessed include, but are not limited to, KCNQ2 gene or chromatin state, KCNQ2 gene interaction with cellular components that regulate gene expression, KCNQ2 gene product expression levels (e.g., expression levels of KCNQ2 transcripts (for example, a KCNQ2 pre-mRNA) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370, or interaction of KCNQ2 RNA or protein with transcriptional, translational, or post-translational processing machinery.
  • KCNQ2 gene product expression levels e.g., expression levels of KCNQ2 transcripts (for example, a KCNQ2 pre-mRNA) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%
  • Detection of KCNQ2 expression signal may be accomplished through in vivo, in vitro, or ex vivo methods.
  • methods of the disclosure may be carried out in vitro.
  • Methods of detecting may involve detection in blood, serum, fecal matter, tissue, cerebrospinal fluid, spinal fluid, urine, extracellular vesicles (for example, CSF exosomes), or cells of a patient.
  • Detection may be achieved by measuring expression signal of KCNQ2 transcripts (for example, a KCNQ2 pre-mRNA) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370 in whole tissue, tissue explants, cell cultures, dissociated cells, cell extract, extracellular vesicles (for example, CSF exosomes), or body fluids, including blood, spinal fluid, cerebrospinal fluid, urine, lymphatic fluid, or serum.
  • KCNQ2 transcripts for example, a KCNQ2 pre-mRNA
  • a KCNQ2 pre-mRNA comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 13
  • Methods of detection include assays that measure levels of KCNQ2 gene product expression such as Western blotting, FACS, ELISA, other quantitative binding assays, cell or tissue growth assays, Northern blots, quantitative or semi-quantitative polymerase chain reaction, medical imaging methods (e.g., MRI), or immunostaining methods (e.g., immunohistochemistry or immunocytochemistry).
  • assays that measure levels of KCNQ2 gene product expression such as Western blotting, FACS, ELISA, other quantitative binding assays, cell or tissue growth assays, Northern blots, quantitative or semi-quantitative polymerase chain reaction, medical imaging methods (e.g., MRI), or immunostaining methods (e.g., immunohistochemistry or immunocytochemistry).
  • RNA nucleoside comprising a 2’-OH sugar moiety and a thymine base
  • RNA methylated uracil
  • nucleic acid sequences provided herein are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases.
  • an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “AT m CGAUCG,” wherein m C indicates a cytosine base comprising a methyl group at the 5- position.
  • Certain compounds described herein e.g., modified oligonucleotides
  • Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds.
  • Compounds provided herein that contain stereocenters that are drawn or described with undefined stereochemistry included all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise.
  • Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2 H or 3 H in place of 1 H, 13 C or 14 C in place of 12 C, 15 N in place of 14 N, 17 O or 18 O in place of 16 O, and 33 S, 34 S, 35 S, or 36 S in place of 32 S.
  • non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool.
  • KCNQ2 AONs oligonucleotides that target a KCNQ2 transcript are designed and tested to identify KCNQ2 AONs capable of reducing quantity of mis-spliced KCNQ2 transcripts.
  • KCNQ2 AONs include a subset of the KCNQ2 parent oligonucleotides represented by any of SEQ ID NOs: 1-176 and SEQ ID NOs: 353-854 or KCNQ2 oligonucleotide variants represented by any of SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224.
  • the KCNQ2 parent oligonucleotides are 25 nucleosides in length.
  • Each of the nucleosides of the KCNQ2 parent oligonucleotides are modified nucleosides with 2’MOE sugar moieties, and each “C” is replaced with a 5-MeC.
  • each of the internucleoside linkages between the nucleosides of the KCNQ2 oligonucleotides are phosphorothioate internucleoside linkages.
  • the length of the KCNQ2 antisense oligonucleotides are 25 oligonucleotide units in length.
  • KCNQ2 antisense oligonucleotides were also designed with varying lengths (e.g., 23mers). Examples of these variant KCNQ2 antisense oligonucleotides were designed to include a subset of the sequences of SEQ ID NOs: 1371-1546 and SEQ ID NOs: 1723-2224. [00410] Table 6: KCNQ2 AONs (including KCNQ2 parent oligonucleotides and KCNQ2 oligonucleotides with two spacers) SEQ Oli l id S * ( h S i di f S )*
  • KCNQ2 antisense oligonucleotides were evaluated in iPSC derived human motor neurons (hMN). The cells were seeded in 96-well plates at a density of 50,000 cells/ well.
  • Antisense oligonucleotide (AON) to TDP43 was transfected with Endoporter (Gene Tools, Philomath, OR, USA) to increase expression of exon 5 containing KCNQ2 transcript.
  • Vehicle control consisted of motor neuron treatment with Endoporter alone.
  • Positive controls included cells that were treated with TDP43 AON alone (“AON TDP43” or “TDP43 AON”).
  • Transcript levels e.g., KCNQ2 exon 5 containing transcript or TDP43 transcript
  • RT-qPCR was performed for detecting GAPDH using Thermofisher TaqMan Gene Expression Assay Hs03929097_g1.
  • RT-qPCR was performed for detecting KCNQ2 exon 5 containing transcripts using custom Thermofisher TaqMan targeting exon junction 5/6.
  • Exon 5/6 Primers: Forward: 5’ GGGAGAACGACCACTTTGA 3’ (SEQ ID NO: 2857) Reverse: 3’ GAAGAAGGAGACACCGATGAG 3’ (SEQ ID NO: 2858) Probe: 5’ TAGCCAATGGTGGTCAGCGTGATC 3’ (SEQ ID NO: 2859) [00415]
  • RT-qPCR was performed on Applied Biosystems ® 7500 Real-time PCR systems.
  • One cycle of reverse transcription was performed at a temperature of 50°C for 5 min.
  • One cycle of RT inactivation/initial denaturation was performed at a temperature of 95°C for 20 seconds.
  • Forty five cycles of amplification were performed at a temperature of 95°C for 1 second followed by 60°C for 20 seconds.
  • KCNQ2 Exon 5 inclusion was normalized to GAPDH (deltaCt).
  • deltaCt GAPDH
  • KCNQ2 AONs e.g, KCNQ2 oligonucleotides without spacers or with one or two spacers
  • KCNQ2 AONs with spacers increased full-length KCNQ2 mRNA (“KCNQ2 FL”).
  • KCNQ2 AONs without spacers increased full-length KCNQ2 mRNA (“KCNQ2 FL”).
  • Specific AON sequences are labeled according to their corresponding SEQ ID NO.
  • a 500 nM dose of SEQ ID NO: 2841 (GGCCAGGSTGAGACASAGGAAGC with two spacers) rescued full length KCNQ2 mRNA to 59.333%. This indicates that the addition of spacers of SEQ ID NO: 2841 improves the performance in comparison to the KCNQ2 AON counterpart without spacers (e.g., SEQ ID NO: 1946).
  • SEQ ID NO: 1889 AGACGGCACCACCATCATGACCA with no spacers
  • a 500 nM dose of SEQ ID NO: 1889 (AGACGGCACCACCATCATGACCA with no spacers) rescued full length KCNQ2 mRNA to 16.627%.
  • a 200nM dose of SEQ ID NO: 2840 (AGACGGCSCCACCATSATGACCA with two spacers) rescued full length KCNQ2 mRNA to 18.720%.
  • a 500 nM dose of SEQ ID NO: 2840 (AGACGGCSCCACCATSATGACCA with two spacers) rescued full length KCNQ2 mRNA to 26,191%.
  • SEQ ID NO: 2840 improves the performance in comparison to the KCNQ2 AON counterpart without spacers (e.g., SEQ ID NO: 1889).
  • SEQ ID NO: 1889 e.g., SEQ ID NO: 1889.
  • Table 7 a 200 nM dose of SEQ ID NO: 1859 (CAGAAGCATCACCATCACCACCA with no spacers) rescued full length KCNQ2 mRNA to - 4.824%.
  • a 500 nM dose of SEQ ID NO: 1859 (CAGAAGCATCACCATCACCACCA with no spacers) rescued full length KCNQ2 mRNA to -4.822%.
  • a 500 nM dose of SEQ ID NO: 2836 (ACCAGAASCATCACCSTCACCAC with two spacers) rescued full length KCNQ2 mRNA to 27.103%. This indicates that the addition of spacers of SEQ ID NO: 2836 improves the performance in comparison to the KCNQ2 AON counterpart without spacers (e.g., SEQ ID NO: 1861).
  • SEQ ID NO: 1860 (CCAGAAGCATCACCATCACCACC with no spacers) rescued full length KCNQ2 mRNA to 0.349%.
  • a 500 nM dose of SEQ ID NO: 1860 (CCAGAAGCATCACCATCACCACC with no spacers) rescued full length KCNQ2 mRNA to -2.195%.
  • a 200nM dose of SEQ ID NO: 2837 (CCAGAAGSATCACCASCACCACC with two spacers) rescued full length KCNQ2 mRNA to 12.326%.
  • a 500 nM dose of SEQ ID NO: 2837 (CCAGAAGSATCACCASCACCACCACCACC with two spacers) rescued full length KCNQ2 mRNA to 18.047%.
  • a 500 nM dose of SEQ ID NO: 2834 (CAACACCSTGACCACSATCACCA with two spacers) rescued full length KCNQ2 mRNA to 29.909%. This indicates that the addition of spacers of SEQ ID NO: 2836 improves the performance in comparison to the KCNQ2 AON counterpart without spacers (e.g., SEQ ID NO: 1816).
  • SEQ ID NO: 1467 CCGACTCCATCCCTCCACCCAGGwith no spacers
  • a 500 nM dose of SEQ ID NO: 1467 (CTGACTCCATCCCTCCACCCAGG with no spacers) rescued full length KCNQ2 mRNA to -2.600%.
  • a 200nM dose of SEQ ID NO: 2805 (CTGACTCSATCCCTCSACCCAGG with two spacers) rescued full length KCNQ2 mRNA to 0.28284%.
  • a 500 nM dose of SEQ ID NO: 2805 (CTGACTCSATCCCTCSACCCAGG with two spacers) rescued full length KCNQ2 mRNA to 10.232%.
  • each of the nucleosides of antisense oligonucleotides shown are modified nucleosides with 2’-O-(2-methoxyethyl) (2’- MOE) sugar moieties, each “C” is replaced with a 5 -methylcytosine (5-MeC), and all intemucleoside linkages are phosphorothioate linkages.
  • a spacer as indicated by S is not a nucleoside.
  • S represents a spacer of Formula (lia’) as disclosed herein.
  • each of the nucleosides of antisense oligonucleotides shown are modified nucleosides with 2’-O-(2-methoxy ethyl) (2’- MOE) sugar moieties, each “C” is replaced with a 5 -methylcytosine (5-MeC), and all intemucleoside linkages are phosphorothioate linkages.
  • a spacer as indicated by S is not a nucleoside.
  • S represents a spacer of Formula (lia’) as disclosed herein.
  • KCNQ2 antisense oligonucleotides were evaluated in iPSC derived human motor neurons (hMN). The cells were seeded in 96-well plates at a density of 40,000 cells/ well. Antisense oligonucleotide (AON) to TDP43 was transfected with Endoporter (Gene Tools, Philomath, OR, USA) to increase expression of exon 5 containing KCNQ2 transcript. Vehicle control consisted of motor neuron treatment with Endoporter alone. Positive controls included cells that were treated with TDP43 AON alone (“AON TDP43” or “TDP43 AON”).
  • Transcript levels e.g., KCNQ2 exon 5 containing transcript or TDP43 transcript
  • RT-qPCR was performed for detecting GAPDH using Thermofisher TaqMan Gene Expression Assay Hs03929097_g1.
  • RT-qPCR was performed for detecting KCNQ2 exon 5 containing transcripts using custom Thermofisher TaqMan targeting exon junction 5/6.
  • Exon 5/6 Primers: Forward: 5’ GGGAGAACGACCACTTTGA 3’ Reverse: 3’ GAAGAAGGAGACACCGATGAG 3’ Probe: 5’ TAGCCAATGGTGGTCAGCGTGATC 3’ [00432]
  • RT-qPCR was also performed for detecting KCNQ2 exon 5 containing transcripts using custom Thermofisher TaqMan targeting exon junction 4/5.
  • RT-qPCR was performed on Applied Biosystems ® 7500 Real-time PCR systems.
  • One cycle of reverse transcription was performed at a temperature of 50°C for 5 min.
  • One cycle of RT inactivation/initial denaturation was performed at a temperature of 95°C for 20 seconds.
  • Forty five cycles of amplification were performed at a temperature of 95°C for 1 second followed by 60°C for 20 seconds.
  • KCNQ2 Exon 5 inclusion was normalized to GAPDH (deltaCt).
  • deltaCt GAPDH
  • the normalized KCNQ2 Exon 5 inclusion signal was further normalized to the vehicle (treated with Endoporter alone, deltadeltaCt).
  • KCNQ2 AONs e.g, KCNQ2 oligonucleotides without spacers or with one or two spacers
  • KCNQ2 AONs with spacers increased full-length KCNQ2 mRNA (“KCNQ2 FL”).
  • KCNQ2 AONs without spacers increased full-length KCNQ2 mRNA (“KCNQ2 FL”).
  • Specific AON sequences are labeled according to their corresponding SEQ ID NO.
  • MOE sugar moieties, each “C” is replaced with a 5 -methylcytosine (5-MeC), and all intemucleoside linkages are phosphorothioate linkages.
  • a spacer as indicated by S is not a nucleoside.
  • S represents a spacer of Formula (lia’) as disclosed herein.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Molecular Biology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Wood Science & Technology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Zoology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

Disclosed herein are KCNQ2 oligonucleotides with one or more spacers or without a spacer. In various embodiments, KCNQ2 oligonucleotides with spacer(s) reduce mis-spliced KCNQ2 transcripts and increase full length KCNQ2 transcripts, thereby imparting therapeutic efficacy against neurological diseases such as amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), or Alzheimer's disease (AD).

