CN116528878A

CN116528878A - Treatment of neurological diseases using gene transcript modulators

Info

Publication number: CN116528878A
Application number: CN202180057917.3A
Authority: CN
Inventors: D·埃尔鲍姆; S·欣克利
Original assignee: Quelis Co
Current assignee: Quelis Co
Priority date: 2020-06-03
Filing date: 2021-06-03
Publication date: 2023-08-01

Abstract

STMN2 oligonucleotides having one or more spacers are disclosed herein. In various embodiments, the STMN2 oligonucleotide with a spacer reduces STMN2 transcripts with cryptic exons and increases full length STMN2 transcripts, thereby conferring therapeutic efficacy against neurological diseases such as Amyotrophic Lateral Sclerosis (ALS), frontotemporal dementia (FTD), or Alzheimer's Disease (AD).

Description

Treatment of neurological diseases using gene transcript modulators

Technical Field

The present application relates generally to methods of treating neurological diseases with antisense oligonucleotides, and in particular antisense oligonucleotides with one or more spacers that target transcripts.

Cross reference to related applications

The present application claims the benefit and priority of U.S. provisional patent application Ser. No. 63/033,926, filed on 3/6/2020, and U.S. provisional patent application Ser. No. 63/119,717, filed on 12/2020, the entire disclosures of each of which are hereby incorporated by reference in their entireties for all purposes.

Sequence listing

The present application contains a sequence listing, which has been electronically submitted in ASCII format and is incorporated herein by reference in its entirety. The ASCII copy was created at 28, 5, 2021, named QRL-006WO_SL.txt and is 510,394 bytes in size.

Background

Motor neuron disease is a type of neurological disease that causes the degeneration and death of motor neurons (those neurons that coordinate voluntary movement of muscles through the brain). Motor neuron disease may be sporadic or inherited, and may affect upper motor neurons and/or lower motor neurons. Motor neuron diseases include amyotrophic lateral sclerosis, progressive bulbar paralysis, pseudobulbar paralysis, primary lateral sclerosis, progressive muscular atrophy, spinal muscular atrophy, and post-polio syndrome.

Amyotrophic Lateral Sclerosis (ALS) is a group of motor neuron diseases affecting about 15,000 people in the united states. ALS is characterized by degeneration and death of upper and lower motor neurons, resulting in loss of voluntary muscle control. Motor neuron death is accompanied by muscle fascicular tremor and atrophy. Early symptoms of ALS include myalgia, muscle spasms, muscle weakness (e.g., affecting the arm, leg, neck, or diaphragm), aphthous and nasal tone, and difficulty chewing or swallowing. Eventually a loss of strength and loss of control over exercise (including those necessary for speaking, eating and breathing) occurs. Disease progression may be accompanied by weight loss, malnutrition, anxiety, depression, increased risk of pneumonia, myalgia spasms, neuropathy, and possibly dementia. Most individuals diagnosed with ALS die from respiratory failure within five years of the first appearance of symptoms. Currently, there is no effective treatment for ALS.

ALS occurs in individuals of all ages, but is most common in individuals between the ages of 55 and 75, and the incidence in men is somewhat higher. ALS may be characterized as sporadic or familial. Sporadic ALS appears to occur randomly, accounting for over 90% of all ALS incidences. Familial ALS accounts for 5-10% of all ALS incidences.

FTD refers to a series of progressive neurodegenerative diseases caused by neuronal loss in the frontal and temporal brain lobes. FTD is the third most common form of dementia (next to alzheimer's disease and lewy body dementia) and is the second most common form of dementia in individuals under 65 years of age. FTD was estimated to affect 20,000 to 30,000 individuals in the united states. FTD is characterized by changes in behavior and personality, as well as language dysfunction. Forms of FTD include behavioral variant FTD (bvFTD), semantic variant primary progressive aphasia (svPPA), and non-fluent variant primary progressive aphasia (nfvPPA). ALS is accompanied by FTD and is characterized by symptoms associated with FTD, as well as symptoms of ALS such as muscle weakness, atrophy, muscle bundle tremor, cramps, speech impairment (dysarthria) and inability to swallow (dysphagia). Individuals typically die from FTD within 5 to 10 years, while ALS with FTD typically causes death within 2 to 3 years of the first disease symptoms.

As with ALS, there is no known cure for FTD or ALS with FTD, nor is there a known therapeutic agent to prevent or delay the progression of either disease.

Thus, there is an urgent need to identify compounds and/or compositions that are capable of preventing, ameliorating, and treating neurological diseases such as: amyotrophic lateral sclerosis (amyotrophic lateral sclerosis, ALS), frontotemporal dementia (frontotemporal dementia, FTD), ALS with FTD, alzheimer's Disease (AD), parkinson's Disease (PD), huntington's disease, progressive supranuclear palsy (progressive supranuclear palsy, PSP), brain trauma (brain traumas), spinal cord injury (spinal cord injury), corticobasal degeneration (corticobasal degeneration, CBD), nerve injury (nerve injuries) (e.g., brachial plexus injury (brachial plexus injuries)), neuropathy (e.g., chemotherapy-induced neuropathy), and TDP43 proteopathy (proteoplague) (e.g., chronic traumatic brain disease (chronic traumatic encephalopathy), perry syndrome, dementia associated with Alzheimer's disease, parkinson's disease or not), and edge-dominant age-related TDP-43 brain disease (linear-pre-advanced TDP-43-brain phase, phas).

RNA binding protein Trans-Activity the DNA binding protein (transactive response DNA-binding protein) 43 (TDP-43) is involved in basic RNA processing activities including RNA transcription, splicing and transport. TDP-43 binds thousands of pre-messages to RNA/mRNA targets with high affinity for GU-rich sequences, including self-regulation of its own mRNA by binding to the 3' untranslated region. The reduction of TDP-43 from otherwise normal adult nervous system alters the splicing or expression levels of more than 1,500 RNAs, including long transcripts containing introns. See Melamed et al, nat neurosci (2019), 22 (2): 180-190.

In most cases of ALS and in about 45% of affected neurons in patients with FTD, cytoplasmic accumulation and nuclear loss of TDP-43 have been reported. See Melamed et al, nat neurosci (2019), 22 (2): 180-190. In addition, TDP-43 has been shown to regulate the expression of the neuronal growth related factor microtubule-inhibiting assembled protein (Stathmin) -2 (STMN 2). See Melamed (2019); see also Klim et al, nat neurosci (2019), 22 (2): 167-179.STMN2 encodes a protein necessary for normal motor neuron outgrowth and repair. See Melamed (2019); see also Klim (2019). The TDP-43 disruption was shown to drive premature polyadenylation and aberrant splicing in intron 1 of the microtubule-inhibiting assembled protein-2 pre-mRNA (pre-mRNA) to produce a non-functional mRNA. See Melamed (2019).

Summary of The Invention

Described herein are oligonucleotides comprising one or more spacers and comprising sequences that are 85% to 98% complementary to the equivalent length portion of an STMN2 transcript. In one aspect, the invention provides STMN2 oligonucleotides that target STMN2 transcripts (e.g., STMN2 transcripts comprising cryptic exons). In various embodiments, the oligonucleotide targets transcripts for use in treating neurological diseases, including motor neuron diseases, and/or neurological diseases. For example, STMN2 oligonucleotides can be used to treat PD, ALS, FTD and ALS with FTD.

In one aspect, the present disclosure provides a compound comprising a modified oligonucleotide comprising a sequence 85% to 98% complementary to an equal length portion of any one of: SEQ ID NO:1339 or SEQ ID NO: 1341. a sequence having 90% identity thereto, or 15 to 50 consecutive nucleobase portions thereof, wherein at least one (i.e., one or more) nucleoside linkages (linkage) of the oligonucleotide is a non-natural linkage, and further wherein the oligonucleotide comprises a spacer. In various embodiments, the oligonucleotide comprises a segment of up to 11 linked nucleosides. In various embodiments, the oligonucleotide comprises a segment of up to 10, 9, or 8 linked nucleosides. In various embodiments, the oligonucleotide comprises a segment of up to 7 linked nucleosides. In certain embodiments, the oligonucleotide comprises a segment of up to 6, 5, 4, 3, or 2 linked nucleosides. In certain embodiments, each segment of the oligonucleotide comprises up to 7 linked nucleosides.

In various embodiments, the oligonucleotide comprises a nucleotide sequence that hybridizes to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 or SEQ ID NO: the equal length portions of any of 1392-1664 share sequences that are at least 85% identical. In various embodiments, the oligonucleotide comprises a nucleotide sequence that hybridizes to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 or SEQ ID NO: the equal length portions of any of 1392-1664 share sequences that are at least 90% identical. In various embodiments, the oligonucleotide comprises a nucleotide sequence that hybridizes to SEQ ID NO: the equal length portions of any of 1451-1664 share sequences of at least 95% identity. In various embodiments, the oligonucleotide comprises a nucleotide sequence that hybridizes to SEQ ID NO: the equal length portions of any of 1451-1664 share sequences of 100% identity.

In various embodiments, the oligonucleotide comprises a segment of up to 11 linked nucleosides or up to 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: the equivalent length within any of positions 144-168, 173-197, 185-209 or 237-261 of 1339 is a sequence that is 85% to 98% complementary. In various embodiments, the oligonucleotide comprises a segment of up to 11 linked nucleosides or up to 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: the equivalent length of the nucleobases in any one of positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165 or 148-168 of 1339 is a sequence that is 85% to 98% complementary. In various embodiments, the oligonucleotide comprises a segment of up to 11 linked nucleosides or up to 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: the equivalent length of the nucleobases within any one of positions 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197 or 179-197 of 1339 is a sequence that is 85% to 98% complementary.

In various embodiments, the oligonucleotide comprises a segment of up to 11 linked nucleosides or up to 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: the equivalent length of the nucleobases in any one of positions 185-205, 187-209, 189-209 or 191-209 of 1339 is a sequence that is 85% to 98% complementary. In various embodiments, the oligonucleotide comprises a segment of up to 11 linked nucleosides or up to 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: the equivalent length of the nucleobases within any one of positions 237-255, 237-259, 239-261, 241-261 or 243-261 of 1339 is a sequence that is 85% to 98% complementary. In various embodiments, the oligonucleotide comprises a segment of up to 6, 5, 4, 3, or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: the equivalent length of the nucleobase within any one of positions 144-168, 173-197, 185-209 or 237-261 of 1339 is a sequence that is 85% to 98% complementary.

In various embodiments, the oligonucleotide comprises a segment of up to 6, 5, 4, 3, or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: the equal length portion of nucleobases within any one of positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, 148-168, 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, 179-197, 185-205, 187-209, 189-209, 191-209, 237-255, 237-259, 239-261, 241-261 or 243-261 of 1339 is a sequence that is 85% to 98% complementary. In various embodiments, the oligonucleotide comprises a segment of up to 11 linked nucleosides or up to 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 or SEQ ID NO: the equal length portions of any of 1392-1664 share sequences that are at least 85% identical. In various embodiments, the oligonucleotide comprises a segment of up to 6, 5, 4, 3, or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: 36. 55, 144, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 252, 380, 385, 390, 395, 400, 928, 947, 1036, 1065, 1069, 1073, 1077, 1089, 1095, 1101, 1107, 1129, 1136, 1144, 1272, 1277, 1282, 1287, or 1292. In various embodiments, the oligonucleotide comprises a segment of up to 6, 5, 4, 3, or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence complementary to SEQ ID NO: 36. 55, 144, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 252, 380, 385, 390, 395, 400, 928, 947, 1036, 1065, 1069, 1073, 1077, 1089, 1095, 1101, 1107, 1129, 1136, 1144, 1272, 1277, 1282, 1287, or 1292.

In various embodiments, the length of the oligonucleotide is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units. In various embodiments, the length of the oligonucleotide is at least 19 oligonucleotide units. In various embodiments, the spacer is a nucleoside replacement group comprising a non-sugar substituent that cannot be linked to a nucleotide base.

In various embodiments, the spacer is located between positions 10 and 15 of the oligonucleotide. In various embodiments, the spacer is located between positions 7 and 11 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 14 and 22 of the oligonucleotide. In various embodiments, the spacer and the second spacer are separated in the oligonucleotide by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases. In various embodiments, the spacer is located between positions 7 and 9 of the oligonucleotide, and wherein the second spacer is located between positions 15 and 18 of the oligonucleotide. In various embodiments, the spacer is located at position 8 of the oligonucleotide, and wherein the second spacer is located at position 16 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 21 and 24 of the oligonucleotide.

In various embodiments, the spacer is located between positions 2 and 5 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 8 and 12 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 18 and 22 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer and a third spacer, wherein three spacers are located at positions in the oligonucleotide such that each segment of the oligonucleotide has up to 7 linked nucleosides. In various embodiments, at least two of the three spacers are adjacent to a guanine nucleobase. In various embodiments, each of at least two of the three spacers immediately precedes a guanine nucleobase.

In various embodiments, each of the first, second, or third spacers is a nucleoside replacement group comprising a non-sugar substituent, wherein the non-sugar substituent does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal (aminal), or hemiaminal (hemiaminal) moiety and is incapable of forming a covalent bond with a nucleoside acid base.

In certain embodiments, each of the first, second, or third spacers is independently represented by formula (X), wherein:

ring a is an optionally substituted 4-8 membered monocyclic cycloalkyl or 4-8 membered monocyclic heterocyclyl wherein the heterocyclyl contains 1 or 2 heteroatoms selected from O, S and N, provided that a cannot form a covalent bond with a nucleobase; and is also provided with

The symbols represent the points of attachment to internucleoside linkages.

In various embodiments, each of the first, second, or third spacers is independently represented by formula (Xa), wherein:

in some embodiments, ring a is an optionally substituted 4-8 membered monocyclic cycloalkyl or 4-8 membered monocyclic heterocyclyl, said optionally substituted 4-8 membered monocyclic cycloalkyl being selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; the 4-8 membered monocyclic heterocyclic group is selected from oxetanyl (oxetanyl), tetrahydrofuranyl, tetrahydropyranyl, 1,4-dioxanyl (1, 4-dioxanyl), pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl (azepanyl).

In a further embodiment, ring a is tetrahydrofuranyl.

In other embodiments, ring a is tetrahydropyranyl.

In various embodiments, each of the first, second, or third spacers is independently represented by formula I, wherein:

X is selected from-CH ₂ -and-O-; and is also provided with

n is 0, 1, 2 or 3.

In various embodiments, each of the first, second, or third spacers is independently represented by formula I', wherein:

x is selected from-CH ₂ -and-O-; and is also provided with

n is 0, 1, 2 or 3.

In various embodiments, each of the first, second, or third spacers is independently represented by formula (Ia), wherein:

and is also provided with

n is 0, 1, 2 or 3.

In various embodiments, each of the first, second, or third spacers is independently represented by formula (Ia'), wherein:

and is also provided with

n is 0, 1, 2 or 3.

In certain embodiments, each of the first, second, or third spacers is independently represented by formula II, wherein:

and is also provided with

X is selected from-CH ₂ -and-O-.

In a further embodiment, each of the first, second or third spacers is independently represented by formula II', wherein:

and is also provided with

X is selected from-CH ₂ -and-O-.

In various embodiments, each of the first, second, or third spacers is independently represented by formula (IIa), wherein:

in a further embodiment, each of the first, second or third spacers is independently represented by formula (IIa'), wherein:

in various embodiments, each of the first, second, or third spacers is independently represented by formula III, wherein:

And is also provided with

X is selected from-CH ₂ -and-O-.

In a further embodiment, each of the first, second or third spacers is independently represented by formula III', wherein:

and is also provided with

X is selected from-CH ₂ -and-O-.

In some embodiments, each of the first, second, or third spacers is independently represented by formula (IIIa), wherein:

in a further embodiment, each of the first, second or third spacers is independently represented by formula (IIIa'), wherein:

in various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 10%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 20%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 25%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 30%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 40%. In various embodiments, the oligonucleotide comprising the spacer has a GC content of at least 50%.

In various embodiments, the length of the oligonucleotide is between 12 and 40 oligonucleotide units

In various embodiments, at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are independently selected from the group consisting of: phosphodiester linkages, phosphorothioate linkages, alkylphosphonate (alkyl phosphonate) linkages, phosphorodithioate (phosphodithioate) linkages, phosphotriester (phosphotriester) linkages, alkylphosphonate (alkylphosphonate) linkages, 3-methoxypropyl phosphonate (3-methoxypropyl phosphonate) linkages, methylphosphonate (methylphosphonate) linkages, aminoalkyl phosphotriester (phosphoramidate) linkages, alkylene phosphonate (alkylene phosphonate) linkages, phosphinate (phosphokanate) linkages, phosphoramidate (phosphotriester) linkages, phosphorodiamidate (phosphorodiamidate) linkages, phosphorodiamidate (e.g., including phosphorodiamidate morpholino (phosphorodiamidate morpholino, PMO), 3 'aminoribose or 5' aminoribose linkages, aminoalkyl phosphoramidate (phosphoramidate) linkages, phosphorothioate (phosphorothioate) linkages, phosphoroselenate (phosphoroselenate) linkages, and phosphoroborophosphate (borophosphate) linkages.

In various embodiments, the one or more nucleoside linkages linking the bases at position 3 or 4 of the oligonucleotide is a phosphodiester linkage. In various embodiments, only one nucleoside linkage that links to a base at position 3 or 4 of the oligonucleotide is a phosphodiester linkage. In various embodiments, the nucleoside linkages linking the bases at both the 3-and 4-positions of the oligonucleotide are phosphodiester linkages. In various embodiments, one or more bases immediately preceding a spacer in the oligonucleotide are linked by a phosphodiester linkage. In various embodiments, only the base immediately preceding the spacer in the oligonucleotide is linked to the spacer through a phosphodiester linkage. In various embodiments, the base immediately preceding the spacer in the oligonucleotide is further linked to a further preceding base by a phosphodiester linkage. In various embodiments, the oligonucleotide comprises a second spacer, wherein the base immediately preceding the second spacer is linked to a further preceding base by a phosphodiester linkage.

In various embodiments, one or more bases immediately following a spacer in the oligonucleotide are linked by a phosphodiester linkage. In various embodiments, only the base immediately following the spacer in the oligonucleotide is linked to the spacer through a phosphodiester linkage. In various embodiments, the two bases immediately preceding the spacer in the oligonucleotide are linked by a phosphodiester linkage. In various embodiments, one or more bases immediately preceding a spacer in the oligonucleotide are linked by a phosphodiester linkage, and wherein one or more bases immediately following a spacer in the oligonucleotide are linked by a phosphodiester linkage. In various embodiments, one base immediately preceding the spacer and one base immediately following the spacer are linked by a phosphodiester linkage. In various embodiments, the oligonucleotide comprises a second spacer, and wherein one or more bases immediately preceding the second spacer in the oligonucleotide are linked by a phosphodiester linkage, and wherein one or more bases immediately following the second spacer in the oligonucleotide are linked by a phosphodiester linkage. In various embodiments, a base immediately preceding the second spacer and a base immediately following the second spacer are linked by a phosphodiester linkage. In various embodiments, the oligonucleotide comprises a series of bases linked by phosphodiester bonds, the series of bases comprising at least two bases. In various embodiments, the oligonucleotide comprises a series of bases linked by phosphodiester bonds, the series of bases comprising at least 5 bases. In various embodiments, the oligonucleotide comprises two or more spacers, and wherein the series of bases is disposed between at least two of the spacers.

Further disclosed herein are compounds comprising an oligonucleotide comprising a nucleotide sequence that hybridizes to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 or SEQ ID NO: the equal length portions of any of 1392-1664 share nucleobase sequences that are at least 90% identical. Disclosed herein are further oligonucleotides comprising a nucleotide sequence that hybridizes to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 or SEQ ID NO: the equal length portions of any of 1392-1664 share nucleobase sequences that are at least 90% identical. In various embodiments, the nucleobase sequence hybridizes to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 or SEQ ID NO: the equal length portions of any of 1392-1664 share at least 95% identity. In various embodiments, the nucleobase sequence hybridizes to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 or SEQ ID NO: the equal length portions of any of 1392-1664 share at least 100% identity. In various embodiments, the oligonucleotide is any one of a 19-mer, a 21-mer, a 23-mer, or a 25-mer.

In various embodiments, the internucleoside linkage of the oligonucleotide is a modified internucleoside linkage. In various embodiments, the modified internucleoside linkage of the oligonucleotide is a phosphorothioate linkage. In various embodiments, all internucleoside linkages of the oligonucleotide are phosphorothioate linkages. In various embodiments, the phosphorothioate linkage is in one of the Rp configuration or the Sp configuration. In various embodiments, the oligonucleotide comprises at least one modified sugar moiety. In various embodiments, the modified sugar moiety is one of a 2' -OMe modified sugar moiety, a bicyclic sugar moiety, a 2' -O- (2-Methoxyethyl) (MOE), a 2' -deoxy-2 ' -fluoronucleoside, a 2' -fluoro- β -D-arabinonucleoside, a Locked Nucleic Acid (LNA), a tricyclic nucleic acid, a constrained ethyl 2' -4' -bridged nucleic acid (cEt), S-cEt, tcDNA, hexitol Nucleic Acid (HNA), and a tricyclic analog (e.g., tcDNA).

In various embodiments, the oligonucleotide exhibits at least a 30%, 40%, 50%, 60%, 70%, 80% or 90% increase in full-length STMN2 protein. In various embodiments, the oligonucleotide exhibits at least a 100% increase in full-length STMN2 protein. In various embodiments, the oligonucleotide exhibits at least a 200% increase in full-length STMN2 protein. In various embodiments, the oligonucleotide exhibits at least a 300% increase in full-length STMN2 protein. In various embodiments, the oligonucleotide exhibits at least a 400% increase in full-length STMN2 protein. In various embodiments, an increase in the full-length STMN2 protein is measured as compared to a reduced level of the full-length STMN2 protein achieved using a TDP43 antisense oligonucleotide. In various embodiments, the oligonucleotide exhibits at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% rescue of the full-length STMN2 protein. In various embodiments, the oligonucleotide exhibits at least a 50%, 60%, 70%, 80% or 90% reduction in STMN2 transcripts with cryptic exons.

In addition, disclosed are methods of treating a neurological disease and/or neurological disorder in a patient in need thereof, the method comprising administering to the patient an oligonucleotide of any of the above disclosed oligonucleotides. In various embodiments, the neurological disorder is selected from Amyotrophic Lateral Sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, alzheimer's Disease (AD), parkinson's Disease (PD), huntington's disease, progressive Supranuclear Palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), and TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, perry syndrome, lewy body dementia associated with alzheimer's disease, parkinson's disease with or without dementia, and edge-dominated age-related TDP-43 encephalopathy (LATE)). In various embodiments, the neurological disease is ALS. In various embodiments, the neurological disease is FTD. In various embodiments, the neurological disease is ALS with FTD. In various embodiments, the neuropathy is chemotherapy-induced neuropathy.

In addition, methods of restoring neurite outgrowth (outgrowth) and/or regeneration of neurons are disclosed, the methods comprising exposing motor neurons to an oligonucleotide in any of the above disclosed oligonucleotides. Also disclosed are methods of increasing, promoting, stabilizing, or maintaining STMN2 expression and/or function in a neuron, the method comprising exposing the cell to an oligonucleotide in any of the above disclosed oligonucleotides.

In various embodiments, the neuron is a neuron in a patient in need of treatment for a neurological disease and/or neuropathy. In various embodiments, the neuropathy is chemotherapy-induced neuropathy. In various embodiments, the exposure is performed in vivo or ex vivo. In various embodiments, the exposing comprises administering the oligonucleotide to a patient in need thereof. In various embodiments, the oligonucleotide is administered topically, parenterally, intrathecally, intrathalamus, intracisternally, orally, rectally, buccally, sublingually, vaginally, pulmonary, intratracheally, intranasally, transdermally, or intraduodenally. In various embodiments, the oligonucleotide is administered orally. In various embodiments, a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamus, or intracisternally. In various embodiments, the patient is a human.

Disclosed herein, inter alia, are pharmaceutical compositions comprising an oligonucleotide in any of the above disclosed oligonucleotides or a pharmaceutically acceptable salt thereof and a pharmaceutically acceptable excipient. In various embodiments, the pharmaceutical composition is suitable for topical, intrathecal, intrathalamic, intracisternal, intraventricular, parenteral, oral, pulmonary, intratracheal, intranasal, transdermal, rectal, buccal, sublingual, vaginal or intraduodenal administration.

Disclosed herein are also methods of treating a neurological disease or neuropathy in a patient in need thereof, the method comprising administering to the patient in need thereof a therapeutically effective amount of a pharmaceutical composition disclosed above. In various embodiments, the neurological disorder is selected from Amyotrophic Lateral Sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, alzheimer's Disease (AD), parkinson's Disease (PD), huntington's disease, progressive Supranuclear Palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), and TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, perry syndrome, lewy body dementia associated with alzheimer's disease, parkinson's disease with or without dementia, and edge-dominated age-related TDP-43 encephalopathy (LATE)). In various embodiments, the neurological disease is ALS. In various embodiments, the neurological disease is FTD. In various embodiments, the neurological disease is ALS with FTD. In various embodiments, the neuropathy is chemotherapy-induced neuropathy. In various embodiments, the pharmaceutical composition is administered topically, parenterally, orally, pulmonary, rectally, buccally, sublingually, vaginally, intratracheally, intranasally, intracisternally, intrathecally, intrathalamus, intravenously, intramuscularly, transdermally, or intraduodenally. In various embodiments, wherein the pharmaceutical composition is administered intrathecally, intrathalamus, intraventricular or intracisternally. In various embodiments, a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamus, or intracisternally. In various embodiments, the patient is a human.

Further disclosed herein is a method for treating a neurological disease in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment of up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide hybridizes to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 or SEQ ID NO: any of 1392-1664 share at least 85% identity; wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are independently selected from the group consisting of: phosphate diester linkages, phosphorothioate linkages, alkyl phosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkyl phosphonate linkages, 3-methoxypropyl phosphonate linkages, methylphosphonate linkages, aminoalkyl phosphotriester linkages, alkylene phosphonate linkages, phosphonite linkages, phosphoramidate linkages, phosphorothioate linkages, phosphorodiamidate linkages (e.g., including Phosphorodiamidate Morpholino (PMO), 3 'aminoribose or 5' aminoribose) linkages, aminoalkyl phosphoramidate linkages, phosphorothioate alkyl phosphonate linkages, phosphorothioate linkages, phosphoroselenate linkages, and phosphoroboronate linkages, and/or wherein at least one (i.e., one or more) of the nucleosides is substituted with a component selected from the group consisting of: 2' -O- (2-methoxyethyl) nucleoside, 2' -O-methyl nucleoside, 2' -deoxy-2 ' -fluoro nucleoside, 2' -fluoro- β -D-arabinonucleoside, locked Nucleic Acid (LNA), tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET) and Peptide Nucleic Acid (PNA), optionally wherein the oligonucleotide further comprises a spacer.

Further disclosed herein are methods for treating ALS in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment of up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide hybridizes to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 or SEQ ID NO: any of 1392-1664 share at least 85% identity; wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are independently selected from the group consisting of: phosphate diester linkages, phosphorothioate linkages, alkyl phosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkyl phosphonate linkages, 3-methoxypropyl phosphonate linkages, methylphosphonate linkages, aminoalkyl phosphotriester linkages, alkylene phosphonate linkages, phosphonite linkages, phosphoramidate linkages, phosphorothioate linkages, phosphorodiamidate linkages (e.g., including Phosphorodiamidate Morpholino (PMO), 3 'aminoribose or 5' aminoribose) linkages, aminoalkyl phosphoramidate linkages, phosphorothioate alkyl phosphonate linkages, phosphorothioate linkages, phosphoroselenate linkages, and phosphoroboronate linkages, and/or wherein at least one (i.e., one or more) of the nucleosides is substituted with a component selected from the group consisting of: 2' -O- (2-methoxyethyl) nucleoside, 2' -O-methyl nucleoside, 2' -deoxy-2 ' -fluoro nucleoside, 2' -fluoro- β -D-arabinonucleoside, locked Nucleic Acid (LNA), tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET) and Peptide Nucleic Acid (PNA), optionally wherein the oligonucleotide further comprises a spacer.

Further disclosed herein are methods for treating FTD in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment of up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide hybridizes to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 or SEQ ID NO: any of 1392-1664 share at least 85% identity; wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are independently selected from the group consisting of: phosphate diester linkages, phosphorothioate linkages, alkyl phosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkyl phosphonate linkages, 3-methoxypropyl phosphonate linkages, methylphosphonate linkages, aminoalkyl phosphotriester linkages, alkylene phosphonate linkages, phosphonite linkages, phosphoramidate linkages, phosphorothioate linkages, phosphorodiamidate linkages (e.g., including Phosphorodiamidate Morpholino (PMO), 3 'aminoribose or 5' aminoribose) linkages, aminoalkyl phosphoramidate linkages, phosphorothioate alkyl phosphonate linkages, phosphorothioate linkages, phosphoroselenate linkages, and phosphoroboronate linkages, and/or wherein at least one (i.e., one or more) of the nucleosides is substituted with a component selected from the group consisting of: 2' -O- (2-methoxyethyl) nucleoside, 2' -O-methyl nucleoside, 2' -deoxy-2 ' -fluoro nucleoside, 2' -fluoro- β -D-arabinonucleoside, locked Nucleic Acid (LNA), tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET) and Peptide Nucleic Acid (PNA), optionally wherein the oligonucleotide further comprises a spacer.

Further disclosed herein are methods for treating ALS with FTD in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment of up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide hybridizes to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 or SEQ ID NO: any of 1392-1664 share at least 85% identity; wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are independently selected from the group consisting of: phosphate diester linkages, phosphorothioate linkages, alkyl phosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkyl phosphonate linkages, 3-methoxypropyl phosphonate linkages, methylphosphonate linkages, aminoalkyl phosphotriester linkages, alkylene phosphonate linkages, phosphonite linkages, phosphoramidate linkages, phosphorothioate linkages, phosphorodiamidate linkages (e.g., including Phosphorodiamidate Morpholino (PMO), 3 'aminoribose or 5' aminoribose) linkages, aminoalkyl phosphoramidate linkages, phosphorothioate alkyl phosphonate linkages, phosphorothioate linkages, phosphoroselenate linkages, and phosphoroboronate linkages, and/or wherein at least one (i.e., one or more) of the nucleosides is substituted with a component selected from the group consisting of: 2' -O- (2-methoxyethyl) nucleoside, 2' -O-methyl nucleoside, 2' -deoxy-2 ' -fluoro nucleoside, 2' -fluoro- β -D-arabinonucleoside, locked Nucleic Acid (LNA), tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET) and Peptide Nucleic Acid (PNA), optionally wherein the oligonucleotide further comprises a spacer.

In various embodiments, one or more bases immediately following a spacer in the oligonucleotide are linked by a phosphodiester linkage. In various embodiments, only the base immediately following the spacer in the oligonucleotide is linked to the spacer through a phosphodiester linkage. In various embodiments, the two bases immediately preceding the spacer in the oligonucleotide are linked by a phosphodiester linkage. In various embodiments, one or more bases immediately preceding a spacer in the oligonucleotide are linked by a phosphodiester linkage, and wherein one or more bases immediately following a spacer in the oligonucleotide are linked by a phosphodiester linkage. In various embodiments, one base immediately preceding the spacer and one base immediately following the spacer are linked by a phosphodiester linkage. In various embodiments, the oligonucleotide comprises a second spacer, and wherein one or more bases immediately preceding the second spacer in the oligonucleotide are linked by a phosphodiester linkage, and wherein one or more bases immediately following the second spacer in the oligonucleotide are linked by a phosphodiester linkage. In various embodiments, a base immediately preceding the second spacer and a base immediately following the second spacer are linked by a phosphodiester linkage. In various embodiments, the oligonucleotide comprises a series of bases linked by phosphodiester bonds, the series of bases comprising at least two bases. In various embodiments, the oligonucleotide comprises a series of bases linked by phosphodiester bonds, the series of bases comprising at least 5 bases. In various embodiments, the oligonucleotide comprises two or more spacers, and wherein the series of bases is disposed between the at least two spacers. In various embodiments, the oligonucleotide is any one of a 19-mer, a 21-mer, a 23-mer, or a 25-mer.

In various embodiments, at least one (i.e., one or more) internucleoside linkage of the oligonucleotide is a phosphorothioate linkage. In various embodiments, all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.

Further disclosed herein are oligonucleotides comprising sequences that are 85% to 98% complementary to: SEQ ID NO:1339 or SEQ ID NO:1341, or a sequence having 90% identity thereto, or 15 to 50 consecutive nucleobase portions thereof, wherein the oligonucleotide comprises a spacer and wherein the oligonucleotide is capable of increasing, restoring or stabilizing expression of STMN2mRNA and/or activity and/or function of STMN2 protein capable of translating functional STMN2 in a human patient for a cellular or immune mediated demyelinating disease, and wherein the increased, restored or stabilized level of expression and/or activity and/or function is sufficient to use the oligonucleotide as a medicament for treating the immune mediated demyelinating disease.

In various embodiments, the oligonucleotide comprises one or more chiral centers and/or double bonds. In various embodiments, the oligonucleotide exists as a stereoisomer selected from the group consisting of geometric isomers, enantiomers and diastereomers.

Further disclosed herein are methods of treating a neurological disease and/or neurological disorder in a patient in need thereof, the method comprising administering to the patient in need thereof a therapeutically effective amount of the pharmaceutical composition disclosed above in combination with a second therapeutic agent. In various embodiments, the second therapeutic agent is selected from Riluzole (Rilutek), edaravone (Edaravone) (Radicava), rivastigmine, donepezil (galantamine), selective serotonin reuptake inhibitors (selective serotonin reuptake inhibitor), antipsychotics (antipsychotic agents), cholinesterase inhibitors, memantine, benzodiazepines (benzodiazepine) anxiolytics, AMX0035 (ELYBRIO), zicoplan (RA 101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078 and BIIB 105), BIIB100, levodopa (levadopa)/carbidopa (carbopa), dopaminergic agents (dopaminergic agents) (e.g., ropinirole, pramipexole, rotigotine), medroxyprosterone, KCNQ2/KCNQ3 openers (openers) (e.g., retigabine, XEN1101, QRL-101), anticonvulsants (anticonvulsants) and psychostimulants (psychostimulant agents), and/or therapies (e.g., selected from respiratory care, physical therapy, occupational therapy, speech therapy, nutritional support) for treating the neurological disease.

Further disclosed herein are methods of treating a neurological disease and/or neurological disorder in a patient in need thereof, the method comprising administering to a patient in need thereof a therapeutically effective amount of the pharmaceutical composition disclosed above, wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are non-natural linkages, wherein the oligonucleotide comprises a spacer, and wherein the oligonucleotide further comprises a targeting or conjugate moiety selected from cholesterol, lipoic acid, pantothenic acid, polyethylene glycol, and an antibody for crossing the blood brain barrier.

In various embodiments, the spacer is a nucleoside replacement group comprising a non-sugar substituent that cannot be linked to a nucleotide base. In various embodiments, the spacer is located between positions 10 and 15 of the oligonucleotide. In various embodiments, the spacer is located between positions 7 and 11 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 14 and 22 of the oligonucleotide. In various embodiments, the spacer and the second spacer are separated in the oligonucleotide by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases. In various embodiments, the spacer is located between positions 7 and 9 of the oligonucleotide, and wherein the second spacer is located between positions 15 and 18 of the oligonucleotide. In various embodiments, the spacer is located at position 8 of the oligonucleotide, and wherein the second spacer is located at position 16 of the oligonucleotide.

In various embodiments, the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 21 and 24 of the oligonucleotide. In various embodiments, the spacer is located between positions 2 and 5 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 8 and 12 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 18 and 22 of the oligonucleotide. In various embodiments, the oligonucleotide further comprises a second spacer and a third spacer, wherein the three spacers are located at positions in the oligonucleotide such that each segment of the oligonucleotide has up to 7 linked nucleosides.

In various embodiments, at least two of the three spacers are adjacent to a guanine nucleobase. In various embodiments, each of at least two of the three spacers immediately precedes a guanine nucleobase.

In various embodiments, in the methods herein, each of the first, second, or third spacers is a nucleoside replacement group comprising a non-sugar substituent, wherein the non-sugar substituent does not contain a ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal, or hemiaminal moiety and is incapable of forming a covalent bond with a nucleoside acid base.

The symbols represent the points of attachment to internucleoside linkages.

in some embodiments, ring a is an optionally substituted 4-8 membered monocyclic cycloalkyl or 4-8 membered monocyclic heterocyclyl, said optionally substituted 4-8 membered monocyclic cycloalkyl being selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; the 4-8 membered monocyclic heterocyclic group is selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1, 4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl.

In a further embodiment, ring a is tetrahydrofuranyl.

In other embodiments, ring a is tetrahydropyranyl.

In various embodiments, each of the first, second, or third spacers is independently represented by formula (I), wherein:

X is selected from-CH ₂ -and-O-; and is also provided with

n is 0, 1, 2 or 3.

In various embodiments, the spacer or second spacer is represented by formula (I'), wherein:

x is selected from-CH ₂ -and-O-; and is also provided with

n is 0, 1, 2 or 3.

and is also provided with

n is 0, 1, 2 or 3.

and is also provided with

n is 0, 1, 2 or 3.

and is also provided with

X is selected from-CH ₂ -and-O-.

and is also provided with

X is selected from-CH ₂ -and-O-.

And is also provided with

X is selected from-CH ₂ -and-O-.

and is also provided with

X is selected from-CH ₂ -and-O-.

Brief Description of Drawings

FIG. 1 is a schematic of portions of a STMN2 transcript and STMN2 antisense oligonucleotides designed to target certain portions of a STMN2 transcript.

FIG. 2 is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 antisense and recovery of full-length STMN2 transcripts in the presence of 6 different STMN2 parental oligonucleotides (SEQ ID NO:36, SEQ ID NO:55, SEQ ID NO:177, SEQ ID NO:203, SEQ ID NO:244 and SEQ ID NO: 395).

FIG. 3 is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts having cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts having cryptic exons in the presence of 6 different STMN2 parent oligonucleotides (SEQ ID NO:173, SEQ ID NO:181, SEQ ID NO:197, SEQ ID NO:215, SEQ ID NO:385 and SEQ ID NO: 400).

FIG. 4 is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and recovery of full-length STMN2 transcripts in the presence of 6 different STMN2 parental oligonucleotides (SEQ ID NO:173, SEQ ID NO:181, SEQ ID NO:197, SEQ ID NO:215, SEQ ID NO:385 and SEQ ID NO: 400).

FIG. 5A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts having cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts having cryptic exons in the presence of 6 different STMN2 parent oligonucleotides (SEQ ID NO:185, SEQ ID NO:209, SEQ ID NO:237, SEQ ID NO:252, SEQ ID NO:380 and SEQ ID NO: 390).

FIG. 5B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and recovery of full-length STMN2 transcripts in the presence of 6 different STMN2 parental oligonucleotides (SEQ ID NO:185, SEQ ID NO:209, SEQ ID NO:237, SEQ ID NO:252, SEQ ID NO:380 and SEQ ID NO: 390).

FIG. 6A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts having cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts having cryptic exons in the presence of 2 different STMN2 parental oligonucleotides (SEQ ID NO:144 and SEQ ID NO: 237) in two replicates.

FIG. 6B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and recovery of full-length STMN2 transcripts in the presence of 2 different STMN2 parent oligonucleotides (SEQ ID NO:144 and SEQ ID NO: 237) in two replicates.

FIG. 7A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts having cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts having cryptic exons in the presence of 5 different STMN2 parent oligonucleotides (SEQ ID NO:36, SEQ ID NO:173, SEQ ID NO:177, SEQ ID NO:181 and SEQ ID NO: 185).

FIG. 7B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and recovery of full-length STMN2 transcripts in the presence of 5 different STMN2 parent oligonucleotides (SEQ ID NO:36, SEQ ID NO:173, SEQ ID NO:177, SEQ ID NO:181 and SEQ ID NO: 185).

FIG. 8A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts having cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts having cryptic exons in the presence of 5 different STMN2 parent oligonucleotides (SEQ ID NO:197, SEQ ID NO:203, SEQ ID NO:237, SEQ ID NO:380 and SEQ ID NO: 395).

