WO2023094992A1 - Systems, formulations and methods for microbial detection and quantification - Google Patents

Systems, formulations and methods for microbial detection and quantification Download PDF

Info

Publication number
WO2023094992A1
WO2023094992A1 PCT/IB2022/061290 IB2022061290W WO2023094992A1 WO 2023094992 A1 WO2023094992 A1 WO 2023094992A1 IB 2022061290 W IB2022061290 W IB 2022061290W WO 2023094992 A1 WO2023094992 A1 WO 2023094992A1
Authority
WO
WIPO (PCT)
Prior art keywords
taxon
specific
probe
sub
fluorescent
Prior art date
Application number
PCT/IB2022/061290
Other languages
French (fr)
Inventor
Christopher Hale CORZETT
Benjamin John TULLY
Molly B. Schmid
Cesar Escobar BLANCO
Sapna Shah JAIN
Steven Eric FINKEL
Original Assignee
Alfred E. Mann Institute For Biomedical Engineering At The University Of Southern California
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Alfred E. Mann Institute For Biomedical Engineering At The University Of Southern California filed Critical Alfred E. Mann Institute For Biomedical Engineering At The University Of Southern California
Publication of WO2023094992A1 publication Critical patent/WO2023094992A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2561/00—Nucleic acid detection characterised by assay method
    • C12Q2561/113—Real time assay
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development