Description

TREATMENT OF NEUROLOGICAL DISEASES USING MODULATORS OF KCNQ2 GENE TRANSCRIPTS
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit under 35 U.S.C. § 119(e) of U.S. Provisional Application No. 63/285,628, filed on December 3, 2021, which is hereby incorporated herein by reference in their entireties for all purposes.
REFERENCE TO A SEQUENCE LISTING XML
[0002] This application contains a sequence listing which has been submitted electronically in XML format. The Sequence Listing XML is incorporated herein by reference. Said XML file, created on November 19, 2022, is named QRL-013WO_SL.xml and is 67,350,973 in size.
FIELD OF THE DISCLOSURE
[0003] This application relates generally to methods of treating neurological diseases with KCNQ2 splice-switching antisense oligonucleotides, in particular, KCNQ2 antisense oligonucleotides with one or more spacers that target a KCNQ2 transcript.
BACKGROUND
[0004] Motor neuron diseases are a class of neurological diseases that result in the degeneration and death of motor neurons - those neurons which coordinate voluntary movement of muscles by the brain. Motor neuron diseases may be sporadic or inherited, and may affect upper motor neurons and/or lower motor neurons. Motor neuron diseases include amyotrophic lateral sclerosis, progressive bulbar palsy, pseudobulbar palsy, primary lateral sclerosis, progressive muscular atrophy, spinal muscular atrophy, and post-polio syndrome.
[0005] Amyotrophic lateral sclerosis (ALS) is a group of motor neuron diseases affecting about 15,000 individuals in the United States of America. ALS is characterized by degeneration and death of upper and lower motor neurons, resulting in loss of voluntary muscle control. Motor neuron death is accompanied by muscle fasciculation and atrophy. Early symptoms of ALS include muscle cramps, muscle spasticity, muscle weakness (for example, affecting an arm, a leg, neck, or diaphragm), slurred and nasal speech, and difficulty chewing or swallowing. Loss of strength and control over movements, including those necessary for speech, eating, and breathing, eventually occur. Disease progression may be accompanied by weight loss, malnourishment, anxiety, depression, increased risk of pneumonia, muscle cramps, neuropathy, and possibly dementia. Most individuals diagnosed with ALS die of respiratory failure within five years of the first appearance of symptoms. Currently, there is no effective treatment for ALS. [0006] ALS occurs in individuals of all ages, but is most common in individuals between 55 to 75 years of age, with a slightly higher incidence in males. ALS can be characterized as sporadic or familial. Sporadic ALS appears to occur at random and accounts for more than 90% of all incidences of ALS. Familial ALS accounts for 5-10% of all incidences of ALS. [0007] FTD refers to a spectrum of progressive neurodegenerative diseases caused by loss of neurons in frontal and temporal lobes of the brain. FTD is the third most common form of dementia (following Alzheimer’s disease and dementia with Lewy bodies), and the second most common form of dementia in individuals below 65 years of age. FTD is estimated to affect 50,000 to 60,000 individuals in the United States of America. FTD is characterized by changes in behavior and personality, and language dysfunction. Forms of FTD include behavioral variant FTD (bvFTD), semantic variant primary progressive aphasia (svPPA), and nonfluent variant primary progressive aphasia (nfvPPA). ALS with FTD is characterized by symptoms associated with FTD, along with symptoms of ALS such as muscle weakness, atrophy, fasciculation, spasticity, speech impairment (dysarthria), and inability to swallow (dysphagia). Individuals usually succumb to FTD within 5 to 10 years, while ALS with FTD often results in death within 2 to 3 years of the first disease symptoms appearing. [0008] Like ALS, there is no known cure for FTD, or ALS with FTD, nor a therapeutic known to prevent or retard either disease’s progression. [0009] Thus, there is a pressing need to identify compounds and/or compositions capable of preventing, ameliorating, and treating neurological diseases such as: amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), and TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia, Limbic-predominant age- related TDP-43 encephalopathy (LATE)), Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, epilepsy/seizure disorders, and synaptic diseases like autism. SUMMARY [0010] Described herein are oligonucleotides comprising one or more spacers and comprising a sequence that is at least 85% complementary to an equal length portion of a KCNQ2 transcript. In one aspect, the present disclosure provides KCNQ2 oligonucleotides that target a KCNQ2 transcript (for example, a KCNQ2 mRNA or KCNQ2 pre-mRNA). In various embodiments, the oligonucleotides target a transcript for the treatment of neurological diseases, including motor neuron diseases, and/or neuropathies. For example, KCNQ2 oligonucleotides can be used to treat PD, ALS, FTD, ALS with FTD, and AD. [0011] In one aspect, the present disclosure provides a compound comprising a modified oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357-1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non-natural linkage. In some embodiments, the oligonucleotide comprises a spacer. [0012] In one aspect, the present disclosure provides a compound comprising a modified oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357-1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non-natural linkage, and further wherein the oligonucleotide comprises a spacer. [0013] In one aspect, the present disclosure provides an oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357- 1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non- natural linkage. In some embodiments, the oligonucleotide comprises a spacer. [0014] In one aspect ,the present disclosure provides an oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357- 1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non- natural linkage, and further wherein the oligonucleotide comprises a spacer. [0015] In various embodiments, the oligonucleotide as provided herein comprises a segment with at most 11 linked nucleosides. In various embodiments, the oligonucleotide comprises a segment with at most 10, 9, or 8 linked nucleosides. In various embodiments, the oligonucleotide comprises a segment with at most 7 linked nucleosides. In various embodiments, the oligonucleotide comprises a segment with at most 6, 5, 4, 3, or 2 linked nucleosides. In various embodiments, every segment of the oligonucleotide comprises at most 7 linked nucleosides. [0016] In various embodiments, the oligonucleotide comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353- 854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. In various embodiments, the oligonucleotide comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. [0017] In various embodiments, wherein the oligonucleotide comprises a sequence that shares at least 95% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. In various embodiments, the oligonucleotide comprises a sequence that shares 100% identity with an equal length portion of any one of SEQ ID NOs: 1- 176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. [0018] In various embodiments, the oligonucleotide comprises a segment with at most 11 linked nucleosides or at most 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. [0019] In various embodiments, the oligonucleotide comprises a segment with at most 6, 5, 4, 3, or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353- 854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. [0020] In various embodiments, the oligonucleotide comprises a segment with at most 6, 5, 4, 3, or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353- 854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. [0021] In various embodiments, the oligonucleotide is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 19 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 23 oligonucleotide units in length. In various embodiments, the spacer is a nucleoside-replacement group comprising a non-sugar substitute that is incapable of linking to a nucleotide base. [0022] In various embodiments, the spacer is located between positions 10 and 15 of the oligonucleotide. In various embodiments, the spacer is located between positions 7 and 11 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 14 and 22 of the oligonucleotide. In various embodiments, the spacer and the second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases in the oligonucleotide. In various embodiments, the spacer is located between positions 7 and 9 of the oligonucleotide, and wherein the second spacer is located between positions 15 and 18 of the oligonucleotide. In various embodiments, the spacer is located at position 8 of the oligonucleotide, and wherein the second spacer is located at position 16 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 21 and 24 of the oligonucleotide. [0023] In various embodiments, the spacer is located between positions 2 and 5 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 8 and 12 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 18 and 22 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer and a third spacer, wherein the three spacers are located at positions in the oligonucleotide such that each segment of the oligonucleotide has at most 7 linked nucleosides. In various embodiments, at least two of the three spacers are adjacent to a guanine nucleobase. In various embodiments, each of the at least two of the three spacers immediately precede a guanine nucleobase. [0024] In various embodiments, each of the first, second or third spacers is a nucleoside- replacement group comprising a non-sugar substitute wherein the non-sugar substitute does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal or hemiaminal moiety and is incapable of forming a covalent bond with a nucleotide base. [0025] In certain embodiments, each of the first, second or third spacers is independently represented by Formula (X), wherein: Formula (X)
Figure imgf000007_0001
A is an optionally substituted 4-8 member monocyclic cycloalkyl group or a 4-8 member monocyclic heterocyclyl group, wherein the heterocyclyl group contains 1 or 2 heteroatoms selected from O, S and N, provided that A is not capable of forming a covalent bond to a nucleobase; and the symbol represents the point of connection to an internucleoside linkage. [0026] In
Figure imgf000007_0002
rious embodiments, each of the first, second or third spacers is independently represented by Formula (Xa), wherein: Formula (Xa). [
Figure imgf000007_0003
ome embodiments, ring A is an optionally substituted 4-8 member monocyclic cycloalkyl group selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; or a 4-8 member monocyclic heterocyclyl group, selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl. [0028] In further embodiments, ring A is tetrahydrofuranyl. [0029] In other embodiments, ring A is tetrahydropyranyl. [0030] In various embodiments, each of the first, second or third spacers is independently represented by Formula I, wherein: Formula (I)
Figure imgf000007_0004
X is selected from -CH2-- and -O-; and n is 0, 1, 2 or 3. [0031] In various embodiments, each of the first, second or third spacers is independently represented by Formula I’, wherein: Formula (I’)
Figure imgf000008_0001
X is selected from -CH2-- and -O-; and n is 0, 1, 2 or 3. [0032] In various embodiments, each of the first, second or third spacers is independently represented by Formula (Ia), wherein: Formula (Ia); and
Figure imgf000008_0002
, 1, 2 or 3. [0033] In various embodiments, each of the first, second or third spacers is independently represented by Formula (Ia’), wherein: Formula (Ia’); and
Figure imgf000008_0003
0, 1, 2 or 3. [0034] In certain embodiments, each of the first, second or third spacers is independently represented by Formula II, wherein: Formula (II); and
Figure imgf000008_0004
elected from -CH2- and -O-. [0035] In further embodiments, each of the first, second or third spacers is independently represented by Formula II’, wherein: Formula (II’); and
Figure imgf000009_0001
elected from -CH2- and -O-. [0036] In various embodiments, each of the first, second or third spacers is independently represented by Formula (Iia), wherein: Formula (Iia). [
Figure imgf000009_0002
ther embodiments, each of the first, second or third spacers is independently represented by Formula (Iia’), wherein: Formula (Iia’). [
Figure imgf000009_0003
me embodiments, the spacer is represented by Formula (IIi), wherein: Formula (IIi)
Figure imgf000009_0004
X is selected from -CH2- and -O-. [0039] In some embodiments, the spacer is represented by Formula (IIi’), wherein: Formula (IIi’)
Figure imgf000009_0005
X is selected from -CH2-and -O. [0040] In some embodiments, the spacer is represented by Formula (IIib), wherein: Formula (IIib).
Figure imgf000010_0001
[0041] In some embodiments, the spacer is represented by Formula (Iiib’), wherein: Formula (IIib’).
Figure imgf000010_0002
[0042] In various embodiments, each of the first, second or third spacers is independently represented by Formula III, wherein: Formula (III); and
Figure imgf000010_0003
elected from -CH2- and -O-. [0043] In further embodiments, each of the first, second or third spacers is independently represented by Formula III’, wherein: Formula (III’); and
Figure imgf000010_0004
elected from -CH2- and -O-. [0044] In some embodiments, each of the first, second or third spacers is independently represented by Formula (IIIa), wherein: Formula (IIIa). [
Figure imgf000010_0005
ther embodiments, each of the first, second or third spacers is independently represented by Formula (IIIa’), wherein:
Figure imgf000011_0001
[0046] In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 10%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 20%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 25%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 30%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 40%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 50%.
[0047] In various embodiments, the oligonucleotide is between 12 and 40 oligonucleotide units in length.
[0048] In various embodiments, at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotri ester linkage, an alkylphosphonate linkage, a 3 -methoxy propyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3' amino ribose, or 5' amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.
[0049] In various embodiments, one or more nucleoside linkages that link a base at position 3 or position 4 of the oligonucleotide are phosphodiester linkages. In various embodiments, only one nucleoside linkage that links a base at position 3 or position 4 of the oligonucleotide is a phosphodiester linkage. In various embodiments, nucleoside linkages that link bases at both position 3 and position 4 of the oligonucleotide are phosphodiester linkages. In various embodiments, one or more bases immediately preceding a spacer in the oligonucleotide are linked through phosphodiester bonds. In various embodiments, only the base immediately preceding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond. In various embodiments, the base immediately preceding the spacer in the oligonucleotide is further linked to a further preceding base through a phosphodiester bond. In various embodiments, the oligonucleotide comprises a second spacer, wherein a base immediately preceding the second spacer is linked to a further preceding base through a phosphodiester bond. [0050] In various embodiments, one or more bases immediately succeeding a spacer in the oligonucleotide are linked through phosphodiester bonds. In various embodiments, only the base immediately succeeding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond. In various embodiments, two bases immediately preceding the spacer in the oligonucleotide are linked through phosphodiester bonds. In various embodiments, one or more bases immediately preceding a spacer in the oligonucleotide are linked through phosphodiester bonds and wherein one or more bases immediately succeeding the spacer in the oligonucleotide are linked through phosphodiester bonds. In various embodiments, one base immediately preceding the spacer and one base immediately succeeding the spacer are linked through phosphodiester bonds. In various embodiments, the oligonucleotide includes a second spacer, and wherein one or more bases immediately preceding the second spacer in the oligonucleotide are linked through phosphodiester bonds and wherein one or more bases immediately succeeding the second spacer in the oligonucleotide are linked through phosphodiester bonds. In various embodiments, one base immediately preceding the second spacer and one base immediately succeeding the second spacer are linked through phosphodiester bonds. In various embodiments, the oligonucleotide comprises a range of bases that are linked through phosphodiester bonds, the range of bases comprising at least two bases. In various embodiments, the oligonucleotide comprises a range of bases that are linked through phosphodiester bonds, the range of bases comprising at least five bases. In various embodiments, the oligonucleotide comprises two or more spacers, and wherein the range of bases are positioned between the at least two spacers. [0051] Additionally disclosed herein is a compound comprising an oligonucleotide comprising a nucleobase sequence that shares at least 90% identity to an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. Additionally disclosed herein is an oligonucleotide comprising a nucleobase sequence that shares at least 90% identity to an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. In various embodiments, the nucleobase sequence shares at least 95% identity to an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. In various embodiments, the nucleobase sequence shares at least 100% identity to an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. In various embodiments, the oligonucleotide is any one of a 19mer, 21mer, 23mer, or 25mer. [0052] In various embodiments, an internucleoside linkage of the oligonucleotide is a modified internucleoside linkage. In various embodiments, the modified internucleoside linkage of the oligonucleotide is a phosphorothioate linkage. In various embodiments, all internucleoside linkages of the oligonucleotide are phosphorothioate linkages. In various embodiments, the phosphorothioate linkage is in one of a Rp configuration or a Sp configuration. In various embodiments, the oligonucleotide comprises at least one modified sugar moiety. In various embodiments, the modified sugar moiety is one of a 2'-OMe modified sugar moiety, bicyclic sugar moiety, 2’-O-(2-methoxyethyl) (MOE), 2'-deoxy-2'-fluoro nucleoside, 2’-fluoro-β-D- arabinonucleoside, locked nucleic acid (LNA), a tricyclic nucleic acid (tcDNA) (e.g., tricyclic nucleic acid with ethyl (2’O-CH2-CH2-4’C) as the bridge or tricyclic nucleic acid with methyl substituted methyl (2’O-CH(CH2)-4’C) bridge), constrained ethyl 2’-4’-bridged nucleic acid (cEt), S-cEt, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA). [0053] In various embodiments, the oligonucleotide exhibits at least a 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase of full length KCNQ2 protein. In various embodiments, the oligonucleotide exhibits at least a 100% increase of full length KCNQ2 protein. In various embodiments, the oligonucleotide exhibits at least a 200% increase of full length KCNQ2 protein. In various embodiments, the oligonucleotide exhibits at least a 300% increase of full length KCNQ2 protein. In various embodiments, the oligonucleotide exhibits at least a 400% increase of full length KCNQ2 protein. In various embodiments, increase of the full length KCNQ2 protein is measured in comparison to a reduced level of full length KCNQ2 protein achieved using a TDP43 antisense oligonucleotide. In various embodiments, the oligonucleotide exhibits at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full length KCNQ2 protein. In various embodiments, the oligonucleotide exhibits at least a 50%, 60%, 70%, 80%, or 90% reduction of a mis-spliced KCNQ2 transcript. [0054] Additionally disclosed is a method of treating a neurological disease and/or a neuropathy in a patient in need thereof, the method comprising administering to the patient an oligonucleotide of any of the oligonucleotides disclosed above. In various embodiments, the neurological disease selected from the group consisting of: amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), and TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia, Limbic-predominant age-related TDP-43 encephalopathy (LATE)), Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, epilepsy/seizure disorders, and synaptic diseases like autism. In various embodiments, the neurological disease is AD. In various embodiments, the neurological disease is PD. In various embodiments, the neurological disease is ALS. In various embodiments, the neurological disease is FTD. In various embodiments, the neurological disease is ALS with FTD. In various embodiments, the neuropathy is chemotherapy induced neuropathy. [0055] Additionally disclosed is a method of restoring axonal outgrowth and/or regeneration of a neuron, the method comprising exposing the motor neuron to an oligonucleotide of any of the oligonucleotides disclosed above. Additionally disclosed is a method of increasing, promoting, stabilizing, or maintaining KCNQ2 expression and/or function in a neuron, the method comprising exposing the cell to an oligonucleotide of any of the oligonucleotides disclosed above. [0056] In various embodiments, the neuron is a neuron of a patient in need of treatment of a neurological disease and/or a neuropathy. In various embodiments, the neuropathy is chemotherapy induced neuropathy. In various embodiments, the exposing is performed in vivo or ex vivo. In various embodiments, the exposing comprises administering the oligonucleotide to a patient in need thereof. In various embodiments, the oligonucleotide is administered topically, parenterally, intrathecally, intrathalamically, intracisternally, orally, rectally, buccally, sublingually, vaginally, pulmonarily, intratracheally, intranasally, transdermally, or intraduodenally. In various embodiments, the oligonucleotide is administered orally. In various embodiments, a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamically or intracisternally. In various embodiments, the patient is a human. [0057] Additionally disclosed herein is a pharmaceutical composition comprising the oligonucleotide of any one of the oligonucleotides disclosed above, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient. In various embodiments, the pharmaceutical composition is suitable for topical, intrathecal, intrathalamic, intracisternal, intracerebroventricular, parenteral, oral, pulmonary, intratracheal, intranasal, transdermal, rectal, buccal, sublingual, vaginal, or intraduodenal administration. [0058] Additionally disclosed herein is a method of treating a neurological disease or a neuropathy in a patient in need thereof, the method comprising administering to a patient in need thereof a therapeutically effective amount of a pharmaceutical composition disclosed above. In various embodiments, the neurological disease is selected from from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Parkinson’s Disease with dementia, dementia with lewy bodies, synucleinopathies, Huntington’s disease, Brachial plexus injuries, peripheral nerve injuries, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, tuberous sclerosis complex, Pick’s Disease, tauopathies, primary age-related tauopathy, Down Syndrome, epilepsy/seizure disorder, depression, traumatic brain injury (TBI), chronic traumatic encephalopathy (CTE), HIV-associated neurocognitive disorders (HAND), multisystem atrophy, amnestic mild cognitive impairment, corticobasal degeneration (CBD) and/or neuropathies such a chemotherapy induced neuropathy, Spinocerebellar ataxia (SCA), SCA type 2, Spinal Muscular Atrophy (SMA), Parkinsonism, Niemann-Pick disease type C (NPC), Charcot-Marie-Tooth Disease (CMT), Mucopolysaccharidosis type II (MPSIIA), Mucolipidosis IV, GM1 gangliosidosis, Sporadic inclusion body myositis (sIBM), Henoch-Schonlein purpura (HSP), Limbic-predominant age-related TDP-43 encephalopathy (LATE)), Cerebral Age-Related TDP- 43 With Sclerosis (CARTS), Gaucher’s disease, and facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, Perry disease, and synaptic diseases like autism. In various embodiments, the neurological disease is ALS. In various embodiments, the neurological disease is FTD. In various embodiments, the neurological disease is ALS with FTD. In various embodiments, the neurological disease is AD. In various embodiments, the neurological disease is PD. In various embodiments, the neuropathy is chemotherapy induced neuropathy. In various embodiments, the pharmaceutical composition is administered topically, parenterally, orally, pulmonarily, rectally, buccally, sublingually, vaginally, intratracheally, intranasally, intracisternally, intrathecally, intrathalamically, intravenously, intramuscularly, transdermally, or intraduodenally. In various embodiments, wherein the pharmaceutical composition is administered intrathecally, intrathalamically intracerebroventricularly, or intracisternally. In various embodiments, a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamically or intracisternally. In various embodiments, the patient is human. [0059] Additionally disclosed herein is a method for treating a neurological disease in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3' amino ribose, or 5' amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2'-O-(2- methoxyethyl) nucleoside, a 2'-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2'-deoxy-2'-fluoro nucleoside, a 2’-fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA), optionally wherein the oligonucleotide further comprises a spacer. [0060] Additionally disclosed herein is a method for treating ALS in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5 or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3' amino ribose, or 5' amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2'-O-(2- methoxyethyl) nucleoside, a 2'-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2'-deoxy-2'-fluoro nucleoside, a 2’-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA), optionally wherein the oligonucleotide further comprises a spacer. [0061] Additionally disclosed herein is a method for treating FTD in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3' amino ribose, or 5' amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2'-O-(2- methoxyethyl) nucleoside, a 2'-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2'-deoxy-2'-fluoro nucleoside, a 2’-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA), optionally wherein the oligonucleotide further comprises a spacer. Additionally disclosed herein is a method for treating ALS with FTD in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs:1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3' amino ribose, or 5' amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2'-O-(2- methoxyethyl) nucleoside, a 2'-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2'-deoxy-2'-fluoro nucleoside, a 2’-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA), optionally wherein the oligonucleotide further comprises a spacer. [0062] In various embodiments, one or more nucleoside linkages that link a base at position 3 or position 4 of the oligonucleotide are phosphodiester linkages. In various embodiments, only one nucleoside linkage that links a base at position 3 or position 4 of the oligonucleotide is a phosphodiester linkage. In various embodiments, nucleoside linkages that link bases at both position 3 and position 4 of the oligonucleotide are phosphodiester linkages. In various embodiments, one or more bases immediately preceding a spacer in the oligonucleotide are linked through phosphodiester bonds. In various embodiments, only the base immediately preceding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond. In various embodiments, the base immediately preceding the spacer in the oligonucleotide is further linked to a further preceding base through a phosphodiester bond. In various embodiments, the oligonucleotide comprises a second spacer, wherein a base immediately preceding the second spacer is linked to a further preceding base through a phosphodiester bond. [0063] In various embodiments, one or more bases immediately succeeding a spacer in the oligonucleotide are linked through phosphodiester bonds. In various embodiments, only the base immediately succeeding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond. In various embodiments, two bases immediately preceding the spacer in the oligonucleotide are linked through phosphodiester bonds. In various embodiments, one or more bases immediately preceding a spacer in the oligonucleotide are linked through phosphodiester bonds and wherein one or more bases immediately succeeding the spacer in the oligonucleotide are linked through phosphodiester bonds. In various embodiments, one base immediately preceding the spacer and one base immediately succeeding the spacer are linked through phosphodiester bonds. In various embodiments, the oligonucleotide includes a second spacer, and wherein one or more bases immediately preceding the second spacer in the oligonucleotide are linked through phosphodiester bonds and wherein one or more bases immediately succeeding the second spacer in the oligonucleotide are linked through phosphodiester bonds. In various embodiments, one base immediately preceding the second spacer and one base immediately succeeding the second spacer are linked through phosphodiester bonds. In various embodiments, the oligonucleotide comprises a range of bases that are linked through phosphodiester bonds, the range of bases comprising at least two bases. In various embodiments, the oligonucleotide comprises a range of bases that are linked through phosphodiester bonds, the range of bases comprising at least five bases. In various embodiments, the oligonucleotide comprises two or more spacers, and wherein the range of bases are positioned between the at least two spacers. In various embodiments, the oligonucleotide is any one of a 19mer, 21mer, 23mer, or 25mer. [0064] In various embodiments, at least one (i.e., one or more) internucleoside linkage of the oligonucleotide is a phosphorothioate linkage. In various embodiments, all internucleoside linkages of the oligonucleotide are phosphorothioate linkages. [0065] Additionally disclosed herein is an oligonucleotide and a pharmaceutically acceptable excipient, the oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357-1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, wherein the oligonucleotide comprises a spacer and wherein the oligonucleotide is capable of increasing, restoring, or stabilizing expression of the KCNQ2 mRNA capable of translation of a functional KCNQ2 and/or activity and/or function of KCNQ2 protein in a cell or a human patient of an immune-mediated demyelinating disease, and wherein the level of increase, restoration, or stabilization of expression and/or activity and/or function is sufficient for use of the oligonucleotide as a medicament for the treatment of the immune-mediated demyelinating disease. [0066] In various embodiments, the oligonucleotide comprises one or more chiral centers and/or double bonds. In various embodiments, the oligonucleotide exist as stereoisomers selected from geometric isomers, enantiomers, and diastereomers. [0067] Additionally disclosed herein is a method of treating a neurological disease and/or a neuropathy in a patient in need thereof, the method comprising administering to a patient in need thereof a therapeutically effective amount of a pharmaceutical composition disclosed above, in combination with a second therapeutic agent. In various embodiments, the second therapeutic agent is selected from Riluzole (Rilutek), PrimeC (combination of celecoxib and ciprofloxacin), Edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitor, antipsychotic agents, cholinesterase inhibitors, memantine, benzodiazepine antianxiety drugs, AMX0035 (ELYBRIO), ZILUCOPLAN (RA101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078, and BIIB105), BIIB100, levodopa/carbidopa, dopaminergic agents (e.g., ropinirole, pramipexole, rotigotine), medroxyprosterone, KCNQ2/KCNQ3 openers (e.g., retigabine, XEN1101, QRL-101), anticonvulsants and psychostimulant agents, deep brain stimulation, istradefylline (nourianz), safinamide (xadago), amantadine (gocovri, Symmetrel, osmolex), benztropine (Cogentin), trihexyphenidyl (artane), selegiline (eldepryl, zelapar), rasagiline, entacapone (comtan), opicapone (ongentys), tolcapone (tasmar), apomorphine (apokyn, kynmobi), exenatide, lingzhi, BIIB054, BIIB094, Caffeine, sarizotan, embryonic dopamine cell implantation, aducanamab (Aduhlem), Namzeric, Suvorexant (belsomra), lecanemab, olanzapine (Zyprexa), quetiapine (Seroquel), SSRIs (citalopram (Cipramil), dapoxetine (Priligy), escitalopram (Cipralex), fluoxetine (Prozac or Oxactin), fluvoxamine (Faverin), paroxetine (Seroxat), sertraline (Lustral), vortioxetine (Brintellix)),, nusinersen (spinraza), onasemnogene abeparvovec-xioi (zolgensma), risdiplam (evrysdi)Brivaracetam (briviact), cannabidiol (epidiolex), carbamazepine (carbatrol, Tegretol), cenobamate (xcopri), diazepam (valium), lorazepam (Ativan), clonazepam (klonopin), eslicarbazepine (aptiom), ethosuximide (zarontin), felbamate (felbatol), fenfluramine (fintepla), lacosamide (VIMPAT), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (oxtellar xr, Trileptal), perampanel (fycompa), phenobarbital, phenytoin (dilantin), pregabalin (lyrica), tiagabine (gabitril), topiramate (topamax), valproate (depakene, depakote), zonisamide (zonegran), bioactive scaffolds, such as bioactive scaffolds with enhanced supramolecular motion, and/or a therapy (e.g., selected from breathing care, physical therapy, occupational therapy, speech therapy, nutritional support), for treating said neurologic disease. [0068] Additionally disclosed herein is a method of treating a neurological disease and/or a neuropathy in a patient in need thereof, the method comprising administering to a patient in need thereof a therapeutically effective amount of a pharmaceutical composition disclosed above, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non-natural linkage, wherein the oligonucleotide comprises a spacer, and wherein the oligonucleotide further comprises a targeting or conjugate moiety selected from cholesterol, lipoic acid, panthothenic acid, polyethylene glycol, and an antibody for crossing the blood brain barrier. [0069] In various embodiments, the spacer is a nucleoside-replacement group comprising a non- sugar substitute that is incapable of linking to a nucleotide base. In various embodiments, the spacer is located at position 8 of the oligonucleotide, and wherein the second spacer is located at position 16 of the oligonucleotide. In various embodiments, the spacer is located between positions 10 and 15 of the oligonucleotide. In various embodiments, the spacer is located between positions 7 and 11 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 14 and 22 of the oligonucleotide. In various embodiments, the spacer and the second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases in the oligonucleotide. In various embodiments, the spacer is located between positions 7 and 9 of the oligonucleotide, and wherein the second spacer is located between positions 15 and 18 of the oligonucleotide. [0070] In various embodiments, the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 21 and 24 of the oligonucleotide. In various embodiments, the spacer is located between positions 2 and 5 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 8 and 12 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 18 and 22 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer and a third spacer, wherein the three spacers are located at positions in the oligonucleotide such that each segment of the oligonucleotide has at most 7 linked nucleosides. [0071] In various embodiments, at least two of the three spacers are adjacent to a guanine nucleobase. In various embodiments, each of the at least two of the three spacers immediately precede a guanine nucleobase. [0072] In various embodiments, of the methods described herein, each of the first, second or third spacers is a nucleoside-replacement group comprising a non-sugar substitute wherein the non-sugar substitute does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal or hemiaminal moiety and is incapable of forming a covalent bond with a nucleotide base. [0073] In certain embodiments, each of the first, second or third spacers is independently represented by Formula (X), wherein: Formula (X)
Figure imgf000022_0001
A is an optionally substituted 4-8 member monocyclic cycloalkyl group or a 4-8 member monocyclic heterocyclyl group, wherein the heterocyclyl group contains 1 or 2 heteroatoms selected from O, S and N, provided that A is not capable of forming a covalent bond to a nucleobase; and the symbol represents the point of connection to an internucleoside linkage. [0074] In
Figure imgf000022_0002
rious embodiments, each of the first, second or third spacers is independently represented by Formula (Xa), wherein: Formula (Xa). [
Figure imgf000022_0003
ome embodiments, ring A is an optionally substituted 4-8 member monocyclic cycloalkyl group selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; or a 4-8 member monocyclic heterocyclyl group, selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl. [0076] In further embodiments, ring A is tetrahydrofuranyl. [0077] In other embodiments, ring A is tetrahydropyranyl. [0078] In various embodiments, each of the first, second or third spacers is independently represented by Formula (I), wherein: Formula (I)
Figure imgf000022_0004
X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.
[0079] In various embodiments, the spacer or the second spacer is represented by Formula (I’), wherein:
[0080]
Figure imgf000023_0001
Formula (I’)
X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.
[0081] In various embodiments, each of the first, second or third spacers is independently represented by Formula (la), wherein:
Figure imgf000023_0002
Formula (la); and n is 0, 1, 2 or 3.
[0082] In various embodiments, each of the first, second or third spacers is independently represented by Formula (la’), wherein:
Figure imgf000023_0003
Formula (la’); and n is 0, 1, 2 or 3.
[0083] In certain embodiments, each of the first, second or third spacers is independently represented by Formula II, wherein:
Figure imgf000024_0001
X is selected from -CH2- and -O-.
[0084] In further embodiments, each of the first, second or third spacers is independently represented by Formula II’, wherein:
Figure imgf000024_0002
X is selected from -CH2- and -O-.
[0085] In various embodiments, each of the first, second or third spacers is independently represented by Formula (lia), wherein:
Figure imgf000024_0003
[0086] In further embodiments, each of the first, second or third spacers is independently represented by Formula (lia’), wherein:
Figure imgf000024_0004
[0087] In some embodiments, the spacer is represented by Formula (Hi), wherein:
Figure imgf000024_0005
Formula (IIi)
X is selected from -CH2- and -O-.
[0088] In some embodiments, the spacer is represented by Formula (IIi’), wherein: Formula (IIi’)
Figure imgf000025_0001
X is selected from -CH2-and -O. [0089] In some embodiments, the spacer is represented by Formula (IIib), wherein: Formula (IIib).
Figure imgf000025_0002
[0090] In some embodiments, the spacer is represented by Formula (Iiib’), wherein: Formula (IIib’).
Figure imgf000025_0003
[0091] In various embodiments, each of the first, second or third spacers is independently represented by Formula III, wherein: Formula (III); and
Figure imgf000025_0004
elected from -CH2- and -O-. [0092] In further embodiments, each of the first, second or third spacers is independently represented by Formula III’, wherein: Formula (III’); and
Figure imgf000025_0005
elected from -CH2- and -O-. [0093] In some embodiments, each of the first, second or third spacers is independently represented by Formula (IIIa), wherein: Formula (IIIa).
Figure imgf000026_0001
ther embodiments, each of the first, second or third spacers is independently represented by Formula (IIIa’), wherein: Formula (IIIa’).
Figure imgf000026_0002