FIG. 8B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense and recovery of full-length STMN2 transcripts in the presence of 5 different STMN2 parent oligonucleotides (SEQ ID NO:197, SEQ ID NO:203, SEQ ID NO:237, SEQ ID NO:380 and SEQ ID NO: 395).

FIG. 9A is a bar graph showing the results of RT-qPVR analysis of mRNA levels of STMN2 transcripts having cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, and reduction of mRNA levels of STMN2 transcripts having cryptic exons in the presence of 3 different STMN2 parent oligonucleotides (SEQ ID NO:144, SEQ ID NO:173 and SEQ ID NO: 237).

FIG. 9B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and recovery of full-length STMN2 transcripts in the presence of 3 different STMN2 parent oligonucleotides (SEQ ID NO:144, SEQ ID NO:173 and SEQ ID NO: 237).

FIG. 10A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, and at different doses of SEQ ID NO: reduction of STMN2 transcript mRNA levels with cryptic exons in the 181STMN2 parent oligonucleotide.

FIG. 10B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the presence of different doses of SEQ ID NO: recovery of full-length STMN2 transcript in 181STMN2 parental oligonucleotide.

FIG. 11A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, and at different doses of SEQ ID NO:185STMN2 parent oligonucleotide has a decrease in STMN2 transcript mRNA levels with cryptic exons.

FIG. 11B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the presence of different doses of SEQ ID NO: restoration of full-length STMN2 transcript in 185STMN2 parental oligonucleotide.

FIG. 12A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, and at different doses of SEQ ID NO:197STMN2 parental oligonucleotide has a decrease in STMN2 transcript mRNA levels with cryptic exons.

FIG. 12B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the presence of different doses of SEQ ID NO: restoration of full length STMN2 transcript in 197STMN2 parental oligonucleotide.

FIG. 13A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, and at different doses of SEQ ID NO: STMN2 transcript mRNA levels were reduced with cryptic exons in the 144STMN2 parent oligonucleotide.

FIG. 13B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the presence of different doses of SEQ ID NO: restoration of full length STMN2 transcript in 144STMN2 parental oligonucleotide.

FIG. 14A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, and at different doses of SEQ ID NO: reduction of mRNA levels of STMN2 transcripts with cryptic exons in 173STMN2 parental oligonucleotides.

FIG. 14B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the presence of different doses of SEQ ID NO: recovery of full-length STMN2 transcript in 173STMN2 parental oligonucleotide.

FIG. 15A is a bar graph showing the results of RT-qPVR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, and at different doses of SEQ ID NO:237STMN2 parent oligonucleotide has a decrease in mRNA level of STMN2 transcript with cryptic exons.

FIG. 15B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the presence of different doses of SEQ ID NO: restoration of full length STMN2 transcript in 237STMN2 parent oligonucleotide.

FIG. 16 is a Western blot and quantitative bar graph showing normalized amounts of STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and recovery of full-length STMN2 transcripts for 2 different STMN2 parental oligonucleotides (SEQ ID NO:173 and SEQ ID NO: 237).

FIG. 17A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, and the use of SEQ ID NO: reduction of mRNA levels of STMN2 transcripts with cryptic exons for different variants of 237STMN2 parent oligonucleotides.

FIG. 17B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the use of SEQ ID NO: recovery of full-length STMN2 transcripts for different variants of 237STMN2 parent oligonucleotides.

FIG. 18A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, and the use of SEQ ID NO: reduction of STMN2 transcript mRNA levels with cryptic exons for different variants of 185STMN2 parent oligonucleotides.

FIG. 18B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the use of SEQ ID NO: restoration of full-length STMN2 transcripts for different variants of 185STMN2 parent oligonucleotides.

FIG. 19A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts having cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, and the use of SEQ ID NO: reduction of mRNA levels of STMN2 transcripts with cryptic exons for different variants of 173STMN2 parental oligonucleotides.

FIG. 19B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the use of SEQ ID NO: recovery of full-length STMN2 transcripts for different variants of 173STMN2 parental oligonucleotides.

FIG. 20A is a bar graph showing the results of RT-qPVR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, and the use of SEQ ID NO: reduction of mRNA levels of STMN2 transcripts with cryptic exons for different variants of 237STMN2 parent oligonucleotides.

FIG. 20B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the use of SEQ ID NO: recovery of full-length STMN2 transcripts for different variants of 237STMN2 parent oligonucleotides.

FIG. 21A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts having cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, and the use of SEQ ID NO: reduction of mRNA levels of STMN2 transcripts with cryptic exons for different variants of 173STMN2 parental oligonucleotides.

FIG. 21B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the use of SEQ ID NO: recovery of full-length STMN2 transcripts for different variants of 173STMN2 parental oligonucleotides.

FIG. 22A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts having cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, and the use of SEQ ID NO: STMN2 transcript mRNA levels with cryptic exons were reduced for the different variants of the 144STMN2 parent oligonucleotides.

FIG. 22B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and the use of SEQ ID NO: recovery of full-length STMN2 transcripts for different variants of 144STMN2 parental oligonucleotides.

Fig. 23 is a bar graph showing the use of SEQ ID NO: the hidden exon-induced reversal of the 237STMN2 parent oligonucleotide, even if increased proteasome inhibition is considered.

FIG. 24 shows a dose response curve demonstrating that recovery of full length STMN2 transcripts increases with increasing STMN2 AON concentration.

Figure 25A shows western blot assays demonstrating qualitative increases in full length STMN2 protein response to higher concentrations of STMN2 AON.

Figure 25B shows quantitative levels of full length STMN2 protein normalized to GAPDH in response to different concentrations of STMN2 AON.

FIG. 26A is a bar graph showing the results of RT-qPVR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 siRNA and TDP43 antisense, and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2 AON comprising the sequence of SEQ ID NO:144AON, SEQ ID NO:144AON with two spacers (SEQ ID NO: 1589), SEQ ID NO:173AON, SEQ ID NO:173 with two spacers (SEQ ID NO: 1590), SEQ ID NO:237AON and SEQ ID NO:237AON with two spacers (SEQ ID NO: 1591).

FIG. 26B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 siRNA and TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2AON comprising the sequence of SEQ ID NO:144AON, SEQ ID NO:144AON with two spacers (SEQ ID NO: 1589), SEQ ID NO:173AON, SEQ ID NO:173 with two spacers (SEQ ID NO: 1590), SEQ ID NO:237AON and SEQ ID NO:237AON with two spacers (SEQ ID NO: 1591).

FIG. 27A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2AON comprising the sequence of SEQ ID NO: 173. SEQ ID NO: 1608. SEQ ID NO: 1609. SEQ ID NO: 1610. SEQ ID NO: 1611. SEQ ID NO: 1612. SEQ ID NO: 1613. SEQ ID NO: 1614. SEQ ID NO: 1615. SEQ ID NO: 1596. SEQ ID NO:1597 and SEQ ID NO:1418.

FIG. 27B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2AON comprising the sequence of SEQ ID NO: 173. SEQ ID NO: 1608. SEQ ID NO: 1609. SEQ ID NO: 1610. SEQ ID NO: 1611. SEQ ID NO: 1612. SEQ ID NO: 1613. SEQ ID NO: 1614. SEQ ID NO: 1615. SEQ ID NO: 1596. SEQ ID NO:1597 and SEQ ID NO:1418.

FIG. 28A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2 AON comprising the sequence of SEQ ID NO: 173. SEQ ID NO: 1632. SEQ ID NO: 1346. SEQ ID NO: 1631. SEQ ID NO:1353 and SEQ ID NO:1598.

FIG. 28B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2 AON comprising the sequence of SEQ ID NO: 173. SEQ ID NO: 1632. SEQ ID NO: 1346. SEQ ID NO: 1631. SEQ ID NO:1353 and SEQ ID NO:1598.

FIG. 29A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2 AON comprising the sequence of SEQ ID NO:173 and SEQ ID NO:1610.

FIG. 29B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2 AON comprising the sequence of SEQ ID NO:173 and SEQ ID NO:1610.

FIG. 30A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2AON comprising the sequence of SEQ ID NO:185 and SEQ ID NO:1635.

FIG. 30B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2AON comprising the sequence of SEQ ID NO:185 and SEQ ID NO:1635.

FIG. 31A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2AON comprising the sequence of SEQ ID NO: 1347. SEQ ID NO:1633 and SEQ ID NO:1634.

FIG. 31B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2AON comprising the sequence of SEQ ID NO: 1347. SEQ ID NO:1633 and SEQ ID NO:1634.

FIG. 32A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2 AON comprising the sequence of SEQ ID NO: 197. SEQ ID NO: 1617. SEQ ID NO:1618 and SEQ ID NO:1619.

FIG. 32B is a bar graph showing the results of RHT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2 AON comprising SEQ ID NO: 197. SEQ ID NO: 1617. SEQ ID NO:1618 and SEQ ID NO:1619.

FIG. 33A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2 AON comprising the sequence of SEQ ID NO: 252. SEQ ID NO: 1650. SEQ ID NO: 1434. SEQ ID NO:1651 and SEQ ID NO:1620.

FIG. 33B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2 AON comprising the sequence of SEQ ID NO: 252. SEQ ID NO: 1650. SEQ ID NO: 1434. SEQ ID NO:1651 and SEQ ID NO:1620.

FIG. 34A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2 AON comprising the sequence of SEQ ID NO:1434 and SEQ ID NO:1620.

FIG. 34B is a bar graph showing the results of RT-qPCR analysis of TDP43 and STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2 AON comprising the sequence of SEQ ID NO:1434 and SEQ ID NO:1620.

fig. 35 is a bar graph showing normalized STMN2 protein levels after treatment with TDP43 antisense and using a light chain comprising SEQ ID NO: 144. SEQ ID NO: 1589. SEQ ID NO: 173. SEQ ID NO: 1616. SEQ ID NO:237 and SEQ ID NO: restoration of STMN2 AON of 1591.

Detailed Description

Features and other details of the present disclosure will now be described in more detail. Certain terms used throughout the description, examples, and appended claims have been collected. These definitions should be read in light of the remainder of the present disclosure and understood by those skilled in the art. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

Disclosed herein are oligonucleotides capable of targeting a region of a transcript transcribed from a gene. In various embodiments, such oligonucleotides target STMN2 transcripts. Also disclosed herein are oligonucleotides, including antisense oligonucleotide sequences, and methods of using the same in the treatment of neurological diseases, such as amyotrophic lateral sclerosis and frontotemporal dementia, and/or neurological disorders, such as chemotherapy-induced neurological disorders. In one embodiment, the oligonucleotide targets a cryptic exon sequence of the STMN2 transcript, thereby reducing the level of STMN2 transcript having the cryptic exon sequence. Also disclosed are pharmaceutical compositions comprising an STMN2 oligonucleotide that targets a region of STMN2 transcript comprising a cryptic exon for use in treating a neurological disease and/or neurological disease; and the preparation of a medicament containing the disclosed STMN2 oligonucleotides targeting a region of STMN2 transcript comprising a cryptic exon to be used in the treatment of neurological diseases and/or neurological disorders.

Definition of the definition

The term "treatment" and the like as used herein generally means obtaining a desired pharmacological and/or physiological effect. The effect may be therapeutic in terms of partial or complete cure of the disease and/or adverse reactions due to the disease. As used herein, the term "treatment" covers any treatment of a disease in a mammal, particularly a human, and includes: (a) Inhibiting the disease, i.e., preventing an increase in the severity or extent of the disease; (b) Remission, i.e., causing partial or complete amelioration of the disease; (c) Preventing recurrence of the disease, i.e., preventing the disease from reverting to an active state after previously successfully treating symptoms of the disease or treating the disease.

"preventing" includes delaying the onset of a clinical symptom, complication, or biochemical indicator of a state, disorder, disease, or condition developing in a subject who may have or be susceptible to the state, disorder, disease, or condition but has not experienced or exhibited a clinical or subclinical symptom of the state, disorder, disease, or condition. "preventing" includes prophylactic treatment of a state, disorder, disease, or condition in or developing in a subject, including prophylactic treatment of a clinical symptom, complication, or biochemical indicator of a state, disorder, disease, or condition in or developing in a subject.

As used herein, the term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable excipient" interchangeably refers to any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. The compositions may also contain other active compounds that provide supplemental, additional or enhanced therapeutic functions.

As used herein, the term "pharmaceutical composition" refers to a composition comprising at least one biologically active compound, such as an STMN2 Antisense Oligonucleotide (AON) as disclosed herein, formulated with one or more pharmaceutically acceptable excipients.

"individual," "patient," or "subject" are used interchangeably and include any animal, including mammals, preferably mice, rats, other rodents, rabbits, dogs, cats, pigs, cattle, sheep, horses, or non-human primates, and most preferably humans. The compounds of the invention may be administered to mammals, such as humans, but may also be other mammals, such as animals in need of veterinary treatment, e.g., domestic animals (e.g., dogs, cats, etc.), farm animals (e.g., cows, sheep, pigs, horses, etc.), and laboratory animals (e.g., rats, mice, guinea pigs, non-human primates, etc.). In some embodiments, the mammal treated in the methods of the invention is desirably a mammal desiring to modulate STMN2 expression and/or activity.

As used herein, "STMN2" (also known as the upper cervical ganglion-10 protein, microtubule-inhibiting assembly protein-like 2, SCGN10, SCG10, neuron growth-related protein, neuron-specific growth-related protein or protein SCG10 (upper cervical ganglion NEAR nerve-specific 10)) refers to a Gene or Gene product identified by Entrez Gene ID No.11075 (e.g., a protein or mRNA transcript (including pre-mRNA) encoded by the Gene) and allelic variants thereof, as well as orthologs found in non-human species (e.g., non-human primates or mice).

The term "STMN2 transcript" refers to a STMN2 transcript comprising a cryptic exon. Such STMN2 transcripts comprising cryptic exons may be STMN2 pre-mRNA sequences or STMN2 mature RNA sequences. The term "STMN2 transcript comprising a cryptic exon" refers to a STMN2 transcript comprising one or more cryptic exon sequences.

The term "STMN2 oligonucleotide", "STMN2 antisense oligonucleotide" or "STMN2AON" refers to an oligonucleotide capable of increasing, restoring or stabilizing full length STMN2 activity, e.g., full length STMN2 expression, e.g., full length STMN2 mRNA and/or full length STMN2 protein expression. Typically, STMN2 oligonucleotides reduce the level of mature STMN2 transcripts with cryptic exons by targeting STMN2 transcripts that contain cryptic exons. For example, an STMN2 oligonucleotide reduces the level of a mature STMN2 transcript having a cryptic exon by suppressing premature polyadenylation of STMN2 pre-mRNA and/or increasing, restoring, or stabilizing activity or function of STMN 2. In various embodiments, the STMN2 oligonucleotide comprises a sequence that is 85% to 98% complementary to the equivalent length portion of: comprising a sequence identical to SEQ ID NO:1339 or SEQ ID NO:1341, or a transcript of a sequence that is at least 90% identical to SEQ ID NO:1339 or SEQ ID NO:1341 of 15 to 50 nucleobase portions in succession.

In various embodiments, the STMN2 oligonucleotide is characterized by having one or more spacers, wherein each spacer divides the STMN2 oligonucleotide into segments of linked nucleosides. In various embodiments, the STMN2 oligonucleotide has two spacers. In one embodiment, the STMN2 oligonucleotide has two segments of linked nucleosides separated by a spacer. In one embodiment, the STMN2 oligonucleotide has three segments of linked nucleosides separated by two spacers. In such embodiments, the STMN2 oligonucleotide has a segment with up to 7 linked nucleosides. For example, an STMN2 oligonucleotide can have 5 linked nucleosides, followed by a spacer, 10 linked nucleosides, followed by a second spacer, and 8 linked nucleosides from the 5 'to the 3' end. Thus, a first segment of 5 linked nucleosides satisfies a segment of up to 7 linked nucleosides. In various embodiments, the STMN2 oligonucleotide has three spacers that divide the STMN2 oligonucleotide into four segments. In various embodiments, each of the four segments of STMN2 oligonucleotides has up to 7 linked nucleosides.

As used herein, the term "STMN2 oligonucleotide" encompasses "STMN2 parent oligonucleotide", "STMN2 oligonucleotide with one or more spacers" (e.g., STMN2 oligonucleotide with two spacers or STMN2 oligonucleotide with three spacers), "STMN2 oligonucleotide variant with one or more spacers". Examples of STMN2 oligonucleotides include a nucleic acid comprising SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 and SEQ ID NO:13 92-1664.

The term "STMN2 parental oligonucleotide" refers to an oligonucleotide that targets STMN2 transcripts with cryptic exons and is capable of increasing, restoring, or stabilizing full-length STMN2 activity, e.g., full-length STMN2 expression, e.g., full-length STMN2 mRNA and/or full-length STMN2 protein expression. The STMN2 parent oligonucleotide does not comprise a spacer. Examples of STMN2 parent oligonucleotides include a nucleic acid comprising SEQ ID NO:1-446 and SEQ ID NO: 893-1338. As described below, STMN2 oligonucleotides and STMN2 oligonucleotide variants with spacers are described with respect to corresponding STMN2 parent oligonucleotides.

The term "STMN2 oligonucleotide variant" refers to a modified version of a STMN2 oligonucleotide representing the corresponding STMN2 parent oligonucleotide. For example, an STMN2 oligonucleotide variant represents a shortened version of the STMN2 parent oligonucleotide. In various embodiments, the STMN2 oligonucleotide variant is any of 15-mer, 16-mer, 17-mer, 18-mer, 19-mer, 20-mer, 21-mer, 22-mer, or 23-mer. Examples of STMN2 oligonucleotide variants include those comprising SEQ ID NO:1342-1366 or SEQ ID NO:13 92-1521. In various embodiments, the STMN2 oligonucleotide variant comprises one or more spacers. Such STMN2 oligonucleotide variants include SEQ ID NO:1342-1366 and SEQ ID NO:1392 to 1416.

The term "oligonucleotide with one or more spacers" or "oligonucleotide comprising a spacer" refers to an oligonucleotide with at least one spacer. In various embodiments, an oligonucleotide having one or more spacers may comprise one spacer, two spacers, three spacers, four spacers, five spacers, six spacers, seven spacers, eight spacers, nine spacers, or ten spacers. In various embodiments, an oligonucleotide comprising one or more spacers comprises at least one segment having up to 7 linked nucleosides. For example, as described in the 5 'to 3' direction, an oligonucleotide comprising a spacer may comprise a segment of 7 linked nucleosides, followed by a spacer, a second segment of 9 linked nucleosides, followed by a second spacer, and a third segment of 7 linked nucleosides. Here, the first segment of 7 linked nucleosides and the third segment of 7 linked nucleosides represent segments having up to 7 linked nucleosides, respectively. As another example, an oligonucleotide comprising a spacer may comprise a segment of 10 linked nucleosides, followed by a spacer, a second segment of 10 linked nucleosides, followed by a second spacer, and a third segment of 3 linked nucleosides. Here, the third segment of 3 linked nucleosides represents a segment having up to 7 linked nucleosides. In various embodiments, an oligonucleotide having one or more spacers comprises a plurality of segments having up to 7 linked nucleosides. In various embodiments, each segment of an oligonucleotide having one or more spacers has up to 7 linked nucleosides. For example, the oligonucleotide may be a 23 mer and comprise two spacers dividing the 23 mer into three separate segments of 7 linked nucleosides each. Thus, each segment of an oligonucleotide has up to 7 linked nucleosides.

In general, STMN2 oligonucleotides comprising one or more spacers are described with reference to a corresponding STMN2 parent oligonucleotide or a corresponding STMN2 oligonucleotide variant. Examples of STMN2 oligonucleotides comprising one or more spacers include SEQ ID NO:1417-1420 and SEQ ID NO: 1451-1664.

In this specification, the term "therapeutically effective amount" means the amount of an oligonucleotide that will elicit the biological or medical response of a tissue, system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician. In one embodiment, the oligonucleotide comprises a sequence that is 85% to 95% complementary to the equal length portion of a transcript comprising a sequence set forth in SEQ ID NO:1339 or SEQ ID NO:1341, or SEQ ID NO:1339 or SEQ ID NO:1341 of 15 to 50 nucleobase portions in succession. The oligonucleotide is administered in a therapeutically effective amount to treat and/or prevent a disease, condition, disorder or state, such as a neurological disease and/or neurological disorder. Alternatively, a therapeutically effective amount of an oligonucleotide is an amount required to achieve the desired therapeutic and/or prophylactic effect, such as an amount that results in the prevention or reduction of symptoms associated with a disease associated with reduced STMN2 activity in a motor neuron.

The phrase "STMN 2 oligonucleotide targeting a STMN2 transcript" refers to a STMN2 oligonucleotide that binds to a STMN2 transcript. Exemplary regions of STMN2 transcripts are shown in table 1, which depict sequences corresponding to the branch point (e.g., branch points 1, 2, and 3) regions, the 3' splice acceptor region, the ESE binding region, the TDP43 binding site, the cryptic exon, and the PolyA region. In various embodiments, the oligonucleotide binds to a region of the STMN2 transcript having a cryptic exon that is located less than 75 nucleobases upstream or downstream of any of the branch point (e.g., branch points 1, 2, and 3), the 3' splice acceptor region, the ESE binding region, the TDP43 binding site, the cryptic exon, and the PolyA region.

As used herein, the term "pharmaceutically acceptable salt" refers to a salt of an acidic or basic group that may be present in an STMN2 oligonucleotide for use in the present compositions. STMN2 oligonucleotides, which are basic in nature, are included in the compositions of the present invention, are capable of forming a wide variety of salts with a variety of inorganic and organic acids. Acids that may be used to prepare pharmaceutically acceptable acid addition salts of such basic compounds are those that form non-toxic acid addition salts, i.e., salts containing pharmaceutically acceptable anions, including, but not limited to malate, oxalate, chloride, bromide, iodide, nitrate, sulfate, bisulfate, phosphate, acid phosphate, isonicotinate, acetate, lactate, salicylate, citrate, tartrate, oleate, tannate, pantothenate, hydrogen tartrate, ascorbate, succinate, maleate, gentisate, fumarate, gluconate, glucarate, gluconate, formate, benzoate, glutamate, mesylate, ethanesulfonate, benzenesulfonate, p-toluenesulfonate, and pamoate (i.e., 1' -methylene-bis- (2-hydroxy-3-naphthoate)). In addition to the acids described above, the STMN2 oligonucleotides included in the present compositions comprising an amino moiety can form pharmaceutically acceptable salts with various amino acids. The compounds included in the present compositions, which are acidic in nature, are capable of forming base salts with a variety of pharmaceutically acceptable cations. Examples of such salts include alkali or alkaline earth metal salts, in particular calcium, magnesium, sodium and lithium salts. Pharmaceutically acceptable salts of the present disclosure include, for example, pharmaceutically acceptable salts of STMN2 oligonucleotides, which include the amino acid sequence of SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 and SEQ ID NO:1392 to 1664.

The STMN2 oligonucleotides of the disclosure may comprise one or more chiral centers, groups, linkages, and/or double bonds, and thus exist as stereoisomers, such as geometric isomers, enantiomers, or diastereomers. The term "stereoisomers" as used herein is made up of all geometric isomers, enantiomers or diastereomers. These compounds may be designated by the symbol "R" or "S" (or "Rp" or "Sp") depending on the configuration of the substituents around the steric atom, e.g., steric carbon, phosphorus or sulfur atoms. In some embodiments, one or more linkages of the compound may have an Rp or Sp configuration (e.g., one or more phosphorothioate linkages have an Rp or Sp configuration). The configuration of each phosphorothioate linkage may be independent of the other phosphorothioate linkage (e.g., one phosphorothioate linkage has the Rp configuration and the second phosphorothioate linkage has the Sp configuration). In various embodiments, the STMN2 oligonucleotide can have a mixed configuration of phosphorothioate linkages. For example, an STMN2 oligonucleotide may have five phosphorothioate linkages in the Rp configuration, followed by 15 phosphorothioate linkages in the Sp configuration, followed by five phosphorothioate linkages in the Rp configuration. The present invention encompasses various stereoisomers of these compounds and mixtures thereof. Stereoisomers include enantiomers and diastereomers. Mixtures of enantiomers or diastereomers may be referred to by nomenclature as "(±)", but those skilled in the art will recognize that structures may implicitly represent chiral centers.

The individual stereoisomers of the STMN2 oligonucleotides of the present invention may be prepared synthetically from commercially available starting materials containing asymmetric or stereocenters or by preparing racemic mixtures followed by resolution methods well known to those of ordinary skill in the art. These splitting methods are exemplified by: (1) attaching the enantiomeric mixture to a chiral auxiliary, separating the resulting diastereomeric mixture by recrystallization or chromatography, and releasing the optically pure product from the auxiliary, (2) forming a salt with an optically active resolving agent, or (3) separating the optically enantiomeric mixture directly on a chiral chromatographic column. The stereoisomer mixture may also be resolved into its constituent stereoisomers by well known methods, such as chiral phase gas chromatography, chiral phase supercritical fluid chromatography, chiral phase simulated moving bed chromatography, chiral phase high performance liquid chromatography, crystallizing a compound as a chiral salt complex, or crystallizing a compound in a chiral solvent. Stereoisomers may also be obtained from stereoisomerically pure intermediates, reagents and catalysts by well known asymmetric synthetic methods.

The STMN2 oligonucleotides disclosed herein can exist in solvated and unsolvated forms with pharmaceutically acceptable solvents such as water, ethanol, and the like, and the present invention is intended to include solvated and unsolvated forms.

The present disclosure also includes isotopically-labeled compounds of the present invention (i.e., isotopically-labeled STMN2 oligonucleotides) which are identical to those recited herein, except that one or more atoms are replaced by an atom having an atomic mass or mass number different from the atomic mass or mass number found in bulk in nature. Examples of isotopes that can be incorporated into compounds of the invention include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorus, fluorine and chlorine, such as, respectively ² H、 ³ H、 ¹¹ C、 ¹³ C、 ¹⁴ C、 ¹⁵ N、 ¹⁸ O、 ¹⁷ O、 ³¹ P、 ³² p、 ³³ P、 ³⁵ S、 ¹⁸ F and F ³⁶ Cl。

Certain isotopically-labeled disclosed compounds (e.g., with ³ H、 ¹⁴ C or ³⁵ S labeled) may be used in compound and/or substrate tissue distribution assays. Tritiated (i.e ³ H) Carbon 14 (i.e ¹⁴ C) Or (b) ³⁵ S-methionine isotopes because they are easy to prepare and detectable. In addition, the use of heavier isotopes (such as deuterium (i.e. ² H) Substitution) may provide certain therapeutic advantages due to higher metabolic stability (e.g., increased in vivo half-life or reduced dosage requirements), and thus may be preferred in certain circumstances.

As used herein, "2' -O- (2-methoxyethyl)" (also 2' -MOE and 2' -O (CH) ₂ ) ₂ OCH ₃ And MOE) refers to O-methoxyethyl modification of the 2' position of the furanose ring. In the present disclosure, 2'-O- (2-methoxyethyl) is used interchangeably as "2' -O-methoxyethyl". The sugar moiety in nucleosides modified with 2' -MOEs is a modified sugar.

As used herein, "2' -MOE nucleoside" (also 2' -O- (2-methoxyethyl) nucleoside) means a nucleoside comprising a sugar moiety modified with a 2' -MOE.

As used herein, "2 '-substituted nucleoside" means a nucleoside comprising a substituent other than H or OH at the 2' -position of the furanose ring. In certain embodiments, the 2' substituted nucleoside includes a nucleoside having a bicyclic sugar modification.

As used herein, "5, methylcytosine" (5-MeC) means a cytosine modified with a methyl group attached to the 5 position. 5-methylcytosine (5-MeC) is a modified nucleobase.

As used herein, "bicyclic sugar" means a furanose ring modified by bridging of two atoms. Bicyclic sugar is a modified sugar.

As used herein, "bicyclic nucleoside" (also BNA) means a nucleoside having a sugar moiety comprising a bridge connecting two carbon atoms of a sugar ring, thereby forming a bicyclic system. In certain embodiments, the bridge connects the 4 '-carbon and the 2' -carbon of the sugar ring.

As used herein, "cap structure" or "end cap moiety" means a chemical modification that has been incorporated at either end of an antisense compound.

As used herein, "cEt" or "constrained ethyl" means a bicyclic nucleoside having a sugar moiety comprising a bridge connecting a 4 '-carbon and a 2' -carbon, wherein the bridge has the formula: 4' -CH (CH) ₃ )-O-2’。

As used herein, "constrained ethyl nucleoside" (also a cEt nucleoside) means a nucleoside comprising a bicyclic sugar moiety comprising 4' -CH (CH) ₃ ) -O-2' bridge. In some embodiments, the cEt may be modified. In some embodiments, the cEt may be S-cEt (in S-constrained ethyl 2'-4' -bridged nucleic acids). In some other embodiments, the cEt may be R-cEt.

As used herein, "internucleoside linkage" refers to covalent linkage between adjacent nucleosides in an oligonucleotide. In some embodiments, as used herein, "non-natural linkage" refers to "modified internucleoside linkage".

As used herein, "contiguous" in the context of an oligonucleotide refers to a nucleoside, nucleobase, sugar moiety, or internucleoside linkage immediately adjacent to one another. For example, "contiguous nucleobases" refers to nucleobases immediately adjacent to each other in sequence. As an opposite example, two nucleosides separated by a spacer are discontinuous.

As used herein, "locked nucleic acid" or "LNA nucleoside" means that the nucleic acid monomer has a bridge (e.g., a methylene, ethylene, aminooxy, or oxyimino bridge) connecting two carbon atoms between the 4 'and 2' positions of the nucleoside sugar unit, thereby forming a bicyclic sugar. Examples of such bicyclic sugars include, but are not limited to, (A) alpha-L-methyleneoxy (4' -CH) ₂ -O-2 ') LNA, (B) beta-D-methyleneoxy (4' -CH) ₂ -O-2 ') LNA, (C) ethoxy (4' - (CH) ₂ ) ₂ -O-2') LNA, (D) aminooxyAnd->Oxoamino->Wherein R is H, C ₁ -C ₁₂ Alkyl or protecting groups (see U.S. patent No. 7,427,672, published on 9/23/2008).

As used herein, LNA compounds include, but are not limited to, compounds having at least one bridge between the 4 'and 2' positions of the sugar, wherein each of the bridges independently comprises 1 or 2 to 4 groups independently selected from the group consisting of- [ C (R ₁ )(R ₂ )] _n -，-C(R ₁ )＝C(R ₂ )-，-C(R ₁ )＝N-，-C(＝NR ₁ )-，-C(＝O)-，-C(＝S)-，-O-，-Si(R ₁ ) ₂ -，-S(＝O) _x -and-N (R) ₁ ) -a linking group; wherein: x is 0, 1 or 2; n is 1, 2, 3 or 4; each R ₁ And R is ₂ Independently H, a protecting group, hydroxy, C ₁ -C ₁₂ Alkyl, substituted C ₁ -C ₁₂ Alkyl, C ₂ -C ₁₂ Alkenyl, substituted C ₂ -C ₁₂ Alkenyl, C ₂ -C ₁₂ Alkynyl, substituted C ₂ -C ₁₂ Alkynyl, C ₅ -C ₂₀ Aryl, substituted C ₅ -C ₂₀ Aryl, heterocyclyl, substituted heterocyclyl, heteroaryl, substituted heteroaryl, C ₅ -C ₇ Alicyclic group, substituted C ₅ -C ₇ Alicyclic, halogen, OJ ₁ 、NJ ₁ J ₂ 、SJ ₁ 、N ₃ 、COOJ ₁ Acyl (C (=o) -H), substituted acyl, CN, sulfonyl (S (=o) ₂ -J ₁ ) Or sulfinyl (sulfoxyl) (S (=O) -J) ₁ ) The method comprises the steps of carrying out a first treatment on the surface of the Each J ₁ And J ₂ H, C independently ₁ -C ₁₂ Alkyl, substituted C ₁ -C ₁₂ Alkyl, C ₂ -C ₁₂ Alkenyl, substituted C ₂ -C ₁₂ Alkenyl, C ₂ -C ₁₂ Alkynyl, substituted C ₂ -C ₁₂ Alkynyl, C ₅ -C ₂₀ Aryl, substituted C ₅ -C ₂₀ Aryl, acyl (C (=o) -H), substituted acyl, heterocyclyl, substituted heterocyclyl, C ₁ -C ₁₂ Aminoalkyl, substituted C ₁ -C ₁₂ Aminoalkyl or a protecting group.

Examples of 4'-2' bridging groups encompassed within the definition of LNA include, but are not limited to, one of the following formulas: - [ C (R) ₁ )(R ₂ )] _n -、-[C(R ₁ )(R ₂ )] _n -O-、-C(R ₁ R ₂ )-N(R ₁ ) -O-or-C (R) ₁ R ₂ )-O-N(R ₁ ) -. In addition, other bridging groups encompassed within the definition of LNA are 4' -CH ₂ -2’、4’-(CH ₂ ) ₂ -2’、4’-(CH ₂ ) ₃ -2’、4’-CH ₂ -O-2’、4’-(CH ₂ ) ₂ -O-2’、4’-CH ₂ -O-N(R ₁ ) -2 'and 4' -CH ₂ -N(R ₁ ) -O-2' -bridge, wherein each R ₁ And R is ₂ Independently H, a protecting group or C ₁ -C ₁₂ An alkyl group.

Also included within the definition of LNA according to the invention is LNA, wherein the 2' -hydroxy group of the ribosyl sugar ringThe group is attached to the 4' carbon atom of the sugar ring, thereby forming a bridge to form a bicyclic sugar moiety. The bridge may be a methylene group (-CH) linking the 2 'oxygen atom and the 4' carbon atom ₂ The (-) group for which the term methyleneoxy (4' -CH) is used ₂ -O-2') LNA. Furthermore, as regards the bicyclic sugar moiety having an ethylene bridging group in this position, the term ethyleneoxy (4' -CH ₂ CH ₂ -O-2') LNA. A-L-methyleneoxy (4' -CH) ₂ -O-2 '), methyleneoxy (4' -CH ₂ The isomers of-O-2') LNAs are also encompassed within the definition of LNA as used herein.

As used herein, "spacer" refers to a nucleoside replacement group (e.g., a non-nucleoside group that replaces a nucleoside present in a STMN2 parent oligonucleotide). The spacer is characterized by a lack of nucleotide bases and replacement of the nucleoside sugar moiety with a non-sugar substituent. The non-sugar substituent groups of the spacer lack aldehyde, ketone, acetal, hemi-acetal or hemi-acetal groups. Thus, the non-sugar substituent groups of the spacer can be attached to the 3 'and 5' positions of the nucleoside adjacent to the spacer through the internucleoside linker described herein, but cannot form covalent bonds with the nucleobase group (i.e., cannot attach the nucleobase to another group in the oligonucleotide, such as an internucleoside linkage, a conjugate group, or a terminal group). In general, STMN2 oligonucleotides with spacers are described with respect to STMN2 parent oligonucleotides, wherein the spacers replace nucleosides of the STMN2 parent oligonucleotides. In all embodiments of the disclosure, the spacer cannot hybridize to a nucleoside comprising a nucleobase at the corresponding position of the STMN2 transcript within the order of the number of lengths of the AON oligonucleotides (i.e., if the spacer is positioned after nucleoside 4 of the AON (i.e., from position 5 'to the 5' end), the spacer is not complementary to the nucleoside (A, C, G or U) at the same corresponding position of the target STMN2 transcript).

As used herein, "mismatched" or "non-complementary group" refers to the case where a group (e.g., nucleobase) of a first nucleic acid cannot pair with a corresponding group (e.g., nucleobase) of a second or target nucleic acid.

As used herein, "modified internucleoside linkage" refers to substitution or any change in a naturally occurring internucleoside linkage (e.g., a phosphodiester internucleoside linkage).

As used herein, "modified nucleobase" means any nucleobase other than adenine, cytosine, guanine, thymine or uracil. Examples of modified nucleobases include 5-methylcytosine, pseudouridine or 5-methoxyuridine. "unmodified nucleobases" means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).

As used herein, "modified nucleoside" means a nucleoside having independently a modified sugar moiety and/or a modified nucleobase. A universal base is a modified nucleobase that can pair with any of five unmodified nucleobases. Modified nucleosides include abasic nucleosides, which lack nucleobases. However, the modified nucleoside does not include a spacer or other group that is not capable of linking nucleobases.

As used herein, a "linked nucleoside" is a nucleoside that is linked in a continuous sequence (i.e., no additional nucleosides are present between the linked nucleosides). In various embodiments, the oligonucleotides may have different segments of linked nucleosides connected by a spacer. Herein, a spacer (i.e., a nucleoside replacement) is not considered a nucleoside, and thus, a linked nucleoside that divides the oligonucleotide into two segments. The oligonucleotide may have a first segment of Y linked nucleosides (e.g., Y nucleosides linked in a contiguous sequence), followed by a spacer, and then a second segment of Z linked nucleosides. Here, Y and Z linked nucleosides are described in terms of the 5 'to 3' direction or the 3 'to 5' direction. In various embodiments, the first segment consists of 7 or fewer linked nucleosides (e.g., y=7 or less) and the second segment consists of 8 or more linked nucleosides (e.g., z=8 or more).

As used herein, "modified oligonucleotide" means an oligonucleotide comprising at least one (i.e., one or more) modified internucleoside linkage, modified sugar, and/or modified nucleobase.

As used herein, "modified sugar" or "modified sugar moiety" means a modified furanosyl sugar moiety or a modified sugar moiety having other than a furanosyl moiety that can link a nucleobase to another group, such as an internucleoside linkage, a conjugate group, or a terminal group in an oligonucleotide.

As used herein, "monomer" means a single unit of oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

As used herein, "motif" means both unmodified and modified nucleoside patterns in antisense compounds.

As used herein, "native sugar moiety" means a sugar moiety present in DNA (2 '-H) or RNA (2' -OH).

As used herein, "naturally occurring internucleoside linkages" means 3 'to 5' phosphodiester linkages.

As used herein, "non-complementary nucleobases" refers to nucleobase pairs that do not form hydrogen bonds with each other or otherwise support hybridization.

As used herein, "nucleic acid" refers to a molecule consisting of monomeric nucleotides. Nucleic acids include, but are not limited to, ribonucleic acid (RNA), deoxyribonucleic acid (DNA), single-stranded nucleic acids, double-stranded nucleic acids, non-coding RNAs, small interfering ribonucleic acids (siRNA), short hairpin RNAs (shRNA), and micrornas (miRNA).

As used herein, "nucleobase" means a heterocyclic moiety capable of base pairing with a base of another nucleic acid.

As used herein, "nucleobase complementarity" refers to a nucleobase that is capable of base pairing with another nucleobase. For example, in DNA, adenine (a) is complementary to thymine (T). For example, in RNA adenine (A) is complementary to uracil (U). In certain embodiments, complementary nucleobases refer to nucleobases of antisense compounds capable of base pairing with nucleobases of their target nucleic acids. For example, if a nucleobase at a position of an antisense compound is capable of hydrogen bonding with a nucleobase at a position of a target nucleic acid, the hydrogen bonding position between the oligonucleotide and the target nucleic acid is considered to be complementary at that nucleobase pair.

As used herein, "nucleobase sequence" means the order of nucleobases independent of any sugar, linkage, and/or nucleobase modification.

As used herein, "nucleoside" refers to a nucleobase linked to a sugar. The term "nucleoside" also includes "modified nucleosides" that independently have modified sugar moieties and/or modified nucleobases.

As used herein, "nucleoside mimetics" include those structures for replacing a sugar or sugar and base at one or more positions of an oligomeric compound and not necessarily replacing a linkage, such as, for example, nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclic or tricyclic sugar mimetics (e.g., non-furanose sugar units). Nucleotide mimics include those structures used to replace nucleosides and linkages at one or more positions of an oligomeric compound, such as, for example, peptide nucleic acids or morpholinos (morpholinos linked by phosphorodiamidate or other non-phosphodiester linkages). Sugar substitutes overlap with the somewhat broader term nucleoside mimics, but are only intended to indicate substitution of sugar units (furanose rings). The tetrahydropyranyl ring provided herein is illustrative of an example of a sugar substitute in which the furanose sugar group has been replaced with a tetrahydropyranyl ring system. "mimetic" refers to a group that replaces a sugar, nucleobase, and/or internucleoside linkage. Typically, a mimetic is used instead of a sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained to hybridize to the selected target.