Definitions

  • This disclosure relates to systems, formulations and methods that may be used in determination of presence/absence, relative and/or absolute abundance of specific bacteria in a sample.
  • This disclosure relates to formulations that include taxonspecific unlabeled primers and taxon-specific fluorescent probes.
  • This disclosure further relates to formulations that may include reference primers, reference fluorescent probes, and/or reference materials, which may be used in determination of relative and/or absolute abundance of specific bacteria in a sample.
  • Taxon-specific fluorescent probes may be used to increase specificity during real-time quantitative polymerase chain reaction (qPCR) reactions. Taxonspecific primers and one or more such taxon-specific fluorescent probes respectively may amplify and quantify specific PGR products and/or specific alleles.
  • An example of such taxon-specific fluorescent probes may be those used in TaqMan® (Applied Biosystems, Foster City, CA) assays targeting specific bacterial species.
  • taxon-specific fluorescent probes such as TaqMan® are marketed, by Thermo Fisher Scientific, for gene expression assays, genotyping, copy number variation, microRNA analysis, mutation detection, non-coding RNA assays, and protein quantification assays.
  • This disclosure relates to systems, formulations and methods that may be used in determination of presence/absence, relative and/or absolute abundance of specific bacteria in a sample.
  • This disclosure particularly relates to formulations that include taxon-specific unlabeled primers and taxon-specific fluorescent probes.
  • This disclosure also relates to species-specific unlabeled primers and species-specific fluorescent probes.
  • This disclosure further relates to formulations that may include reference primers, reference fluorescent probes, and/or reference materials, which may be used in determination of relative and/or absolute abundance of specific bacteria in a sample.
  • the method of determining presence/absence, relative abundance, and/or absolute abundance of specific bacteria in a microbiome sample may include obtaining the microbiome sample, preparing a qPCR by mixing the microbiome sample with a qPCR formulation, performing the qPCR, analyzing results, and thereby determining presence/absence, relative abundance, and/or absolute abundance of the specific bacteria in the microbiome sample.
  • the method of determining presence/absence, relative abundance, and/or absolute abundance of specific bacteria in a microbiome sample may include obtaining the microbiome sample that potentially includes at least one nucleic acid; processing the microbiome sample to have the at least one nucleic acid accessible to react with a specific primer pair; mixing the processed microbiome sample with a qPCR formulation to form a microbiome reaction mixture; subjecting the microbiome reaction mixture to a qPCR under which at least one section of the accessible nucleic acid can be amplified and produce a fluorescence signal; measuring amount of fluorescence signal produced; and identifying whether the specific bacteria are present in the microbiome sample, and/or, if the specific bacteria are present in the microbiome, determining relative abundance, and/or absolute abundance of the specific bacteria in the microbiome sample.
  • This disclosure further relates to a method of treatment of a patient, which may include obtaining a microbiome sample from the patient, wherein the microbiome sample potentially comprises at least one nucleic acid; processing the microbiome sample to have the at least one nucleic acid accessible to react with a specific primer pair designed specifically for identification of the specific bacteria present in the microbiome; mixing the processed microbiome sample with a qPCR formulation to form a microbiome reaction mixture; subjecting the microbiome reaction mixture to a qPCR under which at least one section of the accessible nucleic acid can be amplified and produce a fluorescence signal; measuring amount of fluorescence signal produced; identifying whether the specific bacteria are present in the microbiome sample, and/or, if the specific bacteria are present in the microbiome, determining relative abundance, and/or absolute abundance of the specific bacteria in the microbiome sample; forming a patient bacteria profile based on said identification; comparing the patient bacteria profile with a bacteria profile of a healthy patient; determining whether the patient has
  • the qPCR formulation may include at least one pair of taxon-specific unlabeled primers ("primer pair"). Each primer pair may include a forward primer and a reverse primer.
  • the qPCR formulation may also include at least one DNA polymerase; and at least one taxon-specific fluorescent probe (“taxonspecific probe”) targeting all members of the taxon and/or at least one sub-taxonspecific fluorescent probe (“sub-taxon probe”) for at least one member of the taxon.
  • the taxon-specific probe and/or sub-taxon probe may be a sequence-specific oligonucleotide with a covalently bound fluorescent dye and a covalently bound non- fluorescent quencher.
  • the fluorescent dye is hereafter called “sub-taxon fluorescent dye,” and wherein said non-fluorescent quencher is hereafter called “sub-taxon quencher.”
  • the method may further include having at least one taxon-specific primer pair designed to specifically amplify a genus and/or a specific clade; and having a sub-taxon probe designed to detect a species and/or a specific strain of a species within the genus and/or a specific clade.
  • the method may further include having at least one primer pair designed to specifically amplify a genus and/or a specific clade; and having a sub-taxa probe designed to detect a species through a sequence variation and/or a specific strain of the species.
  • the sub-taxon probe may exclude a 3’-hydroxyl group to ensure that the nucleic acid polymerase does not use this probe to initiate or extend nucleic acid synthesis, and prevent unintended amplification products.
  • the qPCR formulation may include at least two sub-taxon probes.
  • Each sub-taxon probe may have a different sub-taxon fluorescent dye than that of the other sub-taxon probes.
  • Each sub-taxon probe may have a sub-taxon quencher different than those of the other sub-taxon probes.
  • the qPCR formulation may include at least two sub-taxon probes.
  • Each sub-taxon probe may have a different sub-taxon fluorescent dye than that of the other sub-taxon probes.
  • the relative abundance of different sub-taxon variants may be determined by choosing a reference fluorescence intensity of one of the sub-taxon probe's fluorescent dye as a point-of-reference and comparing fluorescence intensities of other sub-taxon probes' fluorescent dyes with the reference fluorescence intensity.
  • the qPCR formulation may include at least two sets of the primer pairs. Each set of the primer pairs may be specific to a taxon. Each set of the primer pairs may be different than other sets of the primer pairs.
  • the qPCR formulation may include at least two fluorescent probes ("taxon-probes"), wherein each taxon probe is specific to a distinct taxon.
  • Each taxon-probe may have a different fluorescent dye than that of the other taxon-probes.
  • the relative abundance of different taxa may be determined by choosing a fluorescence intensity ("reference fluorescence intensity") of one of the taxon-probe's fluorescent dye as a point-of-reference and comparing fluorescence intensities of other taxon-probes' fluorescent dyes with the reference fluorescence intensity.
  • the qPCR formulation may include at least two fluorescent probes ("taxon-probes"), wherein each taxon probe is specific to a distinct taxon.
  • Each taxon-probe may have a different fluorescent dye and a quencher than those of the other taxon-probes.
  • the relative abundance of different taxa may be determined by choosing a reference fluorescence intensity of one of the taxonprobe's fluorescent dye as a point-of-reference and comparing fluorescence intensities of other taxon-probes' fluorescent dyes with the reference fluorescence intensity.
  • the qPCR formulation may further include at least one pair of reference primers ("reference-primer pair”), and at least one reference fluorescent probe (“reference-probe”).
  • the reference-probe may be a sequencespecific oligonucleotide with a covalently bound fluorescent dye ("reference- fluorescent dye”) and a covalently bound non-fluorescent quencher (“referencequencher”).
  • the fluorescent dye may be a fluorophore different than other sub-taxon fluorescent dyes and/or taxon fluorescent dyes.
  • the qPCR formulation may further include at least one pair of reference primers ("reference-primer pair”), and at least one reference fluorescent probe (“reference-probe”).
  • the reference-probe may be a sequencespecific oligonucleotide with a covalently bound fluorescent dye ("reference- fluorescent dye”) and a covalently bound non-fluorescent quencher (“referencequencher”).
  • the reference-fluorescent dye may be a fluorophore different than the sub-taxon fluorescent dye(s) and/or taxon fluorescent dye(s).
  • the referencequencher may be a quencher different than other sub-taxon quenchers and/or taxon quenchers.
  • the qPCR formulation may further include at least one reference-material with known quantity, and a reference-probe.
  • the absolute abundance of each taxon within a sample may be determined by comparing fluorescence intensity of each taxon-probe with that of the reference-material.
  • the reference-material may include a predetermined amount of oligonucleotide.
  • the qPCR formulation may further include a fluorescent probe and a primer pair, which are specific for determination of total number of marker genes of bacteria present in the sample.
  • the method may further include determining total number of marker genes, using said total number of marker genes as a point-of-reference, and determining relative proportion of a taxon of interest within the total bacterial biomass of the sample.
  • the qPCR formulation may further include a referenceprobe specific for determination of total copy number of all bacterial 16S rRNA.
  • the method may further include determining the total copy number of all bacterial 16S rRNA, using said total copy number as a point-of-reference, and determining relative proportion of a taxon of interest within the total bacterial biomass of the sample.
  • the reference-material may include a predetermined amount of 16S rRNA genes.
  • the method further may further include extracting DNA after obtaining the microbiome sample.
  • the method may further include lysing cells after obtaining the microbiome sample.
  • the sub-taxon probe, the taxon-probe, and/or the reference-probe may have a minor groove binder to stabilize each probe's DNA binding stability.
  • the method may further include having a pre-determined threshold fluorescence intensity ("threshold-fluorescence intensity").
  • the fluorescence intensity below the threshold-fluorescence intensity may be indicative of absence of a specific target in the microbiome sample.
  • the fluorescence intensity above the threshold-fluorescence intensity may be indicative of presence of a specific target in the microbiome sample.
  • the qPCR formulation may further include a dNTP, a reaction buffer, or a combination thereof.
  • the method may be used to determine presence/absence, relative abundance, and/or absolute abundance of microbes at sub-taxon resolution, and wherein the sub-taxon resolution comprises resolution of genus, species, and/or strains of a microbial community.
  • the genus of the bacteria may have at least one subtaxon, or at least two sub-taxa.
  • the genus of the bacteria may have at least one subtaxon, or at least two sub-taxa.
  • the specific bacteria may be Porphyromonas.
  • the specific bacteria may belong to at least one species of the Porphyromonas genus.
  • the target bacteria may belong to Porphyromonas somerae, Porphyromonas uenonsis, Porphyromonas asaccharolytica, or a combination thereof.
  • the qPCR formulation may include at least two specific primer pairs; wherein each specific primer pair may include a forward primer and a reverse primer; and wherein at least one first specific primer pair may be capable of amplifying a first species belonging a first sub-taxon of the target bacteria and at least one second specific primer pair may be capable of amplifying a second species belonging a second sub-taxon of the specific bacteria.
  • the qPCR formulation may include a primer pair; the primer pair may include a forward primer and a reverse primer; the primer pair may be selected from the primer pairs of FIGs. 9 or FIG. 10, Primer IDs p0325 (SEQ ID NO: 5), p0326 (SEQ ID NO: 6) , p0333 to p0336 (SEQ ID NO: 1-4), p0387 (SEQ ID NO: 7); , p0388 (SEQ ID NO: 8), or a combination thereof; and the sub-taxon probe may be selected from the species-specific fluorescent probes of FIG. 10, Probe IDs fpOOOl to fp0012 (SEQ ID NO: 9-20), fp0022 (SEQ ID NO: 21), fp0023 (SEQ ID NO: 22), or a combination thereof.
  • the disease may include (chronic) oral infections, cancers, neurodegenerative diseases, or a combination thereof.
  • the disease may include colorectal cancer, endometrial cancer, gastric adenocarcinomas, and cervical cancer, P. aeruginosa pulmonary infections in cystic fibrosis, oral pathological process, or a combination thereof.
  • the disease may include an oral pathological process, wherein the oral pathological process comprises periodontitis, oral squamous cell carcinomas, or a combination thereof.
  • the disease may include colorectal cancer.
  • the microbiome sample may include stool, saliva, skin, nasal swab, vaginal swab, blood, urine, hair, or oral swab.
  • the patient may be a human or an animal.
  • the method may further include administering a therapeutic to the patient.
  • the therapeutic may not be chemotherapy and/or radiation.
  • This disclosure further relates to a diagnostic kit.
  • This diagnostic kit may include one or more primer pairs, and one or more sub-taxon probes of this disclosure.
  • This diagnostic kit may further include a reference standard.
  • This disclosure further relates to a nucleic acid, which may have at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to any one of the sequences of the primer pairs of FIG. 10, Primer IDs p0325 to p0326 (SEQ ID NO: 5-6), p0333 to p0336 (SEQ ID NO: 1-4), p0387 to p0388 (SEQ ID NO: 7-8), or any combination thereof.
  • This disclosure further relates to a synthetic primer pair, which may include a synthetic forward primer and/or a synthetic reverse primer, each having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to any one of the synthetic forward primers and/or the synthetic reverse primers of the primer pairs of FIG. 10, p0325 to p0326 (SEQ ID NO: 5-6),, p0333 to p0336 (SEQ ID NO: 1-4), p0387 to p0388 (SEQ ID NO: 7-8), or any combination thereof.
  • p0325 to p0326 SEQ ID NO: 5-6
  • p0333 to p0336 SEQ ID NO: 1-4
  • p0387 to p0388 SEQ ID NO: 7-8
  • FIG. 1 illustrates exemplary reaction components and their reactions with a template of a DNA belonging to a microorganism (e.g. bacteria).
  • FIG. 1.1 shows reaction components and a DNA template.
  • FIG. 1.2 shows denatured template and annealing.
  • FIG. 1.3 shows polymerization and signal generation.
  • FIG. 2. illustrates an exemplary method of this disclosure for detecting and quantifying microbes at sub-taxon resolution.
  • FIG. 3. illustrates exemplary reaction components and their reactions with a template of a DNA belonging to a microorganism (e.g. bacteria).
  • FIG. 3.1 shows reaction components and a DNA template.
  • FIG. 3.2 shows denatured template and annealing.
  • FIG. 3.3 shows polymerization and signal generation.
  • FIG. 4. illustrates Porphyromonas phylogenetic tree, sequences of an example of a primer pair specific to a Porphyromonas taxon (Clade 5), and sequences of two examples of sub-taxon probes specific to Porphyromonas species.
  • the two target species may be Porphyromonas asaccharolytica and Porphyromonas uenonis.
  • FIG. 5. illustrates genotyping and quantification of species using taxonspecific primers and sub-taxon-specific fluorescent probes.
  • Reaction compositions detailing the primers and probes present in each reaction are shown along with the template material provided and the corresponding Ct values obtained from each fluorescence channel in every reaction.
  • Amplification curves for both fluorescence channels (FAM, red; TAMRA; blue) from every reaction are shown, detailing the species-specific amplification results (P. asaccharolytica and P. uenonis, respectively).
  • Forward primer p0387.
  • Reverse primer p0388.
  • Target Amplicon pp890.
  • FIG. 6 illustrates an exemplary method of this disclosure for determining the presence/relative-abundance of related bacterial species within a sample.
  • FIG. 7. illustrates exemplary reaction components and their reactions with a template of a DNA belonging to a microorganism (e.g. bacteria) and a reference template.
  • FIG. 7.1 shows reaction components, a gDNA template and a reference template.
  • FIG. 7.2 shows denatured gDNA template and denatured reference template, and annealing of these templates.
  • FIG. 7.3 shows polymerization and signal generation from annealed templates.
  • FIG. 8 illustrates an exemplary method for determining the absolute abundance of microbial species within a sample.
  • FIG. 9. illustrates species-specific Porphyromonas qPCR primer pairs.
  • FIG. 10 illustrates species-specific Porphyromonas fluorescent probes.
  • FIG. 11. illustrates probe-based qPCR detection experimental design.
  • FIG. 12. illustrates Porphyromonas somerae -specific fluorescent probe targets.
  • FIG. 13 illustrates Porphyromonas somerae-specific fluorescent probe targets.
  • FIG. 14 illustrates Porphyromonas uenonis-specific fluorescent probe targets.
  • FIG. 15. illustrates end products from probe-based qPCR detection reactions.
  • FIG. 16 illustrates Ct values of FAM-labeled species-specific Porphyromonas probes against correct templates.
  • FIG. 17. illustrates end products from mismatched primer/probe qPCR reactions.
  • FIG. 18. illustrates end products from probe-based qPCR detection reactions.
  • FIG. 19 illustrates serial dilution quantification using P. somerae-specific 6- FAM probes.
  • FIG. 20 illustrates serial dilution quantification using P. somerae-specific 6- FAM probes.
  • FIG. 21 illustrates serial dilution quantification using P. uenon/s-specific 6- FAM probes.
  • FIG. 22 illustrates serial dilution quantification using P. uenon/s-specific 6- FAM probes.
  • FIG. 23 illustrates quantification using TAMRA- and FAM-labeled probes.
  • FIG. 24 illustrates multiplex qPCR to quantify P. somerae using both TAMRA- and FAM-labeled probes simultaneously.
  • FIG. 25 illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using differentially-labeled species-specific fluorescent probes.
  • FIG. 26 illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using differentially-labeled species-specific fluorescent probes.
  • FIG. 27 illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using differentially-labeled species-specific fluorescent probes.
  • FIG. 28 illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes, enabling the determination of the relative abundance of each species.
  • Forward primers were p0325 (SEQ ID NO: 5) and pO333(SEQ ID NO: 1 ); backward primers were pO326(SEQ ID NO: 6) and pO334(SEQ ID NO: 2); and the target region was pp43916 and pp29025.
  • the probe and probe label were fp0003 (SEQ ID NO: 11) and FAM, respectively.
  • probe target P. uenonis the probe and probe label were fpOO1 O (SEQ ID NO: 18) and TAMRA, respectively.
  • FIG. 29 illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes, enabling the determination of the relative abundance of each species.
  • Forward primers were p0325 (SEQ ID NO: 5) and pO333(SEQ ID NO: 1 ); backward primers were pO326(SEQ ID NO: 6) and pO334(SEQ ID NO: 2); and the target region was pp29025 and pp43916.
  • the probe and probe label were fp0004(SEQ ID NO: 12) and FAM, respectively.
  • probe target P. uenonis the probe and probe label were fp0009(SEQ ID NO: 17) and TAMRA, respectively.
  • FIG. 30 illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes enabling the determination of the relative abundance of each species. This figure shows 10-fold dilution series of P. uenonis.
  • FIG. 31 illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes enabling the determination of the relative abundance of each species. This figure shows 10-fold dilution series of P. somerae.
  • FIG. 32 illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes enabling the determination of the relative abundance of each species. This figure shows a constant amount of P. somerae and a 10-fold dilution series of P. uenonis templates.
  • FIG. 33 illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes enabling the determination of the relative abundance of each species.
  • This figure shows a constant amount of P. uenonis and a serial 10-fold dilution series of P. somerae templates.
  • FIG. 34 illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes enabling the determination of the relative abundance of each species.
  • This figure shows a constant amount of P. somerae and a 10-fold dilution series of P. uenonis templates along with a diverse OpenBiome microbial community background.
  • FIG. 35 illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes enabling the determination of the relative abundance of each species.
  • This figure shows a constant amount of P. uenonis and a serial 10-fold dilution series of P. somerae templates along with a diverse OpenBiome microbial community background.
  • Ct threshold cycle which is the intersection between an amplification curve and a threshold line.
  • Ct is a relative measure of the concentration of target in the PCR reaction.
  • PCR cycle PCR cycle number gDNA: genomic DNA dNTP: deoxyribonucleotide triphosphate
  • PCR polymerase chain reaction
  • qPCR quantitative PCR
  • Rn the fluorescence of the reporter dye divided by the fluorescence of a passive reference dye
  • This disclosure relates to systems, formulations and methods that may be used in determination of presence/absence, relative and/or absolute abundance of specific bacteria in a sample.
  • This disclosure relates to formulations that include species-specific unlabeled primers and species-specific fluorescent probes.
  • This disclosure further relates to formulations that may include reference primers, reference fluorescent probes, and/or reference materials, which may be used in determination of relative and/or absolute abundance of specific bacteria in a sample.
  • the disclosure relates to at least one pair of species-specific unlabeled primers (a forward primer and a reverse primer, or a "primer pair") for qPCR.
  • primer pairs may specifically amplify target regions found only in specific taxonomic groups of closely related bacteria.
  • taxon-specific primer pairs may be used to amplify and quantify the abundance of each target taxon within a variety of complex samples.
  • taxon-specific primer pairs may amplify groups of bacteria at various levels of taxonomic resolution (for example at genus, species, and/or strain level).
  • These taxon-specific primer pairs may be combined with fluorescent probes, such as TaqMan probes (sequence-specific oligonucleotides with covalently bound fluorescent dyes and quenchers), to provide new methods and additional applications for the characterization of microbiological samples.
  • fluorescent probes such as TaqMan probes (sequence-specific oligonucleotides with covalently bound fluorescent dyes and quenchers), to provide new methods and additional applications for the characterization of microbiological samples.
  • the primers and probes provided in the specification and Figures are non-limiting examples of primer and probes that can be used in the methods disclosed herein. Those primers and probes are shown in FIGs. 9 and 10, and in Table 1 below.
  • the (microbiological) sample may be a solid sample, a liquid sample, or a combination thereof.
  • the samples may be a soil sample, a fecal sample, a tissue sample, a bodily fluid sample, a saliva sample, or a combination thereof.
  • the method of determining presence/absence, relative abundance, and/or absolute abundance of specific bacteria in a microbiome sample may include obtaining the microbiome sample, preparing a qPCR by mixing the microbiome sample with a qPCR formulation, performing the qPCR, analyzing results, and thereby determining presence/absence, relative abundance, and/or absolute abundance of the specific bacteria in the microbiome sample.
  • the method of determining presence/absence, relative abundance, and/or absolute abundance of specific bacteria in a microbiome sample may include obtaining the microbiome sample that potentially includes at least one nucleic acid; processing the microbiome sample to have the at least one nucleic acid accessible to react with a specific primer pair; mixing the processed microbiome sample with a qPCR formulation to form a microbiome reaction mixture; subjecting the microbiome reaction mixture to a qPCR under which at least one section of the accessible nucleic acid can be amplified and produce a fluorescence signal; measuring amount of fluorescence signal produced; and identifying whether the specific bacteria are present in the microbiome sample, and/or, if the specific bacteria are present in the microbiome, determining relative abundance, and/or absolute abundance of the specific bacteria in the microbiome sample.
  • This disclosure further relates to a method of treatment of a patient, which may include obtaining a microbiome sample from the patient, wherein the microbiome sample potentially comprises at least one nucleic acid; processing the microbiome sample to have the at least one nucleic acid accessible to react with a specific primer pair designed specifically for identification of the specific bacteria present in the microbiome; mixing the processed microbiome sample with a qPCR formulation to form a microbiome reaction mixture; subjecting the microbiome reaction mixture to a qPCR under which at least one section of the accessible nucleic acid can be amplified and produce a fluorescence signal; measuring amount of fluorescence signal produced; identifying whether the specific bacteria are present in the microbiome sample, and/or, if the specific bacteria are present in the microbiome, determining relative abundance, and/or absolute abundance of the specific bacteria in the microbiome sample; forming a patient bacteria profile based on said identification; comparing the patient bacteria profile with a bacteria profile of a healthy patient; determining whether the patient has
  • the qPCR formulation may include at least one pair of species-specific unlabeled primers ("primer pair") for at least one taxon. Each primer pair may include a forward primer and a reverse primer.
  • the qPCR formulation may also include at least one DNA polymerase; and at least one species-specific fluorescent probe ("sub-taxon probe") for at least one member of the taxon.
  • the subtaxon probe may be a sequence-specific oligonucleotide with a covalently bound fluorescent dye and a covalently bound non-fluorescent quencher.
  • the fluorescent dye is hereafter called “sub-taxon fluorescent dye,” and wherein said non-fluorescent quencher is hereafter called “sub-taxon quencher.”
  • the method may further include having at least one primer pair designed to specifically amplify a genus; and having a sub-taxon probe designed to detect a species and/or a specific strain of the species.
  • the method may further include having at least one primer pair designed to specifically amplify a genus; and having a sub-taxon probe designed to detect a species through a sequence variation and/or a specific strain of the species.
  • the method may include at least one primer pair that does not target 16S rRNA.
  • the method may include a sub-taxon probe that does not target 16S rRNA.
  • one or more of the at least one primer pair and/or the sub-taxon probe are configured to target 16s rRNA.
  • the sub-taxon probe may exclude a 3’-hydroxyl group to ensure that the nucleic acid polymerase does not use this probe to initiate or extend nucleic acid synthesis, and prevent unintended amplification products.
  • the qPCR formulation may include at least two sub-taxon probes.
  • Each sub-taxon probe may have a different sub-taxon fluorescent dye than that of the other sub-taxon probes.
  • Each sub-taxon probe may have a sub-taxon quencher different than those of the other sub-taxon probes.
  • the qPCR formulation may include at least two sub-taxon probes. Each sub-taxon probe may have a different sub-taxon fluorescent dye than that of the other sub-taxon probes. The relative abundance of different sub-taxon variants may be determined by choosing a reference fluorescence intensity of one of the sub-taxon probe's fluorescent dye as a point-of-reference and comparing fluorescence intensities of other sub-taxon probes' fluorescent dyes with the reference fluorescence intensity. [00100] In this disclosure, the qPCR formulation may include at least two sets of the primer pairs. Each set of the primer pairs may be specific to a taxon. Each set of the primer pairs may be different than other sets of the primer pairs.
  • the qPCR formulation may include at least two fluorescent probes ("taxon-probe") specific to taxon.
  • Each taxon-probe may have a different fluorescent dye than that of the other taxon-probes.
  • the relative abundance of different taxa may be determined by choosing a reference fluorescence intensity of one of the taxon-probe's fluorescent dye as a point-of-reference and comparing fluorescence intensities of other taxon-probes' fluorescent dyes with the reference fluorescence intensity.
  • the qPCR formulation may include at least two fluorescent probes ("taxon-probe") specific to taxon.
  • Each taxon-probe may have a different fluorescent dye and a quencher than those of the other taxon-probes.
  • the relative abundance of different taxa may be determined by choosing a reference fluorescence intensity of one of the taxon-probe's fluorescent dye as a point-of- reference and comparing fluorescence intensities of other taxon-probes' fluorescent dyes with the reference fluorescence intensity.
  • the qPCR formulation may further include at least one pair of reference primers ("reference-primer pair”), and at least one reference fluorescent probe (“reference-probe”).
  • the reference-probe may be a sequencespecific oligonucleotide with a covalently bound fluorescent dye ("reference- fluorescent dye”) and a covalently bound non-fluorescent quencher (“referencequencher”).
  • the fluorescent dye may be a fluorophore different than other sub-taxon fluorescent dyes and/or taxon fluorescent dyes.
  • the qPCR formulation may further include at least one pair of reference primers ("reference-primer pair”), and at least one reference fluorescent probe (“reference-probe”).
  • the reference-probe may be a sequencespecific oligonucleotide with a covalently bound fluorescent dye ("reference- fluorescent dye”) and a covalently bound non-fluorescent quencher (“referencequencher”).
  • the reference-fluorescent dye may be a fluorophore different than the sub-taxon fluorescent dye(s) and/or taxon fluorescent dye(s).
  • the referencequencher may be a quencher different than other sub-taxon quenchers and/or taxon quenchers.
  • the qPCR formulation may further include at least one reference-material with known quantity, and a reference-probe.
  • the absolute abundance of each taxon may be determined by comparing fluorescence intensity of each taxon-probe with that of the reference-material.
  • the reference-material may include a predetermined amount of oligonucleotide.
  • the qPCR formulation may further include a fluorescent probe and a primer pair, which are specific for determination of total number of marker genes of bacteria present in the sample.
  • the method may further include determining total number of marker genes, using said total number of marker genes as a point-of-reference, and determining relative proportion of a taxa of interest within the total bacterial biomass of the sample.
  • the qPCR formulation may further include a referenceprobe specific for determination of total copy number of all bacterial 16S rRNA.
  • the method may further include determining the total copy number of all bacterial 16S rRNA, using said total copy number as a point-of-reference, and determining relative proportion of a taxa of interest within the total bacterial biomass of the sample.
  • the reference-material may include a predetermined amount of 16S rRNA genes.
  • the method further may further include extracting DNA after obtaining the microbiome sample.
  • the method may further include lysing cells after obtaining the microbiome sample.
  • the sub-taxon probe, the taxon-probe, and/or the reference-probe may have a minor groove binder to stabilize each probe's DNA binding stability.
  • the method may further include having a pre-determined threshold fluorescence intensity ("threshold-fluorescence intensity").
  • the fluorescence intensity below the threshold-fluorescence intensity may be indicative of absence of a specific target in the microbiome sample.
  • the fluorescence intensity above the threshold-fluorescence intensity may be indicative of presence of a specific target in the microbiome sample.
  • the qPCR formulation may further include a dNTP, a reaction buffer, or a combination thereof.
  • the method may be used to determine presence/absence, relative abundance, and/or absolute abundance of microbes at sub-taxon resolution, and wherein the sub-taxon resolution comprises resolution of genus, species, and/or strains of a microbial community.
  • the genus of the bacteria may have at least one subtaxon, or at least two sub-taxa.
  • the genus of the bacteria may have at least one subtaxon, or at least two sub-taxa.
  • the specific bacteria may be Porphyromonas.
  • the specific bacteria may belong to at least one species of the Porphyromonas genus.
  • the target bacteria may belong to Porphyromonas somerae, Porphyromonas uenonsis, Porphyromonas ashaccharolytica, or a combination thereof.
  • the qPCR formulation may include at least two specific primer pairs; wherein each specific primer pair may include a forward primer and a reverse primer; and wherein at least one first specific primer pair may be capable of amplifying a first species belonging a first sub-taxon of the target bacteria and at least one second specific primer pair may be capable of amplifying a second species belonging a second sub-taxon of the specific bacteria.