[0095] In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 10%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 20%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 25%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 30%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 40%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 50%. BRIEF DESCRIPTION OF THE DRAWINGS [0096] Figure 1 shows an example antisense oligonucleotide (AON), a portion of which is complementary to a mRNA transcript or pre-mRNA transcript. Dashed lines indicate positions of the AON which may or may not be occupied by a spacer. DETAILED DESCRIPTION [0097] The features and other details of the disclosure will now be more particularly described. Certain terms employed in the specification, examples and appended claims are collected here. These definitions should be read in light of the remainder of the disclosure and understood as by a person of skill in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by a person of ordinary skill in the art. [0098] Disclosed herein are oligonucleotides capable of targeting a region of a transcript transcribed from a gene. In various embodiments, such oligonucleotides target a KCNQ2 transcript. Additionally disclosed herein are oligonucleotides, including antisense oligonucleotide sequences, and methods for treating neurological diseases, such as amyotrophic lateral sclerosis and frontotemporal dementia, and/or neuropathies such as chemotherapy induced neuropathy, using same. In various embodiments, the oligonucleotides target a sequence of KCNQ2 transcripts resulting in the reduction of levels of mis-spliced KCNQ2 transcripts. Also disclosed are pharmaceutical compositions comprising KCNQ2 oligonucleotides that target a region of KCNQ2 transcripts, for treating neurological diseases and/or neuropathies; and manufacture of medicaments containing a disclosed KCNQ2 oligonucleotide that targets a region of KCNQ2 transcripts to be used in treating a neurological disease and/or neuropathy. Definitions [0099] The terms “treat,” “treatment,” “treating,” and the like are used herein to generally mean obtaining a desired pharmacological and/or physiological effect. The effect may be therapeutic in terms of partially or completely curing a disease and/or adverse effect attributed to the disease. The term “treatment” as used herein covers any treatment of a disease in a mammal, particularly a human, and includes: (a) inhibiting the disease, i.e., preventing the disease from increasing in severity or scope; (b) relieving the disease, i.e., causing partial or complete amelioration of the disease; or (c) preventing relapse of the disease, i.e., preventing the disease from returning to an active state following previous successful treatment of symptoms of the disease or treatment of the disease. [00100] “Preventing” includes delaying the onset of clinical symptoms, complications, or biochemical indicia of the state, disorder, disease, or condition developing in a subject that may be afflicted with or predisposed to the state, disorder, disease, or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder, disease, or condition. “Preventing” includes prophylactically treating a state, disorder, disease, or condition in or developing in a subject, including prophylactically treating clinical symptoms, complications, or biochemical indicia of the state, disorder, disease, or condition in or developing in a subject. [00101] The term “pharmaceutically acceptable carrier” or “pharmaceutically acceptable excipient” as used herein interchangeably refers to any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The compositions may also contain other active compounds providing supplemental, additional, or enhanced therapeutic functions. [00102] The term “pharmaceutical composition” as used herein refers to a composition comprising at least one biologically active compound, for example, a KCNQ2 antisense oligonucleotide (AON), as disclosed herein formulated together with one or more pharmaceutically acceptable excipients. [00103] “Individual,” “patient,” or “subject” are used interchangeably and include any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, swine, cattle, sheep, horses, or non-human primates, and most preferably humans. The compounds of the invention can be administered to a mammal, such as a human, but can also be other mammals such as an animal in need of veterinary treatment, e.g., domestic animals (e.g., dogs, cats, and the like), farm animals (e.g., cows, sheep, pigs, horses, and the like) and laboratory animals (e.g., rats, mice, guinea pigs, non-human primates, and the like). In some embodiments, the mammal treated in the methods of the invention is desirably a mammal in whom modulation of KCNQ2 expression and/or activity is desired. [00104] As used herein, “KCNQ2” (also known as Kv7.2, KCNA11, HNSPC, ENB1, BNFC, Potassium Channel, Voltage Gated KQT-Like Subfamily Q, Member 2, Neuroblastoma-Specific Potassium Channel Subunit Alpha KvLQT2, Potassium Voltage-Gated Channel Subfamily KQT Member 2) refers to the gene or gene products (e.g., protein or mRNA transcript (including pre- mRNA) encoded by the gene) identified by any one of SEQ ID NOs: 1357-1370 and allelic variants thereof, as well as orthologs found in non-human species (e.g., non-human primates or mice). [00105] The term “KCNQ2 transcript” refers to a KCNQ2 transcript. Such a KCNQ2 transcript can be a KCNQ2 pre-mRNA sequence or a KCNQ2 mature RNA sequence. KCNQ2 transcript sequences are shown to contain thymine (T), but one of skill in the art will appreciate that thymine (T) can generally be replaced with uracil (U) in RNA sequences. [00106] The term “KCNQ2 oligonucleotide,” “KCNQ2 antisense oligonucleotide,” or “KCNQ2 AON” refers to an oligonucleotide that is capable of increasing, restoring, or stabilizing full- length KCNQ2 activity e.g., full length KCNQ2 expression, for example, full length KCNQ2 mRNA and/or full length KCNQ2 protein expression. Generally, a KCNQ2 oligonucleotide reduces the level of mis-spliced KCNQ2 transcripts by targeting a KCNQ2 transcript (e.g., KCNQ2 pre-mRNA or mis-spliced KCNQ2 with a target sequence). In various embodiments, a KCNQ2 oligonucleotide comprises a sequence that is at least 85% complementary to an equal length portion of a transcript comprising a sequence at least 90% identity to any one of SEQ ID NOs: 1357-1370 or a contiguous 15 to 50 nucleobase portion to any one of SEQ ID NO: 1357- 1370. KCNQ2 target sequences are shown to contain thymine (T), but one of skill in the art will appreciate that thymine (T) can generally be replaced with uracil (U) in RNA sequences. [00107] In various embodiments, KCNQ2 oligonucleotides are characterized by having one or more spacers, where each spacer divides up the KCNQ2 oligonucleotide into segments of linked nucleosides. In various embodiments, KCNQ2 oligonucleotides have two spacers. In one embodiment, KCNQ2 oligonucleotides have two segments of linked nucleosides separated by one spacer. In one embodiment, KCNQ2 oligonucleotides have three segments of linked nucleosides separated by two spacers. In such embodiments, KCNQ2 oligonucleotides have one segment with at most 7 linked nucleosides. For example, a KCNQ2 oligonucleotide may have, from the 5’ to the 3’ end, 5 linked nucleosides, followed by a spacer, 10 linked nucleosides, followed by a second spacer, and 8 linked nucleosides. Thus, the first segment of 5 linked nucleosides satisfies the one segment with at most 7 linked nucleosides. In various embodiments, KCNQ2 oligonucleotides have three spacers that divide the KCNQ2 oligonucleotide into four segments. In various embodiments, each of the four segments of the KCNQ2 oligonucleotide have at most 7 linked nucleosides. [00108] As used herein, the term “KCNQ2 oligonucleotide” encompasses a “KCNQ2 parent oligonucleotide,” a “KCNQ2 oligonucleotide with one or more spacers” (e.g., KCNQ2 oligonucleotide with two spacers or a KCNQ2 oligonucleotide with three spacers), a “KCNQ2 oligonucleotide variant with one or more spacers.” Examples of KCNQ2 oligonucleotides include oligonucleotides comprising a sequence of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353- 854, SEQ ID NOs: 1371-1546, SEQ ID NO: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. [00109] The term “KCNQ2 parent oligonucleotide” refers to an oligonucleotide that targets a KCNQ2 transcript and is capable of increasing, restoring, or stabilizing full-length KCNQ2 activity e.g., full length KCNQ2 expression, for example, full length KCNQ2 mRNA and/or full length KCNQ2 protein expression. KCNQ2 parent oligonucleotides do not include a spacer. Examples of KCNQ2 parent oligonucleotides include oligonucleotides comprising a sequence of any one of SEQ ID NOs: 1-176 and SEQ ID NOs: 353-854. As described hereafter, KCNQ2 oligonucleotide with spacers and KCNQ2 oligonucleotide variants are described in relation to a corresponding KCNQ2 parent oligonucleotide. [00110] The term “KCNQ2 oligonucleotide variant” refers to a KCNQ2 oligonucleotide that represents a modified version of a corresponding KCNQ2 parent oligonucleotide. For example, a KCNQ2 oligonucleotide variant represents a shortened version of a KCNQ2 parent oligonucleotide. In various embodiments, a KCNQ2 oligonucleotide variant is any one of a 15mer, 16mer, 17mer, 18mer 19mer, 20mer, 21mer, 22mer, 23mer, 24mer, 25mer, 26mer, or 27mer. Examples of KCNQ2 oligonucleotide variants include oligonucleotides comprising a sequence of any one of SEQ ID NOs: 1371-1546, and SEQ ID NO: 1723-2224. In various embodiments, KCNQ2 oligonucleotide variants comprise one or more spacers. Such KCNQ2 oligonucleotide variants comprise a sequence of any one of SEQ ID NOs: 2794-2801, SEQ ID NOs: 2802-2830 and SEQ ID NO: 2831-2855. [00111] The term “oligonucleotide with one or more spacers” or “oligonucleotide comprising a spacer” refers to an oligonucleotide with at least one spacer. An oligonucleotide with one or more spacers can, in various embodiments, include one spacer, two spacers, three spacers, four spacer, five spacers, six spacers, seven spacers, eight spacers, nine spacers, or ten spacers. In various embodiments, an oligonucleotide comprising one or more spacers includes at least one segment with at most 7 linked nucleosides. For example, as described in a 5’ to 3’ direction, an oligonucleotide comprising a spacer can include a segment with 7 linked nucleosides, followed by a spacer, a second segment with 9 linked nucleosides, followed by a second spacer, and a third segment with 7 linked nucleosides. Here, the first segment of 7 linked nucleosides and the third segment of 7 linked nucleosides each represents segments with at most 7 linked nucleosides. As another example, an oligonucleotide comprising a spacer can include a segment with 10 linked nucleosides, followed by a spacer, a second segment with 10 linked nucleosides, followed by a second spacer, and a third segment with 3 linked nucleosides. Here, the third segment of 3 linked nucleosides represents the segment with at most 7 linked nucleosides. In various embodiments, an oligonucleotide with one or more spacers includes multiple segments with at most 7 linked nucleosides. In various embodiments, every segment of an oligonucleotide with one or more spacers has at most 7 linked nucleosides. For example, the oligonucleotide may be a 23mer and include two spacers that divide the 23mer into three separate segments of 7 linked nucleosides each. Therefore, each segment of the oligonucleotide has at most 7 linked nucleosides. [00112] Generally, KCNQ2 oligonucleotides comprising one or more spacers are described in reference to a corresponding KCNQ2 parent oligonucleotide or a corresponding KCNQ2 oligonucleotide variant. Example KCNQ2 oligonucleotides comprising one or spacers include any of the sequences in Tables 3A, 3B, 4 and 5, SEQ ID NOs: 2794-2801, SEQ ID NOs: 2802- 2830 and SEQ ID NO: 2831-2855. [00113] In various embodiments, one or more spacers may be located at one or more positions of an oligonucleotide. A spacer may be located between a first position and a second position of the oligonucleotide. As used herein, a spacer located between a first position and second position encompasses the spacer being located at the first position, located at the second position, or located at any position of the oligonucleotide sandwiched by the first position and the second position. [00114] In the present specification, the term “therapeutically effective amount” means the amount of an oligonucleotide that will elicit the biological or medical response of a tissue, system, animal or human that is being sought by the researcher, veterinarian, medical doctor, or other clinician. In one embodiment, the oligonucleotide comprises a sequence that is at least 85% complementary to an equal length portion of a transcript comprising a sequence at least 90% identity to any one of SEQ ID NO: 1357-1370, or a contiguous 15 to 50 nucleobase portion to any one of SEQ ID NO: 1357-1370. The oligonucleotide is administered in therapeutically effective amounts to treat and/or prevent a disease, condition, disorder, or state, for example, a neurological disease and/or a neuropathy. Alternatively, a therapeutically effective amount of an oligonucleotide is the quantity required to achieve a desired therapeutic and/or prophylactic effect, such as an amount which results in the prevention of or a decrease in the symptoms associated with a disease associated with reduced KCNQ2 activity in the motor neurons. [00115] The phrase “a KCNQ2 oligonucleotide that targets a KCNQ2 transcript” refers to a KCNQ2 oligonucleotide that binds to a KCNQ2 transcript. [00116] The term “pharmaceutically acceptable salt(s)” as used herein refers to salts of acidic or basic groups that may be present in a KCNQ2 oligonucleotide used in the present compositions. A KCNQ2 oligonucleotide included in the present compositions that are basic in nature are capable of forming a wide variety of salts with various inorganic and organic acids. The acids that may be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmacologically acceptable anions, including but not limited to malate, oxalate, chloride, bromide, iodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, oleate, tannate, pantothenate, bitartrate, ascorbate, succinate, maleate, gentisinate, fumarate, gluconate, glucuronate, saccharate, formate, benzoate, glutamate, methanesulfonate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate and pamoate (i.e., 1,1’- methylene-bis-(2-hydroxy-3-naphthoate)) salts. A KCNQ2 oligonucleotide included in the present compositions that include an amino moiety may form pharmaceutically acceptable salts with various amino acids, in addition to the acids mentioned above. Compounds included in the present compositions that are acidic in nature are capable of forming base salts with various pharmacologically acceptable cations. Examples of such salts include alkali metal or alkaline earth metal salts and, particularly, calcium, magnesium, sodium, and lithium salts. Pharmaceutically acceptable salts of the disclosure include, for example, pharmaceutically acceptable salts of KCNQ2 oligonucleotides that include a sequence of any of SEQ ID NOs: 1- 176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NO: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. [00117] A KCNQ2 oligonucleotide of the disclosure may contain one or more chiral centers, groups, linkages, and/or double bonds and, therefore, exist as stereoisomers, such as geometric isomers, enantiomers or diastereomers. The term “stereoisomers” when used herein consist of all geometric isomers, enantiomers or diastereomers. These compounds may be designated by the symbols “R” or “S” (or “Rp” or “Sp”) depending on the configuration of substituents around the stereogenic atom, for example, a stereogenic carbon, phosphorous, or sulfur atom. In some embodiments, one or more linkages of the compound may have a Rp or Sp configuration (e.g., one or more phosphorothioate linkages have either a Rp or Sp configuration). The configuration of each phosphorothioate linkage may be independent of another phosphorothioate linkage (e.g., one phosphorothioate linkage has a Rp configuration and a second phosphorothioate linkage has a Sp configuration). In various embodiments, the KCNQ2 oligonucleotide can have a mixed configuration of phosphorothioate linkages. For example, the KCNQ2 oligonucleotide may have five phosphorothioate linkages in a Rp configuration, followed by fifteen phosphorothioate linkages in a Sp configuration, followed by five phosphorothioate linkages in a Rp configuration. The present invention encompasses various stereoisomers of these compounds and mixtures thereof. Stereoisomers include enantiomers and diastereomers. Mixtures of enantiomers or diastereomers may be designated “(±)” in nomenclature, but the skilled artisan will recognize that a structure may denote a chiral center implicitly. [00118] Individual stereoisomers of a KCNQ2 oligonucleotide of the present invention can be prepared synthetically from commercially available starting materials that contain asymmetric or stereogenic centers, or by preparation of racemic mixtures followed by resolution methods well known to those of ordinary skill in the art. These methods of resolution are exemplified by (1) attachment of a mixture of enantiomers to a chiral auxiliary, separation of the resulting mixture of diastereomers by recrystallization or chromatography and liberation of the optically pure product from the auxiliary, (2) salt formation employing an optically active resolving agent, or (3) direct separation of the mixture of optical enantiomers on chiral chromatographic columns. Stereoisomeric mixtures can also be resolved into their component stereoisomers by well-known methods, such as chiral-phase gas chromatography, chiral-phase super critical fluid chromatography, chiral-phase simulated moving bed chromatography, chiral-phase high performance liquid chromatography, crystallizing the compound as a chiral salt complex, or crystallizing the compound in a chiral solvent. Stereoisomers can also be obtained from stereomerically-pure intermediates, reagents, and catalysts by well-known asymmetric synthetic methods. [00119] The KCNQ2 oligonucleotide disclosed herein can exist in solvated as well as unsolvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and it is intended that the invention embrace both solvated and unsolvated forms. [00120] The disclosure also embraces isotopically labeled compounds of the invention (i.e., isotopically labeled KCNQ2 oligonucleotide) which are identical to those recited herein, except that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number abundantly found in nature. Examples of isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine and chlorine, such as 2H, 3H, 11C, 13C, 14C, 15N, 18O, 17O, 31P, 32P, 33P, 35S, 18F, and 36Cl, respectively. [00121] Certain isotopically labeled disclosed compounds (e.g., those labeled with 3H, 14C, or 35S) are useful in compound and/or substrate tissue distribution assays. Tritiated (i.e., 3H), carbon-14 (i.e., 14C), or 35S isotopes are particularly preferred for their ease of preparation and detectability. Further, substitution with heavier isotopes such as deuterium (i.e., 2H) may afford certain therapeutic advantages resulting from greater metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements) and hence may be preferred in some circumstances. [00122] As used herein, “2’-O-(2-methoxyethyl)” (also 2’-MOE and 2’-O(CH2)2OCH3 and MOE) refers to an O-methoxyethyl modification of the 2’ position of a furanose ring. A 2’-O-(2- methoxyethyl) is used interchangeably as “2’-O-methoxyethyl” in the present disclosure. A sugar moiety in a nucleoside modified with 2’-MOE is a modified sugar. [00123] As used herein, “2’-MOE nucleoside” (also 2’-O-(2-methoxyethyl) nucleoside) means a nucleoside comprising a 2’-MOE modified sugar moiety. [00124] As used herein, “2’-substituted nucleoside” means a nucleoside comprising a substituent at the 2’-position of the furanose ring other than H or OH. In certain embodiments, 2’ substituted nucleosides include nucleosides with bicyclic sugar modifications. [00125] As used herein, “5-methyl cytosine” (5-MeC) means a cytosine modified with a methyl group attached to the 5 position. A 5-methyl cytosine (5-MeC) is a modified nucleobase. [00126] As used herein, “bicyclic sugar” means a furanose ring modified by the bridging of two atoms. A bicyclic sugar is a modified sugar. [00127] As used herein, “bicyclic nucleoside” (also BNA) means a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of the sugar ring, thereby forming a bicyclic ring system. In certain embodiments, the bridge connects the 4’-carbon and the 2’-carbon of the sugar ring. [00128] As used herein, “cap structure” or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an antisense compound. [00129] As used herein, “cEt” or “constrained ethyl” means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting the 4’-carbon and the 2’-carbon, wherein the bridge has the formula: 4’-CH(CH3)—O-2’. [00130] As used herein, “constrained ethyl nucleoside” (also cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising a 4’-CH(CH3)—O-2’ bridge. In some embodiments, cEt can be modified. In some embodiments, the cEt can be S-cEt (in an S- constrained ethyl 2’-4’-bridged nucleic acid). In some other embodiments, the cEt can be R-cEt. [00131] As used herein, “internucleoside linkage” refers to the covalent linkage between adjacent nucleosides in an oligonucleotide. In some embodiments, as used herein, “non-natural linkage” refers to a “modified internucleoside linkage.” [00132] As used herein, “contiguous” in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or internucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence. As an example to the contrary, two nucleosides separated by a spacer are not contiguous. [00133] As used herein, “locked nucleic acid” or “LNA” or “LNA nucleosides” means nucleic acid monomers having a bridge (e.g., methylene, ethylene, aminooxy, or oxyimino bridge) connecting two carbon atoms between the 4’ and 2’ position of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugar include, but are not limited to (A) α-L- Methyleneoxy (4’-CH2—O-2’) LNA, (B) β-D-Methyleneoxy (4’-CH2—O-2’) LNA, (C) Ethyleneoxy (4’-(CH2)2—O-2’) LNA, (D) Aminooxy (4’-CH2—O—N(R)-2’) LNA and (E) Oxyamino (4’-CH2—N(R)—O-2’) LNA; wherein R is H, C1-C12 alkyl, or a protecting group (see U.S. Pat. No.7,427,672, issued on Sep.23, 2008). [00134] As used herein, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4’ and the 2’ position of the sugar wherein each of the bridges independently comprises 1 or from 2 to 4 linked groups independently selected from — [C(R1)(R2)]n —, —C(R1)=C(R2)—, —C(R1)=N—, —C(=NR1)—, —C(=O)—, —C(=S)—, — O—, —Si(R1)2—, —S(=O)x— and —N(R1) —; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R1 and R2 is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, a heterocycle radical, a substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O) —H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)- J1); and each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O) —H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group. [00135] Examples of 4’-2’ bridging groups encompassed within the definition of LNA include, but are not limited to one of formulae: —[C(R1)( R2)]n —, — [C(R1)(R2)]n—O—, — C(R1R2)— N(R1)—O— or —C(R1R2)—O—N(R1)—. Furthermore, other bridging groups encompassed with the definition of LNA are 4’-CH2-2’, 4’-(CH2)2-2’, 4’-(CH2)3-2’, 4’-CH2—O-2’, 4’-(CH2)2—O- 2’, 4’- CH2—O—N(R1)-2’ and 4’- CH2—N(R1)—O-2’- bridges, wherein each R1 and R2 is, independently, H, a protecting group or C1-C12 alkyl. [00136] Also included within the definition of LNA according to the invention are LNAs in which the 2’-hydroxyl group of the ribosyl sugar ring is connected to the 4’ carbon atom of the sugar ring, thereby forming a bridge to form the bicyclic sugar moiety. The bridge can be a methylene (—CH2—) group connecting the 2’ oxygen atom and the 4’ carbon atom, for which the term methyleneoxy (4’-CH2—O-2’) LNA is used. Furthermore, in the case of the bicyclic sugar moiety having an ethylene bridging group in this position, the term ethyleneoxy (4’-CH2CH2—O-2’) LNA is used. [00137] As used herein, a “spacer” refers to a nucleoside-replacement group (e.g., a non- nucleoside group that replaces a nucleoside present in a KCNQ2 parent oligonucleotide). The spacer is characterized by the lack of a nucleotide base and by the replacement of the nucleoside sugar moiety with a non-sugar substitute. The non-sugar substitute group of a spacer lacks an aldehyde, ketone, acetal, ketal, hemiacetal or hemiketal group. The non-sugar substitute group of a spacer is thus capable of connecting to the 3’ and 5’ positions of the nucleosides adjacent to the spacer through an internucleoside linker as described herein, but not capable of forming a covalent bond with a nucleotide base (i.e., not capable of linking a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide). Generally, a KCNQ2 oligonucleotide with a spacer is described in relation to a KCNQ2 parent oligonucleotide, wherein the spacer replaces a nucleoside of the KCNQ2 parent oligonucleotide. In all embodiments of the present disclosure, a spacer cannot hybridize to a nucleoside comprising a nucleobase at the corresponding position of a KCNQ2 transcript, within the numerical order of the length of the AON oligonucleotide (i.e., if the spacer is positioned after nucleoside 4 of an AON (i.e., at position 5 from the 5’-end), the spacer is not complementary to the nucleoside (A, C, G, or U) at the same corresponding position of the target KCNQ2 transcript)). [00138] As used herein, “mismatch” or a “non-complementary group” refers to the case when a group (e.g., nucleobase) of a first nucleic acid is not capable of pairing with the corresponding group (e.g., nucleobase) of a second or target nucleic acid. [00139] As used herein, “modified internucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside linkage (e.g., a phosphodiester internucleoside bond). [00140] As used herein, “modified nucleobase” means any nucleobase other than adenine, cytosine, guanine, thymine, or uracil. Examples of a modified nucleobase include 5-methyl cytosine, pseudouridine, or 5-methoxyuridine. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U). [00141] As used herein, a “modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. Modified nucleosides include abasic nucleosides, which lack a nucleobase. However, modified nucleosides do not include spacers or other groups that are incapable of linking a nucleobase. [00142] As used herein, “linked nucleosides” are nucleosides that are connected in a contiguous sequence (i.e., no additional nucleosides are presented between those that are linked). In various embodiments, an oligonucleotide may have different segments of linked nucleosides connected through a spacer. Here, the spacer (i.e., nucleoside replacement) is not considered a nucleoside and therefore, divides up the oligonucleotide into two segments of linked nucleosides. The oligonucleotide may have a first segment of Y linked nucleosides (e.g., Y nucleosides that are connected in a contiguous sequence), followed by a spacer, and then a second segment of Z linked nucleosides. Here, the Y and Z linked nucleosides is described in either the 5’ to 3’ direction or the 3’ to 5’ direction. In various embodiments, the first segment consists of 7 or fewer linked nucleosides (e.g., Y = 7 or fewer) whereas the second segment comprises 8 or more linked nucleosides (e.g., Z = 8 or more). [00143] As used herein, “modified oligonucleotide” means an oligonucleotide comprising at least one (i.e., one or more) modified internucleoside linkage, modified sugar, and/or modified nucleobase. [00144] As used herein, “modified sugar” or “modified sugar moiety” means a modified furanosyl sugar moiety or a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, conjugate group, or terminal group in an oligonucleotide. [00145] As used herein, “monomer” means a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified. [00146] As used herein, “motif” means the pattern of unmodified and modified nucleosides in an antisense compound. [00147] As used herein, “natural sugar moiety” means a sugar moiety found in DNA (2’-H) or RNA (2’-OH). [00148] As used herein, “naturally occurring internucleoside linkage” means a 3’ to 5’ phosphodiester linkage. [00149] As used herein, “non-complementary nucleobases” refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization. [00150] As used herein, “nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, non-coding RNA, small interfering ribonucleic acids (siRNA), short-hairpin RNA (shRNA), and microRNAs (miRNA). [00151] As used herein, “nucleobase” means a heterocyclic moiety capable of base pairing with a base of another nucleic acid. [00152] As used herein, “nucleobase complementarity” refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobase refers to a nucleobase of an antisense compound that is capable of base pairing with a corresponding nucleobase of its target nucleic acid. For example, if a nucleobase at a certain position of an antisense compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair. [00153] As used herein, “nucleobase sequence” means the order of nucleobases independent of any sugar, linkage, and/or nucleobase modification. [00154] As used herein, “nucleoside” refers to a nucleobase linked to a sugar. The term “nucleoside” also includes a “modified nucleoside” which has independently, a modified sugar moiety and/or modified nucleobase. [00155] As used herein, “nucleoside mimetic” includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound such as for example nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, e.g., non-furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholinos (morpholinos linked by a phosphorodiamidate or other non-phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with a tetrahydropyranyl ring system. “Mimetic” refers to groups that are substituted for a sugar, a nucleobase, and/or internucleoside linkage. Generally, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target. [00156] As used herein, “nucleotide” means a nucleoside having a phosphate group covalently linked to the sugar portion of the nucleoside. [00157] As used herein, “oligomeric compound” or “oligomer” means a polymer of linked monomeric subunits which is capable of hybridizing to at least a region of a nucleic acid molecule. [00158] As used herein, “oligonucleotide” means a polymer of one or more segments of linked nucleosides each of which can be modified or unmodified, independent one from another. [00159] As used herein, “hotspot region” is a range of nucleobases on a target nucleic acid amenable to oligomeric compound-mediated modulation of the splicing of the target nucleic acid. [00160] As used herein, “hybridization” means the pairing or annealing of complementary oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding between complementary nucleobases. [00161] As used herein, “increasing the amount of activity” refers to more transcriptional expression, more accurate splicing resulting in full length mature mRNA and/or protein expression, and/or more activity relative to the transcriptional expression or activity in an untreated or control sample. Antisense Therapeutics [00162] Antisense therapeutics are a class of nucleic acid-based compounds that can be used to modulate a transcript, such as mRNA. In various embodiments, antisense therapeutics comprise one or more spacers and can be used to modulate a transcript that is transcribed from a gene, such as a KCNQ2 pre-mRNA. [00163] Antisense therapeutics may be single- or double-stranded deoxyribonucleic acid (DNA)- based, ribonucleic acid (RNA)-based, or DNA/RNA chemical analogue compounds. In general, antisense therapeutics are designed to include a sequence that is complementary or nearly complementary to an mRNA or pre-mRNA sequence transcribed from a given gene in order to promote binding between the antisense therapeutic and the pre-mRNA or mRNA. In certain embodiments, antisense therapeutics act by binding to an mRNA or pre-mRNA, thereby inhibiting protein translation, altering pre-mRNA splicing into mature mRNA (e.g., by preventing appropriate proteins such as splicing activator proteins from binding), and/or causing destruction of mRNA. In certain embodiments, the antisense therapeutic sequence is complementary to a portion of a targeted gene’s or mRNA’s sense sequence. In certain embodiments, antisense therapeutics described herein are oligonucleotide-based compounds that include an oligonucleotide sequence complementary to a pre-mRNA sense, or a portion thereof, and one or more spacers. In certain embodiments, antisense therapeutics described herein can also be nucleotide chemical analog-based compounds. [00164] In certain embodiments, an oligonucleotide, such as disclosed herein, may be an oligonucleotide sequence of 5 to 100 oligonucleotide units in length, for example, 10 to 60 oligonucleotide units in length, for example, 12 to 50 oligonucleotide units in length, 14 to 40 oligonucleotide units in length, 10 to 30 oligonucleotide units in length, for example, 14 to 30 oligonucleotide units in length, for example, 14 to 25 or 15 to 22 oligonucleotide units in length, or 18, 19, 20, 21, 22, 23, 24, or 25 oligonucleotide units in length. As used herein, an “oligonucleotide unit” refers to either a nucleoside (e.g., a nucleoside which includes a sugar and/or a nucleobase) or a nucleoside-replacement group (e.g., a spacer) of the oligonucleotide. [00165] In particular embodiments, the oligonucleotides are 25 oligonucleotide units in length. In particular embodiments, the oligonucleotides are 23 oligonucleotide units in length. In particular embodiments, the oligonucleotides are 21 oligonucleotide units in length. In particular embodiments, the oligonucleotides are 19 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 18 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 19 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 20 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 21 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 22 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 23 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 24 oligonucleotide units in length. In various embodiments, the oligonucleotide is at least 25 oligonucleotide units in length. [00166] In certain embodiments, AONs may include chemically modified nucleosides (for example, 2’-O-methylated nucleosides or 2’-O-(2-methoxyethyl) nucleosides) as well as modified internucleoside linkages (for example, phosphorothioate linkages). In certain embodiments, AONs described herein include oligonucleotide sequences that are complementary to RNA sequences, such as KCNQ2 mRNA sequences. In certain embodiments, AONs described herein can include chemically modified nucleosides and modified internucleoside linkages (for example, phosphorothioate linkages). In particular embodiments, AONs described herein include one or more spacers. [00167] In various embodiments, the oligonucleotides comprise one or more spacers. In particular embodiments, the oligonucleotides comprise one spacer. In various embodiments, the oligonucleotides comprise two spacers. For example, the oligonucleotide includes 23 oligonucleotide units with 21 nucleobases and two nucleoside replacement groups (e.g., two spacers). Further embodiments of oligonucleotides with one spacer and oligonucleotides with two spacers are described herein. [00168] In some embodiments, an antisense oligonucleotide can be, but is not limited to, inhibitors of a gene transcript (for example, shRNAs, siRNAs, PNAs, LNAs, 2’-O-methyl (2’OMe) antisense oligonucleotide (AON), 2’-O-(2-methoxyethyl) (MOE) AON, or morpholino oligomers (e.g., phosphorodiamidate morpholino (PMO))), or compositions that include such compounds. In some embodiments an oligonucleotide is an antisense oligonucleotide (AON) comprising 2’OMe (e.g., a AON comprising one or more 2’OMe modified sugar), MOE (e.g., a AON comprising one or more MOE modified sugar), peptide nucleic acids (e.g., a AON comprising one or more N-(2-aminoethyl)-glycine units linked by amide bonds or carbonyl methylene linkage as repeating units in place of a sugar-phosphate backbone), locked nucleic acids (e.g., a AON comprising one or more locked ribose, and can be a mixture of 2’-deoxy nucleotides or 2’OMe nucleotides), c-ET (e.g., a AON comprising one or more cET sugar), constrained methoxyethyl (cMOE) (e.g., a AON comprising one or more cMOE sugar), morpholino oligomer (e.g., a AON comprising a backbone comprising one or more PMO), deoxy- 2’-fluoro nucleoside (e.g., a AON comprising one or more 2’-fluoro-β-D-arabinonucleoside), tricyclo-DNAs (tcDNA) (e.g., a AON comprising one or more tcDNA modified sugar), 2’-O,4’- C-Ethylene-bridged nucleic acid (ENA) (e.g., a AON comprising one or more ENA modified sugar), or hexitol nucleic acids (HNA) (e.g., a AON comprising one or more HNA modified sugar). In some embodiments, a AON comprises one or more internucleoside linkage independently selected from a phosphorothioate linkage, phosphodiester linkage, phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, phosphorodiamidate morpholino (PMO) (morpholino) linkage, PNA linkage, or any combination of phosphorothioate linkage, phosphodiester linkage, a phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage, a phosphoramidothioate linkage, thiophosphorodiamidate linkage, phosphorodiamidate morpholino (PMO) (morpholino) linkage, and PNA linkage. In some embodiments, a KCNQ2 AON comprises one or more phosphorothioate linkage, phosphodiester linkage, or a combination of phosphorothioate and phosphodiester linkages. [00169] Peptide nucleic acids (PNAs) are short, artificially synthesized polymers with a structure that mimics DNA or RNA. PNAs include a backbone composed of repeating N-(2-aminoethyl)- glycine units linked by peptide bonds. In certain embodiments, PNAs described herein can be used as antisense therapeutics that bind to RNA sequences with high specificity and increase, restore, and/or stabilize levels (e.g., full length KCNQ2 mRNA or protein levels) and/or activity (e.g., biological activity, for example, KCNQ2 activity). [00170] Locked nucleic acids (LNAs) are oligonucleotide sequences that include one or more modified RNA nucleotides in which the ribose moiety is modified with an extra bridge connecting the 2’ oxygen and 4’ carbon. LNAs are believed to have higher Tm’s than analogous oligonucleotide sequences. In certain embodiments, LNAs described herein can be used as antisense therapeutics that bind to RNA sequences with high specificity. For example, LNAs can bind to KCNQ2 pre-RNA and reduce mis-splicing of KCNQ2 pre-mRNA, and increase, restore, and/or stabilize KCNQ2 levels (e.g., KCNQ2 mRNA or protein levels) and/or activity (e.g., biological activity, for example, KCNQ2 activity). [00171] Morpholino oligomers are oligonucleotide compounds that include bases attached to a backbone of methylenemorpholine rings linked through phosphorodiamidate groups. In certain embodiments, morpholino oligomers of the present invention can be designed to bind to specific pre-RNA sequence of interest. For example, morpholino oligomers bind to KCNQ2 pre-RNA thereby reducing mis-splicing of pre-mRNA, and increase, restore, and/or stabilize KCNQ2 levels (e.g., KCNQ2 mRNA or protein levels) and/or activity (e.g., biological activity, for example, KCNQ2 activity). In certain embodiments, KCNQ2 morpholino oligomers described herein can be used as antisense therapeutics that bind to KCNQ2 pre-mRNA sequences with high specificity and reduce mis-spliced KCNQ2 pre-mRNA, and increase, restore, and/or stabilize KCNQ2 levels (e.g., KCNQ2 mRNA or protein levels) and/or activity (e.g., biological activity, for example, KCNQ2 activity). In certain embodiments, KCNQ2 morpholino oligomers described herein can also be used to bind KCNQ2 pre-mRNA sequences, altering KCNQ2 pre-mRNA splicing and KCNQ2 gene expression, and increase, restore, and/or stabilize KCNQ2 levels (e.g., KCNQ2 mRNA or protein levels) and/or activity (e.g., biological activity, for example, KCNQ2 activity). KCNQ2 Oligonucleotides Complementary to KCNQ2 Transcript [00172] In some embodiments, a KCNQ2 AON includes a sequence that is at least 85% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a KCNQ2 transcript (e.g., any one of SEQ ID NOs: 1357-1370 ). In some embodiments, a KCNQ2 AON includes a sequence that is between 90-95% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a KCNQ2 transcript.( e. g., any one of SEQ ID NOs: 1357-1370 ). In particular embodiments, a KCNQ2 AON includes a sequence that is between 85% and 90% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a KCNQ2 transcript (e.g., any one of SEQ ID NOs: 1357-1370 ). In particular embodiments, a KCNQ2 AON includes a sequence that is between 84% to 88% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a KCNQ2 transcript (e.g., any one of SEQ ID NOs: 1357-1370 ). In particular embodiments, a KCNQ2 AON includes a sequence that is between 89% to 92% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a KCNQ2 transcript (e.g., any one of SEQ ID NOs: 1357-1370 ). In particular embodiments, a KCNQ2 AON includes a sequence that is between 94% to 96% complementary to a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to a region of a KCNQ2 transcript e.g., SEQ ID NOs: 1357-1370 ). [00173] In various embodiments, a KCNQ2 AON comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NO: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. In various embodiments, a KCNQ2 AON comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NO: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5. [00174] In some embodiments, the KCNQ2 AON comprises a spacer and has a segment having at most 7 linked nucleosides. In some embodiments, the KCNQ2 AON comprises a spacer and has a segment having at most 6, 5, 4, 3, or 2 linked nucleosides. [00175] KCNQ2 AON binding specificity can be assessed via measurement of parameters such as dissociation constant, melting temperature or other criteria such as changes in protein or RNA expression levels or other assays that measure KCNQ2 activity or expression. [00176] In some embodiments, a KCNQ2 AON can include a non-duplexed oligonucleotide. In some embodiments, a KCNQ2 AON can include a duplex of two oligonucleotides where the first oligonucleotide includes a nucleobase sequence that is completely or almost completely complementary to a KCNQ2 pre-mRNA sequence and the second oligonucleotide includes a nucleobase sequence that is complementary to the nucleobase sequence of the first oligonucleotide. [00177] In some embodiments, a KCNQ2 AON can target KCNQ2 mRNAs of one or more isoforms. In some embodiments, the KCNQ2 AON includes a nucleobase sequence that is complementary to a nucleobase sequence of a KCNQ2 gene or a KCNQ2 mRNA. [00178] KCNQ2 AONs described herein include antisense oligonucleotides comprising the oligonucleotide sequences listed in Table 1 below: Table 1A. Example KCNQ2 AON Sequences complementary to a sequence in the Intron 4 region of a KCNQ2 transcript.