As used herein, "nucleotide" means a nucleoside having a phosphate group covalently attached to the sugar portion of the nucleoside.

As used herein, "oligomeric compound" or "oligomer" refers to a polymer of linked monomer subunits capable of hybridizing to at least one region of a nucleic acid molecule.

As used herein, "oligonucleotide" means a polymer of one or more segments of linked nucleosides, each of which may be modified or unmodified independently of the other.

As used herein, a "hot spot region" is a series of nucleobases on a target nucleic acid that are amenable to the regulation of oligomeric compound-mediated splicing of the target nucleic acid.

As used herein, "hybridization" means pairing or annealing of complementary oligonucleotides and/or nucleic acids. Although not limited to a particular mechanism, the most common hybridization mechanism involves hydrogen bonding, which may be Watson-Crick, hoosteen or reverse Hoisteen hydrogen bonding between complementary nucleobases.

As used herein, "an amount of increased activity" refers to more transcriptional expression, more accurate splicing resulting in expression of full length mature mRNA and/or protein, and/or more activity relative to transcriptional expression or activity in an untreated or control sample.

Antisense therapeutic agent

Antisense therapeutics are a class of nucleic acid-based compounds that can be used to regulate transcripts such as mRNA. In various embodiments, antisense therapeutic agents comprise one or more spacers and may be used to regulate transcripts transcribed from a gene, such as STMN2 pre-mRNA comprising cryptic exons.

Antisense therapeutics can be compounds based on single-or double-stranded deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or DNA/RNA chemical analogs. In general, antisense therapeutics are designed to include sequences that are complementary or nearly complementary to the mRNA or pre-mRNA sequence transcribed from a given gene to promote binding between the antisense therapeutic and the pre-mRNA or mRNA. In certain embodiments, the antisense therapeutic agent functions as follows: by binding to the mRNA or pre-mRNA, thereby inhibiting protein translation, altering pre-mRNA splicing to mature mRNA (e.g., by preventing binding of an appropriate protein such as a splice activation protein), and/or causing destruction of the mRNA. In certain embodiments, the antisense therapeutic sequence is complementary to a portion of the sense sequence of the target gene or mRNA. In certain embodiments, the antisense therapeutic agents described herein are oligonucleotide-based compounds that include an oligonucleotide sequence complementary to a pre-mRNA sense or a portion thereof and one or more spacers. In certain embodiments, the antisense therapeutic agents described herein may also be nucleoside analog-based compounds.

In certain embodiments, an oligonucleotide (such as disclosed herein) may be 5 to 100 oligonucleotide units in length, for example 10 to 60 oligonucleotide units in length, for example 12 to 50 oligonucleotide units in length, 14 to 40 oligonucleotide units in length, 10 to 30 oligonucleotide units in length, for example 14 to 25 or 15 to 22 oligonucleotide units in length, or an oligonucleotide sequence of 18, 19, 20, 21, 22, 23, 24 or 25 oligonucleotide units in length. As used herein, "oligonucleotide unit" refers to a nucleoside (e.g., a nucleoside including a sugar and/or nucleobase) or nucleoside replacement group (e.g., a spacer) of an oligonucleotide.

In a particular embodiment, the length of the oligonucleotide is 25 oligonucleotide units. In a particular embodiment, the length of the oligonucleotide is 23 oligonucleotide units. In a particular embodiment, the length of the oligonucleotide is 21 oligonucleotide units. In a particular embodiment, the length of the oligonucleotide is 19 oligonucleotide units. In various embodiments, the length of the oligonucleotide is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units. In various embodiments, the length of the oligonucleotide is at least 18 oligonucleotide units. In various embodiments, the length of the oligonucleotide is at least 19 oligonucleotide units. In various embodiments, the length of the oligonucleotide is at least 20 oligonucleotide units. In various embodiments, the length of the oligonucleotide is at least 21 oligonucleotide units. In various embodiments, the length of the oligonucleotide is at least 22 oligonucleotide units. In various embodiments, the length of the oligonucleotide is at least 23 oligonucleotide units. In various embodiments, the length of the oligonucleotide is at least 24 oligonucleotide units. In various embodiments, the length of the oligonucleotide is at least 25 oligonucleotide units.

In certain embodiments, the AON can include chemically modified nucleosides (e.g., 2 '-O-methylated nucleosides or 2' -O- (2-methoxyethyl) nucleosides) as well as modified internucleoside linkages (e.g., phosphorothioate linkages). In certain embodiments, an AON described herein includes an oligonucleotide sequence that is complementary to an RNA sequence, such as an STMN2 mRNA sequence. In certain embodiments, an AON described herein can include chemically modified nucleosides and modified internucleoside linkages (e.g., phosphorothioate linkages). In certain embodiments, an AON described herein includes one or more spacers.

In various embodiments, the oligonucleotide comprises one or more spacers. In a particular embodiment, the oligonucleotide comprises a spacer. In various embodiments, the oligonucleotide comprises two spacers. For example, an oligonucleotide includes 23 oligonucleotide units having 21 nucleobases and two nucleoside replacement groups (e.g., two spacers). Further embodiments of oligonucleotides with one spacer and oligonucleotides with two spacers are described herein.

In some embodiments, the antisense oligonucleotide may be, but is not limited to, an inhibitor of a gene transcript (e.g., shRNA, siRNA, PNA, LNA, 2 '-O-methyl (2' Ome) Antisense Oligonucleotide (AON), 2'-O- (2-Methoxyethyl) (MOE) AON, or morpholino oligonucleotide (e.g., phosphorodiamidate Morpholino (PMO)), or a composition comprising such a compound, in some embodiments, the oligonucleotide is an Antisense Oligonucleotide (AON), including 2' Ome (e.g., AON comprising one or more 2 'Ome-modified saccharides), MOE (e.g., AON comprising one or more MOE-modified saccharides), peptide nucleic acid (e.g., AON comprising one or more N- (2-aminoethyl) -glycine units linked by amide linkages or carbonylmethylene linkages as a repeating unit in place of a saccharide-phosphate backbone), locked nucleic acid (e.g., AON comprising one or more locked ribose), and may be a 2' -deoxynucleotide or a mixture of 2'Ome nucleotides, e.g., AOC comprising one or more 2' Ome-modified saccharides, AOE (e.g., AON comprising one or more methyl-modified saccharides), AOE (e.g., one or more N, one or more fluoro-substituted AOE-nucleotides) (e.g., one or more cMOS-amino-nucleotides comprising one or more of one or more fluoro-phospho-nucleotides, AON comprising one or more tcDNA modifying sugars), 2'-O,4' -C-ethylene-bridging nucleic acid (ENA) (e.g., AON comprising one or more ENA modifying sugars) or Hexitol Nucleic Acid (HNA) (e.g., AON comprising one or more HNA modifying sugars). In some embodiments, the AON comprises one or more internucleoside linkages independently selected from the group consisting of: phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, phosphorothioate linkages, phosphorodiamidate Morpholino (PMO) (morpholino) linkages, PNA linkages, or any combination of phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, phosphorothioate linkages, phosphorodiamidate Morpholino (PMO) (morpholino) linkages, PNA linkages. In some embodiments, the STMN2 AON comprises one or more phosphorothioate linkages, phosphodiester linkages, or a combination of phosphorothioate and phosphodiester linkages.

Peptide Nucleic Acids (PNAs) are short, artificially synthesized polymers with structures that mimic DNA or RNA. PNAs comprise a backbone consisting of repeating N- (2-aminoethyl) -glycine units linked by peptide bonds. In certain embodiments, PNAs described herein can be used as antisense therapeutics that bind to RNA sequences with high specificity and increase, restore, and/or stabilize levels (e.g., full length STMN2 mRNA or protein levels) and/or activities (e.g., biological activities, such as STMN2 activity).

Locked Nucleic Acid (LNA) is an oligonucleotide sequence comprising one or more modified RNA nucleotides in which the ribose moiety is modified with an additional bridge linking 2 'oxygen and 4' carbon. LNA is considered to have a higher Tm than a similar oligonucleotide sequence. In certain embodiments, LNAs described herein may be used as antisense therapeutics that bind with high specificity to RNA sequences. For example, the LNA can bind to the STMN2 pre-RNA and suppress premature polyadenylation of the STMN2 pre-mRNA and increase, restore, and/or stabilize STMN2 levels (e.g., STMN2 mRNA or protein levels) and/or activities (e.g., biological activities, such as STMN2 activity).

Morpholino oligomers are oligonucleotide compounds that include a DNA base attached to the backbone of a methylenemorpholine ring linked by a phosphorodiamidate group. In certain embodiments, morpholino oligomers of the invention can be designed to bind to a particular pre-RNA sequence of interest. For example, morpholino oligomers bind to the STMN2 pre-RNA, thereby suppressing premature polyadenylation of the pre-mRNA and increasing, restoring, and/or stabilizing STMN2 levels (e.g., STMN2 mRNA or protein levels) and/or activities (e.g., biological activities, such as STMN2 activity). In certain embodiments, the STMN2 morpholino oligomers described herein are useful as antisense therapeutics that bind with high specificity to STMN2 pre-mRNA sequences and block premature polyadenylation of STMN2 pre-mRNA and increase, restore, and/or stabilize STMN2 levels (e.g., STMN2 mRNA or protein levels) and/or activities (e.g., biological activities, e.g., STMN2 activity). In certain embodiments, the STMN2 morpholino oligomers described herein can also be used to bind to STMN2 pre-mRNA sequences, alter STMN2 pre-mRNA splicing and STMN2 gene expression, and increase, restore, and/or stabilize STMN2 levels (e.g., STMN2 mRNA or protein levels) and/or activities (e.g., biological activities, such as STMN2 activity).

STMN2 oligonucleotides complementary to STMN2 transcripts with cryptic exons

In some embodiments, the STMN2 AON comprises a sequence that is 85% to 98% complementary to the sequence of seq id no: sequences sharing at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity with a region of an STMN2 transcript comprising a cryptic exon (e.g., SEQ ID NO:1339 or SEQ ID NO: 1341). In some embodiments, the STMN2 AON comprises a sequence that is 90% to 95% complementary to the sequence of seq id no: sequences sharing at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity with a region of an STMN2 transcript comprising a cryptic exon (e.g., SEQ ID NO:1339 or SEQ ID NO: 1341). In particular embodiments, the STMN2 AON comprises a sequence that is 85% to 90% complementary to the sequence: sequences sharing at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity with a region of an STMN2 transcript comprising a cryptic exon (e.g., SEQ ID NO:1339 or SEQ ID NO: 1341). In particular embodiments, the STMN2 AON comprises a sequence that is 84% to 88% complementary to the sequence: sequences sharing at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity with a region of an STMN2 transcript comprising a cryptic exon (e.g., SEQ ID NO:1339 or SEQ ID NO: 1341). In particular embodiments, the STMN2 AON comprises a sequence that is 89% to 92% complementary to the sequence: sequences sharing at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity with a region of an STMN2 transcript comprising a cryptic exon (e.g., SEQ ID NO:1339 or SEQ ID NO: 1341). In particular embodiments, the STMN2 AON comprises a sequence that is 94% to 96% complementary to the sequence: sequences sharing at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity with a region of an STMN2 transcript comprising a cryptic exon (e.g., SEQ ID NO:1339 or SEQ ID NO: 1341).

In various embodiments, the STMN2 AON comprises an amino acid sequence that hybridizes to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 or SEQ ID NO: the equal length portion of any of 1392-1664 has sequences of at least 85% identity. In various embodiments, the STMN2 AON comprises an amino acid sequence that hybridizes to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 or SEQ ID NO: the equal length portion of any of 1392-1664 has sequences at least 90% identical.

In various embodiments, the region of the STMN2 transcript targeted by the STMN2 AON is a cryptic exon sequence. In various embodiments, the region of the STMN2 transcript targeted by the STMN2 AON is a sequence located upstream or downstream (e.g., 100 or 200 bases upstream or downstream) of the cryptic exon sequence. In some embodiments, the STMN2 AON comprises a spacer and has a segment with up to 7 linked nucleosides. In some embodiments, the STMN2 AON comprises a spacer and has a segment with up to 6, 5, 4, 3, or 2 linked nucleosides.

STMN2 AON binding specificity can be measured by measuring parameters such as dissociation constant, melting temperatureOr other criteria such as changes in protein or RNA expression levels or other assays measuring STMN2 activity or expression.

In some embodiments, the STMN2 AON may comprise a non-double stranded oligonucleotide. In some embodiments, the STMN2 AON may comprise a duplex of two oligonucleotides, wherein the first oligonucleotide comprises a nucleobase sequence that is fully or nearly fully complementary to the STMN2 pre-mRNA sequence and the second oligonucleotide comprises a nucleobase sequence that is complementary to the nucleobase sequence of the first oligonucleotide.

In some embodiments, the STMN2 AON may target STMN2 pre-mRNA comprising cryptic exons produced by STMN2 genes of one or more species. For example, the STMN2 AON may target a mammalian STMN2 gene, e.g., a STMN2 pre-mRNA of a human (i.e., homo sapiens) STMN2 gene, which includes a cryptic exon. In particular embodiments, the STMN2 AON targets a human STMN2 pre-mRNA that includes a cryptic exon. In some embodiments, the STMN2 AON comprises a nucleobase sequence that is complementary to a nucleobase sequence of a STMN2 gene or STMN2 pre-mRNA (which includes a cryptic exon) or portion thereof.

The STMN2 AON described herein comprises an antisense oligonucleotide comprising the oligonucleotide sequences listed in table 1 below:

TABLE 1 STM N2 AON sequences, each incorporating one or more of the spacers described in this disclosure, for generating oligonucleotides of the invention

/>

* At least one (i.e., one or more) nucleoside linkages of the oligonucleotide sequence is independently selected from phosphorothioate linkages, alkyl phosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkyl phosphonate linkages, 3-methoxypropyl phosphonate linkages, methylphosphonate linkages, aminoalkyl phosphotriester linkages, alkylene phosphonate linkages, phosphonite linkages, phosphoramidate linkages, phosphorothioate linkages, phosphorodiamidate (e.g., comprising Phosphorodiamidate Morpholino (PMO), 3 'aminoribose or 5' aminoribose) linkages, aminoalkyl phosphoramidate linkages, phosphorothioate alkyl phosphonate linkages, phosphorothioate alkyl phosphotriester linkages, phosphorothioate linkages, phosphoroselenate linkages, and phosphoroboronate linkages.

Table 2 below identifies other STMN2 AON sequences:

TABLE 2 other STMN2 AON sequences (corresponding to SEQ ID NOS: 1-446 but replacing thymine bases with uracil bases)

/>

Table 3 below identifies exemplary STMN2 AON sequences:

TABLE 3 exemplary STMN2 AON sequences, each incorporating one or more of the spacers described in this disclosure, for use in generating oligonucleotides of the invention

In some embodiments, all internucleoside linkages of the STMN2 AON oligonucleotides listed in table 3 are phosphorothioate linkages (except when a spacer is present, the linkages may or may not be phosphorothioate linkages), and each of the linked nucleosides of the oligonucleotides is a 2'-O- (2-methoxyethyl) (2' -MOE) nucleoside, and each "C" is replaced with a 5-MeC. In some embodiments, all internucleoside linkages of the STMN2 AON oligonucleotides listed in table 3 are phosphorothioate linkages, and each of the linked nucleosides of the oligonucleotides is a 2'-O- (2-methoxyethyl) (2' -MOE) nucleoside, and not all "C" or "C" are not replaced with a 5-MeC.

Table 4 below identifies other exemplary STMN2 AON sequences:

TABLE 4 other exemplary STMN2 AON sequences (corresponding to the AON shown in TABLE 3 but with uracil bases substituted thymine bases)

STMN2 transcripts with cryptic exons

In one embodiment, the STMN2 AON targets a region of an STMN2 transcript comprising a cryptic exon sequence, the STMN2 transcript comprising the sequence provided as SEQ ID NO:1399, sequence.

The cryptic exon sequences within the STMN2 transcript are provided as SEQ ID NOs: 1340.

(source: NCBI reference sequence: NC-000008.11).

In various embodiments, STMN2 transcripts with cryptic exons are identical to SEQ ID NOs: 1339 share 90-100% identity. In various embodiments, STMN2 transcripts with cryptic exons are identical to SEQ ID NOs: 1341 shares at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity.

In one embodiment, the STMN2 transcript with the cryptic exon may comprise a pre-mRNA STMN2 transcript. In one embodiment, the STMN2 transcript with the cryptic exon may comprise the sequence provided as SEQ ID NO: 1341.

/>

Oligonucleotides targeting regions of STMN2 transcripts

In various embodiments, an STMN2 AON disclosed herein and a polypeptide comprising a sequence identical to SEQ ID NO:1341 shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to a specific region of a STMN2 transcript (e.g., STMN2 pre-mRNA comprising a cryptic exon). In some embodiments, the STMN2 AON comprises and comprises a sequence identical to SEQ ID NO:1339 or SEQ ID NO:1341 shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) of the sequence of identity to a particular region of a STMN2 transcript (e.g., STMN2 pre-mRNA comprising a cryptic exon). In some embodiments, the STMN2 AON comprises a sequence that is 85% to 98% complementary to a specific region of an STMN2 transcript. In some embodiments, the STMN2 AON comprises a sequence that is 90% to 95% complementary to a specific region of an STMN2 transcript.

In some embodiments, an STMN2 AON (e.g., STMN2 AON) has a segment with up to 7 linked nucleosides. In some embodiments, the STMN2 AON has a segment with up to 6, 5, 4, 3, or 2 linked nucleosides. Segments of the STMN2 AON may be separated from other segments of the STMN2 AON by spacers. Segments of STMN2 AON and a sequence comprising a sequence identical to SEQ ID NO:1339 or SEQ ID NO:1341 shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity with a particular region of a STMN2 transcript (e.g., a STMN2 transcript comprising a cryptic exon).

In some embodiments, the STMN2 AON targets a specific portion of an STMN2 transcript comprising the amino acid sequence of SEQ ID NO: any of positions 144-168, 173-197, 185-209 or 237-261 of 1339. In some embodiments, the STMN2 AON targets a specific portion of a STMN2 transcript comprising any one of positions 121-144, 146-170, 150-172, 150-170, 150-174, 169-193, 170-194, 171-195, 172-196, 197-221, 249-273, 252-276, or 276-300. In some embodiments, the STMN2 AON targets a specific portion of an STMN2 transcript, the specific portion of an STMN2 transcript comprising the amino acid sequence of SEQ ID NO:1339, 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, or 148-168. In some embodiments, the STMN2 AON targets a specific portion of an STMN2 transcript, the specific portion of an STMN2 transcript comprising the amino acid sequence of SEQ ID NO: any of positions 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, or 179-197 of 1339. In some embodiments, the STMN2 AON targets a specific portion of an STMN2 transcript, the specific portion of an STMN2 transcript comprising the amino acid sequence of SEQ ID NO: any of positions 185-205, 187-209, 189-209, or 191-209 of 1339. In some embodiments, the STMN2 AON targets a specific portion of an STMN2 transcript, the specific portion of an STMN2 transcript comprising the amino acid sequence of SEQ ID NO: any of positions 237-255, 237-259, 239-261, 241-261 or 243-261 of 1339.

In some embodiments, the STMN2 AON targets a specific portion of an STMN2 transcript consisting of SEQ ID NO:1339 at any of positions 144-168, 173-197, 185-209 or 237-261. In some embodiments, the STMN2 AON targets a specific portion of an STMN2 transcript consisting of SEQ ID NO:1339, 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, or 148-168. In some embodiments, the STMN2 AON targets a specific portion of an STMN2 transcript consisting of SEQ ID NO:1339, 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, or 179-197. In some embodiments, the STMN2 AON targets a specific portion of an STMN2 transcript consisting of SEQ ID NO:1339, from any of positions 185-205, 187-209, 189-209, or 191-209. In some embodiments, the STMN2 AON targets a specific portion of an STMN2 transcript consisting of SEQ ID NO:1339, 237-255, 237-259, 239-261, 241-261, or 243-261.

STMN2 oligonucleotide variants

In various embodiments, the STMN2 AON includes different variants, hereinafter STMN2 AON variants. An STMN2 AON variant can be an oligonucleotide sequence of 5 to 100 nucleobases in length, e.g., 10 to 40 nucleobases in length, e.g., 14 to 40 nucleobases in length, 10 to 30 nucleobases in length, e.g., 14 to 30 nucleobases in length, e.g., 16 to 28 nucleobases in length, e.g., 19 to 23 nucleobases in length, e.g., 21 to 23 nucleobases in length, e.g., or 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length. The STMN2 AON variant may be an oligonucleotide sequence that is complementary to a STMN2 pre-mRNA sequence or a portion of a STMN2 gene sequence.

In various embodiments, the STMN2 AON variant represents a modified version of a corresponding STMN2 parent oligonucleotide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-446 or SEQ ID NO: 893-1338. In some embodiments, the STMN2 AON variant comprises a nucleobase sequence representing a sequence selected from the group consisting of SEQ ID NOs: 1-446 or SEQ ID NO: 893-1338. As one example, if the STMN2 parent oligonucleotide comprises a 25 mer (e.g., 25 nucleotide bases in length), the variant (e.g., STMN2 variant) may comprise a shorter version of the 25 mer STMN2 parent oligonucleotide (e.g., 15 mer, 17mer, 19 mer, 21 mer, or 23 mer). In one embodiment, the nucleobase sequence of a STMN2 AON variant differs from the nucleobase sequence of a corresponding STMN2 parent oligonucleotide in that 1, 2, 3, 4, 5, or 6 nucleotide bases are removed from one or both of the 3 'and 5' ends of the nucleobase sequence of the STMN2 parent oligonucleotide. In one embodiment, the corresponding STMN2 AON variant may include a 23 mer, wherein two nucleotide bases are removed from one of the 3 'and 5' ends of the 25 mer included in the STMN2 parent oligonucleotide. In one embodiment, the corresponding STMN2 AON variant may include a 23 mer, wherein one nucleotide base is removed from each of the 3 'and 5' ends of the 25 mer included in the STMN2 parent oligonucleotide. In one embodiment, the corresponding STMN2 AON variant may include a 21 mer, wherein two nucleotide bases are removed from each of the 3 'and 5' ends of the 25 mer included in the STMN2 parent oligonucleotide. In one embodiment, the corresponding STMN2 AON variant may include a 21 mer, wherein four nucleotide bases are removed from either of the 3 'and 5' ends of the 25 mer included in the STMN2 parent oligonucleotide. In one embodiment, the corresponding STMN2 AON variant may include a 19 mer, wherein three nucleotide bases are removed from each of the 3 'and 5' ends of the 25 mer included in the STMN2 parent oligonucleotide. In one embodiment, the corresponding STMN2 AON variant may include a 19 mer, wherein six nucleotide bases are removed from either of the 3 'and 5' ends of the 25 mer included in the STMN2 parent oligonucleotide.

Exemplary sequences of STMN2 AON variants are shown in tables 5A and 5B below.

TABLE 5A STMN2 oligonucleotide variant sequences

* At least one nucleoside linkage of the nucleobase sequence is selected from the group consisting of phosphorothioate linkages, alkyl phosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkyl phosphonate linkages, 3-methoxypropyl phosphonate linkages, methylphosphonate linkages, aminoalkyl phosphotriester linkages, alkylene phosphonate linkages, phosphonite linkages, phosphoramidate linkages, phosphorothioate linkages, phosphorophosphorodithioate linkages, phosphorodiamidate (e.g., comprising Phosphorodithioate Morpholino (PMO), 3 'aminoribose or 5' aminoribose) linkages, aminoalkyl phosphoramidate linkages, phosphorothioate alkyl phosphonate linkages, phosphorothioate linkages, phosphoroselenate linkages, and phosphoroboronate linkages.

Table 5B: other STMN2 oligonucleotide variant sequences

SEQ ID NO：	AON sequence (5 '. Fwdarw.3')
		1421	CCTGCAATATGAATATAATTTTA
1422	TGCAATATGAATATAATTTTAAA
		1423	CTGCAATATGAATATAATTTTAA
1424	TGCAATATGAATATAATTTTA
		1425	TCCTGCAATATGAATATAATTTT
1426	CTGCAATATGAATATAATTTT
		1427	AGTCCTGCAATATGAATATAATT
1428	TCCTGCAATATGAATATAATT
		1429	TTTCTCTCGAAGGTCTTCTGCCG
1430	CCTTTCTCTCGAAGGTCTTCTGC
		1431	CTTTCTCTCGAAGGTCTTCTGCC
1432	CTCTCGCACACACGCACACATGC
		1433	CTCTCTCGCACACACGCACACAT
1434	TCTCTCGCACACACGCACACATG
		1435	CTCTCGCACACACGCACACAT

Table 6 below identifies other variants of the STMN2 AON sequence:

TABLE 6 other STMN2 oligonucleotide variant sequences

/>

Antisense oligonucleotides with one or more spacers

In various embodiments, the antisense oligonucleotide comprises one or more spacers. In a particular embodiment, the antisense oligonucleotide comprises a spacer. In a particular embodiment, the antisense oligonucleotide comprises two spacers. In a particular embodiment, the antisense oligonucleotide comprises three spacers. In general, a spacer refers to a nucleoside replacement group that lacks a nucleotide base, and wherein the nucleoside sugar moiety is replaced with a non-sugar substituent group. The non-sugar substituent groups cannot be attached to nucleobases but can be attached to the 3 'and 5' positions of the nucleoside adjacent to the spacer through an internucleoside linker.

In certain embodiments, an oligonucleotide having one or more spacers (such as disclosed herein) may be an oligonucleotide having a length of 5 to 100 oligonucleotide units, e.g., 10 to 60 oligonucleotide units, e.g., 12 to 50 oligonucleotide units, 14 to 40 oligonucleotide units, 10 to 30 oligonucleotide units, e.g., 14 to 25 or 15 to 22 oligonucleotide units, or 18, 19, 20, 21, 22, 23, 24, or 25 oligonucleotide units in length. As used herein, "oligonucleotide unit" refers to a nucleoside (e.g., a nucleoside including a sugar and/or nucleobase) or nucleoside replacement group (e.g., a spacer) of an oligonucleotide.

In a particular embodiment, the oligonucleotide having one or more spacers is 25 oligonucleotide units in length. In a particular embodiment, the oligonucleotide having one or more spacers is 23 oligonucleotide units in length. In a particular embodiment, the oligonucleotide having one or more spacers is 21 oligonucleotide units in length. In a particular embodiment, the oligonucleotide having one or more spacers is 19 oligonucleotide units in length. In various embodiments, the oligonucleotide having one or more spacers is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length. In various embodiments, the length of an oligonucleotide having one or more spacers is at least 18 oligonucleotide units. In various embodiments, the length of the oligonucleotide having one or more spacers is at least 19 oligonucleotide units. In various embodiments, the length of an oligonucleotide having one or more spacers is at least 20 oligonucleotide units. In various embodiments, the length of the oligonucleotide having one or more spacers is at least 21 oligonucleotide units. In various embodiments, the length of an oligonucleotide having one or more spacers is at least 22 oligonucleotide units. In various embodiments, the length of the oligonucleotide having one or more spacers is at least 23 oligonucleotide units. In various embodiments, the length of an oligonucleotide having one or more spacers is at least 24 oligonucleotide units. In various embodiments, the length of an oligonucleotide having one or more spacers is at least 25 oligonucleotide units.

In various embodiments, the STMN2 AON comprises an amino acid sequence that hybridizes to SEQ ID NO: the equal length portions of any of 1451-1664 share sequences of at least 80% identity. In various embodiments, the STMN2 AON comprises an amino acid sequence that hybridizes to SEQ ID NO: the equal length portions of any of 1451-1664 share sequences of at least 85% identity. In various embodiments, the STMN2 AON comprises an amino acid sequence that hybridizes to SEQ ID NO: the equal length portions of any of 1451-1664 share sequences of at least 90% identity. In various embodiments, the STMN2 AON comprises an amino acid sequence that hybridizes to SEQ ID NO: the equal length portions of any of 1451-1664 share sequences of at least 95% identity. In various embodiments, the STMN2 AON comprises an amino acid sequence that hybridizes to SEQ ID NO: the equal length portions of any of 1451-1664 share sequences of 100% identity.

In some embodiments, the spacer is of formula (X):

/>

wherein ring a is as defined herein.

In some embodiments, the spacer is of formula (Xa):

wherein ring A is as defined herein, and-CH ₂ the-O-group is on the ring A atom adjacent to the-O-group.

As generally defined herein, ring a of formulas (X) and (Xa) is an optionally substituted 4-8 membered monocyclic cycloalkyl (e.g., ring a is cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl) or 4-8 membered monocyclic heterocyclyl, wherein the heterocyclyl contains 1 or 2 heteroatoms selected from O, S and N (e.g., ring a is oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1, 4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, azepanyl). In some embodiments, ring a is tetrahydrofuranyl. In some embodiments, ring a is tetrahydropyranyl. In some embodiments, ring a is pyrrolidinyl. In some embodiments, ring a is cyclopentyl. In some embodiments, the monocyclic cycloalkyl or monocyclic heterocyclyl is not further substituted. In some embodiments, cycloalkyl or heterocyclyl is substituted with a moiety selected from halogen (e.g., -F, -C1), -Ome, -Oet-O (CH) ₂ )Ome、-O(CH ₂ ) ₂ The 0, 1, 2 or 3 substituents of Ome and CN are further substituted. In some embodiments, the spacer is represented by formula (I), wherein:

x is selected from-CH ₂ -and-O-; and is also provided with

n is 0, 1, 2 or 3.

In some embodiments, the spacer is represented by formula (I'), wherein:

x is selected from-CH ₂ -and-O-; and is also provided with

n is 0, 1, 2 or 3.

In some embodiments, the spacer is represented by formula (Ia), wherein:

and n is 0, 1, 2 or 3.

In some embodiments, the spacer is represented by formula (Ia'), wherein:

and n is 0, 1, 2 or 3.

X is selected from-CH, as generally defined herein ₂ -and-O-. In some embodiments, X is-CH ₂ -. In other embodiments, X is-O-.

As generally defined herein, n is 0, 1, 2 or 3. In some embodiments, n is 0. In some embodiments, n is 1 or 2. In some embodiments, n is 1. In other embodiments, n is 2. In certain embodiments, n is 3.

In some embodiments, the spacer is represented by formula (II), wherein:

x is selected from-CH ₂ -and-O-.

In some embodiments, the spacer is represented by formula (II'), wherein:

x is selected from-CH ₂ -and-O.

In some embodiments, the spacer is represented by formula (Iia), wherein:

In some embodiments, the spacer is represented by formula (Iia'), wherein:

in some embodiments, the spacer is represented by formula (III), wherein:

x is selected from-CH ₂ -and-O-.

In some embodiments, the spacer is represented by formula (III'), wherein:

x is selected from-CH ₂ -and-O.

In some embodiments, the spacer is represented by formula (IIIa), wherein:

in some embodiments, the spacer is represented by formula (IIIa'), wherein:

in some embodiments, the open positions of formulas (I), (I '), (Ia '), (II '), (Iia '), (III), (IIIa) and (IIIa ') (i.e., the positions not specifically described as carrying only hydrogen atoms, including the-CH of X ₂ -groups) are further substituted with 0-3 substituents selected from halogen (e.g., -F, -Cl), -Ome, -Oet-O (CH) ₂ )Ome、-O(CH ₂ ) ₂ Ome and CN. In some embodiments, formulas (I), (I '), (Ia '), (II '), (Iia '), (III), (IIIa) and (IIIa ') are not further substituted.

As described further below, STMN2 oligonucleotides having one or more spacers are described with reference to corresponding STMN2 parent oligonucleotides. In various embodiments, a STMN2 oligonucleotide with a spacer differs from a STMN2 parent oligonucleotide in that the spacer replaces a nucleoside in the STMN2 parent oligonucleotide. As used hereinafter, the "position" of an STMN2 oligonucleotide refers to a specific position counted from the 5' end of an STMN2 oligonucleotide. In various embodiments, the spacer replaces a nucleoside at any one of positions 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 of the STMN2 parent oligonucleotide. In particular embodiments, the spacer replaces a nucleoside at one of positions 7, 8, 11, 14, 16, 19 or 22 of the STMN2 parent oligonucleotide.

In various embodiments, the STMN2 oligonucleotide comprises one spacer that replaces a nucleoside in the STMN2 parent oligonucleotide (e.g., one spacer replaces one nucleoside of the STMN2 parent oligonucleotide). In particular embodiments, the spacer replaces a nucleoside between positions 9 and 15 of the STMN2 parent oligonucleotide. In particular embodiments, the spacer replaces a nucleoside between positions 9 and 12 of the STMN2 parent oligonucleotide. In particular embodiments, the spacer replaces the nucleoside at position 10 of the STMN2 parent oligonucleotide. In particular embodiments, the spacer replaces the nucleoside at position 11 of the STMN2 parent oligonucleotide. In particular embodiments, the spacer replaces a nucleoside at position 12 of the STMN2 parent oligonucleotide. In particular embodiments, the spacer replaces a nucleoside between positions 12 and 16 of the STMN2 parent oligonucleotide. In particular embodiments, the spacer replaces the nucleoside at position 15 of the STMN2 parent oligonucleotide.

In various embodiments, an STMN2 oligonucleotide comprising one spacer has 2 segments, wherein at least one of the 2 segments has up to 11 linked nucleosides. For example, the STMN2 oligonucleotide may be 23 oligonucleotide units in length and the spacer may be located at position 12. Thus, an STMN2 oligonucleotide has 2 segments separated by a spacer, wherein two of the 2 segments are 11 nucleobases in length. In various embodiments, an STMN2 oligonucleotide comprising one spacer has 2 segments, wherein at least one of the 2 segments has up to 10 linked nucleosides. For example, the STMN2 oligonucleotide may be 21 oligonucleotide units in length and the spacer may be located at position 11. Thus, an STMN2 oligonucleotide has 2 segments separated by a spacer, wherein two of the 2 segments are 10 nucleobases in length. As another example, the STMN2 oligonucleotide may be 25 oligonucleotide units in length and the spacer may be located at position 15. Thus, an STMN2 oligonucleotide has 2 segments separated by a spacer, wherein one of the 2 segments is 14 nucleobases in length and the second of the 2 segments is 10 nucleobases in length.

In various embodiments, the STMN2 oligonucleotide comprises two spacers that each replace a nucleoside in the STMN2 parent oligonucleotide (e.g., two spacers replace two separate nucleosides of the STMN2 parent oligonucleotide). In various embodiments, the first and second spacers are separated in the oligonucleotide by at least 5 nucleobases, at least 6 nucleobases, at least 7 nucleobases, at least 8 nucleobases, at least 9 nucleobases, or at least 10 nucleobases. In particular embodiments, the first spacer and the second spacer are separated by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases. In certain embodiments, the first spacer and the second spacer are not adjacent to each other in the oligonucleotide.

In a particular embodiment, the first spacer replaces a nucleoside between positions 7 and 11 of the STMN2 parent oligonucleotide. In various embodiments, the first spacer replaces a nucleoside at positions 8 and 11, positions 9 and 11, positions 10 and 11, positions 7 and 10, positions 7 and 9, positions 7 and 8, positions 8 and 10, positions 8 and 9, or between positions 9 and 10 of the STMN2 parent oligonucleotide. In a particular embodiment, the second spacer replaces a nucleoside between positions 14 and 22 of the STMN2 parent oligonucleotide. In various embodiments, the second spacer replaces the nucleoside between 15 and 22, 16 and 22, 17 and 22, 18 and 22, 19 and 22, 20 and 22, 21 and 22, 15 and 21, 16 and 21, 17 and 21, 18 and 21, 19 and 21, 20 and 21, 15 and 20, 16 and 20, 17 and 20, 18 and 20, 19 and 20, 15 and 19, 16 and 19, 17 and 19, 18 and 19, 15 and 18, 16 and 18, 17 and 18, 15 and 17, 17 and 17, 16 and 17, or 15 and 16 of the STMN2 parent oligonucleotide.

In a preferred embodiment, the first spacer replaces a nucleoside at position 7 of the STMN2 parent oligonucleotide and the second spacer replaces a nucleoside at position 14 of the STMN2 parent oligonucleotide. In a preferred embodiment, the first spacer replaces the nucleoside at position 8 of the STMN2 parent oligonucleotide and the second spacer replaces the nucleoside at position 16 of the STMN2 parent oligonucleotide. In a preferred embodiment, the first spacer replaces the nucleoside at position 11 of the STMN2 parent oligonucleotide and the second spacer replaces the nucleoside at position 22 of the STMN2 parent oligonucleotide. In a preferred embodiment, the first spacer replaces a nucleoside at position 9 of the STMN2 parent oligonucleotide and the second spacer replaces a nucleoside at position 19 of the STMN2 parent oligonucleotide.

In various embodiments, the STMN2 oligonucleotide comprises three spacers that each replace a nucleoside in the STMN2 parent oligonucleotide (e.g., three spacers replace three separate nucleosides of the STMN2 parent oligonucleotide). In a particular embodiment, the first spacer replaces a nucleoside between positions 7 and 11 of the STMN2 parent oligonucleotide. In a particular embodiment, the second spacer replaces a nucleoside between positions 14 and 22 of the STMN2 parent oligonucleotide. In certain embodiments, the third spacer replaces a nucleoside between positions 21 and 24 of the STMN2 parent oligonucleotide. In some embodiments, the first spacer replaces a nucleoside between positions 2 and 5 of the STMN2 parent oligonucleotide. In a particular embodiment, the second spacer replaces a nucleoside between positions 8 and 12 of the STMN2 parent oligonucleotide. In a particular embodiment, the third spacer replaces a nucleoside between positions 18 and 22 of the STMN2 parent oligonucleotide.

In various embodiments, the three spacers in the STMN2 oligonucleotide are positioned such that each of the four segments of STMN2 oligonucleotide is up to 7 linked nucleosides in length. For example, an STMN2 oligonucleotide may have a first segment of 7 linked nucleosides linked to a first spacer, followed by a second segment of 7 linked nucleosides linked to the first spacer at one end and to a second spacer at the other end, followed by a third segment of 6 linked nucleosides linked to the second spacer at one end and to a third spacer at the other end, followed by a fourth segment of 6 linked nucleosides linked to the third spacer.

In various embodiments, one or more spacers are disposed in the oligonucleotide to replace one or more adenosine or thymidine (as opposed to guanine or cytosine nucleosides). For example, one or more spacers may replace one, two, three, four, five, six, seven, eight, or nine adenosine or thymidine in the oligonucleotide. In various embodiments, one or more spacers are disposed in the oligonucleotide to replace one or more guanines or cytidines (as opposed to adenosine or thymidine). For example, one or more spacers may replace one, two, three, four, five, six, seven, eight, or nine guanine or cytosine nucleosides in an oligonucleotide. In various embodiments, spacers are placed in the oligonucleotides to replace equal amounts of adenosine/thymidine and guanine/cytosine nucleosides. For example, a first spacer in the oligonucleotide may replace adenosine/thymidine and a second spacer in the oligonucleotide may replace guanine/cytosine nucleosides.

In various embodiments, one or more spacers are disposed in the oligonucleotide to control the sequence content in the oligonucleotide. For example, one or more spacers are positioned such that at least one of the spacers is located adjacent to a guanine group. In various embodiments, an oligonucleotide with a spacer may include one spacer adjacent to a guanine group, two spacers adjacent to a guanine group, three spacers adjacent to a guanine group, four spacers adjacent to a guanine group, or five spacers adjacent to a guanine group. In one embodiment, the spacer immediately precedes the guanine group in the sequence if calculated from the 5' end of the oligonucleotide. Thus, in various embodiments, an oligonucleotide having a spacer may include one spacer immediately preceding a guanine group, two spacers each immediately preceding a guanine group, three spacers each immediately preceding a guanine group, four spacers each immediately preceding a guanine group, or five spacers each immediately preceding a guanine group. In one embodiment, the guanine group is immediately followed by a spacer if calculated from the 5' end of the oligonucleotide. Thus, in various embodiments, an oligonucleotide having a spacer may include one spacer immediately following a guanine group, two spacers each immediately following a guanine group, three spacers each immediately following a guanine group, four spacers each immediately following a guanine group, or five spacers each immediately following a guanine group. In various embodiments, the spacers in the oligonucleotide may be positioned to maximize the number of spacers adjacent to the guanine group.