  • the qPCR formulation may include a primer pair; the primer pair may include a forward primer and a reverse primer; the primer pair may be selected from the primer pairs of FIGs. 9 or FIG.
  • the disease may include (chronic) oral infections, cancers, neurodegenerative diseases, or a combination thereof.
  • the disease may include colorectal cancer, endometrial cancer, gastric adenocarcinomas, and cervical cancer, P. aeruginosa pulmonary infections in cystic fibrosis, oral pathological process, or a combination thereof.
  • the disease may include an oral pathological process, wherein the oral pathological process comprises periodontitis, oral squamous cell carcinomas, or a combination thereof.
  • the disease may include colorectal cancer.
  • the microbiome sample may include stool, saliva, skin, nasal swab, vaginal swab, blood, urine, hair, or oral swab.
  • the patient may be a human or an animal.
  • the method may further include administering a therapeutic to the patient.
  • the therapeutic may not be chemotherapy and/or radiation.
  • This disclosure further relates to a diagnostic kit.
  • This diagnostic kit may include one or more primer pairs, and one or more sub-taxon probes of this disclosure.
  • This diagnostic kit may further include a reference standard.
  • This disclosure further relates to a nucleic acid, which may have at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to any one of the sequences of the primer pairs of FIG. 10, Primer IDs p0325 to pO326(SEQ ID NO: 5-6), p0333 to pO336(SEQ ID NO: 1-4), p0387 to pO387(SEQ ID NO: 7-8), or any combination thereof.
  • This disclosure further relates to a synthetic primer pair, which may include a synthetic forward primer and/or a synthetic reverse primer, each having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to any one of the synthetic forward primers and/or the synthetic reverse primers of the primer pairs FIGs. 10, Primer IDs p0325 (SEQ ID NO: 5), p0326 (SEQ ID NO: 6), p0333 to p0336 (SEQ ID NO: 1-4), pO387(SEQ ID NO: 7), pO388(SEQ ID NO: 8), or a combination thereof.
  • a synthetic forward primer and/or a synthetic reverse primer each having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to any one of the synthetic forward
  • Example 1 Detecting and quantifying sub-taxon level taxonomic resolution such as genus, species, and/or strain levels.
  • sub-taxon probe By integrating at least one species-specific fluorescent probe ("sub-taxon probe") into reactions with taxon-specific primers, one may use sequence variation within amplicon products to detect the presence of and quantify specific bacteria or groups of bacteria within microbial samples with greater taxonomic resolution using the following reaction components and method, schematically shown in FIG. 1 and FIG. 2.
  • Each polymerase chain reaction (PGR) reaction may rely upon of a pair of species-specific unlabeled primers, at least one species-specific fluorogenic (or detection) probe ("taxon probe"), and a nucleic acid polymerase with 5’-exonuclease activity (FIG.1.1 ).
  • An example of nucleic acid polymerase may be Taq DNA polymerase.
  • species-specific primers may be designed to amplify a specific region of nucleic acid with the help of nucleic acid polymerase during repeated thermal cycling steps.
  • a species-specific detection probe may be included in each reaction.
  • This detection probe may typically include a species-specific oligonucleotide with a fluorescent dye covalently attached to the 5’-end, a non-fluorescent quencher covalently linked to the 3’-end, and may further include a minor groove binder to stabilize probe: nucleic acid binding stability.
  • the fluorescent dyes may be fluorescein amidite (FAM), VIC, and TAMRA fluorescent dye.
  • FAM fluorescein amidite
  • VIC VIC
  • TAMRA fluorescent dye fluorescent dye.
  • Such detection probes may lack a 3’-hydroxyl group to ensure the nucleic acid polymerase does not use this probe to initiate or extend nucleic acid synthesis and prevent unintended amplification products.
  • the sample temperature may first be raised to denature template double-stranded nucleic acid (FIG. 1.2).
  • the non-fluorescent quencher on the 3-end may quench any signal of the fluorescent dye on the 5’-end because these compounds may remain in close proximity while attached to the same probe and since the energy from an excited fluorescent dye may get transferred to the quencher via fluorescence resonance energy transfer.
  • the reaction temperature may be lowered to allow the species-specific primers and the species-specific fluorescent probe(s) to anneal to their target sequences.
  • nucleic acid polymerase may be allowed to synthesize new, complementary strands of nucleic acid using the unlabeled primers and template (FIG. 1.3).
  • the polymerase may reach the detection probe, its endogenous 5’-exonuclease activity may cleave the probe and may permanently release the fluorescent dye from the quencher. Once released, the fluorescent dye may be excited and its signal intensity may be detected and used to monitor and quantify the PCR amplification products since the fluorescence intensity may be proportional to the amount of PCR product synthesized.
  • This formulation may include at least one primer pair for at least one taxon, at least one nucleic acid polymerase, and at least one sub-taxon-specific fluorescent probe ("sub-taxon probe") for at least one member of the taxon.
  • the sub-taxon probe may have complementarity to sequence variation within amplicons specifically associated with groups, species, or strains of bacteria of interest to enable their detection and quantification.
  • the primer pair may specifically amplify a taxon within the genus Porphyromonas and the sub-taxon probe may be used to detect sequence variation with the amplicon associated with Porphyromonas uenonis and/or a specific strain of Porphyromonas uenonis.
  • Subtaxon probes may bind sequences that may not be necessarily found only within the amplicon. Since the sub-taxon probe's oligonucleotide lacks 3’-hydroxyl group, even if the sub-taxon probe may bind elsewhere in the target genome or the genomes of non-target organisms within a complex sample, the sub-taxon probe may not yield a fluorescent signal. This may be because no upstream priming may allow a nucleic acid polymerase to release the fluorescent dye from the sub-taxon probe.
  • (c) Optionally, lyse cells and/or extract microbial nucleic acid, if necessary.
  • (d) Prepare qPCR reaction(s) using the formulation that includes the primer pair and the sub-taxon probe(s) at appropriate concentrations.
  • This formulation may further include other reaction components, for example, a nucleic acid polymerase, a deoxyribonucleotide triphosphate (dNTP), a reaction buffer, or a mixture thereof at appropriate concentrations.
  • dNTP deoxyribonucleotide triphosphate
  • fluorescence intensities from different reactions may be compared to determine relative abundance among samples. If a sample is being analyzed for different taxa and/or sub-taxa with distinct taxon and/or sub-taxon probes across distinct reactions may be compared to determine their relative abundancies within the sample. Quantification may be determined by comparing fluorescence intensities to reference standards using internal references/standards, external references/standards, or a combination thereof.
  • Example 2 Quantification of the abundance of specific species and/or strains present within a complex community.
  • Example 1 The method disclosed in Example 1 may be used to detect/quantify the abundance of specific species and/or strains present within a complex community.
  • the method that may be used in this example is schematically shown in FIG. 2.
  • a sub-taxon probe may be used targeting the SNP to determine the presence/absence, and/or abundance of the strain following administration to a patient. This method may be used to determine whether the target organisms is abundant enough for the intended clinical effect, or whether a single dose was enough to establish a long-term colonization within a patient.
  • Example 3 Multiple probes targeting different sequences within taxon-specific amplicons.
  • Multiple sub-taxon probes may be used to target different sequences within taxon-specific amplicons to detect/quantify the type and/or relative abundance of organisms with greater taxonomic resolution.
  • One application may be to "genotype" different sequence variants, such as different species, within amplicons from a specified target taxon (as schematically shown in FIG. 3).
  • Porphyromonas species such as P. asaccharolytica and P. uenonis (FIG. 4). These two closely related species fall within one clade of the Porphyromonas phylogenetic tree.
  • a single primer pair that may specifically target this taxon and specifically amplify both of these species of Porphyromonas, Forward Primer (p0387): 5' TGGAGGTAGTGAGTTCTTTAT 3' (SEQ ID NO: 7); and Reverse Primer (p0388): 5' ACCATCAGAGAGCCTG 3' (SEQ ID NO: 8) (Table 1 ).
  • Species-specific sub-taxon probes based on species-specific sequence variation within these amplicons was then targeted to enable species-specific detection.
  • species-specific sub-taxon probes include P. uenonis probe (fp0022): 5' ACAAGATGGGCGTACG 3' (SEQ ID NO: 21); and P. asaccharolytica probe (fp0023): 5’ ACAAGATGGGTGTACG 3’ (SEQ ID NO: 22), each labeled with distinct fluorescent markers (TAMRA and FAM, respectively).
  • TAMRA and FAM distinct fluorescent markers
  • SNP Single Nucleotide Polymorphism
  • each probe continued to yield comparable Ct values on the appropriate fluorescence channel(s) demonstrating the capacity to determine the genotype the species provided, the presence/absence of each species, and determine the relative abundance of each species within a single, multiplexed reaction.
  • FIG. 6 illustrates an exemplary method of this disclosure for determining the presence and/or relative-abundance of related bacterial species within a sample.
  • Multiple sub-taxon probes designed for sequence variation with taxonspecific amplicons offers a method of determining the presence/absence and/or relative abundance of different sub-taxon variants (FIG. 7).
  • this method may be used to quantify the relative abundance of a probiotic strain of bacteria administered as a therapeutic compared to other bacteria within the same taxon. Such method may aid in distinguishing whether the administered bacteria is present within a patient at sufficient levels at a given time, and/or might have displaced other bacteria from the same taxon within the patient.
  • This multi-probe approach may be used with many different labels to distinguish many different subgroups within a given taxon. Taxon-specific primers and sub-taxon probes may be developed to identify many or all species within that taxon so long as enough species-specific variation exists within the amplicon and enough fluorescent signals may be distinguished from one another. Example 4. Determining the relative abundance of two amplicons within a sample.
  • At least two formulations each including a different taxon-specific primer and a different sub-taxon probe may be introduced to the same reaction.
  • Each formulation is specific to a distinct amplicon/sequence of interest, each formulation may have a taxon-specific primer different than that of the other, and each formulation may have a sub-taxon probe different than that of the other.
  • This duplexed PGR reaction may provide direct, within-reaction measurements of relative abundance of two specific amplicons/sequences using the following method, schematically shown in FIGs. 7-8.
  • each formulation may include at least one primer pair for at least one taxon, at least one nucleic acid polymerase, and at least one species-specific fluorescent probe ("sub-taxon probe") for at least one member of the taxon.
  • Each formulation may be specific to a distinct amplicon/sequence of interest, each formulation may have a taxon-specific primer different than that of the other, and each formulation may have a sub-taxon probe different than that of the other.
  • Each sub-taxon probe may have complementarity to sequence variation within amplicons specifically associated with groups, species, or strains of bacteria of interest to enable their detection and quantification.
  • a first formulation including at least one taxon-specific primer pair and a sub-taxon probe may be used to specifically amplify Porphyromonas somerae and to detect sequence variation within the amplicon associated with Porphyromonas somerae and/or a specific strain of Porphyromonas somerae.
  • a second formulation including at least one taxon-specific primer pair and a sub-taxon probe may be used to specifically amplify the genus Porphyromonas uenonis and to detect sequence variation within the amplicon associated with Porphyromonas uenonis and/or a specific strain of Porphyromonas uenonis.
  • (c) Optionally, lyse cells and/or extract microbial nucleic acid, if necessary.
  • (d) Prepare qPCR reaction(s) using the two formulations each including the primer pair and the sub-taxon probe(s) at appropriate concentrations.
  • Each formulation may further include other reaction components, for example, a nucleic acid polymerase, a deoxyribonucleotide triphosphate (dNTP), a reaction buffer, or a mixture thereof at appropriate concentrations.
  • dNTP deoxyribonucleotide triphosphate
  • Fluorescence intensities attributable to each sub-taxon probe may be compared to determine the relative abundance of each targeted sequence within each amplicon from the sample directly within each reaction. If a microbiome sample is being analyzed for different taxa and/or sub-taxa with distinct taxon and/or subtaxon probes across distinct reactions, relative abundancies may be compared and/or normalized across reactions when the same formulation including a taxonspecific primer pair and a sub-taxon probe set is included in multiple reactions as a reference formulation.
  • Quantification may also be carried out by comparing fluorescence intensities from a sub-taxon probe aimed for a target organism to a reference fluorescence intensity formed by using a reference formulation.
  • the reference formulation may be an internal formulation, an external formulation, or a combination thereof. This reference formulation may be a standard formulation used in this industry.
  • a first formulation targeting a specific genus/species may be included in multiple reactions where a second formulation may target another genus/species. Resulting fluorescence intensities from these two formulations may then be compared to quantify, normalize, or standardize across reactions.
  • a known reference material may be included in the microbiome sample and/or multiple reactions.
  • a first formulation (“reference formulation") may target the reference material and a second formulation may target a genus/species of interest.
  • one formulation including a species-specific primer pair may be used to specifically amplify Porphyromonas somerae and another primer pair may be used to specifically amplify Porphyromonas uenonis.
  • Fluorescent probes with distinct fluorophores may be used to target species-specific sequence variation within each amplicon.
  • Both primer/probe sets, each targeting a distinct taxon/sub-taxon, respectively, may then be included within a single reaction. At the end of the reaction, the signal intensities attributable to each amplicon/sequence reflecting each taxon/sub-taxon may directly be compared, thereby enabling the determination of within-reaction relative abundance.
  • Such methods of this disclosure may be used to compare the relative abundance of two clinically-relevant bacterial taxa (for example, genus, species, and/or strains) within a patient's microbiome.
  • clinically-relevant bacterial taxa for example, genus, species, and/or strains
  • Such within-reaction relative abundance measurement methods of this disclosure may eliminate the need for external standard dilution series and/or reference reactions. This may significantly reduce the number of reactions required to quantify the abundance of an amplicon/sequence within a sample. Reducing the number of required reactions may likely reduce assay costs, enable a greater number of within-plate comparisons, and/or increase capacity/sample throughput when many samples are being processed.
  • Example 5 Determining the absolute abundance of an amplicon/sequence within a sample.
  • This example discloses a method for determination of the absolute abundance of any and/or all bacteria within the sample by integrating a reference formulation including a primer/probe set within a given reaction and directly comparing the abundance of a target amplicon/sequence to the abundance of an established reference material or standard material.
  • At least two formulations each including a distinct primer/probe set may be introduced into the same reaction.
  • One formulation may be specific to the amplicon/sequence of interest and the other formulation may be specific to the reference amplicon/sequence.
  • the fluorescence intensity of the amplicon/sequence of interest may directly be compared to the fluorescence intensity of the reference amplicon/sequence, thereby enabling the determination of within-reaction relative abundance, as described in the following method and illustrated in FIG.8.
  • (a) Prepare at least one sample-formulation including a taxon-specific primer pair and a sub-taxon probe to amplify target sequences within distinct bacterial taxa of interest.
  • the sub-taxon probe may have complementarity to sequence variation within amplicons specifically associated with groups, species, or strains of bacteria of interest to enable their detection and quantification.
  • a reference-sequence may be (i) a sequence within the microbiome sample (such as 16S rRNA gene sequences), (ii) a sequence introduced to the microbiome sample (such as one or more reference oligonucleotide(s) or strain(s) of known abundance), (iii) a sequence introduced directly into each reaction (such as a reference oligonucleotide or strain with known abundance), (iv) a combination thereof.
  • a reference-probe may target a specific sequence within the reference amplicon not found in the taxon-specific amplicon.
  • each of these formulations may further include other reaction components, for example, a nucleic acid polymerase, a deoxyribonucleotide triphosphate (dNTP), a reaction buffer, or a mixture thereof at appropriate concentrations.
  • dNTP deoxyribonucleotide triphosphate
  • the fluorescence intensities attributable to sub-taxon probe may then be compared to that of the reference-probe to determine the relative abundance of each targeted sequence within each amplicon from the sample directly within each reaction.
  • comparison of the fluorescence intensity of the referenceprobe to the fluorescence intensity of the taxon-specific probe may be used to calculate the absolute abundance of the targeted taxon within the sample and/or reaction.
  • Quantification, normalization, and/or standardization may be achieved by comparing fluorescence intensities of target taxa to those of reference standards.
  • the reference standards may be internal or external references/standards.
  • a known reference material spike-in
  • a reference-formulation including a reference primer pair and a reference probe targeting the reference material may enable quantification, normalization, and or standardization within or across reactions.
  • Within-reaction relative abundance measurements may eliminate the need for external calibration, references, and/or standard dilution series. This may significantly reduce the number of reactions required to quantify the abundance of an amplicon/sequence within a sample.
  • a first set of primer pairs may specifically amplify a taxon within the genus Porphyromonas and a first sub-taxon probe may be used to detect sequence variation within the amplicon associated with Porphyromonas uenonis and/or a specific strain of Porphyromonas uenonis.
  • a reference primer pair may specifically amplify a 16S rRNA gene region, and a reference-probe may target sequence(s) therein, which might be conserved across bacterial taxa.
  • a reference primer pair and a reference-probe may target a reference sequence either within a microbiome sample or introduced to either the microbiome sample or reactions (such as a known oligonucleotide).
  • sample and reference specific formulations thereby enable the detection, quantification, and comparison of each amplicon/sequence respectively.
  • the absolute abundance of P. uenonis may be used as a standard (or reference) to calibrate the absolute abundancies of other taxa within compositional datasets obtained from NGS sequencing of the same microbiome sample.
  • a biologically relevant or known amount of the reference material is present within the microbiome sample and/or a given reaction, its relative abundance compared to an unknown target (such as a bacterial taxon, genus, species, strain etc.) may be used to determine the absolute abundance of the amplicon/sequence of interest.
  • an unknown target such as a bacterial taxon, genus, species, strain etc.
  • One example of a reference with biological relevance may be an amplicon/sequence targeting 16S rRNA genes, which are thought to be present in all bacteria.
  • the total copy number of all bacterial 16S rRNA may provide a useful biological reference.
  • a duplex reaction with reference-probes quantifying all 16S rRNA may allow one to determine the relative proportion of a taxon of interest within the total bacterial biomass of the sample.
  • 16S rRNA genes as a reference may be applicable for some bacteria. For example, if 16S rRNA gene copy number does not vary widely among such bacteria, 16S rRNA genes may be used as a reference for quantification purposes.
  • 16S rRNA gene copy number may vary widely among some bacteria, another method may be used. Accordingly, a reference-target for total bacterial biomass within a complex microbial community may need to have three adjacent stretches (within an appropriately sized amplicon) of perfectly conserved sequences present in all bacteria (or all bacterial within the microbiome sample) with a known copy number. Alternatively, one may also target specific subsets of organism with biological relevance using marker genes with conserved sequences suitable for primers/probes. Examples of such marker genes are disclosed in a publication to Lan, Y., Rosen, G. & Hershberg, R.
  • Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains," Microbiome 4, 18 (2016); https://doi.org/10.1186/s40168- 016-0162-5. The entire contents of this publication, including its supplemental content, are incorporated herein by reference. These marker gene sites may be used for priming and probe sites that may provide a within-reaction reference to know the exact abundance of another target amplicon relative to the total number of all bacteria present, or subsets of bacteria, within the sample.
  • Another example for an internal reference comparison may be introducing a known reference template (such as a known oligonucleotide or amplicon) at a defined copy number within a given microbiome sample or reaction.
  • a known reference template such as a known oligonucleotide or amplicon
  • one of the primer/probe sets specifically may target the template with a known absolute abundance, and then may compare the probe fluorescence intensity to that of the other primer/probe set for a given taxon/sequence.
  • the absolute abundance of Porphyromonas uenonis within a complex microbiome sample may be determined.
  • the sample may be spiked-in with 100 copies of a reference oligonucleotide along with reference-primer/probe set specific for the reference oligonucleotide. If both the reference and Porphyromonas t/enon/s-specific probes may yield substantially same proportional increase in their respective fluorescence signal intensity (assuming identical amplification efficiencies), then it may be determined that there may also be 100 copies of the Porphyromonas uenonis amplicon (and therefore 100 Porphyromonas uenonis bacteria) within the original complex microbiome sample.
  • one potential application of this approach may be to pair this method with samples used for further Next-Generation Sequencing analysis. If the above-described method may be used to quantify the absolute abundance of a well- defined taxon or taxa within a complex community, this abundance measurement may subsequently be used with the relative abundance data obtained via Next- Generation Sequencing to calibrate and thereby calculate the absolute abundance of all other sequences within the complex sample.
  • relative abundances of all the bacterial species present within a complex microbiome sample may be achieved by sequencing an aliquot of the same sample.
  • all the Porphyromonas uenonis sequences present in the NGS dataset may be determined to originate from 100 bacteria. Accordingly, a user may calibrate and compare the relative abundance the Porphyromonas uenonis sequences to those of non- Porphyromonas uenonis sequences to calculate their abundances in the original complex sample.
  • Taxon-specific primer pairs and sub-taxon specific fluorescent probes specific for sequence variations among organisms within each group may enable the characterization of microbial communities at greater taxonomic resolution using qPCR-based technologies.
  • Single primer/probe sets may provide methods for detecting and quantifying microbes at sub-taxon level resolution (such as genus, species, and/or strains) within complex microbial communities. Furthermore, adding an additional fluorescent probe designed to distinguish sequence variation within amplicons from the taxon-specific probes may offer a method for determining the relative abundance of related organisms within a single reaction.
  • reactions containing two or more sets of primers/probes may offer a novel method for comparing the relative abundance of distinct groups or organisms within complex samples.
  • This second set of primers/probes may also be designed to target a reference sequence of known abundance, thereby enabling a direct, within-reaction comparison and absolute quantification of a target organism within a complex microbial community. Paired with Next-Generation Sequencing applications, such methods may offer a novel approach for calibrating compositional datasets to determine the absolute quantification of all organisms sequenced.
  • Fluorescent probes may be designed in the region amplified by a set of primers. These fluorescent probes may provide enhanced accuracy and specificity to the detection threshold for target nucleic acid regions. The following method may be applied to a target amplified region (50-150bp in length) to identify suitable probe locations. The fluorescent probes that meet the following criteria may be used. a) 13-25bp in length. b) Melt temperature 5-7°C above primer melt temperature. c) G+C% content of 30-80%. d) Preferential placement of the probes in close proximity to the primers. e) Specific placement of nucleotides and their relationship to the 3' minor groove binding moiety. f) No guanine in the 5' position.
  • the SNP site may be preferentially placed in the middle third of the fluorescent probe, with a possible alternative position in the last third of the fluorescent probe, excluding the last two base pairs.
  • the fluorescent probes used to detect SNPs may have less than/equal to 1 °C difference in melt temperature.
  • Example 7 Detecting and quantifying bacterial taxa using fluorescent probes.
  • Integrating one or more sequence-specific fluorescent probe(s) into reactions with one or more taxon-specific primers sets may increase signal specificity during real-time quantitative PGR reactions and enable additional applications for the characterization of microbiological samples.
  • a single species-specific primer set was designed to target a conserved region within all known Porphyromonas uenonis genomes (FIGs. 9-14, primer set p0325/p0326 (SEQ ID NO: 5-6)targeting region pp29025).
  • primer set p0325/p0326 SEQ ID NO: 5-6targeting region pp29025.
  • two conserved probe tagetes were identified within the anticipated amplicon, and fluorescent probes labeled with either 5' 6-FAM or 5' TAMRA were created for each (FIGs. 9-14, fp0009-fp0012 (SEQ ID NO: 17-20).
  • each species-specific primer set yielded a correctly- sized PCR product only when genomic DNA of the targeted species was present as a template within the reaction (FIG. 15).
  • genomic DNA of the targeted species was present as a template within the reaction (FIG. 15).
  • faint bands were observed in reactions where the complex stool-derived communities were provided as a template.
  • all of these unintended products were smaller than intended amplicon sizes and likely reflected smaller primer-dimers or spurious products produced in the presence of complex templates.
  • each P. somerae-specific FAM- labelled probe was also purposefully paired with the incorrect P. somerae-specific primer set (expected to produce a non-targeted amplicon).
  • the intended species-specific amplicon was observed on the agarose gel (FIG. 17).
  • the fluorescent probes without sufficient homology to sequences within an amplicon resulted in no fluorescent dye being liberated from the probe.
  • the Ct values observed for each target species were consistent regardless of the amplicon produced by the distinct species-specific primers. They were also consistent regardless of which region within the amplicon was targeted with the fluorogenic species-specific probe. In no instance was any substantial crossreactivity observed when the target species was not present. This held true when a closely related strain within the same Porphyromonas genus was present, as well as when complex and diverse human stool-derived communities were present within the OpenBiome templates. Furthermore, when targeted species were not directly introduced in a reaction there was no background fluorescence detected, as indicated by the absence of Ct values in reactions where the targeted species was not introduced to the reaction.
  • Example 8 Sensitivity of fluorescent probe-based detection.
  • Example 9 Detecting and quantifying bacterial taxa using additional fluorescent probes.
  • each TAMRA-labeled probe was assessed in reactions with appropriately paired primer sets and purified genomic DNA from their intended target species as a template (FIG. 23). Simultaneously each primer set was also assessed on the same templates using the same target species for template gDNA using previously assessed FAM-based fluorescent probes to enable the direct comparison of each fluorescent signal within the same reaction plate. [00209] Reaction end products were run on an agarose gel, and the expected amplicon products were observed in nearly all reactions except for one primer pair in the presence of a TAMRA-labeled probe (p0335/p0336 (SEQ ID NO: 3 and 4), fp0008 (SEQ ID NO: 16)) (FIG. 23).
  • sequence-specific probes labeled with different fluorescent markers may be used to detect and quantify bacteria present within a reaction and that similar quantification values were obtained regardless of the fluorescent molecule used in the probe.
  • Example 10 Multiplex reactions quantifying a single species with two speciesspecific fluorescent probes.
  • reaction end products run on agarose gels revealed each multiplex reaction successfully produced two distinct PCR products of the appropriate size (112bp and 132bp), as expected from each set of species-specific primers (FIG. 24).
  • every reaction containing template P. somerae gDNA yielded both FAM- and TAMRA-specific emissions indicating the presence of both amplicons was detected with each amplicon-specific fluorescent probe.
  • the Ct values obtained from both FAM and TAMRA fluorescent signals were very similar in value, as expected with target regions that are each present only once within the P. somerae genome and therefore present in the same copy number at the beginning of each reaction.
  • Example 11 Multiplex reactions quantifying two different species within the same well using differentially labeled species-specific fluorescent probes.
  • somerae gDNA only P. uenonis gDN A, or both P. somerae and P. uenonis gDNA.
  • Reaction end products analyzed with agarose gel electrophoresis confirmed that within each reaction species-specific amplicons of the correct size were only produced in reaction where the appropriate template strain gDNA was present. This result confirmed that each species-specific primer set could be multiplexed with one another without the formation of spurious, unintended products on these closely related template genomes.
  • reaction Ct values revealed speciesspecific fluorescent signal, which could be used to both i) identify the presence of, and ii) quantify the abundance of each species present in each multiplex reaction.
  • very similar Ct values were observed for the abundance of each species regardless of which color fluorescent probe was used, which species-specific region was targeted with the probe, and regardless of which amplicon was targeted in P. somerae.
  • each species-specific primer/probe combination could be used to quantify the abundance of each species present within the same reaction
  • the fluorescent intensity of each probe could be used to directly determine the relative abundance of two different species within the same reaction. Accordingly, we constructed a series of multiplex reactions containing primers and probes specific for both P. somerae and P. asaccharolytica within the same well, then assessed them against their intended targets alone, combined, and within a diverse background community at varying relative abundance (FIGs. 28-29). Primers specific for P.
  • somerae (p0325 and p0326 (SEQ ID NO: 5 and 6) were paired with either a FAM- labeled (fp0003 (SEQ ID NO: 11) or TAMRA-labeled (fp0004 (SEQ ID NO: 12) P. somerae probe.
  • primers specific for P. uenonis (p0333 and p0334 (SEQ ID NO: 1 and 2) were also included along with either a TAMRA- labeled (fpOO1O (SEQ ID NO: 18)) or FAM-labeled (fp0009) (SEQ ID NO: 17) P. asaccharolytica probe, respectively. In this manner, reactions were capable of quantifying both P.
  • Relational terms such as “first” and “second” and the like may be used solely to distinguish one entity or action from another, without necessarily requiring or implying any actual relationship or order between them.
  • the terms “comprises,” “comprising,” and any other variation thereof when used in connection with a list of elements in the specification or claims are intended to indicate that the list is not exclusive and that other elements may be included.
  • an element preceded by an “a” or an “an” does not, without further constraints, preclude the existence of additional elements of the identical type.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Analytical Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