Figure imgf000044_0001
Figure imgf000045_0001
Figure imgf000046_0001
Figure imgf000047_0001
Figure imgf000048_0001
Figure imgf000049_0001
Figure imgf000050_0001
* At least one (i.e., one or more) nucleoside linkage of the oligonucleotide sequence is independently selected from a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. Table 1B. Example KCNQ2 AON Sequences complementary to a sequence in the Exon 5 region of a KCNQ2 transcript. SEQ AON Sequence* SEQ Target Sequence
Figure imgf000050_0002
Figure imgf000051_0001
Figure imgf000052_0001
Figure imgf000053_0001
Figure imgf000054_0001
Figure imgf000055_0001
Figure imgf000056_0001
Figure imgf000057_0001
Figure imgf000058_0001
Figure imgf000059_0001
Figure imgf000060_0001
* At least one (i.e., one or more) nucleoside linkage of the oligonucleotide sequence is independently selected from a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. KCNQ2 Transcript [00179] In various embodiments, a KCNQ2 transcript comprises the sequence provided as SEQ ID NO: 1357.
Figure imgf000060_0002
Figure imgf000061_0001
Figure imgf000062_0001
Figure imgf000063_0001
T C T s
Figure imgf000064_0001
SEQ ID NO: 1358.
Figure imgf000064_0002
Figure imgf000065_0001
T CCC AGCC C
Figure imgf000066_0001
Figure imgf000067_0001
_ [00181] In various embodiments, a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1359.
Figure imgf000067_0002
Figure imgf000068_0001
Figure imgf000069_0001
G T T G A
Figure imgf000070_0001
[00182] In various embodiments, a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1360.
Figure imgf000070_0002
Figure imgf000071_0001
Figure imgf000072_0001
Figure imgf000073_0001
Figure imgf000074_0001
[00183] In various embodiments, a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1361.
Figure imgf000074_0002
Figure imgf000075_0001
Figure imgf000076_0001
G T T T C C C G A G G T A T C T C
Figure imgf000077_0001
[00184] In various embodiments, KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1362.
Figure imgf000077_0002
Figure imgf000078_0001
[00185] In various embodiments, a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1363. T C T G T G A
Figure imgf000078_0002
Figure imgf000079_0001
G AA G G GCCA A
Figure imgf000080_0001
Figure imgf000081_0001
[00186] In various embodiments, a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1364.
Figure imgf000081_0002
Figure imgf000082_0001
Figure imgf000083_0001
T G
Figure imgf000084_0001
[00187] In various embodiments, a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1365.
Figure imgf000085_0001
Figure imgf000086_0001
Figure imgf000087_0001
Figure imgf000088_0001
[00188] In various embodiments, a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1366. T C T C G T G C C C
Figure imgf000088_0002
Figure imgf000089_0001
Figure imgf000090_0001
Figure imgf000091_0001
[00189] In various embodiments, a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1367.
Figure imgf000091_0002
Figure imgf000092_0001
AGC T G C G T A T
Figure imgf000093_0001
Figure imgf000094_0001
(SEQ ID NO: 1367) (Source: NCBI Reference Sequence: XM_017027843.2) [00190] In various embodiments, a KCNQ2 mRNA transcript comprises the sequence provided as SEQ ID NO: 1368.
Figure imgf000095_0001
Figure imgf000096_0001
Figure imgf000097_0001
Figure imgf000098_0001
[00191] In various embodiments, a KCNQ2 transcript is a KCNQ2 pre-mRNA transcript. In various embodiments, a KCNQ2 pre-mRNA transcript comprises a sequence provided as SEQ ID NO: 1369.
Figure imgf000098_0002
Figure imgf000099_0001
Figure imgf000100_0001
Figure imgf000101_0001
Figure imgf000102_0001
Figure imgf000103_0001
Figure imgf000104_0001
Figure imgf000105_0001
Figure imgf000106_0001
Figure imgf000107_0001
Figure imgf000108_0001
Figure imgf000109_0001
Figure imgf000110_0001
Figure imgf000111_0001
GGGCC C GG A C C CT GTG T
Figure imgf000112_0001
Figure imgf000113_0001
Figure imgf000114_0001
Figure imgf000115_0001
Figure imgf000116_0001
Figure imgf000117_0001
CT GGCC G TCTA CAAGG AT C A C
Figure imgf000118_0001
Figure imgf000119_0001
[00192] In various embodiments, a KCNQ2 pre-mRNA transcript comprises a sequence provided as SEQ ID NO: 1370. NCBI Reference Sequence NC_000020.11 Reference GRCh38.p13 Primary Assembly is SEQ ID NO: 1370. [00193] In various embodiments, the KCNQ2 transcript shares between 90-100% identity with any one of SEQ ID NO: 1357-1368 or shares between 90-100% identity to a KCNQ2 pre-mRNA transcript comprising SEQ ID NO: 1369 or SEQ ID NO: 1370. In various embodiments, the KCNQ2 transcript shares at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NO: 1357-1368 or shares at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with a KCNQ2 pre-mRNA transcript transcribed from SEQ ID NO: 1369 or SEQ ID NO: 1370. KCNQ2 Oligonucleotides Targeting Regions of the KCNQ2 Transcript [00194] In various embodiments, KCNQ2 AON disclosed herein are complementary to specific regions of KCNQ2 transcripts (for example, a KCNQ2 transcript) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370 In some embodiments, a KCNQ2 AON comprises a sequence that is complementary to a specific region of the KCNQ2 transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370. In some embodiments, a KCNQ2 AON comprises a sequence that is at least 85%complementary to a specific region of the KCNQ2 transcript. In some embodiments, a KCNQ2 AON comprises a sequence that is at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% complementary to a specific region of the KCNQ2 transcript. In some embodiments, a KCNQ2 AON comprises a sequence that is 90 to 99% complementary to a specific region of the KCNQ2 transcript. In some embodiments, a KCNQ2 AON comprises a sequence that is 90 to 95% complementary to a specific region of the KCNQ2 transcript. In some embodiments, a KCNQ2 AON comprises a sequence that is 95 to 99% complementary to a specific region of the KCNQ2 transcript. In various embodiments, the KCQN2 transcript is a pre- mRNA transcript and the specific region is intron 4 of the KCNQ2 pre-mRNA transcript. In various embodiments, the KCQN2 transcript is a pre-mRNA transcript and the specific region is intron 5 of the KCNQ2 pre-mRNA transcript. In various embodiments, the specific region is exon 5 of the KCNQ2 pre-mRNA transcript. [00195] In some embodiments, the KCNQ2 AON (e.g., KCNQ2 AON) has a segment that has, at most, 7 linked nucleosides. In some embodiments, the KCNQ2 AON has a segment that has, at most, 6, 5, 4, 3, or 2 linked nucleosides. The segments of the KCNQ2 AON may be separated from other segments of the KCNQ2 AON through a spacer. The segment of the KCNQ2 AON is complementary to a specific region of the KCNQ2 transcript (for example, a KCNQ2 transcript) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370. KCNQ2 Oligonucleotide Variants [00196] In various embodiments, KCNQ2 AONs include different variants, hereafter referred to as KCNQ2 AON variants. A KCNQ2 AON variant may be an oligonucleotide sequence of 5 to 100 nucleobases in length, for example, 10 to 40 nucleobases in length, for example, 14 to 40 nucleobases in length, 10 to 30 nucleobases in length, for example, 14 to 30 nucleobases in length, for example, 16 to 28 nucleobases in length, for example, 19 to 23 nucleobases in length, for example, 21 to 23 nucleobases in length, for example, or 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length. A KCNQ2 AON variant may be an oligonucleotide sequence complementary to a portion of a KCNQ2 pre-mRNA sequence or a KCNQ2 gene sequence. Example KCNQ2 AON variants include a nucleobase sequence selected from any one of the sequences in Tables 3A, 3B, 4 and 5, SEQ ID NOs: 2794-2801, SEQ ID NOs: 2802-2830 and SEQ ID NO: 2831-2855. [00197] In various embodiments, a KCNQ2 AON variant represents a modified version of a corresponding KCNQ2 parent oligonucleotide that includes a nucleobase sequence selected from any one of SEQ ID NOs: 1-176 and SEQ ID NOs: 353-854. In some embodiments, a KCNQ2 AON variant includes a nucleobase sequence that represents a shortened version of a nucleobase sequence of a KCNQ2 AON selected from any one of SEQ ID NOs: 1-176 and SEQ ID NOs: 353-854. As one example, if a KCNQ2 parent oligonucleotide includes a 25mer (e.g., 25 nucleotide bases in length) a variant (e.g., a KCNQ2 variant) may include a shorter version (e.g., 15mer, 17mer, 19mer, 21mer, or 23mer) of the 25mer KCNQ2 parent oligonucleotide. In one embodiment, a nucleobase sequence of a KCNQ2 AON variant differs from a corresponding nucleobase sequence of a KCNQ2 parent oligonucleotide in that 1, 2, 3, 4, 5, or 6 nucleotide bases are removed from one or both of the 3’ and 5’ ends of the nucleobase sequence of the KCNQ2 parent oligonucleotide. In one embodiment, the corresponding KCNQ2 AON variant may include a 23mer where two nucleotide bases were removed from one of the 3’ or 5’ end of a 25mer included in the KCNQ2 parent oligonucleotide. In one embodiment, the corresponding KCNQ2 AON variant may include a 23mer where one nucleotide base is removed from each of the 3’ and 5’ ends of the 25mer included in the KCNQ2 parent oligonucleotide. In one embodiment, the corresponding KCNQ2 AON variant may include a 21mer where two nucleotide bases are removed from each of the 3’ and 5’ ends of the 25mer included in the KCNQ2 parent oligonucleotide. In one embodiment, the corresponding KCNQ2 AON variant may include a 21mer where four nucleotide bases are removed from either the 3’ or 5’ end of the 25mer included in the KCNQ2 parent oligonucleotide. In one embodiment, the corresponding KCNQ2 AON variant may include a 19mer where three nucleotide bases are removed from each of the 3’ and 5’ ends of the 25mer included in the KCNQ2 parent oligonucleotide. In one embodiment, the corresponding KCNQ2 AON variant may include a 19mer where six nucleotide bases are removed from either the 3’ or 5’ end of the 25mer included in the KCNQ2 parent oligonucleotide. [00198] Example sequences of KCNQ2 AON variants are shown below in Tables 2A and 2B. Table 2A. KCNQ2 Oligonucleotide Variant Sequences complementary to a sequence of a KCNQ2 transcript.
Figure imgf000122_0001
Figure imgf000123_0001
Figure imgf000124_0001
Figure imgf000125_0001
Figure imgf000126_0001
At least one nucleoside linkage of the nucleobase sequence is selected from a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. Table 2B: Additional KCNQ2 Oligonucleotide Variant Sequences complementary to a sequence of a KCNQ2 transcript
Figure imgf000127_0001
Figure imgf000128_0001
Figure imgf000129_0001
Figure imgf000130_0001
Figure imgf000131_0001
Figure imgf000132_0001
Figure imgf000133_0001
Figure imgf000134_0001
Figure imgf000135_0001
Figure imgf000136_0001
* At least one nucleoside linkage of the nucleobase sequence is selected from a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. Antisense Oligonucleotides with One or more Locked Nucleic Acids (LNAs) [00199] In various embodiments, antisense oligonucleotides disclosed herein (e.g., KCQN2 parent oligonucleotides and/or KCQN2 oligonucleotide variants) comprise one or more locked nucleic acids (LNAs). In particular embodiments, an antisense oligonucleotide includes one LNA. In particular embodiments, an antisense oligonucleotide includes two LNAs. In particular embodiments, an antisense oligonucleotide includes three LNAs. Generally, a LNA refers to nucleic acid monomers having a bridge (e.g., methylene, ethylene, aminooxy, or oxyimino bridge) connecting two carbon atoms between the 4’ and 2’ position of the nucleoside sugar unit, thereby forming a bicyclic sugar. [00200] In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a LNA at a 4th position of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a LNA at a 7th position of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a LNA at a 9th position of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a LNA at a 12th position of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a LNA at a 15th position of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a LNA at a 17th position of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a LNA at a 20th position of the antisense oligonucleotide. [00201] In various embodiments, antisense oligonucleotides disclosed herein (e.g., KCQN2 parent oligonucleotides and/or KCQN2 oligonucleotide variants) comprise two LNAs located at two different positions of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a first LNA at a fourth position of the antisense oligonucleotide and a second LNA at a 20th position of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a first LNA at a 7th position of the antisense oligonucleotide and a second LNA at a 15th position of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a first LNA at a 7th position of the antisense oligonucleotide and a second LNA at a 17th position of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a first LNA at a 9th position of the antisense oligonucleotide and a second LNA at a 17th position of the antisense oligonucleotide. [00202] In various embodiments, antisense oligonucleotides disclosed herein (e.g., KCQN2 parent oligonucleotides and/or KCQN2 oligonucleotide variants) comprise three LNAs located at three different positions of the antisense oligonucleotide. In some embodiments, an antisense oligonucleotide disclosed herein includes, if counting from 5’ to 3’, a first LNA at a 4th position of the antisense oligonucleotide, a second LNA at a 12th position of the antisense oligonucleotide, and a third LNA at a 20th position of the antisense oligonucleotide. Antisense Oligonucleotides with One or more Spacers [00203] In various embodiments, antisense oligonucleotides comprise one or more spacers. In particular embodiments, an antisense oligonucleotide includes one spacer. In particular embodiments, an antisense oligonucleotide includes two spacers. In particular embodiments, an antisense oligonucleotide includes three spacers. Generally, a spacer refers to a nucleoside- replacement group lacking a nucleotide base and wherein the nucleoside sugar moiety is replaced by a non-sugar substitute group. The non-sugar substitute group is not capable of linking to a nucleobase, but is capable of linking with the 3’ and 5’ positions of nucleosides adjacent to the spacer through an internucleoside linking group. [00204] In certain embodiments, an oligonucleotide with one or more spacers, such as disclosed herein, may be an oligonucleotide with 5 to 100 oligonucleotide units in length, for example, 10 to 60 oligonucleotide units in length, for example, 12 to 50 oligonucleotide units in length, 14 to 40 oligonucleotide units in length, 10 to 30 oligonucleotide units in length, for example, 14 to 30 oligonucleotide units in length, for example, 14 to 25 or 15 to 22 oligonucleotide units in length, or 18, 19, 20, 21, 22, 23, 24, or 25 oligonucleotide units in length. As used herein, an “oligonucleotide unit” refers to either a nucleoside (e.g., a nucleoside which includes a sugar and/or a nucleobase) or a nucleoside-replacement group (e.g., a spacer) of the oligonucleotide. [00205] In particular embodiments, oligonucleotides with one or more spacers are 25 oligonucleotide units in length. In particular embodiments, the oligonucleotides with one or more spacers are 23 oligonucleotide units in length. In particular embodiments, the oligonucleotides with one or more spacers are 21 oligonucleotide units in length. In particular embodiments, the oligonucleotides with one or more spacers are 19 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 18 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 19 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 20 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 21 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 22 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 23 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 24 oligonucleotide units in length. In various embodiments, the oligonucleotides with one or more spacers are at least 25 oligonucleotide units in length. [00206] In various embodiments, a KCNQ2 AON comprises a sequence that shares at least 80% identity with an equal length portion of any one of the sequences in Tables 3A, 3B, 4 and 5, SEQ ID NOs: 2794-2801, SEQ ID NOs: 2802-2830 and SEQ ID NO: 2831-2855. In various embodiments, a KCNQ2 AON comprises a sequence that shares at least 85% identity with an equal length portion of any one of the sequences in Tables 3A, 3B, 4 and 5, SEQ ID NOs: 2794- 2801, SEQ ID NOs: 2802-2830 and SEQ ID NO: 2831-2855. In various embodiments, a KCNQ2 AON comprises a sequence that shares at least 90% identity with an equal length portion of any one of the sequences in Tables 3A, 3B, 4 and 5, SEQ ID NOs: 2794-2801, SEQ ID NOs: 2802- 2830 and SEQ ID NO: 2831-2855. In various embodiments, a KCNQ2 AON comprises a sequence that shares at least 95% identity with an equal length portion of any one of the sequences in Tables 3A, 3B, 4 and 5, SEQ ID NOs: 2794-2801, SEQ ID NOs: 2802-2830 and SEQ ID NO: 2831-2855. In various embodiments, a KCNQ2 AON comprises a sequence that shares 100% identity with an equal length portion of any one of SEQ ID NOs: 2794-2801, SEQ ID NOs: 2802-2830 and SEQ ID NO: 2831-2855. [00207] In some embodiments, the spacer is of Formula (X):
Figure imgf000139_0001
Formula (X) where n rng A is as defined herein. [00208] In some embodiments, the spacer is of Formula (Xa): Formula (Xa)
Figure imgf000140_0001
ng A is as defined herein and the -CH2-O- group is on a ring A atom adjacent to the -O- group. [00209] As generally defined herein, ring A of formulae (X) and (Xa), is an optionally substituted 4-8 member monocyclic cycloalkyl group (e.g. ring A is cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl) or a 4-8 member monocyclic heterocyclyl group, wherein the heterocyclyl group contains 1 or 2 heteroatoms selected from O, S and N (e.g. ring A is oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, azepanyl). In some embodiments, ring A is tetrahydrofuranyl. In some embodiments, ring A is tetrahydropyranyl. In some embodiments, ring A is pyrrolidinyl. In some embodiments, ring A is cyclopentyl. In some embodiments, the monocyclic cycloalkyl or monocyclic heterocyclyl is not further substituted. In some embodiments, the cycloalkyl or heterocyclyl is further substituted with 0, 1, 2 or 3 substituents selected from halo (e.g., -F, -Cl), - Ome, -Oet -O(CH2)Ome, -O(CH2)2Ome and CN. [00210] In some embodiments, tetrahydrofuranyl is substituted with 1 or 2 substituents selected from halo (e.g., -F, -Cl), -OMe, -OEt -O(CH2)OMe, -O(CH2)2OMe and CN. In some embodiments, tetrahydrofuranyl is substituted with 2 substituents selected from halo (e.g., -F, - Cl), -OMe, -OEt -O(CH2)OMe, -O(CH2)2OMe and CN. In some embodiments, tetrahydrofuranyl is substituted with 1 substituent selected from halo (e.g., -F, -Cl), -OMe, -OEt -O(CH2)OMe, - O(CH2)2OMe and CN. In some embodiments, tetrahydrofuranyl is substituted with - O(CH2)2OMe. [00211] In some embodiments, the spacer is represented by Formula (I), wherein: I)
Figure imgf000140_0002
s se ecte rom -CH2- and -O-; and n is 0, 1, 2 or 3. [00212] In some embodiments, the spacer is represented by Formula (I’), wherein: ’)
Figure imgf000141_0001
s se ecte rom -C 2-and -O-; and n is 0, 1, 2 or 3. [00213] In some embodiments, the spacer is represented by Formula (Ia), wherein: Formula (Ia)
Figure imgf000141_0002
and n is 0, 1, 2 or 3. [00214] In some embodiments, the spacer is represented by Formula (Ia’), wherein: Formula (Ia’)
Figure imgf000141_0003
and n is 0, 1, 2 or 3. [00215] As generally defined herein, X is selected from -CH2- and -O-. In some embodiments, X is -CH2-. In other embodiments, X is -O-. [00216] As generally defined herein, n is 0, 1, 2 or 3. In some embodiments, n is 0. In some embodiments, n is 1 or 2. In some embodiments, n is 1. In other embodiments, n is 2. In certain embodiments, n is 3. [00217] In some embodiments, the spacer is represented by Formula (II), wherein: Formula (II)
Figure imgf000141_0004
X is selected from -CH2- and -O-. [00218] In some embodiments, the spacer is represented by Formula (II’), wherein: Formula (II’)
Figure imgf000142_0001
X is selected from -CH2-and -O. [00219] In some embodiments, the spacer is represented by Formula (Iia), wherein: Formula (Iia).
Figure imgf000142_0002
[00220] In some embodiments, the spacer is represented by Formula (Iia’), wherein: Formula (Iia’).
Figure imgf000142_0003
[00221] In some embodiments, the spacer is represented by Formula (IIi), wherein: i)
Figure imgf000142_0004
s se ecte rom -C 2- and -O-. [00222] In some embodiments, the spacer is represented by Formula (IIi’), wherein: Formula (IIi’)
Figure imgf000142_0005
X is selected from -CH2-and -O. [00223] In some embodiments, the spacer is represented by Formula (IIib), wherein: Formula (IIib).
Figure imgf000143_0001
[00224] In some embodiments, the spacer is represented by Formula (IIib’), wherein: Formula (IIib’).
Figure imgf000143_0002
[00225] In some embodiments, the spacer is represented by Formula (III), wherein: Formula (III)
Figure imgf000143_0003
X is selected from -CH2- and -O-. [00226] In some embodiments, the spacer is represented by Formula (III’), wherein: Formula (III’)
Figure imgf000143_0004
X is selected from -CH2-and -O. [00227] In some embodiments, the spacer is represented by Formula (IIIa), wherein: Formula (IIIa).
Figure imgf000143_0005
[00228] In some embodiments, the spacer is represented by Formula (IIIa’), wherein: Formula (IIIa’).
Figure imgf000144_0001
[00229] In some embodiments, the open positions of Formulae (I), (I’), (Ia), (Ia’), (II), (II’), (Iia), (Iia’), (III), (III’), (IIIa) and (IIIa’) (i.e., the positions not specifically depicted as bearing exclusively hydrogen atoms, including the -CH2- group of X) are further substituted with 0-3 substituents independently selected from halo (e.g., -F, -Cl), -OMe, -OEt -O(CH2)OMe, - O(CH2)2OMe and CN. In some embodiments, Formulae (I), (I’), (Ia), (Ia’), (II), (II’), (Iia), (Iia’), (III), (III’), (IIIa) and (IIIa’) are not further substituted. [00230] As described further below, a KCNQ2 oligonucleotide with one or more spacers is described in reference to a corresponding KCNQ2 parent oligonucleotide or a KCNQ2 variant oligonucleotide. In various embodiments, a KCNQ2 oligonucleotide with a spacer differs from a KCNQ2 parent oligonucleotide or a KCNQ2 variant oligonucleotide in that the spacer replaces a nucleoside in the KCNQ2 parent oligonucleotide or a KCNQ2 variant oligonucleotide. As used hereafter, the “position” of the KCNQ2 oligonucleotide refers to a particular location as counted from the 5’ end of the KCNQ2 oligonucleotide. In various embodiments, the spacer replaces a nucleoside at any one of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 of the KCNQ2 parent oligonucleotide or a KCNQ2 variant oligonucleotide. In particular embodiments, a spacer replaces a nucleoside at one of positions 7, 8, 11, 14, 16, 19, or 22 of the KCNQ2 parent oligonucleotide or a KCNQ2 variant oligonucleotide. [00231] In various embodiments, a KCNQ2 oligonucleotide includes one spacer that replaces a nucleoside in the KCNQ2 oligonucleotide (e.g., one spacer replaces one nucleoside of the KCNQ2 oligonucleotide). In particular embodiments, the spacer replaces a nucleoside between positions 9 and 15 of the KCNQ2 oligonucleotide. In particular embodiments, the spacer replaces a nucleoside between positions 9 and 12 of the KCNQ2 oligonucleotide. In particular embodiments, the spacer replaces a nucleoside at position 10 of the KCNQ2 oligonucleotide. In particular embodiments, the spacer replaces a nucleoside at position 11 of the KCNQ2 oligonucleotide. In particular embodiments, the spacer replaces a nucleoside at position 12 of the KCNQ2 oligonucleotide. In particular embodiments, the spacer replaces a nucleoside between positions 12 and 16 of the KCNQ2 oligonucleotide. In particular embodiments, the spacer replaces a nucleoside at position 15 of the KCNQ2 oligonucleotide. [00232] In various embodiments, a KCNQ2 oligonucleotide including one spacer has 2 segments, where at least one of the 2 segments has at most 11 linked nucleosides. For example, the KCNQ2 oligonucleotide may be 23 oligonucleotide units in length, and the spacer can be located at position 12. Therefore, the KCNQ2 oligonucleotide has 2 segments divided by the spacer, where both of the 2 segments are 11 nucleobases in length. In various embodiments, a KCNQ2 oligonucleotide including one spacer has 2 segments, where at least one of the 2 segments has at most 10 linked nucleosides. For example, the KCNQ2 oligonucleotide may be 21 oligonucleotide units in length, and the spacer can be located at position 11. Therefore, the KCNQ2 oligonucleotide has 2 segments divided by the spacer, where both of the 2 segments are 10 nucleobases in length. As another example, the KCNQ2 oligonucleotide may be 25 oligonucleotide units in length, and the spacer can be located at position 15. Therefore, the KCNQ2 oligonucleotide has 2 segments divided by the spacer, where one of the 2 segments is 14 nucleobases in length and the second of the 2 segments is 10 nucleobases in length. [00233] In various embodiments, a KCNQ2 oligonucleotide includes two spacers that each replace a nucleoside in the KCNQ2 oligonucleotide (e.g., two spacers replace two separate nucleosides of the KCNQ2 oligonucleotide). In various embodiments, a first spacer and a second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, at least 7 nucleobases, at least 8 nucleobases, at least 9 nucleobases, or at least 10 nucleobases in the oligonucleotide. In particular embodiments, a first spacer and a second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases. In particular embodiments, the first spacer and the second spacer are not adjacent to one another in the oligonucleotide. [00234] In particular embodiments, the first spacer replaces a nucleoside between positions 7 and 11 of the KCNQ2 oligonucleotide. In various embodiments, the first spacer replaces a nucleoside between positions 8 and 11, positions 9 and 11, positions 10 and 11, positions 7 and 10, positions 7 and 9, positions 7 and 8, positions 8 and 10, positions 8 and 9, or positions 9 and 10 of the KCNQ2 oligonucleotide. In particular embodiments, the second spacer replaces a nucleoside between positions 14 and 22 of the KCNQ2 oligonucleotide. In various embodiments, the second spacer replaces a nucleoside between positions 15 and 22, positions 16 and 22, positions 17 and 22, position 18 and 22, position 19 and 22, positions 20 and 22, positions 21 and 22, positions 15 and 21, position 16 and 21, positions 17 and 21, positions 18 and 21, positions 19 and 21, positions 20 and 21, positions 15 and 20, positions 16 and 20, positions 17 and 20, positions 18 and 20, positions 19 and 20, positions 15 and 19, positions 16 and 19, positions 17 and 19, positions 18 and 19, positions 15 and 18, position 16 and 18, position 17 and 18, positions 15 and 17, positions 16 and 17, or positions 15 and 16 of the KCNQ2 oligonucleotide. [00235] In preferred embodiments, the first spacer replaces a nucleoside at position 7 of the KCNQ2 oligonucleotide and the second spacer replaces a nucleoside at position 14 of the KCNQ2 oligonucleotide. In preferred embodiments, the first spacer replaces a nucleoside at position 7 of the KCNQ2 oligonucleotide and the second spacer replaces a nucleoside at position 19 of the KCNQ2 oligonucleotide. In preferred embodiments, the first spacer replaces a nucleoside at position 8 of the KCNQ2 oligonucleotide and the second spacer replaces a nucleoside at position 16 of the KCNQ2 oligonucleotide. In preferred embodiments, the first spacer replaces a nucleoside at position 8 of the KCNQ2 oligonucleotide and the second spacer replaces a nucleoside at position 15 of the KCNQ2 oligonucleotide. In preferred embodiments, the first spacer replaces a nucleoside at position 11 of the KCNQ2 oligonucleotide and the second spacer replaces a nucleoside at position 22 of the KCNQ2 oligonucleotide. In preferred embodiments, the first spacer replaces a nucleoside at position 9 of the KCNQ2 oligonucleotide and the second spacer replaces a nucleoside at position 19 of the KCNQ2 oligonucleotide. [00236] In various embodiments, a KCNQ2 oligonucleotide includes three spacers that each replace a nucleoside in the KCNQ2 oligonucleotide (e.g., three spacers replace three separate nucleosides of the KCNQ2 oligonucleotide). In particular embodiments, the first spacer replaces a nucleoside between positions 7 and 11 of the KCNQ2 oligonucleotide. In particular embodiments, the second spacer replaces a nucleoside between positions 14 and 22 of the KCNQ2 oligonucleotide. In particular embodiments, the third spacer replaces a nucleoside between positions 21 and 24 of the KCNQ2 oligonucleotide. In some embodiments, the first spacer replaces a nucleoside between positions 2 and 5 of the KCNQ2 oligonucleotide. In particular embodiments, the second spacer replaces a nucleoside between positions 8 and 12 of the KCNQ2 oligonucleotide. In particular embodiments, the third spacer replaces a nucleoside between positions 18 and 22 of the KCNQ2 oligonucleotide. [00237] In various embodiments, the three spacers in a KCNQ2 oligonucleotide are positioned such that each of the four segments of the KCNQ2 oligonucleotide are at most 7 linked nucleosides in length. For example, a KCNQ2 oligonucleotide may have a first segment with 7 linked nucleosides connected to a first spacer, then a second segment with 7 linked nucleosides connected on one end to the first spacer and connected on another end to a second spacer, then a third segment with 6 linked nucleosides connected on one end to the second spacer and connected on another end to a third spacer, then a fourth segment with 6 linked nucleosides connected to the third spacer. [00238] In various embodiments, the one or more spacers are positioned in the oligonucleotide to replace one or more adenosine or thymine nucleosides (as opposed to guanine or cytosine nucleosides). For example, the one or more spacers can replace one, two, three, four, five, six, seven, eight, or nine adenosine or thymine nucleosides in the oligonucleotide. In various embodiments, the one or more spacers are positioned in the oligonucleotide to replace one or more guanine or cytosine nucleosides (as opposed to adenosine or thymine nucleosides). For example, the one or more spacers can replace one, two, three, four, five, six, seven, eight, or nine guanine or cytosine nucleosides in the oligonucleotide. In various embodiments, the spacers are positioned in the oligonucleotide to replace an equal number of adenosine/thymine nucleosides and guanine/cytosine nucleosides. For example, a first spacer in the oligonucleotide may replace an adenosine/thymine nucleoside and a second spacer in the oligonucleotide may replace a guanine/cytosine nucleoside. [00239] In various embodiments, the one or more spacers are positioned in the oligonucleotide to control the sequence content in the oligonucleotide. For example, the one or more spacers are positioned such that at least one of the spacers is located adjacent to a guanine group. In various embodiments, an oligonucleotide with spacers can include one spacer adjacent to a guanine group, two spacers adjacent to guanine groups, three spacers adjacent to guanine groups, four spacers adjacent to guanine groups, or five spacers adjacent to guanine groups. In one embodiment, if counting from the 5’ end of the oligonucleotide, a spacer immediately precedes a guanine group in the sequence. Thus, in various embodiments, an oligonucleotide with spacers can include one spacer that immediately precedes a guanine group, two spacers that each immediately precede a guanine group, three spacers that each immediately precede a guanine group, four spacers that each immediately precede a guanine group, or five spacers that each immediately precede a guanine group. In one embodiment, if counting from the 5’ end of the oligonucleotide, a guanine group is immediately succeeded by a spacer. Thus, in various embodiments, an oligonucleotide with spacers can include one spacer that immediately succeeds a guanine group, two spacers that each immediately succeed a guanine group, three spacers that each immediately succeed a guanine group, four spacers that each immediately succeed a guanine group, or five spacers that each immediately succeed a guanine group. In various embodiments, the spacers in the oligonucleotide can be positioned to maximize the number of spacers adjacent to guanine groups. [00240] In various embodiments, the one or more spacers are positioned in the oligonucleotide to replace one or more adenosine or thymine nucleosides such that the one or more spacers are located adjacent guanine groups. For example, two spacers can replace adenosine or thymine nucleosides in the oligonucleotide, each of the two spacers being located adjacent to a guanine group. [00241] In various embodiments, the KCNQ2 oligonucleotide with one or more spacers has a particular GC content. As used herein, GC content (or guanine-cytosine content) is the percentage of nitrogenous bases in the oligonucleotide that are either guanine (G) or cytosine (C). In various embodiments, the KCNQ2 oligonucleotide with one or more spacers has at least 10% GC content, at least 20% GC content, at least 25% GC content, at least 30% GC content, at least 35% GC content, at least 40% GC content, at least 45% GC content, at least 50% GC content, at least 55% GC content, at least 60% GC content, at least 65% GC content, at least 75% GC content, at least 80% GC content, at least 85% GC content, at least 90% GC content, or at least 95% GC content. In particular embodiments, the KCNQ2 oligonucleotide with one or more spacers has at least 30% GC content. In particular embodiments, the KCNQ2 oligonucleotide with one or more spacers has at least 40% GC content. In various embodiments, the one or more spacers are positioned in the KCNQ2 oligonucleotide to maximize GC content. For example, instead of selecting a guanine or cytosine for replacement by a spacer in the KCNQ2 oligonucleotide, a thymine or adenine can be selected for replacement by a spacer. [00242] In various embodiments, a KCNQ2 oligonucleotide with spacers is designed such that 1) each segment of the KCNQ2 oligonucleotide has at most 7 linked nucleosides and 2) at least two, three, or four spacers are positioned adjacent to a guanine group. In some embodiments, a KCNQ2 oligonucleotide with spacers is designed such that 1) each segment of the KCNQ2 oligonucleotide has at most 7 linked nucleosides and 2) each of two spacers precede a guanine group. [00243] In various embodiments, the inclusion of one or more spacers in the KCNQ2 oligonucleotide does not decrease the effectiveness of the KCNQ2 oligonucleotide with the spacers in restoring full length KCNQ2 protein or full length KCNQ2 mRNA in comparison to the effect of a corresponding KCNQ2 parent oligonucleotide. In various embodiments, the inclusion of one or more spacers in the KCNQ2 oligonucleotide increases the effectiveness of the KCNQ2 oligonucleotide with the spacers in restoring full length KCNQ2 protein or full length KCNQ2 mRNA in comparison to the effect of a corresponding KCNQ2 parent oligonucleotide. In various embodiments, the inclusion of one or more spacers in the KCNQ2 oligonucleotide does not decrease the effectiveness of the KCNQ2 oligonucleotide with the spacers in reducing quantity of KCNQ2 transcripts in comparison to the effect of a corresponding KCNQ2 parent oligonucleotide. In various embodiments, the inclusion of one or more spacers in the KCNQ2 oligonucleotide increases the effectiveness of the KCNQ2 oligonucleotide with the spacers in reducing quantity of KCNQ2 transcripts in comparison to the effect of a corresponding KCNQ2 parent oligonucleotide.
[00244] Tables 3A, 3B, 4, and 5 document example KCNQ2 oligonucleotides with one or more spacers and their relation to corresponding KCNQ2 parent oligonucleotides. Each KCNQ2 oligonucleotide is assigned a sequence name. As used hereafter, the nomenclature of the sequence name is expressed as “X_spA” (for a KCNQ2 AON with one spacer), “X_spA_spB” (for a KCNQ2 AON with two spacers), or “X_spA_spB_spC” (for a KCNQ2 AON with three spacers). Here, “X” refers to the length of the KCNQ2 AON, “A” refers to the position in the KCNQ2 AON where the first spacer is located, “B” refers to the position in the KCNQ2 AON where the second spacer is located, and if present, “C” refers to the position in the KCNQ2 AON where the third spacer is located.
[00245] In various embodiments, KCNQ2 oligonucleotides include one spacer. In various embodiments, the KCNQ2 oligonucleotides are oligonucleotide variants, such as any one of a 23mer, 21mer, or 19mer. In various embodiments, the inclusion of a spacer divides up the KCNQ2 oligonucleotide into two separate segments, where at least one of the segments is at most 11 linked nucleosides in length. In various embodiments, the inclusion of a spacer divides up the KCNQ2 oligonucleotide into two separate segments, where at least one of the segments is at most 10 linked nucleosides in length.
[00246] In various embodiments, the spacer is located between positions 10 and 15 of the oligonucleotide. In various embodiments, the spacer is located between positions 10 and 12 of the oligonucleotide. In particular embodiments, the spacer is located at position 10 of the oligonucleotide. In particular embodiments, the spacer is located at position 11 of the oligonucleotide. In particular embodiments, the spacer is located at position 12 of the oligonucleotide. In particular embodiments, the spacer is located at position 15 of the oligonucleotide. Example KCNQ2 AONs with one spacer are documented below in Table 3A. Table 3 A: Identification of KCNQ2 AONs with one spacer. Here, each KCNQ2 AON has 2 segments, where at least one of the segments has at most 11 linked nucleosides.
Figure imgf000149_0001
te
Figure imgf000150_0001
linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. [00247] In various embodiments, KCNQ2 oligonucleotides include two spacers. In various embodiments, the inclusion of a spacer divides up the KCNQ2 oligonucleotide into three separate segments, where at least one of the segments is at most 7 linked nucleosides in length. Example KCNQ2 AONs with two spacers are documented below in Table 3B.
Table 3B: Identification of KCNQ2 AONs with two spacers. Here, each KCNQ2 AON has 3 segments, where at least one of the segments has at most 7 linked nucleosides.
Figure imgf000151_0001
Figure imgf000152_0001
Figure imgf000153_0001
Figure imgf000154_0001
ate
Figure imgf000155_0001
linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. [00248] In various embodiments, KCNQ2 oligonucleotides include three spacers. The inclusion of three spacers divides up the KCNQ2 oligonucleotide into four separate segments. In various embodiments, the three spacers are located at different positions of the KCNQ2 oligonucleotide such that each of the segments of the KCNQ2 oligonucleotide are at most 7 linked nucleosides in length. Example KCNQ2 AONs with three spacers are documented below in Table 4.
Table 4: Identification of KCNQ2 AONs or AON variants with three spacers. Here, each KCNQ2
AON has 4 segments, where each segment has at most 7 linked nucleosides.
Figure imgf000156_0001
othioate
Figure imgf000157_0001
linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3 -methoxy propyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a phosphorodiamidate (e.g, comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.
[00249] In various embodiments, KCNQ2 AONs with one or more spacers are reduced in length in comparison to the KCNQ2 AONs described above in Tables 3B and 4. For example, such KCNQ2 AONs may be KCNQ2 oligonucleotide variants with one or more spacers. In various embodiments, the KCNQ2 oligonucleotide variants with one or more spacers are 23mers, 21mers, or 19mers. In various embodiments, KCNQ2 oligonucleotide variants include two spacers such that the KCNQ2 oligonucleotide variant includes three segments that are divided up by the two spacers. In various embodiments, at least one of the three segments has at most 7 linked nucleosides. In various embodiments, each of the three segments has at most 7 linked nueclosides. Example KCNQ2 oligonucleotide variants with one or more spacers are shown below in Table 5.