In various embodiments, one or more spacers are disposed in the oligonucleotide to replace one or more of adenosine or thymidine such that the one or more spacers are located adjacent to the guanine group. For example, two spacers may replace adenosine or thymidine in an oligonucleotide, each of the two spacers being located adjacent to a guanine group.

In various embodiments, STMN2 oligonucleotides with one or more spacers have a specific GC content. As used herein, GC content (or guanine-cytosine content) is guanine (G) orThe percentage of nitrogenous bases in the oligonucleotide. In various embodiments, an STMN2 oligonucleotide having one or more spacers has at least 10% gc content, at least 20% gc content, at least 25% gc content, at least 30% gc content, at least 35% gc content, at least 40% gc content, at least 45% gc content, at least 50% gc content, at least 55% gc content, at least 60% gc content, at least 65% gc content, at least 75% gc content, at least 80% gc content, at least 85% gc content, at least 90% gc content, or at least 95% gc content. In particular embodiments, STMN2 oligonucleotides having one or more spacers have a GC content of at least 30%. In particular embodiments, STMN2 oligonucleotides having one or more spacers have a GC content of at least 40%. In various embodiments, one or more spacers are disposed in the STMN2 oligonucleotide to maximize GC content. For example, instead of selecting guanine or cytosine for replacement by a spacer in an STMN2 oligonucleotide, thymine or adenine is selected for replacement by a spacer.

In various embodiments, the STMN2 oligonucleotide with the spacer is designed such that: 1) Each segment of the STMN2 oligonucleotide has up to 7 linked nucleosides, and 2) at least two, three, or four spacers are disposed adjacent to the guanine group. In some embodiments, the STMN2 oligonucleotide with the spacer is designed such that: 1) Each segment of the STMN2 oligonucleotide has up to 7 linked nucleosides, and 2) each of the two spacers precede a guanine group.

In various embodiments, the inclusion of one or more spacers in the STMN2 oligonucleotide does not reduce the effectiveness of the STMN2 oligonucleotide with the spacer in restoring full length STMN2 protein or full length STMN2 mRNA compared to the effect of the corresponding STMN2 parent oligonucleotide. In various embodiments, the inclusion of one or more spacers in the STMN2 oligonucleotide increases the effectiveness of the STMN2 oligonucleotide with a spacer in restoring full-length STMN2 protein or full-length STMN2 mRNA compared to the effect of the corresponding STMN2 parent oligonucleotide. In various embodiments, the inclusion of one or more spacers in the STMN2 oligonucleotide does not reduce the effectiveness of the STMN2 oligonucleotide with spacers in reducing the amount of STMN2 transcript with cryptic exons compared to the effect of a corresponding STMN2 parent oligonucleotide. In various embodiments, the inclusion of one or more spacers in the STMN2 oligonucleotide increases the effectiveness of the STMN2 oligonucleotide with a spacer in reducing the number of STMN2 transcripts with cryptic exons compared to the effect of a corresponding STMN2 parent oligonucleotide.

Tables 7A, 7B, 8 and 9 record exemplary STMN2 oligonucleotides with one or more spacers and their relationship to corresponding STMN2 parent oligonucleotides. Each STMN2 oligonucleotide is assigned a sequence name. As used below, the nomenclature of the sequence names is denoted as "x_spa" (for STMN2 AON with one spacer), "x_spa_spb" (for STMN2 AON with two spacers), or "x_spa_spb_spc" (for STMN2 AON with three spacers). Here, "X" refers to the length of the STMN2 AON, "a" refers to the location of the first spacer in the STMN2 AON, "B" refers to the location of the second spacer in the STMN2 AON, and "C" refers to the location of the third spacer in the STMN2 AON, if present.

In various embodiments, the STMN2 oligonucleotide comprises a spacer. In various embodiments, the STMN2 oligonucleotide is an oligonucleotide variant, such as any of a 23-mer, a 21-mer, or a 19-mer. In various embodiments, the inclusion of a spacer divides the STMN2 oligonucleotide into two separate segments, wherein at least one of the segments is up to 11 linked nucleosides in length. In various embodiments, the inclusion of a spacer divides the STMN2 oligonucleotide into two separate segments, wherein at least one of the segments is up to 10 linked nucleosides in length.

In various embodiments, the spacer is located between positions 10 and 15 of the oligonucleotide. In various embodiments, the spacer is located between positions 10 and 12 of the oligonucleotide. In a particular embodiment, the spacer is located at position 10 of the oligonucleotide. In a particular embodiment, the spacer is located at position 11 of the oligonucleotide. In a particular embodiment, the spacer is located at position 12 of the oligonucleotide. In a particular embodiment, the spacer is located at position 15 of the oligonucleotide. An example STMN2 AON with one spacer is recorded in table 7A below.

Table 7A: identification of STMN2 AON with one spacer. Here, each STMN2 AON has 2 segments, wherein at least one of the segments has at most 11 linked nucleosides.

* At least one nucleoside linkage of the nucleobase sequence is selected from phosphorothioate linkages, alkyl phosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkyl phosphonate linkages, 3-methoxypropyl phosphonate linkages, methylphosphonate linkages, aminoalkyl phosphotriester linkages, alkylene phosphonate linkages, phosphonite linkages, phosphoramidate linkages, phosphorothioate linkages, phosphorodiamidate linkages (e.g., comprising Phosphorodiamidate Morpholino (PMO), 3 'aminoribose or 5' aminoribose) linkages), aminoalkyl phosphoramidate linkages, phosphorothioate alkyl phosphonate linkages, phosphorothioate linkages, seleno phosphate linkages, and phosphoroboronate linkages.

In various embodiments, the STMN2 oligonucleotide comprises two spacers. In various embodiments, the inclusion of a spacer divides the STMN2 oligonucleotide into three separate segments, wherein at least one of the segments is up to 7 linked nucleosides in length. An example STMN2 AON with two spacers is recorded in table 7B below.

Table 7B: identification of STMN2 AON with two spacers. Here, each STMN2 AON has 3 segments, wherein at least one of the segments has at most 7 linked nucleosides.

/>

In various embodiments, the STMN2 oligonucleotide comprises three spacers. The inclusion of three spacers divides the STMN2 oligonucleotide into four separate segments. In various embodiments, the three spacers are located at different positions of the STMN2 oligonucleotide such that each of the segments of STMN2 oligonucleotide is up to 7 linked nucleosides in length. An example STMN2AON with three spacers is recorded in table 8 below.

Table 8: identification of STMN2AON or AON variants with three spacers. Here, each STMN2AON has 4 segments, with each segment having up to 7 linked nucleosides.

/>

In various embodiments, the STMN2AON with one or more spacers has a reduced length as compared to the STMN2 AONs described in tables 7B and 8 above. For example, such STMN2 AONs may be STMN2 oligonucleotide variants with one or more spacers. In various embodiments, the STMN2 oligonucleotide variant with one or more spacers is a 23 mer, a 21 mer, or a 19 mer. In various embodiments, the STMN2 oligonucleotide variant comprises two spacers, such that the STMN2 oligonucleotide variant comprises three segments separated by two spacers. In various embodiments, at least one of the three segments has up to 7 linked nucleosides. In various embodiments, each of the three segments has up to 7 linked nucleosides. Exemplary STMN2 oligonucleotide variants with one or more spacers are shown in table 9.

Table 9: STMN2AON variants with two spacers. Here, each STMN2AON variant has 3 segments, with each segment having up to 7 linked nucleosides.

/>

Performance of STMN2 oligonucleotides

Typically, STMN2 oligonucleotides and/or STMN2 parent oligonucleotides (e.g., STMN2 oligonucleotides having the sequence of any one of SEQ ID NOs: 1-466, SEQ ID NOs: 893-1338, SEQ ID NOs: 1342-1366, and SEQ ID NOs: 1392-1664) target a nucleic acid sequence comprising a sequence identical to SEQ ID NO:1339 or SEQ ID NO:1341 shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) of the same sequence of an STMN2 transcript (e.g., an STMN2 pre-mRNA comprising a cryptic exon) in order to increase, restore, rescue or stabilize the expression level of an STMN2 mRNA capable of translating into a functional STMN2 protein (e.g., full length STMN 2). In various embodiments, the STMN2 AON may exhibit at least a 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% increase in full length STMN2 protein. In various embodiments, the STMN2 AON may exhibit at least a 100%, 200%, 300%, or 400% increase in full length STMN2 protein. In some embodiments, the increase in percentage of full-length STMN2 protein is an increase compared to the reduced full-length STMN2 protein level achieved using a TDP43 antisense oligonucleotide. For example, a TDP43 antisense oligonucleotide can be used to deplete the full length STMN2 protein and then increase the full length STMN2 protein using STMN2 AON.

In some embodiments, the STMN2AON may exhibit at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% rescue of the full length STMN2 protein. In some embodiments, the percent rescue of full-length STMN2 refers to the% of full-length STMN2 relative to a negative control (e.g., cells that have not been subtracted or treated or cells treated with a vehicle solution) after subtraction using TDP43 antisense oligonucleotides and treatment with STMN2 AON.

Modification

Nucleosides are base-sugar combinations. The nucleobase (also referred to as base) portion of a nucleoside is typically a heterocyclic base portion. A nucleotide is a nucleoside further comprising a phosphate group covalently linked to the sugar moiety of the nucleoside. For those nucleosides that include a pentofuranosyl sugar, the phosphate group can be attached to the 2', 3', or 5' hydroxyl moiety of the sugar. Oligonucleotides are formed by covalent linkage of nucleosides adjacent to each other to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, phosphate groups are commonly referred to as internucleoside linkages that form an oligonucleotide.

Modifications to antisense compounds encompass substitutions or alterations to internucleoside linkages, sugar moieties, or nucleobases. Modified antisense compounds are generally preferred over the natural form due to desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid targets, increased stability in the presence of nucleases, or increased inhibitory activity.

Chemically modified nucleosides can also be employed to increase the binding affinity of a shortened or truncated antisense oligonucleotide to its target nucleic acid. Thus, comparable results can generally be obtained with shorter antisense compounds having such chemically modified nucleosides.

Modified internucleoside linkages

Naturally occurring internucleoside linkages of RNA and DNA are 3 'to 5' phosphodiester linkages. Antisense compounds having one or more modified (i.e., non-naturally occurring) internucleoside linkages are typically selected as compared to antisense compounds having naturally occurring internucleoside linkages due to desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for the target nucleic acid, and increased stability in the presence of nucleases.

Oligonucleotides with modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom and internucleoside linkages that do not have a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiester, phosphotriester, methylphosphonate, phosphoramidate and phosphorothioate. Methods for preparing phosphorus-containing and phosphorus-free linkages are well known.

In certain embodiments, antisense compounds targeted to STMN2 nucleic acids comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are interspersed throughout the antisense compound. In certain embodiments, the modified internucleoside linkage is a phosphorothioate linkage. In certain embodiments, each internucleoside linkage of the antisense compound is a phosphorothioate internucleoside linkage. In certain embodiments, the antisense compound targeted to the STMN2 nucleic acid comprises at least one phosphodiester linkage and at least one phosphorothioate linkage.

Modified sugar moieties

The antisense compounds may optionally contain one or more nucleosides wherein the glycosyl group has been modified. Such sugar-modified nucleosides can confer enhanced nuclease stability, increased activity on antisense compoundsOr some other beneficial biological property. In certain embodiments, the nucleoside comprises a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings include, but are not limited to, addition of substituents (including 5 'and 2' substituents), bridging of non-bicyclic atoms (non-geminal ring atom) to form a Bicyclic Nucleic Acid (BNA), use of S,Or C (R1) (R2) (each R, R) ₁ And R is ₂ H, C independently ₁ -C ₁₂ Alkyl or protecting groups) to replace ribosyl epoxy atoms and combinations thereof. Examples of chemically modified sugars include 2'-F-5' -methyl substituted nucleosides (for other published 5',2' -disubstituted nucleosides see PCT international application WO2008/101157 published 8/21 in 2008) or substitution of ribose epoxy atoms with S and further substitution at the 2 '-position (see U.S. patent application US2005-0130923 published 6/16 in 2005) or alternatively 5' -substitution of BNA (see PCT international application WO2007/134181 published 11/22 in 2007, wherein LNA is substituted with, for example, a 5 '-methyl or 5' -vinyl group).

Examples of nucleosides having modified sugar moieties include, but are not limited to, nucleosides comprising 5' -vinyl, 5' -methyl (R or 5), 4' -S, 2' -F, 2' -OCH ₃ 、2’-OCH ₂ CH ₃ 、2’-O CH ₂ CH ₂ F and 2' -O (CH) ₂ ) ₂ OCH ₃ Nucleosides of substituents. The substituents in the 2' position may also be selected from allyl, amino, azido, thio, O-allyl, O-C ₁ -C ₁₀ Alkyl, OCF ₃ 、OCH ₂ F、O(CH ₂ ) ₂ S CH ₃ 、O(CH ₂ ) ₂ -O-N(R _m )(R _n )、O-CH ₂ -C(＝O)-N(R _m )(R _n ) And O-CH ₂ -C(＝O)-N(R ₁ )-(CH ₂ ) ₂ -N(R _m )(R _n ) -wherein each R ₁ 、R _m And R is _n Independently H or substituted or unsubstituted C ₁ -C ₁₀ An alkyl group.

Other examples of modified sugar moieties include 2'-Ome modified sugar moieties, bicyclic sugar moieties, 2' -O- (2-methoxyethyl) (2 'moe), 2' -deoxy-2 '-fluoronucleosides, 2' -fluoro- β -D-arabinonucleosides, locked Nucleic Acids (LNAs), constrained ethyl 2'-4' -bridging nucleic acids (cets), S-cets, tcDNA, hexitol Nucleic Acids (HNAs), and tricyclic analogues (e.g., tcDNA).

As used herein, "bicyclic nucleoside" refers to a modified nucleoside comprising a bicyclic sugar moiety. Examples of bicyclic nucleosides include, but are not limited to nucleosides comprising a bridge between the 4 'and 2' ribosyl ring atoms. In certain embodiments, antisense compounds provided herein include one or more bicyclic nucleosides comprising a 4 'to 2' bridge. Examples of such 4 'to 2' bridged bicyclic nucleosides include, but are not limited to, one of the following formulas: 4' - (CH) ₂ )-O-2’(LNA)；4’-(CH ₂ )-S-2’；4’-(CH ₂ ) ₂ -O-2’(ENA)；4’-CH(CH ₃ ) -O-2 'and 4' -CH (CH) ₂ OCH ₃ ) O-2' (and analogs thereof see U.S. patent No. 7,399,845 issued at 7/15 of 2008); 4' -C (CH) ₃ )(CH ₃ ) -O-2' (and analogues thereof see published international application WO/2009/006478 published 1/8 2009); 4' -CH ₂ -N(OCH ₃ ) -2' (and analogues thereof see published international application WO/2008/150729 published on month 11 2008); 4' -CH ₂ -O-N(CH ₃ ) -2' (see published U.S. patent application US2004-0171570 published at 9/2/2004); wherein R is H, C ₁ -C ₁₂ Alkyl or a protecting group (see U.S. patent No. 7,427,672 issued on 9, 23, 2008); 4' -CH ₂ -C(H)(CH ₃ ) -2' (see Chattopadhyaya et al, j. Org. Chem.,2009, 74, 118-134); and 4' -CH ₂ -C-(＝CH ₂ ) -2' (and analogues thereof see published international application WO2008/154401 published at 12/8 of 2008).

Further reports relating to bicyclic nucleosides can also be found in published literature (see, e.g., singh et al, chem.Commun.,1998,4, 455-456;Koshkin et al, tetrahedron,1998, 54, 3607-3630;Wahlestedt et al, proc.Natl. Acad.Sci.U.S. A.,2000, 97, 5633-5638; kumar et al, biorg.Med.chem.Lett., 1998,8, 2219-2222; singh et al, J.org.chem.,1998, 63, 10035-10039;Srivastava et al, J.am.chem.Soc.,2007, 129 (26) 8362-8379;Elayadi et al, curr.Opinion Invert.drugs, 2001,2, 558-561;Braasch et al, chem.biol, 2001,8,1-7; and Orum et al, curr. Opiion mol. Ter., 2001,3, 239-243; U.S. Pat. Nos. 6,268,490, 6,525,191, 6,670,461, 6,770,748, 6,794,499, 7,034,133, 7,053,207, 7,399,845, 7,547,684, and 7,696,345, U.S. patent publication Nos. US2008-0039618, US2009-0012281, U.S. patent serial nos. 60/989,574, 61/026,995, 61/026,998, 61/056,564, 61/086,231, 61/097,787, and 61/099,844, published PCT International applications WO 1994/014226, WO 2004/106356, WO 2005/570, WO 2007/134181, WO 2008/150729, WO 2009/154401, and WO 2009/006021478 may be prepared each of the aforementioned bicyclic nucleosides having one or more stereochemical sugar configurations including, for example, alpha-L-ribofuranose and beta-D-ribofuranose (see PCT publication No. WO 25/00398/WO 35, PCT published as WO 26/00393).

In certain embodiments, the bicyclic sugar moiety of a BNA nucleoside includes, but is not limited to, a compound having at least one bridge between the 4 'and 2' positions of the pentose moiety, wherein the bridges independently comprise 1 or 2 to 4 groups independently selected from the group consisting of- [ C (R _a )(R _b )] _n -、-C(R _a )＝C(R _b )-、-C(R _a )＝N-、-C(＝O)-、-C(＝NR _a )-、-C(＝S)-、-O-、-Si(R _a ) ₂ -、-S(＝O) _x -and-N (R) _a ) -a linking group;

wherein:

x is 0, 1 or 2;

n is 1, 2, 3 or 4;

each R _a And R is _b Independently H, a protecting group, hydroxyRadical, C ₁ -C ₁₂ Alkyl, substituted C ₁ -C ₁₂ Alkyl, C ₂ -C ₁₂ Alkenyl, substituted C ₂ -C ₁₂ Alkenyl, C ₂ -C ₁₂ Alkynyl, substituted C ₂ -C ₁₂ Alkynyl, C ₅ -C ₂₀ Aryl, substituted C ₅ -C ₂₀ Aryl, heterocyclyl, substituted heterocyclyl, heteroaryl, substituted heteroaryl, C ₅ -C ₇ Alicyclic group, substituted C ₅ -C ₇ Alicyclic, halogen, OJ ₁ 、NJ ₁ J ₂ 、SJ ₁ 、N ₃ 、COOJ ₁ Acyl (C (=o) -H), substituted acyl, CN, sulfonyl (S (=o) ₂ -J1) or sulfinyl (S (=o) -J ₁ ) The method comprises the steps of carrying out a first treatment on the surface of the And is also provided with

Each J ₁ And J ₂ H, C independently ₁ -C ₁₂ Alkyl, substituted C ₁ -C ₁₂ Alkyl, C ₂ -C ₁₂ Alkenyl, substituted C ₂ -C ₁₂ Alkenyl, C ₂ -C ₁₂ Alkynyl, substituted C ₂ -C ₁₂ Alkynyl, C ₅ -C ₂₀ Aryl, substituted C ₅ -C ₂₀ Aryl, acyl (C (=o) -H), substituted acyl, heterocyclyl, substituted heterocyclyl, C ₁ -C ₁₂ Aminoalkyl, substituted C ₁ -C ₁₂ Aminoalkyl or a protecting group.

In certain embodiments, the bridge of the bicyclic sugar moiety is- [ C (R _a )(R _b )] _n -、-[-[C(R _a )(R _b )] _n -O-、In certain embodiments, the bridge is 4' -CH ₂ -2’、4’-(CH ₂ ) ₂ -2’、4’-(CH ₂ ) ₃ -2’、4’-CH ₂ -O-2’、4’-(CH ₂ ) ₂ -O-2’、/>And-wherein each R is independently H, a protecting group or C ₁ -C ₁₂ Alkyl, each R _a And R is _b Independently H, a protecting group, hydroxy, C ₁ -C ₁₂ Alkyl, substituted C ₁ -C ₁₂ Alkyl, C ₂ -C ₁₂ Alkenyl, substituted C ₂ -C ₁₂ Alkenyl, C ₂ -C ₁₂ Alkynyl, substituted C ₂ -C ₁₂ Alkynyl, C ₅ -C ₂₀ Aryl, substituted C ₅ -C ₂₀ Aryl, heterocyclyl, substituted heterocyclyl, heteroaryl, substituted heteroaryl, C ₅ -C ₇ Alicyclic group, substituted C ₅ -C ₇ Alicyclic, halogen, OJ ₁ 、NJ ₁ J ₂ 、SJ ₁ 、N ₃ 、COOJ ₁ Acyl (C (=o) -H), substituted acyl, CN, sulfonyl (S (=o) ₂ -J1) or sulfinyl (S (=o) -J ₁ ) The method comprises the steps of carrying out a first treatment on the surface of the Each J ₁ And J ₂ H, C independently ₁ -C ₁₂ Alkyl, substituted C ₁ -C ₁₂ Alkyl, C ₂ -C ₁₂ Alkenyl, substituted C ₂ -C ₁₂ Alkenyl, C ₂ -C ₁₂ Alkynyl, substituted C ₂ -C ₁₂ Alkynyl, C ₄ -C ₂₀ Aryl, substituted C ₅ -C ₂₀ Aryl, acyl (C (=o) -H), substituted acyl, heterocyclyl, substituted heterocyclyl, C ₁ -C ₁₂ Aminoalkyl, substituted C ₁ -C ₁₂ Aminoalkyl or a protecting group; and R is H, C ₁ -C ₁₂ Alkyl or a protecting group (see U.S. patent No. 7,427,672 issued at 9/23 of 2008).

In certain embodiments, the bicyclic nucleoside is further defined by an isomeric configuration. For example, nucleosides comprising a 4'-2' methyleneoxy bridge can be in the α -L configuration or β -D configuration. Previously, α -L-methyleneoxy (4' -CH ₂ -O-2') BNA has been incorporated into antisense oligonucleotides exhibiting antisense activity (Frieden et al Nucleic Acids Research,2003, 21, 6365-6372).

In certain embodiments, bicyclic nucleosides include, but are not limited to, α -L-methyleneoxy (4' -CH ₂ -O-2 ') BNA, beta-D-methyleneoxy (4' -CH) ₂ -O-2 ') BNA, ethylene oxide (4' - (CH) ₂ ) ₂ -O-2) BNA, aminooxyBNA、130yrrolid/>BNA, methyl (methyleneoxy) (4' -CH (CH) ₃ ) -O-2 ') BNA, methylenethio (4' -CH) ₂ -S-2') BNA, methyleneamino->BNA, methyl carbocycle (4' -CH) ₂ -CH(CH ₃ ) -2 ') and propylene carbocycle (4' - (CH) ₂ ) ₃ -2') BNA; wherein R is H, C ₁ -C ₁₂ Alkyl or a protecting group (see U.S. patent No. 7,427,672 issued at 9/23 of 2008).

In some embodiments, the present disclosure provides methods for treating, ameliorating, or preventing a neurological disease and/or neuropathy, further comprising administering to a patient a pharmaceutically acceptable composition, e.g., a pharmaceutically acceptable formulation comprising one or more STMN2 oligonucleotides. The STMN2 oligonucleotide can increase, restore, or stabilize STMN2 activity, e.g., STMN2 activity, and/or STMN2 expression levels, e.g., STMN2 mRNA and/or protein expression.

The present disclosure also provides pharmaceutical compositions comprising STMN2 oligonucleotides formulated with one or more pharmaceutically or cosmetically acceptable excipients. Such formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisternal, intracerebroventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal or intravenous), transmucosal (e.g., buccal, vaginal, and rectal), or for topical use, e.g., as part of a composition suitable for topical application to skin and/or mucosa, such as a gel, paste, wax, cream, spray, liquid, foam, lotion, ointment, topical solution, transdermal patch, powder, vapor or tincture. Although the most suitable form of administration in any given case will depend on the extent and severity of the condition being treated and the nature of the particular STMN2 oligonucleotide used.

The present disclosure also provides pharmaceutical compositions comprising STMN2 oligonucleotides or pharmaceutically acceptable salts thereof (e.g., STMN2 AON comprising the sequence of any one of SEQ ID NOS: 1-466, SEQ ID NOS: 893-1338, SEQ ID NOS: 1342-1366, and SEQ ID NOS: 1392-1664).

The present disclosure also provides methods comprising using a pharmaceutical composition comprising an STMN2 oligonucleotide formulated with one or more pharmaceutically acceptable excipients. Exemplary compositions provided herein include compositions comprising an STMN2 AON and one or more pharmaceutically acceptable excipients. Formulations include those suitable for oral, sublingual, intratracheal, intranasal, transdermal, pulmonary, intrathecal, intrathalamic, intracisternal, intraventricular, parenteral (e.g., subcutaneous, intramuscular, intradermal, intraduodenal or intravenous), transmucosal (e.g., buccal, vaginal and rectal), or topical use. In any given case, the most suitable form of administration will depend on the clinical symptoms, complications or biochemical indicators of the state, disorder, disease or condition the individual is attempting to prevent in the subject; a state, disorder, disease or condition that an individual is attempting to prevent in a subject; and/or the nature of the particular compound and/or composition used.

Other chemically modified STMN2 oligonucleotides

The STMN2 AONs described herein can include chemically modified nucleosides, including modified ribonucleosides and modified deoxyribonucleosides. Chemically modified nucleosides include, but are not limited to, uracil, uridine, 2' -O- (2-methoxyethyl) modifications, such as 2' -O- (2-methoxyethyl) guanosine, 2' -O- (2-methoxyethyl) adenosine, 2' -O- (2-methoxyethyl) cytosine, 2' -O- (2-methoxyethyl) thymidine. In certain embodiments, the hybrid morphology, e.g., a combination of STMN2 Peptide Nucleic Acid (PNA) and STMN2 Locked Nucleic Acid (LNA). Chemically modified nucleosides also include, but are not limited to, locked Nucleic Acid (LNA), 2' -O-methyl, 2' -fluoro, and 2' -fluoro- β -D-arabinonucleotide (FANA) and fluorocyclohexenyl nucleic acid (F-CeNA) modifications. Chemically modified nucleosides that can be included in the STMN2 AON described herein are described in Johannes and Lucchino, (2018) "Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs" Nucleic Acid Ther.28 (3): 178-93; rettig and Behlke, (2012) "Progress toward in vivo use of siRNAs-II" Mol ter 20:483-512; and Khvorova and Watts, (2017) "The chemical evolution of oligonucleotide therapies of clinical utility" Nat biotechnol, 35 (3): 238-48, the contents of each of which are incorporated herein by reference.

The STMN2 AONs described herein can include chemical modifications that promote stabilization of the oligonucleotide-terminated 5 '-phosphate and phosphatase-resistant analogs of the 5' -phosphate. Chemically modified or 5 '-phosphate phosphatase resistant analogs that promote stabilization of the oligonucleotide terminal 5' -phosphate include, but are not limited to, 5 '-methylphosphonate, 5' -methylenephosphonate analogs, 5 '-E-vinylphosphonate (5' -E-VP), 5 '-phosphorothioate, and 5' -C-methyl analogs. Khvorova and Watts, (2017) "The chemical evolution of oligonucleotide therapies of clinical utility" Nat biotechnol, 35 (3): 238-48 (the contents of which are incorporated herein by reference) describe chemical modifications that promote stabilization of the AON-terminal 5 '-phosphate and phosphatase resistant analogues of the 5' -phosphate.

In some embodiments described herein, an STMN2 AON described herein can include chemically modified nucleosides, such as 2' o-methylribosides, such as 2' o-methylcytidine, 2' o-methylguanosine, 2' o-methyluridine, and/or 2' o-methyladenosine. The STMN2 AONs described herein can include one or more chemically modified bases, including 5-methyl pyrimidine, e.g., 5-methyl cytosine, and/or 5-methyl purine, e.g., 5-methyl guanine. The chemically modified base may further comprise pseudouridine or 5' methoxyuridine. The STMN2 AON described herein can include any of the following chemically modified nucleosides: 5-methyl-2 ' -O-methylcytidine, 5-methyl-2 ' -O-methylthymidine, 5-methylcytidine, 5-methyluridine and/or 5-methyl-2 ' -deoxycytidine.

The STMN2 AONs described herein can include a phosphate backbone in which one or more oligonucleotide linkages are phosphate linkages. The STMN2AON described herein can include a modified oligonucleotide backbone wherein one or more of the nucleoside linkages of the sequence are selected from the group consisting of: phosphorothioate linkages, phosphorodithioate linkages, phosphotriester linkages, alkylphosphonate linkages, 3-methoxypropyl phosphonate linkages, aminoalkyl phosphotriester linkages, alkylene phosphonate linkages, phosphonite linkages, phosphoramidate linkages, phosphorothioate linkages, phosphorodithioate linkages (e.g., comprising Phosphorodithioate Morpholino (PMO), 3 'aminoribose or 5' aminoribose), aminoalkyl phosphoramidate linkages, phosphorothioate alkyl phosphonate linkages, phosphorothioate linkages, seleno phosphorate linkages, and borophosphate linkages. In some embodiments of the STMN2 AONs described herein, at least one (i.e., one or more) internucleoside linkage of the oligonucleotides is a phosphorothioate linkage. For example, in some embodiments of STMN2 AONs described herein, one, two, three, or more internucleoside linkages of an oligonucleotide are phosphorothioate linkages. In a preferred embodiment of the STMN2AON described herein, all internucleoside linkages of the oligonucleotides are phosphorothioate linkages. Thus, in some embodiments, SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 and SEQ ID NO: all nucleotide linkages of the STMN2AON of any of 1392-1664 are phosphorothioate linkages. In some embodiments, SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 and SEQ ID NO: one or more nucleotide linkages of the STMN2AON of any of 1392-1664 are phosphorothioate linkages.

In various embodiments, an STMN2 AON described herein, such as SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 and SEQ ID NO: nucleotide linkages of any of 1392-1664 include mixtures of phosphodiester and phosphorothioate linkages.

In some embodiments, the nucleoside linkage that connects the bases at position 3 of the STMN2 AON described herein is a phosphodiester linkage. For example, the base at position 3 may be linked to each adjacent base (e.g., the preceding base and the following base) by a phosphodiester linkage. An example 25-mer STMN2 AON with a phosphodiester linkage joining bases at the 3-position can be expressed as:

XXoDoXXXXXXXXXXXXXXXXXXXXXX

wherein "o" represents a phosphodiester bond and "D" represents a base at position 3. Any nucleobase in an AON may be a nucleobase analogue.

In some embodiments, one of the nucleoside linkages connecting the bases at position 3 of the STMN2 AON described herein is a phosphodiester linkage. For example, the base at position 3 may be linked to the preceding base or the following base by a phosphodiester linkage. An exemplary 25-mer STMN2 AON with a phosphodiester linkage linking the base at position 3 with the preceding base can be represented as:

XXoDXXXXXXXXXXXXXXXXXXXXXX

An exemplary 25-mer STMN2 AON with a phosphodiester linkage linking the base at position 3 with a subsequent base can be represented as:

XXDoXXXXXXXXXXXXXXXXXXXXXX

In various embodiments, the STMN2 AON further comprises two spacers in addition to one of the nucleoside linkages connecting bases at position 3 of the STMN2 AON described herein being a phosphodiester linkage. The two spacers may be disposed in the STMN2 AON such that the STMN2 AON includes a segment having up to 7 linked nucleosides. An exemplary 25-mer STMN2 AON having two spacers and having a phosphodiester linkage connecting the base at position 3 with the preceding base can be represented as:

XxoDS ₁ XXXXXXXXXS ₂ XXXXXXXXXXX

wherein "S ₁ "means a first spacer," S ₂ "means a second spacer," o "means a phosphodiester bond and" D "means a base at position 3. Any nucleobase in an AON may be a nucleobase analogue.

An example 25-mer STMN2 AON with two spacers and with a phosphodiester linkage connecting the base at position 3 with the following base can be expressed as:

XXDoXXXXXXXS ₁ XXXXXXXXXS ₂ XXXX

In some embodiments, the nucleoside linkage that connects the bases at position 4 of the STMN2AON described herein is a phosphodiester linkage. For example, the base at position 4 may be linked to each adjacent base (e.g., the preceding base and the following base) by a phosphodiester linkage. An example 25-mer STMN2AON with a phosphodiester linkage joining bases at the 4-position can be expressed as:

XXXoDoXXXXXXXXXXXXXXXXXXXXX

wherein "o" represents a phosphodiester bond and "D" represents a base at position 4. Any nucleobase in an AON may be a nucleobase analogue.

In some embodiments, one of the nucleoside linkages connecting the bases at position 4 of the STMN2AON described herein is a phosphodiester linkage. For example, the base at position 4 may be linked to the preceding base or the following base by a phosphodiester linkage. An exemplary 25-mer STMN2AON with a phosphodiester linkage linking the base at position 4 with the preceding base can be represented as:

XXXoDXXXXXXXXXXXXXXXXXXXXX

An exemplary 25-mer STMN2AON with a phosphodiester linkage linking a base at position 4 with a subsequent base can be represented as:

XXXDoXXXXXXXXXXXXXXXXXXXXX

In some embodiments, the nucleoside linkages connecting the two bases at positions 3 and 4 of the STMN2 AON described herein are phosphodiester linkages. For example, the base at position 3 may be linked to each adjacent base (e.g., the preceding base and the following base) by a phosphodiester bond, and the base at position 4 may be linked to each adjacent base (e.g., the preceding base and the following base) by a phosphodiester bond. An example 25-mer STMN2 AON with a phosphodiester linkage linking bases at the 3-and 4-positions can be expressed as:

XXoDoEoXXXXXXXXXXXXXXXXXXXXX

wherein "o" represents a phosphodiester bond, "D" represents a base at position 3, and "E" represents a base at position 4. In various embodiments, all other bases of the STMN2 AON are linked by phosphorothioate linkages. Any nucleobase in an AON may be a nucleobase analogue.

In various embodiments, an STMN2 AON described herein includes one or more spacers, and a phosphodiester linkage is positioned relative to the one or more spacers. In some embodiments, the Y number of bases immediately preceding the spacer are linked by a phosphodiester linkage. In various embodiments, Y is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 bases. In a particular embodiment, Y is two bases. For example, if the spacer is located at position 15, the bases at positions 13 and 14 of the STMN2 AON are linked to their respective adjacent bases by phosphodiester bonds, respectively. As described herein, the spacers may be located at different positions of the STMN2 AON, and thus, the 2 bases immediately preceding the spacers within the STMN2 AON may vary depending on the position of the spacers.

In various embodiments, the STMN2 AON may include more than one spacer. In some embodiments, only one of the spacers has a Y number of bases immediately preceding the spacer linked by a phosphodiester linkage. In such embodiments, the other spacer is linked to the respective preceding base by a phosphorothioate linkage. In various embodiments, two of the spacers have a Y number of bases immediately preceding the spacer linked by a phosphodiester linkage. In various embodiments, each of the spacers in the STMN2 AON has a Y number of bases immediately preceding the spacer linked by a phosphodiester linkage. In various embodiments, all other bases of the STMN2 AON are linked by phosphorothioate linkages.

In some embodiments, the Y number of bases immediately preceding the spacer and the Z number of bases immediately following the spacer are linked by a phosphodiester linkage. In various embodiments, Y is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 bases. In various embodiments, Z is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 bases. Y and Z may be independent of each other. In a particular embodiment, Y is a base and Z is a base. For example, if the spacer is located at position 15, the bases at positions 14 and 16 of the STMN2 AON are linked to their respective adjacent bases by phosphodiester bonds, respectively. To provide an example, such STMN2 AONs (e.g., 25-mers) can be expressed as:

XXXXXXXXXXXXXoDoSoEoXXXXXXXXX

Where "S" represents a spacer, "o" represents a phosphodiester bond, "D" represents a base immediately preceding the spacer, and "E" represents a base immediately following the spacer. Any nucleobase in an AON may be a nucleobase analogue.

As described herein, the spacers may be located at different positions in the STMN2 AON, and thus, the bases immediately preceding the spacers or immediately following the spacers within the STMN2 AON may vary depending on the position of the spacers.

In various embodiments, the STMN2 AON may include more than one spacer. In some embodiments, only one of the spacers has Y number of bases immediately preceding the spacer and Z number of bases immediately following the spacer linked by a phosphodiester linkage. In such embodiments, the other spacers of the STMN2 AON are linked to the respective preceding and following bases by phosphorothioate linkages. To provide an example, such STMN2 AONs (e.g., 25-mers) can be expressed as:

XXXXoDoS ₁ oEoXXXXXXXXXXXS ₂ XXXXXX

wherein "S ₁ "means a first spacer," S ₂ "means a second spacer," o "means a phosphodiester bond," D "means a base immediately before the spacer, and" E "means a base immediately after the spacer. Any nucleobase in an AON may be a nucleobase analogue.

As another example, such STMN2 AONs (e.g., 25 mers) can be expressed as:

XXXXXS _１ XXXXXXXXXXXoDoS ₂ oDoXXXXX

In some embodiments, one of the spacers is linked to the immediately preceding base by a phosphodiester linkage. For example, STMN2 AON includes a first spacer linked to an immediately preceding base through a phosphodiester linkage, which can be expressed as:

XXXXXXoS ₁ XXXXXXXXXXXS ₂ XXXXXX

wherein "S ₁ "means a first spacer," S ₂ "means a second spacer," o "means a phosphodiester bond. Any nucleobase in an AON may be a nucleobase analogue.

As another example, an STMN2 AON includes a second spacer linked to an immediately preceding base through a phosphodiester linkage, which can be expressed as:

XXXXXXS ₁ XXXXXXXXXXXoS ₂ XXXXXX

wherein "S ₁ "means a first spacer," S ₂ "means a second spacer," o "means a phosphodiester bond. A is thatAny nucleobase in an ON may be a nucleobase analog.

In various embodiments, the STMN2 AON can be an AON variant (e.g., 23-mer, 21-mer, or 19-mer) in which one of the spacers is linked to an immediately preceding base by a phosphodiester linkage. For example, STMN2 AON can be a 21 mer with a first spacer linked to an immediately preceding base through a phosphodiester linkage, which can be expressed as:

XXXXXXXoS ₁ XXXXXS ₂ XXXXXXX

As another example, STMN2 AON may be a 21 mer with a second spacer linked to an immediately preceding base through a phosphodiester linkage, which may be represented as:

XXXXXXXS ₁ XXXXXoS ₂ XXXXXXX

In some embodiments, the STMN2 AON can be an AON variant (e.g., 23-mer, 21-mer, or 19-mer) in which one of the spacers is linked to an immediately preceding base by a phosphodiester linkage and an immediately following base is further linked to the preceding base by a phosphodiester linkage. Example 21 Polymer STMN2 AON may be expressed as:

XXXEODOS ₁ XXXXXXS ₂ XXXXXXX

wherein "S ₁ "means a first spacer," S ₂ "means a second spacer," o "means a phosphodiester bond," D "means a sequence immediately following S ₁ Previous bases, and "E" represents the base immediately preceding "D". Any nucleobase in an AON may be a nucleobase analogue.

As another example, a 21-mer STMN2 AON may be expressed as:

XXXXXS ₁ XXXXEoDoS ₂ XXXXXXX

Wherein "S ₁ "means a first spacer," S ₂ "means a second spacer," o "means a phosphodiester bond," D "means a sequence immediately following S ₂ Previous bases, and "E" represents the base immediately preceding "D". Any nucleobase in an AON may be a nucleobase analogue.

In some embodiments, the STMN2 AON can be an AON variant (e.g., 23-mer, 21-mer, or 19-mer) in which the base immediately preceding the first spacer is linked to another base by a phosphodiester linkage. The base immediately preceding the first spacer may be linked to the first spacer by a non-phosphodiester linkage, such as a phosphorothioate linkage. In addition, the second spacer is linked to the immediately following base through a phosphodiester linkage. An example of a 21-mer STMN2 AON can be expressed as:

XXXEoDS ₁ XXXXXXoS ₂ XXXXXXX

wherein "S ₁ "means a first spacer," S ₂ "means a second spacer," o "means a phosphodiester bond," D "means a sequence immediately following S ₁ Previous bases, and "E" represents the base immediately preceding "D". Here, the base "D" is linked to the first spacer S through a non-phosphodiester linkage (e.g., phosphorothioate linkage) ₁ And (5) connection. In addition, the base "D" is linked to the base "E" through a phosphodiester bond. Second spacer S ₂ Is linked to the immediately preceding base by a phosphodiester linkage. Any nucleobase in an AON may be a nucleobase analogue.