This disclosure relates to systems, formulations and methods that may be used in determination of presence/absence, relative and/or absolute abundance of specific bacteria in a sample. This disclosure relates to formulations that include species-specific unlabeled primers and species-specific fluorescent probes. This disclosure further relates to formulations that may include reference primers, reference fluorescent probes, and/or reference materials, which may be used in determination of relative and/or absolute abundance of specific bacteria in a sample.

Description

SYSTEMS, FORMULATIONS AND METHODS FOR MICROBIAL DETECTION AND QUANTIFICATION
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims priority to U.S. Provisional Patent Application, 63/264,499, filed November 23, 2021 , the entire contents of which is incorporated by reference herein.
INCORPORATION BY REFERENCE OF MATERIAL IN SEQUENCE LISTING FILE
[0002] This application incorporates by reference the material in the Sequence Listing contained in the following XML file being submitted concurrently herewith: File name: AMISC.019WO - ST.26 Sequence Listing. xml, created on November 18, 2022 and is 12,630 bytes in size.
TECHNICAL FIELD
[0003] This disclosure relates to systems, formulations and methods that may be used in determination of presence/absence, relative and/or absolute abundance of specific bacteria in a sample. This disclosure relates to formulations that include taxonspecific unlabeled primers and taxon-specific fluorescent probes. This disclosure further relates to formulations that may include reference primers, reference fluorescent probes, and/or reference materials, which may be used in determination of relative and/or absolute abundance of specific bacteria in a sample.
DESCRIPTION OF RELATED ART
[0004] Taxon-specific fluorescent probes may be used to increase specificity during real-time quantitative polymerase chain reaction (qPCR) reactions. Taxonspecific primers and one or more such taxon-specific fluorescent probes respectively may amplify and quantify specific PGR products and/or specific alleles. An example of such taxon-specific fluorescent probes may be those used in TaqMan® (Applied Biosystems, Foster City, CA) assays targeting specific bacterial species.
[0005] Currently, taxon-specific fluorescent probes such as TaqMan® are marketed, by Thermo Fisher Scientific, for gene expression assays, genotyping, copy number variation, microRNA analysis, mutation detection, non-coding RNA assays, and protein quantification assays.
RELATED ART REFERENCES
[0006] The following publications are related art for the background of this disclosure. One digit or two-digit numbers in the box brackets before each reference, correspond to the numbers in the box brackets used in the other parts of this disclosure.
[1 ] Isaksen, Morten, "Microorganism Detection Methods," PCT Publication No. WO 2018/185015, Publication Date: October 11 , 2018.
[2] Ott SJ, Musfeldt M, Ullmann U, Hampe J, Schreiber S. "Quantification of intestinal bacterial populations by real-time PCR with a universal primer set and minor groove binder probes: a global approach to the enteric flora," J Clin Microbiol. 2004 Jun;42(6):2566-72. doi: 10.1128/JCM.42.6.2566- 2572.2004. PMID: 15184435; PMCID: PMC427818.
[3] Nadine J. DeCoste, Vijay J. Gadkar, Martin Filion, "Relative and Absolute Quantitative Real-Time PCR-Based Quantifications of hcnC and phlD Gene Transcripts in Natural Soil Spiked with Pseudomonas sp. Strain LBUM300,” Applied and Environmental Microbiology Dec 2010, 77 (1 ) 41 -47; DOI:
10.1128/AEM.01387-10.
[4] Sujatha Srinivasan, Noah G. Hoffman, Martin T. Morgan, Frederick A. Matsen, Tina L. Fiedler, Robert W. Hall, Frederick J. Ross, Connor O. McCoy, Roger Bumgarner, Jeanne M. Marrazzo, David N. Fredricks "Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria," PLoS ONE, June 2012, Volume 7, Issue 6, e37818.
[5] Fajardo, Thor Vinicius Martins, Vanni, Marcos Fernando, & Nickel, Osmar. (2017), “Absolute quantification of viruses by TaqMan real-time RT-PCR in grapevines,” Ciencia Rural, 47(6), e20161063. Epub May 04,
2017. https://dx.doi.Org/10.1590/0103-8478cr20161063.
[6] Zhang C, Zheng X, Zhao C, et al. "Detection of pathogenic microorganisms from bloodstream infection specimens using TaqMan array card technology," Sci Rep. 2018;8(1 ):12828. Published 2018 Aug 27. doi : 10.1038/S41598-018-31200-3.
[7] Ayaka Yazawa, Shigeki Kamitani, Naoyuki Togawa, "Method for absolute quantification of microbial communities by using both microarrays and competitive PCR," Journal of Microbiological Methods, Volume 165, 2019, 105718, ISSN 0167-7012, https://doi.Org/10.1016/j.mimet.2019.105718.
[8] Florencia Tettamanti Boshier, Sujatha Srinivasan, Anthony Lopez, Noah G. Hoffman, Sean ProIl, David N. Fredricks, Joshua T. Schiffer, "Complementing 16S rRNA gene amplicon sequencing with estimates of total bacterial load to infer absolute species concentrations in the vaginal microbiome," American Society for Microbiology, March/April 2020 Volume 5 Issue 2, page 1. bioRxiv 598771 ; doi: https://doi.org/10.1101/598771.
[9] Applied Biosystems, "TaqMan® Pathogen Detection Kits," White Paper, 2008.
[10] Ley, R., Turnbaugh, P., Klein, S. et al. "Human gut microbes associated with obesity," Nature 444, 1022-1023 (2006), https://doi.Org/10.1038/4441022a.
[1 1] Ruth E. Ley, Fredrik Backhed, Peter Turnbaugh, Catherine A. Lozupone, Robin D. Knight, and Jeffrey I. Gordon, "Obesity alters gut microbial ecology," PNAS August 2, 2005 102 (31 ) 1 1070-11075; https://doi.Org/10.1073/pnas.0504978102.
[12] Lan, Y., Rosen, G. & Hershberg, R. "Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains," Microbiome 4, 18 (2016); https://doi.Org/10.1 186/S40168-016-0162-5.
[0007] The entire contents of each of the above references, including its supplemental content, if available, are incorporated herein by reference.
SUMMARY
[0008] This disclosure relates to systems, formulations and methods that may be used in determination of presence/absence, relative and/or absolute abundance of specific bacteria in a sample. This disclosure particularly relates to formulations that include taxon-specific unlabeled primers and taxon-specific fluorescent probes. This disclosure also relates to species-specific unlabeled primers and species-specific fluorescent probes. This disclosure further relates to formulations that may include reference primers, reference fluorescent probes, and/or reference materials, which may be used in determination of relative and/or absolute abundance of specific bacteria in a sample.
[0009] In this disclosure, the method of determining presence/absence, relative abundance, and/or absolute abundance of specific bacteria in a microbiome sample may include obtaining the microbiome sample, preparing a qPCR by mixing the microbiome sample with a qPCR formulation, performing the qPCR, analyzing results, and thereby determining presence/absence, relative abundance, and/or absolute abundance of the specific bacteria in the microbiome sample.
[0010] In this disclosure, the method of determining presence/absence, relative abundance, and/or absolute abundance of specific bacteria in a microbiome sample may include obtaining the microbiome sample that potentially includes at least one nucleic acid; processing the microbiome sample to have the at least one nucleic acid accessible to react with a specific primer pair; mixing the processed microbiome sample with a qPCR formulation to form a microbiome reaction mixture; subjecting the microbiome reaction mixture to a qPCR under which at least one section of the accessible nucleic acid can be amplified and produce a fluorescence signal; measuring amount of fluorescence signal produced; and identifying whether the specific bacteria are present in the microbiome sample, and/or, if the specific bacteria are present in the microbiome, determining relative abundance, and/or absolute abundance of the specific bacteria in the microbiome sample.
[0011] This disclosure further relates to a method of treatment of a patient, which may include obtaining a microbiome sample from the patient, wherein the microbiome sample potentially comprises at least one nucleic acid; processing the microbiome sample to have the at least one nucleic acid accessible to react with a specific primer pair designed specifically for identification of the specific bacteria present in the microbiome; mixing the processed microbiome sample with a qPCR formulation to form a microbiome reaction mixture; subjecting the microbiome reaction mixture to a qPCR under which at least one section of the accessible nucleic acid can be amplified and produce a fluorescence signal; measuring amount of fluorescence signal produced; identifying whether the specific bacteria are present in the microbiome sample, and/or, if the specific bacteria are present in the microbiome, determining relative abundance, and/or absolute abundance of the specific bacteria in the microbiome sample; forming a patient bacteria profile based on said identification; comparing the patient bacteria profile with a bacteria profile of a healthy patient; determining whether the patient has a disease, or determining progression of a disease of the patient; and treating the patient if the patient has a disease.
[0012] In this disclosure, the qPCR formulation may include at least one pair of taxon-specific unlabeled primers ("primer pair"). Each primer pair may include a forward primer and a reverse primer. The qPCR formulation may also include at least one DNA polymerase; and at least one taxon-specific fluorescent probe (“taxonspecific probe”) targeting all members of the taxon and/or at least one sub-taxonspecific fluorescent probe ("sub-taxon probe") for at least one member of the taxon. The taxon-specific probe and/or sub-taxon probe may be a sequence-specific oligonucleotide with a covalently bound fluorescent dye and a covalently bound non- fluorescent quencher. The fluorescent dye is hereafter called "sub-taxon fluorescent dye," and wherein said non-fluorescent quencher is hereafter called "sub-taxon quencher."
[0013] In this disclosure, the method may further include having at least one taxon-specific primer pair designed to specifically amplify a genus and/or a specific clade; and having a sub-taxon probe designed to detect a species and/or a specific strain of a species within the genus and/or a specific clade.
[0014] In this disclosure, the method may further include having at least one primer pair designed to specifically amplify a genus and/or a specific clade; and having a sub-taxa probe designed to detect a species through a sequence variation and/or a specific strain of the species.
[0015] In this disclosure, the sub-taxon probe may exclude a 3’-hydroxyl group to ensure that the nucleic acid polymerase does not use this probe to initiate or extend nucleic acid synthesis, and prevent unintended amplification products.
[0016] In this disclosure, the qPCR formulation may include at least two sub-taxon probes. Each sub-taxon probe may have a different sub-taxon fluorescent dye than that of the other sub-taxon probes. Each sub-taxon probe may have a sub-taxon quencher different than those of the other sub-taxon probes.
[0017] In this disclosure, the qPCR formulation may include at least two sub-taxon probes. Each sub-taxon probe may have a different sub-taxon fluorescent dye than that of the other sub-taxon probes. The relative abundance of different sub-taxon variants may be determined by choosing a reference fluorescence intensity of one of the sub-taxon probe's fluorescent dye as a point-of-reference and comparing fluorescence intensities of other sub-taxon probes' fluorescent dyes with the reference fluorescence intensity.
[0018] In this disclosure, the qPCR formulation may include at least two sets of the primer pairs. Each set of the primer pairs may be specific to a taxon. Each set of the primer pairs may be different than other sets of the primer pairs.
[0019] In this disclosure, the qPCR formulation may include at least two fluorescent probes ("taxon-probes"), wherein each taxon probe is specific to a distinct taxon. Each taxon-probe may have a different fluorescent dye than that of the other taxon-probes. The relative abundance of different taxa may be determined by choosing a fluorescence intensity ("reference fluorescence intensity") of one of the taxon-probe's fluorescent dye as a point-of-reference and comparing fluorescence intensities of other taxon-probes' fluorescent dyes with the reference fluorescence intensity.
[0020] In this disclosure, the qPCR formulation may include at least two fluorescent probes ("taxon-probes"), wherein each taxon probe is specific to a distinct taxon. Each taxon-probe may have a different fluorescent dye and a quencher than those of the other taxon-probes. The relative abundance of different taxa may be determined by choosing a reference fluorescence intensity of one of the taxonprobe's fluorescent dye as a point-of-reference and comparing fluorescence intensities of other taxon-probes' fluorescent dyes with the reference fluorescence intensity.
[0021] In this disclosure, the qPCR formulation may further include at least one pair of reference primers ("reference-primer pair"), and at least one reference fluorescent probe ("reference-probe"). The reference-probe may be a sequencespecific oligonucleotide with a covalently bound fluorescent dye ("reference- fluorescent dye") and a covalently bound non-fluorescent quencher ("referencequencher"). The fluorescent dye may be a fluorophore different than other sub-taxon fluorescent dyes and/or taxon fluorescent dyes. [0022] In this disclosure, the qPCR formulation may further include at least one pair of reference primers ("reference-primer pair"), and at least one reference fluorescent probe ("reference-probe"). The reference-probe may be a sequencespecific oligonucleotide with a covalently bound fluorescent dye ("reference- fluorescent dye") and a covalently bound non-fluorescent quencher ("referencequencher"). The reference-fluorescent dye may be a fluorophore different than the sub-taxon fluorescent dye(s) and/or taxon fluorescent dye(s). The referencequencher may be a quencher different than other sub-taxon quenchers and/or taxon quenchers.
[0023] In this disclosure, the qPCR formulation may further include at least one reference-material with known quantity, and a reference-probe. The absolute abundance of each taxon within a sample may be determined by comparing fluorescence intensity of each taxon-probe with that of the reference-material.
[0024] In this disclosure, the reference-material may include a predetermined amount of oligonucleotide.
[0025] In this disclosure, the qPCR formulation may further include a fluorescent probe and a primer pair, which are specific for determination of total number of marker genes of bacteria present in the sample. The method may further include determining total number of marker genes, using said total number of marker genes as a point-of-reference, and determining relative proportion of a taxon of interest within the total bacterial biomass of the sample.
[0026] In this disclosure, the qPCR formulation may further include a referenceprobe specific for determination of total copy number of all bacterial 16S rRNA. The method may further include determining the total copy number of all bacterial 16S rRNA, using said total copy number as a point-of-reference, and determining relative proportion of a taxon of interest within the total bacterial biomass of the sample.
[0027] In this disclosure, the reference-material may include a predetermined amount of 16S rRNA genes. [0028] In this disclosure, the method further may further include extracting DNA after obtaining the microbiome sample.
[0029] In this disclosure, the method may further include lysing cells after obtaining the microbiome sample.
[0030] In this disclosure, the sub-taxon probe, the taxon-probe, and/or the reference-probe may have a minor groove binder to stabilize each probe's DNA binding stability.
[0031] In this disclosure, the method may further include having a pre-determined threshold fluorescence intensity ("threshold-fluorescence intensity"). The fluorescence intensity below the threshold-fluorescence intensity may be indicative of absence of a specific target in the microbiome sample. Or, the fluorescence intensity above the threshold-fluorescence intensity may be indicative of presence of a specific target in the microbiome sample.
[0032] In this disclosure, the qPCR formulation may further include a dNTP, a reaction buffer, or a combination thereof.
[0033] In this disclosure, the method may be used to determine presence/absence, relative abundance, and/or absolute abundance of microbes at sub-taxon resolution, and wherein the sub-taxon resolution comprises resolution of genus, species, and/or strains of a microbial community.
[0034] In this disclosure, the genus of the bacteria may have at least one subtaxon, or at least two sub-taxa. The genus of the bacteria may have at least one subtaxon, or at least two sub-taxa.
[0035] In this disclosure, the specific bacteria may be Porphyromonas. The specific bacteria may belong to at least one species of the Porphyromonas genus. The target bacteria may belong to Porphyromonas somerae, Porphyromonas uenonsis, Porphyromonas asaccharolytica, or a combination thereof.
[0036] In this disclosure, the qPCR formulation may include at least two specific primer pairs; wherein each specific primer pair may include a forward primer and a reverse primer; and wherein at least one first specific primer pair may be capable of amplifying a first species belonging a first sub-taxon of the target bacteria and at least one second specific primer pair may be capable of amplifying a second species belonging a second sub-taxon of the specific bacteria.
[0037] In this disclosure, the qPCR formulation may include a primer pair; the primer pair may include a forward primer and a reverse primer; the primer pair may be selected from the primer pairs of FIGs. 9 or FIG. 10, Primer IDs p0325 (SEQ ID NO: 5), p0326 (SEQ ID NO: 6) , p0333 to p0336 (SEQ ID NO: 1-4), p0387 (SEQ ID NO: 7); , p0388 (SEQ ID NO: 8), or a combination thereof; and the sub-taxon probe may be selected from the species-specific fluorescent probes of FIG. 10, Probe IDs fpOOOl to fp0012 (SEQ ID NO: 9-20), fp0022 (SEQ ID NO: 21), fp0023 (SEQ ID NO: 22), or a combination thereof.
[0038] In this disclosure, the disease may include (chronic) oral infections, cancers, neurodegenerative diseases, or a combination thereof. The disease may include colorectal cancer, endometrial cancer, gastric adenocarcinomas, and cervical cancer, P. aeruginosa pulmonary infections in cystic fibrosis, oral pathological process, or a combination thereof. The disease may include an oral pathological process, wherein the oral pathological process comprises periodontitis, oral squamous cell carcinomas, or a combination thereof. The disease may include colorectal cancer.
[0039] In this disclosure, the microbiome sample may include stool, saliva, skin, nasal swab, vaginal swab, blood, urine, hair, or oral swab.
[0040] In this disclosure, the patient may be a human or an animal.
[0041] In this disclosure, the method may further include administering a therapeutic to the patient. The therapeutic may not be chemotherapy and/or radiation. [0042] This disclosure further relates to a diagnostic kit. This diagnostic kit may include one or more primer pairs, and one or more sub-taxon probes of this disclosure. This diagnostic kit may further include a reference standard.
[0043] This disclosure further relates to a nucleic acid, which may have at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to any one of the sequences of the primer pairs of FIG. 10, Primer IDs p0325 to p0326 (SEQ ID NO: 5-6), p0333 to p0336 (SEQ ID NO: 1-4), p0387 to p0388 (SEQ ID NO: 7-8), or any combination thereof.
[0044] This disclosure further relates to a synthetic primer pair, which may include a synthetic forward primer and/or a synthetic reverse primer, each having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to any one of the synthetic forward primers and/or the synthetic reverse primers of the primer pairs of FIG. 10, p0325 to p0326 (SEQ ID NO: 5-6),, p0333 to p0336 (SEQ ID NO: 1-4), p0387 to p0388 (SEQ ID NO: 7-8), or any combination thereof.
[0045] Any combination of above features of methods, formulations, and systems are within the scope of this disclosure.
[0046] These, as well as other components, steps, features, objects, benefits, and advantages, will now become clear from a review of the following detailed description of illustrative examples, the accompanying drawings, and the claims.
BRIEF DESCRIPTION OF DRAWINGS
[0047] The drawings are illustrative examples. They do not illustrate all examples. Other examples may be used in addition or instead. Details that may be apparent or unnecessary may be omitted to save space or for more effective illustration. Some examples may be practiced with additional components or steps and/or without all the components or steps that are illustrated. When the same numeral appears in different drawings, it refers to the same or like components or steps. [0048] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
[0049] FIG. 1 . illustrates exemplary reaction components and their reactions with a template of a DNA belonging to a microorganism (e.g. bacteria). FIG. 1.1 shows reaction components and a DNA template. FIG. 1.2 shows denatured template and annealing. FIG. 1.3 shows polymerization and signal generation.
[0050] FIG. 2. illustrates an exemplary method of this disclosure for detecting and quantifying microbes at sub-taxon resolution.
[0051] FIG. 3. illustrates exemplary reaction components and their reactions with a template of a DNA belonging to a microorganism (e.g. bacteria). FIG. 3.1 shows reaction components and a DNA template. FIG. 3.2 shows denatured template and annealing. FIG. 3.3 shows polymerization and signal generation.
[0052] FIG. 4. illustrates Porphyromonas phylogenetic tree, sequences of an example of a primer pair specific to a Porphyromonas taxon (Clade 5), and sequences of two examples of sub-taxon probes specific to Porphyromonas species. In this example, the two target species may be Porphyromonas asaccharolytica and Porphyromonas uenonis. Illustrates Porphyromonas Clade 5 primer targets, P. asaccharolytica-speci ic fluorescent probe targets (red bar), and P. t/enon/s-specific fluorescent probe targets (blue bar).
[0053] FIG. 5. illustrates genotyping and quantification of species using taxonspecific primers and sub-taxon-specific fluorescent probes. Reaction compositions detailing the primers and probes present in each reaction are shown along with the template material provided and the corresponding Ct values obtained from each fluorescence channel in every reaction. Amplification curves for both fluorescence channels (FAM, red; TAMRA; blue) from every reaction are shown, detailing the species-specific amplification results (P. asaccharolytica and P. uenonis, respectively). Forward primer: p0387. Reverse primer: p0388. Target Amplicon: pp890.
[0054] FIG. 6 illustrates an exemplary method of this disclosure for determining the presence/relative-abundance of related bacterial species within a sample.
[0055] FIG. 7. illustrates exemplary reaction components and their reactions with a template of a DNA belonging to a microorganism (e.g. bacteria) and a reference template. FIG. 7.1 shows reaction components, a gDNA template and a reference template. FIG. 7.2 shows denatured gDNA template and denatured reference template, and annealing of these templates. FIG. 7.3 shows polymerization and signal generation from annealed templates.
[0056] FIG. 8 illustrates an exemplary method for determining the absolute abundance of microbial species within a sample.
[0057] FIG. 9. illustrates species-specific Porphyromonas qPCR primer pairs.
[0058] FIG. 10. illustrates species-specific Porphyromonas fluorescent probes.
[0059] FIG. 11. illustrates probe-based qPCR detection experimental design.
[0060] FIG. 12. illustrates Porphyromonas somerae -specific fluorescent probe targets.
[0061] FIG. 13. illustrates Porphyromonas somerae-specific fluorescent probe targets.
[0062] FIG. 14. illustrates Porphyromonas uenonis-specific fluorescent probe targets.
[0063] FIG. 15. illustrates end products from probe-based qPCR detection reactions.