Table 5: KCNQ2 AON variants with two spacers. Here, each KCNQ2 AON variant has 3 segments, where each segment has at most 7 linked nucleosides.
Figure imgf000158_0001
Figure imgf000159_0001
phorothioate
Figure imgf000160_0001
linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. [00250] In some embodiments, an antisense oligonucleotide disclosed herein (e.g., KCQN2parent oligonucleotides and/or KCQN2 oligonucleotide variants) comprise one or more spacers as well as one or more locked nucleic acids (LNAs). In some embodiments, an antisense oligonucleotide disclosed herein (e.g., KCQN2 parent oligonucleotides and/or KCQN2 oligonucleotide variants) comprises two spacers and two LNAs. In some embodiments, an antisense oligonucleotide disclosed herein (e.g., KCQN2 parent oligonucleotides and/or KCQN2 oligonucleotide variants) comprises two spacers and three LNAs. [00251] In various embodiments, a spacer and a LNA are located adjacent to one another in an antisense oligonucleotide. For example, if counting from 5’ to 3’, a LNA can be located at a 7th position of the antisense oligonucleotide and a spacer can be located at a 8th position of the antisense oligonucleotide. As another example, if counting from 5’ to 3’, a LNA can be located at a 9th position of the antisense oligonucleotide and a spacer can be located at a 8th position of the antisense oligonucleotide. As another example, if counting from 5’ to 3’, a LNA can be located at a 15th position of the antisense oligonucleotide and a spacer can be located at a 16th position of the antisense oligonucleotide. As another example, if counting from 5’ to 3’, a LNA can be located at a 17th position of the antisense oligonucleotide and a spacer can be located at a 16th position of the antisense oligonucleotide. [00252] In particular embodiments, a first spacer is located adjacent to a first LNA and a second spacer is located adjacent to a second LNA in an antisense oligonucleotide. For example, if counting from 5’ to 3’, a first LNA can be located at a 7th position of the antisense oligonucleotide, a first spacer can be located at a 8th position of the antisense oligonucleotide, a second LNA can be located at a 15th position of the antisense oligonucleotide, and a second spacer can be located at a 16th position of the antisense oligonucleotide. As another example, if counting from 5’ to 3’, a first LNA can be located at a 7th position of the antisense oligonucleotide, a first spacer can be located at a 8th position of the antisense oligonucleotide, a second LNA can be located at a 17th position of the antisense oligonucleotide, and a second spacer can be located at a 16th position of the antisense oligonucleotide. As another example, if counting from 5’ to 3’, a first LNA can be located at a 9th position of the antisense oligonucleotide, a first spacer can be located at a 8th position of the antisense oligonucleotide, a second LNA can be located at a 17th position of the antisense oligonucleotide, and a second spacer can be located at a 16th position of the antisense oligonucleotide. [00253] In various embodiments, one or more spacers and one or more LNAs are not located adjacent to one another in an antisense oligonucleotide. For example, if counting from 5’ to 3’, a LNA can be located at a 4th position of the antisense oligonucleotide and a spacer can be located at a 8th position of the antisense oligonucleotide. As example, if counting from 5’ to 3’, a LNA can be located at a 20th position of the antisense oligonucleotide and a spacer can be located at a 16th position of the antisense oligonucleotide. In particular embodiments, if counting from 5’ to 3’, a first LNA can be located at a 4th position of the antisense oligonucleotide, a first spacer can be located at a 8th position of the antisense oligonucleotide, a second LNA can be located at a 20th position of the antisense oligonucleotide, and a second spacer can be located at a 16th position of the antisense oligonucleotide. In particular embodiments, if counting from 5’ to 3’, a first LNA can be located at a 4th position of the antisense oligonucleotide, a first spacer can be located at a 8th position of the antisense oligonucleotide, a second LNA can be located at a 12th position of the antisense oligonucleotide, a second spacer can be located at a 16th position of the antisense oligonucleotide, and a third LNA can be located at a 20th position of the antisense oligonucleotide. Performance of KCNQ2 Oligonucleotides [00254] Generally, KCNQ2 oligonucleotides and/or KCNQ2 parent oligonucleotides (e.g., KCNQ2 oligonucleotides with sequences of any of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5) target KCNQ2 transcripts (for example, a KCNQ2 mRNA comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NO: 1357-1370 in order to increase, restore, rescue, or stabilize levels of expression of KCNQ2 mRNA that is capable of translation to produce a functional KCNQ2 protein (e.g., full length KCNQ2). In various embodiments, KCNQ2 AONs can exhibit at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase of full length KCNQ2 mRNA. In various embodiments, KCNQ2 AONs can exhibit at least a 100%, 200%, 300%, or 400% increase of full length KCNQ2 mRNA. In various embodiments, KCNQ2 AONs can exhibit at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% reduction of mis-spliced KCNQ2 mRNA. In various embodiments, KCNQ2 AONs can exhibit at least a 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase of full length KCNQ2 protein. In various embodiments, KCNQ2 AONs can exhibit at least a 100%, 200%, 300%, or 400% increase of full length KCNQ2 protein. In some embodiments, the percent increase of the full length KCNQ2 protein is an increase in comparison to a reduced level of full length KCNQ2 protein achieved using a KCNQ2 antisense oligonucleotide. For example, a KCNQ2 antisense oligonucleotide can be used to deplete full length KCNQ2 protein followed by increase of the full length KCNQ2 protein using a KCNQ2 AON. [00255] In some embodiments, KCNQ2 AONs can exhibit at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full length KCNQ2 protein. In some embodiments, the percent rescue of full length KCNQ2 refers to the % of full length KCNQ2 following depletion using a TDP43 antisense oligonucleotide and a treatment using KCNQ2 AONs in comparison to a negative control (e.g., cells that did not undergo depletion or treatment or cells that were treated with a vehicle solution). Modifications [00256] A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that further include a phosphate group covalently linked to the sugar portion of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be linked to the 2’, 3’ or 5’ hydroxyl moiety of the sugar. Oligonucleotides are formed through the covalent linkage of adjacent nucleosides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the phosphate groups are commonly referred to as forming the internucleoside linkages of the oligonucleotide. [00257] Modifications to antisense compounds encompass substitutions or changes to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target, increased stability in the presence of nucleases, or increased activity. [00258] Chemically modified nucleosides may also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide for its target nucleic acid. Consequently, comparable results can often be obtained with shorter antisense compounds that have such chemically modified nucleosides. Modified Internucleoside Linkages [00259] The naturally occurring internucleoside linkage of RNA and DNA is a 3’ to 5’ phosphodiester linkage. Antisense compounds having one or more modified, i.e. non-naturally occurring, internucleoside linkages are often selected over antisense compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases. [00260] Oligonucleotides having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous- containing linkages are well known. [00261] In certain embodiments, antisense compounds targeted to a KCNQ2 nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are interspersed throughout the antisense compound. In certain embodiments, the modified internucleoside linkages are phosphorothioate linkages. In certain embodiments, each internucleoside linkage of an antisense compound is a phosphorothioate internucleoside linkage. In certain embodiments, the antisense compounds targeted to a KCNQ2 nucleic acid comprise at least one phosphodiester linkage and at least one phosphorothioate linkage. Modified Sugar Moieties [00262] Antisense compounds can optionally contain one or more nucleosides wherein the sugar group has been modified. Such sugar modified nucleosides may impart enhanced nuclease stability, increased binding affinity, or some other beneficial biological property to the antisense compounds. In certain embodiments, nucleosides comprise chemically modified ribofuranose ring moieties. Examples of chemically modified ribofuranose rings include without limitation, addition of substituent groups (including 5’ and 2’ substituent groups, bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA), replacement of the ribosyl ring oxygen atom with S, N(R) or C(R1)(R2) (R, R1 and R2 are each independently H, C1-C12 alkyl or a protecting group) and combinations thereof. Examples of chemically modified sugars include 2’-F-5’-methyl substituted nucleoside (see PCT International Application WO 2008/101157 Published on Aug.21, 2008 for other disclosed 5’,2’-bis substituted nucleosides) or replacement of the ribosyl ring oxygen atom with S with further substitution at the 2’-position (see published U.S. Patent Application US2005- 0130923, published on Jun.16, 2005) or alternatively 5’-substitution of a BNA (see PCT International Application WO 2007/134181 Published on Nov.22, 2007 wherein LNA is substituted with for example a 5’-methyl or a 5’-vinyl group). [00263] Examples of nucleosides having modified sugar moieties include without limitation nucleosides comprising 5’-vinyl, 5’-methyl (R or 5), 4’-S, 2’-F, 2’-OCH3, 2’-OCH2CH3, 2’-O CH2 CH2F and 2’-O(CH2)2OCH3 substituent groups. The substituent at the 2’ position can also be selected from allyl, amino, azido, thio, O-allyl, O—C1-C10 alkyl, OCF3, OCH2F, O(CH2)2S CH3, O(CH2)2—O—N(Rm)(Rn), O—CH2—C(=O)—N(Rm)(Rn), and O—CH2—C(=O)—N(R1)—( CH2)2—N(Rm)(Rn)- , where each Rl, Rm and Rn is, independently, H or substituted or unsubstituted C1-C10 alkyl. [00264] Additional examples of modified sugar moieties include a 2’-Ome modified sugar moiety, bicyclic sugar moiety, 2’-O-(2-methoxyethyl) (2’-MOE), 2’-deoxy-2’-fluoro nucleoside, 2’-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), constrained ethyl 2’-4’-bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA). [00265] As used herein, “bicyclic nucleosides” refer to modified nucleosides comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include without limitation nucleosides comprising a bridge between the 4’ and the 2’ ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4’ to 2’ bridge. Examples of such 4’ to 2’ bridged bicyclic nucleosides, include but are not limited to one of the formulae: 4’-(CH2)—O-2’ (LNA); 4’-(CH2)—S-2’; 4’-(CH2)2—O-2’ (ENA); 4’- CH(CH3)—O-2’ and 4’-CH(CH2OCH3)—O-2’ (and analogs thereof see U.S. Pat. No.7,399,845, issued on Jul.15, 2008); 4’-C(CH3)(CH3)—O-2’ (and analogs thereof see published International Application WO/2009/006478, published Jan.8, 2009); 4’-CH2—N(OCH3)-2’ (and analogs thereof see published International Application WO/2008/150729, published Dec.11, 2008); 4’- CH2—O—N(CH3)-2’ (see published U.S. Patent Application US2004-0171570, published Sep.2, 2004); 4’- CH2—N(R)—O-2’, wherein R is H, C1-C12 alkyl, or a protecting group (see U.S. Pat. No.7,427,672, issued on Sep.23, 2008); 4’-CH2—C(H)(CH3)-2’ (see Chattopadhyaya et al., J. Org. Chem., 2009, 74, 118-134); and 4’-CH2—C—(=CH2)-2’ (and analogs thereof see published International Application WO 2008/154401, published on Dec.8, 2008). [00266] Further reports related to bicyclic nucleosides can also be found in published literature (see for example: Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl. Acad. Sci. U.S.A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 2007, 129(26) 8362-8379; Elayadi et al., Curr. Opinion Invest. Drugs, 2001, 2, 558-561; Braasch et al., Chem. Biol., 2001, 8, 1-7; and Orum et al., Curr. Opinion Mol. Ther., 2001, 3, 239-243; U.S. Pat. Nos.6,268,490; 6,525,191; 6,670,461; 6,770,748; 6,794,499; 7,034,133; 7,053,207; 7,399,845; 7,547,684; and 7,696,345; U.S. Patent Publication No. US2008-0039618; US2009-0012281; U.S. Patent Ser. No. 60/989,574; 61/026,995; 61/026,998; 61/056,564; 61/086,231; 61/097,787; and 61/099,844; Published PCT International applications WO 1994/014226; WO 2004/106356; WO 2005/021570; WO 2007/134181; WO 2008/150729; WO 2008/154401; and WO 2009/006478. Each of the foregoing bicyclic nucleosides can be prepared having one or more stereochemical sugar configurations including for example α-L-ribofuranose and β-D-ribofuranose (see PCT international application PCT/DK98/00393, published on Mar.25, 1999 as WO 99/14226). [00267] In certain embodiments, bicyclic sugar moieties of BNA nucleosides include, but are not limited to, compounds having at least one bridge between the 4’ and the 2’ position of the pentofuranosyl sugar moiety wherein such bridges independently comprises 1 or from 2 to 4 linked groups independently selected from —[C(Ra)(Rb)]n—, —C(Ra)=C(Rb)—, —C(Ra)=N—, —C(=O)—, —C(=NRa)—, —C(=S) —, —O—, —Si(Ra)2—, —S(=O)x—, and —N(Ra)—; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5- C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)—H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); and each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5- C20 aryl, acyl (C(=O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group. [00268] In certain embodiments, the bridge of a bicyclic sugar moiety is —[C(Ra)(Rb)]n—, —[— [C(Ra)(Rb)]n—O—, —C(RaRb)—N(R)—O— or —C(RaRb)—O—N(R)—. In certain embodiments, the bridge is 4’-CH2-2’, 4’-(CH2)2-2’, 4’-(CH2)3-2’, 4’-CH2—O-2’, 4’-(CH2)2—O- 2’, 4’-CH2—O—N(R)-2’ and 4’-CH2—N(R)—O-2’- wherein each R is, independently, H, a protecting group or C1-C12 alkyl, each Ra and Rb is, independently, H, a protecting group, hydroxyl, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2- C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C5-C7 alicyclic radical, substituted C5-C7 alicyclic radical, halogen, OJ1, NJ1J2, SJ1, N3, COOJ1, acyl (C(=O)—H), substituted acyl, CN, sulfonyl (S(=O)2-J1), or sulfoxyl (S(=O)-J1); each J1 and J2 is, independently, H, C1-C12 alkyl, substituted C1-C12 alkyl, C2-C12 alkenyl, substituted C2-C12 alkenyl, C2-C12 alkynyl, substituted C2-C12 alkynyl, C5-C20 aryl, substituted C5-C20 aryl, acyl (C(=O)—H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, C1-C12 aminoalkyl, substituted C1-C12 aminoalkyl or a protecting group; and R is H, C1-C12 alkyl, or a protecting group (see U.S. Pat. No.7,427,672, issued on Sep.23, 2008). [00269] In certain embodiments, bicyclic nucleosides are further defined by isomeric configuration. For example, a nucleoside comprising a 4’-2’ methylene-oxy bridge, may be in the α-L configuration or in the β-D configuration. Previously, α-L-methyleneoxy (4’-CH2—O-2’) BNA’s have been incorporated into antisense oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). [00270] In certain embodiments, bicyclic nucleosides include, but are not limited to, α-L- methyleneoxy (4’-CH2—O-2’) BNA, β-D-methyleneoxy (4’-CH2—O-2’) BNA, ethyleneoxy (4’- (CH2)2—O-2) BNA, aminooxy (4’-CH2—O—N(R)-2’) BNA, oxyamino (4’-CH2—N(R)—O-2’) BNA, methyl(methyleneoxy) (4’-CH(CH3)—O-2’) BNA, methylene-thio (4’-CH2—S-2’) BNA, methylene-amino (4’-CH2—N(R)-2’) BNA, methyl carbocyclic (4’-CH2—CH(CH3)-2’) BNA, and propylene carbocyclic (4’-(CH2)3-2’) BNA; wherein R is H, C1-C12 alkyl, or a protecting group (see U.S. Pat. No.7,427,672, issued on Sep.23, 2008). [00271] The present disclosure provide, in some embodiments, methods for treating, ameliorating, or preventing a neurological disease and/or a neuropathy further include methods of administering, to a patient, a pharmaceutically acceptable composition, for example, a pharmaceutically acceptable formulation that includes one or more KCNQ2 oligonucleotides. KCNQ2 oligonucleotides can increase, restore, or stabilize KCNQ2 activity, for example, KCNQ2 activity, and/or levels of KCNQ2 expression, for example, KCNQ2 mRNA and/or protein expression. [00272] The present disclosure also provides pharmaceutical compositions comprising a KCNQ2 oligonucleotide formulated together with one or more pharmaceutically or cosmetically acceptable excipients. These formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisternal, intracerebroventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) administration, transmucosal (e.g., buccal, vaginal, and rectal), or for topical use, e.g., as part of a composition suitable for applying topically to skin and/or mucous membrane, for example, a composition in the form of a gel, a paste, a wax, a cream, a spray, a liquid, a foam, a lotion, an ointment, a topical solution, a transdermal patch, a powder, a vapor, or a tincture. Although the most suitable form of administration in any given case will depend on the degree and severity of the condition being treated and on the nature of the particular KCNQ2 oligonucleotide being used. [00273] The present disclosure also provides a pharmaceutical composition comprising a KCNQ2 oligonucleotide or a pharmaceutically acceptable salt thereof (for example, a KCNQ2 AON that includes a sequence of any of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371- 1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 or the sequences in Tables 3A, 3B, 4 and 5). [00274] The present disclosure also provides methods that include the use of pharmaceutical compositions comprising a KCNQ2 AON is formulated together with one or more pharmaceutically acceptable excipients. Exemplary compositions provided herein include compositions comprising a KCNQ2 AON, and one or more pharmaceutically acceptable excipients. Formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisternal, intracerebroventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal, or intravenous) administration, transmucosal (e.g., buccal, vaginal, and rectal), or for topical use. The most suitable form of administration in any given case will depend on the clinical symptoms, complications, or biochemical indicia of the state, disorder, disease, or condition that one is trying to prevent in a subject; the state, disorder, disease, or condition one is trying to prevent in a subject; and/or on the nature of the particular compound and/or the composition being used. Additional Chemically Modified KCNQ2 Oligonucleotides [00275] KCNQ2 AONs described herein, can include chemically modified nucleosides, including modified ribonucleosides and modified deoxyribonucleosides. Chemically modified nucleosides include, but are not limited to, uracine, uridine, 2’-O-(2-methoxyethyl) modifications, for example, 2’-O-(2-methoxyethyl)guanosine, 2’-O-(2-methoxyethyl)adenosine, 2’-O-(2- methoxyethyl)cytosine, and 2’-O-(2-methoxyethyl)thymidine. In certain embodiments, mixed modalities, e.g., a combination of a KCNQ2 peptide nucleic acid (PNA) and a KCNQ2 locked nucleic acid (LNA). Chemically modified nucleosides also include, but are not limited to, locked nucleic acids (LNAs), 2’-O-methyl, 2’-fluoro, and 2’-fluoro-β-D-arabinonucleotide (FANA), and Fluoro Cyclohexenyl nucleic acid (F-CeNA) modifications. Chemically modified nucleosides that can be included in KCNQ2 AONs described herein are described in Johannes and Lucchino, (2018) “Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs” Nucleic Acid Ther.28(3): 178–93; Rettig and Behlke, (2012) “Progress toward in vivo use of siRNAs-II” Mol Ther 20:483–512; and Khvorova and Watts, (2017) “The chemical evolution of oligonucleotide therapies of clinical utility” Nat Biotechnol., 35(3):238-48, the contents of each of which are incorporated by reference herein. [00276] KCNQ2 AONs described herein can include chemical modifications that promote stabilization of an oligonucleotide’s terminal 5’-phosphate and phosphatase-resistant analogs of 5′-phosphate. Chemical modifications that promote oligonucleotide terminal 5’-phosphate stabilization or which are phosphatase-resistant analogs of 5′-phosphate include, but are not limited to, 5′-methyl phosphonate, 5′-methylenephosphonate, 5′-methylenephosphonate analogs, 5′-E-vinyl phosphonate (5′-E-VP), 5′-phosphorothioate, and 5′-C-methyl analogs. Chemical modifications that promote AON terminal 5’-phosphate stabilization and phosphatase-resistant analogues of 5′-phosphate are described in Khvorova and Watts, (2017) “The chemical evolution of oligonucleotide therapies of clinical utility” Nat Biotechnol., 35(3):238-48, the contents of which are incorporated by reference herein. [00277] In some embodiments described herein, KCNQ2 AONs described herein can include chemically modified nucleosides, for example, 2’ O-methyl ribonucleosides, for example, 2’ O- methyl cytidine, 2’ O-methyl guanosine, 2’ O-methyl uridine, and/or 2’ O-methyl adenosine. KCNQ2 AONs described herein can include one or more chemically modified bases, including a 5-methylpyrimidine, for example, 5-methylcytosine, and/or a 5-methylpurine, for example, 5- methylguanine. Chemically modified bases can further include pseudo-uridine or 5’methoxyuridine. KCNQ2 AONs described herein can include any of the following chemically modified nucleosides: 5-methyl-2’-O-methylcytidine, 5-methyl-2’-O-methylthymidine, 5- methylcytidine, 5-methyluridine, and/or 5-methyl 2’-deoxycytidine. [00278] KCNQ2 AONs described herein can include a phosphate backbone where one or more of the oligonucleoside linkages is a phosphate linkage. KCNQ2 AONs described herein may include a modified oligonucleotide backbone, where one or more of the nucleoside linkages of the sequence is selected from the group consisting of a phosphorothioate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3- methoxypropyl phosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate (e.g., comprising a phosphorodiamidate morpholino (PMO), 3’ amino ribose, or 5’ amino ribose) linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage. In some embodiments of KCNQ2 AONs described herein, at least one (i.e., one or more) internucleoside linkage of the oligonucleotide is a phosphorothioate linkage. For example, in some embodiments of KCNQ2 AONs described herein, one, two, three, or more internucleoside linkages of the oligonucleotide is a phosphorothioate linkage. In preferred embodiments of KCNQ2 AONs described herein, all internucleoside linkages of the oligonucleotide are phosphorothioate linkages. Thus, in some embodiments, all of the nucleotide linkages of a KCNQ2 AON of any of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 or the sequences in Tables 3A, 3B, 4 and 5 are phosphorothioate linkages. In some embodiments, one or more of the nucleotide linkages of a KCNQ2 AON of any of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 or the sequences in Tables 3A, 3B, 4 and 5 are phosphorothioate linkages. [00279] In various embodiments, nucleotide linkages of KCNQ2 AON described herein such as any of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 or the sequences in Tables 3A, 3B, 4 and 5 include a mix of phosphodiester and phosphorothioate linkages. [00280] In some embodiments, nucleoside linkages linking a base at position 3 of a KCNQ2 AON described herein are phosphodiester bonds. For example, the base at position 3 may be linked to each adjacent base (e.g., preceding base and succeeding base) through a phosphodi ester bond. An example 25mer KCNQ2 AON with phosphodiester bonds linking the base at position 3 can be denoted as:
XXoD oXXXXXXXXXXXXXXXXXXXXXX where “o” represents a phosphodiester bond and “D” represents the base at position 3. Any nucleobase in the AON can be a nucleobase analog.
[00281] In some embodiments, one of the nucleoside linkages linking a base at position 3 of a KCNQ2 AON described herein is a phosphodiester bond. For example, the base at position 3 may be linked to either the preceding base or the succeeding base through a phosphodiester bond. An example 25mer KCNQ2 AON with a phosphodiester bond linking the base at position 3 to a preceding base can be denoted as:
XXoDXXXXXXXXXXXXXXXXXXXXXX where “o” represents a phosphodiester bond and “D” represents the base at position 3. Any nucleobase in the AON can be a nucleobase analog.
[00282] An example 25mer KCNQ2 AON with a phosphodiester bond linking the base at position 3 to a succeeding base can be denoted as:
XXD oXXXXXXXXXXXXXXXXXXXXXX where “o” represents a phosphodiester bond and “D” represents the base at position 3. Any nucleobase in the AON can be a nucleobase analog.
[00283] In various embodiments, in addition to one of the nucleoside linkages linking a base at position 3 of a KCNQ2 AON described herein being a phosphodiester bond, the KCNQ2 AON further includes two spacers. The two spacers can be positioned in the KCNQ2 AON such that the KCNQ2 AON includes a segment with at most 7 linked nucleosides. An example 25mer KCNQ2 AON with two spacers and with a phosphodiester bond linking the base at position 3 to a preceding base can be denoted as:
XxoD S1XXXXXXXXXS2XXXXXXXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond and “D” represents the base at position 3. Any nucleobase in the AON can be a nucleobase analog.
[00284] An example 25mer KCNQ2 AON with two spacers and with a phosphodiester bond linking the base at position 3 to a succeeding base can be denoted as: XXD oXXXXXXXS1XXXXXXXXXS2XXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond and “D” represents the base at position 3. Any nucleobase in the AON can be a nucleobase analog.
[00285] In some embodiments, nucleoside linkages linking a base at position 4 of a KCNQ2 AON described herein are phosphodiester bonds. For example, the base at position 4 may be linked to each adjacent base (e.g., preceding base and succeeding base) through a phosphodiester bond. An example 25mer KCNQ2 AON with phosphodiester bonds linking the base at position 4 can be denoted as:
XXXoD oXXXXXXXXXXXXXXXXXXXXX where “0” represents a phosphodiester bond and “D” represents the base at position 4. Any nucleobase in the AON can be a nucleobase analog.
[00286] In some embodiments, one of the nucleoside linkages linking a base at position 4 of a KCNQ2 AON described herein is a phosphodiester bond. For example, the base at position 4 may be linked to either the preceding base or the succeeding base through a phosphodiester bond. An example 25mer KCNQ2 AON with a phosphodiester bond linking the base at position 4 to a preceding base can be denoted as:
XXXoDXXXXXXXXXXXXXXXXXXXXX where “0” represents a phosphodiester bond and “D” represents the base at position 4. Any nucleobase in the AON can be a nucleobase analog.
[00287] An example 25mer KCNQ2 AON with a phosphodiester bond linking the base at position 4 to a succeeding base can be denoted as:
XXXD oXXXXXXXXXXXXXXXXXXXXX where “0” represents a phosphodiester bond and “D” represents the base at position 4. Any nucleobase in the AON can be a nucleobase analog.
[00288] In some embodiments, nucleoside linkages linking both bases at position 3 and position 4 of a KCNQ2 AON described herein are phosphodiester bonds. For example, the base at position 3 may be linked to each adjacent base (e.g., preceding base and succeeding base) through a phosphodiester bond, and the base at position 4 may be linked to each adjacent base (e.g., preceding base and succeeding base) through a phosphodiester bond. An example 25mer KCNQ2 AON with phosphodiester bonds linking the bases at positions 3 and 4 can be denoted as:
XX0D0E0XXXXXXXXXXXXXXXXXXXXX where “o” represents a phosphodiester bond, “D” represents the base at position 3, and “E” represents the base at position 4. In various embodiments, all other bases of the KCNQ2 AON are linked through phosphorothioate bonds. Any nucleobase in the AON can be a nucleobase analog. [00289] In various embodiments, KCNQ2 AON described herein include one or more spacers and phosphodiester bonds are located relative to the one or more spacers. In some embodiments, the Y number of bases immediately preceding a spacer are linked through phosphodiester bonds. In various embodiments, Y is one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve bases. In particular embodiments, Y is two bases. For example, if the spacer is located at position 15, the bases at positions 13 and 14 of the KCNQ2 AON are each linked to their respective adjacent bases through phosphodiester bonds. As described herein, the spacer can be located at various positions in the KCNQ2 AON and therefore, the 2 bases immediately preceding the spacer can vary within the KCNQ2 AON depending on where the spacer is situated.
[00290] In various embodiments, the KCNQ2 AON may include more than one spacer. In some embodiments, only one of the spacers has Y number of bases immediately preceding the spacer that are linked through phosphodiester bonds. In such embodiments, the other spacers are linked to respective preceding bases through phosphorothioate bonds. In various embodiments, two of the spacers have Y number of bases immediately preceding the spacers that are linked through phosphodiester bonds. In various embodiments, each of the spacers in the KCNQ2 AON have Y number of bases immediately preceding the spacers that are linked through phosphodiester bonds. In various embodiments, all other bases of the KCNQ2 AON are linked through phosphorothioate bonds.
[00291] In some embodiments, Y number of bases immediately preceding a spacer and Z number of bases immediately succeeding a spacer are linked through phosphodiester bonds. In various embodiments, Y is one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve bases. In various embodiments, Z is one, two, three, four, five, six, seven, eight, nine, ten, eleven, or twelve bases. Y and Z can be independent of each other. In particular embodiments, Y is one base and Z is one base. For example, if the spacer is located at position 15, the bases at positions 14 and 16 of the KCNQ2 AON are each linked to their respective adjacent bases through phosphodiester bonds. To provide an example, such a KCNQ2 AON (e.g., 25mer) can be denoted as:
XXXXXXXXXXXXXoD o SoEoXXXXXXXXX where “S” represents a spacer, “o” represents a phosphodiester bond, “D” represents a base immediately preceding the spacer, and “E” represents the base immediately succeeding the spacer. Any nucleobase in the AON can be a nucleobase analog.
[00292] As described herein, the spacer can be located at various positions in the KCNQ2 AON and therefore, the bases immediately preceding or immediately succeeding the spacer can vary within the KCNQ2 AON depending on where the spacer is situated.
[00293] In various embodiments, the KCNQ2 AON may include more than one spacer. In some embodiments, only one of the spacers has Y number of bases immediately preceding the spacer and Z number of bases immediately succeeding the spacer that are linked through phosphodiester bonds. In such embodiments, the other spacers of the KCNQ2 AON are linked to respective preceding and succeeding bases through phosphorothioate bonds. To provide an example, such a KCNQ2 AON (e.g., 25mer) can be denoted as:
XXXXODOS1OEOXXXXXXXXXXXS2XXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond, “D” represents a base immediately preceding the spacer, and “E” represents the base immediately succeeding the spacer. Any nucleobase in the AON can be a nucleobase analog.
[00294] As another example, such a KCNQ2 AON (e.g., 25mer) can be denoted as: XXXXXS1XXXXXXXXXXXODOS20D0XXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond, “D” represents a base immediately preceding the spacer, and “E” represents the base immediately succeeding the spacer. Any nucleobase in the AON can be a nucleobase analog.
[00295] In some embodiments, one of the spacers is linked to the immediately preceding base through a phosphodiester bond. For example, a KCNQ2 AON includes a first spacer that is linked to the immediately preceding base through a phosphodiester bond, which can be denoted as:
XXXXXXoS1XXXXXXXXXXXS2XXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.
[00296] As another example, a KCNQ2 AON includes a second spacer that is linked to the immediately preceding base through a phosphodiester bond, which can be denoted as:
XXXXXXS1XXXXXXXXXXXoS2XXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.
[00297] In various embodiments, the KCNQ2 AON may be a AON variant (e.g., a 23mer, a 21mer, or a 19mer) where one of the spacers is linked to the immediately preceding base through a phosphodiester bond. For example, the KCNQ2 AON may be a 21mer with a first spacer that is linked to the immediately preceding base through a phosphodiester bond, which can be denoted as:
XXXXXXXoS1XXXXXS2XXXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.
[00298] As another example, the KCNQ2 AON may be a 21mer with a second spacer that is linked to the immediately preceding base through a phosphodiester bond, which can be denoted as:
XXXXXXXS1XXXXXoS2 XXXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.
[00299] In some embodiments, the KCNQ2 AON may be a AON variant (e.g., a 23mer, a 21mer, or a 19mer) where one of the spacers is linked to the immediately preceding base through a phosphodiester bond and the immediately preceding base is further linked to the preceding base through a phosphodiester bond. An example 21mer KCNQ2 AON can be denoted as:
XXXEODOS1XXXXXXS2XXXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond, “D” represents the base immediately preceding Si and "E” represents the base immediately preceding "D.” Any nucleobase in the AON can be a nucleobase analog.
[00300] As another example, a 21mer KCNQ2 AON can be denoted as:
XXXXXS1XXXXEODOS2XXXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond, “D” represents the base immediately preceding S2 and "E” represents the base immediately preceding “D.” Any nucleobase in the AON can be a nucleobase analog.
[00301] In some embodiments, the KCNQ2 AON may be a AON variant (e.g., a 23mer, a 21mer, or a 19mer) where a base that immediately precedes a first spacer is linked to another base through a phosphodiester bond. The base that immediately precedes the first spacer may be linked to the first spacer through a non-phosphodiester bond, such as a phosphorothioate bond. Additionally a second spacer is linked to an immediately preceding base through a phosphodiester bond. An example of a 21mer KCNQ2 AON can be denoted as:
XXXEoD S1XXXXXXoS2XXXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond, “D” represents the base immediately preceding Si and “E” represents the base immediately preceding “D.” Here, the base “D” is linked to the first spacer Si through a non-phosphodiester bond (e.g., phosphorothioate bond). Additionally, the base “D” is linked to base “E” through a phosphodiester bond. The second spacer S2 is linked to an immediately preceding base through a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.
[00302] Another example of such a 21mer KCNQ2 AON can be denoted as:
XXXXXOS1XXXXEODS2XXXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond, “D” represents the base immediately preceding S2 and “E” represents the base immediately preceding “D.” Here, the base “D” is linked to the second spacer S2 through a non-phosphodiester bond (e.g., phosphorothioate bond). Additionally, the base “D” is linked to base “E” through a phosphodiester bond. The first spacer Si is linked to an immediately preceding base through a phosphodi ester bond. Any nucleobase in the AON can be a nucleobase analog.
[00303] In some embodiments, one of the spacers is linked to the immediately succeeding base through a phosphodiester bond. For example, a KCNQ2 AON includes a first spacer that is linked to the immediately succeeding base through a phosphodiester bond, which can be denoted as:
XXXXXXS1 oXXXXXXXXXXXS2XXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.
[00304] As another example, a KCNQ2 AON includes a second spacer that is linked to the immediately succeeding base through a phosphodiester bond, which can be denoted as:
XXXXXXS2XXXXXXXXXXXS2 oXXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.
[00305] In various embodiments, the KCNQ2 AON may be a AON variant (e.g., a 23mer, a 21mer, or a 19mer) where one of the spacers is linked to the immediately succeeding base through a phosphodiester bond. For example, the KCNQ2 AON may be a 21mer with a first spacer that is linked to the immediately succeeding base through a phosphodiester bond, which can be denoted as:
XXXXXXXS1 oXXXXXS2 XXXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.
[00306] As another example, the KCNQ2 AON may be a 21mer with a second spacer that is linked to the immediately succeeding base through a phosphodiester bond, which can be denoted as:
XXXXXXXS1XXXXXS2 oXXXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond. Any nucleobase in the AON can be a nucleobase analog.
[00307] In various embodiments, two of the spacers have Y number of bases immediately preceding the spacers and Z number of bases immediately succeeding the spacers that are linked through phosphodiester bonds. In various embodiments, each of the spacers in the KCNQ2 AON have Y number of bases immediately preceding the spacers and Z number of bases immediately succeeding the spacers that are linked through phosphodi ester bonds. An example of such a KCNQ2 AON (e.g., 25mer) can be denoted as:
XXXXODOS1OEOXXXXXXXXXXOFOS2OHOXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, “0” represents a phosphodiester bond, “D” represents a base immediately preceding the first spacer, “E” represents the base immediately succeeding the first spacer, “F” represents a base immediately preceding the second spacer, and “H” represents the base immediately succeeding the second spacer. In various embodiments, all other bases of the KCNQ2 AON are linked through phosphorothioate bonds. Any nucleobase in the AON can be a nucleobase analog.
[00308] In various KCNQ2 AON includes two or more spacers and a range of bases located between the two spacers are linked through phosphodiester bonds. In various embodiments, the range of bases include two, three, four, five, six, or seven bases linked through phosphodiester bonds. In particular embodiments, the range of bases include two bases linked through phosphodiester bonds. In particular embodiments, the range of bases include four bases linked through phosphodiester bonds. In various embodiments, all other bases of the KCNQ2 AON are linked through phosphorothioate bonds. Any nucleobase in the AON can be a nucleobase analog. [00309] In various embodiments, the range of bases linked through phosphodiester bonds are positioned Y number of bases succeeding the first spacer and Z number of preceding the second spacer. In various embodiments, Y is one, two, three, four, five, six, or seven bases. In various embodiments, Z is one, two, three, four, five, six, or seven bases. Y and Z can be independent on each other. Any nucleobase in the AON can be a nucleobase analog.
[00310] In particular embodiments, Y is five bases and Z is four bases. To provide an example, such a KCNQ2 AON (e.g., 25mer) can be denoted as:
XXXXXXXXS1XXXXODOEOFOHOXXXS2XXXX where “Si” represents a first spacer, “S2” represents a second spacer, and “0” represents a phosphodiester bond. The bases “D,” “E,” “F,” and “H” represent the range of bases that are linked through phosphodi ester bonds. In this example, the range of bases is located five bases after the first spacer (e.g., D is positioned five bases after the first spacer) and the range of bases is located four bases preceding the second spacer (e.g., H is positioned four bases before the second spacer). Any nucleobase in the AON can be a nucleobase analog.
[00311] In particular embodiments, Y is four bases and Z is three bases. To provide an example, such a KCNQ2 AON (e.g., 23mer) can be denoted as:
XXXXXXXS1XXXODOEOXXS2XXXXXXX where “Si” represents a first spacer, “S2” represents a second spacer, and “0” represents a phosphodiester bond. The bases “D” and “E” represent the range of bases that are linked through phosphodiester bonds. In this example, the range of bases is located four bases after the first spacer (e.g., D is positioned four bases after the first spacer) and the range of bases is located three bases preceding the second spacer (e.g., E is positioned three bases before the second spacer). In various embodiments, the positions of the two spacers differ than shown above and therefore, the range of bases linked through phosphodiester bonds are differently positioned. In various embodiments, all other bases of the KCNQ2 AON are linked through phosphorothioate bonds. Any nucleobase in the AON can be a nucleobase analog.