Another example of such a 21-mer STMN2 AON can be expressed as:

XXXXXoS ₁ XXXXEoDS ₂ XXXXXXX

wherein "S ₁ "means a first spacer," S ₂ "means a second spacer," o "means a phosphodiester bond," D "means a sequence immediately following S ₂ Previous bases, and "E" represents the base immediately preceding "D". Here, the base "D" is linked to the second spacer S through a non-phosphodiester linkage (e.g., phosphorothioate linkage) ₂ And (5) connection. In addition, the baseThe group "D" is linked to the base "E" via a phosphodiester linkage. First spacer S ₁ Is linked to the immediately preceding base by a phosphodiester linkage. Any nucleobase in an AON may be a nucleobase analogue.

In some embodiments, wherein one of the spacers is linked to the immediately following base by a phosphodiester linkage. For example, STMN2 AON includes a first spacer linked to an immediately following base through a phosphodiester linkage, which can be expressed as:

XXXXXXS ₁ oXXXXXXXXXXXS ₂ XXXXXX

As another example, an STMN2 AON includes a second spacer linked to an immediately following base through a phosphodiester linkage, which can be expressed as:

XXXXXXS ₁ XXXXXXXXXXXS ₂ oXXXXXX

In various embodiments, the STMN2 AON can be an AON variant (e.g., 23-mer, 21-mer, or 19-mer) in which one of the spacers is linked to an immediately subsequent base through a phosphodiester linkage. For example, STMN2 AON can be a 21 mer with a first spacer linked to an immediately following base through a phosphodiester linkage, which can be expressed as:

XXXXXXXS ₁ oXXXXXS ₂ XXXXXXX

As another example, STMN2 AON may be a 21 mer with a second spacer linked to an immediately following base by a phosphodiester linkage, which may be expressed as:

XXXXXXXS ₁ XXXXXS ₂ oXXXXXXX

In various embodiments, wherein two of the spacers have Y number of bases immediately after the spacer and Z number of bases immediately after the spacer linked by a phosphodiester linkage. In various embodiments, each of the spacers in the STMN2 AON has a Y number of bases immediately after the spacer and a Z number of bases immediately after the spacer connected by a phosphodiester linkage. Examples of such STMN2 AONs (e.g., 25 mers) can be expressed as:

XXXXoDoS ₁ oEoXXXXXXXXXXoFoS ₂ oHoXXXXX

wherein "S ₁ "means a first spacer," S ₂ "means a second spacer," o "means a phosphodiester bond," D "means a base immediately before a first spacer," E "means a base immediately after a first spacer," F "means a base immediately before a second spacer, and" H "means a base immediately after a second spacer. In various embodiments, all other bases of the STMN2 AON are linked by phosphorothioate linkages. Any nucleobase in an AON may be a nucleobase analogue.

Two or more spacers are included in various STMN2 AONs, and a series of bases located between the two spacers are linked by phosphodiester bonds. In various embodiments, the series of bases includes two, three, four, five, six, or seven bases linked by phosphodiester bonds. In a particular embodiment, the series of bases comprises two bases linked by a phosphodiester linkage. In a particular embodiment, the series of bases comprises four bases linked by phosphodiester bonds. In various embodiments, all other bases of the STMN2 AON are linked by phosphorothioate linkages. Any nucleobase in an AON may be a nucleobase analogue.

In various embodiments, a series of bases linked by phosphodiester linkages are positioned Y number of bases after the first spacer and Z number of bases before the second spacer. In various embodiments, Y is 1, 2, 3, 4, 5, 6, or 7 bases. In various embodiments, Z is 1, 2, 3, 4, 5, 6, or 7 bases. Y and Z may be independent of each other. Any nucleobase in an AON may be a nucleobase analogue.

In a particular embodiment, Y is five bases and Z is four bases. To provide an example, such STMN2 AONs (e.g., 25-mers) can be expressed as:

XXXXXXXXS ₁ XXXXoDoEoFoHoXXXS ₂ XXXX

wherein "S ₁ "means a first spacer," S ₂ "means a second spacer, and" o "means a phosphodiester bond. The bases "D", "E", "F" and "H" represent a series of bases linked by phosphodiester bonds. In this example, the series of bases is five bases after the first spacer (e.g., five bases after the first spacer is positioned D) and the series of bases is four bases before the second spacer (e.g., four bases before the second spacer is positioned H). Any nucleobase in an AON may be a nucleobase analogue.

In a particular embodiment, Y is four bases and Z is three bases. To provide an example, such STMN2 AONs (e.g., 23 mers) can be expressed as:

XXXXXXXS ₁ XXXoDoEoXXS ₂ XXXXXXX

wherein "S ₁ "means a first spacer," S ₂ "means a second spacer, and" o "means a phosphodiester bond. Bases "D" and "E" represent a series of bases linked by phosphodiester bonds. In this example, the series of bases is four bases after the first spacer (e.g., four bases after the first spacer is positioned D) and the series of bases is three bases before the second spacer (e.g., three bases before the second spacer is positioned E). In various embodimentsThe positions of the two spacers are different from those shown above, and therefore, the positions of the series of bases linked by phosphodiester bonds are different. In various embodiments, all other bases of the STMN2 AON are linked by phosphorothioate linkages. Any nucleobase in an AON may be a nucleobase analogue.

Table 10 below further describes examples of STMN2 AONs with a mixture of phosphodiester and phosphorothioate linkages. In particular, table 10 describes examples of STMN2 AONs comprising a mixture of spacers and phosphodiester and phosphorothioate linkages. Any nucleobase in an AON may be a nucleobase analogue.

Table 10: an example STMN2 AON with a mixture of phosphodiester and phosphorothioate linkages.

/>

In some embodiments, the disclosed STMN2 AONs can have at least one modified nucleotide, such as 5-methylcytosine, and/or at least one methylphosphonate nucleotide, for example, placed at only one of the 5 'or 3' ends or at both the 5 'and 3' ends or along an oligonucleotide sequence.

The STMN2 AON may include at least one modified sugar. For example, the sugar moiety of at least one of the nucleotides comprising the oligonucleotide is ribose, wherein the 2'-OH group can be selected from OR, R' OR, SH, SR, NH ₂ 、NR ₂ 、N ₃ CN, F, cl, br and I (wherein R is alkyl or aryl and R' is alkylene). Examples of modified sugar moieties include 2'-Ome modified sugar moieties, bicyclic sugar moieties, 2' -O- (2-methoxyethyl) (2 'MOE or MOE) 2' -deoxy-2 '-fluoronucleosides, 2' -fluoro- β -D-arabinonucleosides, locked Nucleic Acids (LNAs), constrained ethyl 2'-4' -bridging nucleic acids (cets), S-cets, tcDNA, hexitol Nucleic Acids (HNAs), and tricyclic analogues (e.g., tcDNA).

In some embodiments, the STMN2 AON comprises a 2'ome (e.g., STMN2 AON comprising one or more 2' ome modified saccharides), a 2'MOE or MOE (e.g., STMN2 AON comprising one or more 2' MOE modified saccharides), a PNA (e.g., STMN2 AON comprising one or more N- (2-aminoethyl) -glycine units linked by an amide bond or a carbonyl methylene linkage as a repeating unit instead of the saccharide-phosphate backbone), an LNA (e.g., STMN2 AON comprising one or more ribose-locked and may be a mixture of 2'ome nucleotides), a c-ET (e.g., STMN2 AON comprising one or more cET saccharides), a cMOE (e.g., STMN2 AON comprising one or more apo saccharides), a morpholino oligomer (e.g., STMN2 AON comprising a backbone comprising one or more PMOs), a deoxy-2' -fluoronucleoside (e.g., STMN- β -mn 2 AON comprising one or more fluoro-nucleoside (e.g., mn2 AON comprising one or more dna-containing one or more of the dna-modified saccharides), an enna (e.g., HNA 2 AON, e.g., one or more of the dna-modified saccharides). In some embodiments, the STMN2 AON comprises one or more phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, phosphorothioate linkages, morpholino linkages, PNA linkages, or any combination of phosphorothioate linkages, phosphodiester linkages, phosphotriester linkages, methylphosphonate linkages, phosphoramidate linkages, morpholino linkages, and PNA linkages. In some embodiments, the STMN2 AON comprises one or more phosphorothioate linkages, phosphodiester linkages, or a combination of phosphorothioate linkages and phosphodiester linkages.

In some embodiments, a polypeptide having SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 and SEQ ID NO: the STMN2 AON of the sequence of any of 1392-1664 is a chiral controlled oligonucleotide, such as described in U.S. patent No. 9,982,257, U.S. patent No. 10,590,413, U.S. patent No. 10,724,035, U.S. patent No. 10,450,568, and PCT publication No. WO2019200185, each of which is incorporated herein by reference in its entirety.

For example, a polypeptide having SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 and SEQ ID NO: the STMN2 AON of the sequence of any one of 1392-1664 is a chiral control oligonucleotide comprising a plurality of oligonucleotides of at least one type, wherein each type is defined by: 1) A base sequence; 2) A backbone linked mode; 3) A pattern of main chain chiral centers; and 4) pattern of the X-part of the backbone (-X-L-R) ¹ ) The method comprises the steps of carrying out a first treatment on the surface of the Wherein: at least one type of oligonucleotide comprises one or more phosphorothioate triester internucleotide linkages and one or more phosphodiester linkages; at least one type of oligonucleotide comprises at least two consecutive modified internucleotide linkages; and at least one oligonucleotide of the oligonucleotide type comprises one or more modified internucleotide linkages independently having the structure:

Wherein: p is an asymmetric phosphorus atom and is Rp or Sp;

w is O, S or Se; x, Y and Z are each independently-O-, -S-, -N (-L-R) ¹ ) -or L; l is a covalent bond or optionally substituted, linear or branched C ₁ -C ₅₀ Alkylene group, whichWherein one or more methylene units of L are optionally and independently substituted by optionally substituted C ₁ -C ₆ Alkylene, C ₁ -C ₆ Alkenylene, -C.ident.C-, -C (R') ₂ -、-Cy-、-O-、-S-、-S-S-、--N(R′)-、-C(O)-、-C(S)-、-C(NR′)-、-C(O)N(R′)-、-N(R′)C(O)N(R′)-、-N(R′)C(O)-、-N(R′)C(O)O-、-OC(O)N(R′)-、-S(O)-、-S(O) ₂ -、-S(O) ₂ N(R′)-、-N(R′)S(O) ₂ -SC (O) -, -C (O) S-, -OC (O) -or-C (O) O-substitution; r is R ¹ Is halogen, R or optionally substituted C ₁ -C ₁₀ Aliphatic wherein one or more methylene units are optionally and independently substituted by optionally substituted C ₁ -C ₆ Alkylene, C ₁ -C ₆ Alkenylene, -C.ident.C-, -C (R') ₂ -、-Cy-、-O-、-S-、-S-S-、-N(R′)-、-C(O)-、-C(S)-、-C(NR′)-、-C(O)N(R′)-、-N(R′)C(O)N(R′)-、-N(R′)C(O)-、-N(R′)C(O)O-、-OC(O)N(R′)-、-S(O)-、-S(O) ₂ -、-S(O) ₂ N(R′)-、-N(R′)S(O) ₂ -SC (O) -, -C (O) S-, -OC (O) -or-V (O) O-substitution; each R' is independently-R, -C (O) R, -CO ₂ R or-SO ₂ R, or: two R's on the same nitrogen together with the atoms between them form an optionally substituted heterocyclic or heteroaromatic ring, or two R's on the same carbon together with the atoms between them form an optionally substituted aromatic, carbocyclic, heterocyclic or heteroaromatic ring; -Cy-is an optionally substituted divalent ring selected from phenylene, carbocyclylene, arylene, heteroarylene or heterocyclylene; each R is independently hydrogen, or an optionally substituted group selected from C ₁ -C ₆ Aliphatic, phenyl, carbocyclyl, aryl, heteroaryl, or heterocyclyl; and each ofIndependently represents a linkage to a nucleoside. In some embodiments, a polypeptide having SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 and SEQ ID NO: the STMN2 AON of the sequence of any of 1392-1664 is a chiral controlled oligonucleotide comprising certain chemical modifications (e.g., 2'f (2' fluoro, whichContaining a fluorine molecule at the 2' -ribose position (instead of the 2' -hydroxy group in the RNA monomer), 2' -Ome, phosphorothioate linkages, lipid conjugation, etc.), as described in us patent No. 10,450,568.

Motor neuron disease

Motor neuron disease is a group of diseases characterized by loss of motor neuron function, which coordinates the voluntary movement of muscles through the brain. Motor neuron diseases may affect upper and/or lower motor neurons and may have sporadic or familial origins. Motor neuron diseases include amyotrophic lateral sclerosis (ALS or Lou Gehrig disease), progressive bulbar paralysis, pseudobulbar paralysis, progressive muscular atrophy, primary lateral sclerosis, spinal muscular atrophy, post polio syndrome, and ALS with frontotemporal dementia.

Symptoms of motor neuron disease include muscle decay or weakness, muscle pain, spasticity, aphrongeur, dysphagia, loss of muscle control, joint pain, stiffness of the extremities, dyspnea, fluid flow, and muscle control, including complete loss of essential functions in respiration, swallowing, feeding, speech, and limb movement. These symptoms are sometimes accompanied by depression, memory loss, difficulty planning, language deficiency, behavioral changes, and difficulty assessing spatial relationships and/or personality changes.

Motor neuron disease can be assessed and diagnosed by a skilled clinician, such as a neurologist, using various tools and tests. For example, blood and urine tests (e.g., tests to determine the presence of creatinine kinase), magnetic Resonance Imaging (MRI), electromyography (EMG), nerve conduction check (NCS), spinal fluid withdrawal, lumbar puncture, and/or muscle biopsy may be used to assess and diagnose the presence and risk of developing motor neuron disease. Motor neuron diseases may be diagnosed by physical and/or neurological examination to assess motor and sensory skills, neurological function, hearing and speech, vision, coordination and balance, mental state, and changes in emotion or behavior.

Amyotrophic lateral sclerosis

ALS is a progressive motor neuron disease that disrupts the signals of all voluntary muscles. ALS causes atrophy of upper and lower motor neurons. Symptoms of ALS include bulbar muscle weakness and wasting, general and bilateral strength loss, spasms, muscle cramps, fasciculi tremors, poor teeth, dyspnea, or loss of respiratory ability. Some individuals with ALS also suffer from cognitive decline. At the molecular level, ALS is characterized by protein and RNA aggregates in the cytoplasm of motor neurons, including aggregates of the RNA binding protein TDP 43.

ALS is most commonly found in men over 40 years of age, although it may also occur in women and children. The risk of ALS also increases in individuals who smoke, are exposed to chemicals such as lead, or have been in service in the military. Most cases of ALS are sporadic, while only about 10% of cases are familial. Causes of ALS include sporadic or genetic mutations, high glutamate levels, and improper protein handling. Genetic mutations associated with ALS include mutations in the genes SOD1, C9orf72, TARDBP, FUS, ANG, ATXN, CHCHD10, CHMP2B, DCTN1, erbB4, FIG4, HNRPA1, MATR3, NEFH, OPTN, PFN1, PRPH, SETX, SIGMAR1, SMN1, SPG11, SQSTM1, TBK1, TRPM7, TUBA4A, UBQLN2, VAPB, and VCP.

Frontotemporal dementia

Frontotemporal dementia (FTD) is a form of dementia involving the frontal and temporal lobes of the brain. FTD includes frontotemporal lobar degeneration (FTLD). It has an average age of onset earlier than Alzheimer's disease-40 years. Symptoms of FTD include extreme changes in behavior and character, speech and language problems, and symptoms associated with exercise such as tremors, rigidity, muscle spasms, weakness, and dysphagia. Subtypes of FTD include behavioral variability frontotemporal dementia (bvFTD), characterized by personality and behavioral changes, and Primary Progressive Aphasia (PPA), which affect language skills, speaking, writing, and understanding abilities. FTD is associated with tau protein accumulation (Pick corpuscles) and altered TDP43 function. About 30% of cases of FTD are familial and no other risk factors are known other than the family history of the disease. Genetic mutations associated with FTD include the genes C9orf72, granulin precursor (GRN), microtubule-associated protein tau (MAPT), UBQLN2, VPC, CHMP2B, TARDBP, FUS, ITM2B, CHCHD, SQSTM1, PSEN2, CTSF, CYP27A1, TBK1, and TBP.

Amyotrophic lateral sclerosis with frontotemporal dementia

Amyotrophic lateral sclerosis with frontotemporal dementia (ALS with FTD) is a clinical syndrome in which FTD and ALS occur in the same individual. Interestingly, the C9orf72 mutation is the most common cause of familial ALS and FTD. In addition, mutations in TBK1, VCP, SQSTM1, UBQLN2 and CHMP2B are also associated with ALS with FTD. Symptoms of ALS with FTD include abrupt changes in personality, as well as muscle weakness, muscle atrophy, muscle beam tremor, cramps, dysarthria, dysphagia, and degeneration of spinal cord, motor neurons, and the frontal and temporal lobes of the brain. At the molecular level, ALS accompanies FTD by accumulation of TDP-43 and/or FUS proteins. TBK1 mutations are associated with ALS, FTD and ALS with FTD.

Edge-dominated age-related TDP-43 encephalopathy (LATE)

Edge-dominated age-related TDP-43 encephalopathy (LATE) is characterized by accumulation of misfolded TDP-43 protein in the brain, particularly in the limbic system. LATE is a neurological disease that is commonly manifested in elderly patients (e.g., older than 80 years). LATE can be a diagnosis of dementia and LATE often exhibits symptoms of alzheimer's disease, including memory loss, confusion, and mood changes.

Therapeutic method

Further in a patient in need thereof (e.g., amyotrophic Lateral Sclerosis (ALS), frontotemporal dementia (FTD), alzheimer's Disease (AD), parkinson's Disease (PD), huntington's disease, progressive Supranuclear Palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), and edge-dominated age-related TDP-43 encephalopathy (LATE), including administration of STMN2 aon. In some embodiments, provided herein are methods of treating neurological diseases in a patient in need thereof, including administration of the disclosed STMN2 aon. In some embodiments of the present disclosure, an effective amount of the disclosed STMN2 oligonucleotides can be administered to a patient in need thereof to treat neurological diseases and/or to increase, restore, or stabilize expression of STMN2 mRNA that can be translated to produce functional STMN2 protein, thereby increasing, restoring, or stabilizing STMN2 activity and/or function.

In some embodiments, treating the neurological disease includes at least ameliorating or reducing symptoms associated with the neurological disease (e.g., reducing muscle weakness in ALS patients). Methods of treating a neurological disease (e.g., ALS, FTD, or ALS with FTD) in a patient suffering from the disease are provided, comprising administering the disclosed STMN2 AON. In some embodiments, methods of slowing the progression of a neurological disease, such as a motor neuron disease, are provided.

Provided herein are methods of treating, reducing the risk of developing, or delaying the onset of a neurological disease in a subject in need thereof comprising administering the disclosed STMN2 AON. The method includes, for example, treating a subject at risk of developing a neurological disease; for example, an effective amount of the disclosed STMN2 AON is administered to a subject. Neurological diseases that may be treated in this manner include motor neuron disease, ALS, FTD, ALS concomitant FTD, progressive bulbar paralysis, pseudobulbar paralysis, progressive amyotrophic lateral sclerosis, spinal muscular atrophy, and post-polio syndrome.

Methods of preventing or treating neurological diseases (e.g., PD, ALS, FTD and ALS with FTD) form part of the present disclosure. Such methods may comprise administering to a patient in need thereof or at risk a pharmaceutical formulation comprising an STMN2 AON as disclosed herein. For example, methods of preventing or treating neurological diseases are provided comprising administering to a patient in need thereof an STMN2 AON disclosed herein.

Patients treated using the methods described above can experience an increase, restoration, and stabilization of STMN2 mRNA expression that is capable of translating to produce at least about 5%, 10%, 20%, 30%, 40%, or even 50% of a functional STMN2 protein, thereby increasing, restoring, or stabilizing STMN2 activity and/or function in a target cell (e.g., motor neuron) after administration of the STMN2 oligonucleotide, e.g., 1 day, 2 days, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 7 weeks, 8 weeks, 1 month, 2 months, 3 months, 4 months, 5 months, or 6 months, or more. In some embodiments, such STMN2 oligonucleotides may be administered, for example, at least daily. STMN2 oligonucleotides can be administered orally. In some embodiments, the STMN2 oligonucleotide is administered intrathecally, intrathalamus, or intracisternally. For example, in embodiments described herein, the STMN2 oligonucleotide is administered about every 3 menses intrathecally, intrathalamus, or intracisternally. Delays or improvements in clinical manifestations of neurological diseases in patients due to administration of an STMN2 oligonucleotide disclosed herein may be at least, for example, 6 months, 1 year, 18 months, or even 2 years or longer, compared to patients not administered an STMN2 oligonucleotide (such as one disclosed herein).

The STMN2 oligonucleotides may be used alone or in combination with each other, whereby at least two STMN2 oligonucleotides are used together in a single composition or as part of a therapeutic regimen. STMN2 oligonucleotides may also be used in combination with other drugs or AONs to treat neurological diseases or disorders.

In various embodiments, disclosed herein are methods for treating Amyotrophic Lateral Sclerosis (ALS) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide hybridizes to SEQ ID NOs:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 and SEQ ID NO: any of 1392-1664 share at least 85% identity; wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are independently selected from the group consisting of: phosphate diester linkages, phosphorothioate linkages, alkyl phosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkyl phosphonate linkages, 3-methoxypropyl phosphonate linkages, methylphosphonate linkages, aminoalkyl phosphotriester linkages, alkylene phosphonate linkages, phosphonite linkages, phosphoramidate linkages, phosphorothioate linkages, phosphorodiamidate linkages, phosphoramidate linkages, aminoalkyl phosphoramidate linkages, phosphorothioate alkyl phosphonate linkages, phosphorothioate alkyl phosphotriester linkages, phosphorothioate linkages, phosphoroseleno-phosphate linkages, and phosphoroboro-phosphate linkages, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of: 2' -O- (2-methoxyethyl) nucleoside, 2' -O-methyl nucleoside, 2' -deoxy-2 ' -fluoro nucleoside, 2' -fluoro- β -D-arabinonucleoside, locked Nucleic Acid (LNA), tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET) and Peptide Nucleic Acid (PNA), optionally wherein the oligonucleotide further comprises a spacer.

In various embodiments, disclosed herein are methods for treating frontotemporal dementia (FTD) in a subject in need thereof, the methods comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide hybridizes to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 and SEQ ID NO: any of 1392-1664 share at least 85% identity; wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are independently selected from the group consisting of: phosphate diester linkages, phosphorothioate linkages, alkyl phosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkyl phosphonate linkages, 3-methoxypropyl phosphonate linkages, methylphosphonate linkages, aminoalkyl phosphotriester linkages, alkylene phosphonate linkages, phosphonite linkages, phosphoramidate linkages, phosphorothioate linkages, phosphorodiamidate linkages, phosphoramidate linkages, aminoalkyl phosphoramidate linkages, phosphorothioate alkyl phosphonate linkages, phosphorothioate alkyl phosphotriester linkages, phosphorothioate linkages, phosphoroseleno-phosphate linkages, and phosphoroboro-phosphate linkages, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of: 2' -O- (2-methoxyethyl) nucleoside, 2' -O-methyl nucleoside, 2' -deoxy-2 ' -fluoro nucleoside, 2' -fluoro- β -D-arabinonucleoside, locked Nucleic Acid (LNA), tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET) and Peptide Nucleic Acid (PNA), optionally wherein the oligonucleotide further comprises a spacer.

In various embodiments, disclosed herein are methods for treating Amyotrophic Lateral Sclerosis (ALS) with frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment having up to 7 linked nucleosides, or a pharmaceutically acceptable salt thereof, and wherein the oligonucleotide hybridizes to SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 and SEQ ID NO: any of 1392-1664 share at least 85% identity; wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are independently selected from the group consisting of: phosphate diester linkages, phosphorothioate linkages, alkyl phosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkyl phosphonate linkages, 3-methoxypropyl phosphonate linkages, methylphosphonate linkages, aminoalkyl phosphotriester linkages, alkylene phosphonate linkages, phosphonite linkages, phosphoramidate linkages, phosphorothioate linkages, phosphorodiamidate linkages, phosphoramidate linkages, aminoalkyl phosphoramidate linkages, phosphorothioate alkyl phosphonate linkages, phosphorothioate alkyl phosphotriester linkages, phosphorothioate linkages, phosphoroseleno-phosphate linkages, and phosphoroboro-phosphate linkages, and/or wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of: 2' -O- (2-methoxyethyl) nucleoside, 2' -O-methyl nucleoside, 2' -deoxy-2 ' -fluoro nucleoside, 2' -fluoro- β -D-arabinonucleoside, locked Nucleic Acid (LNA), tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET) and Peptide Nucleic Acid (PNA), optionally wherein the oligonucleotide further comprises a spacer.

Treatment and assessment

As used herein, patient refers to any animal at risk of, suffering from, or diagnosed with a neurological disease, including, but not limited to, mammals, primates, and humans. In certain embodiments, the patient may be a non-human mammal, such as, for example, a cat, dog, or horse. The patient may be a high risk individual diagnosed with a neurological disease, a person who has been diagnosed with a neurological disease, a person who has previously had a neurological disease, or an individual who has been assessed for symptoms or indications of a neurological disease, e.g., any sign or symptom associated with a neurological disease, such as Amyotrophic Lateral Sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, alzheimer's Disease (AD), parkinson's Disease (PD), huntington's disease, progressive Supranuclear Palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), and TDP43 protein disease (e.g., chronic traumatic brain disease, perry syndrome, dementia with or without lewy bodies associated with alzheimer's disease, parkinson's disease, and edge-dominant age-related TDP-43 brain disease (LATE)).

As used herein, a "patient in need thereof" refers to a patient suffering from any symptom or manifestation of a neurological disease, a patient likely to suffer from any symptom or manifestation of a neurological disease, or any patient likely to benefit from the methods of the present disclosure for treating a neurological disease. Patients in need thereof may include patients diagnosed with a risk of a neurological disease, patients who have had a neurological disease in the past, or who have previously received treatment for a neurological disease.

As used herein, "effective amount" refers to an amount of an agent sufficient to at least partially treat a condition when administered to a patient. The therapeutically effective amount will vary depending on the severity of the condition, the route of administration of the components, the age, weight, etc., of the patient being treated. Thus, an effective amount of the disclosed STMN2 oligonucleotides is that amount of STMN2 oligonucleotides required to treat a neurological disease in a patient such that administration of the agent can prevent the neurological disease from occurring in the subject, prevent progression of the neurological disease (e.g., prevent neurological symptoms such as reduced muscle, spasticity, or increased onset or severity of fascicular tremor), or alleviate or completely ameliorate all relevant symptoms of the neurological disease, i.e., cause regression of the disease.

Efficacy of treatment may be assessed by assessing general symptoms associated with the neurological disease, histological analysis, biochemical assays, imaging methods such as, for example, magnetic resonance imaging or other known methods. For example, after administration of the disclosed STMN2 oligonucleotides to a patient with a neurological disease, the efficacy of the treatment can be assessed by analyzing the overall symptoms of the disease, such as changes and control of muscle strength or other aspects of the general pathology associated with the neurological disease.

Efficacy of the treatment can also be assessed at a tissue or cellular level, e.g., by obtaining a tissue biopsy (e.g., brain, spinal cord, muscle, motor neuron tissueBiopsies or olfactory neurosphere cell biopsies) and assess gross tissue or cell morphology or staining characteristics. Biochemical assays that examine protein or RNA expression can also be used to assess the efficacy of a treatment. For example, one can evaluate the level of protein or gene product indicative of neurological disease in dissociated cells or undissociated tissue by immunocytochemistry, immunohistochemistry, western blot, or Northern blot methods or methods for evaluating RNA levels, such as quantitative or semi-quantitative polymerase chain (e.g., digital PCR (DigitalPCR, dPCR or dePCR), qPCR, etc.) reactions. One can also evaluate the effect of the antigen on spinal fluid, cerebrospinal fluid, extracellular vesicles (e.g., light Neurofilament (NEFL), heavy Neurofilament (NEFH), TDP-43, or p75 extracellular domain (p 75) ^ECD ) Levels of presence or expression (e.g., exosome-like cerebrospinal fluid extracellular vesicles ("CSF exosomes"), such as described in Welton et al, (2017) "Cerebrospinal fluid extracellular vesicle enrichment for protein biomarker discovery in neurological disease; multiple sclerosis "J excel vectors, 6 (1): 1-10; and Street et al, (2012) "Identification and proteomic profiling of exosomes in human cerebrospinal fluid" J trans.med., 10: 5), urine, stool, lymphatic fluid, blood, plasma, or serum to assess disease status and therapeutic efficacy. One can also assess the presence or expression level of useful biomarkers found in plasma, neuronal extracellular vesicles/exosomes. Other measures of efficacy may include intensity duration constant (SDTC), short Interval Cortical Inhibition (SICI), force measurement, accurate testing of muscle strength such as limbs (ATLIS), compound Muscle Action Potential (CMAP), and ALSFRS-R. In certain embodiments, the uro-neurotrophic factor receptor p75 extracellular domain (p 75 ^ECD ) Is a disease progression and prognosis biomarker in Amyotrophic Lateral Sclerosis (ALS). Phosphorylated neurofilament heavy chain (pNFH) in cerebrospinal fluid (VSF) predicts disease status and survival in patients with C9ORF 72-related amyotrophic lateral sclerosis (C9 ALS). CSFpNFH as a prognostic biomarker for clinical trials would increase the likelihood of successful development of a therapeutic approach to c9 ALS.

In assessing the efficacy of a treatment, an appropriate control may be selected to ensure an effective assessment. For example, one can compare symptoms assessed in a patient with a neurological disease after administration of the disclosed STMN2 oligonucleotide to those symptoms of the same patient prior to treatment or at an earlier point in time during treatment, or in another patient who is not diagnosed with a neurological disease. Alternatively, one can compare the results of biochemical or histological analysis of tissue after administration of the disclosed STMN2 oligonucleotides to those from the same patient or from individuals not diagnosed with a neurological disease or from tissue of the same patient prior to administration of the STMN2 oligonucleotides. In addition, one can compare a blood, plasma, serum, cell, urine, lymph, spinal fluid, cerebrospinal fluid, or fecal sample after administration of the STMN2 oligonucleotide to a comparable sample from an individual who is not diagnosed with a neurological disorder or from the same patient prior to administration of the STMN2 oligonucleotide. In some embodiments, one can compare an extracellular vesicle (e.g., CSF exosome) after administration of an STMN2 oligonucleotide to an extracellular vesicle from an individual not diagnosed with a neurological disease or from the same patient prior to administration of an STMN2 oligonucleotide.

Verification of STMN2 oligonucleotides can be determined by assessing STMN2 expression levels or activity directly or indirectly. For example, biochemical assays measuring STMN2 protein or RNA expression can be used to evaluate a nucleic acid sequence comprising a sequence that hybridizes to SEQ ID NO:1339 or SEQ ID NO:1341 shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) of the overall role of a STMN2 transcript (e.g., STMN2 pre-mRNA comprising a cryptic exon) of sequence identity. For example, one can measure STMN2 protein levels in cells or tissues by Western blotting to assess overall STMN2 levels. One can also measure STMN2 mRNA levels by Northern blotting or quantitative polymerase chain reaction to determine a sequence comprising a sequence identical to SEQ ID NO:1339 or SEQ ID NO:1341 shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) of the overall role of a STMN2 transcript (e.g., STMN2 pre-mRNA comprising a cryptic exon) of sequence identity. One can also evaluate the level of STMN2 protein or another protein indicative of STMN2 signaling activity in dissociated cells, undissociated tissue, extracellular vesicles (e.g., CSF exosomes), blood, serum, or stool by immunocytochemistry or immunohistochemical methods.

Useful biomarkers (e.g., neurofilament light (NEFL), neurofilament weight (NEFH), TDP-43, or p 75) can also be found by measuring parameters such as autophagy, endocytosis, protein aggregation, and in plasma, spinal fluid, cerebrospinal fluid, extracellular vesicles (e.g., cerebrospinal fluid exosomes), blood, urine, lymph fluid, stool, or tissue ^ECD ) Indirectly assessing the presence or level of a polypeptide comprising a polypeptide sequence corresponding to SEQ ID NO:1339 or SEQ ID NO:1341 shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to the expression level of a STMN2 transcript (e.g., STMN2 pre-mRNA comprising a cryptic exon) to evaluate the regulation of expression of a polypeptide comprising a sequence identical to SEQ ID NO:1339 or SEQ ID NO:1341 shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity to the sequence of the STMN2 transcript (e.g., STMN2 pre-mRNA comprising a cryptic exon). The expression of a polypeptide comprising a polypeptide identical to SEQ ID NO:1339 or SEQ ID NO:1341 shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity of the sequence (e.g., a STMN2 pre-mRNA comprising a cryptic exon). Other measurements may include intensity duration constant (SDTC), short-interval cortical inhibition (SICI), 157yrrolidiny, accurate testing of limb isometric muscle strength (ATLIS), composite muscle action potential, and ALSFRS-R. In certain embodiments, the urinary neurotrophic factor receptor p75 extracellular domain (p 75 ECD) is a disease progression and prognosis biomarker in Amyotrophic Lateral Sclerosis (ALS). Phosphorylation in cerebrospinal fluid (CSF) The neurofilament heavy chain (pNFH) predicts disease status and survival in c9ALS patients. CSF pNFH as a prognostic biomarker for clinical trials would increase the likelihood of successful development of c9ALS treatment.

The present disclosure also provides methods of restoring expression of full length STMN2 transcripts in cells of a patient suffering from a neurological disease. Full length STMN2 transcripts may be recovered in any cell in which STMN2 expression or activity occurs, including cells of the nervous system (including cells of the central nervous system (e.g., spinal cord or brain), peripheral nervous system, motor neurons, glial cells, astrocytes, oligodendrocytes, microglial cells, brain stem, frontal lobe, temporal lobe, spinal cord), musculoskeletal system, spinal fluid, and cerebrospinal fluid. Cells of the musculoskeletal system include skeletal muscle cells (e.g., muscle cells). Motor neurons include upper motor neurons and lower motor neurons.

Pharmaceutical compositions and routes of administration

The present disclosure also provides methods of treating neurological diseases by administering a pharmaceutical composition comprising the disclosed STMN2 oligonucleotides. In another aspect, the present disclosure provides a pharmaceutical composition for treating a neurological disease. The pharmaceutical composition may consist of the disclosed STMN2 oligonucleotides and a pharmaceutically acceptable carrier. As used herein, the term "pharmaceutical composition" means, for example, a mixture of therapeutic compounds to be administered to a mammal, such as a human, in a pharmaceutically acceptable carrier containing a specific amount, such as a therapeutically effective amount, for example, for the treatment of a neurological disease. In some embodiments, described herein are pharmaceutical compositions comprising the disclosed STMN2 oligonucleotides and a pharmaceutically acceptable carrier. In another aspect, the present disclosure provides the use of the disclosed STMN2 oligonucleotides in the manufacture of a medicament for treating a neurological disease. As used herein, "drug" has substantially the same meaning as the term "pharmaceutical composition".

As used herein, "pharmaceutically acceptable carrier" means buffers, carriers and excipients suitable for contact with tissues of humans and animals without undue toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. The carrier should be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not deleterious to the recipient. Pharmaceutically acceptable carriers include buffers, solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is known in the art. In one embodiment, the pharmaceutical composition is administered orally and includes an enteric coating suitable for modulating the absorption site of the encapsulated material in the digestive system or intestinal tract. For example, the enteric coating may comprise an ethyl acrylate-methacrylic acid copolymer.

In one embodiment, the disclosed STMN2 oligonucleotides and any pharmaceutical compositions thereof can be administered by one or more routes, including topically, intrathecally, intrathalamus, intracisternally, parenterally, orally, rectally, buccally, sublingually, vaginally, pulmonary, intratracheally, intranasally, transdermally, or intraduodenally. As used herein, the term parenteral includes subcutaneous injections, intracardiac administration, intravenous, intracisternal, intraventricular, intrathecal, thalamic, intramuscular, intraperitoneal, intrasternal injection or infusion techniques. For example, the disclosed STMN2 oligonucleotides can be administered to a subject subcutaneously. In another example, the disclosed STMN2 oligonucleotides can be administered orally to a subject. In another example, the disclosed STMN2 oligonucleotides can be administered directly to the nervous system or specific areas or cells of the nervous system (e.g., brain, brainstem, lower motor neurons, spinal cord, upper motor neurons) via parenteral administration, e.g., the disclosed STMN2 oligonucleotides can be administered intrathecally, intrathalamus, or intracisternally.

In various embodiments, the STMN2 oligonucleotide, e.g., STMN2 AON, may be exposed to a calcium-containing buffer prior to administration. Such calcium-containing buffers may alleviate toxic adverse effects of STMN2 oligonucleotides. Further details of exposure of exemplary antisense oligonucleotides to calcium-containing buffers are described in Moazami, et al, quantifying and Mitigating Motor Phenotypes Induced by Antisense Oligonucleotides in the Central Nervous System, bioRxiv 2021.02.14.431096, which is incorporated herein by reference in its entirety.

In some embodiments, the STMN2 oligonucleotide, e.g., STMN2 AON, may be encapsulated in a nanoparticle coating. Nanoparticle encapsulation is believed to prevent AON degradation and enhance cellular uptake. For example, in some embodiments, the STMN2 oligonucleotide is encapsulated in a coating of a cationic polymer, such as a synthetic polymer (e.g., poly-L-lysine, polyamidoamine, poly (β -amino ester)) and polyethylenimine) or a naturally occurring polymer (e.g., chitosan and protamine). In some embodiments, the STMN2 oligonucleotide is encapsulated in a lipid or lipid-like material, such as a cationic lipid, a cationic lipid-like material, or an ionizable lipid that is positively charged only at an acidic pH. For example, in some embodiments, the STMN2 oligonucleotide is encapsulated in a lipid nanoparticle that includes a hydrophobic moiety, such as cholesterol and/or polyethylene glycol (PEG) lipids.

Pharmaceutical compositions containing the disclosed STMN2 oligonucleotides, such as those disclosed herein, may be presented in dosage unit form and may be prepared by any suitable method. The pharmaceutical composition should be formulated to be compatible with its intended route of administration. Useful formulations may be prepared by methods well known in the pharmaceutical arts. See, for example, remington's Pharmaceutical Sciences,18 ^th ed.(Mack Publishing Company，1990)。

In some embodiments, the pharmaceutical formulation is sterile. Sterilization may be accomplished, for example, by filtration through sterile filtration membranes. When the composition is lyophilized, filter sterilization may be performed before or after lyophilization and reconstitution.

Parenteral administration

The pharmaceutical compositions of the present disclosure may be formulated for parenteral administration, e.g., formulated for injection by intravenous, intracisternal, intraventricular, intramuscular, subcutaneous, intrathecal, intrathalamic, intralesional, or intraperitoneal routes. Those of skill in the art will be aware of the preparation of aqueous compositions, such as aqueous pharmaceutical compositions containing the disclosed STMN2 oligonucleotides, in view of this disclosure. Typically, such compositions may be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for preparing solutions or suspensions after addition of liquids prior to injection can also be prepared; and the formulation may also be emulsified.

Pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; the preparation comprises physiological saline, artificial cerebrospinal fluid, sesame oil, peanut oil or propylene glycol water solution; sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy injectability is achieved. It must be stable under the conditions of preparation and storage and must be protected from the contaminating action of microorganisms such as bacteria and fungi.

Solutions of the active compound as the free base or pharmaceutically acceptable salt may be prepared in water suitably mixed with a surfactant such as hydroxypropyl cellulose. Dispersants may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and oils. In addition, sterile, fixed oils may be employed as a solvent or suspending medium. For this purpose, any bland fixed oil may be employed including synthetic mono-or diglycerides. In addition, fatty acids such as oleic acid find use in the preparation of injectables. The sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a non-toxic parenterally-acceptable diluent or solvent, for example as a solution in 1, 3-butanediol. Acceptable vehicles and solvents that may be employed include water, ringer's solution, u.s.p. And isotonic sodium chloride solution. In one embodiment, the disclosed STMN2 antisense oligonucleotide may be suspended in a composition comprising 1% (w/v) sodium carboxymethyl cellulose and 0.1% (v/v) TWEEN ^TM 80 in a carrier liquid. Under normal conditions of storage and use, these formulations contain a preservative to prevent the growth of microorganisms.