[0064] FIG. 16. illustrates Ct values of FAM-labeled species-specific Porphyromonas probes against correct templates.
[0065] FIG. 17. illustrates end products from mismatched primer/probe qPCR reactions. [0066] FIG. 18. illustrates end products from probe-based qPCR detection reactions.
[0067] FIG. 19. illustrates serial dilution quantification using P. somerae-specific 6- FAM probes.
[0068] FIG. 20. illustrates serial dilution quantification using P. somerae-specific 6- FAM probes.
[0069] FIG. 21. illustrates serial dilution quantification using P. uenon/s-specific 6- FAM probes.
[0070] FIG. 22. illustrates serial dilution quantification using P. uenon/s-specific 6- FAM probes.
[0071] FIG. 23. illustrates quantification using TAMRA- and FAM-labeled probes.
[0072] FIG. 24. illustrates multiplex qPCR to quantify P. somerae using both TAMRA- and FAM-labeled probes simultaneously.
[0073] FIG. 25. illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using differentially-labeled species-specific fluorescent probes.
[0074] FIG. 26. illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using differentially-labeled species-specific fluorescent probes.
[0075] FIG. 27. illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using differentially-labeled species-specific fluorescent probes.
[0076] FIG. 28. illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes, enabling the determination of the relative abundance of each species. Forward primers were p0325 (SEQ ID NO: 5) and pO333(SEQ ID NO: 1 ); backward primers were pO326(SEQ ID NO: 6) and pO334(SEQ ID NO: 2); and the target region was pp43916 and pp29025. For probe target P. somerae, the probe and probe label were fp0003 (SEQ ID NO: 11) and FAM, respectively. For probe target P. uenonis, the probe and probe label were fpOO1 O (SEQ ID NO: 18) and TAMRA, respectively.
[0077] FIG. 29. illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes, enabling the determination of the relative abundance of each species. Forward primers were p0325 (SEQ ID NO: 5) and pO333(SEQ ID NO: 1 ); backward primers were pO326(SEQ ID NO: 6) and pO334(SEQ ID NO: 2); and the target region was pp29025 and pp43916. For probe target P. somerae, the probe and probe label were fp0004(SEQ ID NO: 12) and FAM, respectively. For probe target P. uenonis, the probe and probe label were fp0009(SEQ ID NO: 17) and TAMRA, respectively.
[0078] FIG. 30. illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes enabling the determination of the relative abundance of each species. This figure shows 10-fold dilution series of P. uenonis.
[0079] FIG. 31. illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes enabling the determination of the relative abundance of each species. This figure shows 10-fold dilution series of P. somerae. [0080] FIG. 32. illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes enabling the determination of the relative abundance of each species. This figure shows a constant amount of P. somerae and a 10-fold dilution series of P. uenonis templates.
[0081] FIG. 33. illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes enabling the determination of the relative abundance of each species. This figure shows a constant amount of P. uenonis and a serial 10-fold dilution series of P. somerae templates.
[0082] FIG. 34. illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes enabling the determination of the relative abundance of each species. This figure shows a constant amount of P. somerae and a 10-fold dilution series of P. uenonis templates along with a diverse OpenBiome microbial community background.
[0083] FIG. 35. illustrates multiplex qPCR to simultaneously quantify multiple species within the same well using species-specific primers and differentially-labeled species-specific fluorescent probes enabling the determination of the relative abundance of each species. This figure shows a constant amount of P. uenonis and a serial 10-fold dilution series of P. somerae templates along with a diverse OpenBiome microbial community background.
DETAILED DESCRIPTION OF ILLUSTRATIVE EXAMPLES
[0084] Illustrative examples are now described. Other examples may be used in addition or instead. Details that may be apparent or unnecessary may be omitted to save space or for a more effective presentation. Some examples may be practiced with additional components or steps and/or without all the components or steps that are described.
[0085] Following acronyms are used in this disclosure.
Ct threshold cycle, which is the intersection between an amplification curve and a threshold line. Ct is a relative measure of the concentration of target in the PCR reaction.
Cycle: PCR cycle number gDNA: genomic DNA dNTP: deoxyribonucleotide triphosphate
NTC: no template controls
PCR: polymerase chain reaction qPCR: quantitative PCR
Rn: the fluorescence of the reporter dye divided by the fluorescence of a passive reference dye
ACt: Relative abundance of the species
ARn: Rn minus the baseline
[0086] This disclosure relates to systems, formulations and methods that may be used in determination of presence/absence, relative and/or absolute abundance of specific bacteria in a sample. This disclosure relates to formulations that include species-specific unlabeled primers and species-specific fluorescent probes. This disclosure further relates to formulations that may include reference primers, reference fluorescent probes, and/or reference materials, which may be used in determination of relative and/or absolute abundance of specific bacteria in a sample.
[0087] The disclosure relates to at least one pair of species-specific unlabeled primers (a forward primer and a reverse primer, or a "primer pair") for qPCR. Such primer pairs may specifically amplify target regions found only in specific taxonomic groups of closely related bacteria. These taxon-specific primer pairs may be used to amplify and quantify the abundance of each target taxon within a variety of complex samples. For example, such taxon-specific primer pairs may amplify groups of bacteria at various levels of taxonomic resolution (for example at genus, species, and/or strain level). These taxon-specific primer pairs may be combined with fluorescent probes, such as TaqMan probes (sequence-specific oligonucleotides with covalently bound fluorescent dyes and quenchers), to provide new methods and additional applications for the characterization of microbiological samples. The primers and probes provided in the specification and Figures are non-limiting examples of primer and probes that can be used in the methods disclosed herein. Those primers and probes are shown in FIGs. 9 and 10, and in Table 1 below.
Table 1. Exemplary primers and probes of this disclosure
Figure imgf000020_0001
Figure imgf000021_0001
[0088] These methods and additional functionalities may offer a means to i) detect sub-taxon (ex. genus/species/strain) level diversity within the amplicons of specific taxon, and ii) eliminate the need for external reference standards to quantify either the relative or absolute abundance of specific bacterial taxa within complex communities/samples.
[0089] In this disclosure, the (microbiological) sample may be a solid sample, a liquid sample, or a combination thereof. Examples of the samples may be a soil sample, a fecal sample, a tissue sample, a bodily fluid sample, a saliva sample, or a combination thereof.
[0090] In this disclosure, the method of determining presence/absence, relative abundance, and/or absolute abundance of specific bacteria in a microbiome sample may include obtaining the microbiome sample, preparing a qPCR by mixing the microbiome sample with a qPCR formulation, performing the qPCR, analyzing results, and thereby determining presence/absence, relative abundance, and/or absolute abundance of the specific bacteria in the microbiome sample.
[0091] In this disclosure, the method of determining presence/absence, relative abundance, and/or absolute abundance of specific bacteria in a microbiome sample may include obtaining the microbiome sample that potentially includes at least one nucleic acid; processing the microbiome sample to have the at least one nucleic acid accessible to react with a specific primer pair; mixing the processed microbiome sample with a qPCR formulation to form a microbiome reaction mixture; subjecting the microbiome reaction mixture to a qPCR under which at least one section of the accessible nucleic acid can be amplified and produce a fluorescence signal; measuring amount of fluorescence signal produced; and identifying whether the specific bacteria are present in the microbiome sample, and/or, if the specific bacteria are present in the microbiome, determining relative abundance, and/or absolute abundance of the specific bacteria in the microbiome sample.
[0092] This disclosure further relates to a method of treatment of a patient, which may include obtaining a microbiome sample from the patient, wherein the microbiome sample potentially comprises at least one nucleic acid; processing the microbiome sample to have the at least one nucleic acid accessible to react with a specific primer pair designed specifically for identification of the specific bacteria present in the microbiome; mixing the processed microbiome sample with a qPCR formulation to form a microbiome reaction mixture; subjecting the microbiome reaction mixture to a qPCR under which at least one section of the accessible nucleic acid can be amplified and produce a fluorescence signal; measuring amount of fluorescence signal produced; identifying whether the specific bacteria are present in the microbiome sample, and/or, if the specific bacteria are present in the microbiome, determining relative abundance, and/or absolute abundance of the specific bacteria in the microbiome sample; forming a patient bacteria profile based on said identification; comparing the patient bacteria profile with a bacteria profile of a healthy patient; determining whether the patient has a disease, or determining progression of a disease of the patient; and treating the patient if the patient has a disease.
[0093] In this disclosure, the qPCR formulation may include at least one pair of species-specific unlabeled primers ("primer pair") for at least one taxon. Each primer pair may include a forward primer and a reverse primer. The qPCR formulation may also include at least one DNA polymerase; and at least one species-specific fluorescent probe ("sub-taxon probe") for at least one member of the taxon. The subtaxon probe may be a sequence-specific oligonucleotide with a covalently bound fluorescent dye and a covalently bound non-fluorescent quencher. The fluorescent dye is hereafter called "sub-taxon fluorescent dye," and wherein said non-fluorescent quencher is hereafter called "sub-taxon quencher."
[0094] In this disclosure, the method may further include having at least one primer pair designed to specifically amplify a genus; and having a sub-taxon probe designed to detect a species and/or a specific strain of the species.
[0095] In this disclosure, the method may further include having at least one primer pair designed to specifically amplify a genus; and having a sub-taxon probe designed to detect a species through a sequence variation and/or a specific strain of the species.
[0096] In this disclosure, the method may include at least one primer pair that does not target 16S rRNA. The method may include a sub-taxon probe that does not target 16S rRNA. Optionally, according to several embodiments, one or more of the at least one primer pair and/or the sub-taxon probe are configured to target 16s rRNA.
[0097] In this disclosure, the sub-taxon probe may exclude a 3’-hydroxyl group to ensure that the nucleic acid polymerase does not use this probe to initiate or extend nucleic acid synthesis, and prevent unintended amplification products.
[0098] In this disclosure, the qPCR formulation may include at least two sub-taxon probes. Each sub-taxon probe may have a different sub-taxon fluorescent dye than that of the other sub-taxon probes. Each sub-taxon probe may have a sub-taxon quencher different than those of the other sub-taxon probes.
[0099] In this disclosure, the qPCR formulation may include at least two sub-taxon probes. Each sub-taxon probe may have a different sub-taxon fluorescent dye than that of the other sub-taxon probes. The relative abundance of different sub-taxon variants may be determined by choosing a reference fluorescence intensity of one of the sub-taxon probe's fluorescent dye as a point-of-reference and comparing fluorescence intensities of other sub-taxon probes' fluorescent dyes with the reference fluorescence intensity. [00100] In this disclosure, the qPCR formulation may include at least two sets of the primer pairs. Each set of the primer pairs may be specific to a taxon. Each set of the primer pairs may be different than other sets of the primer pairs.
[00101] In this disclosure, the qPCR formulation may include at least two fluorescent probes ("taxon-probe") specific to taxon. Each taxon-probe may have a different fluorescent dye than that of the other taxon-probes. The relative abundance of different taxa may be determined by choosing a reference fluorescence intensity of one of the taxon-probe's fluorescent dye as a point-of-reference and comparing fluorescence intensities of other taxon-probes' fluorescent dyes with the reference fluorescence intensity.
[00102] In this disclosure, the qPCR formulation may include at least two fluorescent probes ("taxon-probe") specific to taxon. Each taxon-probe may have a different fluorescent dye and a quencher than those of the other taxon-probes. The relative abundance of different taxa may be determined by choosing a reference fluorescence intensity of one of the taxon-probe's fluorescent dye as a point-of- reference and comparing fluorescence intensities of other taxon-probes' fluorescent dyes with the reference fluorescence intensity.
[00103] In this disclosure, the qPCR formulation may further include at least one pair of reference primers ("reference-primer pair"), and at least one reference fluorescent probe ("reference-probe"). The reference-probe may be a sequencespecific oligonucleotide with a covalently bound fluorescent dye ("reference- fluorescent dye") and a covalently bound non-fluorescent quencher ("referencequencher"). The fluorescent dye may be a fluorophore different than other sub-taxon fluorescent dyes and/or taxon fluorescent dyes.
[00104] In this disclosure, the qPCR formulation may further include at least one pair of reference primers ("reference-primer pair"), and at least one reference fluorescent probe ("reference-probe"). The reference-probe may be a sequencespecific oligonucleotide with a covalently bound fluorescent dye ("reference- fluorescent dye") and a covalently bound non-fluorescent quencher ("referencequencher"). The reference-fluorescent dye may be a fluorophore different than the sub-taxon fluorescent dye(s) and/or taxon fluorescent dye(s). The referencequencher may be a quencher different than other sub-taxon quenchers and/or taxon quenchers.
[00105] In this disclosure, the qPCR formulation may further include at least one reference-material with known quantity, and a reference-probe. The absolute abundance of each taxon may be determined by comparing fluorescence intensity of each taxon-probe with that of the reference-material.
[00106] In this disclosure, the reference-material may include a predetermined amount of oligonucleotide.
[00107] In this disclosure, the qPCR formulation may further include a fluorescent probe and a primer pair, which are specific for determination of total number of marker genes of bacteria present in the sample. The method may further include determining total number of marker genes, using said total number of marker genes as a point-of-reference, and determining relative proportion of a taxa of interest within the total bacterial biomass of the sample.
[00108] In this disclosure, the qPCR formulation may further include a referenceprobe specific for determination of total copy number of all bacterial 16S rRNA. The method may further include determining the total copy number of all bacterial 16S rRNA, using said total copy number as a point-of-reference, and determining relative proportion of a taxa of interest within the total bacterial biomass of the sample.
[00109] In this disclosure, the reference-material may include a predetermined amount of 16S rRNA genes.
[00110] In this disclosure, the method further may further include extracting DNA after obtaining the microbiome sample.
[00111] In this disclosure, the method may further include lysing cells after obtaining the microbiome sample. [00112] In this disclosure, the sub-taxon probe, the taxon-probe, and/or the reference-probe may have a minor groove binder to stabilize each probe's DNA binding stability.
[00113] In this disclosure, the method may further include having a pre-determined threshold fluorescence intensity ("threshold-fluorescence intensity"). The fluorescence intensity below the threshold-fluorescence intensity may be indicative of absence of a specific target in the microbiome sample. Or, the fluorescence intensity above the threshold-fluorescence intensity may be indicative of presence of a specific target in the microbiome sample.
[00114] In this disclosure, the qPCR formulation may further include a dNTP, a reaction buffer, or a combination thereof.
[00115] In this disclosure, the method may be used to determine presence/absence, relative abundance, and/or absolute abundance of microbes at sub-taxon resolution, and wherein the sub-taxon resolution comprises resolution of genus, species, and/or strains of a microbial community.
[00116] In this disclosure, the genus of the bacteria may have at least one subtaxon, or at least two sub-taxa. The genus of the bacteria may have at least one subtaxon, or at least two sub-taxa.
[00117] In this disclosure, the specific bacteria may be Porphyromonas. The specific bacteria may belong to at least one species of the Porphyromonas genus. The target bacteria may belong to Porphyromonas somerae, Porphyromonas uenonsis, Porphyromonas ashaccharolytica, or a combination thereof.
[00118] In this disclosure, the qPCR formulation may include at least two specific primer pairs; wherein each specific primer pair may include a forward primer and a reverse primer; and wherein at least one first specific primer pair may be capable of amplifying a first species belonging a first sub-taxon of the target bacteria and at least one second specific primer pair may be capable of amplifying a second species belonging a second sub-taxon of the specific bacteria. [00119] In this disclosure, the qPCR formulation may include a primer pair; the primer pair may include a forward primer and a reverse primer; the primer pair may be selected from the primer pairs of FIGs. 9 or FIG. 10, Primer IDs p0325 (SEQ ID NO: 5), pO326(SEQ ID NO: 6), p0333 to pO336(SEQ ID NO: 1-4), pO387(SEQ ID NO: 7), pO388(SEQ ID NO: 8), or a combination thereof; and the sub-taxon probe may be selected from the species-specific fluorescent probes of FIG. 10, Probe IDs fpOOOl to fp0012(SEQ ID NO: 9-20), fp0022(SEQ ID NO: 21 )„ fp0023 (SEQ ID NO: 22), or a combination thereof.
[00120] In this disclosure, the disease may include (chronic) oral infections, cancers, neurodegenerative diseases, or a combination thereof. The disease may include colorectal cancer, endometrial cancer, gastric adenocarcinomas, and cervical cancer, P. aeruginosa pulmonary infections in cystic fibrosis, oral pathological process, or a combination thereof. The disease may include an oral pathological process, wherein the oral pathological process comprises periodontitis, oral squamous cell carcinomas, or a combination thereof. The disease may include colorectal cancer.
[00121] In this disclosure, the microbiome sample may include stool, saliva, skin, nasal swab, vaginal swab, blood, urine, hair, or oral swab.
[00122] In this disclosure, the patient may be a human or an animal.
[00123] In this disclosure, the method may further include administering a therapeutic to the patient. The therapeutic may not be chemotherapy and/or radiation.
[00124] This disclosure further relates to a diagnostic kit. This diagnostic kit may include one or more primer pairs, and one or more sub-taxon probes of this disclosure. This diagnostic kit may further include a reference standard.
[00125] This disclosure further relates to a nucleic acid, which may have at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to any one of the sequences of the primer pairs of FIG. 10, Primer IDs p0325 to pO326(SEQ ID NO: 5-6), p0333 to pO336(SEQ ID NO: 1-4), p0387 to pO387(SEQ ID NO: 7-8), or any combination thereof.
[00126] This disclosure further relates to a synthetic primer pair, which may include a synthetic forward primer and/or a synthetic reverse primer, each having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to any one of the synthetic forward primers and/or the synthetic reverse primers of the primer pairs FIGs. 10, Primer IDs p0325 (SEQ ID NO: 5), p0326 (SEQ ID NO: 6), p0333 to p0336 (SEQ ID NO: 1-4), pO387(SEQ ID NO: 7), pO388(SEQ ID NO: 8), or a combination thereof.
[00127] Any combination of above features of methods, formulations, and systems are within the scope of this disclosure.
Example 1 . Detecting and quantifying sub-taxon level taxonomic resolution such as genus, species, and/or strain levels.
[00128] By integrating at least one species-specific fluorescent probe ("sub-taxon probe") into reactions with taxon-specific primers, one may use sequence variation within amplicon products to detect the presence of and quantify specific bacteria or groups of bacteria within microbial samples with greater taxonomic resolution using the following reaction components and method, schematically shown in FIG. 1 and FIG. 2.
[00129] Each polymerase chain reaction (PGR) reaction may rely upon of a pair of species-specific unlabeled primers, at least one species-specific fluorogenic (or detection) probe ("taxon probe"), and a nucleic acid polymerase with 5’-exonuclease activity (FIG.1.1 ). An example of nucleic acid polymerase may be Taq DNA polymerase. Much like a typical PGR reaction, species-specific primers may be designed to amplify a specific region of nucleic acid with the help of nucleic acid polymerase during repeated thermal cycling steps. To quantify the abundance of the PGR product, a species-specific detection probe may be included in each reaction. This detection probe may typically include a species-specific oligonucleotide with a fluorescent dye covalently attached to the 5’-end, a non-fluorescent quencher covalently linked to the 3’-end, and may further include a minor groove binder to stabilize probe: nucleic acid binding stability. Examples of the fluorescent dyes may be fluorescein amidite (FAM), VIC, and TAMRA fluorescent dye. Such detection probes may lack a 3’-hydroxyl group to ensure the nucleic acid polymerase does not use this probe to initiate or extend nucleic acid synthesis and prevent unintended amplification products.
[00130] During each real-time PCR reaction, the sample temperature may first be raised to denature template double-stranded nucleic acid (FIG. 1.2). At this step, the non-fluorescent quencher on the 3-end may quench any signal of the fluorescent dye on the 5’-end because these compounds may remain in close proximity while attached to the same probe and since the energy from an excited fluorescent dye may get transferred to the quencher via fluorescence resonance energy transfer. Next, the reaction temperature may be lowered to allow the species-specific primers and the species-specific fluorescent probe(s) to anneal to their target sequences. Then, at an appropriate temperature, nucleic acid polymerase may be allowed to synthesize new, complementary strands of nucleic acid using the unlabeled primers and template (FIG. 1.3). When the polymerase may reach the detection probe, its endogenous 5’-exonuclease activity may cleave the probe and may permanently release the fluorescent dye from the quencher. Once released, the fluorescent dye may be excited and its signal intensity may be detected and used to monitor and quantify the PCR amplification products since the fluorescence intensity may be proportional to the amount of PCR product synthesized.
[00131] The following, shown schematically in FIG. 2, is an exemplary method.
[00132] (a) Prepare a qPCR formulation. This formulation may include at least one primer pair for at least one taxon, at least one nucleic acid polymerase, and at least one sub-taxon-specific fluorescent probe ("sub-taxon probe") for at least one member of the taxon. The sub-taxon probe may have complementarity to sequence variation within amplicons specifically associated with groups, species, or strains of bacteria of interest to enable their detection and quantification. For example, the primer pair may specifically amplify a taxon within the genus Porphyromonas and the sub-taxon probe may be used to detect sequence variation with the amplicon associated with Porphyromonas uenonis and/or a specific strain of Porphyromonas uenonis. Subtaxon probes may bind sequences that may not be necessarily found only within the amplicon. Since the sub-taxon probe's oligonucleotide lacks 3’-hydroxyl group, even if the sub-taxon probe may bind elsewhere in the target genome or the genomes of non-target organisms within a complex sample, the sub-taxon probe may not yield a fluorescent signal. This may be because no upstream priming may allow a nucleic acid polymerase to release the fluorescent dye from the sub-taxon probe.
[00133] (b) Obtain a microbiome sample from source of interest.
[00134] (c) Optionally, lyse cells and/or extract microbial nucleic acid, if necessary. [00135] (d) Prepare qPCR reaction(s) using the formulation that includes the primer pair and the sub-taxon probe(s) at appropriate concentrations. This formulation may further include other reaction components, for example, a nucleic acid polymerase, a deoxyribonucleotide triphosphate (dNTP), a reaction buffer, or a mixture thereof at appropriate concentrations.
[00136] (e) Perform a qPCR using appropriate reaction steps, temperatures, incubation times, fluorescence detection, cycle numbers, and/or melt curves.
[00137] (f) Determine and analyze reaction fluorescence intensities to detect and quantify target sequences within amplicons from target organisms at sub-taxon resolution.
[00138] If more than one sample is being analyzed, fluorescence intensities from different reactions may be compared to determine relative abundance among samples. If a sample is being analyzed for different taxa and/or sub-taxa with distinct taxon and/or sub-taxon probes across distinct reactions may be compared to determine their relative abundancies within the sample. Quantification may be determined by comparing fluorescence intensities to reference standards using internal references/standards, external references/standards, or a combination thereof.
Example 2. Quantification of the abundance of specific species and/or strains present within a complex community.
[00139] The method disclosed in Example 1 may be used to detect/quantify the abundance of specific species and/or strains present within a complex community. The method that may be used in this example is schematically shown in FIG. 2.
[00140] For example, if a target organism possesses a unique single nucleotide polymorphism (SNP) within the taxon-specific amplicon, a sub-taxon probe may be used targeting the SNP to determine the presence/absence, and/or abundance of the strain following administration to a patient. This method may be used to determine whether the target organisms is abundant enough for the intended clinical effect, or whether a single dose was enough to establish a long-term colonization within a patient.
Example 3. Multiple probes targeting different sequences within taxon-specific amplicons.
[00141] Multiple sub-taxon probes may be used to target different sequences within taxon-specific amplicons to detect/quantify the type and/or relative abundance of organisms with greater taxonomic resolution. One application may be to "genotype" different sequence variants, such as different species, within amplicons from a specified target taxon (as schematically shown in FIG. 3).
[00142] For example, one might want to determine the presence/absence or relative abundance of two closely related Porphyromonas species, such as P. asaccharolytica and P. uenonis (FIG. 4). These two closely related species fall within one clade of the Porphyromonas phylogenetic tree. For example, we designed a single primer pair that may specifically target this taxon and specifically amplify both of these species of Porphyromonas, Forward Primer (p0387): 5' TGGAGGTAGTGAGTTCTTTAT 3' (SEQ ID NO: 7); and Reverse Primer (p0388): 5' ACCATCAGAGAGCCTG 3' (SEQ ID NO: 8) (Table 1 ).
[00143] Species-specific sub-taxon probes based on species-specific sequence variation within these amplicons was then targeted to enable species-specific detection. Examples of such species-specific sub-taxon probes include P. uenonis probe (fp0022): 5' ACAAGATGGGCGTACG 3' (SEQ ID NO: 21); and P. asaccharolytica probe (fp0023): 5’ ACAAGATGGGTGTACG 3’ (SEQ ID NO: 22), each labeled with distinct fluorescent markers (TAMRA and FAM, respectively). In this instance, a Single Nucleotide Polymorphism (SNP) distinguishes these sub-taxon target species. Accordingly, the presence/absence, and/or relative abundance of P. asaccharolytica and P. uenonis may be determined or compared within the same reaction using a single taxon-specific primer pair and two species-specific sub-taxon probes (FIG. 4).
[00144] Here, a series of reactions were constructed using the same forward (p0387) (SEQ ID NO: 7) and reverse (p0388) (SEQ ID NO: 8) primer pair targeting a taxon-specific amplicon (pp890) as well as either one species-specific probe alone (fp0022 or fp0023) (SEQ ID NO: 21 or 22) or both sub-taxon-specific probes together (fp0022 and fp0023) (SEQ ID NO: 21 and 22).
[00145] These mixtures were then assessed against a variety of templates to demonstrate target specificity and relative abundance (FIG. 5). First, No Template Controls (NTC) demonstrate neither probe yields a Ct value when target templates are absent. Then, genomic DNA from each target species was provided as template in isolation. Here, Ct values were only obtained from reactions with gDNA templates when probes targeting the template species were added to the reaction. Furthermore, the fluorescence signals used to obtain these Ct values corresponded to the respective probes targeting the intended template species (e.g., the TAMRA probe targeting P. uenonis only yielded a TAMRA Ct value when P. uenonis gDNA template was provided and the FAM probe targeting P. asaccharolytica only yielded a FAM Ct value when P. asaccharolytica gDNA was provided). Additionally, neither speciesspecific fluorescent probe resulted in a Ct value when assessed against a diverse background community of microorganisms (OpenBiome) known not to contain either P. uenonis or P. asaccharolytica, demonstrating the absence of unintended cross reactivity with other microorganisms. Finally, when the same amount of both P. uenonis and P. asaccharolytica gDNA template was provided within the same reaction, each probe continued to yield comparable Ct values on the appropriate fluorescence channel(s) demonstrating the capacity to determine the genotype the species provided, the presence/absence of each species, and determine the relative abundance of each species within a single, multiplexed reaction.
[00146] FIG. 6 illustrates an exemplary method of this disclosure for determining the presence and/or relative-abundance of related bacterial species within a sample. [00147] Multiple sub-taxon probes designed for sequence variation with taxonspecific amplicons offers a method of determining the presence/absence and/or relative abundance of different sub-taxon variants (FIG. 7).
[00148] For example, one may use this method to quantify the relative abundance of a probiotic strain of bacteria administered as a therapeutic compared to other bacteria within the same taxon. Such method may aid in distinguishing whether the administered bacteria is present within a patient at sufficient levels at a given time, and/or might have displaced other bacteria from the same taxon within the patient. [00149] This multi-probe approach may be used with many different labels to distinguish many different subgroups within a given taxon. Taxon-specific primers and sub-taxon probes may be developed to identify many or all species within that taxon so long as enough species-specific variation exists within the amplicon and enough fluorescent signals may be distinguished from one another. Example 4. Determining the relative abundance of two amplicons within a sample.
[00150] At least two formulations, each including a different taxon-specific primer and a different sub-taxon probe may be introduced to the same reaction. Each formulation is specific to a distinct amplicon/sequence of interest, each formulation may have a taxon-specific primer different than that of the other, and each formulation may have a sub-taxon probe different than that of the other. This duplexed PGR reaction may provide direct, within-reaction measurements of relative abundance of two specific amplicons/sequences using the following method, schematically shown in FIGs. 7-8.
[00151] (a) Prepare at least two qPCR formulations. Each formulation may include at least one primer pair for at least one taxon, at least one nucleic acid polymerase, and at least one species-specific fluorescent probe ("sub-taxon probe") for at least one member of the taxon. Each formulation may be specific to a distinct amplicon/sequence of interest, each formulation may have a taxon-specific primer different than that of the other, and each formulation may have a sub-taxon probe different than that of the other. Each sub-taxon probe may have complementarity to sequence variation within amplicons specifically associated with groups, species, or strains of bacteria of interest to enable their detection and quantification. For example, a first formulation including at least one taxon-specific primer pair and a sub-taxon probe may be used to specifically amplify Porphyromonas somerae and to detect sequence variation within the amplicon associated with Porphyromonas somerae and/or a specific strain of Porphyromonas somerae. A second formulation including at least one taxon-specific primer pair and a sub-taxon probe may be used to specifically amplify the genus Porphyromonas uenonis and to detect sequence variation within the amplicon associated with Porphyromonas uenonis and/or a specific strain of Porphyromonas uenonis.
[00152] (b) Obtain a microbiome sample from source of interest.
[00153] (c) Optionally, lyse cells and/or extract microbial nucleic acid, if necessary. [00154] (d) Prepare qPCR reaction(s) using the two formulations each including the primer pair and the sub-taxon probe(s) at appropriate concentrations. Each formulation may further include other reaction components, for example, a nucleic acid polymerase, a deoxyribonucleotide triphosphate (dNTP), a reaction buffer, or a mixture thereof at appropriate concentrations.
[00155] (e) Perform a qPCR using appropriate reaction steps, temperatures, incubation times, fluorescence detection, cycle numbers, and/or melt curves.
[00156] (f) Determine and analyze reaction fluorescence intensities from each subtaxon probe to detect and quantify target sequences within amplicons from target organisms at sub-taxon resolution.
[00157] Fluorescence intensities attributable to each sub-taxon probe may be compared to determine the relative abundance of each targeted sequence within each amplicon from the sample directly within each reaction. If a microbiome sample is being analyzed for different taxa and/or sub-taxa with distinct taxon and/or subtaxon probes across distinct reactions, relative abundancies may be compared and/or normalized across reactions when the same formulation including a taxonspecific primer pair and a sub-taxon probe set is included in multiple reactions as a reference formulation.
[00158] Quantification may also be carried out by comparing fluorescence intensities from a sub-taxon probe aimed for a target organism to a reference fluorescence intensity formed by using a reference formulation. The reference formulation may be an internal formulation, an external formulation, or a combination thereof. This reference formulation may be a standard formulation used in this industry.
[00159] For example, a first formulation targeting a specific genus/species may be included in multiple reactions where a second formulation may target another genus/species. Resulting fluorescence intensities from these two formulations may then be compared to quantify, normalize, or standardize across reactions. [00160] In another example, a known reference material may be included in the microbiome sample and/or multiple reactions. A first formulation ("reference formulation") may target the reference material and a second formulation may target a genus/species of interest. With this approach of using a reference material and a reference formulation, quantification, normalization, and/or standardization within or across reactions may be achieved.
[00161] Within-reaction relative abundance measurements may eliminate the need for external calibration, references, and/or standard dilution series. With such approaches of this disclosure, the number of reactions required to quantify the abundance of an amplicon/sequence within a sample may significantly be reduced.
[00162] For example, one formulation including a species-specific primer pair may be used to specifically amplify Porphyromonas somerae and another primer pair may be used to specifically amplify Porphyromonas uenonis. Fluorescent probes with distinct fluorophores may be used to target species-specific sequence variation within each amplicon. Both primer/probe sets, each targeting a distinct taxon/sub-taxon, respectively, may then be included within a single reaction. At the end of the reaction, the signal intensities attributable to each amplicon/sequence reflecting each taxon/sub-taxon may directly be compared, thereby enabling the determination of within-reaction relative abundance.
[00163] Such methods of this disclosure may be used to compare the relative abundance of two clinically-relevant bacterial taxa (for example, genus, species, and/or strains) within a patient's microbiome. The publications of Ley, R., Turnbaugh, P., Klein, S. et al. "Human gut microbes associated with obesity," Nature 444, 1022- 1023 (2006), https://doi.org/10.1038/4441022a; and Ruth E. Ley, Fredrik Backhed, Peter Turnbaugh, Catherine A. Lozupone, Robin D. Knight, and Jeffrey I. Gordon, "Obesity alters gut microbial ecology," PNAS August 2, 2005 102 (31 ) 11070-11075; https://doi.org/10.1073/pnas.0504978102 disclose that the ratio of Firmicutes to Bacteroidetes may be associated with patient obesity and/or gut health (Firmicutes > Bacteroidetes in obese patients, and the inverse within lean patients). The entire contents, including their supplemental information, of each publication are incorporated herein by reference. By using phyla-specific formulations including primer/probe sets, the relative abundance of each bacterial taxon may be determined within a single reaction and may provide meaningful clinical insights.
[00164] Such within-reaction relative abundance measurement methods of this disclosure may eliminate the need for external standard dilution series and/or reference reactions. This may significantly reduce the number of reactions required to quantify the abundance of an amplicon/sequence within a sample. Reducing the number of required reactions may likely reduce assay costs, enable a greater number of within-plate comparisons, and/or increase capacity/sample throughput when many samples are being processed.
Example 5. Determining the absolute abundance of an amplicon/sequence within a sample.
[00165] This example discloses a method for determination of the absolute abundance of any and/or all bacteria within the sample by integrating a reference formulation including a primer/probe set within a given reaction and directly comparing the abundance of a target amplicon/sequence to the abundance of an established reference material or standard material.
[00166] At least two formulations each including a distinct primer/probe set may be introduced into the same reaction. One formulation may be specific to the amplicon/sequence of interest and the other formulation may be specific to the reference amplicon/sequence. At the end of the reaction, the fluorescence intensity of the amplicon/sequence of interest may directly be compared to the fluorescence intensity of the reference amplicon/sequence, thereby enabling the determination of within-reaction relative abundance, as described in the following method and illustrated in FIG.8. [00167] (a) Prepare at least one sample-formulation including a taxon-specific primer pair and a sub-taxon probe to amplify target sequences within distinct bacterial taxa of interest. The sub-taxon probe may have complementarity to sequence variation within amplicons specifically associated with groups, species, or strains of bacteria of interest to enable their detection and quantification.
[00168] (b) Prepare at least one reference-formulation including a reference primer pair and a reference-probe to amplify a target sequence within a reference. A reference-sequence may be (i) a sequence within the microbiome sample (such as 16S rRNA gene sequences), (ii) a sequence introduced to the microbiome sample (such as one or more reference oligonucleotide(s) or strain(s) of known abundance), (iii) a sequence introduced directly into each reaction (such as a reference oligonucleotide or strain with known abundance), (iv) a combination thereof. For the reference primer(s) targeting the reference amplicon, a reference-probe may target a specific sequence within the reference amplicon not found in the taxon-specific amplicon.
[00169] (c) Obtain a microbiome sample from source of interest.
[00170] (d) Optionally, lyse cells and/or extract microbial nucleic acid, if necessary.
[00171] (e) Prepare qPCR reaction(s) using the sample-formulation and the reference-formulation. Each of these formulations may further include other reaction components, for example, a nucleic acid polymerase, a deoxyribonucleotide triphosphate (dNTP), a reaction buffer, or a mixture thereof at appropriate concentrations.
[00172] (f) Perform a qPCR using appropriate reaction steps, temperatures, incubation times, fluorescence detection, cycle numbers, and/or melt curves.
[00173] (g) Determine and analyze reaction fluorescence intensities from the subtaxon probe and the reference-probe to detect and quantify target sequences within amplicons from target organisms at sub-taxon resolution. [00174] (h) Optionally, compare the calculated absolute abundance of the targeted sequence within the reaction to the abundance of the targeted sequence in other compositional datasets to standardize, normalize, and/or calibrate the abundances in the other reactions or results.
[00175] The fluorescence intensities attributable to sub-taxon probe may then be compared to that of the reference-probe to determine the relative abundance of each targeted sequence within each amplicon from the sample directly within each reaction.
[00176] After the abundance of the reference target within the sample and/or reaction is determined, comparison of the fluorescence intensity of the referenceprobe to the fluorescence intensity of the taxon-specific probe may be used to calculate the absolute abundance of the targeted taxon within the sample and/or reaction.
[00177] If a microbiome sample is being analyzed for different taxa and/or sub-taxa with distinct taxon and/or sub-taxon probes across distinct reactions, relative abundancies of the sample and the reference may be compared and/or normalized across reactions when the same reference-formulation is included in multiple reactions.
[00178] Quantification, normalization, and/or standardization may be achieved by comparing fluorescence intensities of target taxa to those of reference standards. The reference standards may be internal or external references/standards. For example, a known reference material (spike-in) may be included in a microbiome sample and/or multiple reactions. A reference-formulation including a reference primer pair and a reference probe targeting the reference material may enable quantification, normalization, and or standardization within or across reactions.
[00179] Within-reaction relative abundance measurements may eliminate the need for external calibration, references, and/or standard dilution series. This may significantly reduce the number of reactions required to quantify the abundance of an amplicon/sequence within a sample.
[00180] For example, a first set of primer pairs may specifically amplify a taxon within the genus Porphyromonas and a first sub-taxon probe may be used to detect sequence variation within the amplicon associated with Porphyromonas uenonis and/or a specific strain of Porphyromonas uenonis. A reference primer pair may specifically amplify a 16S rRNA gene region, and a reference-probe may target sequence(s) therein, which might be conserved across bacterial taxa. Alternatively, a reference primer pair and a reference-probe may target a reference sequence either within a microbiome sample or introduced to either the microbiome sample or reactions (such as a known oligonucleotide). Such sample and reference specific formulations thereby enable the detection, quantification, and comparison of each amplicon/sequence respectively.
[00181] In another example, after determining the absolute abundance of Porphyromonas uenonis within an aliquot of a complex microbiome sample, the absolute abundance of P. uenonis may be used as a standard (or reference) to calibrate the absolute abundancies of other taxa within compositional datasets obtained from NGS sequencing of the same microbiome sample.
[00182] If a biologically relevant or known amount of the reference material is present within the microbiome sample and/or a given reaction, its relative abundance compared to an unknown target (such as a bacterial taxon, genus, species, strain etc.) may be used to determine the absolute abundance of the amplicon/sequence of interest.
[00183] One example of a reference with biological relevance may be an amplicon/sequence targeting 16S rRNA genes, which are thought to be present in all bacteria. The total copy number of all bacterial 16S rRNA may provide a useful biological reference. Then, as a relevant measure of total bacterial biomass within a sample, a duplex reaction with reference-probes quantifying all 16S rRNA may allow one to determine the relative proportion of a taxon of interest within the total bacterial biomass of the sample.
[00184] Using 16S rRNA genes as a reference may be applicable for some bacteria. For example, if 16S rRNA gene copy number does not vary widely among such bacteria, 16S rRNA genes may be used as a reference for quantification purposes.
[00185] If 16S rRNA gene copy number may vary widely among some bacteria, another method may be used. Accordingly, a reference-target for total bacterial biomass within a complex microbial community may need to have three adjacent stretches (within an appropriately sized amplicon) of perfectly conserved sequences present in all bacteria (or all bacterial within the microbiome sample) with a known copy number. Alternatively, one may also target specific subsets of organism with biological relevance using marker genes with conserved sequences suitable for primers/probes. Examples of such marker genes are disclosed in a publication to Lan, Y., Rosen, G. & Hershberg, R. "Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains," Microbiome 4, 18 (2016); https://doi.org/10.1186/s40168- 016-0162-5. The entire contents of this publication, including its supplemental content, are incorporated herein by reference. These marker gene sites may be used for priming and probe sites that may provide a within-reaction reference to know the exact abundance of another target amplicon relative to the total number of all bacteria present, or subsets of bacteria, within the sample.
[00186] Another example for an internal reference comparison may be introducing a known reference template (such as a known oligonucleotide or amplicon) at a defined copy number within a given microbiome sample or reaction. In this method, one of the primer/probe sets specifically may target the template with a known absolute abundance, and then may compare the probe fluorescence intensity to that of the other primer/probe set for a given taxon/sequence. For example, with a formulation suitable for a Porphyromonas t/enon/s-specific, which targets an appropriately conserved single-copy gene, the absolute abundance of Porphyromonas uenonis within a complex microbiome sample may be determined. Within the qPCR reaction, the sample may be spiked-in with 100 copies of a reference oligonucleotide along with reference-primer/probe set specific for the reference oligonucleotide. If both the reference and Porphyromonas t/enon/s-specific probes may yield substantially same proportional increase in their respective fluorescence signal intensity (assuming identical amplification efficiencies), then it may be determined that there may also be 100 copies of the Porphyromonas uenonis amplicon (and therefore 100 Porphyromonas uenonis bacteria) within the original complex microbiome sample.
[00187] Furthermore, one potential application of this approach may be to pair this method with samples used for further Next-Generation Sequencing analysis. If the above-described method may be used to quantify the absolute abundance of a well- defined taxon or taxa within a complex community, this abundance measurement may subsequently be used with the relative abundance data obtained via Next- Generation Sequencing to calibrate and thereby calculate the absolute abundance of all other sequences within the complex sample.
[00188] For example, relative abundances of all the bacterial species present within a complex microbiome sample may be achieved by sequencing an aliquot of the same sample. By determining that there may be 100 Porphyromonas uenonis present in the original sample, all the Porphyromonas uenonis sequences present in the NGS dataset may be determined to originate from 100 bacteria. Accordingly, a user may calibrate and compare the relative abundance the Porphyromonas uenonis sequences to those of non- Porphyromonas uenonis sequences to calculate their abundances in the original complex sample.
[00189] Taxon-specific primer pairs and sub-taxon specific fluorescent probes specific for sequence variations among organisms within each group may enable the characterization of microbial communities at greater taxonomic resolution using qPCR-based technologies.
[00190] Single primer/probe sets may provide methods for detecting and quantifying microbes at sub-taxon level resolution (such as genus, species, and/or strains) within complex microbial communities. Furthermore, adding an additional fluorescent probe designed to distinguish sequence variation within amplicons from the taxon-specific probes may offer a method for determining the relative abundance of related organisms within a single reaction.
[00191] Additionally, reactions containing two or more sets of primers/probes may offer a novel method for comparing the relative abundance of distinct groups or organisms within complex samples. This second set of primers/probes may also be designed to target a reference sequence of known abundance, thereby enabling a direct, within-reaction comparison and absolute quantification of a target organism within a complex microbial community. Paired with Next-Generation Sequencing applications, such methods may offer a novel approach for calibrating compositional datasets to determine the absolute quantification of all organisms sequenced.
Example 6. Fluorescent probe Design
[00192] Fluorescent probes may be designed in the region amplified by a set of primers. These fluorescent probes may provide enhanced accuracy and specificity to the detection threshold for target nucleic acid regions. The following method may be applied to a target amplified region (50-150bp in length) to identify suitable probe locations. The fluorescent probes that meet the following criteria may be used. a) 13-25bp in length. b) Melt temperature 5-7°C above primer melt temperature. c) G+C% content of 30-80%. d) Preferential placement of the probes in close proximity to the primers. e) Specific placement of nucleotides and their relationship to the 3' minor groove binding moiety. f) No guanine in the 5' position. g) No repeating oligonucleotides consisting of 4 or more guanines. h) No repeating oligonucleotides consisting of 6 or more adenines. i) No cytosine dinucleotides in the middle third of the probe. j) Neither of the following two motifs in the 3' position: 5'-...GGG-3' or 5'- ...GGAG-3'.
[00193] These criteria may generate one or more viable fluorescent probes.
Additional considerations may be made when designing probes with a defining single nucleotide polymorphism. The SNP site may be preferentially placed in the middle third of the fluorescent probe, with a possible alternative position in the last third of the fluorescent probe, excluding the last two base pairs. The fluorescent probes used to detect SNPs may have less than/equal to 1 °C difference in melt temperature.
Example 7. Detecting and quantifying bacterial taxa using fluorescent probes.
[00194] Integrating one or more sequence-specific fluorescent probe(s) into reactions with one or more taxon-specific primers sets may increase signal specificity during real-time quantitative PGR reactions and enable additional applications for the characterization of microbiological samples.
[00195] We designed species-specific fluorescent probes to complement validated species-specific PGR primers (FIG. 9) for two species within the genus Porphyromonas. A schematic representation of the primer and the fluorescent probe designs, probe sequences, fluorescent labels, and quenchers are shown in FIGs. 10- 11.
[00196] First, two distinct species-specific primer sets targeting Porphyromonas somerae were selected to be complemented with species-specific fluorescent probes (FIGs. 12-14, primer set p0333/p0334 (SEQ ID NO: 1 and 2) targeting region pp43916 and p0335/p0336(SEQ ID NO: 3 and 4) targeting region pp49625). Each primer set targeted a different conserved region among all known P. somerae genomes. Within each amplicon expected from these species-specific primer sets, two regions conserved in all known species representatives were identified and targeted with species-specific fluorescent probes (FIGs. 9-14, fp0001 -fp0008 (SEQ ID NO: 9-16). For each of these two conserved regions, two fluorescent probes were created: one labeled with 5' 6-FAM (6-Carboxyfluorescein) and one labeled with 5' TAMRA NHS (5-Carboxytetramethylrhodamine N-Hydroxysuccinimide ester).
[00197] Similarly, a single species-specific primer set was designed to target a conserved region within all known Porphyromonas uenonis genomes (FIGs. 9-14, primer set p0325/p0326 (SEQ ID NO: 5-6)targeting region pp29025). Again, two conserved probe tagetes were identified within the anticipated amplicon, and fluorescent probes labeled with either 5' 6-FAM or 5' TAMRA were created for each (FIGs. 9-14, fp0009-fp0012 (SEQ ID NO: 17-20).
[00198] These species-specific primers and fluorescent probes were then used in a series of qPCR reactions to confirm i) species-specific amplification, ii) speciesspecific fluorescence signal using fluorescent probes, and iii) consistent quantification of target template regardless of the amplicon, probe-target site, or fluorescent molecule being detected.
[00199] Every primer set and appropriately paired FAM-labeled fluorescent probe were assessed in qPCR reactions with either a no template control (NTC), purified P. somerae gDNA (Ps), purified P. uenonis gDNA (Pu), or a complex microbial community from OpenBiome (OB) comprised of a mixture of stool donations from numerous healthy donors. Previous sequencing results indicated the OpenBiome community did not contain any Porphyromonas species, thereby providing a negative control within a complex bacterial community to ensure no inappropriate primer or probe cross-reactivity. [00200] At the end of the qPCR, reaction end products were run on agarose gels to confirm species-specific amplification of targeted amplicon regions for each speciesspecific primer set. As expected, each species-specific primer set yielded a correctly- sized PCR product only when genomic DNA of the targeted species was present as a template within the reaction (FIG. 15). In some cases, faint bands were observed in reactions where the complex stool-derived communities were provided as a template. However, all of these unintended products were smaller than intended amplicon sizes and likely reflected smaller primer-dimers or spurious products produced in the presence of complex templates.
[00201] Throughout the qPCR, the fluorescence intensity of each well was also assessed following each cycle using appropriate excitation and emission spectra for each fluorescent dye. For nearly every appropriate species-specific primer pair/probe combination, the correct fluorescent signal was only detected in reactions where the gDNA of the intended target species was provided as a template (FIGs. 15-16).
[00202] Furthermore, when analyzing the Ct values determined for each reaction, every correct primer/probe combination for a given species produced similar Ct values indicating they each provided very similar quantification values when the same amount of template gDNA was introduced in each reaction. In addition, despite a few instances of unintended small products observed when the OpenBiome community was introduced as a template, the fluorescent signal was never detected in these reactions (FIGs. 15-16). These findings confirmed the fluorescent probes only released dye when intended amplicons were produced, indicating the fluorescent probes reduced unintended background signals as compared to nonsequence-specific fluorescent dyes such as SYBR Green.
[00203] To determine whether incorrectly paired species-specific probes would produce unintended background fluorescent signal, each P. somerae-specific FAM- labelled probe was also purposefully paired with the incorrect P. somerae-specific primer set (expected to produce a non-targeted amplicon). In every case, the intended species-specific amplicon was observed on the agarose gel (FIG. 17). However, despite the intended amplicon being produced, there was no fluorescent signal detected above background levels (FIG. 18). As predicted, the fluorescent probes without sufficient homology to sequences within an amplicon resulted in no fluorescent dye being liberated from the probe. These results emphasize how fluorescent probe-based detection is highly specific, as illustrated by the fact that although both the primers and probes used were P. somerae-specific, they yielded no background signal because the sequence-specific probe site did not fall within the amplicon generated by species-specific primers.
[00204] Together, the results from this experiment revealed the FAM-labeled fluorescent probes yielded detectable signals in a species-specific manner only when the intended target species was introduced as template DNA as intended.
Furthermore, the Ct values observed for each target species were consistent regardless of the amplicon produced by the distinct species-specific primers. They were also consistent regardless of which region within the amplicon was targeted with the fluorogenic species-specific probe. In no instance was any substantial crossreactivity observed when the target species was not present. This held true when a closely related strain within the same Porphyromonas genus was present, as well as when complex and diverse human stool-derived communities were present within the OpenBiome templates. Furthermore, when targeted species were not directly introduced in a reaction there was no background fluorescence detected, as indicated by the absence of Ct values in reactions where the targeted species was not introduced to the reaction.
Example 8. Sensitivity of fluorescent probe-based detection.
[00205] Next, to assess the sensitivity of fluorescent probes, we conducted qPCR reactions using appropriate primer/probe sets against serial dilutions of targeted template gDNA. Each validated species-specific primer and appropriate FAM-labelled probe combination that passed initial quality control reactions were subjected to serial 10-fold dilutions of target template gDNA. Based upon the DNA concentration in each starting gDNA solution and the size of the genome for each respective strain, we calculated the template copy number present in each serial dilution and within each reaction.
[00206] Again, regardless of which amplicon was produced by species-specific primers or which region within each amplicon was targeted with species-specific fluorescent probes, very similar Ct values were observed for each serial dilution (P. somerae probes FIGs. 19-20; and P. uenonis probes FIGs. 21-22). Furthermore, each appropriate primer/probe set was able to detect the presence of target species when present at very low copy numbers in each reaction. In many instances, P. somerae was detected when as few as approximately seven copies of template were present in each reaction, and sometimes when as few as approximately four copies of P. uenonis were present in each rection. In every serial dilution, regardless of amplicon or probe target region, similar results were obtained for each respective template species when tens of template copies were present within the reaction.
Example 9. Detecting and quantifying bacterial taxa using additional fluorescent probes.
[00207] To demonstrate the ability to detect and quantify targeted bacteria with different types of fluorescent probes, we next assessed the same species-specific primer sets with the aforementioned TAMRA-labeled fluorescent probes. Again, these probes target the same sequence-specific binding sites but rely upon a different fluorescent dye for signal detection.
[00208] Here, each TAMRA-labeled probe was assessed in reactions with appropriately paired primer sets and purified genomic DNA from their intended target species as a template (FIG. 23). Simultaneously each primer set was also assessed on the same templates using the same target species for template gDNA using previously assessed FAM-based fluorescent probes to enable the direct comparison of each fluorescent signal within the same reaction plate. [00209] Reaction end products were run on an agarose gel, and the expected amplicon products were observed in nearly all reactions except for one primer pair in the presence of a TAMRA-labeled probe (p0335/p0336 (SEQ ID NO: 3 and 4), fp0008 (SEQ ID NO: 16)) (FIG. 23). When assessing the amplification curves of the qPCR reactions, we observed very similar Ct values for specific amplicons and probe sites regardless of which fluorescent marker was included in the probe. The only exceptions were reactions using TAMRA-labeled probes fp0006 (SEQ ID NO: 14), which resulted in an abnormally low Ct value, and fp0008 (SEQ ID NO: 16) for which no fluorescence was detected above background, likely due to the fact that no target amplicon was produced in this reaction.
[00210] Together, these results demonstrate that sequence-specific probes labeled with different fluorescent markers may be used to detect and quantify bacteria present within a reaction and that similar quantification values were obtained regardless of the fluorescent molecule used in the probe.
Example 10. Multiplex reactions quantifying a single species with two speciesspecific fluorescent probes.
[00211] Following the preliminary validation of both FAM- and TAMRA-labelled fluorogenic species-specific probes, we initiated a series of multiplex qPCR reactions to illustrate how multiple primer/probe sets can be used within a single reaction to simultaneously detect and quantify distinct amplicons/target sequences.
[00212] Since two P. somerae-specific primer sets targeting distinct regions had previously been validated, along with both FAM- and TAMRA-labeled probes targeting two distinct regions within each amplicon, we first assessed all possible pairwise combinations to quantify both amplicons within a single, multiplex qPCR reaction. Each reaction contained two distinct primer sets, each targeting a different region of the P. somerae genome. Each reaction also contained two species-specific probes with different fluorescent markers targeting regions within each amplicon. Accordingly, both amplicons were expected to be detectable with different colored fluorescent signals.
[00213] Reaction end products run on agarose gels revealed each multiplex reaction successfully produced two distinct PCR products of the appropriate size (112bp and 132bp), as expected from each set of species-specific primers (FIG. 24). When analyzing the fluorescence from each qPCR reaction, every reaction containing template P. somerae gDNA yielded both FAM- and TAMRA-specific emissions indicating the presence of both amplicons was detected with each amplicon-specific fluorescent probe. Furthermore, the Ct values obtained from both FAM and TAMRA fluorescent signals were very similar in value, as expected with target regions that are each present only once within the P. somerae genome and therefore present in the same copy number at the beginning of each reaction.
[00214] Taken together, these results confirm that both species-specific amplicons, both species-specific probe binding sites within each, and both colors of fluorescently labeled sequence-specific probes could be used to accurately determine the abundance of targeted organisms. Furthermore, when labeled with differently colored fluorescent probes, all possible appropriately paired primer/probe sets assessed here could be combined in multiplex reactions while maintaining accurate template quantification.
Example 11 . Multiplex reactions quantifying two different species within the same well using differentially labeled species-specific fluorescent probes.
[00215] Next, we conducted multiplexed qPCR reactions with species-specific primers and differentially labeled species-specific fluorescent probe combinations targeting both P. somerae and P. uenonis within the same reaction. Here, previously validated primer/probe combinations specific for either P. somerae or P. uenonis were combined to simultaneously determine the abundance of each species within the same reaction (FIGs. 25-27). [00216] Each reaction contained two sets of species-specific primers and two differentially labeled (FAM or TAMRA) species-specific fluorescent probes. All possible pairwise combination of differentially labeled species-specific primers/probe sets were then used in qPCR reactions containing either a No Template Control, only P. somerae gDNA, only P. uenonis gDN A, or both P. somerae and P. uenonis gDNA. Reaction end products analyzed with agarose gel electrophoresis confirmed that within each reaction species-specific amplicons of the correct size were only produced in reaction where the appropriate template strain gDNA was present. This result confirmed that each species-specific primer set could be multiplexed with one another without the formation of spurious, unintended products on these closely related template genomes.
[00217] Additionally, analysis of the qPCR reaction fluorescence emissions also revealed species-specific emission spectra capable of determining the presence and quantity of both species within each reaction. Reaction Ct values revealed speciesspecific fluorescent signal, which could be used to both i) identify the presence of, and ii) quantify the abundance of each species present in each multiplex reaction. Importantly, very similar Ct values were observed for the abundance of each species regardless of which color fluorescent probe was used, which species-specific region was targeted with the probe, and regardless of which amplicon was targeted in P. somerae. Combined, these findings suggest these primers and probes could be multiplexed in almost every possible pairwise combination and provide consistent results.
[00218] Furthermore, since each species-specific primer/probe combination could be used to quantify the abundance of each species present within the same reaction, the fluorescent intensity of each probe could be used to directly determine the relative abundance of two different species within the same reaction. Accordingly, we constructed a series of multiplex reactions containing primers and probes specific for both P. somerae and P. asaccharolytica within the same well, then assessed them against their intended targets alone, combined, and within a diverse background community at varying relative abundance (FIGs. 28-29). Primers specific for P. somerae (p0325 and p0326 (SEQ ID NO: 5 and 6) were paired with either a FAM- labeled (fp0003 (SEQ ID NO: 11) or TAMRA-labeled (fp0004 (SEQ ID NO: 12) P. somerae probe. Within the same reactions, primers specific for P. uenonis (p0333 and p0334 (SEQ ID NO: 1 and 2) were also included along with either a TAMRA- labeled (fpOO1O (SEQ ID NO: 18)) or FAM-labeled (fp0009) (SEQ ID NO: 17) P. asaccharolytica probe, respectively. In this manner, reactions were capable of quantifying both P. somerae and P. asaccharolytica within the same well according to the fluorescent signal obtained from their respective species-specific probes. These multiplexed reactions were then assessed against template from either target species alone in the form a 10-fold serial dilution of target gDNA templates (FIGs. 30-31). Regardless of the fluorescent marker associated with the species-specific probe, Ct values were only observed from the correct fluorescent dye when the intended target was present, again demonstrating species-specific quantification. Furthermore, the relative values of the observed Ct values varied in accordance with their known abundance across at least five orders of magnitude and Ct values were obtained at 40 or fewer copies of target template in every instance. Next, we held the abundance of one strain constant with hundreds of thousands of target copies (P. somerae, 672,238; P. uenonis, 402,737) while also including a serial 10-fold dilution series of gDNA from the other target species to determine whether we could quantify both strains when one was present as a minority population (FIGs. 32-33). Indeed, in each instance we maintained our ability to quantify both species simultaneously across at least four orders of magnitude. Finally, we determined the relative abundance of both strains in a similar dilution series while including a 1 :100 dilution of a complex and diverse microbial community (OpenBiome) present within the reaction (FIGs. 34-35). Again, we obtained Ct values capable of determining the abundance of both target species differing across at least four orders of magnitude and reflecting minority populations below 1000 copies of the target species present within a complex background community. While limited to only two species in these experiments, we anticipate similar multiplexed reactions could be used to determine the presence and relative abundance of multiple species in more complex communities as well.
[00219] All articles, patents, patent applications, and other publications that have been cited in this disclosure are incorporated herein by reference.
[00220] In this disclosure, the indefinite article "a" and phrases "one or more" and "at least one" are synonymous and mean "at least one".
[00221] Relational terms such as "first" and "second" and the like may be used solely to distinguish one entity or action from another, without necessarily requiring or implying any actual relationship or order between them. The terms "comprises,” "comprising," and any other variation thereof when used in connection with a list of elements in the specification or claims are intended to indicate that the list is not exclusive and that other elements may be included. Similarly, an element preceded by an "a" or an "an" does not, without further constraints, preclude the existence of additional elements of the identical type.
[00222] The abstract is provided to help the reader quickly ascertain the nature of the technical disclosure. It is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the claims. In addition, various features in the foregoing detailed description are grouped together in various examples to streamline the disclosure. This method of disclosure should not be interpreted as requiring claimed examples to require more features than are expressly recited in each claim. Rather, as the following claims reflect, inventive subject matter lies in less than all features of a single disclosed example. Thus, the following claims are hereby incorporated into the detailed description, with each claim standing on its own as separately claimed subject matter.

Claims

52
WHAT IS CLAIMED IS
1 . A method of determining presence/absence, relative abundance, and/or absolute abundance of specific bacteria in a microbiome sample, comprising: obtaining the microbiome sample that potentially comprises at least one nucleic acid; processing the microbiome sample to have the at least one nucleic acid accessible to react with a specific primer pair; mixing the processed microbiome sample with a qPCR formulation to form a microbiome reaction mixture; subjecting the microbiome reaction mixture to a qPCR under which at least one section of the accessible nucleic acid can be amplified and produce a fluorescence signal; measuring amount of fluorescence signal produced; and identifying whether the specific bacteria are present in the microbiome sample, and/or, if the specific bacteria are present in the microbiome, determining relative abundance, and/or absolute abundance of the specific bacteria in the microbiome sample; wherein the qPCR formulation comprises: at least one pair of species-specific unlabeled primers targeting at least one taxon, wherein each primer pair consists of a forward primer and a reverse primer, and wherein a pair of species-specific unlabeled primers is hereafter called "primer pair"; at least one nucleic acid polymerase; at least one species-specific fluorescent probe targeting at least one member of the taxon, wherein said species-specific 53 fluorescent probe is hereafter called "sub-taxon probe" ; and the sub-taxon probe is a sequence-specific oligonucleotide with a covalently bound fluorescent dye and a covalently bound non-fluorescent quencher, wherein said fluorescent dye is hereafter called "sub-taxon fluorescent dye," and wherein said non-fluorescent quencher is hereafter called "subtaxon quencher." thod of treatment of a patient, comprising: obtaining a microbiome sample from the patient, wherein the microbiome sample potentially comprises at least one nucleic acid; processing the microbiome sample to have the at least one nucleic acid accessible to react with a specific primer pair designed specifically for identification of the specific bacteria present in the microbiome; mixing the processed microbiome sample with a qPCR formulation to form a microbiome reaction mixture; subjecting the microbiome reaction mixture to a qPCR under which at least one section of the accessible nucleic acid can be amplified and produce a fluorescence signal; measuring amount of fluorescence signal produced; identifying whether the specific bacteria are present in the microbiome sample, and/or, if the specific bacteria are present in the microbiome, determining relative abundance, and/or absolute abundance of the specific bacteria in the microbiome sample; forming a patient bacteria profile based on said identification; 54 comparing the patient bacteria profile with a bacteria profile of a healthy patient; determining whether the patient has a disease, or determining progression of a disease of the patient; and treating the patient if the patient has a disease; wherein the qPCR formulation comprises: at least one pair of species-specific unlabeled primers targeting at least one taxon, wherein each primer pair consists of a forward primer and a reverse primer, and wherein a pair of species-specific unlabeled primers is hereafter called "primer pair"; at least one nucleic acid polymerase; at least one species-specific fluorescent probe targeting at least one member of the taxon, wherein said species-specific fluorescent probe is hereafter called "sub-taxon probe"; and the sub-taxon probe is a sequence-specific oligonucleotide with a covalently bound fluorescent dye and a covalently bound non-fluorescent quencher, wherein said fluorescent dye is hereafter called "sub-taxon fluorescent dye," and wherein said non-fluorescent quencher is hereafter called "subtaxon quencher."
3. The method of any of the preceding claims or the following claims, wherein the method further comprises having at least one primer pair designed to specifically amplify a genus and/or a specific clade; and having a sub-taxon probe designed to detect a species and/or a specific strain of the species within the genus and/or the specific clade. 55
4. The method of any of the preceding claims or the following claims, wherein the method further comprises having at least one primer pair designed to specifically amplify a genus and/or a clade; and having a sub-taxon probe designed to detect a species through a sequence variation and/or a specific strain of the species.
5. The method of any of the preceding claims or the following claims, wherein the at least one primer pair does not target 16S rRNA.
6. The method of any of the preceding claims or the following claims wherein the sub-taxon probe does not target 16S rRNA.
7. The method of any of the preceding claims or the following claims, the subtaxon probe excludes a 3’-hydroxyl group to ensure that the nucleic acid polymerase does not use this probe to initiate or extend nucleic acid synthesis, and prevent unintended amplification products.
8. The method of any of the preceding claims or the following claims, the qPCR formulation comprises at least two sub-taxon probes, and wherein each sub-taxon probe has a different sub-taxon fluorescent dye than that of the other sub-taxon probes.
9. The method of any of the preceding claims or the following claims, the qPCR formulation comprises at least two sub-taxon probes, and wherein each subtaxon probe has a different sub-taxon fluorescent dye and a different sub-taxon quencher than those of the other sub-taxon probes.
10. The method of any of the preceding claims or the following claims, wherein the qPCR formulation comprises at least two sub-taxon probes; wherein each subtaxon probe has a different sub-taxon fluorescent dye than that of the other subtaxon probes; and wherein relative abundance of different sub-taxon variants is determined by choosing a reference fluorescence intensity of one of the sub-taxon probe's fluorescent dye as a point-of-reference and comparing fluorescence intensities of other sub-taxon probes' fluorescent dyes with the reference fluorescence intensity.
11 . The method of any of the preceding claims or the following claims, wherein the qPCR formulation comprises at least two sets of the primer pairs; wherein each set of the primer pairs is specific to a taxon; and wherein each set of the primer pairs is different than other sets of the primer pairs.
12. The method of any of the preceding claims or the following claims, wherein the qPCR formulation comprises at least two fluorescent probes specific to taxon, wherein the fluoresecence probes specific to taxon is hereafter called taxon-probe; wherein each taxon-probe has a different fluorescent dye than that of the other taxon-probes; wherein relative abundance of different taxa are determined by choosing a reference fluorescence intensity of one of the taxon-probe's fluorescent dye as a point-of-reference and comparing fluorescence intensities of other taxonprobes' fluorescent dyes with the reference fluorescence intensity.
13. The method of any of the preceding claims or the following claims, wherein the qPCR formulation comprises at least two fluorescent probes specific to taxon, wherein hereafter fluorescent probes specific to taxon is called taxon-probe; wherein each taxon-probe has a different fluorescent dye and a quencher than those of the other taxon-probes; wherein relative abundance of different taxa are determined by choosing a reference fluorescence intensity of one of the taxon-probe's fluorescent dye as a point-of-reference and comparing fluorescence intensities of other taxonprobes' fluorescent dyes with the reference fluorescence intensity.
14. The method of any of the preceding claims or the following claims, wherein the qPCR formulation further comprises at least one reference primer pair, and at least one reference fluorescent probe; wherein the reference fluorescent probe is a sequence-specific oligonucleotide with a covalently bound reference fluorescent dye and a covalently bound non-fluorescent reference quencher; and wherein said reference fluorescent dye is a fluorophore different than other sub-taxon fluorescent dyes.
15. The method of any of the preceding claims or the following claims, wherein the qPCR formulation further comprises at least one reference primer pair, and at least one reference fluorescent probe; wherein the reference fluorescent probe is a sequence-specific oligonucleotide with a covalently bound reference fluorescent dye and a covalently bound non-fluorescent reference quencher; wherein the reference fluorescent dye is a fluorophore different than the sub-taxon fluorescent dye(s); and wherein the non-fluorescent reference quencher is a quencher different than other sub-taxon quenchers.
16. The method of any of the preceding claims or the following claims, wherein the qPCR formulation further comprises at least one reference-material with known quantity, and a reference fluorescent probe; and wherein absolute abundance of each taxon is determined by comparing fluorescence intensity of each taxon-probe with that of the reference-material.
17. The method of any of the preceding claims or the following claims, wherein the reference-material comprises a predetermined amount of oligonucleotide.
18. The method of any of the preceding claims or the following claims, wherein the qPCR formulation further comprises a fluorescent probe and a primer pair, which are specific for determination of total number of marker genes of bacteria present in the sample; and wherein the method further comprises determining total number of marker genes, using said total number of marker genes as a point-of-reference, and determining relative proportion of a taxon of interest within the total bacterial biomass of the sample.
19. The method of any of the preceding claims or the following claims, wherein the qPCR formulation further comprises a reference fluorescent probe specific for determination of total copy number of all bacterial 16S rRNA; and wherein the 58 method further comprises determining the total copy number of all bacterial 16S rRNA, using said total copy number as a point-of-reference, and determining relative proportion of a taxon of interest within the total bacterial biomass of the sample.
20. The method of any of the preceding claims or the following claims, the reference-material comprises a predetermined amount of 16S rRNA genes.
21 . The method of any of the preceding claims or the following claims, wherein the method further comprises extracting nucleic acid after obtaining the microbiome sample.
22. The method of any of the preceding claims or the following claims, wherein the method further comprises lysing cells after obtaining the microbiome sample.
23. The method of any of the preceding claims or the following claims, the subtaxon probe and/or the reference fluorescent probe has a minor groove binder to stabilize each probe's nucleic acid binding stability.
24. The method of any of the preceding claims or the following claims, wherein the method further comprises having a pre-determined threshold fluorescence intensity; and wherein the fluorescence intensity below the threshold-fluorescence intensity is indicative of absence of a specific target in the microbiome sample, or the fluorescence intensity above the threshold-fluorescence intensity is indicative of presence of a specific target in the microbiome sample.
25. The method of any of the preceding claims or the following claims, wherein the qPCR formulation further comprises a dNTP, a reaction buffer, or a combination thereof.
26. The method of any of the preceding claims or the following claims, wherein the method is used to determine presence/absence, relative abundance, and/or absolute abundance of microbes at sub-taxon resolution, and wherein the sub-taxon resolution comprises resolution of genus, species, and/or strains of a microbial community. 59
27. The method of any preceding claims or any following claims, wherein genus of the bacteria has at least one sub-taxon, or at least two sub-taxa.
28. The method of any preceding claims or any following claims, wherein genus of the bacteria has at least one sub-taxon, or at least two sub-taxa.
29. The method of any preceding claims or any following claims, wherein the specific bacteria is Porphyromonas.
30. The method of any preceding claims or any following claims, wherein the specific bacteria belong to at least one species of the Porphyromonas genus.
31 . The method of any preceding claims or any following claims, wherein the target bacteria belong to Porphyromonas somerae, Porphyromonas uenonsis, Porphyromonas asaccharolytica, or a combination thereof.
32. The method of any preceding claims or any following claims, wherein the qPCR formulation comprises at least two specific primer pairs; wherein each specific primer pair comprises a forward primer and a reverse primer; and wherein at least one first specific primer pair is capable of amplifying a first species belonging a first sub-taxon of the target bacteria and at least one second specific primer pair is capable of amplifying a second species belonging a second sub-taxon of the specific bacteria.
33. The method of any preceding claims or any following claims, wherein: the qPCR formulation comprises a primer pair; the primer pair comprises a forward primer and a reverse primer; the primer pair is selected from the primer pairs of FIG. 9, Primer IDs p0325 to p0326 (SEQ ID NO: 5-6), p0333 to p0336 (SEQ ID NO: 1-4), p0387 to p0388 (SEQ ID NO: 7-8), or a combination thereof; and 60 the sub-taxa probe is selected from the species-specific fluorescent probes of FIG. 10, Probe IDs fpOOOl to fp0012 (SEQ ID NO: 9- 20), fp0022 (SEQ ID NO: 21), fp0023 (SEQ ID NO: 22), or a combination thereof.
34. The method of any preceding claims or any following claims, the disease comprises (chronic) oral infections, cancers, neurodegenerative diseases, or a combination thereof.
35. The method of any preceding claims or any following claims, wherein the disease comprises colorectal cancer, endometrial cancer, gastric adenocarcinomas, and cervical cancer, P. aeruginosa pulmonary infections in cystic fibrosis, oral pathological process, or a combination thereof.
36. The method of any preceding claims or any following claims, wherein the disease comprises an oral pathological process, wherein the oral pathological process comprises periodontitis, oral squamous cell carcinomas, or a combination thereof.
37. The method of any preceding claims or any following claims, wherein the disease comprises colorectal cancer.
38. The method of any preceding claims or any following claims, wherein the microbiome sample comprises stool, saliva, skin, nasal swab, vaginal swab, blood, urine, hair, or oral swab.
39. The method of any preceding claims or any following claims, wherein the patient is a human or an animal.
40. The method of any preceding claims or any following claims, wherein the method further comprises administering a therapeutic to the patient.
41 . The method of any preceding claims or any following claims, wherein the therapeutic is not chemotherapy and/or radiation. 61
42. A diagnostic kit comprising one or more primer pairs, and one or more subtaxa probes of any preceding claims or any following claims.
43. The diagnostic kit of any preceding claims or any following claims further comprising a reference standard.
44. A nucleic acid having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to any one of the sequences of the primer pairs of FIG. 10, Primer IDs p0325 to p0326 (SEQ ID NO: 5-6), p0333 to p0336 (SEQ ID NO: 1-4), p0387 to p0388 (SEQ ID NO: 7-8), or any combination thereof.
45. A synthetic primer pair comprising a synthetic forward primer and/or a synthetic reverse primer, each having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology to any one of the synthetic forward primers and/or the synthetic reverse primers of the primer pairs of FIG. 10, Primer IDs p0325 to p0326 (SEQ ID NO: 5-6), p0333 to p0336 (SEQ ID NO: 1-4), p0387 to p0388 (SEQ ID NO: 7-8), or any combination thereof.
PCT/IB2022/061290 2021-11-23 2022-11-22 Systems, formulations and methods for microbial detection and quantification WO2023094992A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163264499P 2021-11-23 2021-11-23
US63/264,499 2021-11-23

Publications (1)

Publication Number Publication Date
WO2023094992A1 true WO2023094992A1 (en) 2023-06-01

Family

ID=84369891

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2022/061290 WO2023094992A1 (en) 2021-11-23 2022-11-22 Systems, formulations and methods for microbial detection and quantification

Country Status (1)

Country Link
WO (1) WO2023094992A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018185015A1 (en) 2017-04-03 2018-10-11 Sidel Participations Installation for treating containers and method for changing format
US20210079447A1 (en) * 2019-07-12 2021-03-18 California Institute Of Technology Absolute quantification of nucleic acids and related methods and systems
WO2021146338A1 (en) * 2020-01-13 2021-07-22 California Institute Of Technology Rodent model and related device, compositions, methods and systems

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018185015A1 (en) 2017-04-03 2018-10-11 Sidel Participations Installation for treating containers and method for changing format
US20210079447A1 (en) * 2019-07-12 2021-03-18 California Institute Of Technology Absolute quantification of nucleic acids and related methods and systems
WO2021146338A1 (en) * 2020-01-13 2021-07-22 California Institute Of Technology Rodent model and related device, compositions, methods and systems

Non-Patent Citations (11)

* Cited by examiner, † Cited by third party
Title
AYAKA YAZAWASHIGEKI KAMITANINAOYUKI TOGAWA: "Method for absolute quantification of microbial communities by using both microarrays and competitive PCR", JOURNAL OF MICROBIOLOGICAL METHODS, vol. 165, 2019, XP085867777, DOI: 10.1016/j.mimet.2019.105718
FAJARDO, THOR VINICIUS MARTINS, VANNI, MARCOS FERNANDO, NICKEL, OSMAR.: "Absolute quantification of viruses by TaqMan real-time RT-PCR in grapevines", CIENCIA RURAL, vol. 47, no. 6, 2017, pages e20161063
FLORENCIA TETTAMANTI BOSHIERSUJATHA SRINIVASANANTHONY LOPEZNOAH G. HOFFMANSEAN PROLLDAVID N. FREDRICKSJOSHUA T. SCHIFFER: "Complementing 16S rRNA gene amplicon sequencing with estimates of total bacterial load to infer absolute species concentrations in the vaginal microbiome", AMERICAN SOCIETY FOR MICROBIOLOGY, vol. 5, Retrieved from the Internet <URL:https://doi.org/10.1101/598771.>
LAN, Y.ROSEN, GHERSHBERG, R: "Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains", MICROBIOME, vol. 4, 2016, pages 18, Retrieved from the Internet <URL:https://doi.org/10.1186/s40168-016-0162-5>
LEY, R.TURNBAUGH, P.KLEIN, S. ET AL.: "Human gut microbes associated with obesity", NATURE, vol. 444, 2006, pages 1022 - 1023, Retrieved from the Internet <URL:https://doi.org/10.1038/4441022a>
NADINE J. DECOSTEVIJAY J. GADKARMARTIN FILION: "Relative and Absolute Quantitative Real-Time PCR-Based Quantifications of hcnC and phlD Gene Transcripts in Natural Soil Spiked with Pseudomonas sp. Strain LBUM300", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 77, no. 1, December 2010 (2010-12-01), pages 41 - 47
OTT SJMUSFELDT MULLMANN UHAMPE JSCHREIBER S: "Quantification of intestinal bacterial populations by real-time PCR with a universal primer set and minor groove binder probes: a global approach to the enteric flora", J CLIN MICROBIOL, vol. 42, no. 6, June 2004 (2004-06-01), pages 2566 - 72, XP002428203, DOI: 10.1128/JCM.42.6.2566-2572.2004
OTT STEPHAN J ET AL: "Quantification of intestinal bacterial populations by real-time PCR with a universal primer set and minor groove binder probes: a global approach to the enteric flora", JOURNAL OF CLINICAL MICROBIOLOGY, AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 42, no. 6, 1 June 2004 (2004-06-01), pages 2566 - 2572, XP002428203, ISSN: 0095-1137, DOI: 10.1128/JCM.42.6.2566-2572.2004 *
RUTH E. LEYFREDRIK BACKHEDPETER TURNBAUGHCATHERINE A. LOZUPONEROBIN D. KNIGHTJEFFREY I. GORDON: "Obesity alters gut microbial ecology", PNAS, vol. 102, no. 31, 2 August 2005 (2005-08-02), pages 11070 - 11075, XP002678829, Retrieved from the Internet <URL:https://doi.org/10.1073/pnas.0504978102> DOI: 10.1073/PNAS.0504978102
TINA L. FIEDLERROBERT W. HALLFREDERICK J. ROSSCONNOR O. MCCOYROGER BUMGARNERJEANNE M. MARRAZZODAVID N. FREDRICKS: "Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria", PLOS ONE, vol. 7, June 2012 (2012-06-01), pages e37818
ZHANG CZHENG XZHAO C ET AL.: "Detection of pathogenic microorganisms from bloodstream infection specimens using TaqMan array card technology", SCI REP, vol. 8, no. 1, 2018, pages 12828

Similar Documents

Publication Publication Date Title
Ishmael et al. Principles and applications of polymerase chain reaction: basic science for the practicing physician
CN108441565B (en) Fluorescence labeling multiplex amplification kit for 37 STR loci of human Y chromosome and application thereof
DK2714939T3 (en) DETECTION OF METHICILLIN-RESISTENT STAPHYLOCOCCUS AUREUS
JP2023504258A (en) Methods of identifying microbes in clinical and non-clinical settings
CN106414738A (en) Detection of single nucleotide polymorphisms in human kras
Derzelle et al. Use of high-resolution melting and melting temperature-shift assays for specific detection and identification of Bacillus anthracis based on single nucleotide discrimination
Luque-González et al. Identification of Trypanosomatids by detecting Single Nucleotide Fingerprints using DNA analysis by dynamic chemistry with MALDI-ToF
CN108456721B (en) Method for synchronously detecting gene mutation and methylation and application thereof
US11279982B2 (en) EGFR assay
Debruyne et al. Comparative performance of different PCR assays for the identification of Campylobacter jejuni and Campylobacter coli
Mianzhi et al. Contemporary nucleic acid-based molecular techniques for detection, identification, and characterization of Bifidobacterium
JP5916740B2 (en) Quantitative multiple identification of nucleic acid targets
JP5900908B2 (en) Single nucleotide repeat polymorphism analysis method and single nucleotide polymorphism analysis method
US10041130B2 (en) Method of determining types I, II, III, IV or V or methicillin-resistant Staphylococcus aureus (MRSA) in a biological sample
EP1802771A1 (en) Detection, identification and differentiation of serratia species using the spacer region
WO2023094992A1 (en) Systems, formulations and methods for microbial detection and quantification
JP2024509840A (en) Multiplexed genotyping assay with single probe using fluorescence amplitude adjustment
US9234248B2 (en) Simultaneous quantitative multiple primer detection of Clostridium difficile
EP2839025B1 (en) Compositions and methods for detection of microorganisms of the mycobacterium avium complex excluding mycobacterium avium paratuberculosis
EP2834369B1 (en) Compositions and methods for detection of mycobacterium avium paratuberculosis
JP4766878B2 (en) Detection, identification and discrimination of eubacteria using hybridization assays
JP5641465B2 (en) Single nucleotide repeat polymorphism analysis method and single nucleotide polymorphism analysis method
EP3822370A1 (en) Method of determining the presence of a hyper-virulent clostridioides difficile strain of the b1/nap1/027 group in a sample
WO2022261365A1 (en) Primers and methods for microbial detection and quantification of porphyromonas in a sample
CN116790771A (en) Method and primers for detection of mycoplasma in samples by PCR

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22817381

Country of ref document: EP

Kind code of ref document: A1