[00312] In some embodiments, a disclosed KCNQ2 AON may have at least one modified nucleobase, e.g., 5 -methylcytosine, and/or at least one methylphosphonate nucleotide, which is placed, for example, either at only one of the 5' or 3' ends or at both 5' and 3' ends or along the oligonucleotide sequence.
[00313] KCNQ2 AONs may include at least one modified sugar. For example, the sugar moiety of at least one nucleotide constituting the oligonucleotide is a ribose in which the 2'-OH group may be replaced by any one selected from the group consisting of OR, R, R'OR, SH, SR, NH2, NR2, N3, CN, F, Cl, Br, and I (wherein R is an alkyl or aryl and R´ is an alkylene). Examples of a modified sugar moiety include a 2’-Ome modified sugar moiety, bicyclic sugar moiety, 2’-O-(2- methoxyethyl) (2’MOE or MOE), 2’-O-(N-methylacetamide), 2’-deoxy-2’-fluoro nucleoside, 2’- fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), constrained ethyl 2’-4’-bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA). [00314] In some embodiments, KCNQ2 AONs comprise 2’OMe (e.g., a KCNQ2 AON comprising one or more 2’OMe modified sugar), 2’MOE or MOE (e.g., a KCNQ2 AON comprising one or more 2’MOE modified sugar), PNA (e.g., a KCNQ2 AON comprising one or more N-(2-aminoethyl)-glycine units linked by amide bonds or carbonyl methylene linkage as repeating units in place of a sugar-phosphate backbone), LNA (e.g., a KCNQ2 AON comprising one or more locked ribose, and can be a mixture of 2’-deoxy nucleotides or 2’OMe nucleotides), c-ET (e.g., a KCNQ2 AON comprising one or more cET sugar), cMOE (e.g., a KCNQ2 AON comprising one or more cMOE sugar), morpholino oligomer (e.g., a KCNQ2 AON comprising a backbone comprising one or more PMO), deoxy-2’-fluoro nucleoside (e.g., a KCNQ2 AON comprising one or more 2’-fluoro-β-D-arabinonucleoside), tcDNA (e.g., a KCNQ2 AON comprising one or more tcDNA modified sugar), ENA (e.g., a KCNQ2 AON comprising one or more ENA modified sugar), or HNA (e.g., a KCNQ2 AON comprising one or more HNA modified sugar). In some embodiments, a KCNQ2 AON comprises one or more phosphorothioate linkage, phosphodiester linkage, phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, morpholino linkage, PNA linkage, or any combination of phosphorothioate linkage, phosphodiester linkage, a phosphotriester linkage, methylphosphonate linkage, phosphoramidate linkage, morpholino linkage, and PNA linkage. In some embodiments, a KCNQ2 AON comprises one or more phosphorothioate linkage, phosphodiester linkage, or a combination of phosphorothioate and phosphodiester linkages. [00315] In some embodiments, KCNQ2 AONs with a sequence of any one of SEQ ID NOs: 1- 176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5 is a chirally controlled oligonucleotide, such as a chirally controlled oligonucleotide described in any of US Patent No.9,982,257, US Patent No.10,590,413, US 10,724,035, US 10,450,568, and PCT Publication No. WO2019200185, each of which is hereby incorporated by reference in its entirety. [00316] For example, a KCNQ2 AON with a sequence of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5 is a chirally controlled oligonucleotide comprising a plurality of oligonucleotides of at least one type, wherein each type is defined by: 1) base sequence; 2) pattern of backbone linkages; 3) pattern of backbone chiral centers; and 4) pattern of backbone X-moieties (—X-L-R1); wherein: the oligonucleotides of at least one type comprise one or more phosphorothioate triester internucleotidic linkages and one or more phosphate diester linkage; the oligonucleotides of at least one type comprise at least two consecutive modified internucleotidic linkages; and oligonucleotides of at least one oligonucleotide type comprise one or more modified internucleotidic linkages independently having the structure of: ymmetric phosphorus atom and is either Rp or Sp;
Figure imgf000179_0001
W is O, S or Se; each of X, Y and Z is independently —O—, —S—, —N(-L-R1)—, or L; L is a covalent bond or an optionally substituted, linear or branched C1-C50 alkylene, wherein one or more methylene units of L are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, — N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, —C(O)N(R′)—, —N(R′)C(O)N(R′)—, — N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, —S(O)—, —S(O)2—, —S(O)2N(R′)—, — N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—; R1 is halogen, R, or an optionally substituted C1-C10 aliphatic wherein one or more methylene units are optionally and independently replaced by an optionally substituted C1-C6 alkylene, C1-C6 alkenylene, —C≡C—, —C(R′)2—, -Cy-, —O—, —S—, —S—S—, —N(R′)—, —C(O)—, —C(S)—, —C(NR′)—, — C(O)N(R′)—, —N(R′)C(O)N(R′)—, —N(R′)C(O)—, —N(R′)C(O)O—, —OC(O)N(R′)—, — S(O)—, —S(O)2—, —S(O)2N(R′)—, —N(R′)S(O)2—, —SC(O)—, —C(O)S—, —OC(O)—, or —C(O)O—; each R′ is independently —R, —C(O)R, —CO2R, or —SO2R, or: two R′ on the same nitrogen are taken together with their intervening atoms to form an optionally substituted heterocyclic or heteroaryl ring, or two R′ on the same carbon are taken together with their intervening atoms to form an optionally substituted aryl, carbocyclic, heterocyclic, or heteroaryl ring; -Cy- is an optionally substituted bivalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene, or heterocyclylene; each R is independently hydrogen, or an optionally substituted group selected from C1-C6 aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl; and eac independently represents a connection to a nucleoside. In some
Figure imgf000179_0002
embodiments, a KCNQ2 AON with a sequence of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 or the sequences in Tables 3A, 3B, 4 and 5 is a chirally controlled oligonucleotide comprising certain chemical modifications (e.g., 2’F (2’ Fluoro, which contains a fluorine molecule at the 2’ ribose position (instead of 2’-hydroxyl group in an RNA monomer)), 2’-Ome, phosphorothioate linkages, lipid conjugation, etc.), as described in U.S. Patent No.10,450,568. Motor Neuron Diseases [00317] Motor neuron diseases are a group of diseases characterized by loss of function of motor neurons that coordinate voluntary movement of muscles by the brain. Motor neuron diseases may affect upper and/or lower motor neurons, and may have sporadic or familial origins. Motor neuron diseases include amyotrophic lateral sclerosis (ALS or Lou Gehrig’s disease), progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, post-polio syndrome, and ALS with frontotemporal dementia. [00318] Symptoms of motor neuron diseases include muscle decay or weakening, muscle pain, spasms, slurred speech, difficulty swallowing, loss of muscle control, joint pain, stiff limbs, difficulty breathing, drooling, and complete loss of muscle control, including over basic functions such as breathing, swallowing, eating, speaking, and limb movement. These symptoms are also sometimes accompanied by depression, loss of memory, difficulty with planning, language deficits, altered behavior, and difficulty assessing spatial relationships and/or changes in personality. [00319] Motor neuron diseases can be assessed and diagnosed by a clinician of skill, for example, a neurologist, using various tools and tests. For example, the presence or risk of developing a motor neuron disease can be assessed or diagnosed using blood and urine tests (for example, tests that assay for the presence of creatinine kinase), magnetic resonance imaging (MRI), electromyography (EMG), nerve conduction study (NCS), spinal tap, lumbar puncture, and/or muscle biopsy. Motor neuron diseases can be diagnosed with the aid of a physical exam and/or a neurological exam to assess motor and sensory skills, nerve function, hearing and speech, vision, coordination and balance, mental status, and changes in mood or behavior. Amyotrophic Lateral Sclerosis [00320] ALS is a progressive motor neuron disease that disrupts signals to all voluntary muscles. ALS results in atrophy of both upper and lower motor neurons. Symptoms of ALS include weakening and wasting of the bulbar muscles, general and bilateral loss of strength, spasticity, muscle spasms, muscle cramps, fasciculations, slurred speech, and difficulty breathing or loss of ability to breathe. Some individuals with ALS also suffer from cognitive decline. At the molecular level, ALS is characterized by protein and RNA aggregates in the cytoplasm of motor neurons, including aggregates of the RNA-binding protein TDP43. [00321] ALS is most common in males above 40 years of age, although it can also occur in women and children. Risk of ALS is also heightened in individuals who smoke, are exposed to chemicals such as lead, or who have served in the military. Most instances of ALS are sporadic, while only about 10% of cases are familial. Causes of ALS include sporadic or inherited genetic mutations, high levels of glutamate, protein mishandling. Genetic mutations associated with ALS include mutations in the genes SOD1, C9orf72, TARDBP, FUS, ANG, ATXN2, CHCHD10, CHMP2B, DCTN1, ErbB4, FIG4, HNRPA1, MATR3, NEFH, OPTN, PFN1, PRPH, SETX, SIGMAR1, SMN1, SPG11, SQSTM1, TBK1, TRPM7, TUBA4A, UBQLN2, VAPB, and VCP. Frontotemporal Dementia [00322] Frontotemporal dementia (FTD) is a form of dementia that affects the frontal and temporal lobes of the brain. FTD includes frontotemporal lobar degeneration (FTLD). It has an earlier average age of onset than Alzheimer’s disease – 40 years of age. Symptoms of FTD include extreme changes in behavior and personality, speech and language problems, and movement-related symptoms such as tremor, rigidity, muscle spasm, weakness, and difficulty swallowing. Subtypes of FTD include behavior variant frontotemporal dementia (bvFTD), characterized by changes in personality and behavior, and primary progressive aphasia (PPA), which affects language skills, speaking, writing and comprehension. FTD is associated with tau protein accumulation (Pick bodies) and altered TDP43 function. About 30% of cases of FTD are familial, and no other risk factors other than family history of the disease are known. Genetic mutations associated with FTD include mutations in the genes C9orf72, Progranulin (GRN), microtubule-associated protein tau (MAPT), UBQLN2, VPC, CHMP2B, TARDBP, FUS, ITM2B, CHCHD10, SQSTM1, PSEN1, PSEN2, CTSF, CYP27A1, TBK1 and TBP. Amyotrophic lateral sclerosis with frontotemporal dementia [00323] Amyotrophic lateral sclerosis with frontotemporal dementia (ALS with FTD) is a clinical syndrome in which FTD and ALS occur in the same individual. Interestingly, mutations in C9orf72 are the most common cause of familial forms of ALS and FTD. Additionally, mutations in TBK1, VCP, SQSTM1, UBQLN2 and CHMP2B are also associated with ALS with FTD. Symptoms of ALS with FTD include dramatic changes in personality, as well as muscle weakness, muscle atrophy, fasciculations, spasticity, dysarthria, dysphagia, and degeneration of the spinal cord, motor neurons, and frontal and temporal lobes of the brain. At the molecular level, ALS with FTD is characterized by the accumulation of TDP-43 and/or FUS proteins. TBK1 mutations are associated with ALS, FTD, and ALS with FTD. Limbic-predominant age-related TDP-43 encephalopathy (LATE) [00324] Limbic-predominant age-related TDP-43 encephalopathy (LATE) is characterized by accumulation of misfolded TDP-43 protein in the brain, specifically in the limbic system. LATE is a neurological disorder that typically manifests in older patients (e.g., greater than 80 years old). LATE can be a diagnosis for dementia and LATE often mimics the symptoms of Alzheimer’s Disease including memory loss, confusion, and mood changes. Methods of Treatment [00325] The disclosure contemplates, in part, treating neurological diseases including any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), and Limbic-predominant age-related TDP-43 encephalopathy (LATE) in a patient in need thereof comprising administering a KCNQ2 AON. In some embodiments, provided herein are methods for treatment of a neurological disease in a patient in need thereof, comprising administering a disclosed KCNQ2 AON. In some embodiments of the disclosure, an effective amount of a disclosed KCNQ2 oligonucleotide may be administered to a patient in need thereof to treat a neurological disease, and/or to increase, restore, or stabilize expression of KCNQ2 mRNA that is capable of translation to produce a functional KCNQ2 protein, thereby increase, restore, or stabilize KCNQ2 activity and/or function. [00326] In some embodiments, treating a neurological disease comprises at least ameliorating or reducing one symptom associated with the neurological disease (for example, reducing muscle weakness in a patient with ALS). Methods of treating a neurological disease (for example, ALS, FTD, or ALS with FTD) in a patient suffering therefrom are provided, that include administering a disclosed KCNQ2 AON. In some embodiments, methods of slowing the progression of a neurological disease, for example, a motor neuron disease, are provided. [00327] Provided herein are methods of treating, reducing the risk of developing, or delaying the onset of a neurological disease in a subject in need thereof comprising administering a disclosed KCNQ2 AON. The methods include for example, treating a subject at risk of developing a neurological disease; e.g., administering to the subject an effective amount of a disclosed KCNQ2 AON. Neurological diseases that can be treated in this manner include motor neuron diseases, ALS, FTD, ALS with FTD, progressive bulbar palsy, pseudobulbar palsy, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, and post-polio syndrome. [00328] Methods of preventing or treating neurological diseases (for example, PD, ALS, FTD, and ALS with FTD) form part of this disclosure. Such methods may comprise administering to a patient in need thereof or a patient at risk, a pharmaceutical preparation comprising a KCNQ2 AON disclosed herein. For example, a method of preventing or treating a neurological disease is provided comprising administering to a patient in need thereof a KCNQ2 AON disclosed herein. [00329] Patients treated using an above method may experience an increase, restoration of, or stabilization of KCNQ2 mRNA expression, which is capable of translation to produce a functional KCNQ2 protein, of at least about 5%, 10%, 20%, 30%, 40% or even 50%, thereby increase, restore, or stabilize KCNQ2 activity and/or function in a target cell (for example, a motor neuron) after administering a KCNQ2 oligonucleotide e.g. after 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 1 month, 2 months, 3, months, 4 months, 5, months, or 6 months or more. In some embodiments, administering such a KCNQ2 oligonucleotide may be on, e.g., at least a daily basis. The KCNQ2 oligonucleotide may be administered orally. In some embodiments, the KCNQ2 oligonucleotide is administered intrathecally, intrathalamically, or intracisternally. For example, in an embodiment described herein, a KCNQ2 oligonucleotide is administered intrathecally, intrathalamically or intracisternally about every 3 months. The delay or amelioration of clinical manifestation of a neurological disease in a patient as a consequence of administering a KCNQ2 oligonucleotide disclosed here may be at least e.g., 6 months, 1 year, 18 months or even 2 years or more as compared to a patient who is not administered a KCNQ2 oligonucleotide, such as one disclosed herein. [00330] KCNQ2 oligonucleotides can be used alone or in combination with each other whereby at least two KCNQ2 oligonucleotides are used together in a single composition or as part of a treatment regimen. KCNQ2 oligonucleotides may also be used in combination with other drugs or AON for treating neurological diseases or conditions. [00331] In various embodiments, disclosed herein is a method for treating amyotrophic lateral sclerosis (ALS) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2’-O-(2-methoxyethyl) nucleoside, a 2’-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2’-deoxy-2’-fluoro nucleoside, a 2’-fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA), optionally wherein the oligonucleotide further comprises a spacer. [00332] In various embodiments, disclosed herein is a method for treating frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 or the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2’-O-(2-methoxyethyl) nucleoside, a 2’-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2’-deoxy-2’-fluoro nucleoside, a 2’-fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA), optionally wherein the oligonucleotide further comprises a spacer. [00333] In various embodiments, disclosed herein is a method for treating amyotrophic lateral sclerosis (ALS) with frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2’-O-(2-methoxyethyl) nucleoside, a 2’- O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2’-deoxy-2’-fluoro nucleoside, a 2’-fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA), optionally wherein the oligonucleotide further comprises a spacer. Treatment and Evaluation [00334] A patient, as described herein, refers to any animal at risk for, suffering from or diagnosed with a neurological disease, including, but not limited to, mammals, primates, and humans. In certain embodiments, the patient may be a non-human mammal such as, for example, a cat, a dog, or a horse. A patient may be an individual diagnosed with a high risk of developing a neurological disease, someone who has been diagnosed with a neurological disease, someone who previously suffered from a neurological disease, or an individual evaluated for symptoms or indications of a neurological disease, for example, any of the signs or symptoms associated with neurological diseases such as: amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), and TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia, Limbic-predominant age-related TDP-43 encephalopathy (LATE)), Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, epilepsy/seizure disorders, and synaptic diseases like autism. [00335] “A patient in need,” as used herein, refers to a patient suffering from any of the symptoms or manifestations of a neurological disease, a patient who may suffer from any of the symptoms or manifestations of a neurological disease, or any patient who might benefit from a method of the disclosure for treating a neurological disease. A patient in need may include a patient who is diagnosed with a risk of developing a neurological disease, a patient who has suffered from a neurological disease in the past, or a patient who has previously been treated for a neurological disease. [00336] “Effective amount,” as used herein, refers to the amount of an agent that is sufficient to at least partially treat a condition when administered to a patient. The therapeutically effective amount will vary depending on the severity of the condition, the route of administration of the component, and the age, weight, etc. of the patient being treated. Accordingly, an effective amount of a disclosed KCNQ2 oligonucleotide is the amount of the KCNQ2 oligonucleotide necessary to treat a neurological disease in a patient such that administration of the agent prevents a neurological disease from occurring in a subject, prevents neurological disease progression (e.g., prevents the onset or increased severity of symptoms of the neurological such as muscle weakening, spasms, or fasciculation), or relieves or completely ameliorates all associated symptoms of a neurological disease, i.e. causes regression of the disease. [00337] Efficacy of treatment may be evaluated by means of evaluation of gross symptoms associated with a neurological disease, analysis of tissue histology, biochemical assay, imaging methods such as, for example, magnetic resonance imaging, or other known methods. For instance, efficacy of treatment may be evaluated by analyzing gross symptoms of the disease such as changes in muscle strength and control or other aspects of gross pathology associated with a neurological disease following administration, to a patient suffering from a neurological disease, a disclosed KCNQ2 oligonucleotide. [00338] Efficacy of treatment may also be evaluated at the tissue or cellular level, for example, by means of obtaining a tissue biopsy (e.g., a brain, spinal, muscle, motor neuron tissue biopsy, or olfactory neurosphere cell biopsy) and evaluating gross tissue or cell morphology or staining properties. Biochemical assays that examine protein or RNA expression may also be used to evaluate efficacy of treatment. For instance, one may evaluate levels of a protein or gene product indicative of a neurological disease, in dissociated cells or non-dissociated tissue via immunocytochemical, immunohistochemical, Western blotting, or Northern blotting methods, or methods useful for evaluating RNA levels such as quantitative or semi-quantitative polymerase chain (e.g., digital PCR (DigitalPCR, dPCR, or ddPCR), qPCR etc.) reaction. One may also evaluate the presence or level of expression of useful biomarkers (e.g., neurofilament light (NEFL), neurofilament heavy (NEFH), TDP-43 or p75 extracellular domain (p75ECD)) found in spinal cord fluid, cerebrospinal fluid, extracellular vesicles (for example, exosome-like cerebrospinal fluid extracellular vesicles (“CSF exosomes”), such as those described in Welton et al., (2017) “Cerebrospinal fluid extracellular vesicle enrichment for protein biomarker discovery in neurological disease; multiple sclerosis” J Extracell Vesicles., 6(1):1-10; and Street et al., (2012) “Identification and proteomic profiling of exosomes in human cerebrospinal fluid” J Transl. Med., 10:5), urine, fecal matter, lymphatic fluid, blood, plasma, or serum to evaluate disease state and efficacy of treatment. One may also evaluate the presence or level of expression of useful biomarkers found in the plasma, neuronal extracellular vesicles/exosomes. Additional measurements of efficacy may include strength duration time constant (SDTC), short interval cortical inhibition (SICI), dynamometry, accurate test of limb isometric strength (ATLIS), compound muscle action potential (CMAP), and ALSFRS-R. In certain embodiments, urinary neurotrophin receptor p75 extracellular domain (p75ECD) is a disease progression and prognostic biomarker in amyotrophic lateral sclerosis (ALS). Phosphorylated neurofilament heavy chain (pNFH) in cerebrospinal fluid (CSF) predict disease status and survival in C9ORF72-associated amyotrophic lateral sclerosis (c9ALS) patients. CSF pNFH as a prognostic biomarker for clinical trials, which will increase the likelihood of successfully developing a treatment for c9ALS. [00339] In evaluating efficacy of treatment, suitable controls may be chosen to ensure a valid assessment. For instance, one can compare symptoms evaluated in a patient with a neurological disease following administration of a disclosed KCNQ2 oligonucleotide to those symptoms in the same patient prior to treatment or at an earlier point in the course of treatment or in another patient not diagnosed with the neurological disease. Alternatively, one may compare the results of biochemical or histological analysis of tissue following administration of a disclosed KCNQ2 oligonucleotide with those of tissue from the same patient or from an individual not diagnosed with the neurological disease or from the same patient prior to administration of the KCNQ2 oligonucleotide. Additionally, one may compare blood, plasma, serum, cell, urine, lymphatic fluid, spinal cord fluid, cerebrospinal fluid, or fecal samples following administration of the KCNQ2 oligonucleotide with comparable samples from an individual not diagnosed with the neurological disease or from the same patient prior to administration of the KCNQ2 oligonucleotide. In some embodiments one may compare extracellular vesicles (for example CSF exosomes), following administration of the KCNQ2 oligonucleotide with extracellular vesicles from an individual not diagnosed with the neurological disease or from the same patient prior to administration of the KCNQ2 oligonucleotide. [00340] Validation of KCNQ2 oligonucleotides may be determined by direct or indirect assessment of KCNQ2 expression levels or activity. For instance, biochemical assays that measure KCNQ2 protein or RNA expression may be used to evaluate overall effect on KCNQ2 transcripts) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370. For instance, one may measure KCNQ2 protein levels in cells or tissue by Western blot to evaluate overall KCNQ2 levels. One may also measure KCNQ2 mRNA levels by means of Northern blot or quantitative polymerase chain reaction to determine overall effect on KCNQ2 transcripts (for example, a KCNQ2 pre-mRNA) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370. One may also evaluate KCNQ2 protein levels or levels of another protein indicative of KCNQ2 signaling activity in dissociated cells, non-dissociated tissue, extracellular vesicles (for example, CSF exosomes), blood, serum, or fecal matter via immunocytochemical or immunohistochemical methods. [00341] Modulation of expression levels of KCNQ2 transcripts (for example, a KCNQ2 pre- mRNA) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370 may also be evaluated indirectly by measuring parameters such as autophagy, endocytosis, protein aggregation, and the presence or level of expression of useful biomarkers (e.g., neurofilament light (NEFL), neurofilament heavy (NEFH), TDP-43, or p75ECD found in plasma, spinal cord fluid, cerebrospinal fluid, extracellular vesicles (for example, CSF exosomes), blood, urine, lymphatic fluid, fecal matter, or tissue to evaluate the modulation of expression of KCNQ2 transcripts (for example, a KCNQ2 pre-mRNA ) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370. Modulation of expression levels of KCNQ2 transcripts (for example, a KCNQ2 pre-mRNA) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370 may also be evaluated indirectly by measuring parameters such as autophagy, endocytosis, protein aggregation, and the presence or level of expression of physiological biomarkers such as compound muscle action potential (CMAP). Additional measurements may include strength duration time constant (SDTC), short interval cortical inhibition (SICI), dynamometry, accurate test of limb isometric strength (ATLIS), compound muscle action potential, and ALSFRS-R. In certain embodiments, urinary neurotrophin receptor p75 extracellular domain (p75ECD) is a disease progression and prognostic biomarker in amyotrophic lateral sclerosis (ALS). Phosphorylated neurofilament heavy chain (pNFH) in cerebrospinal fluid (CSF) predict disease status and survival in c9ALS patients. CSF pNFH as a prognostic biomarker for clinical trials, which will increase the likelihood of successfully developing a treatment for c9ALS. [00342] The disclosure also provides methods of restoring expression of full length KCNQ2 transcripts in cells of a patient suffering from a neurological disease. Full length KCNQ2 transcripts may be restored in any cell in which KCNQ2 expression or activity occurs, including cells of the nervous system (including the central nervous system (e.g., spinal cord or brain), the peripheral nervous system, motor neurons, glial cells, astrocytes, oligodendrocytes, microglia, the brain, the brain stem, the frontal lobes, the temporal lobes, the spinal cord), the musculoskeletal system, spinal fluid, and cerebrospinal fluid. Cells of the musculoskeletal system include skeletal muscle cells (e.g., myocytes). Motor neurons include upper motor neurons and lower motor neurons. Pharmaceutical Compositions and Routes of Administration [00343] The present disclosure also provides methods for treating a neurological disease via administration of a pharmaceutical composition comprising a disclosed KCNQ2 oligonucleotide. In another aspect, the disclosure provides a pharmaceutical composition for use in treating a neurological disease. The pharmaceutical composition may be comprised of a disclosed KCNQ2 oligonucleotide, and a pharmaceutically acceptable carrier. As used herein the term “pharmaceutical composition” means, for example, a mixture containing a specified amount of a therapeutic compound, e.g., a therapeutically effective amount, of a therapeutic compound in a pharmaceutically acceptable carrier to be administered to a mammal, e.g., a human, in order to treat a neurological disease. In some embodiments, described herein are pharmaceutical compositions comprising a disclosed KCNQ2 oligonucleotide, and a pharmaceutically acceptable carrier. In another aspect, the disclosure provides use of a disclosed KCNQ2 oligonucleotide in the manufacture of a medicament for treating a neurological disease. “Medicament,” as used herein, has essentially the same meaning as the term “pharmaceutical composition.” [00344] As used herein, “pharmaceutically acceptable carrier” means buffers, carriers, and excipients suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. The carrier(s) should be “acceptable” in the sense of being compatible with the other ingredients of the formulations and not deleterious to the recipient. Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is known in the art. In one embodiment the pharmaceutical composition is administered orally and includes an enteric coating suitable for regulating the site of absorption of the encapsulated substances within the digestive system or gut. For example, an enteric coating can include an ethylacrylate-methacrylic acid copolymer. [00345] In one embodiment, a disclosed KCNQ2 oligonucleotide and any pharmaceutical composition thereof may be administered by one or several routes, including topically, intrathecally, intrathalamically, intracisternally, parenterally, orally, rectally, buccally, sublingually, vaginally, pulmonarily, intratracheally, intranasally, transdermally, or intraduodenally. The term parenteral as used herein includes subcutaneous injections, intrapancreatic administration, intravenous, intracisternal, intracerebroventricular, intrathecal, intrathalamic, intramuscular, intraperitoneal, intrasternal injection or infusion techniques. For example, a disclosed KCNQ2 oligonucleotide may be administered subcutaneously to a subject. In another example, a disclosed KCNQ2 oligonucleotide may be administered orally to a subject. In another example, a disclosed KCNQ2 oligonucleotide may be administered directly to the nervous system, or specific regions or cells of the nervous system (e.g., the brain, brain stem, lower motor neurons, spinal cord, upper motor neurons) via parenteral administration, for example, a disclosed KCNQ2 oligonucleotide may be administered intrathecally, intrathalamically, intracisternally, or intracerebroventricularly. [00346] In various embodiments, a KCNQ2 oligonucleotide, for example a KCNQ2 AON, can be exposed to calcium-containing buffers prior to administration. Such calcium-containing buffers can mitigate toxicity adverse effects of the KCNQ2 oligonucleotide. Further details of exposing an example antisense oligonucleotide to calcium-containing buffers is described in Moazami, et al., Quantifying and Mitigating Motor Phenotypes Induced by Antisense Oligonucleotides in the Central Nervous System, bioRxiv 2021.02.14.431096, which is hereby incorporated by reference in its entirety. [00347] In some embodiments, a KCNQ2 oligonucleotide, for example a KCNQ2 AON, can be encapsulated in a nanoparticle coating. It is believed that nanoparticle encapsulation prevents AON degradation and enhances cellular uptake. For example, in some embodiments a KCNQ2 oligonucleotide is encapsulated in a coating of a cationic polymer, for example, a synthetic polymer (e.g., poly-L-lysine, polyamidoamine, a poly(β-amino ester), and polyethyleneimine) or a naturally occurring polymer (e.g., chitosan and a protamine). In some embodiments, a KCNQ2 oligonucleotide is encapsulated in a lipid or lipid-like material, for example, a cationic lipid, a cationic lipid-like material, or an ionizable lipid that is positively charged only at an acidic pH. An example of a lipid nanoparticle nucleotide therapy includes Exicure’s XCUR-FXN, a lipid- nanoparticle spherical nucleic acid (SNA)-based therapeutic candidate. For example, in some embodiments, a KCNQ2 oligonucleotide is encapsulated in a lipid nanoparticle that includes hydrophobic moieties, e.g., cholesterol and/or a polyethylene glycol (PEG) lipid. [00348] Pharmaceutical compositions containing a disclosed KCNQ2 oligonucleotide, such as those disclosed herein, can be presented in a dosage unit form and can be prepared by any suitable method. A pharmaceutical composition should be formulated to be compatible with its intended route of administration. Useful formulations can be prepared by methods well known in the pharmaceutical art. For example, see Remington’s Pharmaceutical Sciences, 18th ed. (Mack Publishing Company, 1990). [00349] Pharmaceutical formulations, in some embodiments, are sterile. Sterilization can be accomplished, for example, by filtration through sterile filtration membranes. Where the composition is lyophilized, filter sterilization can be conducted prior to or following lyophilization and reconstitution. Parenteral Administration [00350] The pharmaceutical compositions of the disclosure can be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intracisternal, intracerebroventricular, intramuscular, subcutaneous, intrathecal, intrathalamic, intralesional, or intraperitoneal routes. The preparation of an aqueous composition, such as an aqueous pharmaceutical composition containing a disclosed KCNQ2 oligonucleotide, will be known to those of skill in the art in light of the present disclosure. Typically, such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for using to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified. [00351] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including normal saline, artificial cerebrospinal fluid, sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. [00352] Solutions of active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. In addition, sterile, fixed oils may be employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid can be used in the preparation of injectables. The sterile injectable preparation may also be a sterile injectable solution, suspension, or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer’s solution, U.S.P., and isotonic sodium chloride solution. In one embodiment, a disclosed KCNQ2 antisense oligonucleotide may be suspended in a carrier fluid comprising 1% (w/v) sodium carboxymethylcellulose and 0.1% (v/v) TWEEN™ 80. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. [00353] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. Generally, dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. Sterile injectable solutions of the disclosure may be prepared by incorporating a disclosed KCNQ2 antisense oligonucleotide in the required amount of the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The injectable formulations can be sterilized, for example, by filtration through a bacteria-retaining filter. [00354] The preparation of more, or highly concentrated solutions for intramuscular injection is also contemplated. In this regard, the use of DMSO as solvent is preferred as this will result in extremely rapid penetration, delivering high concentrations of the disclosed oligonucleotide to a small area. [00355] Suitable preservatives for use in such a solution include benzalkonium chloride, benzethonium chloride, chlorobutanol, thimerosal and the like. Suitable buffers include boric acid, sodium and potassium bicarbonate, sodium and potassium borates, sodium and potassium carbonate, sodium acetate, sodium biphosphate and the like, in amounts sufficient to maintain the pH at between about pH 6 and pH 8, and for example, between about pH 7 and pH 7.5. Suitable tonicity agents are dextran 40, dextran 70, dextrose, glycerin, potassium chloride, propylene glycol, sodium chloride, and the like, such that the sodium chloride equivalent of the solution is in the range 0.9 plus or minus 0.2%. Suitable antioxidants and stabilizers include sodium bisulfite, sodium metabisulfite, sodium thiosulfite, thiourea and the like. Suitable wetting and clarifying agents include polysorbate 80, polysorbate 20, poloxamer 282 and tyloxapol. Suitable viscosity- increasing agents include dextran 40, dextran 70, gelatin, glycerin, hydroxyethylcellulose, hydroxymethylpropylcellulose, lanolin, methylcellulose , petrolatum, polyethylene glycol, polyvinyl alcohol, polyvinylpyrrolidone, carboxymethylcellulose and the like. Oral Administration [00356] In some embodiments, contemplated herein are compositions suitable for oral delivery of a disclosed KCNQ2 oligonucleotide, e.g., tablets that include an enteric coating, e.g., a gastro- resistant coating, such that the compositions may deliver a KCNQ2 oligonucleotide to, e.g., the gastrointestinal tract of a patient. [00357] For example, a tablet for oral administration is provided that comprises granules (e.g., is at least partially formed from granules) that include a disclosed KCNQ2 oligonucleotide, e.g., a KCNQ2 oligonucleotide represented by any SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5 that targets a KCNQ2 transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370, and pharmaceutically acceptable excipients. Such a tablet may be coated with an enteric coating. Contemplated tablets may include pharmaceutically acceptable excipients such as fillers, binders, disintegrants, and/or lubricants, as well as coloring agents, release agents, coating agents, sweetening, flavoring such as wintergreen, orange, xylitol, sorbitol, fructose, and maltodextrin, and perfuming agents, preservatives and/or antioxidants. [00358] In some embodiments, contemplated pharmaceutical formulations include an intra- granular phase that includes a disclosed KCNQ2 oligonucleotide, e.g., a KCNQ2 oligonucleotide represented by any of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5 that targets a KCNQ2 transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370, and a pharmaceutically acceptable salt. In some embodiments, contemplated pharmaceutical formulations include an intra-granular phase that includes a disclosed KCNQ2 oligonucleotide, e.g., a KCNQ2 oligonucleotide represented by any of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5 that targets a KCNQ2 transcript comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NO: 1357-1370, and a pharmaceutically acceptable filler. For example, a disclosed KCNQ2 oligonucleotide and a filler may be blended together, optionally, with other excipients, and formed into granules. In some embodiments, the intragranular phase may be formed using wet granulation, e.g., a liquid (e.g., water) is added to the blended KCNQ2 oligonucleotide and filler, and then the combination is dried, milled and/or sieved to produce granules. One of skill in the art would understand that other processes may be used to achieve an intragranular phase. [00359] In some embodiments, contemplated formulations include an extra-granular phase, which may include one or more pharmaceutically acceptable excipients, and which may be blended with the intragranular phase to form a disclosed formulation. [00360] A disclosed formulation may include an intragranular phase that includes a filler. Exemplary fillers include, but are not limited to, cellulose, gelatin, calcium phosphate, lactose, sucrose, glucose, mannitol, sorbitol, microcrystalline cellulose, pectin, polyacrylates, dextrose, cellulose acetate, hydroxypropylmethyl cellulose, partially pre-gelatinized starch, calcium carbonate, and others including combinations thereof. [00361] In some embodiments, a disclosed formulation may include an intragranular phase and/or an extragranular phase that includes a binder, which may generally function to hold the ingredients of the pharmaceutical formulation together. Exemplary binders of the disclosure may include, but are not limited to, the following: starches, sugars, cellulose or modified cellulose such as hydroxypropyl cellulose, lactose, pre-gelatinized maize starch, polyvinyl pyrrolidone, hydroxypropyl cellulose, hydroxypropylmethyl cellulose, low substituted hydroxypropyl cellulose, sodium carboxymethyl cellulose, methyl cellulose, ethyl cellulose, sugar alcohols and others including combinations thereof. [00362] Contemplated formulations, e.g., that include an intragranular phase and/or an extragranular phase, may include a disintegrant such as but not limited to, starch, cellulose, crosslinked polyvinyl pyrrolidone, sodium starch glycolate, sodium carboxymethyl cellulose, alginates, corn starch, crosmellose sodium, crosslinked carboxymethyl cellulose, low substituted hydroxypropyl cellulose, acacia, and others including combinations thereof. For example, an intragranular phase and/or an extragranular phase may include a disintegrant. [00363] In some embodiments, a contemplated formulation includes an intra-granular phase comprising a disclosed KCNQ2 oligonucleotide and excipients chosen from: mannitol, microcrystalline cellulose, hydroxypropylmethyl cellulose, and sodium starch glycolate or combinations thereof, and an extra-granular phase comprising one or more of: microcrystalline cellulose, sodium starch glycolate, and magnesium stearate or mixtures thereof. [00364] In some embodiments, a contemplated formulation may include a lubricant, e.g. an extra- granular phase may contain a lubricant. Lubricants include