Injectable formulations, for example sterile injectable aqueous or oleaginous suspensions, may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. Generally, the dispersions are prepared by incorporating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. The sterile injectable solutions of the present disclosure can be prepared by incorporating the disclosed STMN2 antisense oligonucleotides in the required amount of an appropriate solvent with the various other ingredients enumerated above, as required, followed by filtered sterilization. As regards the sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof. The injectable formulation may be sterilized, for example, by filtration through an antibacterial filter.

It is also contemplated to prepare more or highly concentrated solutions for intramuscular injection. In this regard, DMSO is preferred as a solvent, as this will result in extremely rapid penetration, delivering high concentrations of the disclosed oligonucleotides to small areas.

Suitable preservatives for such solutions include benzalkonium chloride, benzethonium chloride, chlorobutanol, thimerosal, and the like. Suitable buffers include boric acid, sodium and potassium bicarbonate, sodium and potassium borates, sodium and potassium carbonates, sodium acetate, sodium hydrogen phosphate, and the like, in amounts sufficient to maintain a pH between about pH 6 and pH 8, for example, between about pH 7 and pH 7.5. Suitable tonicity agents are dextran 40, dextran 70, dextrose, glycerol, potassium chloride, propylene glycol, sodium chloride and the like such that the sodium chloride equivalent of the solution is in the range of 0.9 plus or minus 0.2%. Suitable antioxidants and stabilizers include sodium bisulfite, sodium metabisulfite, 161yrrolidiny sodium, thiourea and the like. Suitable wetting and clarifying agents include polysorbate 80, polysorbate 20, poloxamer 282, and tyloxapol. Suitable viscosity enhancing agents include dextran 40, dextran 70, gelatin, glycerol, hydroxyethyl cellulose, hydroxymethyl propyl cellulose, lanolin, methyl cellulose, petrolatum, polyethylene glycol, polyvinyl alcohol, polyvinylpyrrolidone, carboxymethyl cellulose, and the like.

Oral administration

In some embodiments, compositions suitable for oral delivery of the disclosed STMN2 oligonucleotides are contemplated herein, e.g., tablets comprising an enteric coating, e.g., an anti-gastric coating, such that the composition can deliver the STMN2 oligonucleotide to, e.g., the gastrointestinal tract of a patient.

For example, provided tablets for oral administration comprise (e.g., are at least partially formed from) particles comprising the disclosed STMN2 oligonucleotides, e.g., from any of SEQ ID NOs: 1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 and SEQ ID NO:1392-1664, which targets an oligonucleotide comprising a sequence identical to SEQ ID NO:1339 or SEQ ID NO:1341, and pharmaceutically acceptable excipients. Such tablets may be coated with an enteric coating. Contemplated tablets may include pharmaceutically acceptable excipients such as fillers, binders, disintegrants and/or lubricants, as well as colorants, mold release agents, coating agents, sweeteners, flavoring agents such as wintergreen, orange, xylitol, sorbitol, fructose and maltodextrin, and flavoring agents, preservatives and/or antioxidants.

In some embodiments, contemplated pharmaceutical formulations include an intra-granular phase comprising the disclosed STMN2 oligonucleotides, e.g., a sequence consisting of SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 and SEQ ID NO:1392-1664, which targets an STMN2 antisense oligonucleotide comprising a sequence identical to any one of SEQ ID NOs: 1339 or SEQ ID NO:1341 shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity. In some embodiments, contemplated pharmaceutical formulations include an intra-granular phase comprising the disclosed STMN2 oligonucleotides, e.g., a phase consisting of SEQ ID NO:1-466, SEQ ID NO:893-1338, SEQ ID NO:1342-1366 and SEQ ID NO:1392-1664, which targets an STMN2 antisense oligonucleotide comprising a sequence identical to any one of SEQ ID NOs: 1339 or SEQ ID NO:1341 shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity. For example, the disclosed STMN2 oligonucleotides and bulking agents can optionally be mixed together with other excipients and formed into particles. In some embodiments, wet granulation may be used to form an intragranular phase, e.g., a liquid (e.g., water) is added to the mixed STMN2 oligonucleotide and filler, and the combination is then dried, ground, and/or sieved to produce granules. Those skilled in the art will appreciate that other methods may be used to achieve the intra-particulate phase.

In some embodiments, contemplated formulations include an extra-granular phase, which may include one or more pharmaceutically acceptable excipients, and may be mixed with an intra-granular phase to form the disclosed formulations.

The disclosed formulations may include a intragranular phase containing a filler. Exemplary fillers include, but are not limited to, cellulose, gelatin, calcium phosphate, lactose, sucrose, glucose, mannitol, sorbitol, microcrystalline cellulose, pectin, polyacrylate, dextrose, cellulose acetate, hydroxypropyl methylcellulose, partially pregelatinized starch, calcium carbonate, and others including combinations thereof.

In some embodiments, the disclosed formulations may include an intra-particulate phase and/or an extra-particulate phase including a binder, which may generally act to hold the ingredients of the pharmaceutical formulation together. Exemplary adhesives of the present disclosure may include, but are not limited to, the following: starch, sugar, cellulose or modified cellulose such as hydroxypropyl cellulose, lactose, pregelatinized corn starch, polyvinylpyrrolidone, hydroxypropyl cellulose, hydroxypropyl methylcellulose, low substituted hydroxypropyl cellulose, sodium carboxymethyl cellulose, methyl cellulose, ethyl cellulose, sugar alcohols, and others including combinations thereof.

Contemplated formulations, for example, formulations comprising an intra-granular phase and/or an extra-granular phase, may include disintegrants such as, but not limited to, starch, cellulose, cross-linked polyvinylpyrrolidone, sodium starch glycolate, sodium carboxymethyl cellulose, alginates, cornstarch, cross-linked sodium cellulose, cross-linked carboxymethyl cellulose, low-substituted hydroxypropyl cellulose, acacia, and others including combinations thereof. For example, the intra-and/or extra-granular phase may include a disintegrant.

In some embodiments, contemplated formulations include an intragranular phase comprising the disclosed STMN2 oligonucleotides and an excipient selected from the group consisting of: mannitol, microcrystalline cellulose, hydroxypropyl methylcellulose, and sodium starch glycolate, or a combination thereof, and an extra-granular phase comprising one or more of the following: microcrystalline cellulose, sodium starch glycolate, and magnesium stearate, or mixtures thereof.

In some embodiments, contemplated formulations may include a lubricant, for example, the extra-granular phase may contain a lubricant. Lubricants include, but are not limited to, talc, silica, fat, stearin, magnesium stearate, calcium phosphate, silica, calcium silicate, calcium phosphate, colloidal silica, metal stearate, hydrogenated vegetable oil, corn starch, sodium benzoate, polyethylene glycol, sodium acetate, calcium stearate, sodium lauryl sulfate, sodium chloride, magnesium lauryl sulfate, talc, and stearic acid.

In some embodiments, the pharmaceutical formulation comprises an enteric coating. Typically, the enteric coating creates a barrier for the oral drug, controlling the location of drug absorption along the digestive tract. The enteric coating may include polymers that disintegrate at different rates depending on pH. The enteric coating may include, for example, cellulose acetate phthalate, methyl acrylate-methacrylic acid copolymer, cellulose acetate succinate, hydroxypropyl methylcellulose phthalate, methyl methacrylate-methacrylic acid copolymer, ethyl acrylate-methacrylic acid copolymer, methacrylic acid copolymer type C, polyvinyl acetate-phthalate, and cellulose acetate phthalate.

Exemplary enteric coatings includeAMB，/>A stage. In some embodiments, the enteric coating may comprise from about 5% to about 10%, from about 5% to about 20%, from 8% to about by weight15%, about 8% to about 20%, about 10% to about 20%, or about 12% to about 20%, or about 18% of the intended tablet. For example, the enteric coating may comprise an ethyl acrylate-methacrylic acid copolymer.

For example, in contemplated embodiments, a tablet is provided comprising or consisting essentially of: about 0.5% to about 70%, such as about 0.5% to about 10%, or about 1% to about 20% by weight of the disclosed STMN2 oligonucleotides or pharmaceutically acceptable salts thereof. Such tablets may include, for example, from about 0.5% to about 60% mannitol by weight, such as from about 30% to about 50% mannitol by weight, such as about 40% mannitol by weight; and/or from about 20% to about 40% by weight microcrystalline cellulose, or from about 10% to about 30% by weight microcrystalline cellulose. For example, the disclosed tablets may comprise an intra-granular phase comprising from about 30% to about 60% by weight, such as from about 45% to about 65% by weight, or alternatively, from about 5% to about 10% by weight of the disclosed STMN2 oligonucleotide, from about 30% to about 50% by weight, or alternatively, from about 5% to about 15% mannitol, from about 5% to about 15% by weight microcrystalline cellulose, from about 0% to about 4% or from about 1% to about 7% hydroxypropyl methylcellulose, and from about 0% to about 4% by weight, such as from about 2% to about 4% sodium starch glycolate.

In another contemplated embodiment, a pharmaceutical tablet formulation for oral administration of a disclosed STMN2 oligonucleotide comprises an intragranular phase, wherein the intragranular phase comprises a disclosed STMN2 AON or a pharmaceutically acceptable salt thereof (such as a sodium salt) and a pharmaceutically acceptable filler, and may further comprise an extragranular phase, which may comprise a pharmaceutically acceptable excipient such as a disintegrant. The extra-granular phase may comprise a component selected from microcrystalline cellulose, magnesium stearate and mixtures thereof. The pharmaceutical composition may further comprise an enteric coating of about 12% to 20% by weight of the tablet. For example, a pharmaceutically acceptable tablet for oral use may comprise about 0.5% to 10% by weight of a disclosed STMN2 AON, such as a disclosed STMN2 AON or a pharmaceutically acceptable salt thereof, about 30% to 50% by weight mannitol, about 10% to 30% by weight microcrystalline cellulose, and an enteric coating comprising an ethyl acrylate-methacrylic acid copolymer.

In another example, a pharmaceutically acceptable tablet for oral use may comprise an intra-granular phase comprising about 5% to about 10% by weight of the disclosed STMN2 AON, e.g., the disclosed STMN2 AON or a pharmaceutically acceptable salt thereof, about 40% mannitol by weight, about 8% microcrystalline cellulose by weight, about 5% hydroxypropyl methylcellulose by weight, and about 2% sodium starch glycolate by weight; an extra-granular phase comprising about 17% microcrystalline cellulose by weight, about 2% sodium starch glycolate by weight, about 0.4% magnesium stearate by weight; and an enteric coating comprising an ethyl acrylate-methacrylic acid copolymer on the tablet.

In some embodiments, the pharmaceutical composition may contain an enteric coating comprising about 13% or about 15%, 16%, 17% or 18% by weight, e.g.,(see, e.g., PCT publication No. WO2010/054826, which is incorporated herein by reference in its entirety).

The rate at which the coating dissolves and the active ingredient is released is its dissolution rate. In embodiments, the desired tablet may have a dissolution profile of about 50% to about 100% of the STMN2 oligonucleotide released after about 120 minutes to about 240 minutes, e.g., 180 minutes, when tested in a USP/EP type 2 apparatus (paddle) at 100rpm and 37 ℃ in phosphate buffer at pH 7.2. In another embodiment, the desired tablet may have a dissolution profile that does not substantially release STMN2 oligonucleotide after 120 minutes, for example, when tested in a USP/EP type 2 apparatus (paddle) at 100rpm and 37 ℃ in dilute HCl at pH 1.0. In another embodiment, the desired tablet may have a dissolution profile of about 10% to about 30%, or no more than about 50% of the STMN2 oligonucleotide released after 30 minutes, for example, when tested in a USP/EP type 2 apparatus (paddle) at 100rpm and 37 ℃ in phosphate buffer at pH 6.6.

In some embodiments, the methods provided herein may further comprise administering at least one additional agent that is directed to the treatment of the diseases and conditions disclosed herein. In one embodiment, other agents (e.g., sequentially or simultaneously) may be co-administered as desired.

Dosage and frequency of administration

The dosages or amounts described below refer to the oligonucleotides or pharmaceutically acceptable salts thereof.

In some embodiments, the methods described herein comprise administering at least 1 μg, at least 5 μg, at least 10 μg, at least 20 μg, at least 30 μg, at least 40 μg, at least 50 μg, at least 60 μg, at least 70 μg, at least 80 μg, at least 90 μg, or at least 100 μg of an STMN2 antisense oligonucleotide, e.g., an STMN2 oligonucleotide. In some embodiments, the method comprises administering from 10mg to 500mg, from 1mg to 10mg, from 10mg to 20mg, from 20mg to 30mg, from 30mg to 40mg, from 40mg to 50mg, from 50mg to 60mg, from 60mg to 70mg, from 70mg to 80mg, from 80mg to 90mg, from 90mg to 100mg, from 100mg to 150mg, from 150mg to 200mg, from 200mg to 250mg, from 250mg to 300mg, from 300mg to 350mg, from 350mg to 400mg, from 400mg to 450mg, from 450mg to 500mg, from 500mg to 600mg, from 600mg to 700mg, from 700mg to 800mg, from 800mg to 900mg, from 900mg to 1g, from 1mg to 50mg, from 20mg to 40mg, or from 1mg to 500mg of an STMN2 antisense oligonucleotide.

In some embodiments, the methods described herein comprise administering a formulation comprising about 10mg, 15mg, 20mg, 25mg, 30mg, 35mg, 40mg, 50mg, 60mg, 70mg, 80mg, 90mg, 100mg, 110mg, 120mg, 130mg, 140mg, 150mg, 160mg, 170mg, 180mg, 190mg, 200mg, 250mg, 300mg, 350mg, 400mg, 450mg, 500mg, 600mg, 700mg, 800mg, 900mg, 1g, 1.5g, 2.0g, 2.5g, 3.0g, 3.5g, 4.0g, 4.5g, or 5.0g of a disclosed STMN2 oligonucleotide. In some embodiments, the formulation may include about 40mg, 80mg, or 160mg of the disclosed STMN2 oligonucleotide. In some embodiments, the formulation may include at least 100 μg of the disclosed STMN2 oligonucleotides. For example, a formulation may include about 0.1mg, 0.2mg, 0.3mg, 0.4mg, 0.5mg, 1mg, 5mg, 10mg, 15mg, 20mg, 25mg, or 30mg of the disclosed STMN2 oligonucleotide. The amount administered depends on variables such as the type and extent of the disease or indication to be treated, the overall health and size of the patient, the in vivo efficacy of the STMN2 oligonucleotide, the pharmaceutical formulation and the route of administration. The initial dose may be increased beyond the upper limit to quickly reach the desired blood or tissue level. Alternatively, the initial dose may be less than optimal and the dose may be gradually increased during the course of treatment. Human doses can be optimized, for example, in a conventional phase I dose escalation study. The frequency of administration may vary depending on factors such as the route of administration, the dosage and the disease being treated. Exemplary dosing frequencies are once daily, once weekly, and once every two weeks. In some embodiments, the administration is once daily for 7 days. In some embodiments, the administration is once every 4 weeks, once every 5 weeks, once every 6 weeks, once every 7 weeks, once every 8 weeks, once every 9 weeks, once every 10 weeks, once every 11 weeks, or once every 12 weeks. In some embodiments, the administration is once per month to once every three months.

Combination therapy

In various embodiments, the STMN2 AONs disclosed herein can be administered in combination with one or more additional therapies. In some embodiments, the disclosed combination therapies of the oligonucleotides and one or more additional therapies may synergistically treat any of Amyotrophic Lateral Sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, alzheimer's Disease (AD), parkinson's Disease (PD), huntington's disease, progressive Supranuclear Palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), and TDP43 protein disease (e.g., chronic traumatic encephalopathy, perry syndrome, dementia with lewy bodies associated with alzheimer's disease, parkinson's disease or not, and edge-dominated age-related TDP-43 encephalopathy (LATE)).

Exemplary additional therapies include riluzole (Rilutek), edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (ELYBRIO), ZILUCOPLAN (RA 101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078 and BIIB 105), BIIB100, levodopa/carbidopa, dopaminergic agents (e.g., ropinirole, pramipexole, rotigotine), medroxyprogesterone, KCNQ2/KCNQ3 openers (e.g., retigabine, XEN1101 or QRL-101), anticonvulsants and psychostimulants. Additional therapies may also include respiratory care, physical therapy, occupational therapy, speech therapy, and nutritional support. In various embodiments, the additional therapy may be a second antisense oligonucleotide. For example, the second antisense oligonucleotide can target an STMN2 transcript (e.g., STMN2 pre-mRNA, mature STMN2 mRNA) to regulate expression levels of the full-length STMN2 protein.

In various embodiments, the disclosed oligonucleotides and one or more additional therapies can be conjugated to each other and provided in conjugated form. Further description of conjugates involving the disclosed oligonucleotides is described below. In various embodiments, the disclosed oligonucleotides and one or more additional therapies are provided together. In various embodiments, the disclosed oligonucleotides and one or more additional therapies are provided simultaneously. In various embodiments, the disclosed oligonucleotides and one or more additional therapies are provided sequentially.

Conjugate(s)

In certain embodiments, provided herein are oligomeric compounds comprising an oligonucleotide (e.g., STMN2 oligonucleotide) and optionally one or more conjugate groups and/or end groups (terminal groups). The conjugate group includes one or more conjugate moieties and a conjugate linker that links the conjugate moieties to the oligonucleotide. The conjugate group may be attached to one or both of the ends of the oligonucleotide and/or any internal position. In certain embodiments, the conjugate group is attached to the 2' -position of the nucleoside of the modified oligonucleotide. In certain embodiments, the conjugate groups attached to one or both of the ends of the oligonucleotide are end groups. In certain such embodiments, the conjugate groups or end groups are attached at the 3 'and/or 5' ends of the oligonucleotides. In certain such embodiments, the conjugate group (or end group) is attached at the 3' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 3' end of the oligonucleotide. In certain embodiments, a conjugate group (or end group) is attached at the 5' end of the oligonucleotide. In certain embodiments, the conjugate group is attached near the 5' end of the oligonucleotide.

Examples of end groups include, but are not limited to, conjugation groups, end capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides, independently modified or unmodified.

Conjugation group

In certain embodiments, the STMN2 AON is covalently attached to one or more conjugate groups. In certain embodiments, the conjugate group alters one or more properties of the attached oligonucleotide, including, but not limited to, pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cell uptake, charge, and clearance. In certain embodiments, the conjugate group alters (e.g., increases) the circulation time of the oligonucleotide in the blood stream such that an increased concentration of the oligonucleotide is delivered to the brain. In certain embodiments, the conjugate group alters the residence time of the oligonucleotides in the target organ (e.g., brain) (e.g., increases the residence time) such that the increased residence time of the oligonucleotides improves their performance (e.g., efficacy). In certain embodiments, the conjugate group increases delivery of the oligonucleotide to the brain through the blood brain barrier and/or brain parenchyma (e.g., through receptor-mediated endocytosis). In particular embodiments, the conjugate group enables the oligonucleotide to target a particular organ (e.g., brain). In certain embodiments, the conjugate group imparts novel properties to the attached oligonucleotide, such as a fluorophore or reporter group capable of detecting the oligonucleotide. Certain conjugation groups and conjugation moieties have been previously described, for example: cholesterol moiety (Letsinger et al, proc.Natl. Acad.Sci.USA,1989, 86, 6553-6556), cholic acid (Manoharan et al, bioorg.Med. Chem. Lett.,1994,4, 1053-1060), thioethers, such as hexyl-S-tritylthiol (Manoharan et al, ann.NY. Acad.Sci.,1992, 660, 306-309;Manoharan et al, bioorg.Med. Chem. Lett.,1993,3, 2765-2770), mercapto cholesterol (thiocholestol) (Obohauser et al, nucl. Acids Res.,1992, 20, 533-538), fatty chains, such as dodecyl glycol (do-decan-diol) or undecyl (undecyl) residues (undecyl) such as (Saon-Behmoeas J,1991, 19910, 19983, lett., 19910, 1999, lett., 327, 1995, 1999, 10-259, 1995, 533-538); biochimie,1993, 75, 49-54), phospholipids, such as di-hexadecyl-rac-glycerol (di-hexadecyl-rac-glycerol) or 1, 2-di-hexadecyl-rac-glycerol-3-H-phosphonic acid triethyl-ammonium (trimethyl-ammonium 1, 2-di-0-hexadecyl-rac-glycerol-3-H-phosphate) (Manoharan et al, tetrahedron Lett, 1995, 36, 3651-3654; shea et al, nucl. Acids Res.,1990, 18, 3777-3783), polyamines or polyethylene glycol chains (Manoharan et al, nucl & Nucl tides,1995, 14, 969-973), or adamantanacetyl moieties (biogra et al, biobook, 1995, biol. 1264-237, 1995), octadecylamine (octadecylamine) or hexylamino-carbonyl-oxycholesterol) moiety (Crooke et al, j. Pharmacol. Exp. Ter., 1996, 277, 923-937), tocopherol groups (nishena et al, molecular Therapy Nucleic Acids,2015,4, e220; and nishena et al, molecular Therapy,2008, 16, 734-740), or GalNAc clusters (e.g., WO 2014/179620).

Conjugate moiety

Conjugate moieties include, but are not limited to, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates, vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterol, sulfhydryl cholesterol, cholic acid moieties, folic acid, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluorescein, rhodamine, coumarin, fluorophores, and dyes. In particular embodiments, the conjugate moiety is selected from a peptide, a lipid, N-acetylgalactosamine (GalNAc), cholesterol, vitamin E, lipoic acid, pantothenic acid, polyethylene glycol, an antibody (e.g., an antibody for crossing the blood brain barrier, such as an anti-transferrin receptor antibody), or a cell penetrating peptide (e.g., a transcription trans-activator (TAT) and an osmotic agent).

In certain embodiments, the conjugate moiety comprises an active drug substance, e.g., aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S) - (+) -pranoprofen, carprofen, dansyl sarcosine, 2,3, 5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, benzothiadiazine, chlorothiazide, diazepine, indomethacin, barbital, cephalosporin, sulfonamides, antidiabetic, antibacterial, or antibiotics.

Conjugation linker

The conjugate moiety is attached to the STMN2 AON by a conjugate linker. In certain oligomeric compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is directly attached to the oligonucleotide by a single bond). In certain embodiments, the conjugate linker comprises a chain structure such as a hydrocarbon chain, or an oligomer of repeating units such as ethylene glycol, nucleoside, or amino acid units.

In certain embodiments, the conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxyamino groups. In certain such embodiments, the conjugate linker comprises a group selected from alkyl, amino, oxo, amide, and ether groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises a group selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker comprises at least one neutral linking group.

In certain embodiments, the conjugate linkers (including those described above) are bifunctional linking moieties, e.g., those known in the art that can be used to attach a conjugate group to a parent compound, such as the oligonucleotides provided herein. Typically, the bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a specific site on the parent compound and the other is selected to bind to the conjugate group. Examples of functional groups for the bifunctional linking moiety include, but are not limited to, electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophiles. In certain embodiments, the bifunctional linking moiety comprises one or more groups selected from amino, hydroxy, carboxylic acid, thiol, alkyl, alkenyl and alkynyl groups.

Examples of conjugated linkers include, but are not limited to, pyrrolidine, 8-amino-3, 6-dioxooctanoic Acid (ADO), succinimidyl 4- (N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC), and 6-aminocaproic acid (AHEX or AHA). Other conjugation linkers include, but are not limited to, substituted or unsubstituted C ₁ -C ₁₀ Alkyl, substituted or unsubstituted C ₂ -C ₁₀ Alkenyl or substituted or unsubstituted C ₂ -C ₁₀ A non-limiting list of preferred substituents include hydroxy, amino, alkoxy, carboxy, benzyl, phenyl, nitro, mercapto, thioalkoxy, halogen, alkyl, aryl, alkenyl, and alkynyl.

In certain embodiments, the conjugate linker comprises 1-10 linker-nucleosides. In certain embodiments, the conjugate linker comprises 2-5 linker-nucleosides. In certain embodiments, the conjugate linker comprises 3 linker-nucleosides.

In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments, such linker-nucleosides comprise modified sugar moieties. In certain embodiments, the linker-nucleoside is unmodified. In certain embodiments, the linker-nucleoside comprises an optionally protected heterocyclic base selected from the group consisting of a purine, a substituted purine, a pyrimidine, or a substituted pyrimidine. In certain embodiments, the cleavable moiety is a nucleoside selected from the group consisting of uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5-methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is generally desirable that the linker-nucleoside be cleaved from the oligomeric compound after it reaches the target tissue. Thus, the linker-nucleosides are typically linked to each other and to the remainder of the oligomeric compound via cleavable linkages. In certain embodiments, such cleavable linkages are phosphodiester linkages.

In this context, linker-nucleosides are not considered part of an oligonucleotide. Thus, in embodiments wherein the oligomeric compound comprises an oligonucleotide consisting of a specific number or range of linked nucleosides and/or having a specific percentage complementarity to a reference nucleic acid and the oligomeric compound further comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides do not account for the length of the oligonucleotide and are not used to determine the percentage complementarity of the oligonucleotide to the reference nucleic acid.

In certain embodiments, it is desirable to cleave the conjugate group from the STMN2 AON. For example, in some cases, oligomeric compounds comprising a particular conjugate moiety are better absorbed by a particular cell type, but once the oligomeric compound has been absorbed, it is desirable to cleave the conjugate moiety to release the unconjugated oligonucleotide or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, the cleavable moiety is a cleavable bond. In certain embodiments, the cleavable moiety is a group comprising at least one atom of the cleavable bond. In certain embodiments, the cleavable moiety comprises a group having one, two, three, four, or more than four atoms of the cleavable bond. In certain embodiments, the cleavable moiety selectively cleaves within a cellular or subcellular compartment (such as lysosomes). In certain embodiments, the cleavable moiety is selectively cleaved by an endogenous enzyme, such as a nuclease.

In certain embodiments, the cleavable bond is selected from: one or two esters of amides, esters, ethers, phosphodiesters, phosphates, carbamates or disulfides. In certain embodiments, the cleavable bond is one or both esters of the phosphodiester. In certain embodiments, the cleavable moiety comprises a phosphate or a phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between the oligonucleotide and the conjugate moiety or conjugate group.

In certain embodiments, the cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, one or more linker-nucleosides are linked to each other and/or to the remainder of the oligomeric compound by cleavable linkages. In certain embodiments, such cleavable linkages are unmodified phosphodiester linkages. In certain embodiments, the cleavable moiety is a 2' -deoxynucleoside that is attached to the 3' or 5' terminal nucleoside of the oligonucleotide by an internucleoside phosphate linkage and is covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2' -deoxyadenosine.

End group

In certain embodiments, the oligomeric compounds comprise one or more end groups. In certain such embodiments, the oligomeric compound comprises a stable 5' -phosphate. Stable 5' -phosphates include, but are not limited to, 5' -phosphonates, including, but not limited to, 5' -vinyl phosphonates. In certain embodiments, the end groups comprise one or more abasic nucleosides and/or inverted nucleosides (inverted nucleosides). In certain embodiments, the end groups comprise one or more 2' -linked nucleosides. In certain such embodiments, the 2' -linked nucleoside is an abasic nucleoside. In various embodiments, the end groups comprise one or more spacers.

Diagnostic method

The present disclosure also provides methods of diagnosing a patient with a neurological disease that rely on detecting the level of STMN2 expression signal in one or more biological samples of the patient. As used herein, the term "STMN2 expression signal" may refer to any indication of STMN2 gene expression or gene product activity. STMN2 gene products include RNA (e.g., mRNA), peptides, and proteins. The expression indicators of the STMN2 gene that can be evaluated include, but are not limited to, the state of the STMN2 gene or chromatin, the interaction of the STMN2 gene with cellular components that regulate gene expression, the expression level of the STMN2 gene product (e.g., the expression level of a STMN2 transcript (e.g., STMN2 pre-mRNA comprising cryptic exons) comprising a sequence sharing at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity with SEQ ID NO:1339 or SEQ ID NO: 1341), or the interaction of the STMN2 RNA or protein with transcriptional, translational or post-translational processing mechanisms.

Detection of STMN2 expression signals can be accomplished by in vivo, in vitro, or ex vivo methods. In preferred embodiments, the methods of the present disclosure may be performed in vitro. The detection method may involve in the patient's blood, serum, stool, tissue, cerebrospinal fluid, spinal fluid, extracellular vesicles (e.g., CSF exosomes), or cells. The nucleic acid sequence comprising a nucleic acid sequence corresponding to SEQ ID NO:1339 or SEQ ID NO:1341 shares at least 90% (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) of the expression signal of a STMN2 transcript (e.g., STMN2 pre-mRNA comprising a cryptic exon) of the sequence of identity to effect detection. Detection methods include assays that measure the expression level of the STMN2 gene product, such as Western blot, FACS, ELISA, other quantitative binding assays, cell or tissue growth assays, northern blot, quantitative or semi-quantitative polymerase chain reaction, medical imaging methods (e.g., MRI), or immunostaining methods (e.g., immunohistochemistry or immunocytochemistry).

General modifications

While certain compounds, compositions, and methods described herein have been specifically described in terms of certain embodiments, the following examples are illustrative of the compounds described herein and are not intended to be limiting. Each of the references, genBank accession numbers, etc. listed in this application are incorporated by reference in their entirety.

Although the sequence listing accompanying this application identifies each sequence as "RNA" or "DNA" as desired, in practice, these sequences may be modified with any combination of chemical modifications. Those skilled in the art will readily appreciate that in some cases, names such as "RNA" or "DNA" describing the modified oligonucleotides are arbitrary. For example, an oligonucleotide comprising a nucleoside comprising a 2'-OH sugar moiety and a thymine base can be described as having a modified sugar (2' -OH groupOne of the 2' -H) of the DNA or RNA having a modified base (thymine (methylated uracil) instead of uracil of RNA). Thus, the nucleic acid sequences provided herein, including but not limited to those in the sequence listing, are intended to encompass nucleic acids containing any combination of natural or modified RNAs and/or DNAs, including but not limited to nucleic acids having modified nucleobases. By way of further example and not limitation, oligomeric compounds having the nucleobase sequence "ATCGATCG" encompass any oligomeric compound having such nucleobase sequence, whether modified or unmodified, including but not limited to such compounds containing RNA bases, such as those having the sequence "aucghucg" and those having some DNA bases and some RNA bases, such as those of "aucghgcg" and other modified nucleobases such as "AT ^m Oligomeric compounds of CGAUCG ", wherein ^m C represents a cytosine base containing a methyl group at position 5.

Certain compounds described herein (e.g., modified oligonucleotides) have one or more asymmetric centers and thus produce enantiomers, diastereomers, and other stereoisomeric configurations, which may be defined in terms of absolute stereochemistryOr (S), such as alpha or beta for the anomer of sugar, or (D) or (L) for the amino acid, etc. Compounds provided herein that are drawn or described as having certain stereoisomeric configurations include only the indicated compounds. Unless otherwise indicated, compounds provided herein that are drawn or described in undefined stereochemistry include all such possible isomers, including their stereorandom and optically pure forms. Likewise, all tautomeric forms of the compounds herein are also included unless otherwise indicated. Unless otherwise indicated, the compounds described herein are intended to include the corresponding salt forms.

Compounds described herein include variants in which one or more atoms are replaced with a non-radioactive isotope or radioisotope of a specified element. For example, a compound comprising a hydrogen atom herein encompasses each ¹ All possible deuterium extraction of H hydrogen atomsAnd (3) replacing. Isotopic substitutions encompassed by the compounds herein include, but are not limited to: ² h or ³ H replaces ¹ H、 ¹³ C or ¹⁴ C instead of ¹² C、 ¹⁵ N instead of ¹⁴ N、 ¹⁷ O or ¹⁸ O replaces ¹⁶ O, O ³³ S、 ³⁴ S、 ³⁵ S or ³⁶ S replaces ³² S, S. In certain embodiments, non-radioisotope substitution may impart novel properties to oligomeric compounds that are advantageous for use as therapeutic or research tools.

Examples

The disclosure is further illustrated by the following examples. These examples are provided for illustrative purposes only and should not be construed as limiting the scope or content of the present disclosure in any way.

Example 1: design and selection of STMN2 oligonucleotides

STMN2 AON oligonucleotides targeting STMN2 transcripts containing cryptic exons were designed and tested to identify STMN2 AONs capable of reducing the number of STMN2 transcripts containing cryptic exons. Such STMN2 AONs include those consisting of SEQ ID NO:1-446 or SEQ ID NO: 893-1338. The STMN2 parent oligonucleotide is 25 nucleosides in length. Each of the nucleosides of the STMN2 parent oligonucleotide is a modified nucleoside having a 2' moe sugar moiety, and each "C" is replaced with a 5-MeC. In addition, each of the internucleoside linkages between nucleosides of the STMN2 oligonucleotide is a phosphorothioate internucleoside linkage.

FIG. 1 depicts portions of STMN2 transcripts and STMN2 parent oligonucleotides designed to target certain portions of STMN2 transcripts comprising cryptic exons. Specifically, the region of the STMN2 transcript includes branch points (e.g., branch points 1, 2, and 3), a 3' splice acceptor region, an ESE binding region, a TDP43 binding site, and a PolyA region. STMN2 oligonucleotides are identified based on the location of the STMN2 transcript corresponding to the STMN2 oligonucleotide. For example, fig. 1 depicts an STMN2 oligonucleotide targeting positions 36 to 60 of STMN2 transcripts comprising cryptic exons, including branch point 1. Similarly, different STMN2 oligonucleotides target positions 144 to 178 of STMN2 transcripts comprising cryptic exons, including branch point 3. Other STMN2 oligonucleotides can be designed using any of the sequences disclosed above.

Typically, the STMN2 antisense oligonucleotide is 25 nucleotide bases in length. However, variants of STMN2 antisense oligonucleotides are also designed to have different lengths (e.g., 23-mer, 21-mer, or 19-mer). Examples of these variant STMN2 antisense oligonucleotides were designed to include SEQ ID NO:1342-1366 or SEQ ID NO: 1392-1521.

Example 2: methods for evaluating STMN2 antisense oligonucleotides

STMN2 antisense oligonucleotides were evaluated in SY5Y cells and human motor neurons (hMN). Cells were dispensed in 6-well or 96-well plates and cultured to 80% confluence. Antisense Oligonucleotides (AONs) directed against TDP43 were transfected with RNAiMax (Thermo Fisher Scientific, waltham, MA, USA) to express cryptic exons, thereby preventing transcription of full length STMN2 (STMN 2-FL) products. The vehicle was treated with RNAiMax alone. Positive controls included cells treated with TDP43 siRNA alone ("siRNA TDP 43") and/or TDP43 AON alone ("AON TDP43" or "TDP43 AON"). siRNA TDP43 was purchased from horizons/Dharmacon as ON-TARGETplus Human TARDBP (23435) siRNA-SMARTpool (#L-012394-00-0005). TARDBP (23435) sirnas include four separate sirnas that target four separate sequences:

1) Target sequence 1: GCUCAAGCAUGGAUUCUAA (SEQ ID NO: 1665)

2) Target sequence 2: CAAUCAAGGUAGUAAUAUG (SEQ ID NO: 1666)

3) Target sequence 3: GGGCUUCGCUACAGGAAUC (SEQ ID NO: 1667)

4) Target sequence 4: CAGGGUGGAUUUGGUAAUA (SEQ ID NO: 1668)

TDP43 AON is a gapmer oligonucleotide with the following sequence and chemistry:

5’A*A*G*G*C*T*T*C*A*T*A*T*T*G*T*A*C*T*T*T 3’(SEQ ID NO：1669)

where = phosphorothioate, underlined = DNA, others = 2' moe RNA; each "C" is 5-MeC.

To assess the ability of STMN2 AON to recover STMN2-FL, antisense oligonucleotides directed against STMN2 were co-incubated with TDP43 AON in RNAiMax. After 96 hours, transcript levels (e.g., STMN2 full length transcript, STMN2 transcript with cryptic exons, or TDP43 transcript) were detected by RT-qPCR using Taqman. Specifically, GAPDH was detected by RT-qPCR using Thermofisher TaqMan gene expression detection Hs03929097 _g1. RT-qPCR was performed to detect STMN2 transcripts with cryptic exons using the following primer sequences: 1) Forward primer: 5'-CTCAGTGCCTTATTCAGTCTTCTC-3' (SEQ ID NO: 1670), 2) reverse primer: 5'-TCTTCTGCCGAGTCCCATTT-3' (SEQ ID NO: 1671) and 3) probes: 5'-/56-FAM/TCAGCGTCTGCACATCCCTACAAT/3BHQ_1/-3' (SEQ ID NO: 1672). RT-qPCR was performed to detect full length STMN2 transcripts using the following primer sequences: 1) Forward primer: 5'-CCACGAACTTTAGCTTCTCCA-3' (SEQ ID NO: 1673), 2) reverse primer: 5'-GCCAATTGTTTCAGCACCTG-3' (SEQ ID NO: 1674), and 3) a probe: 5'-/56-FAM/ACTTTCTTCTTTCCTCTGCAGCCTCC/3BHQ_1/-3' (SEQ ID NO: 1675).

In AppliedRT-qPCR was performed on a 7500 real-time PCR system. One reverse transcription cycle was performed at a temperature of 50℃for 5 minutes. One RT inactivation/initial denaturation cycle was performed at a temperature of 95℃for 20 seconds. 45 amplification cycles were performed at a temperature of 95℃for 1 second and then at a temperature of 60℃for 20 seconds.

STMN2-FL or STMN2 hidden Signal (Ct) was normalized to GAPDH (deltaCt). To visualize quantitative changes (e.g., a% increase in STMN-FL), the normalized STMN2-FL signal was further normalized to vehicle (RNAiMax treatment alone, deltadeltatac). Using equation rq=2 ^{-deltadeltaCt} The relative amounts of transcript levels were calculated and used to describe the comparison of the treatment profile with normal healthy levels (1.0).

The percent reduction in STMN2 expression with the cryptic exon was calculated using the following equation:

the percentage increase in full length STMN2 mRNA transcripts was calculated using the following equation:

efficacy of STMN2 antisense oligonucleotides in reducing cryptic exons and increasing STMN2 full-length transcripts was also evaluated in human motor neurons. According to the manufacturer's instructions, the iCell human motor neurons (Cellular Dynamics International) were grown in 96-well plates at 15X10 ³ Individual cell/well partition for RT-qPCRRNA quantification, or 3x10 in 6 well plates ⁵ Individual cells/wells were allocated for western blot protein quantification. Neurons were transfected with TDP43 AON and/or STMN2 AON using an endoporter (GeneTools, llc.), or treated with an endoporter alone. Treatment was tested in triplicate (qRT-PCR) or duplicate (western blot) wells of organisms. The same TDP43 AON as described above was used herein for evaluation of human motor neurons. TDP43 AON is a gapmer oligonucleotide and has the following sequence and chemistry:

5’A*A*G*G*C*T*T*C*A*T*A*T*T*G*T*A*C*T*T*T 3’(SEQ ID NO：1669)

Where = phosphorothioate, underlined = DNA, others = 2' moe RNA.

After 72 hours, antisense oligonucleotides and endoporters were washed off and replaced with fresh medium. After 72 hours more, RNA was collected from 96-well plates for RT-qPCR or protein from 6-well plates for western blotting. RNA was isolated, cDNA was generated, and multiplexed RT-qPCR assays were performed using taqman probes for STMN2 cryptic exons, STMN2 full-length transcripts, and reference GAPDH quantification. As described above with reference to SY5Y cells, the same primers used to detect GAPDH, STMN2 transcript with cryptic exons and full length STMN2 were used herein to perform RT-qPCR of human motor neurons. For protein quantification, the soluble fraction of the protein collection was denatured and separated by SDS-PAGE, transferred onto polyvinylidene fluoride membranes and probed with antibodies against GAPDH (Proteintech, 60004-1-1 g), TDP-43 (Proteintech, 10782-2-AP) and tubulin-2 (ThermoFisher, PA-23049).

Example 3: STMN2 parent oligonucleotides and oligonucleotide variants restore full length STMN2 and reduce STMN2 transcripts with cryptic exons

STMN2 parent oligonucleotides and oligonucleotide variants were tested for their ability to increase or restore full length STMN2 mRNA (i.e., the mRNA from which full length STMN2 was translated) levels in TDP43 silenced cells. In some cases, STMN2 oligonucleotides were tested for their ability to reduce STMN2 transcripts with cryptic exons. As described further below, the quantitative increase/recovery of the percentage of STMN2-FL and/or the decrease of the percentage of STMN2 transcripts with cryptic exons is described with reference to the levels of STMN-FL and/or STMN2 transcripts with cryptic exons in a control group (e.g., cells treated with 500nM TDP43 AON).

Referring to FIG. 2, TDP43 transcripts were reduced by about 52% and STMN2-FL was reduced by about 57% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of 36 STMN2 parent AON increased TDP43 levels by 25% and STMN-FL levels by 55% (rescue to 67%). Has the sequence of SEQ ID NO: 50nM and 500nM treatment of the STMN2 parent oligonucleotide of 177 increased STMN-FL levels by 58% (rescue to 66%) and 53% (rescue to 68%), respectively. Has the sequence of SEQ ID NO:203 to increase TDP43 levels by 15% (rescue to 74%) and STMN-FL levels by 72% (rescue to 74%). Has the sequence of SEQ ID NO: 50nM and 500nM treatment of 395 STMN2 parent oligonucleotides increased STMN-FL levels by 49% (rescue to 64%) and 37% (rescue to 59%) respectively.

Referring to FIG. 3, the number of STMN2 transcripts with cryptic exons increased by more than 20 fold when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 68%. Has the sequence of SEQ ID NO: 500nM treatment of 181 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 65%. Has the sequence of SEQ ID NO: 500nM treatment of 197 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 39%. Has the sequence of SEQ ID NO: 500nM treatment of the 215 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 31%. Has the sequence of SEQ ID NO: 500nM treatment of 385 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 53%. Has the sequence of SEQ ID NO: 500nM treatment of 400 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 74%.

Referring to FIG. 4, STMN2-FL was reduced by about 59% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotide increased STMN-FL levels by 66% (rescue to 68%). Has the sequence of SEQ ID NO: 500nM treatment of 197 STMN2 parent oligonucleotide increased STMN-FL levels by 46% (rescue to 60%).

Referring to FIG. 5A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased by more than 36-fold. Has the sequence of SEQ ID NO: 500nM treatment of 185 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 58%. Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 87%. Has the sequence of SEQ ID NO: 500nM treatment of the 380 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 70%. Has the sequence of SEQ ID NO: 500nM treatment of 390 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 58%.

Referring to FIG. 5B, STMN2-FL was reduced by 66% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of 185 STMN2 parent oligonucleotide increased STMN-FL levels by 109% (rescue to 71%). Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide increased STMN-FL levels by 247% (rescue to 118%).

Referring to FIG. 6A, when treated with 500nM TDP43 AON (two different compositions), the number of STMN2 transcripts with cryptic exons increased by more than 20-fold. Has the sequence of SEQ ID NO: 500nM treatment of 144 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 83% to 88%. Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 92% to 93%.

Referring to FIG. 6B, STMN2-FL was reduced by about 80% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of 144 STMN2 parent oligonucleotides increased STMN-FL levels by 276% to 329% (rescue to 79% to 90%). Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide increased STMN-FL levels by 390% to 438% (rescue to 103% to 113%).

Referring to FIG. 7A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased by more than 23-fold. Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 83%. Has the sequence of SEQ ID NO: 500nM treatment of the 177 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 83%. Has the sequence of SEQ ID NO: 500nM treatment of 181 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 72%.

Referring to FIG. 7B, STMN2-FL was reduced by about 58% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotide increased STMN-FL levels by 119% (rescue to 92%). Has the sequence of SEQ ID NO: 500nM treatment of 181 STMN2 parent oligonucleotide increased STMN-FL levels by 88% (rescue to 79%). Has the sequence of SEQ ID NO: 500nM treatment of 185 STMN2 parent oligonucleotide increased STMN-FL levels by 74% (rescue to 73%).

Referring to FIG. 8A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased by more than 20-fold. Has the sequence of SEQ ID NO: 500nM treatment of 197 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 65%. Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 94%.

Referring to FIG. 8B, STMN2-FL was reduced by 59% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of 197 STMN2 parent oligonucleotide increased STMN-FL levels by 85% (rescue to 76%). Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide increased STMN-FL levels by 127% (rescue to 93%). Has the sequence of SEQ ID NO: 500nM treatment of the 380 STMN2 parent oligonucleotide increased STMN-FL levels by 71% (rescue to 70%).

Referring to FIG. 9A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased by more than 50-fold. Has the sequence of SEQ ID NO: 500nM treatment of 144 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 92%. Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 82%. Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 96%.

Referring to FIG. 9B, STMN2-FL was reduced by 67% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of 144 STMN2 parent oligonucleotide increased STMN-FL levels by 135% (rescue to 87%). Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotide increased STMN-FL levels by 132% (rescue to 86%). Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide increased STMN-FL levels by 143% (rescue to 90%).

Referring to FIG. 10A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased by more than 65-fold. Has the sequence of SEQ ID NO: 200nM treatment of 181 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 50%. Has the sequence of SEQ ID NO: 500nM treatment of 181 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 73%. Referring to FIG. 10B, STMN2-FL was reduced by 67% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 50nM treatment of 181 STMN2 parent oligonucleotide increased STMN-FL levels by 115% (rescue to 71%). Has the sequence of SEQ ID NO: 200nM treatment of 181 STMN2 parent oligonucleotide increased STMN-FL levels by 97% (rescue to 65%). Has the sequence of SEQ ID NO: 500nM treatment of 181 STMN2 parent oligonucleotide increased STMN-FL levels by 94% (rescue to 64%).

Referring to FIG. 11A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased more than 26-fold. Has the sequence of SEQ ID NO: 500nM treatment of 185 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 47%. Referring to FIG. 11B, STMN2-FL was reduced by 74% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 50nM treatment of 185 STMN2 parent oligonucleotide increased STMN-FL levels by 73% (rescue to 45%). Has the sequence of SEQ ID NO: 200nM treatment of 185 STMN2 parent oligonucleotide increased STMN-FL levels by 246% (rescue to 90%). Has the sequence of SEQ ID NO: 500nM treatment of 185 STMN2 parent oligonucleotide increased STMN-FL levels by 165% (rescue to 69%).

Referring to FIG. 12A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased by more than 41-fold. Has the sequence of SEQ ID NO: 500nM treatment of 197 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 51%. Referring to FIG. 12B, STMN2-FL was reduced by 65% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 20nM treatment of 197 STMN2 parent oligonucleotide increased STMN-FL levels by 86% (rescue to 65%). Has the sequence of SEQ ID NO: 50nM treatment of 197 STMN2 parent oligonucleotide increased STMN-FL levels by 131% (rescue to 81%). Has the sequence of SEQ ID NO: 200nM treatment of 197 STMN2 parent oligonucleotide increased STMN-FL levels by 154% (rescue to 89%). Has the sequence of SEQ ID NO: 500nM treatment of 197 STMN2 parent oligonucleotide increased STMN-FL levels by 169% (rescue to 94%).

Referring to FIG. 13A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased by more than 41-fold. Has the sequence of SEQ ID NO: 500nM treatment of 144 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 93%. Referring to FIG. 13B, STMN2-FL was reduced by 84% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 50nM treatment of 144 STMN2 parent oligonucleotide increased STMN-FL levels by 75% (rescue to 28%). Has the sequence of SEQ ID NO: 200nM treatment of 144 STMN2 parent oligonucleotide increased STMN-FL levels by 260% (rescue to 57%). Has the sequence of SEQ ID NO: 500nM treatment of 144 STMN2 parent oligonucleotide increased STMN-FL levels by 444% (rescue to 87%).

Referring to FIG. 14A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased more than 24-fold. Has the sequence of SEQ ID NO: 200nM treatment of 173 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 59%. Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 70%. Referring to FIG. 14B, STMN2-FL was reduced by 62% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 200nM treatment of 173 STMN2 parent oligonucleotide increased STMN-FL levels by 100% (rescue to 76%). Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotide increased STMN-FL levels by 158% (rescue to 98%).

Referring to FIG. 15A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased by more than 70-fold. Has the sequence of SEQ ID NO: 200nM treatment of 237 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 78%. Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 92%. Referring to FIG. 15B, STMN2-FL was reduced by 77% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 50nM treatment of the 237 STMN2 parent oligonucleotide increased STMN-FL levels by 87% (rescue to 43%). Has the sequence of SEQ ID NO: 200nM treatment of the 237 STMN2 parent oligonucleotide increased STMN-FL levels by 135% (rescue to 54%). Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide increased STMN-FL levels by 209% (rescue to 71%).

Referring to FIG. 16, STMN2 protein levels were reduced by 44% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotides increased STMN protein levels by 52%. Has the sequence of SEQ ID NO: 500nM treatment of 237 STMN2 parent oligonucleotide increased STMN protein levels by 34%.

Referring to FIG. 17A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased by more than 30-fold. Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 96%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1348 reduced STMN2 transcript levels with cryptic exons by 97%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1349 reduced STMN2 transcript levels with cryptic exons by 97%. Has the sequence of SEQ ID NO: 500nM treatment of 1360 STMN2 oligonucleotide variants reduced STMN2 transcript levels with cryptic exons by 71%.

Referring to FIG. 17B, STMN2-FL was reduced by 76% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide increased STMN-FL levels by 238% (rescue to 81%). Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1348 increased STMN-FL levels by 63% (rescue to 39%). Has the sequence of SEQ ID NO: 500nM treatment of 1359 STMN2 oligonucleotide variants increased STMN-FL levels by 96% (rescue to 47%). Has the sequence of SEQ ID NO: 500nM treatment of 1360 STMN2 oligonucleotide variants increased STMN-FL levels by 125% (rescue to 54%).

Referring to FIG. 18A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased by more than 19 fold. Has the sequence of SEQ ID NO: 500nM treatment of 185 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 83%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1347 reduced STMN2 transcript levels with cryptic exons by 85%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1356 reduced STMN2 transcript levels with cryptic exons by 56%. Has the sequence of SEQ ID NO: 500nM treatment of 1357 STMN2 oligonucleotide variants reduced STMN2 transcript levels with cryptic exons by 78%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1364 reduced STMN2 transcript levels with cryptic exons by 78%.

Referring to FIG. 18B, STMN2-FL was reduced by 82% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of 185 STMN2 parent oligonucleotide increased STMN-FL levels by 161% (rescue to 47%). Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1347 increased STMN-FL levels by 144% (rescue to 44%). Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1356 increased STMN-FL levels by 128% (rescue to 41%). Has the sequence of SEQ ID NO: 500nM treatment of 1357 STMN2 oligonucleotide variants increased STMN-FL levels by 144% (rescue to 44%). Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1364 increased STMN-FL levels by 183% (rescue to 51%).

Referring to FIG. 19A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased by more than 23-fold. Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 81%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1345 reduced STMN2 transcript levels with cryptic exons by 86%. Has the sequence of SEQ ID NO: 500nM treatment of 1354 STMN2 oligonucleotide variants reduced STMN2 transcript levels with cryptic exons by 81%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1355 reduced STMN2 transcript levels with cryptic exons by 47%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1362 reduced STMN2 transcript levels with cryptic exons by 75%.

Referring to FIG. 19B, STMN2-FL was reduced by 83% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotide increased STMN-FL levels by 265% (rescue to 62%). Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1345 increased STMN-FL levels by 206% (rescue to 52%). Has the sequence of SEQ ID NO: 500nM treatment of 1354 STMN2 oligonucleotide variants increased STMN-FL levels by 212% (rescue to 53%). Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1355 increased STMN-FL levels by 88% (rescue to 32%). Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1362 increased STMN-FL levels by 188% (rescue to 49%).

Referring to FIG. 20A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased more than 35-fold. Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 91%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1348 reduced STMN2 transcript levels with cryptic exons by 94%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1349 reduced STMN2 transcript levels with cryptic exons by 96%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1365 reduced STMN2 transcript levels with cryptic exons by 82%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1366 reduced STMN2 transcript levels with cryptic exons by 38%. Has the sequence of SEQ ID NO: 500nM treatment of 1358 STMN2 oligonucleotide variants reduced STMN2 transcript levels with cryptic exons by 33%.

Referring to FIG. 20B, STMN2-FL was reduced by 80% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide increased STMN-FL levels by 325% (rescue to 85%). Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1348 increased STMN-FL levels by 350% (rescue to 90%). Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1366 increased STMN-FL levels by 105% (rescue to 41%). Has the sequence of SEQ ID NO: 500nM treatment of 1358 STMN2 oligonucleotide variants increased STMN-FL levels by 20% (rescue to 24%).

Referring to FIG. 21A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased by more than 11-fold. Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 72%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1346 reduced STMN2 transcript levels with cryptic exons by 85%. Has the sequence of SEQ ID NO: 500nM treatment of 1353 STMN2 oligonucleotide variants reduced STMN2 transcript levels with cryptic exons by 55%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1662 (G.A.G. TCCTGCAATATGAATATA.AT.T.T, where T indicates phosphodiester linkage) reduced STMN2 transcript levels with cryptic exons by 49%. Has the sequence of SEQ ID NO:1663 (gagtctg, pa, ta TGAATATAATTT), wherein 500nM treatment of the STMN2 oligonucleotide variant (gagtctg, pa, ta TGAATATAATTT) indicates phosphodiester linkage reduced STMN2 transcript levels with cryptic exons by 57%.

Referring to FIG. 21B, STMN2-FL was reduced by 73% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotide increased STMN-FL levels by 85% (rescue to 50%). Has the sequence of SEQ ID NO: 500nM treatment of 1353 STMN2 oligonucleotide variants increased STMN-FL levels by 85% (rescue to 50%). Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1662 increased STMN-FL levels by 74% (rescue to 47%). Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1663 increased STMN-FL levels by 89% (rescue to 51%).

Referring to FIG. 22A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased by more than 13-fold. Has the sequence of SEQ ID NO: 500nM treatment of 144 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 91%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1344 reduced STMN2 transcript levels with cryptic exons by 80%. Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1342 reduced STMN2 transcript levels with cryptic exons by 85%.

Referring to FIG. 22B, STMN2-FL was reduced by 65% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of 144 STMN2 parent oligonucleotides increased STMN-FL levels by 94% (rescue to 68%). Has the sequence of SEQ ID NO: 500nM treatment of the 1343 STMN2 parent oligonucleotide increased STMN-FL levels by 11% (rescue to 39%). Has the sequence of SEQ ID NO: 500nM treatment of 1351 STMN2 parent oligonucleotide increased STMN-FL levels by 9% (rescue to 38%). Has the sequence of SEQ ID NO: 500nM treatment of the STMN2 oligonucleotide variant of 1344 increased STMN-fL levels by 114% (rescue to 75%). Has the sequence of SEQ ID NO: 500nM treatment of 1350 STMN2 parent oligonucleotide increased STMN-FL levels by 3% (rescue to 36%). Has the sequence of SEQ ID NO: 500nM treatment of 1361 STMN2 parent oligonucleotide increased STMN-FL levels by 9% (rescue to 38%).

Example 4: neuropathy as an indication that can be targeted by microtubule-inhibiting assembly protein-2 cryptic splice modulators

Experimentally, according to the manufacturer's instructions, the iCell human motor neurons (Cellular Dynamics International) were distributed in 96-well plates at 19,000 cells/well. The use of SEQ ID NO:237 and endoporter (GeneTools, llc.) or neurons treated with endoporter alone. After 72 hours, the sequence of SEQ ID NO:237STMN2 parent oligonucleotide and endoporter and adding MG 132. After 18 hours, RNA was isolated, eDNA was generated and multiplex QPCR assays were performed for STMN2 cryptic exon and reference GAPDH quantification.

Referring to fig. 23, a bar graph showing the use of SEQ ID NO: the hidden exon-induced reversal of the 237STMN2 parent oligonucleotide, even if increased proteasome inhibition is considered. As a control, cells treated with endoporter alone (without AON) and then subsequently with MG132 (in all concentrations of MG 132) exhibited high cryptic exon levels. This indicates TDP-43 pathology induced by proteasome inhibition in human motor neurons. The incorrect localization of TDP-43 resulted in STMN2 missplicing and increased expression of the cryptic exon. Adding SEQ ID NO:237 parent oligonucleotides reverse the cryptic exon induction with high potency (IC 50 < 5 nM). As shown in fig. 23, the added SEQ ID NO:237 concentrations (varying from 5nM up to 500 nM) significantly reduced the relative numbers of cryptic exons.

Overall, this data establishes SEQ ID NO: the 237 parent oligonucleotide provides protection against the induction of proteolytic stress by cryptic exon expression. This applies to the environment that protects neurons from the proteolytic stresses in neurodegenerative disorders.

Example 5: dose response recovery of full-length STMN2 mRNA and STMN2 protein using microtubule-inhibiting assembly protein-2 cryptic splice modulator

Experiments were performed as described previously in human neuroblastoma SY5Y cells. Cells were dispensed in 6-well or 96-well plates and cultured to 80% confluence. TDP-43 expression in AON knockdown cells against TDP43 was used to express cryptic exons to prevent transcription of full length STMN2 (STMN 2-FL) product. In addition, cells were co-transfected with STMN2 oligonucleotide variants (specifically, SEQ ID NO: 1348) at different doses (5 nM, 50nM, 100nM, 200nM and 500 nM). RNA and protein were isolated for QPCR and western blot assays.

Fig. 24 shows a dose response curve illustrating the following with SEQ ID NO:1348 of the STMN2 oligonucleotide variant concentration increases, full length STMN2 transcript recovery increases. In general, increased oligonucleotide concentrations increased full length STMN2 mRNA, decreasing cryptic exon levels. Specifically, 5nM treatment of STMN2 oligonucleotide variants resulted in approximately 40% recovery of full-length STMN2 transcripts. 500nM treatment of STMN2 oligonucleotide variants resulted in near 100% recovery of full-length STMN2 transcripts. Furthermore, 500nM treatment of STMN2 oligonucleotide variants resulted in a significant reduction (near 0%) of cryptic exons.

Fig. 25A shows western blot assays demonstrating that the response is higher with the sequence of SEQ ID NO:1348, the full-length STMN2 protein is qualitatively increased. Figure 25B shows quantitative levels of full length STMN2 protein normalized to GAPDH in response to different concentrations of STMN2 oligonucleotide variants. In general, both figures 25A and 25B show that increased STMN2 oligonucleotide variant concentrations resulted in increased full length STMN2 protein concentrations. Specifically, as shown in fig. 25B, lower STMN2 oligonucleotide variant concentrations (5 nM and 50 nM) resulted in a full-length STMN2 protein concentration of about 60% of the control group (cells only). Notably, 500nM treatment of STMN2 oligonucleotide variants resulted in near 100% recovery of full-length STMN2 protein (compared to the cell-only control group).

Example 6: STMN2 AON with spacer technology restores full length STMN2 and reduces STMN2 transcripts with cryptic exons

STMN2 AONs with two or three spacers were developed. Here, the spacer is represented by formula (I), wherein:

x is-O-; and is also provided with

n is 1.

The ability of STMN2 AONs (e.g., STMN2 oligonucleotides each having two spacers) to increase or restore full-length STMN2mRNA (i.e., mRNA from which full-length STMN2 is translated) levels in TDP 43-silenced cells was tested in human motor neurons (hmns). In some cases, STMN2 oligonucleotides were tested for their ability to reduce STMN2 transcripts with cryptic exons. As described further below, the percentage increase/recovery of quantitative STMN2-FL and/or the percentage decrease of STMN2 transcripts with cryptic exons is described with reference to the levels of STMN-FL and/or STMN2 transcripts with cryptic exons in a control group (e.g., cells treated with 500nM TDP43 AON).

Three different STMN2 oligonucleotides with two spacers were generated. These three exemplary STMN2 oligonucleotides were named: 1) SEQ ID NO:1589 (25 mer with first spacer at position 11 and second spacer at position 22), 2) SEQ ID NO:1590 (25 mer with first spacer at position 7 and second spacer at position 14), and 3) SEQ ID NO:1591 (25 mer with first spacer at position 8 and second spacer at position 19). STMN2 AON is shown in table 11. Table 11: STMN2 AON (comprising STMN2 parent oligonucleotide and STMN2 oligonucleotide with two spacers)

Referring to FIG. 26A, when treated with 500nM TDP43 AON, the number of STMN2 transcripts with cryptic exons increased more than 27 fold. Has the sequence of SEQ ID NO: 500nM treatment of 144 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 71%. Has the sequence of SEQ ID NO: 500nM treatment of 1589 STMN2 AON reduced STMN2 transcript levels with cryptic exons by 88%. Here, SEQ ID NO:1589 and SEQ ID NO:144 Further reduction of STMN2 transcripts with cryptic exons was demonstrated compared to (without two spacers). Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotides reduced STMN2 transcript levels with cryptic exons by 77%. Has the sequence of SEQ ID NO: 500nM treatment of 1590 STMN2 AON reduced STMN2 transcript levels with cryptic exons by 48%. Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide reduced STMN2 transcript levels with cryptic exons by 93%. Has the sequence of SEQ ID NO: 500nM treatment of 1591 STMN2 AON reduced STMN2 transcript levels with cryptic exons by 96%. Here, SEQ ID NO:1591 and SEQ ID NO:237 Similar reductions in STMN2 transcripts with cryptic exons were exhibited compared to (without two spacers).

Referring to FIG. 26B, STMN2-FL was reduced by 68% when treated with 500nM TDP43 AON. Has the sequence of SEQ ID NO: 500nM treatment of 144 STMN2 parent oligonucleotide increased STMN-FL levels by 165% (rescue to 85%). Has the sequence of SEQ ID NO: 500nM treatment of 1589 STMN2 AON increased STMN-FL levels by 256% (rescue to 114%). Here, SEQ ID NO:1589 and SEQ ID NO:144 Improved recovery of STMN2 FL mRNA was exhibited compared to (without two spacers). Has the sequence of SEQ ID NO: 500nM treatment of 173 STMN2 parent oligonucleotide increased STMN-FL levels by 184% (rescue to 91%). Has the sequence of SEQ ID NO: 500nM treatment of 1590 STMN2 AON increased STMN-FL levels by 156% (rescue to 82%). Here, SEQ ID NO:1590 and SEQ ID NO:173 Compared (without two spacers), exhibited similar recovery of STMN2 FL mRNA. Has the sequence of SEQ ID NO: 500nM treatment of the 237 STMN2 parent oligonucleotide increased STMN-FL levels by 225% (rescue to 104%). Has the sequence of SEQ ID NO: 500nM treatment of 1591 STMN2 AON increased STMN-FL levels by 225% (rescue to 104%). Here, SEQ ID NO:1591 and SEQ ID NO:237 Compared (without two spacers), exhibited similar recovery of STMN2 FL mRNA.

Additional examples of STMN2 AONs, including those described in Table 11 above, are shown in Table 12 below. Specifically, table 12 includes an STMN2 AON with two spacers and an STMN2 AON example with three spacers. In addition, table 12 includes examples of shorter length STMN2 AON variants (e.g., 23-mer, 21-mer, or 19-mer) with one or more spacers as compared to the STMN2 parent oligonucleotides described in table 11 above.

Table 12: STMN2 AON with two or three spacers and STMN2 AON variants with two spacers.

/>

Table 13 depicts the performance of STMN2 AONs, including STMN2 AONs with two or three spacers.

STMN2 AON comprising two spacers increases the level of STMN 2-FL. For example, at a dose of 200nM ASO, SEQ ID NO:1608 and SEQ ID NO:1609 raise the level of STMN-FL to 0.65 and 0.78, respectively. Furthermore, at a dose of 200nM ASO, SEQ ID NO:1610 and SEQ ID NO:1611 increases the level of STMN-FL to 0.95 and 1.09, respectively. Notably, many STMN2 AONs increase STMN-FL levels to a lesser extent. Specifically, at a 200nM dose of STMN2 AON, SEQ ID NO: 1612. SEQ ID NO: 1613. SEQ ID NO:1614 and SEQ ID NO:1615 increases the level of STMN-FL to 0.10 to 0.20.

At a dose of 200nM AON, a polypeptide derived from SEQ ID NO: all STMN2 AONs of 197 significantly increased the level of STMN-FL. Specifically, SEQ ID NO: 1617. SEQ ID NO:1618 and SEQ ID NO:1619 increases the level of STMN-FL to 0.99, 0.94 and 1.00, respectively.

Overall, these results demonstrate that different STMN2 AONs comprising two spacers are capable of increasing STMN-FL to levels close to or equivalent to their non-spacer counterparts (e.g., SEQ ID NO:173 or SEQ ID NO: 197).

Derived from SEQ ID NO:173 STMN2 AON comprising SEQ ID NO: 1612. SEQ ID NO: 1613. SEQ ID NO:1614 and SEQ ID NO:1615 and a nucleotide sequence derived from SEQ ID NO:197, STMN2 AON comprising SEQ ID NO: 1617. SEQ ID NO:1618 and SEQ ID NO: the performance differences between 1619 may be due to GC content in the respective STMN2 AONs. Specifically, as shown in table 13, the sequences derived from SEQ ID NOs: 173 has a GC content of less than 30%, which may lead to reduced performance. In contrast, as shown in table 13, the sequences derived from SEQ ID NOs: 197 has a GC content of greater than 40%. Thus, it may be preferable to include two or more spacers on the higher GC content of the AON.

In addition to GC content, the position of the spacer relative to guanine and cytosine nucleobases can also affect STMN2 AON performance. For example, at a 200nM AON dose, SEQ ID NO: 1615. SEQ ID NO:1596 and SEQ ID NO:1597 increased the STMN2-FL level to 0.12, 0.26 and 0.29. Each of these STMN2 AONs has three spacers. In contrast, at 200nM AON dose, SEQ ID NO:1418 increases the level of STMN2-FL to 0.73.SEQ ID NO:1418 includes spacers positioned to maximize the number of spacers immediately preceding the guanine base. Specifically, SEQ ID NO:1418 are each preceded by a guanine base. Thus, maximizing the number of spacers immediately preceding guanine bases in an STMN2 AON can improve the performance of an STMN2 AON.

Table 13: different STMN2 AONs, including STMN2 AON performance with two or three spacers.

/>

Example 7: additional experiments demonstrated that STMN2 AON with spacer technology restores full length STMN2 and reduces STMN2 transcripts with cryptic exons

STMN2 AONs with one, two or three spacers were developed. In general, in this example, in addition to the SEQ ID NO:1649, wherein the spacer is represented by formula (I), wherein:

X is-O-; and is also provided with

n is 1.

For SEQ ID NO:1649, each spacer included in the ASO is represented by formula (I), wherein:

x is-O-; and is also provided with

n is 2.

The STMN2 AON with spacers was characterized and compared to the STMN2 AON counterpart without spacers. Specifically, the melting temperatures of STMN2 AONs with and without spacers were determined to demonstrate structural differences in STMN2 AONs. Table 14 shows the different melting temperatures of the STMN2 AON between two different replicates. STMN2 AONs with two spacers exhibit lower melting temperatures (about 10 ℃ lower) than STMN2 AONs without spacers.

Table 14: melting temperature of STMN2 AON with and without spacers.

STMN2 AONs (e.g., STMN2 oligonucleotides with one, two, or three spacers) were tested for their ability to increase or restore full length STMN2 mRNA (i.e., mRNA from which full length STMN2 is translated) levels in TDP43 silenced cells. In some cases, STMN2 oligonucleotides were tested for their ability to reduce STMN2 transcripts with cryptic exons. FIGS. 27-35 show the role of STMN2 AON with spacers in increasing full length STMN2 mRNA ("STMN 2 FL") and/or decreasing STMN2 transcripts with cryptic exons ("STMN 2 cryptic"). In addition, table 15 identifies the respective STMN2 AONs and their respective properties. The treatment groups were identified on the X-axis of FIGS. 27-35 and included the concentrations of the specific AON sequences. Here, specific AON sequences are marked according to their corresponding SEQ ID NOs.

FIG. 27A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2 AON comprising the sequence of SEQ ID NO: 173. SEQ ID NO: 1608. SEQ ID NO: 1609. SEQ ID NO: 1610. SEQ ID NO: 1611. SEQ ID NO: 1612. SEQ ID NO: 1613. SEQ ID NO: 1614. SEQ ID NO: 1615. SEQ ID NO: 1596. SEQ ID NO:1597 and SEQ ID NO:1418. FIG. 27B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2 AON comprising the sequence set forth in SEQ ID NO: 173. SEQ ID NO: 1608. SEQ ID NO: 1609. SEQ ID NO: 1610. SEQ ID NO: 1611. SEQ ID NO: 1612. SEQ ID NO: 1613. SEQ ID NO: 1614. SEQ ID NO: 1615. SEQ ID NO: 1596. SEQ ID NO:1597 and SEQ ID NO:1418. in general, FIGS. 27A and 27B demonstrate the performance of STMN2 AON with spacers (e.g., SEQ ID NO:1608, SEQ ID NO:1609, SEQ ID NO:1610, SEQ ID NO:1611, SEQ ID NO:1612, SEQ ID NO:1613, SEQ ID NO:1614, SEQ ID NO:1615, SEQ ID NO:1596, SEQ ID NO:1597, and SEQ ID NO: 1418) compared to STMN2 AON without spacers (SEQ ID NO: 173). Here, many STMN2 AONs with spacers showed the same good performance as those without spacers (SEQ ID NO: 173) or better performance than those without spacers (SEQ ID NO: 173). Specifically, in comparison to STMN2 AON without spacer (SEQ ID NO: 173), 200nM of SEQ ID NO: 1609. SEQ ID NO:1610 and SEQ ID NO:1611 achieves comparable levels of STMN2 transcript mRNA levels with cryptic exons and STMN2 full-length mRNA levels.

FIG. 28A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2 AON comprising the sequence of SEQ ID NO: 173. SEQ ID NO: 1632. SEQ ID NO: 1346. SEQ ID NO: 1631. SEQ ID NO:1353 and SEQ ID NO:1598. FIG. 28B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2 AON comprising the sequence of SEQ ID NO: 173. SEQ ID NO: 1632. SEQ ID NO: 1346. SEQ ID NO: 1631. SEQ ID NO:1353 and SEQ ID NO:1598. in general, FIGS. 28A and 28B demonstrate the performance of STMN2 AON with spacers (e.g., SEQ ID NO:1632, SEQ ID NO:1631, and SEQ ID NO: 1598) compared to STMN2 AON counterparts without spacers (e.g., SEQ ID NO:173, SEQ ID NO:1346, and SEQ ID NO: 1353). Here, in comparison to a 50nM or 200nM dose of the STMN2 AON counterpart without spacer (SEQ ID NO: 173), a 50nM or 200nM dose of SEQ ID NO:1632 achieve comparable levels of STMN2 transcript mRNA levels with cryptic exons and STMN2 full-length mRNA levels. In comparison to a 200nM dose of the STMN2 AON counterpart without spacer (SEQ ID NO: 1346), a 200nM dose of the sequence of SEQ ID NO:1631 achieve comparable levels of STMN2 full-length mRNA levels.

FIG. 29A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2 AON comprising the sequence of SEQ ID NO:173 and SEQ ID NO:1610. FIG. 29B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2 AON comprising the sequence set forth in SEQ ID NO:173 and SEQ ID NO:1610. in general, FIGS. 29A and 29B demonstrate the performance of STMN2 AON with spacers (e.g., SEQ ID NO: 1610) compared to the STMN2 AON counterpart without spacers (e.g., SEQ ID NO: 173). Between different doses (e.g., 500nM, 200nM, 50nM, 20nM and 5 nM), the sequence of SEQ ID NO in the presence of TDP43 compared to the STMN2 AON counterpart without spacer (SEQ ID NO: 173): 1610 achieve comparable levels of STMN2 transcript mRNA levels with cryptic exons and STMN2 full-length mRNA levels.

FIG. 30A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2 AON comprising the sequence of SEQ ID NO:185 and SEQ ID NO:1635. FIG. 30B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2 AON comprising the sequence of SEQ ID NO:185 and SEQ ID NO:1635. in general, FIGS. 30A and 30B demonstrate the performance of STMN2 AON with spacers (e.g., SEQ ID NO: 1635) compared to the STMN2 AON counterpart without spacers (e.g., SEQ ID NO: 185). Between different doses (e.g., 500nM, 200nM, 50nM, 20nM and 5 nM), the sequence of SEQ ID NO in the presence of TDP43 compared to the STMN2 AON counterpart without spacer (SEQ ID NO: 185): 1610 achieve equivalent or reduced levels of STMN2 transcript mRNA levels with cryptic exons and equivalent or increased STMN2 full-length mRNA levels.

FIG. 31A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2 AON comprising the sequence of SEQ ID NO: 1347. SEQ ID NO:1633 and SEQ ID NO:1634. FIG. 31B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2 AON comprising the sequence of SEQ ID NO: 1347. SEQ ID NO:1633 and SEQ ID NO:1634. in general, FIGS. 31A and 31B demonstrate the performance of STMN2 AON with spacers (e.g., SEQ ID NO:1633 and SEQ ID NO: 1634) compared to the STMN2 AON counterpart without spacers (e.g., SEQ ID NO: 1347). Between different doses (e.g., 500nM, 200nM, 50nM, 20nM and 5 nM), the sequence of SEQ ID NO in the presence of TDP43 compared to the STMN2 AON counterpart without spacer (SEQ ID NO: 1347): 1633 achieve equivalent or reduced levels of STMN2 transcript mRNA levels with cryptic exons and equivalent or increased STMN2 full-length mRNA levels. Similarly, between different doses (e.g., 500nM, 200nM, 50nM, 20nM and 5 nM), the sequence of SEQ ID NO in the presence of TDP43 compared to the STMN2 AON counterpart without spacer (SEQ ID NO: 1347): 1634 achieve equivalent or reduced levels of STMN2 transcript mRNA levels with cryptic exons and equivalent or increased STMN2 full-length mRNA levels.

FIG. 32A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2 AON comprising the sequence of SEQ ID NO: 197. SEQ ID NO: 1617. SEQ ID NO:1618 and SEQ ID NO:1619. FIG. 32B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2 AON comprising the sequence set forth in SEQ ID NO: 197. SEQ ID NO: 1617. SEQ ID NO:1618 and SEQ ID NO:1619. in general, FIGS. 32A and 32B demonstrate the performance of STMN2 AON with spacers (e.g., SEQ ID NO:1617, SEQ ID NO:1618, and SEQ ID NO: 1619) compared to STMN2 AON counterparts without spacers (e.g., SEQ ID NO: 197). At a dose of 50nM or 200nM, the sequence of SEQ ID NO in the presence of TDP43 compared to the spacer-free STMN2 AON counterpart (SEQ ID NO: 197) at a dose of 50nM or 200 nM: 1617 achieves comparable or reduced levels of STMN2 transcript mRNA levels with cryptic exons and comparable or increased STMN2 full-length mRNA levels. At a dose of 50nM or 200nM, the sequence of SEQ ID NO in the presence of TDP43 compared to the spacer-free STMN2 AON counterpart (SEQ ID NO: 197) at a dose of 50nM or 200 nM: 1618 achieves comparable or reduced levels of STMN2 transcript mRNA levels with cryptic exons and comparable or increased STMN2 full-length mRNA levels. At a dose of 50nM or 200nM, the sequence of SEQ ID NO in the presence of TDP43 compared to the spacer-free STMN2 AON counterpart (SEQ ID NO: 197) at a dose of 50nM or 200 nM: 1619 achieves comparable or reduced levels of STMN2 transcript mRNA levels with cryptic exons and comparable or increased STMN2 full-length mRNA levels.

FIG. 33A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts having cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts having cryptic exons between different doses of STMN2 AON comprising the sequence of SEQ ID NO: 252. SEQ ID NO: 1650. SEQ ID NO: 1434. SEQ ID NO:1651 and SEQ ID NO:1620. FIG. 33B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2 AON comprising the sequence of SEQ ID NO: 252. SEQ ID NO: 1650. SEQ ID NO: 1434. SEQ ID NO:1651 and SEQ ID NO:1620. in general, FIGS. 33A and 33B illustrate the performance of STMN2 AON with spacers (e.g., SEQ ID NO: 1620) compared to STMN2 AON counterparts without spacers (e.g., SEQ ID NO:252, SEQ ID NO:1650, SEQ ID NO:1434, and SEQ ID NO: 1651). At a dose of 50nM or 200nM, the sequence of SEQ ID NO in the presence of TDP43 is compared to the spacer-free STMN2 AON counterpart (SEQ ID NO:252, SEQ ID NO:1650, SEQ ID NO:1434 and SEQ ID NO: 1651) at a dose of 50nM or 200 nM: 1620 achieves equivalent or reduced levels of STMN2 transcript mRNA levels with cryptic exons and equivalent or increased STMN2 full-length mRNA levels.

FIG. 34A is a bar graph showing the results of RT-qPCR analysis of mRNA levels of STMN2 transcripts with cryptic exons in the presence of TDP43 antisense and reduction of mRNA levels of STMN2 transcripts with cryptic exons between different doses of STMN2 AON comprising the sequence of SEQ ID NO:1434 and SEQ ID NO:1620. FIG. 34B is a bar graph showing the results of RT-qPCR analysis of STMN2 full-length mRNA levels in the presence of TDP43 antisense, and recovery of full-length STMN2 transcripts between different doses of STMN2 AON comprising the sequence set forth in SEQ ID NO:1434 and SEQ ID NO:1620. in general, FIGS. 34A and 34B demonstrate the performance of STMN2 AON with spacers (e.g., SEQ ID NO: 1620) compared to the STMN2 AON counterpart without spacers (e.g., SEQ ID NO: 1434). Between different doses (e.g., 500nM, 200nM, 50nM, 20nM and 5 nM), the sequence of SEQ ID NO in the presence of TDP43 compared to the STMN2 AON counterpart without spacer (SEQ ID NO: 1434): 1620 achieve reduced levels of STMN2 transcript mRNA levels with cryptic exons and increased STMN2 full-length mRNA levels.

Fig. 35 is a bar graph showing normalized STMN2 protein levels after treatment with TDP43 antisense and using a light chain comprising SEQ ID NO: 144. SEQ ID NO: 1589. SEQ ID NO: 173. SEQ ID NO: 1616. SEQ ID NO:237 and SEQ ID NO: recovery of 500nM STM N2 AON of 1591. In general, FIG. 35 demonstrates the performance of STMN2 AON with spacers (e.g., SEQ ID NO:1589, SEQ ID NO:1616, and SEQ ID NO: 1591) compared to its STMN2 AON counterparts without spacers (e.g., SEQ ID NO:144, SEQ ID NO:173, SEQ ID NO: 237). In general, the spacer-bearing STMN2 AON is capable of achieving comparable levels of STMN2 protein levels as compared to its STMN2 AON counterparts. Specifically, SEQ ID NO:1589 and SEQ ID NO:144 achieve comparable levels of STMN2 protein. SEQ ID NO:1616 and SEQ ID NO:173 achieve comparable levels of STMN2 protein. SEQ ID NO:1591 and SEQ ID NO:237 achieve comparable levels of STMN2 protein.

Referring to tables 15 and 17, the performance of STMN2 AONs with spacers (e.g., table 15) and STMN2 AONs without spacers (e.g., table 16) in human motor neurons are shown. The RT-qPCR results for the STMN2 full-length transcripts provided in tables 15 and 17 are normalized values using the equation ((RQASO-RQTDP 43)/(Rqendo-RQTDP 43))x100, where RQ refers to the relative amounts described above. The RT-qPCR results for STMN2 transcripts with cryptic exons provided in tables 15 and 17 are normalized values using the equation (1- ((RQASO-RQTDP 43)/(Rqendo-RQTDP 43))x100, where RQ refers to the relative amounts described above each RT-qPCR experiment was performed in triplicate wells and N independent replicates were performed.

Furthermore, as shown in table 15, a 200nM dose of SEQ ID NO:1633 (GTCTTCTSCCGAGTCSTGCAATA, with two spacers) rescued full length STMN2 mRNA to 83% and reduced STMN2 transcript levels with cryptic exons to 10% (90% reduction). In contrast, as shown in table 16, a 200nM dose of SEQ ID NO:1347 (GTCTTCTGCCGAGTCCTGCAATA, without spacer) rescue of full length STMN2 mRNA to 40.2% and reduced STMN2 transcript levels with cryptic exons to 20.8% (80.2% reduction). This shows that the addition of the spacer improves the sequence of SEQ ID NO compared to the STMN2 AON counterpart without spacer (as in SEQ ID NO: 1347): 1633.