but are not limited to talc, silica, fats, stearin, magnesium stearate, calcium phosphate, silicone dioxide, calcium silicate, calcium phosphate, colloidal silicon dioxide, metallic stearates, hydrogenated vegetable oil, corn starch, sodium benzoate, polyethylene glycols, sodium acetate, calcium stearate, sodium lauryl sulfate, sodium chloride, magnesium lauryl sulfate, talc, and stearic acid. [00365] In some embodiments, the pharmaceutical formulation comprises an enteric coating. Generally, enteric coatings create a barrier for the oral medication that controls the location at which the drug is absorbed along the digestive track. Enteric coatings may include a polymer that disintegrates at different rates according to pH. Enteric coatings may include for example, cellulose acetate phthalate, methyl acrylate-methacrylic acid copolymers, cellulose acetate succinate, hydroxylpropylmethyl cellulose phthalate, methyl methacrylate-methacrylic acid copolymers, ethylacrylate-methacrylic acid copolymers, methacrylic acid copolymer type C, polyvinyl acetate-phthalate, and cellulose acetate phthalate. [00366] Exemplary enteric coatings include Opadry® AMB, Acryl-EZE®, Eudragit® grades. In some embodiments, an enteric coating may comprise about 5% to about 10%, about 5% to about 20%, 8% to about 15%, about 8% to about 20%, about 10% to about 20%, or about 12% to about 20%, or about 18% of a contemplated tablet by weight. For example, enteric coatings may include an ethylacrylate-methacrylic acid copolymer. [00367] For example, in a contemplated embodiment, a tablet is provided that comprises or consists essentially of about 0.5% to about 70%, e.g., about 0.5% to about 10%, or about 1% to about 20%, by weight of a disclosed KCNQ2 oligonucleotide or a pharmaceutically acceptable salt thereof. Such a tablet may include for example, about 0.5% to about 60% by weight of mannitol, e.g., about 30% to about 50% by weight mannitol, e.g., about 40% by weight mannitol; and/or about 20% to about 40% by weight of microcrystalline cellulose, or about 10% to about 30% by weight of microcrystalline cellulose. For example, a disclosed tablet may comprise an intragranular phase that includes about 30% to about 60%, e.g. about 45% to about 65% by weight, or alternatively, about 5 to about 10% by weight of a disclosed KCNQ2 oligonucleotide, about 30% to about 50%, or alternatively, about 5% to about 15% by weight mannitol, about 5% to about 15% microcrystalline cellulose, about 0% to about 4%, or about 1% to about 7% hydroxypropylmethylcellulose, and about 0% to about 4%, e.g., about 2% to about 4% sodium starch glycolate by weight. [00368] In another contemplated embodiment, a pharmaceutical tablet formulation for oral administration of a disclosed KCNQ2 oligonucleotide comprises an intra-granular phase, wherein the intra-granular phase includes a disclosed KCNQ2 AON or a pharmaceutically acceptable salt thereof (such as a sodium salt), and a pharmaceutically acceptable filler, and which may also include an extra-granular phase, that may include a pharmaceutically acceptable excipient such as a disintegrant. The extra-granular phase may include components chosen from microcrystalline cellulose, magnesium stearate, and mixtures thereof. The pharmaceutical composition may also include an enteric coating of about 12% to 20% by weight of the tablet. For example, a pharmaceutically acceptable tablet for oral use may comprise about 0.5% to 10% by weight of a disclosed KCNQ2 AON, e.g., a disclosed KCNQ2 AON or a pharmaceutically acceptable salt thereof, about 30% to 50% by weight mannitol, about 10% to 30% by weight microcrystalline cellulose, and an enteric coating comprising an ethylacrylate-methacrylic acid copolymer. [00369] In another example, a pharmaceutically acceptable tablet for oral use may comprise an intra-granular phase, comprising about 5 to about 10% by weight of a disclosed KCNQ2 AON, e.g., a disclosed KCNQ2 AON or a pharmaceutically acceptable salt thereof, about 40% by weight mannitol, about 8% by weight microcrystalline cellulose, about 5% by weight hydroxypropylmethyl cellulose, and about 2% by weight sodium starch glycolate; an extra- granular phase comprising about 17% by weight microcrystalline cellulose, about 2% by weight sodium starch glycolate, about 0.4% by weight magnesium stearate; and an enteric coating over the tablet comprising an ethylacrylate-methacrylic acid copolymer. [00370] In some embodiments the pharmaceutical composition may contain an enteric coating comprising about 13% or about 15%, 16%, 17% or 18% by weight, e.g., AcyrlEZE® (see, e.g., PCT Publication No. WO 2010/054826, which is hereby incorporated by reference in its entirety). [00371] The rate at which the coating dissolves and the active ingredient is released is its dissolution rate. In an embodiment, a contemplated tablet may have a dissolution profile, e.g., when tested in a USP/EP Type 2 apparatus (paddle) at 100 rpm and 37 °C in a phosphate buffer with a pH of 7.2, of about 50% to about 100% of the KCNQ2 oligonucleotide releasing after about 120 minutes to about 240 minutes, for example after 180 minutes. In another embodiment, a contemplated tablet may have a dissolution profile, e.g., when tested in a USP/EP Type 2 apparatus (paddle) at 100 rpm and 37 °C in diluted HCl with a pH of 1.0, where substantially none of the KCNQ2 oligonucleotide is released after 120 minutes. A contemplated tablet, in another embodiment, may have a dissolution profile, e.g., when tested in USP/EP Type 2 apparatus (paddle) at 100 rpm and 37 °C in a phosphate buffer with a pH of 6.6, of about 10% to about 30%, or not more than about 50% of the KCNQ2 oligonucleotide releasing after 30 minutes. [00372] In some embodiments, methods provided herein may further include administering at least one other agent that is directed to treatment of diseases and disorders disclosed herein. In one embodiment, contemplated other agents may be co-administered (e.g., sequentially or simultaneously). Dosage and Frequency of Administration [00373] The dosage or amounts described below refer either to the oligonucleotide or a pharmaceutically acceptable salt thereof. [00374] In some embodiments, methods described herein include administering at least 1 μg, at least 5 μg, at least 10 μg, at least 20 μg, at least 30 μg, at least 40 μg, at least 50 μg, at least 60 μg, at least 70 μg, at least 80 μg, at least 90 μg, or at least 100 μg of a KCNQ2 antisense oligonucleotide e.g., a KCNQ2 oligonucleotide. In some embodiments, methods include administering from 10 mg to 500 mg, from 1 mg to 10 mg, from 10 mg to 20 mg, from 20 mg to 30 mg, from 30 mg to 40 mg, from 40 mg to 50 mg, from 50 mg to 60 mg, from 60 mg to 70 mg, from 70 mg to 80 mg, from 80 mg to 90 mg, from 90 mg to 100 mg, from 100 mg to 150 mg, from 150 mg to 200 mg, from 200 mg to 250 mg, from 250 mg to 300 mg, from 300 mg to 350 mg, from 350 mg to 400 mg, from 400 mg to 450 mg, from 450 mg to 500 mg, from 500 mg to 600 mg, from 600 mg to 700 mg, from 700 mg to 800 mg, from 800 mg to 900 mg, from 900 mg to 1 g, from 1 mg to 50 mg, from 20 mg to 40 mg, or from 1 mg to 500 mg of a KCNQ2 antisense oligonucleotide. [00375] In some embodiments, methods described herein include administering formulations that include about 10 mg, 15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 110 mg, 120 mg, 130 mg, 140 mg, 150 mg, 160 mg, 170 mg, 180 mg, 190 mg, 200 mg, 250 mg, 300 mg, 350 mg, 400 mg, 450 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, 1 g, 1.5 g, 2.0 g, 2.5 g, 3.0 g, 3.5 g, 4.0 g, 4.5 g, or 5.0 g of a disclosed KCNQ2 oligonucleotide. In some embodiments, a formulation may include about 40 mg, 80 mg, or 160 mg of a disclosed KCNQ2 oligonucleotide. In some embodiments, a formulation may include at least 100 μg of a disclosed KCNQ2 oligonucleotide. For example, formulations may include about 0.1 mg, 0.2 mg, 0.3 mg, 0.4 mg, 0.5 mg, 1 mg, 5 mg, 10 mg, 15 mg, 20 mg, 25 mg, or 30 mg of a disclosed KCNQ2 oligonucleotide. The amount administered will depend on variables such as the type and extent of disease or indication to be treated, the overall health and size of the patient, the in vivo potency of the KCNQ2 oligonucleotide, the pharmaceutical formulation, and the route of administration. The initial dosage can be increased beyond the upper level in order to rapidly achieve the desired blood-level or tissue level. Alternatively, the initial dosage can be smaller than the optimum, and the dosage may be progressively increased during the course of treatment. Human dosage can be optimized, e.g., in a conventional Phase I dose escalation study. Dosing frequency can vary, depending on factors such as route of administration, dosage amount and the disease being treated. Exemplary dosing frequencies are once per day, once per week and once every two weeks. In some embodiments, dosing is once per day for 7 days. In some embodiments, dosing is once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, or once every 12 weeks. In some embodiments, dosing is once a month to every three months. In some embodiments, dosing is once every 2 weeks for three dose, then monthly, bimonthly, or every three or four months. Combination Therapies [00376] In various embodiments, a KCNQ2 AON as disclosed herein can be administered in combination with one or more additional therapies. The combination therapy of the disclosed oligonucleotide and the one or more additional therapies can, in some embodiments, be synergistic in treating any of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), and TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Parkinson’s disease, Parkinson’s disease with or without dementia, Limbic-predominant age-related TDP-43 encephalopathy (LATE)),Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, epilepsy/seizure disorders, and synaptic diseases like autism. [00377] Example additional therapies include any of Riluzole (Rilutek), PrimeC, Edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitor, antipsychotic agents, cholinesterase inhibitors, memantine, benzodiazepine antianxiety drugs, AMX0035 (ELYBRIO), ZILUCOPLAN (RA101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078, and BIIB105), BIIB100, levodopa/carbidopa, dopaminergic agents (e.g., ropinirole, pramipexole, rotigotine), medroxyprosterone, KCNQ2/KCNQ3 openers (e.g., retigabine, XEN1101, or QRL-101), bioactive scaffolds, anticonvulsants and psychostimulant agents. Additional therapies can further include breathing care, physical therapy, occupational therapy, speech therapy, and nutritional support. In various embodiments, an additional therapy can be a second antisense oligonucleotide. As an example, the second antisense oligonucleotide may target a KCNQ2 transcript (e.g., KCNQ2 pre-mRNA, mature KCNQ2 mRNA) to modulate the expression levels of full length KCNQ2 protein. [00378] Non-limiting examples of therapies for Parkinson’s disease (PD) include: deep brain stimulation, levodopa and carbidopa (duopa, rytary, Sinemet, inbrija), istradefylline (nourianz), safinamide (xadago), pramipexole (Mirapex), rotigotine (neupro), ropinirole (requip), amantadine (gocovri, Symmetrel, osmolex), benztropine (Cogentin), trihexyphenidyl (artane), selegiline (eldepryl, zelapar), rasagiline, entacapone (comtan), opicapone (ongentys), tolcapone (tasmar), apomorphine (apokyn, kynmobi), exenatide, lingzhi, BIIB054, BIIB094, Caffeine, sarizotan, and embryonic dopamine cell implantation. [00379] Non-limiting examples of therapies for Alzheimer’s disease (AD) include aducanamab (Aduhlem), memantine (Namenda), Donepezil (Aricept), Rivastigmine (Exelon), Galantamine (razadyne), Namzeric, Suvorexant (belsomra), and lecanemab. [00380] A non-limiting example of a therapy for amyotrophic lateral sclerosis (ALS) is pridopidine. [00381] Non-limiting examples of therapies for frontotemporal dementia (FTD) include olanzapine (Zyprexa), quetiapine (Seroquel), SSRIs (citalopram (Cipramil), dapoxetine (Priligy), escitalopram (Cipralex), fluoxetine (Prozac or Oxactin), fluvoxamine (Faverin), paroxetine (Seroxat), sertraline (Lustral), vortioxetine (Brintellix)), divalproex sodium (Depakote), carbamazepine (Tegretol), and medroxyprogestrone. [00382] Non-limiting examples of therapies for spinal cord injury includes bioactive scaffolds, such as bioactive scaffolds with enhanced supramolecular motion. Further details of example bioactive scaffolds as therapies for spinal cord injury is described in Alvarez et al., “Bioactive scaffolds with enhanced supramolecular motion promote recovery from spinal cord injury.” Science, 374, 848-856 (2021), which is hereby incorporated by reference in its entirety. [00383] In various embodiments, the disclosed oligonucleotide and the one or more additional therapies can be conjugated to one another and provided in a conjugated form. Further description regarding conjugates involving the disclosed oligonucleotide is described below. In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided concurrently. In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided simultaneously. In various embodiments, the disclosed oligonucleotide and one or more additional therapies are provided sequentially. [00384] Non-limiting examples of therapies for epilepsy include Brivaracetam (briviact), cannabidiol (epidiolex), carbamazepine (carbatrol, Tegretol), cenobamate (xcopri), diazepam (valium), lorazepam (Ativan), clonazepam (klonopin), eslicarbazepine (aptiom), ethosuximide (zarontin), felbamate (felbatol), fenfluramine (fintepla), lacosamide (VIMPAT), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (oxtellar xr, Trileptal), perampanel (fycompa), phenobarbital, phenytoin (dilantin), pregabalin (lyrica), tiagabine (gabitril), topiramate (topamax), valproate (depakene, depakote), and zonisamide (zonegran). Conjugates [00385] In certain embodiments, provided herein are oligomeric compounds, which comprise an oligonucleotide (e.g., KCNQ2 oligonucleotide) and optionally one or more conjugate groups and/or terminal groups. Conjugate groups include one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2’-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3’ and/or 5’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5’- end of oligonucleotides. [00386] Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified. Conjugate Groups [00387] In certain embodiments, a KCNQ2 AON is covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge, and clearance. In particular embodiments, conjugate groups modify the circulation time (e.g., increase) of the oligonucleotides in the bloodstream such that increased concentrations of the oligonucleotides are delivered to the brain. In particular embodiments, conjugate groups modify the residence time (e.g., increase residence time) of the oligonucleotides in a target organ (e.g., brain) such that increased residence time of the oligonucleotides improves their performance (e.g., efficacy). In particular embodiments, conjugate groups increase the delivery of the oligonucleotide to the brain through the blood brain barrier and/or brain parenchyma (e.g., through receptor mediated transcytosis). In particular embodiments, conjugate groups enable the oligonucleotide to target a specific organ (e.g., the brain). In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac -glycerol or triethyl -ammonium l,2-di-0-hexadecyl-rac- glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et al., Molecular Therapy Nucleic Acids, 2015, 4, e220; and Nishina et al., Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620). Conjugate Moieties [00388] Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, dyes, bile acids, and phenylbutyric acid. In particular embodiments, conjugate moieties are selected from a peptide, a lipid, N- acetylgalactosamine (GalNAc), cholesterol, vitamin E, lipoic acid, panthothenic acid, polyethylene glycol, an antibody (e.g., an antibody for crossing the blood brain barrier such as anti-transferrin receptor antibody), or a cell-penetrating peptide (e.g., transactivator of transcription (TAT) and penetratine). [00389] In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)- pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethacin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Conjugate Linkers [00390] Conjugate moieties are attached to a KCNQ2 AON through conjugate linkers. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbon chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units. [00391] In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group. [00392] In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl. [00393] Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6- dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- l-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted C1-C10 alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl. [00394] In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, conjugate linkers comprise 2-5 linker-nucleosides. In certain embodiments, conjugate linkers comprise 3 linker-nucleosides. [00395] In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methyl cytosine, 4-N -benzoyl-5 -methyl cytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the oligomeric compound after it reaches a target tissue. Accordingly, linker-nucleosides are typically linked to one another and to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are phosphodiester bonds. [00396] Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an oligomeric compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the oligomeric compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker- nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. [00397] In certain embodiments, it is desirable for a conjugate group to be cleaved from the KCNQ2 AON. For example, in certain circumstances oligomeric compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the oligomeric compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases. [00398] In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group. [00399] In certain embodiments, a cleavable moiety comprises or consists of one or more linker- nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the oligomeric compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2’-deoxy nucleoside that is attached to either the 3’ or 5’- terminal nucleoside of an oligonucleotide by a phosphate internucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2’-deoxy adenosine. Terminal Groups [00400] In certain embodiments, oligomeric compounds comprise one or more terminal groups. In certain such embodiments, oligomeric compounds comprise a stabilized 5’-phosphate. Stabilized 5’-phosphates include, but are not limited to 5’-phosphonates, including, but not limited to 5’- vinylphosphonates. In certain embodiments, terminal groups comprise one or more abasic nucleosides and/or inverted nucleosides. In certain embodiments, terminal groups comprise one or more 2’-linked nucleosides. In certain such embodiments, the 2’-linked nucleoside is an abasic nucleoside. In various embodiments, terminal groups comprise one or more spacers. Diagnostic Methods [00401] The disclosure also provides a method of diagnosing a patient with a neurological disease that relies upon detecting levels of KCNQ2 expression signal in one or more biological samples of a patient. As used herein, the term “KCNQ2 expression signal” can refer to any indication of KCNQ2 gene expression, or gene or gene product activity. KCNQ2 gene products include RNA (e.g., mRNA), peptides, and proteins. Indices of KCNQ2 gene expression that can be assessed include, but are not limited to, KCNQ2 gene or chromatin state, KCNQ2 gene interaction with cellular components that regulate gene expression, KCNQ2 gene product expression levels (e.g., expression levels of KCNQ2 transcripts (for example, a KCNQ2 pre-mRNA) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370, or interaction of KCNQ2 RNA or protein with transcriptional, translational, or post-translational processing machinery. [00402] Detection of KCNQ2 expression signal may be accomplished through in vivo, in vitro, or ex vivo methods. In a preferred embodiment, methods of the disclosure may be carried out in vitro. Methods of detecting may involve detection in blood, serum, fecal matter, tissue, cerebrospinal fluid, spinal fluid, urine, extracellular vesicles (for example, CSF exosomes), or cells of a patient. Detection may be achieved by measuring expression signal of KCNQ2 transcripts (for example, a KCNQ2 pre-mRNA) comprising a sequence that shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity to any one of SEQ ID NOs: 1357-1370 in whole tissue, tissue explants, cell cultures, dissociated cells, cell extract, extracellular vesicles (for example, CSF exosomes), or body fluids, including blood, spinal fluid, cerebrospinal fluid, urine, lymphatic fluid, or serum. Methods of detection include assays that measure levels of KCNQ2 gene product expression such as Western blotting, FACS, ELISA, other quantitative binding assays, cell or tissue growth assays, Northern blots, quantitative or semi-quantitative polymerase chain reaction, medical imaging methods (e.g., MRI), or immunostaining methods (e.g., immunohistochemistry or immunocytochemistry). Modifications in General [00403] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references, GenBank accession numbers, and the like recited in the present application is incorporated herein by reference in its entirety. [00404] Although the sequence listing accompanying this filing identifies each sequence as either “RNA” or “DNA” as required, in reality, those sequences may be modified with any combination of chemical modifications. One of skill in the art will readily appreciate that such designation as “RNA” or “DNA” to describe modified oligonucleotides is, in certain instances, arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2’-OH sugar moiety and a thymine base could be described as a DNA having a modified sugar (2’-OH in place of one 2’-H of DNA) or as an RNA having a modified base (thymine (methylated uracil) in place of a uracil of RNA). Accordingly, nucleic acid sequences provided herein, including, but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNA and/or DNA, including, but not limited to such nucleic acids having modified nucleobases. By way of further example and without limitation, an oligomeric compound having the nucleobase sequence “ATCGATCG” encompasses any oligomeric compounds having such nucleobase sequence, whether modified or unmodified, including, but not limited to, such compounds comprising RNA bases, such as those having sequence “AUCGAUCG” and those having some DNA bases and some RNA bases such as “AUCGATCG” and oligomeric compounds having other modified nucleobases, such as “ATmCGAUCG,” wherein mC indicates a cytosine base comprising a methyl group at the 5- position. [00405] Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as α or β such as for sugar anomers, or as (D) or (L), such as for amino acids, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Compounds provided herein that contain stereocenters that are drawn or described with undefined stereochemistry included all such possible isomers, including their stereorandom and optically pure forms, unless specified otherwise. Likewise, all tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, compounds described herein are intended to include corresponding salt forms. [00406] The compounds described herein include variations in which one or more atoms are replaced with a non-radioactive isotope or radioactive isotope of the indicated element. For example, compounds herein that comprise hydrogen atoms encompass all possible deuterium substitutions for each of the 1H hydrogen atoms. Isotopic substitutions encompassed by the compounds herein include but are not limited to: 2H or 3H in place of 1H, 13C or 14C in place of 12C, 15N in place of 14N, 17O or 18O in place of 16O, and 33S, 34S, 35S, or 36S in place of 32S. In certain embodiments, non-radioactive isotopic substitutions may impart new properties on the oligomeric compound that are beneficial for use as a therapeutic or research tool. EXAMPLES [00407] The disclosure is further illustrated by the following examples. The examples are provided for illustrative purposes only, and are not to be construed as limiting the scope or content of the disclosure in any way. Example 1: Design and Selection of KCNQ2 Oligonucleotides [00408] KCNQ2 AONs oligonucleotides that target a KCNQ2 transcript are designed and tested to identify KCNQ2 AONs capable of reducing quantity of mis-spliced KCNQ2 transcripts. Such KCNQ2 AONs include a subset of the KCNQ2 parent oligonucleotides represented by any of SEQ ID NOs: 1-176 and SEQ ID NOs: 353-854 or KCNQ2 oligonucleotide variants represented by any of SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224. The KCNQ2 parent oligonucleotides are 25 nucleosides in length. Each of the nucleosides of the KCNQ2 parent oligonucleotides are modified nucleosides with 2’MOE sugar moieties, and each “C” is replaced with a 5-MeC. Additionally, each of the internucleoside linkages between the nucleosides of the KCNQ2 oligonucleotides are phosphorothioate internucleoside linkages. [00409] Generally, the length of the KCNQ2 antisense oligonucleotides are 25 oligonucleotide units in length. However, variants of the KCNQ2 antisense oligonucleotides were also designed with varying lengths (e.g., 23mers). Examples of these variant KCNQ2 antisense oligonucleotides were designed to include a subset of the sequences of SEQ ID NOs: 1371-1546 and SEQ ID NOs: 1723-2224. [00410] Table 6: KCNQ2 AONs (including KCNQ2 parent oligonucleotides and KCNQ2 oligonucleotides with two spacers) SEQ Oli l id S * ( h S i di f S )*
Figure imgf000208_0001
Figure imgf000209_0001
Figure imgf000210_0001
Figure imgf000211_0001
Figure imgf000212_0001
modified nucleosides with 2 -O-(2-methoxyethyl) (2 -MOE) sugar moieties, each C is replaced with a 5-methylcytosine (5-MeC), and all internucleoside linkages are phosphorothioate linkages. A spacer as indicated by S is not a nucleoside. S represents a spacer of Formula (Iia’) as disclosed herein. Example 2: Methods for Evaluating KCNQ2 Antisense Oligonucleotides [00411] KCNQ2 antisense oligonucleotides were evaluated in iPSC derived human motor neurons (hMN). The cells were seeded in 96-well plates at a density of 50,000 cells/ well. Antisense oligonucleotide (AON) to TDP43 was transfected with Endoporter (Gene Tools, Philomath, OR, USA) to increase expression of exon 5 containing KCNQ2 transcript. Vehicle control consisted of motor neuron treatment with Endoporter alone. Positive controls included cells that were treated with TDP43 AON alone (“AON TDP43” or “TDP43 AON”). [00412] TDP43 AON is a gapmer oligonucleotide and has the following sequence and chemistry: 5’ A*A*G*G*C*T*T*C*A*T*A*T*T*G*T*A*C*T*T*T 3’ (SEQ ID NO: 2856) where * = phosphorothioate, underlined = DNA, other=2’MOE RNA; each “C” is 5-MeC. [00413] To evaluate KCNQ2 AON ability to restore Exon 5 inclusion in the presence of TDP-43 knockdown, antisense oligonucleotides to KCNQ2 were co-incubated with TDP43 AON in Endoporter in media before addition to the cells. After 72 hours, antisense oligonucleotides and Endoporter were washed out and replaced with fresh media. After 72 additional hours fresh media was replaced, and after 72 hours RNA was collected from the 96-well plates for RT- qPCR. RNA was isolated, cDNA generated, and multiplexed RT-qPCR assay performed with TaqMan probes for KCNQ2 exon 5 inclusion in the transcript and reference GAPDH quantification. [00414] Transcript levels (e.g., KCNQ2 exon 5 containing transcript or TDP43 transcript) were detected by RT-qPCR using Taqman. Specifically, RT-qPCR was performed for detecting GAPDH using Thermofisher TaqMan Gene Expression Assay Hs03929097_g1. RT-qPCR was performed for detecting KCNQ2 exon 5 containing transcripts using custom Thermofisher TaqMan targeting exon junction 5/6. Exon 5/6 Primers: Forward: 5’ GGGAGAACGACCACTTTGA 3’ (SEQ ID NO: 2857) Reverse: 3’ GAAGAAGGAGACACCGATGAG 3’ (SEQ ID NO: 2858) Probe: 5’ TAGCCAATGGTGGTCAGCGTGATC 3’ (SEQ ID NO: 2859) [00415] RT-qPCR was performed on Applied Biosystems ® 7500 Real-time PCR systems. One cycle of reverse transcription was performed at a temperature of 50°C for 5 min. One cycle of RT inactivation/initial denaturation was performed at a temperature of 95°C for 20 seconds. Forty five cycles of amplification were performed at a temperature of 95°C for 1 second followed by 60°C for 20 seconds.
[00416] KCNQ2 Exon 5 inclusion (Ct) was normalized to GAPDH (deltaCt). To visualize the quantitative changes (e.g, % increase of KCNQ2 Exon 5 inclusion), the normalized KCNQ2 Exon 5 inclusion signal was further normalized to the vehicle (treated with Endoporter alone, deltadeltaCt). Relative quantity (RQ) of transcript level was calculated using the equation RQ=2‘ deitadeitact an d is used to describe treatment condition comparison to normal, healthy levels (1.0).
[00417] Rq values for KCNQ2 Exon Junctions 5/6 were normalized using the following formula: ((RQAON - RQTDP43)/(RQendo - RQTDP43)) * 100
[00418] Table 7 and 8 show the RT-qPCR results of KCNQ2 AONs with spacers and performance of KCNQ2 AONs without spacers in human motor neurons. KCNQ2 AONs (e.g, KCNQ2 oligonucleotides without spacers or with one or two spacers) were tested for their ability to increase or restore full-length KCNQ2 mRNA (i.e., mRNA from which full-length KCNQ2 is translated which include exon 5 in the transcript) levels. In some cases, KCNQ2 AONs with spacers increased full-length KCNQ2 mRNA (“KCNQ2 FL”). In some cases, KCNQ2 AONs without spacers increased full-length KCNQ2 mRNA (“KCNQ2 FL”). Specific AON sequences are labeled according to their corresponding SEQ ID NO.
[00419] As shown in Table 7, a 200 nM dose of SEQ ID NO: 1946 (GGCCAGGATGAGACAAAGGAAGC with no spacers) rescued full length KCNQ2 mRNA to -0.2490%. A 500 nM dose of SEQ ID NO: 1946 (GGCCAGGATGAGACAAAGGAAGC with no spacers) rescued full length KCNQ2 mRNA to 27.870%. Comparatively, 200 nM dose of SEQ ID NO: 2841 (GGCCAGGSTGAGACASAGGAAGC with two spacers) rescued full length KCNQ2 mRNA to 4.1655%. A 500 nM dose of SEQ ID NO: 2841 (GGCCAGGSTGAGACASAGGAAGC with two spacers) rescued full length KCNQ2 mRNA to 59.333%. This indicates that the addition of spacers of SEQ ID NO: 2841 improves the performance in comparison to the KCNQ2 AON counterpart without spacers (e.g., SEQ ID NO: 1946). [00420] Additionally shown in Table 7, a 200 nM dose of SEQ ID NO: 1889 (AGACGGCACCACCATCATGACCA with no spacers) rescued full length KCNQ2 mRNA to - 3.66%. A 500 nM dose of SEQ ID NO: 1889 (AGACGGCACCACCATCATGACCA with no spacers) rescued full length KCNQ2 mRNA to 16.627%. Comparatively, a 200nM dose of SEQ ID NO: 2840 (AGACGGCSCCACCATSATGACCA with two spacers) rescued full length KCNQ2 mRNA to 18.720%. A 500 nM dose of SEQ ID NO: 2840 (AGACGGCSCCACCATSATGACCA with two spacers) rescued full length KCNQ2 mRNA to 26,191%. This indicates that the addition of spacers of SEQ ID NO: 2840 improves the performance in comparison to the KCNQ2 AON counterpart without spacers (e.g., SEQ ID NO: 1889). [00421] Additionally shown in Table 7, a 200 nM dose of SEQ ID NO: 1859 (CAGAAGCATCACCATCACCACCA with no spacers) rescued full length KCNQ2 mRNA to - 4.824%. A 500 nM dose of SEQ ID NO: 1859 (CAGAAGCATCACCATCACCACCA with no spacers) rescued full length KCNQ2 mRNA to -4.822%. Comparatively, a 200nM dose of SEQ ID NO: 2835 (CAGAAGCSTCACCATSACCACCA with two spacers) rescued full length KCNQ2 mRNA to -4.361%. A 500 nM dose of SEQ ID NO: 2835 (CAGAAGCSTCACCATSACCACCA with two spacers) rescued full length KCNQ2 mRNA to 31.426%. This indicates that the addition of spacers of SEQ ID NO: 2835 improves the performance in comparison to the KCNQ2 AON counterpart without spacers (e.g., SEQ ID NO: 1859). [00422] Additionally shown in Table 7, a 200 nM dose of SEQ ID NO: 1861 (ACCAGAAGCATCACCATCACCAC with no spacers) rescued full length KCNQ2 mRNA to - 1.253%. A 500 nM dose of SEQ ID NO: 1861 (ACCAGAAGCATCACCATCACCAC with no spacers) rescued full length KCNQ2 mRNA to -4.846%. Comparatively, a 200nM dose of SEQ ID NO: 2836 (ACCAGAASCATCACCSTCACCAC with two spacers) rescued full length KCNQ2 mRNA to 11.898%. A 500 nM dose of SEQ ID NO: 2836 (ACCAGAASCATCACCSTCACCAC with two spacers) rescued full length KCNQ2 mRNA to 27.103%. This indicates that the addition of spacers of SEQ ID NO: 2836 improves the performance in comparison to the KCNQ2 AON counterpart without spacers (e.g., SEQ ID NO: 1861). [00423] Additionally shown in Table 7, a 200 nM dose of SEQ ID NO: 1860 (CCAGAAGCATCACCATCACCACC with no spacers) rescued full length KCNQ2 mRNA to 0.349%. A 500 nM dose of SEQ ID NO: 1860 (CCAGAAGCATCACCATCACCACC with no spacers) rescued full length KCNQ2 mRNA to -2.195%. Comparatively, a 200nM dose of SEQ ID NO: 2837 (CCAGAAGSATCACCASCACCACC with two spacers) rescued full length KCNQ2 mRNA to 12.326%. A 500 nM dose of SEQ ID NO: 2837 (CCAGAAGSATCACCASCACCACC with two spacers) rescued full length KCNQ2 mRNA to 18.047%. This indicates that the addition of spacers of SEQ ID NO: 2836 improves the performance in comparison to the KCNQ2 AON counterpart without spacers (e.g., SEQ ID NO: 1861). [00424] Additionally shown in Table 7, a 200 nM dose of SEQ ID NO: 1816 (TCAACACCATGACCACCATCACC with no spacers) rescued full length KCNQ2 mRNA to - 5.7868%. A 500 nM dose of SEQ ID NO: 1816 (TCAACACCATGACCACCATCACC with no spacers) rescued full length KCNQ2 mRNA to -0.189%. Comparatively, a 200nM dose of SEQ ID NO: 2833 (TCAACACSATGACCASCATCACC with two spacers) rescued full length KCNQ2 mRNA to 9.940%. A 500 nM dose of SEQ ID NO: 2833 (TCAACACSATGACCASCATCACC with two spacers) rescued full length KCNQ2 mRNA to 13.392%. This indicates that the addition of spacers of SEQ ID NO: 2836 improves the performance in comparison to the KCNQ2 AON counterpart without spacers (e.g., SEQ ID NO: 1816). [00425] Additionally shown in Table 7, a 200 nM dose of SEQ ID NO: 1815 (CAACACCATGACCACCATCACCA with no spacers) rescued full length KCNQ2 mRNA to - 5.760%. A 500 nM dose of SEQ ID NO: 1815 (CAACACCATGACCACCATCACCA with no spacers) rescued full length KCNQ2 mRNA to 2.607%. Comparatively, a 200nM dose of SEQ ID NO: 2834 (CAACACCSTGACCACSATCACCA with two spacers) rescued full length KCNQ2 mRNA to -3.772%. A 500 nM dose of SEQ ID NO: 2834 (CAACACCSTGACCACSATCACCA with two spacers) rescued full length KCNQ2 mRNA to 29.909%. This indicates that the addition of spacers of SEQ ID NO: 2836 improves the performance in comparison to the KCNQ2 AON counterpart without spacers (e.g., SEQ ID NO: 1816). [00426] Additionally shown in Table 8, a 200 nM dose of SEQ ID NO: 1467 (CTGACTCCATCCCTCCACCCAGGwith no spacers) rescued full length KCNQ2 mRNA to - 3.1968%. A 500 nM dose of SEQ ID NO: 1467 (CTGACTCCATCCCTCCACCCAGG with no spacers) rescued full length KCNQ2 mRNA to -2.600%. Comparatively, a 200nM dose of SEQ ID NO: 2805 (CTGACTCSATCCCTCSACCCAGG with two spacers) rescued full length KCNQ2 mRNA to 0.28284%. A 500 nM dose of SEQ ID NO: 2805 (CTGACTCSATCCCTCSACCCAGG with two spacers) rescued full length KCNQ2 mRNA to 10.232%. This indicates that the addition of spacers of SEQ ID NO: 2836 improves the performance in comparison to the KCNQ2 AON counterpart without spacers (e.g., SEQ ID NO: 1467). [00427] Altogether, these results demonstrate that different KCNQ2 AONs including two spacers are capable of increasing KCNQ2-FL to levels that are close or comparable to their non-spacer counterparts.
Table 7, Performance of KCNQ2 AONs
Figure imgf000217_0001
Figure imgf000218_0001
Figure imgf000219_0001
Figure imgf000220_0001
* Unless otherwise noted, each of the nucleosides of antisense oligonucleotides shown are modified nucleosides with 2’-O-(2-methoxyethyl) (2’- MOE) sugar moieties, each “C” is replaced with a 5 -methylcytosine (5-MeC), and all intemucleoside linkages are phosphorothioate linkages. A spacer as indicated by S is not a nucleoside. S represents a spacer of Formula (lia’) as disclosed herein.
Table 8. Performance of additional KCNQ2 AONs
Figure imgf000220_0002
Figure imgf000221_0001
Figure imgf000222_0001
* Unless otherwise noted, each of the nucleosides of antisense oligonucleotides shown are modified nucleosides with 2’-O-(2-methoxy ethyl) (2’- MOE) sugar moieties, each “C” is replaced with a 5 -methylcytosine (5-MeC), and all intemucleoside linkages are phosphorothioate linkages. A spacer as indicated by S is not a nucleoside. S represents a spacer of Formula (lia’) as disclosed herein.
Example 3: Additional Methods for Evaluating KCNQ2 Antisense Oligonucleotides [00428] KCNQ2 antisense oligonucleotides were evaluated in iPSC derived human motor neurons (hMN). The cells were seeded in 96-well plates at a density of 40,000 cells/ well. Antisense oligonucleotide (AON) to TDP43 was transfected with Endoporter (Gene Tools, Philomath, OR, USA) to increase expression of exon 5 containing KCNQ2 transcript. Vehicle control consisted of motor neuron treatment with Endoporter alone. Positive controls included cells that were treated with TDP43 AON alone (“AON TDP43” or “TDP43 AON”). [00429] TDP43 AON is a gapmer oligonucleotide and has the following sequence and chemistry: 5’ A*A*G*G*C*T*T*C*A*T*A*T*T*G*T*A*C*T*T*T 3’ where * = phosphorothioate, underlined = DNA, other=2’MOE RNA; each “C” is 5-MeC. [00430] To evaluate KCNQ2 AON ability to restore Exon 5 inclusion in the presence of TDP-43 knockdown, antisense oligonucleotides to KCNQ2 were co-incubated with TDP43 AON in Endoporter in media before addition to the cells. After 72 hours, antisense oligonucleotides and Endoporter were washed out and replaced with fresh media. After 72 additional hours fresh media was replaced, and after 72 hours RNA was collected from the 96-well plates for RT-qPCR. RNA was isolated, cDNA generated, and multiplexed RT- qPCR assay performed with TaqMan probes for KCNQ2 exon 5 inclusion in the transcript and reference GAPDH quantification. [00431] Transcript levels (e.g., KCNQ2 exon 5 containing transcript or TDP43 transcript) were detected by RT-qPCR using Taqman. Specifically, RT-qPCR was performed for detecting GAPDH using Thermofisher TaqMan Gene Expression Assay Hs03929097_g1. RT-qPCR was performed for detecting KCNQ2 exon 5 containing transcripts using custom Thermofisher TaqMan targeting exon junction 5/6. Exon 5/6 Primers: Forward: 5’ GGGAGAACGACCACTTTGA 3’ Reverse: 3’ GAAGAAGGAGACACCGATGAG 3’ Probe: 5’ TAGCCAATGGTGGTCAGCGTGATC 3’ [00432] RT-qPCR was also performed for detecting KCNQ2 exon 5 containing transcripts using custom Thermofisher TaqMan targeting exon junction 4/5. Exon 4/5 Primers: Forward: 5’ GGATGATCCGCATGGAC 3’ (SEQ ID NO: 2856) Reverse: 3’ CCTTCTCTGCCAAGTACAC 3’ (SEQ ID NO: 2857) Probe: 5’ AGGCCAGGATGAGACAAAGGAAGC 3’(SEQ ID NO:
2858)
[00433] RT-qPCR was performed on Applied Biosystems ® 7500 Real-time PCR systems. One cycle of reverse transcription was performed at a temperature of 50°C for 5 min. One cycle of RT inactivation/initial denaturation was performed at a temperature of 95°C for 20 seconds. Forty five cycles of amplification were performed at a temperature of 95°C for 1 second followed by 60°C for 20 seconds.
[00434] KCNQ2 Exon 5 inclusion (Ct) was normalized to GAPDH (deltaCt). To visualize the quantitative changes (e.g, % increase of KCNQ2 Exon 5 inclusion), the normalized KCNQ2 Exon 5 inclusion signal was further normalized to the vehicle (treated with Endoporter alone, deltadeltaCt). Relative quantity (RQ) of transcript level was calculated using the equation RQ=2'deltadeltaCt and is used to describe the treatment condition comparison to normal, healthy levels (1.0).
[00435] Rq values for KCNQ2 Exon Junctions 5/6 and 4/5 were normalized using the following formula:
((RQAON - RQTDP43)/(RQendo - RQTDP43)) * 100
[00436] Table 9 show the RT-qPCR results of KCNQ2 AONs with spacers and performance of KCNQ2 AONs without spacers in human motor neurons. KCNQ2 AONs (e.g, KCNQ2 oligonucleotides without spacers or with one or two spacers) were tested for their ability to increase or restore full-length KCNQ2 mRNA (i.e., mRNA from which full-length KCNQ2 is translated which include exon 5 in the transcript) levels. In some cases, KCNQ2 AONs with spacers increased full-length KCNQ2 mRNA (“KCNQ2 FL”). In some cases, KCNQ2 AONs without spacers increased full-length KCNQ2 mRNA (“KCNQ2 FL”). Specific AON sequences are labeled according to their corresponding SEQ ID NO.
Table 9 Performance of yet additional KCNQ2 AONs
Figure imgf000225_0001
Figure imgf000226_0001
Figure imgf000227_0001
Figure imgf000228_0001
Figure imgf000229_0001
MOE) sugar moieties, each “C” is replaced with a 5 -methylcytosine (5-MeC), and all intemucleoside linkages are phosphorothioate linkages. A spacer as indicated by S is not a nucleoside. S represents a spacer of Formula (lia’) as disclosed herein.
INCORPORATION BY REFERENCE [00437] The entire disclosure of each of the patent documents and scientific articles cited herein is incorporated by reference for all purposes. EQUIVALENTS [00438] The disclosure can be embodied in other specific forms without departing from the essential characteristics thereof. The foregoing embodiments therefore are to be considered illustrative rather than limiting on the disclosure described herein. The scope of the disclosure is indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.