Furthermore, as shown in table 15, a 200nM dose of SEQ ID NO:1618 (CTTTCTCSCGAAGGTSTTCTGCC, with two spacers) rescued full length STMN2 mRNA to 82% and reduced STMN2 transcript levels with cryptic exons to 11% (89% reduction). 200nM dose of SEQ ID NO:1619 (TTTCTCTSGAAGGTCSTCTGCCG, with two spacers) rescued full length STMN2 mRNA to 80% and reduced STMN2 transcript levels with cryptic exons to 12% (88% reduction). In contrast, as shown in table 16, a 200nM dose of SEQ ID NO:197 (CCTTCTCGAAGGTCTTCTGCCG, without spacer) rescue of full length STMN2 mRNA to 79.3% and reduced STMN2 transcript levels with cryptic exons to 12.1% (87.9% reduction). Here, at a dose of 200nM, the performance of the STMN2 AON with two spacers (e.g., SEQ ID NO:1618 and SEQ ID NO: 1619) is comparable to that of the STMN2 AON counterpart without spacers (e.g., SEQ ID NO: 197). Notably, at a dose of 50nM, the performance of STMN2 AON with two spacers (e.g., SEQ ID NO:1618 and SEQ ID NO: 1619) is improved compared to the STMN2 AON counterpart without a spacer (e.g., SEQ ID NO: 197). Specifically, at a dose of 50nM, SEQ ID NO:1618 rescues full length STMN2 mRNA to 46% and SEQ ID NO:1619 rescues full length STMN2 mRNA to 42%, while SEQ ID NO:197 Full length STMN2 mRNA was saved (without spacer) to 26.7%.

Furthermore, as shown in table 15, a 200nM dose of SEQ ID NO:1620 (TCTCTCGSACACACGSACACATG, with two spacers) rescued full length STMN2mRNA to 103% and reduced STMN2 transcript levels with cryptic exons to 1% (99% reduction). 50nM dose of SEQ ID NO:1620 rescues full length STMN2mRNA to 74% and reduces STMN2 transcript levels with cryptic exons to 5% (95% reduction). In contrast, as shown in table 16, 200nM dose and 50nM dose of SEQ ID NO:1434 (TCTCTCGCACACGCACACATG, without spacer) rescue of full length STMN2mRNA to 77.5% and 16.6%, respectively, and reduced STMN2 transcript levels with cryptic exons to 2.7% (97.3% reduction) and 18.3% (81.7% reduction), respectively. This shows that the addition of the spacer improves the sequence of SEQ ID NO compared to the STMN2 AON counterpart without spacer (e.g., SEQ ID NO: 1434): 1620, performance of 1620.

/>

Incorporated by reference

The entire disclosure of each of the patent documents and scientific articles cited herein is incorporated by reference for all purposes.

Equivalent solution

The present disclosure may be embodied in other specific forms without departing from its essential characteristics. Accordingly, the foregoing embodiments are to be considered illustrative rather than limiting of the disclosure described herein. The scope of the present disclosure is indicated by the appended claims rather than by the foregoing description, and all changes that come within the meaning and range of equivalency of the claims are intended to be embraced therein.

Claims

1. A compound comprising a modified oligonucleotide comprising a sequence 85% to 98% complementary to an equal length portion of any one of: 1339 or 1341, or 15 to 50 consecutive nucleobase portions thereof, wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are non-natural linkages, and further wherein the oligonucleotide comprises a spacer.

2. An oligonucleotide comprising a sequence 85% to 98% complementary to an equal length portion of any one of: 1339 or 1341, a sequence having 90% identity thereto, or 15 to 50 contiguous nucleobase portions thereof, wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are non-natural linkages, and further wherein the oligonucleotide comprises a spacer.

3. The compound of claim 1 or the oligonucleotide of claim 2, wherein the oligonucleotide comprises a segment of up to 11 linked nucleosides.

4. The compound of claim 1 or 3, or the oligonucleotide of claim 2 or 3, wherein the oligonucleotide comprises a segment of up to 10, 9, or 8 linked nucleosides.

5. The compound of any one of claims 1 or 3-4 or the oligonucleotide of any one of claims 2-4, wherein the oligonucleotide comprises a segment of up to 7 linked nucleosides.

6. The compound of any one of claims 1 or 3-5 or the oligonucleotide of any one of claims 1-5, wherein the oligonucleotide comprises a segment of up to 6, 5, 4, 3, or 2 linked nucleosides.

7. The compound of any one of claims 1 or 3-6 or the oligonucleotide of any one of claims 1-6, wherein each segment of the oligonucleotide comprises up to 7 linked nucleosides.

8. The compound or oligonucleotide of any one of claims 3-7, wherein the oligonucleotide comprises a sequence sharing at least 85% identity with an equal length portion of any one of SEQ ID NOs 1-466, 893-1338, 1342-1366, or 1392-1664.

9. The compound or oligonucleotide of any one of claims 3-8, wherein the oligonucleotide comprises a sequence sharing at least 90% identity with an equal length portion of any one of SEQ ID NOs 1-466, 893-1338, 1342-1366, or 1392-1664.

10. The compound or oligonucleotide of any one of claims 3-9, wherein the oligonucleotide comprises a sequence sharing at least 95% identity with the equal length portion of any one of SEQ ID NOs 1451-1664.

11. The compound or oligonucleotide of any one of claims 3-9, wherein the oligonucleotide comprises a sequence sharing 100% identity with the equal length portion of any one of SEQ ID NOs 1451-1664.

12. The compound of claim 1 or the oligonucleotide of claim 2, wherein the oligonucleotide comprises a segment of up to 11 linked nucleosides or up to 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence that is 85% to 98% complementary to an equal length portion within any one of positions 144-168, 173-197, 185-209, or 237-261 of SEQ ID No. 1339.

13. The compound or oligonucleotide of claim 12, wherein the oligonucleotide comprises a segment of up to 11 linked nucleosides or up to 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence 85% to 98% complementary to an equal length portion of nucleobases within any one of positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165 or 148-168 of SEQ ID No. 1339.

14. The compound or oligonucleotide of claim 12, wherein the oligonucleotide comprises a segment of up to 11 linked nucleosides or up to 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence 85% to 98% complementary to an equal length portion of nucleobases within any one of 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, or 179-197 of SEQ ID No. 1339.

15. The compound or oligonucleotide of claim 12, wherein the oligonucleotide comprises a segment of up to 11 linked nucleosides or up to 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence 85% to 98% complementary to an equal length portion of a nucleobase within any one of positions 185-205, 187-209, 189-209, or 191-209 of SEQ ID No. 1339.

16. The compound or oligonucleotide of claim 12, wherein the oligonucleotide comprises a segment of up to 11 linked nucleosides or up to 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence 85% to 98% complementary to an equal length portion of nucleobases within any one of positions 237-255, 237-259, 239-261, 241-261, or 243-261 of SEQ ID No. 1339.

17. The compound or oligonucleotide of claim 12, wherein the oligonucleotide comprises a segment of up to 6, 5, 4, 3 or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence 85% to 98% complementary to an equal length portion of a nucleobase within any one of positions 144-168, 173-197, 185-209 or 237-261 of SEQ ID No. 1339.

18. The compound or oligonucleotide of claim 12, wherein the oligonucleotide comprises a segment of up to 6, 5, 4, 3 or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence 85% to 98% complementary to the equivalent length portion of nucleobases within any one of positions 144-164, 144-166, 145-167, 146-166, 146-168, 147-165, 148-168, 173-191, 173-193, 173-195, 173-197, 175-195, 175-197, 177-197, 179-197, 185-205, 187-209, 189-209, 191-209, 237-255, 237-259, 239-261, 241-261 or 243-261 of SEQ ID No. 1339.

19. The compound or oligonucleotide of claim 12, wherein the oligonucleotide comprises a segment of up to 11 linked nucleosides or up to 7 linked nucleosides, and wherein the oligonucleotide comprises a sequence sharing at least 85% identity with an equal length portion of any one of SEQ ID NOs 1-466, 893-1338, 1342-1366, or 1392-1664.

20. The compound or oligonucleotide of claim 19, wherein the oligonucleotide comprises a segment of up to 6, 5, 4, 3 or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence sharing at least 85% identity with an equal length portion of any one of SEQ ID NOs 36, 55, 144, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 252, 380, 385, 390, 395, 400, 928, 947, 1036, 1065, 1069, 1073, 1077, 1089, 1095, 1101, 1107, 1129, 1136, 1144, 1272, 1277, 1282, 1287 or 1292.

21. The compound or oligonucleotide of claim 19 or 20, wherein the oligonucleotide comprises a segment of up to 6, 5, 4, 3 or 2 linked nucleosides, and wherein the oligonucleotide comprises a sequence sharing at least 90% identity with an equal length portion of any one of SEQ ID NOs 36, 55, 144, 173, 177, 181, 185, 197, 203, 209, 215, 237, 244, 252, 380, 385, 390, 395, 400, 928, 947, 1036, 1065, 1069, 1073, 1077, 1089, 1095, 1101, 1107, 1129, 1136, 1144, 1272, 1277, 1282, 1287 or 1292.

22. The compound of any one of claims 1 and 3-21 or the oligonucleotide of any one of claims 2-21, wherein the oligonucleotide is at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 oligonucleotide units in length.

23. The compound of claim 21 or the oligonucleotide of claim 21, wherein the oligonucleotide is at least 19 oligonucleotide units in length.

24. The compound of any one of claims 1 and 3-23 or the oligonucleotide of any one of claims 2-23, wherein the spacer is a nucleoside replacement group comprising a non-sugar substituent that is not capable of linking to a nucleotide base.

25. The compound or oligonucleotide of claim 24, wherein the spacer is located between positions 10 and 15 of the oligonucleotide.

26. The compound or oligonucleotide of claim 24, wherein the spacer is located between positions 7 and 11 of the oligonucleotide.

27. The compound or oligonucleotide of claim 24 or 26, wherein the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 14 and 22 of the oligonucleotide.

28. The compound or oligonucleotide of claim 27, wherein the spacer and the second spacer are separated in the oligonucleotide by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases.

29. The compound or oligonucleotide of claim 27 or 28, wherein the spacer is located between positions 7 and 9 of the oligonucleotide, and wherein the second spacer is located between positions 15 and 18 of the oligonucleotide.

30. The compound or oligonucleotide of any one of claims 27-29, wherein the spacer is located at position 8 of the oligonucleotide, and wherein the second spacer is located at position 16 of the oligonucleotide.

31. The compound or oligonucleotide of any one of claims 27-30, wherein the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 21 and 24 of the oligonucleotide.

32. The compound or oligonucleotide of claim 24, wherein the spacer is located between positions 2 and 5 of the oligonucleotide.

33. The compound or oligonucleotide of claim 32, wherein the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 8 and 12 of the oligonucleotide.

34. The compound or oligonucleotide of claim 33, wherein the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 18 and 22 of the oligonucleotide.

35. The compound or oligonucleotide of claim 24, wherein the oligonucleotide further comprises a second spacer and a third spacer, wherein three spacers are located at positions in the oligonucleotide such that each segment of the oligonucleotide has up to 7 linked nucleosides.

36. The compound or oligonucleotide of claim 35, wherein at least two of the three spacers are adjacent to a guanine nucleobase.

37. The compound or oligonucleotide of claim 36, wherein each of at least two of the three spacers immediately precedes a guanine nucleobase.

38. The compound or oligonucleotide of any one of claims 24-37, wherein each of the first, second, or third spacers is a nucleoside replacement group comprising a non-sugar substituent, wherein the non-sugar substituent is free of ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal, or hemiaminal moieties and is incapable of forming a covalent bond with a nucleoside acid base.

39. The compound or oligonucleotide of any one of claims 24-37, wherein each of the first, second, or third spacers is independently represented by formula (X), wherein:

ring a is an optionally substituted 4-8 membered monocyclic cycloalkyl or 4-8 membered monocyclic heterocyclyl, wherein the heterocyclyl contains 1 or 2 heteroatoms selected from O, S and N, provided that a cannot form a covalent bond with a nucleobase; and is also provided with

The symbols represent the points of attachment to internucleoside linkages.

40. The compound or oligonucleotide of claim 39, wherein each of the first, second or third spacers is independently represented by formula (Xa), wherein:

41. The compound or nucleotide of claim 39 or 40, wherein ring A is an optionally substituted 4-8 membered monocyclic cycloalkyl or 4-8 membered monocyclic heterocyclyl, the optionally substituted 4-8 membered monocyclic cycloalkyl being selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; the 4-8 membered monocyclic heterocyclic group is selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1, 4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl.

42. The compound or nucleotide of claim 41, wherein ring A is tetrahydrofuranyl.

43. The compound or nucleotide of claim 41, wherein ring A is tetrahydropyranyl.

44. The compound or oligonucleotide of any one of claims 24-37, wherein each of the first, second, or third spacers is independently represented by formula I, wherein:

x is selected from-CH ₂ -and-O-; and is also provided with

n is 0, 1, 2 or 3.

45. The compound or oligonucleotide of any one of claims 24-37, wherein each of the first, second, or third spacers is independently represented by formula I', wherein:

x is selected from-CH ₂ -and-O-; and is also provided with

n is 0, 1, 2 or 3.

46. The compound or oligonucleotide of any one of claims 24-37, wherein each of the first, second, or third spacers is independently represented by formula (Ia), wherein:

And is also provided with

n is 0, 1, 2 or 3.

47. The compound or oligonucleotide of any one of claims 24-37, wherein each of the first, second, or third spacers is independently represented by formula (Ia'), wherein:

and is also provided with

n is 0, 1, 2 or 3.

48. The compound or oligonucleotide of any one of claims 24-37, wherein each of the first, second, or third spacers is independently represented by formula II, wherein:

and is also provided with

X is selected from-CH ₂ -and-O-.

49. The compound or oligonucleotide of any one of claims 24-37, wherein each of the first, second, or third spacers is independently represented by formula II', wherein:

and is also provided with

X is selected from-CH ₂ -and-O-.

50. The compound or oligonucleotide of any one of claims 24-37, wherein each of the first, second, or third spacers is independently represented by formula (Iia), wherein:

51. the compound or oligonucleotide of any one of claims 24-37, wherein each of the first, second, or third spacers is independently represented by formula (Iia'), wherein:

52. the compound or oligonucleotide of any one of claims 24-37, wherein each of the first, second, or third spacers is independently represented by formula III, wherein:

And is also provided with

X is selected from-CH ₂ -and-O-.

53. The compound or oligonucleotide of any one of claims 24-37, wherein each of the first, second, or third spacers is independently represented by formula III', wherein:

and is also provided with

X is selected from-CH ₂ -and-O-.

54. The compound or oligonucleotide of any one of claims 24-37, wherein each of the first, second, or third spacers is independently represented by formula (IIIa), wherein:

55. the compound or oligonucleotide of any one of claims 24-37, wherein each of the first, second, or third spacers is independently represented by formula (IIIa'), wherein:

56. the compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 10%.

57. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 20%.

58. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 25%.

59. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 30%.

60. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 40%.

61. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprising the spacer has a GC content of at least 50%.

62. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide is between 12 and 40 oligonucleotide units in length.

63. The compound or oligonucleotide of any one of the preceding claims, wherein at least one (i.e., one or more) nucleoside linkage of the oligonucleotide is independently selected from the group consisting of: phosphate diester linkages, phosphorothioate linkages, alkyl phosphate linkages, phosphorodithioate linkages, phosphotriester linkages, alkyl phosphonate linkages, 3-methoxypropyl phosphonate linkages, methylphosphonate linkages, aminoalkyl phosphotriester linkages, alkylene phosphonate linkages, phosphonite linkages, phosphoramidate linkages, phosphorothioate (phosphoamidite) linkages, phosphorothioate linkages, phosphorodiamidate linkages, aminoalkyl phosphoramidate linkages, phosphorothioate (phosphorothioate) linkages, phosphorothioate alkyl phosphonate linkages, phosphorothioate (phosphorothioate) linkages, selenophosphate linkages, and borophosphate linkages.

64. The compound or oligonucleotide of any one of claims 1-63, wherein one or more nucleoside linkages linking bases at position 3 or 4 of the oligonucleotide is a phosphodiester linkage.

65. The compound or oligonucleotide of claim 64, wherein only one nucleoside linkage that links bases at position 3 or 4 of the oligonucleotide is a phosphodiester linkage.

66. The compound or oligonucleotide of any one of claims 1-63, wherein the nucleoside linkage linking bases at both the 3-and 4-positions of the oligonucleotide is a phosphodiester linkage.

67. The compound or oligonucleotide of any one of claims 1-63, wherein one or more bases immediately preceding a spacer in the oligonucleotide are linked by a phosphodiester linkage.

68. The compound or oligonucleotide of claim 67, wherein only bases immediately preceding the spacer in the oligonucleotide are linked to the spacer by a phosphodiester linkage.

69. The compound or oligonucleotide of claim 68, wherein the base immediately preceding the spacer in the oligonucleotide is further linked to a further preceding base by a phosphodiester linkage.

70. The compound or oligonucleotide of claim 68, wherein the oligonucleotide comprises a second spacer, wherein a base immediately preceding the second spacer is linked to a further preceding base by a phosphodiester linkage.

71. The compound or oligonucleotide of any one of claims 1-63, wherein one or more bases immediately following a spacer in the oligonucleotide are linked by a phosphodiester linkage.

72. The compound or oligonucleotide of claim 71, wherein only bases immediately following the spacer in the oligonucleotide are linked to the spacer through a phosphodiester linkage.

73. The compound or oligonucleotide of claim 67, wherein two bases immediately preceding the spacer in the oligonucleotide are linked by a phosphodiester linkage.

74. The compound or oligonucleotide of any one of claims 1-63, wherein one or more bases immediately preceding a spacer in the oligonucleotide are linked by a phosphodiester linkage, and wherein one or more bases immediately following the spacer in the oligonucleotide are linked by a phosphodiester linkage.

75. The compound or oligonucleotide of claim 74, wherein one base immediately preceding the spacer and one base immediately following the spacer are linked by a phosphodiester linkage.

76. The compound or oligonucleotide of claim 74 or 75, wherein the oligonucleotide comprises a second spacer, and wherein one or more bases immediately preceding the second spacer in the oligonucleotide are linked by a phosphodiester linkage, and wherein one or more bases immediately following the second spacer in the oligonucleotide are linked by a phosphodiester linkage.

77. The compound or oligonucleotide of claim 76, wherein one base immediately preceding the second spacer and one base immediately following the second spacer are linked by a phosphodiester linkage.

78. The compound or oligonucleotide of any one of claims 1-63, wherein the oligonucleotide comprises a series of bases linked by phosphodiester linkages, the series of bases comprising at least two bases.

79. The compound or oligonucleotide of any one of claims 1-63, wherein the oligonucleotide comprises a series of bases linked by phosphodiester linkages, the series of bases comprising at least five bases.

80. The compound or oligonucleotide of claim 78 or 79, wherein the oligonucleotide comprises two or more spacers, and wherein the series of bases is disposed between the at least two spacers.

81. A compound comprising an oligonucleotide comprising a nucleobase sequence which shares at least 90% identity with an equal length portion of any one of SEQ ID NOs 1-466, 893-1338, 1342-1366 or 1392-1664.

82. An oligonucleotide comprising a nucleobase sequence which shares at least 90% identity with an equal length portion of any one of SEQ ID NOS: 1-466, 893-1338, 1342-1366 or 1392-1664.

83. The compound of claim 81 or the oligonucleotide of claim 81 or 82, wherein the nucleobase sequence shares at least 95% identity with an equal length portion of any one of SEQ ID NOs 1-466, 893-1338, 1342-1366 or 1392-1664.

84. The compound of claim 81 or the oligonucleotide of claim 81 or 82, wherein the nucleobase sequence shares at least 100% identity with an equal length portion of any one of SEQ ID NOs 1-466, 893-1338, 1342-1366 or 1392-1664.

85. The compound or oligonucleotide of any one of claims 64-84, wherein the oligonucleotide is any one of a 19-mer, a 21-mer, a 23-mer, or a 25-mer.

86. The compound or oligonucleotide of any one of the preceding claims, wherein one or more internucleoside linkages of the oligonucleotide are modified internucleoside linkages.

87. The compound or oligonucleotide of claim 86, wherein the modified internucleoside linkage of the oligonucleotide is a phosphorothioate linkage.

88. The compound or oligonucleotide of claim 86 or 87, wherein all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.

89. The compound or oligonucleotide of claim 87, wherein the phosphorothioate linkage is in one of the Rp configuration or the Sp configuration.

90. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises at least one modified sugar moiety.

91. The compound or oligonucleotide of claim 90, wherein the modified sugar moiety is one of a 2'-OMe modified sugar moiety, a bicyclic sugar moiety, a 2' -O- (2-methoxyethyl) (2 '-MOE), a 2' -deoxy-2 '-fluoronucleoside, a 2' -fluoro- β -D-arabinonucleoside, a Locked Nucleic Acid (LNA), a constrained ethyl 2'-4' -bridging nucleic acid (cEt), S-cEt, tcDNA, hexitol Nucleic Acid (HNA), and a tricyclic analogue (e.g., tcDNA).

92. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide exhibits at least a 30%, 40%, 50%, 60%, 70%, 80% or 90% increase in full-length STMN2 protein.

93. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide exhibits at least a 100% increase in full-length STMN2 protein.

94. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide exhibits at least a 200% increase in full-length STMN2 protein.

95. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide exhibits at least a 300% increase in full-length STMN2 protein.

96. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide exhibits at least a 400% increase in full-length STMN2 protein.

97. The compound or oligonucleotide of any one of claims 92-96, wherein an increase in the full-length STMN2 protein is measured as compared to a reduced level of full-length STMN2 protein achieved using a TDP43 antisense oligonucleotide.

98. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide exhibits at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% rescue of a full length STMN2 protein.

99. The compound or oligonucleotide of any one of the preceding claims, wherein the oligonucleotide exhibits at least a 50%, 60%, 70%, 80% or 90% reduction in STMN2 transcripts with cryptic exons.

100. A method of treating a neurological disease and/or neurological disorder in a patient in need thereof, the method comprising administering to the patient a compound or oligonucleotide of any one of claims 1-99.

101. The method of claim 100, wherein the neurological disease is selected from the group consisting of: amyotrophic Lateral Sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, alzheimer's Disease (AD), parkinson's Disease (PD), huntington's disease, progressive Supranuclear Palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), and TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, perry syndrome, dementia with lewy bodies associated with alzheimer's disease, parkinson's disease with or without dementia, and edge-dominated age-related TDP-43 encephalopathy (LATE)).

102. The method of claim 101, wherein the neurological disease is ALS.

103. The method of claim 101, wherein the neurological disease is FTD.

104. The method of claim 101, wherein the neurological disease is ALS with FTD.

105. The method of claim 100, wherein the neuropathy is chemotherapy-induced neuropathy.

106. A method of restoring neurite outgrowth and/or regeneration of a neuron, the method comprising exposing the neuron to a compound or oligonucleotide of any one of claims 1-99.

107. A method of increasing, promoting, stabilizing or maintaining STMN2 expression and/or function in a neuron, the method comprising exposing the cell to a compound or oligonucleotide of any one of claims 1-99.

108. The method of claim 106 or 107, wherein the neuron is a motor neuron.

109. The method of claim 106 or 107, wherein the neuron is a spinal cord neuron.

110. The method of any one of claims 106-109, wherein the neuron is a neuron of a patient in need of treatment for a neurological disease and/or neuropathy.

111. The method of claim 110, wherein the neuropathy is chemotherapy-induced neuropathy.

112. The method of any one of claims 106-111, wherein the exposing is performed in vivo or ex vivo.

113. The method of any one of claims 106-111, wherein the exposing comprises administering the oligonucleotide to a patient in need thereof.

114. The method of any one of claims 106-113, wherein the oligonucleotide is administered topically, parenterally, intrathecally, intrathalamus, intracisternally, orally, rectally, buccally, sublingually, vaginally, pulmonary, intratracheally, intranasally, transdermally, or intraduodenally.

115. The method of claim 114, wherein the oligonucleotide is administered orally.

116. The method of any one of claims 106-114, wherein a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamus, or intracisternally.

117. The method of any one of claims 106-116, wherein the patient is a human.

118. A pharmaceutical composition comprising the oligonucleotide of any one of claims 1-99, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable excipient.

119. The pharmaceutical composition of claim 118, wherein the pharmaceutical composition is suitable for topical, intrathecal, intrathalamic, intracisternal, intraventricular, parenteral, oral, pulmonary, intratracheal, intranasal, transdermal, rectal, buccal, sublingual, vaginal or intraduodenal administration.

120. A method of treating a neurological disease or neuropathy in a patient in need thereof, the method comprising administering to the patient in need thereof a therapeutically effective amount of the pharmaceutical composition of claim 118 or 119.

121. The method of claim 120, wherein the neurological disease is selected from the group consisting of: amyotrophic Lateral Sclerosis (ALS), frontotemporal dementia (FTD), ALS with FTD, alzheimer's Disease (AD), parkinson's Disease (PD), huntington's disease, progressive Supranuclear Palsy (PSP), brain trauma, spinal cord injury, corticobasal degeneration (CBD), nerve injury (e.g., brachial plexus injury), neuropathy (e.g., chemotherapy-induced neuropathy), and TDP43 proteinopathies (e.g., chronic traumatic encephalopathy, perry syndrome, dementia with lewy bodies associated with alzheimer's disease, parkinson's disease with or without dementia, and edge-dominated age-related TDP-43 encephalopathy (LATE)).

122. The method of claim 121, wherein the neurological disease is ALS.

123. The method of claim 121, wherein the neurological disease is FTD.

124. The method of claim 121, wherein the neurological disease is ALS with FTD.

125. The method of claim 120, wherein the neuropathy is chemotherapy-induced neuropathy.

126. The method of any one of claims 120-125, wherein the pharmaceutical composition is administered topically, parenterally, orally, pulmonary, rectally, buccally, sublingually, vaginally, intratracheally, intranasally, intracisternally, intrathecally, intrathalamus, transdermally, or intraduodenally.

127. The method of any one of claims 120-125, wherein the pharmaceutical composition is administered intrathecally, intrathalamus, or intracisternally.

128. The method of any one of claims 120-127, wherein a therapeutically effective amount of the oligonucleotide is administered intrathecally, intrathalamus, or intracisternally.

129. The method of any one of claims 120-128, wherein the patient is a human.

130. A method for treating a neurological disease in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment of up to 7 linked nucleosides and wherein the oligonucleotide shares at least 85% identity with any one of SEQ ID NOs 1-466, 893-1338, 1342-1366, or 1392-1664;

wherein at least one (i.e., one or more) nucleoside linkages of the oligonucleotide are independently selected from the group consisting of: phosphate diester linkages, phosphorothioate linkages, alkyl phosphate linkages, dithiophosphate linkages, phosphotriester linkages, alkyl phosphonate linkages, 3-methoxypropyl phosphonate linkages, methylphosphonate linkages, aminoalkyl phosphotriester linkages, alkylene phosphonate linkages, phosphinate linkages, phosphoramidate linkages, phosphorothioate linkages, phosphorodithioate linkages, phosphorodiaminoate linkages, phosphoramidate linkages, aminoalkyl phosphoramidate linkages, phosphorothioate alkyl phosphonate linkages, phosphorothioate alkyl phosphotriester linkages, phosphorothioate linkages, selenophosphate linkages, and borophosphate linkages, and/or

Wherein at least one (i.e., one or more) nucleoside is substituted with a component selected from the group consisting of: 2' -O- (2-methoxyethyl) nucleoside, 2' -O-methyl nucleoside, 2' -deoxy-2 ' -fluoro nucleoside, 2' -fluoro- β -D-arabinonucleoside, locked Nucleic Acid (LNA), tricyclic nucleic acid, constrained methoxyethyl (cMOE), constrained ethyl (cET) and Peptide Nucleic Acid (PNA)

Optionally, wherein the oligonucleotide further comprises a spacer.

131. A method for treating Amyotrophic Lateral Sclerosis (ALS) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment of up to 7 linked nucleosides and wherein the oligonucleotide shares at least 85% identity with any one of SEQ ID NOs 1-466, 893-1338, 1342-1366, or 1392-1664;

Optionally, wherein the oligonucleotide further comprises a spacer.

132. A method for treating frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment of up to 7 linked nucleosides and wherein the oligonucleotide shares at least 85% identity with any one of SEQ ID NOs 1-466, 893-1338, 1342-1366, or 1392-1664;

Optionally, wherein the oligonucleotide further comprises a spacer.

133. A method for treating Amyotrophic Lateral Sclerosis (ALS) with frontotemporal dementia (FTD) in a subject in need thereof, the method comprising administering to the subject an oligonucleotide comprising a segment of up to 7 linked nucleosides and wherein the oligonucleotide shares at least 85% identity with any one of SEQ ID NOs 1-466, 893-1338, 1342-1366, or 1392-1664;

Optionally, wherein the oligonucleotide further comprises a spacer.

134. The method of any one of claims 130-133, wherein the nucleoside linkage that links the bases at position 3 or 4 of the oligonucleotide is a phosphodiester linkage.

135. The method of claim 134, wherein only one nucleoside linkage that links bases at position 3 or 4 of the oligonucleotide is a phosphodiester linkage.

136. The method of any one of claims 130-133, wherein the nucleoside linkage that links the bases at both positions 3 and 4 of the oligonucleotide is a phosphodiester linkage.

137. The method of any one of claims 130-133, wherein one or more bases immediately preceding a spacer in the oligonucleotide are linked by a phosphodiester linkage.

138. The method of claim 137, wherein only bases immediately preceding the spacer in the oligonucleotide are linked to the spacer by a phosphodiester linkage.

139. The method of claim 138, wherein the base immediately preceding the spacer in the oligonucleotide is further linked to a further preceding base by a phosphodiester linkage.

140. The method of claim 138, wherein the oligonucleotide comprises a second spacer, wherein a base immediately preceding the second spacer is linked to a further preceding base by a phosphodiester linkage.

141. The method of any one of claims 130-133, wherein one or more bases immediately following a spacer in the oligonucleotide are linked by a phosphodiester linkage.

142. The method of claim 141, wherein only bases immediately following the spacer in the oligonucleotide are linked to the spacer by a phosphodiester linkage.

143. The method of any one of claims 130-133, wherein two bases immediately preceding the spacer in the oligonucleotide are linked by a phosphodiester linkage.

144. The method of any one of claims 130-133, wherein one or more bases immediately preceding a spacer in the oligonucleotide are linked by a phosphodiester linkage, and wherein one or more bases immediately following the spacer in the oligonucleotide are linked by a phosphodiester linkage.

145. The method of claim 144, wherein one base immediately preceding the spacer and one base immediately following the spacer are linked by a phosphodiester linkage.

146. The method of claim 144 or 145, wherein the oligonucleotide comprises a second spacer, and wherein one or more bases immediately preceding the second spacer in the oligonucleotide are linked by a phosphodiester linkage, and wherein one or more bases immediately following the second spacer in the oligonucleotide are linked by a phosphodiester linkage.

147. The compound or oligonucleotide of claim 146, wherein one base immediately preceding the second spacer and one base immediately following the second spacer are linked by a phosphodiester linkage.

148. The method of any one of claims 130-133, wherein the oligonucleotide comprises a series of bases linked by phosphodiester linkages, the series of bases comprising at least two bases.

149. The method of any one of claims 130-133, wherein the oligonucleotide comprises a series of bases linked by phosphodiester linkages, the series of bases comprising at least five bases.

150. The method of claim 148 or 149, wherein the oligonucleotide comprises two or more spacers, and wherein the series of bases is disposed between the at least two spacers.

151. The method of any one of claims 134-150, wherein the oligonucleotide is any one of a 19-mer, a 21-mer, a 23-mer, or a 25-mer.

152. The method of any one of claims 130-133, wherein at least one (i.e., one or more) internucleoside linkage of the oligonucleotide is a phosphorothioate linkage.

153. The method of any one of claims 130-133, wherein all internucleoside linkages of the oligonucleotide are phosphorothioate linkages.

154. An oligonucleotide comprising a sequence 85% to 98% complementary to an equal length portion of any one of: 1339 or 1341, or 15 to 50 consecutive nucleobase portions thereof, optionally wherein said oligonucleotide comprises a spacer and wherein said oligonucleotide is capable of increasing, restoring or stabilizing expression of STMN2 mRNA and/or activity and/or function of STMN2 protein capable of translating functional STMN2 in a cell or human patient of an immune mediated demyelinating disease, and wherein the level of increase, restoration or stabilization of expression and/or activity and/or function is sufficient to use said oligonucleotide as a medicament for treating said immune mediated demyelinating disease.

155. The method of any one of claims 100-117 or 120-153, the pharmaceutical composition of claim 118 or 119, or the oligonucleotide of any one of claims 1-99 or 154, wherein the oligonucleotide comprises one or more chiral centers and/or double bonds.

156. The method of any one of claims 100-117, 120-153 or 155, the pharmaceutical composition of claim 118, 119 or 155, or the oligonucleotide of any one of claims 1-99 or 154-155, wherein said oligonucleotide is present as a stereoisomer selected from the group consisting of a geometric isomer, an enantiomer and a diastereomer.

157. A method of treating a neurological disease and/or neurological disorder in a patient in need thereof, the method comprising administering to a patient in need thereof a therapeutically effective amount of the pharmaceutical composition of claim 118 or 119 in combination with a second therapeutic agent.

158. The method of claim 157, wherein the second therapeutic agent is selected from the group consisting of: riluzole (Rilutek), edaravone (Radicava), rivastigmine, donepezil, galantamine, selective serotonin reuptake inhibitors, antipsychotics, cholinesterase inhibitors, memantine, benzodiazepine anxiolytics, AMX0035 (ELYBRIO), ZILUCOPLAN (RA 101495), pridopidine, dual AON intrathecal administration (e.g., BIIB067, BIIB078 and BIIB 105), BIIB100, levodopa/carbidopa, dopaminergic agents (e.g., ropinirole, pramipexole, rotigotine), medroxyprogesterone, KCNQ2/KCNQ3 openers (e.g., retigabine, XEN1101 or QRL-101), anticonvulsants and psychostimulants, and/or therapies (e.g., selected from respiratory care, physiotherapy, speech therapy, nutritional support) are used to treat the neurological disease.

159. A method of treating a neurological disease and/or neurological disorder in a patient in need thereof, the method comprising administering to a patient in need thereof a therapeutically effective amount of the pharmaceutical composition of claim 118 or 119, wherein at least one nucleoside linkage of the oligonucleotide is a non-natural linkage, optionally wherein the oligonucleotide comprises a spacer, and wherein the oligonucleotide further comprises a targeting or conjugation moiety selected from the group consisting of: cholesterol, lipoic acid, pantothenic acid, polyethylene glycol, and antibodies for crossing the blood brain barrier.

160. The method of any one of claims 100-117, 120-153, or 155-159, wherein the spacer is a nucleoside replacement group comprising a non-sugar substituent that is not capable of linking to a nucleotide base.

161. The method of claim 160, wherein the spacer is located between positions 10 and 15 of the oligonucleotide.

162. The method of claim 160, wherein the spacer is located between positions 7 and 11 of the oligonucleotide.

163. The method of claim 160 or 162, wherein the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 14 and 22 of the oligonucleotide.

164. The method of claim 163, wherein the spacer and the second spacer are separated in the oligonucleotide by at least 5 nucleobases, at least 6 nucleobases, or at least 7 nucleobases.

165. The method of claim 163 or 164, wherein the spacer is located between positions 7 and 9 of the oligonucleotide, and wherein the second spacer is located between positions 15 and 18 of the oligonucleotide.

166. The method of any one of claims 163-165, wherein the spacer is located at position 8 of the oligonucleotide, and wherein the second spacer is located at position 16 of the oligonucleotide.

167. The method of any one of claims 163-166, wherein the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 21 and 24 of the oligonucleotide.

168. The method of claim 160, wherein the spacer is located between positions 2 and 5 of the oligonucleotide.

169. The method of claim 168, wherein the oligonucleotide further comprises a second spacer, wherein the second spacer is located between positions 8 and 12 of the oligonucleotide.

170. The method of claim 169, wherein the oligonucleotide further comprises a third spacer, wherein the third spacer is located between positions 18 and 22 of the oligonucleotide.

171. The method of claim 160, wherein the oligonucleotide further comprises a second spacer and a third spacer, wherein the three spacers are located at positions in the oligonucleotide such that each segment of the oligonucleotide has up to 7 linked nucleosides.

172. The method of claim 171, wherein at least two of the three spacers are adjacent to a guanine nucleobase.

173. The method of claim 172, wherein each of at least two of the three spacers immediately precedes a guanine nucleobase.

174. The method of any one of claims 160-173, wherein each of the first, second, or third spacers is a nucleoside replacement group comprising a non-sugar substituent, wherein the non-sugar substituent is free of ketone, aldehyde, ketal, hemiketal, acetal, hemiacetal, aminal, or hemiaminal moieties and is incapable of forming a covalent bond with a nucleoside acid base.

175. The method of any one of claims 160-173, wherein each of the first, second, or third spacers is independently represented by formula (X), wherein:

The symbols represent the points of attachment to internucleoside linkages.

176. The method of claim 175, wherein each of the first, second, or third spacers is independently represented by formula (Xa), wherein:

177. the method of claim 175 or 176, wherein ring a is an optionally substituted 4-8 membered monocyclic cycloalkyl or 4-8 membered monocyclic heterocyclyl, the optionally substituted 4-8 membered monocyclic cycloalkyl being selected from cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl and cyclooctyl; the 4-8 membered monocyclic heterocyclic group is selected from oxetanyl, tetrahydrofuranyl, tetrahydropyranyl, 1, 4-dioxanyl, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl and azepanyl.

178. The method of claim 177, wherein ring a is tetrahydrofuranyl.

179. The method of claim 177, wherein ring a is tetrahydropyranyl.

180. The method of any one of claims 160-173, wherein each of the first, second, or third spacers is independently represented by formula (I), wherein:

x is selected from-CH ₂ -and-O-; and is also provided with

n is 0, 1, 2 or 3.

181. The method of any one of claims 160-173, wherein each of the first, second, or third spacers is independently represented by formula (I'), wherein:

182. The method of any one of claims 160-173, wherein each of the first, second, or third spacers is independently represented by formula (Ia), wherein:

183. the method of any one of claims 160-173, wherein each of the first, second, or third spacers is independently represented by formula (Ia'), wherein:

184. the method of any one of claims 160-173, wherein each of the first, second, or third spacers is independently represented by formula II, wherein:

and is also provided with

X is selected from-CH ₂ -and-O-.

185. The method of any one of claims 160-173, wherein each of the first, second, or third spacers is independently represented by formula II', wherein:

and is also provided with

X is selected from-CH ₂ -and-O-.

186. The method of any one of claims 160-173, wherein each of the first, second, or third spacers is independently represented by formula (IIa), wherein:

187. the method of any one of claims 160-173, wherein each of the first, second, or third spacers is independently represented by formula (IIa'), wherein:

188. the method of any one of claims 160-173, wherein each of the first, second, or third spacers is independently represented by formula III, wherein:

And is also provided with

X is selected from-CH ₂ -and-O-.

189. The method of any one of claims 160-173, wherein each of the first, second, or third spacers is independently represented by formula III', wherein:

and is also provided with

X is selected from-CH ₂ -and-O-.

190. The method of any one of claims 160-173, wherein each of the first, second, or third spacers is independently represented by formula (IIIa), wherein:

191. the method of any one of claims 160-173, wherein each of the first, second, or third spacers is independently represented by formula (IIIa'), wherein:

192. the method of any one of claims 160-191, wherein the oligonucleotide comprising the spacer has a GC content of at least 10%.

193. The method of any one of claims 160-192, wherein the oligonucleotide comprising the spacer has a GC content of at least 20%.

194. The method of any one of claims 160-193, wherein the oligonucleotide comprising the spacer has a GC content of at least 25%.

195. The method of any one of claims 160-194, wherein the oligonucleotide comprising the spacer has a GC content of at least 30%.

196. The method of any one of claims 160-195, wherein the oligonucleotide comprising the spacer has a GC content of at least 40%.

197. The method of any one of claims 160-196, wherein the oligonucleotide comprising the spacer has a GC content of at least 50%.