Claims

WHAT IS CLAIMED IS: 1. A compound comprising a modified oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357-1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non- natural linkage.
2. The compound of claim 1, wherein the oligonucleotide comprises a spacer.
3. A compound comprising a modified oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357-1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non- natural linkage, and further wherein the oligonucleotide comprises a spacer.
4. An oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357-1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non-natural linkage.
5. The oligonucleotide of claim 3, wherein the oligonucleotide comprises a spacer.
6. An oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357-1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is a non-natural linkage, and further wherein the oligonucleotide comprises a spacer.
7. The compound of claim 1-3 or oligonucleotide of claim 4-6, wherein the oligonucleotide comprises a segment with at most 11 linked nucleosides.
8. The compound of claim 1-3 or 7, or oligonucleotide of claim 4 or 7, wherein the oligonucleotide comprises a segment with at most 10, 9, or 8 linked nucleosides.
9. The compound of any one of claims 1-3 or 7-8 or oligonucleotide of any one of claims 4-8, wherein the oligonucleotide comprises a segment with at most 7 linked nucleosides.
10. The compound of any one of claims 1-3 or 7-9 or oligonucleotide of any one of claims 4-9, wherein the oligonucleotide comprises a segment with at most 6, 5, 4, 3, or 2 linked nucleosides.
11. The compound of any one of claims 1-3 or 7-10 or oligonucleotide of any one of claims 4-10, wherein every segment of the oligonucleotide comprises at most 7 linked nucleosides.
12. The compound or oligonucleotide of any one of claims 7-11, wherein the oligonucleotide comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
13. The compound or oligonucleotide of any one of claims 7-12, wherein the oligonucleotide comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
14. The compound or oligonucleotide of any one of claims 7-13, wherein the oligonucleotide comprises a sequence that shares at least 95% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
15. The compound or oligonucleotide of any one of claims 7-13, wherein the oligonucleotide comprises a sequence that shares 100% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
16. The compound or oligonucleotide of any one of claims 1-6, wherein the oligonucleotide comprises a segment with at most 11 linked nucleosides or at most 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353- 854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
17. The compound or oligonucleotide of claim 16, wherein the oligonucleotide comprises a segment with at most 6, 5, 4, 3, or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence that shares at least 85% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
18. The compound or oligonucleotide of claim 16 or 17, wherein the oligonucleotide comprises a segment with at most 6, 5, 4, 3, or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence that shares at least 90% identity with an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
19. The compound of any one of claims 1-3 and 7-18 or oligonucleotide of any one of claims 4-18, wherein the oligonucleotide is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length.
20. The compound of claim 18 or oligonucleotide of claim 18, wherein the oligonucleotide is at least 19 oligonucleotide units in length.
21. The compound of any one of claims 1-3 and 7-20 or oligonucleotide of any one of claims 2-20, wherein the spacer is a nucleoside-replacement group comprising a non-sugar substitute that is incapable of linking to a nucleotide base.
22. The compound or oligonucleotide of claim 21, wherein the spacer is located between positions 10 and 15 of the oligonucleotide.
23. The compound or oligonucleotide of claim 21, wherein the spacer is located between positions 7 and 11 of the oligonucleotide.
24. The compound or oligonucleotide of claim 21 or 23, wherein the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 14 and 22 of the oligonucleotide.
25. The compound or oligonucleotide of claim 24, wherein the spacer and the second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases in the oligonucleotide.
26. The compound or oligonucleotide of claim 24 or 25, wherein the spacer is located between positions 7 and 9 of the oligonucleotide, and wherein the second spacer is located between positions 15 and 18 of the oligonucleotide.
27. The compound or oligonucleotide of any one of claims 24-26, wherein the spacer is located at position 8 of the oligonucleotide, and wherein the second spacer is located at position 16 of the oligonucleotide.
28. The compound or oligonucleotide of any one of claims 24-27, wherein the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 21 and 24 of the oligonucleotide.
29. The compound or oligonucleotide of claim 21, wherein the spacer is located between positions 2 and 5 of the oligonucleotide.
30. The compound or oligonucleotide of claim 29, wherein the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 8 and 12 of the oligonucleotide.
31. The compound or oligonucleotide of claim 30, wherein the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 18 and 22 of the oligonucleotide.
32. The compound or oligonucleotide of claim 21, wherein the oligonucleotide further comprises a second spacer and a third spacer, wherein the three spacers are located at positions in the oligonucleotide such that each segment of the oligonucleotide has at most 7 linked nucleosides.
33. The compound or oligonucleotide of claim 32, wherein at least two of the three spacers are adjacent to a guanine nucleobase.
34. The compound or oligonucleotide of claim 33, wherein each of the at least two of the three spacers immediately precede a guanine nucleobase.
35. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is a nucleoside-replacement group comprising a non-sugar substitute wherein the non-sugar substitute does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal or hemiaminal moiety and is incapable of forming a covalent bond with a nucleotide base.
36. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula (X), wherein:
Figure imgf000235_0001
Formula (X) Ring A s an optionally substituted 4-8 member monocyclic cycloalkyl group or a 4-8 member monocyclic heterocyclyl group, wherein the heterocyclyl group contains 1 or 2 heteroatoms selected from O, S and N, provided that A is not capable of forming a covalent bond to a nucleobase; and the symbol represents the point of connection to an internucleoside linkage.
37. The compound or oligonucleotide of claim 36, wherein each of the first, second or third spacers is independently represented by Formula (Xa), wherein:
Figure imgf000235_0002
Formula (Xa).
38. The compound or nucleotide of claim 36 or 37, wherein ring A is an optionally substituted 4-8 member monocyclic cycloalkyl group selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; or a 4-8 member monocyclic heterocyclyl group, selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl.
39. The compound or nucleotide of claim 38 wherein ring A is tetrahydrofuranyl.
40. The compound or nucleotide of claim 38 wherein ring A is tetrahydropyranyl.
41. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula I, wherein: Formula (I)
Figure imgf000236_0001
X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.
42. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula I’, wherein: Formula (I’)
Figure imgf000236_0002
X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.
43. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula (Ia), wherein: Formula (Ia); and
Figure imgf000236_0003
n is 0, 1, 2 or 3.
44. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula (Ia’), wherein: Formula (Ia’); and
Figure imgf000237_0001
n is 0, 1, 2 or 3.
45. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula II, wherein: Formula (II); and
Figure imgf000237_0002
X is selected from -CH2- and -O-.
46. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula II’, wherein: Formula (II’); and
Figure imgf000237_0003
X is selected from -CH2- and -O-.
47. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula (Iia), wherein: Formula (Iia).
Figure imgf000238_0001
48. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula (Iia’), wherein: Formula (Iia’).
Figure imgf000238_0002
49. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula III, wherein: Formula (III); and
Figure imgf000238_0003
X is selected from -CH2- and -O-.
50. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula (IIi), wherein: Formula (IIi)
Figure imgf000238_0004
X is selected from -CH2- and -O-.
51. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula (IIi’), wherein: Formula (IIi’)
Figure imgf000239_0001
X is selected from -CH2- and -O-.
52. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula (IIib), wherein: Formula (IIib).
Figure imgf000239_0002
53. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula (IIib’), wherein: Formula (IIib’).
Figure imgf000239_0003
54. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula III’, wherein: Formula (III’); and
Figure imgf000239_0004
X is selected from -CH2- and -O-.
55. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula (IIIa), wherein: Formula (IIIa).
Figure imgf000240_0001
56. The compound or oligonucleotide of any one of claims 21-34, wherein each of the first, second or third spacers is independently represented by Formula (IIIa’), wherein: Formula (IIIa’).
Figure imgf000240_0002
57. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide further comprises a locked nucleic acid (LNA).
58. The compound or oligonucleotide of claim 57, wherein the locked nucleic acid (LNA) is located at one of positions 4, 7, 9, 12, 15, or 20 of the oligonucleotide.
59. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 10%.
60. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 20%.
61. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 25%.
62. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 30%.
63. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 40%.
64. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 50%.
65. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide is between 12 and 40 oligonucleotide units in length.
66. The compound or oligonucleotide of any one of the above claims, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage.
67. The compound or oligonucleotide of any one of claims 1-66, wherein one or more nucleoside linkages that link a base at position 3 or position 4 of the oligonucleotide are phosphodiester linkages.
68. The compound or oligonucleotide of claim 67, wherein only one nucleoside linkage that links a base at position 3 or position 4 of the oligonucleotide is a phosphodiester linkage.
69. The compound or oligonucleotide of any one of claims 1-66, wherein nucleoside linkages that link bases at both position 3 and position 4 of the oligonucleotide are phosphodiester linkages.
70. The compound or oligonucleotide of any one of claims 1-66, wherein one or more bases immediately preceding a spacer in the oligonucleotide are linked through phosphodiester bonds.
71. The compound or oligonucleotide of claim 70, wherein only the base immediately preceding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond.
72. The compound or oligonucleotide of claim 71, wherein the base immediately preceding the spacer in the oligonucleotide is further linked to a further preceding base through a phosphodiester bond.
73. The compound or oligonucleotide of claim 71, wherein the oligonucleotide comprises a second spacer, wherein a base immediately preceding the second spacer is linked to a further preceding base through a phosphodiester bond.
74. The compound or oligonucleotide of any one of claims 1-66, wherein one or more bases immediately succeeding a spacer in the oligonucleotide are linked through phosphodiester bonds.
75. The compound or oligonucleotide of claim 74, wherein only the base immediately succeeding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond.
76. The compound or oligonucleotide of claim 70, wherein two bases immediately preceding the spacer in the oligonucleotide are linked through phosphodiester bonds.
77. The compound or oligonucleotide of any one of claims 1-66, wherein one or more bases immediately preceding a spacer in the oligonucleotide are linked through phosphodiester bonds and wherein one or more bases immediately succeeding the spacer in the oligonucleotide are linked through phosphodiester bonds.
78. The compound or oligonucleotide of claim 77, wherein one base immediately preceding the spacer and one base immediately succeeding the spacer are linked through phosphodiester bonds.
79. The compound or oligonucleotide of claim 77 or 78, wherein the oligonucleotide includes a second spacer, and wherein one or more bases immediately preceding the second spacer in the oligonucleotide are linked through phosphodiester bonds and wherein one or more bases immediately succeeding the second spacer in the oligonucleotide are linked through phosphodiester bonds.
80. The compound or oligonucleotide of claim 79, wherein one base immediately preceding the second spacer and one base immediately succeeding the second spacer are linked through phosphodiester bonds.
81. The compound or oligonucleotide of any one of claims 1-66, wherein the oligonucleotide comprises a range of bases that are linked through phosphodiester bonds, the range of bases comprising at least two bases.
82. The compound or oligonucleotide of any one of claims 1-66, wherein the oligonucleotide comprises a range of bases that are linked through phosphodiester bonds, the range of bases comprising at least five bases.
83. The compound or oligonucleotide of claim 81 or 82, wherein the oligonucleotide comprises two or more spacers, and wherein the range of bases are positioned between the at least two spacers.
84. A compound comprising an oligonucleotide comprising a nucleobase sequence that shares at least 90% identity to an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
85. An oligonucleotide comprising a nucleobase sequence that shares at least 90% identity to an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
86. The compound of claim 84 or the oligonucleotide of claim 84 or 85, wherein the nucleobase sequence shares at least 95% identity to an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723- 2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
87. The compound of claim 84 or the oligonucleotide of claim 84 or 85, wherein the nucleobase sequence shares at least 100% identity to an equal length portion of any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723- 2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5.
88. The compound or oligonucleotide of any of claims 67-87, wherein the oligonucleotide is any one of a 19mer, 21mer, 23mer, or 25mer.
89. The compound or oligonucleotide of any one of the above claims, wherein one or more internucleoside linkage of the oligonucleotide is a modified internucleoside linkage.
90. The compound or oligonucleotide of claim 89, wherein the modified internucleoside linkage of the oligonucleotide is a phosphorothioate linkage.
91. The compound or oligonucleotide of claim 89 or 90, wherein all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.
92. The compound or oligonucleotide of claim 90, wherein the phosphorothioate linkage is in one of a Rp configuration or a Sp configuration.
93. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises at least one modified sugar moiety.
94. The compound or oligonucleotide of claim 93, wherein the modified sugar moiety is one of a 2'-OMe modified sugar moiety, bicyclic sugar moiety, 2’-O-(2-methoxyethyl) (2’- MOE), 2'-deoxy-2'-fluoro nucleoside, 2’-fluoro-β-D-arabinonucleoside, locked nucleic acid (LNA), constrained ethyl 2’-4’-bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol nucleic acids (HNA), and tricyclic analog (e.g., tcDNA).
95. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide exhibits at least a 30%, 40%, 50%, 60%, 70%, 80%, or 90% increase of full length KCNQ2 protein.
96. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide exhibits at least a 100% increase of full length KCNQ2 protein.
97. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide exhibits at least a 200% increase of full length KCNQ2 protein.
98. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide exhibits at least a 300% increase of full length KCNQ2 protein.
99. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide exhibits at least a 400% increase of full length KCNQ2 protein.
100. The compound or oligonucleotide of any one of claims 95-99, wherein increase of the full length KCNQ2 protein is measured in comparison to a reduced level of full length KCNQ2 protein achieved using a TDP43 antisense oligonucleotide.
101. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide exhibits at least a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% rescue of full length KCNQ2 protein.
102. The compound or oligonucleotide of any one of the above claims, wherein the oligonucleotide exhibits at least a 50%, 60%, 70%, 80%, or 90% reduction of a mis-spliced KCNQ2 transcript.
103. A method of treating a neurological disease and/or a neuropathy in a patient in need thereof, the method comprising administering to the patient a compound or an oligonucleotide of any one of claims 1-102.
104. The method of claim 103, wherein the neurological disease selected from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington’s disease, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injuries (e.g., brachial plexus injuries), neuropathies (e.g., chemotherapy induced neuropathy), and TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, Perry Syndrome, Dementia with Lewy body in association with Alzheimer’s disease, Parkinson’s disease with or without dementia, Limbic-predominant age-related TDP-43 encephalopathy (LATE)), Cerebral Age-Related TDP-43 With Sclerosis (CARTS), facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, CTE, epilepsy/seizure disorders, and synaptic diseases like autism.
105. The method of claim 104, wherein the neurological disease is ALS.
106. The method of claim 104, wherein the neurological disease is FTD.
107. The method of claim 104, wherein the neurological disease is ALS with FTD.
108. The method of claim 104, wherein the neurological disease is AD.
109. The method of claim 104, wherein the neurological disease is PD.
110. The method of claim 103, wherein the neuropathy is chemotherapy induced neuropathy.
111. A method of restoring axonal outgrowth and/or regeneration of a neuron, the method comprising exposing the neuron to a compound or an oligonucleotide of any one of claims 1- 102.
112. A method of increasing, promoting, stabilizing, or maintaining KCNQ2 expression and/or function in a neuron, the method comprising exposing the cell to a compound or an oligonucleotide of any one of claims 1-102.
113. The method of claim 111 or 112, wherein the neuron is a motor neuron.
114. The method of claim 111 or 112, wherein the neuron is a spinal cord neuron.
115. The method of any one of claims 111-114, wherein the neuron is a neuron of a patient in need of treatment of a neurological disease and/or a neuropathy.
116. The method of claim 115, wherein the neuropathy is chemotherapy induced neuropathy.
117. The method of any one of claims 111-116, wherein the exposing is performed in vivo or ex vivo.
118. The method of any one of claims 111-116, wherein the exposing comprises administering the oligonucleotide to a patient in need thereof.
119. The method of any one of claims 111-118, wherein the oligonucleotide is administered topically, parenterally, intrathecally, intrathalamically, intracisternally, orally, rectally, buccally, sublingually, vaginally, pulmonarily, intratracheally, intranasally, transdermally, intraduodenally, or intracerebroventricularly.
120. The method of claim 119, wherein the oligonucleotide is administered orally.
121. The method of any one of claims 111-119, wherein a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamically or intracisternally.
122. The method of any one of claims 111-121, wherein the patient is a human.
123. A pharmaceutical composition comprising the oligonucleotide of any one of claims 1- 102, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.
124. The pharmaceutical composition of claim 123, wherein the pharmaceutical composition is suitable for topical, intrathecal, intrathalamic, intracisternal, intracerebroventricular, parenteral, oral, pulmonary, intratracheal, intranasal, transdermal, rectal, buccal, sublingual, vaginal, or intraduodenal administration.
125. A method of treating a neurological disease or a neuropathy in a patient in need thereof, the method comprising administering to a patient in need thereof a therapeutically effective amount of a pharmaceutical composition of claim 123 or 124.
126. The method of claim 125, wherein the neurological disease is selected from from the group consisting of amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, Alzheimer’s disease (AD), Parkinson’s disease (PD), Parkinson’s Disease with dementia, dementia with lewy bodies, synucleinopathies, Huntington’s disease, Brachial plexus injuries, peripheral nerve injuries, progressive supranuclear palsy (PSP), brain trauma, spinal cord injury, tuberous sclerosis complex, Pick’s Disease, tauopathies, primary age- related tauopathy, Down Syndrome, epilepsy/seizure disorder, depression, traumatic brain injury (TBI), chronic traumatic encephalopathy (CTE), HIV-associated neurocognitive disorders (HAND), multisystem atrophy, amnestic mild cognitive impairment, corticobasal degeneration (CBD) and/or neuropathies such a chemotherapy induced neuropathy, Spinocerebellar ataxia (SCA), SCA type 2, Spinal Muscular Atrophy (SMA), Parkinsonism, Niemann-Pick disease type C (NPC), Charcot-Marie-Tooth Disease (CMT), Mucopolysaccharidosis type II (MPSIIA), Mucolipidosis IV, GM1 gangliosidosis, Sporadic inclusion body myositis (sIBM), Henoch-Schonlein purpura (HSP), Limbic-predominant age- related TDP-43 encephalopathy (LATE)), Cerebral Age-Related TDP-43 With Sclerosis (CARTS), Gaucher’s disease, and facial onset sensory and motor neuronopathy, Guam Parkinson-dementia complex, multisystem proteinopathy, Perry disease, and synaptic diseases like autism.
127. The method of claim 126, wherein the neurological disease is ALS.
128. The method of claim 126, wherein the neurological disease is FTD.
129. The method of claim 126, wherein the neurological disease is ALS with FTD.
130. The method of claim 124, wherein the neurological disease is AD.
131. The method of claim 124, wherein the neurological disease is PD.
132. The method of claim 125, wherein the neuropathy is chemotherapy induced neuropathy.
133. The method of any one of claims 125-132, wherein the pharmaceutical composition is administered topically, parenterally, orally, pulmonarily, rectally, buccally, sublingually, vaginally, intratracheally, intranasally, intracisternally, intrathecally, intrathalamically, transdermally, intraduodenally, or intracerebroventricularly.
134. The method of any one of claims 125-132, wherein the pharmaceutical composition is administered intrathecally, intrathalamically, or intracisternally.
135. The method of any one of claims 125-134, wherein a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamically or intracisternally.
136. The method of any one of claims 125-135, wherein the patient is human.
137. A method for treating a neurological disease in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2'-O-(2-methoxyethyl) nucleoside, a 2'-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2'-deoxy-2'-fluoro nucleoside, a 2’- fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA) optionally, wherein the oligonucleotide further comprises a spacer.
138. A method for treating amyotrophic lateral sclerosis (ALS) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2'-O-(2-methoxyethyl) nucleoside, a 2'-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2'-deoxy-2'-fluoro nucleoside, a 2’- fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA) optionally, wherein the oligonucleotide further comprises a spacer.
139. A method for treating frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2'-O-(2-methoxyethyl) nucleoside, a 2'-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2'-deoxy-2'-fluoro nucleoside, a 2’- fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA) optionally, wherein the oligonucleotide further comprises a spacer.
140. A method for treating amyotrophic lateral sclerosis (ALS) with frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2'-O-(2-methoxyethyl) nucleoside, a 2'-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2'-deoxy-2'-fluoro nucleoside, a 2’- fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA) optionally, wherein the oligonucleotide further comprises a spacer.
141. A method for treating Alzheimer’s Disease (AD) with frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment with at most 7 linked nucleosides, and wherein oligonucleotide shares at least 85% identity with any one of SEQ ID NOs: 1-176, SEQ ID NOs: 353-854, SEQ ID NOs: 1371-1546, SEQ ID NOs: 1723-2224, SEQ ID NOs: 2794-2855 and the sequences in Tables 3A, 3B, 4 and 5, or a pharmaceutically acceptable salt thereof; wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: a phosphodiester linkage, a phosphorothioate linkage, an alkyl phosphate linkage, a phosphorodithioate linkage, a phosphotriester linkage, an alkylphosphonate linkage, a 3-methoxypropyl phosphonate linkage, a methylphosphonate linkage, an aminoalkylphosphotriester linkage, an alkylene phosphonate linkage, a phosphinate linkage, a phosphoramidate linkage, a phosphoramidothioate linkage, a thiophosphorodiamidate linkage, a phosphorodiamidate linkage, an aminoalkylphosphoramidate linkage, a thiophosphoramidate linkage, a thionoalkylphosphonate linkage, a thionoalkylphosphotriester linkage, a thiophosphate linkage, a selenophosphate linkage, and a boranophosphate linkage, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of a 2'-O-(2-methoxyethyl) nucleoside, a 2'-O-methyl nucleoside, a 2’-O-(N-methylacetamide) nucleoside, a 2'-deoxy-2'-fluoro nucleoside, a 2’- fluoro-β-D-arabinonucleoside, a locked nucleic acid (LNA), a tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET), and a peptide nucleic acid (PNA), optionally, wherein the oligonucleotide further comprises a spacer
142. The method of any one of claims 137-140, wherein nucleoside linkages that link a base at position 3 or position 4 of the oligonucleotide are phosphodiester linkages.
143. The method of claim 141, wherein only one nucleoside linkage that links a base at position 3 or position 4 of the oligonucleotide is a phosphodiester linkage.
144. The method of any one of claims 137-140, wherein nucleoside linkages that link bases at both position 3 and position 4 of the oligonucleotide are phosphodiester linkages.
145. The method of any one of claims 137-140, wherein one or more bases immediately preceding a spacer in the oligonucleotide are linked through phosphodiester bonds.
146. The method of claim 145, wherein only the base immediately preceding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond.
147. The method of claim 146, wherein the base immediately preceding the spacer in the oligonucleotide is further linked to a further preceding base through a phosphodiester bond.
148. The method of claim 146, wherein the oligonucleotide comprises a second spacer, wherein a base immediately preceding the second spacer is linked to a further preceding base through a phosphodiester bond.
149. The method of any one of claims 137-140, wherein one or more bases immediately succeeding a spacer in the oligonucleotide are linked through phosphodiester bonds.
150. The method of claim 149, wherein only the base immediately succeeding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester bond.
151. The method of any one of claims 137-140, wherein two bases immediately preceding the spacer in the oligonucleotide are linked through phosphodiester bonds.
152. The method of any one of claims 137-140, wherein one or more bases immediately preceding a spacer in the oligonucleotide are linked through phosphodiester bonds and wherein one or more bases immediately succeeding the spacer in the oligonucleotide are linked through phosphodiester bonds.
153. The method of claim 152, wherein one base immediately preceding the spacer and one base immediately succeeding the spacer are linked through phosphodiester bonds.
154. The method of claim 152 or 153, wherein the oligonucleotide includes a second spacer, and wherein one or more bases immediately preceding the second spacer in the oligonucleotide are linked through phosphodiester bonds and wherein one or more bases immediately succeeding the second spacer in the oligonucleotide are linked through phosphodiester bonds.
155. The compound or oligonucleotide of claim 154, wherein one base immediately preceding the second spacer and one base immediately succeeding the second spacer are linked through phosphodiester bonds.
156. The method of any one of claims 137-140, wherein the oligonucleotide comprises a range of bases that are linked through phosphodiester bonds, the range of bases comprising at least two bases.
157. The method of any one of claims 137-140, wherein the oligonucleotide comprises a range of bases that are linked through phosphodiester bonds, the range of bases comprising at least five bases.
158. The method of claim 156 or 157, wherein the oligonucleotide comprises two or more spacers, and wherein the range of bases are positioned between the at least two spacers.
159. The method of any of claims 141-158, wherein the oligonucleotide is any one of a 19mer, 21mer, 23mer, or 25mer.
160. The method of any one of claims 137-140, wherein at least one (i.e., one or more) internucleoside linkage of the oligonucleotide is a phosphorothioate linkage.
161. The method of any one of claims 137-140, wherein all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.
162. An oligonucleotide and a pharmaceutically acceptable excipient, the oligonucleotide comprising a sequence that is at least 85% complementary to an equal length portion of any one of SEQ ID NO: 1357-1370, a sequence having 90% identity thereof, or to a 15 to 50 contiguous nucleobase portion thereof, optionally wherein the oligonucleotide comprises a spacer and wherein the oligonucleotide is capable of increasing, restoring, or stabilizing expression of the KCNQ2 mRNA capable of translation of a functional KCNQ2 and/or activity and/or function of KCNQ2 protein in a cell or a human patient of an immune- mediated demyelinating disease, and wherein the level of increase, restoration, or stabilization of expression and/or activity and/or function is sufficient for use of the oligonucleotide as a medicament for the treatment of the immune-mediated demyelinating disease.
163. The method of any one of claims 103-122 or 125-161, the pharmaceutical composition of claim 123 or 124, or the oligonucleotide of any one of claims 1-102 or 162, wherein the oligonucleotide comprises one or more chiral centers and/or double bonds.
164. The method of any one of claims 103-122, 125-161, or 163, the pharmaceutical composition of claim 123, 124, or 163, or the oligonucleotide of any one of claims 1-102 or 162-163, wherein the oligonucleotide exist as stereoisomers selected from geometric isomers, enantiomers, and diastereomers.
165. A method of treating a neurological disease and/or a neuropathy in a patient in need thereof, the method comprising administering to a patient in need thereof a therapeutically effective amount of a pharmaceutical composition of claim 123 or 124, in combination with a second therapeutic agent.
166. The method of claim 165, wherein the second therapeutic agent is selected from Riluzole (Rilutek), PrimeC, Edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitor, antipsychotic agents, cholinesterase inhibitors, memantine, benzodiazepine antianxiety drugs, AMX0035 (ELYBRIO), ZILUCOPLAN (RA101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078, and BIIB105), BIIB100, levodopa/carbidopa, dopaminergic agents (e.g., ropinirole, pramipexole, rotigotine), medroxyprogesetrone, KCNQ2/KCNQ3 openers (e.g., retigabine, XEN1101, or QRL-101), anticonvulsants and psychostimulant agents, deep brain stimulation, istradefylline (nourianz), safinamide (xadago), amantadine (gocovri, Symmetrel, osmolex), benztropine (Cogentin), trihexyphenidyl (artane), selegiline (eldepryl, zelapar), rasagiline, entacapone (comtan), opicapone (ongentys), tolcapone (tasmar), apomorphine (apokyn, kynmobi), exenatide, lingzhi, BIIB054, BIIB094, Caffeine, sarizotan, embryonic dopamine cell implantation, aducanamab (Aduhlem), Namzeric, Suvorexant (belsomra), lecanemab, olanzapine (Zyprexa), quetiapine (Seroquel), SSRIs (citalopram (Cipramil), dapoxetine (Priligy), escitalopram (Cipralex), fluoxetine (Prozac or Oxactin), fluvoxamine (Faverin), paroxetine (Seroxat), sertraline (Lustral), vortioxetine (Brintellix)),, nusinersen (spinraza), onasemnogene abeparvovec-xioi (zolgensma), risdiplam (evrysdi), Brivaracetam (briviact), cannabidiol (epidiolex), carbamazepine (carbatrol, Tegretol), cenobamate (xcopri), diazepam (valium), lorazepam (Ativan), clonazepam (klonopin), eslicarbazepine (aptiom), ethosuximide (zarontin), felbamate (felbatol), fenfluramine (fintepla), lacosamide (VIMPAT), lamotrigine (Lamictal), levetiracetam (Keppra), oxcarbazepine (oxtellar xr, Trileptal), perampanel (fycompa), phenobarbital, phenytoin (dilantin), pregabalin (lyrica), tiagabine (gabitril), topiramate (topamax), valproate (depakene, depakote), zonisamide (zonegran), bioactive scaffolds, such as bioactive scaffolds with enhanced supramolecular motion, and/or a therapy (e.g., selected from breathing care, physical therapy, occupational therapy, speech therapy, nutritional support), for treating said neurologic disease.
167. A method of treating a neurological disease and/or a neuropathy in a patient in need thereof, the method comprising administering to a patient in need thereof a therapeutically effective amount of a pharmaceutical composition of claim 123 or 124, wherein at least one nucleoside linkage of the oligonucleotide is a non-natural linkage, optionally wherein the oligonucleotide comprises a spacer, and wherein the oligonucleotide further comprises a targeting or conjugate moiety selected from cholesterol, lipoic acid, panthothenic acid, polyethylene glycol, and an antibody for crossing the blood brain barrier.
168. The method of any one of claims 103-122, 125-161, or 163-167, wherein the spacer is a nucleoside-replacement group comprising a non-sugar substitute that is incapable of linking to a nucleotide base.
169. The method of claim 168, wherein the spacer is located between positions 10 and 15 of the oligonucleotide.
170. The method of claim 168, wherein the spacer is located between positions 7 and 11 of the oligonucleotide.
171. The method of claim 168 or 170, wherein the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 14 and 22 of the oligonucleotide.
172. The method of claim 171, wherein the spacer and the second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases in the oligonucleotide.
173. The method of claim 171 or 172, wherein the spacer is located between positions 7 and 9 of the oligonucleotide, and wherein the second spacer is located between positions 15 and 18 of the oligonucleotide.
174. The method of any one of claims 171-173, wherein the spacer is located at position 8 of the oligonucleotide, and wherein the second spacer is located at position 16 of the oligonucleotide.
175. The method of any one of claims 171 -174, wherein the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 21 and 24 of the oligonucleotide.
176. The method of claim 168, wherein the spacer is located between positions 2 and 5 of the oligonucleotide.
177. The method of claim 176, wherein the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 8 and 12 of the oligonucleotide.
178. The method of claim 177, wherein the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 18 and 22 of the oligonucleotide.
179. The method of claim 168, wherein the oligonucleotide further comprises a second spacer and a third spacer, wherein the three spacers are located at positions in the oligonucleotide such that each segment of the oligonucleotide has at most 7 linked nucleosides.
180. The method of claim 179, wherein at least two of the three spacers are adjacent to a guanine nucleobase.
181. The method of claim 180, wherein each of the at least two of the three spacers immediately precede a guanine nucleobase.
182. The method of any one of claims 168-181, wherein each of the first, second or third spacers is a nucleoside-replacement group comprising a non-sugar substitute wherein the non-sugar substitute does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal or hemiaminal moiety and is incapable of forming a covalent bond with a nucleotide base.
183. The method of any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula (X), wherein: Formula (X)
Figure imgf000257_0001
s an optionally substituted 4-8 member monocyclic cycloalkyl group or a 4-8 member monocyclic heterocyclyl group, wherein the heterocyclyl group contains 1 or 2 heteroatoms selected from O, S and N, provided that A is not capable of forming a covalent bond to a nucleobase; and the symbol represents the point of connection to an internucleoside linkage.
184 The method of claim 183, wherein each of the first, second or third spacers is independently represented by Formula (Xa), wherein: Formula (Xa).
Figure imgf000258_0001
185. The method of claim 183 or 184, wherein ring A is an optionally substituted 4-8 member monocyclic cycloalkyl group selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; or a 4-8 member monocyclic heterocyclyl group, selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl, pyrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl.
186. The method of claim 185, wherein ring A is tetrahydrofuranyl.
187. The method of claim 185, wherein ring A is tetrahydropyranyl.
188. The method of any one of claims 168-181 wherein each of the first, second or third spacers is independently represented by Formula (I), wherein: Formula (I)
Figure imgf000258_0002
X is selected from -CH2- and -O-; and n is 0, 1, 2 or 3.
189. The method of any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula (I’), wherein: Formula (I’).
Figure imgf000258_0003
190. The method of any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula (Ia), wherein: Formula (Ia).
Figure imgf000259_0001
191. The method of any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula (Ia’), wherein: Formula (Ia’).
Figure imgf000259_0002
192. The method of any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula II, wherein: Formula (II); and
Figure imgf000259_0003
X is selected from -CH2- and -O-.
193. The method of any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula II’, wherein: Formula (II’); and
Figure imgf000259_0004
X is selected from -CH2- and -O-.
194. The method of any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula (Iia), wherein: Formula (Iia).
Figure imgf000260_0001
195. The method of any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula (Iia’), wherein: Formula (Iia’).
Figure imgf000260_0002
196. The method of any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula (IIi’), wherein: Formula (IIi’)
Figure imgf000260_0003
X is selected from -CH2- and -O-. 197. The method of any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula (IIib), wherein: Formula (IIib).
Figure imgf000260_0004
198. The method of any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula (IIib’), wherein: Formula (IIib’).
Figure imgf000261_0001
199. The method of any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula III, wherein: Formula (III); and
Figure imgf000261_0002
X is selected from -CH2- and -O-. 200. The method of any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula III’, wherein: Formula (III’); and
Figure imgf000261_0003
X is selected from -CH2- and -O-. 201. The method of any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula (IIIa), wherein: a).
Figure imgf000261_0004
. e met o o any one of claims 168-181, wherein each of the first, second or third spacers is independently represented by Formula (IIIa’), wherein: Formula (IIIa’).
Figure imgf000262_0001
203. The method of any one of claims 168-202, wherein the oligonucleotide comprising the spacer has a GC content of at least 10%. 204. The method of any one of claims 168-203, wherein the oligonucleotide comprising the spacer has a GC content of at least 20%. 205. The method of any one of claims 168-204, wherein the oligonucleotide comprising the spacer has a GC content of at least 25%. 206. The method of any one of claims 168-205, wherein the oligonucleotide comprising the spacer has a GC content of at least 30%. 207. The method of any one of claims 168-206, wherein the oligonucleotide comprising the spacer has a GC content of at least 40%. 208. The method of any one of claims 168-207, wherein the oligonucleotide comprising the spacer has a GC content of at least 50%.
PCT/US2022/080853 2021-12-03 2022-12-02 Treatment of neurological diseases using modulators of kcnq2 gene transcripts WO2023102548A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163285628P 2021-12-03 2021-12-03
US63/285,628 2021-12-03

Publications (1)

Publication Number Publication Date
WO2023102548A1 true WO2023102548A1 (en) 2023-06-08

Family

ID=86613187

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/080853 WO2023102548A1 (en) 2021-12-03 2022-12-02 Treatment of neurological diseases using modulators of kcnq2 gene transcripts

Country Status (1)

Country Link
WO (1) WO2023102548A1 (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160193354A1 (en) * 2013-09-09 2016-07-07 University Of Vienna Antisense oligonucleotides with improved pharmacokinetic properties
WO2019084050A1 (en) * 2017-10-23 2019-05-02 Stoke Therapeutics, Inc. Antisense oligomers for treatment of non-sense mediated rna decay based conditions and diseases

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160193354A1 (en) * 2013-09-09 2016-07-07 University Of Vienna Antisense oligonucleotides with improved pharmacokinetic properties
WO2019084050A1 (en) * 2017-10-23 2019-05-02 Stoke Therapeutics, Inc. Antisense oligomers for treatment of non-sense mediated rna decay based conditions and diseases

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DALAKAS: "Pathogenesis of immune-mediated neuropathies", BIOCHIMICA ET BIOPHYSICA ACTA (BBA) - MOLECULAR BASIS OF DISEASE, vol. 1852, no. 4, April 2015 (2015-04-01), pages 658 - 666, XP029196742, DOI: 10.1016/j.bbadis.2014.06.013 *

Similar Documents

Publication Publication Date Title
US20220333105A1 (en) Oligonucleotides and methods of use for treating neurological diseases
TWI833770B (en) Compounds and methods for reducing lrrk2 expression
CN112423767B (en) Compounds and methods for reducing ATXN2 expression
CN112189053B (en) Compounds and methods for reducing ATXN3 expression
CN111373043B (en) Compounds and methods for reducing SNCA expression
WO2023102225A2 (en) Treatment of neurological diseases using modulators of unc13a gene transcripts
AU2022402929A1 (en) Splice switcher antisense oligonucleotides with modified backbone chemistries
IL313205A (en) Microbial consortia
US20230235332A1 (en) Treatment of neurological diseases using modulators of gene transcripts
US20220372489A1 (en) Ppm1a inhibitors and methods of using same
WO2023102548A1 (en) Treatment of neurological diseases using modulators of kcnq2 gene transcripts
US20230374519A1 (en) Compounds and methods for modulating pmp22
WO2023102227A2 (en) Treatment of neurological diseases using modulators of smn2 gene transcripts
IL313204A (en) Methods for the synthesis of complement factor d inhibitors
EP4441224A1 (en) Gapmer antisense oligonucleotides with modified backbone chemistries
CN116528878A (en) Treatment of neurological diseases using gene transcript modulators
WO2023122666A2 (en) Compounds and methods for modulating glycogen synthase 1

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22902433

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE