WO2023093021A1

WO2023093021A1 - Recombinant long-acting human growth hormone fusion protein and its use thereof

Info

Publication number: WO2023093021A1
Application number: PCT/CN2022/100114
Authority: WO
Inventors: Suofu QIN; Juan Li; Dongmei Zhou; Qiongying YOU; Wei Zhang
Original assignee: Shenzhen Kexing Pharmaceutical Co., Ltd.
Priority date: 2021-11-26
Filing date: 2022-06-21
Publication date: 2023-06-01
Also published as: CN115873127A

Abstract

Provided are an Fc fragment mutant, a fusion protein, a nucleic acid molecule, an expression vector, a recombinant cell, pharmaceutical composition and use thereof, and a method for preventing or treating a disease associated with abnormal growth hormone. The Fc fragmentmutant has an amino acid sequence as shown in any one of SEQ ID NOs: 2 to 7; the fusion protein comprises: asecond peptide comprising a bioactive molecular functional region, and a third peptide connected with the second peptide, the third peptide comprising an Fc fragment mutant according to any one of the above-mentioned Fc fragment mutant.

Description

RECOMBINANT LONG-ACTING HUMAN GROWTH HORMONE FUSION PROTEIN AND ITS USE THEREOF

CROSS-REFERENCE TO RELATED APPLICATION

This application claims the benefits of Chinese Patent Application 202111420842.9, filed November 26, 2021, and Chinese Patent Application 202210395423.2, filed April 14, 2022, which are incorporated herein by reference in their entirety.

FIELD

The present disclosure relates to the field of molecular biology and medicine. Specifically, the present invention relates to recombinant long-acting human growth hormone fusion protein and itsuse thereof. More specifically, the present invention relates to an Fc fragmentmutant, a fusion protein, a nucleic acid molecule, an expression vector, a recombinant cell, a pharmaceutical composition and its use thereof, and a method of preventing and/or treating a diseaseassociated withabnormal growth hormone.

BACKGROUND

Growth hormone deficiency is a well-recognized clinical syndrome associated with many metabolic abnormalities, including abnormal body composition, decreased physical performance, altered lipid metabolism, decreased bone mass, increased insulin resistance, and decreased quality of life. Most metabolic abnormalities associated with growth hormone deficiency couldbe reversed with recombinant human growth hormone (rhGH) replacement. Traditional treatment for growth hormone deficiency involves daily subcutaneous injections of rhGH, but the treatment is cumbersome and inconvenient for many patients, which in turn raises concerns about poor compliance to treatment, and may lead to reduced efficacy. Long-acting rhGH preparations or long-acting growth hormone (GH) preparations not only reduce the number of injections and improve compliance to treatment but also help to improve the therapeutic effect of GH.

Therefore, there is still an urgent need to develop a new fusion protein that can effectively treat growth hormone deficiency.

SUMMARY

The present invention is accomplished based on the following findings of the inventor:

In the research and development process, the inventors surprisingly found that if specific sites of the wild-type IgG1 Fc fragmentwere mutated (such as P228 del, C229 del, P230 del, T366R, L368H, P395K and K409Xaa; or P228 del, C229 del, T366R, L368H, P395K, and K409Xaa; where in K409Xaa, Xaa represent D or T) , the Fc fragment in the native dimer form could be expressed to form the Fcfragment mutant in the form of a monomer. In addition, it is further found that the fusion protein in the form of monomer could be formed by fusion of the above-mentioned Fc fragment mutant and growth hormone, which could be purified by ProteinAand simplify the purification process. More importantly, the fusion protein obtained a strong binding activity of human growth hormone receptor, good promoting cell proliferation activity and good reporter gene cell expression luciferase activity, as well as longer half-life and betterin vivo biological activity.

Therefore, in the first aspect, the present invention relates to anFc fragmentmutant. According to an embodiment of the present invention, the Fc fragment mutant comprises a first peptide, the first peptide comprises mutations at the following positions in comparison to a wild-type IgG1 Fc fragment: positions 228, 229, 366, 368, 395 and 409, and optional position 230.

In the research and development process, the inventors found that the above-mentioned mutations could be beneficial to the formation of monomeric Fc fragment mutant after the expression of the Fc fragment in the native dimer form. The Fc fragment mutant in the form of a monomer could be fused with bioactive molecules, which could be subsequently purified by ProteinA and simplify the purification process. More importantly, the fusion protein obtained by the Fc fragment mutanthasa higher in vitro and in vivo activity, and lower ADCC and CDC effects.

It should be noted that the Fc fragment of the IgG antibodyreferredin this patent refers to the CH2 region and the CH3 regions ofthe IgG antibody.

For example, the amino acid sequence of a wild-type IgG1Fc fragment (including CH2-CH3) is as follows:

It should be noted that the wild-type IgG1Fc fragment referred to in this patent refers to the wild-type IgG1Fc fragment of human.

The amino acid sequence of the hinge region fragment of the wild-type IgG1is as follows:

DKTHTG (SEQ ID NO: 41) .

The nucleotide sequence of the hinge region fragment of the wild-type IgG1 is as follows:

GACAAGACACACACCGGA (SEQ ID NO: 42) .

In the second aspect, the present invention relates toa fusion protein. According to an embodiment of the present invention, the fusion protein comprises: a second peptide comprising a bioactive molecular functional region; and a third peptideconnected with the second peptide, the third peptide comprisingan Fc fragment mutant according to the first aspect.

In the third aspect, the present invention relates to a fusion protein. According to an embodiment of the present invention, the general structure of the fusion protein is expressed as X-L-Y or Y-L-X; wherein X is the first bioactive molecule, L is absent or a linker peptide, Y is the second bioactive molecule, -is the peptide bond. And the X or Y is selected from the protein or protein domain, polypeptide, antibody or antibody fragment.

It should be noted that the "X-L-Y" means that a C-terminal of X is connected with an N-terminal of L, and a C-terminal of L is connected with an N-terminal of Y. The "Y-L-x" means that a C-terminal of Y is connected with an N-terminal of L, and a C-terminal of L is connected with an N-terminal of X.

In some embodiments, the fusion protein described in the second aspector the third aspect may further comprise at least one of the following additional technical characteristics:

In some embodiments, the fusion protein is a monomer.

In some embodiments, the X is a human growth hormone.

In some embodiments, the amino acid sequence of the human growth hormone comprises an amino acid sequence as shown in SEQ ID NO: 1 or at least 80%-99%homologous thereof, or at least part of its sequence.

In some embodiments, the nucleotide sequence of the human growth hormone comprises a nucleotide sequence as shown inSEQ ID NO: 11 or at least 80%-99%homologous thereof, or at least part of its sequence or a codon-optimized sequence of its sequence.

In some embodiments, the Y is the IgG Fc fragment mutant.

In some embodiments, the Y is the IgG1 Fc fragment mutant.

In some embodiments, the amino acid sequence of the IgG1 Fc fragment mutant comprises an amino acid sequence as shown in any one of SEQ ID NOs: 2-7 or at least 80%-99%homologous thereof, or at least part of its sequence.

Compared with wild-type IgG1Fc fragment, the mutations in the first peptide of SEQ ID NO: 2 comprises P228 Delete, C229 Delete, P230 Delete, T366R, L368H, P395K and K409T.

Compared with wild-type IgG1Fc fragment, the mutations in the first peptide of SEQ ID NO: 3 and SEQ ID NO: 7comprise P228 Delete, C229 Delete, T366R, L368H, P395K and K409T.

Compared with wild-type IgG1Fc fragment, the mutations in the first peptide of SEQ ID

NO: 4comprises P228 Delete, C229 Delete, P230 Delete, T366R, L368H, P395K, K409Tand K447A.

NO: 5comprises P228 Delete, C229 Delete, P230 Delete, L351S, T366R, L368H, P395K, K409D and M428Y.

NO: 6comprises P228 Delete, C229 Delete, P230 Delete, L351S, T366R, L368H, P395K, K409D, M428Yand K447A.

The above-mentionedmutations could be conducive to the formation of monomeric Fc fragment mutant after the expression of the Fc fragment in the native dimer form, which could form fusion proteins with bioactive molecules. And the fusion proteins could be subsequently purified by ProteinA, andsimplify the purification process, improve in vivo and in vitro activity.

In some embodiments, the linker peptide comprises one or more amino acids selected from glycine, serine, alanine, and threonine.

In some embodiments, the linker peptide comprises an amino acid sequence of (GGGGS) _nor at least 80%-99%homologous thereof, or at least part of its sequence, n being an integer greater than or equal to 1, preferably 1, 2, 3, 4, 5 or 6.

In some embodiments, the amino acid sequence of the linker peptide comprises an amino acid sequence as shown in any one of SEQ ID NOs: 8-10 or at least 80%-99%homologous thereof, or at least part of its sequence.

GGGGSGGGGSGGGGS (SEQ ID NO: 8) .

GGGGSGGGGS (SEQ ID NO: 9) .

GGGGS (SEQ ID NO: 10) .

In some embodiments, the nucleotide sequence of the linker peptide comprises a nucleotide sequence as shown inany one of SEQ ID NOs: 21-23 or at least 80%-99%homologous thereof, or at least part of its sequence, or a codon-optimized sequence of its sequence.

GGAGGAGGAGGAAGCGGAGGCGGAGGATCTGGAGGAGGAGGAAGC (SEQ ID NO: 21) .

GGCGGCGGAGGATCTGGCGGAGGTGGAAGT (SEQ ID NO: 22) .

GGCGGCGGAGGATCT (SEQ ID NO: 23) .

In some embodiments, the amino acid sequence of the fusion protein comprises an amino acid sequence as shown in any one of SEQ ID NOs: 24-31 or at least 80%-99%homologous thereof, or at least part of its sequence.

In some embodiments, the first bioactive molecule, the second bioactive molecule, and the linker peptide in the amino acid sequence shown in SEQ ID NOs: 24-31 are shown in the table below:

In some embodiments, the nucleotide sequence of the fusion protein comprises a nucleotide sequence as shown inany one of SEQ ID NOs: 32-39 or at least 80%-99%homologous thereof, or at least part of its sequence, or a codon-optimized sequence of its sequence.

In the fourth aspect, the present invention relates toa linker peptide for constructing fusion protein. According to an embodiment of the present invention, the amino acid sequence of the linker peptide comprises an amino acid sequence as shown in any one of SEQ ID NOs: 8-10 or at least 80%-99%homologous thereof, or at least part of its sequence.

In the fifth aspect, the present invention relates to a nucleic acid molecule. According to an embodiment of the present invention, the nucleic acid molecule encodesthe Fc fragment mutant of the first aspect, or the fusion protein of the second aspect and the third aspect, or the linker peptide of the fourth aspect.

In some embodiments, the nucleotide sequence of the nucleic acid molecule comprises at least one of SEQ ID NOs: 21-23 or at least 80%-99%homologous thereof, or at least part of its sequence, or a codon-optimized sequence of its sequence.

SEQ ID NO: 21 encodes SEQ ID NO: 8.

SEQ ID NO: 22 encodes SEQ ID NO: 9.

SEQ ID NO: 23 encodes SEQ ID NO: 10.

In some embodiments, the nucleotide sequence of the nucleic acid molecule comprises at least one of SEQ ID NOs: 32-39 or at least 80%-99%homologous thereof, or at least part of its sequence, or a codon-optimized sequence of its sequence.

SEQ ID NO: 32 encodes SEQ ID NO: 24.

SEQ ID NO: 33 encodes SEQ ID NO: 25.

SEQ ID NO: 34 encodes SEQ ID NO: 26.

SEQ ID NO: 35 encodes SEQ ID NO: 27.

SEQ ID NO: 36 encodes SEQ ID NO: 28.

SEQ ID NO: 37 encodes SEQ ID NO: 29.

SEQ ID NO: 38 encodes SEQ ID NO: 30.

SEQ ID NO: 39 encodes SEQ ID NO: 31.

In some embodiments, the nucleotide sequence of the nucleic acid molecule comprises at least one of SEQ ID NOs: 12-20 or at least 80%-99%homologous thereof, or at least part of its sequence, or a codon-optimized sequence of its sequence.

SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15 and SEQ ID NO: 16 encode SEQ ID NO: 2.

SEQ ID NO: 14 encodes SEQ ID NO: 3.

SEQ ID NO: 17 encodes SEQ ID NO: 4.

SEQ ID NO: 18 encodes SEQ ID NO: 5.

SEQ ID NO: 19 encodes SEQ ID NO: 6.

SEQ ID NO: 20 encodes SEQ ID NO: 7.

Inthe sixth aspect, the present invention relates to an expression vector. According to an embodiment of the present invention, the expression vectorcarries the nucleic acid molecule of the fifth aspect. After the expression vector according to embodiments of the invention is introduced into a suitable recipient cell, the recipient cell can be effectively achieved the expression of the above-mentioned Fc fragmentmutant or fusion protein under the mediation of a regulatory system, so as to obtain a large amount of the Fc fragmentmutant or the fusion protein.

Inthe seventh aspect, the present invention relates to a recombinant cell. According to an embodiment of the present invention, the recombinant cell carries the nucleic acid molecule of the fifth aspect, or the expresses the Fc fragment mutant of the first aspect or the fusion protein of the second aspect or the third aspect. The recombinant cell according to embodiments of the invention can be used for in vitro expression and large quantities of the Fc fragmentmutants or the fusion proteins.

In theeighth aspect, the present invention relates toa pharmaceutical composition. According to an embodiment of the present invention, the pharmaceutical composition comprises the fusion protein of the second aspect or the third aspect. The pharmaceutical composition could prevent or treat a disease associated withabnormal growth hormone.

In some embodiments, the pharmaceutical composition is for oral and/or intravenous administration, such as pushing injection or continuous infusion for a period of time, via the subcutaneous, intramuscular, intraarterial, intraperitoneal, intrapulmonary, cerebrospinal, intra-articular, intrasynovial, intrathecal, or by inhalation routes such as intranasally. A pharmaceutical composition is usually administered intravenously or subcutaneously.

In some embodiments, the dosage form of the pharmaceutical composition is a tablet, a capsule, a spray, an injection, a freeze-dried powder injection or a prefilled injection.

Inthe ninthaspect, the present invention relates to a method of preparing the fusion protein of the second aspect or the third aspect. According to an embodiment of the present invention, the method comprises: culturing of the recombinant cell of the seventh aspect to obtain a culture medium containing the fusion proteins of the second aspect or the third aspect; the fusion protein is separated from the culture medium. The fusion proteins can be prepared effectively.

Inthe tenthaspect, the present invention relates to a method ofpreventing or treating a disease associated withabnormal growth hormone. According to an embodiment of the present invention, the method comprises: administering to a subject in need a pharmaceutically acceptable amount of the fusion protein of the second aspect or the third aspect, or the pharmaceutical composition of the eighth aspect.

Inthe eleventh aspect, the present invention relates tothe use of the fusion protein of the second aspect or the third aspect, the nucleic acid molecule of the fifth aspect, the expression vector of the sixth aspect, the recombinant cell of the seventh aspect and the pharmaceutical composition of the eighth aspect inthe preparation of a medicament for preventing or treating a disease associated with abnormal growth hormone.

In the twelfth aspect, the present invention relates tothe fusion protein of the second aspect or the third aspect, the nucleic acid molecule of the fifth aspect, the expression vector of the sixth aspect, the recombinant cell of the seventh aspect, and the pharmaceutical composition of the eighth aspect, for use in preventing or treating a disease associated with abnormal growth hormone.

In the thirteenthaspect, the present invention relates tothe fusion protein of the second aspect or the third aspect, the nucleic acid molecule of the fifth aspect, the expression vector of the sixth aspect, the recombinant cell of the seventh aspect, and the pharmaceutical composition of the eighth aspect, for use in preventing or treating a disease associated with abnormal growth hormone comprises at least one of the following: childhood growth hormone deficiency, idiopathic short stature, adult growth hormone deficiency, Turner's syndrome, Prader-Willi syndrome, kidney failure, disorders caused by alienated states during chemotherapy and AIDS treatment, and intrauterine growth retardation.

Beneficial effects:

Compared with the prior art, the present invention has at least one of the following beneficial effects:

(1) In the present invention, the Fc fragment mutant of the fusion proteinis mutated at a specific site. The fusion protein formed by the fusion of theFc fragment mutant and growth hormoneis secreted and expressed in the form of a monomer, which can be purified by ProteinA andsimplify the purification process.

(2) The fusion protein provided bythe present invention has a low EC ₅₀ value for binding to the human growth hormone receptor (hGHR) and a strong binding activity with hGHR.

(3) The fusion protein provided bythe present invention has a low EC ₅₀ value for promoting the proliferation of NB2-11 cells and a good proliferation effect on NB2-11 cells.

(4) The fusion protein provided bythe present invention has a low EC ₅₀ value for promoting the expression of luciferase in reporter cells, which is equal to or lower than that of the control sample (Genexine GX-H9) . And the fusion protein has an excellent activity in promoting the expression of luciferase in reporter cells.

(5) Compared with human growth hormone, the fusion protein provided bythe present invention has a longer half-life and better in vivo biological activity.

BRIEF DESCRIPTION OF THE FIGURES

The present application can be best understood by reference to the following description taken in conjunction with the accompanying figures included in the specification.

FIG. 1 is a schematic diagram of monomer form of fusion protein in one embodiment of the present invention.

FIG. 2 is the result graph of ADCC of J2 or J18 in Example 7 of the present invention.

FIG. 3 is the trend diagram of the results of body weight gain of each group of rats measured in vivo biological activity in Example 9 of the present invention.

DESCRIPTION OF THE DISCLOSURE

The present invention is intended to cover all alternatives, modifications, and equivalents which may be included within the scope of the present invention as defined by the claims. One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. The present invention is in no way limited to the methods and materials described herein. In the event that one or more of the incorporated literature, patents, and similar materials differ from or contradict this application, including but not limited to defined terms, term usage, described techniques, or the like, this application controls.

It is further appreciated that certain features of the present invention, which are, for clarity, described in the context of separate embodiments, can also be provided in combination in a single embodiment. Conversely, various features of the present invention which are, for brevity, described in the context of a single embodiment, can also be provided separately or in any suitable subcombination.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one skilled in the art to which this invention belongs. All patents and publications referred to herein are incorporated by reference in their entirety. Although many methods and materials similar or equivalent to those described herein could be used in the practice or test of the present invention, the preferred methods, equipment and materials are described in the present invention.

It should be noted that the terms "first" and "second" are only used for descriptive purposes, and cannot be understood as indicating or implying relative importance orimplying the number of indicated technical features. Thus, a feature defined as "first" or "second" may include, explicitly or implicitly, one or more of these features. Further, unless otherwise specified, in the description of the present invention, "more than one" means two or more.

The term “a” , “an” and “the” , as used herein, are intended to include “at least one” or “one or more” unless otherwise indicated herein or clearly contradicted by the context. Thus, the articles used herein refer to one or more than one (i.e. at least one) of the grammatical objects of the article. For example, “an embodiment” refers to one or more embodiments.

The term “comprise” , “contain” or “include” is an open expression, it means comprising the contents disclosed herein, but don’t exclude other contents.

The terms “optionally” or “optional” generally mean that the subsequently described event or condition can occur, but may not must, and that the description includes the circumstances in which the event or condition occurs and the circumstances in which the event or condition does not occur.

The term “room temperature” refers to the ambient temperature, which may be 20℃-30℃. In some embodiments, the room temperature may be 22℃-28℃; In some embodiments, 24℃-26℃; In some embodiments, 25℃.

The term "antibody fragment" means the antigen-binding fragment and antibody analog, which usually contains at least some of the antigen-binding region or variable region of a parental antibody (e.g. one or more CDRS) .

The term "variant" or "mutant" generally refers to any naturally occurring or engineered molecule that contains one or more nucleotide or amino acid mutations.

The amino acid number of the IgG1 Fc fragmentis numbered according to the EU numbering system. For example, position 366 refers to the 366th position according to the EU numbering system; "T366R" refers to the threonine at the 366th of the EU numbering system replacedby arginine; "L368H" refers to the leucine at the 368th of the EU numbering systemreplacedby histidine; "P228 del" refers to the absence of the proline at the228th of the EU numbering system.

The term " (GGGGS) _n" indicates that n GGGGSs are connected, such as " (GGGGS) ₃" means GGGGSGGGGSGGGGS.

The term "fusion protein" generally refers to a protein resulting from the fusion of two or more proteins or polypeptides. Genes or nucleic acid molecules encoding two or more proteins or polypeptides are linked to each other to form a fusion gene or a fusion nucleic acid molecule, which may encode the fusion protein. The translation of the fusion gene produces a single polypeptide that has the properties of at least one or even each of the two or more proteins or polypeptides prior to fusion. Recombinant fusion proteins are artificially created using recombinant DNA technology for biological research or therapy. Recombinant fusion proteins are proteins created by the genetic engineering of fusion genes. The terms “fusion protein” and “recombinant fusion protein” are used herein with the same meaning. The fusion proteins described in this paper generally contain at least two domains (A and C) , and optionally contain a third component, for example, a linker peptide between the two domains. The generation of recombinant fusion proteins is known in this field and usually involves the removal of stop codons from the cDNA sequence of the first protein or the first polypeptide, then attaching the cDNA sequence of the second protein in a frame compliant manner by linking or overlapping extension PCR. This DNA sequence is expressed by the cell as a single protein. The protein is engineered to include the entire sequence of the two original proteins or polypeptides, or only includea part of the entire sequence.

The fusion protein of the present invention is generally prepared by a biosynthesis method. According to the nucleotide sequence of the present invention, the persons skilled in thisfield can easily prepare the encoding nucleic acid of the present invention by various known methods. These methods include, but are not limited to: PCR, artificial DNA synthesis, etc. For specific methods, please refer to J. Sambrock, "Molecular Cloning Experiment Guide" . In some implementations, the coding nucleic acid sequence of the present invention can be constructed by the method of segmented synthesis of nucleotide sequence followed by overlap extension PCR.

The term "identity" , "homologous" or "similar" are used to describe the relative to the reference sequence of amino acid sequencesor nucleic acid sequence, determines the percentage of identical amino acids or nucleotides between two amino acid sequences or nucleic acid sequencesby conventional methods, see, for example, Ausubel et al., eds. (1995) , Current Protocols in Molecular Biology, Chapter 19 (Greene Publishing and Wiley-Interscience, New York) ; And the ALIGN program (Dayhoff (1978) , Atlas of Protein Sequence and Structure 5: Suppl. 3 (National Biomedical Research Foundation, Washington, D.C. ) . There are many algorithms for aligning sequences and determining sequence identity, including, the homology alignment algorithm ofNeedleman et al. ( (1970) J. Mol. Biol. 48: 443) ; the local homology algorithmof Smith et al. ( (1981) Adv. Appl. Math. 2: 482) ; the similarity search method of Pearson et al. ( (1988) Proc. Natl. Acad. Sci. 85: 2444) ; the Smith-Waterman algorithm (Meth. Mol. Biol. 70: 173-187 (1997) ) ; and the BLASTP, BLASTN, and BLASTX algorithms (see Altschul et al. (1990) J. Mol. Biol. 215: 403-410) . Using computer programs for these algorithms are also available, and the computer programsinclude, but are not limited to: ALIGN or Megalign (DNASTAR) software, or WU-BLAST-2 (Altschul et al., Meth. Enzym., 266: 460-480 (1996) ) ; or GAP, BESTFIT, BLAST Altschul et al., supra, FASTA, and TFASTA, available in the Genetics Computing Group (GCG) package, version 8, Madison, Wisconsin, USA; and the CLUSTAL of PC/Gene program provided by Intelligenetics, Mountain View, California.

The term "nucleotide" generally is ribonucleotides, deoxynucleotides, or any type of nucleotide, and theirmodified forms, and their combinations.

The term "at least 90%homologous" or "at least 90%identity" means at least 90%identical to each reference sequence, which may be 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%identity.

The term "at least 80%-99%homologous" means, compared with each reference sequence, at least 80%-99%, at least 81-99%, at least 82-99%, at least 83%-99%, at least 84%-99%, at least 85%-99%, at least 86%-99%, at least 87%-99%, at least 88%-99%, at least 89%-99%, at least 90%-99%, at least 91-99%, at least 92-99%, at least 93-99%, at least 94-99%, at least 95%-99%, at least 96-99%, at least 97%-99%, at least 98%-99%or at least 99%homologous.

The term "expression vector" generally refers to a self-replicating nucleic acid molecule that can be inserted into a suitable host, which transfers the inserted nucleic acid molecule into and/or between host cells. The expression vectors may include vectors primarily used for insertion of DNA or RNA into cells, vectors primarily used for replication of DNA or RNA, and vectors primarily used for expression of transcription and/or translation of DNA or RNA. The expression vector also includes a vector having a variety of the above-mentioned functions. The expression vector may be a polynucleotide that can be transcribed and translated into a polypeptide when introduced into a suitable host cell. Typically, the expression vector can produce the desired expression product by culturing a suitable host cell containing the expression vector.

The term "recombinant cell" generally refers to a cell that is modified or recombined with the genetic material of the host cell using genetic engineering or cell fusion technology, in whichhas a unique character with stable inheritance. The term "host cell" refers to a prokaryoticcell or a eukaryotic cell which a recombinant expression vector can be introduced. The term "transformed" or "transfected" refers to the introduction of a nucleic acid (eg, a vector) into a cell by various techniques known in thisfield. Suitable host cells can be transformed or transfected with the DNA sequences of the present invention and can be used for the expression and/or secretion of the target protein. Examples of suitable host cells that can be used in the present invention include immortalized hybridoma cells, NS/0 myeloma cells, 293 cells, Chinese hamster ovary (CHO) cells, HeLa cells, Cap cells (human amniotic fluid-derived cells) and CoS cells.

The term "pharmaceutical composition" generally refers to unit dosage form and can be prepared by any of the methods well known in the pharmaceutical field. All methods include the step of combining the active ingredient with the carrier which constitutes one or more accessory ingredients. Generally, the compositions are prepared by uniformly and thoroughly combining the active compound with liquid carriers, finely divided solid carriers, or both.

The term “pharmaceutically acceptable” as used herein, refers to those compounds, materials, compositions, and/or dosage forms that are, within the scope of sound medical judgment, suitable for use in contact with the tissues of patients without excessive toxicity, irritation, allergic response, or other problem or complication commensurate with a reasonable benefit/risk ratio, and are effective for their intended use.

The term "pharmaceutically acceptable carrier" includes any solvent, solid excipient, diluent or another liquid excipient, etc., suitable for the particular target dosage form. Except to the extent that any conventional excipients are incompatible with the compounds of the present invention, such as any adverse biological effect producedor interaction in a detrimental manner with any other component of a pharmaceutically acceptable composition, their usesare also considered in the scope of the present invention.

Extensive literature could be referencedon this subject for other pharmaceutically acceptable carriers or processes mentioned, see particularly Handbook of Pharmaceutical Excipients, 3rd Edition, ed. by Arthur H. Kibbe, American Pharmaceutical Association, Washington, USA and Pharmaceutical Press, London; and Lexikon der Hilfsstoffe für Pharmazie, Kosmetik and angrenzende Gebiete, edited by H.P. Fiedler, 4th edition, edited by Cantor, Aulendorf and earlier editions.

The term "administration" refers to the introduction of a predetermined amount of a substance into a patient by some suitable means. The fusion protein of the present invention can be administered by any common route provided as long as it can reach the intended tissue. Various modes of administration are contemplated, including peritoneal, intravenous, intramuscular, subcutaneous, cortical, oral, topical, nasal, pulmonary, rectal, and smear, but the present invention is not limited to these exemplified modes of administration. Preferably, the fusion protein of the present invention is administered by injection.

The term "a disease associated with abnormal growth hormone" generally refers to diseases caused by growth hormone abnormality, such as related diseases caused by a growth hormone deficiency or alienationstatus, including but not limited to, childhood growth hormone deficiency, idiopathic short stature, adult growth hormone deficiency, Turners Syndrome, Prader Willi Syndrome, intrauterine growth retardation, idiopathic short stature, renal failure, and, alienation status during chemotherapy and AIDS treatment. Growth hormone deficiency can include congenital deficiencyor acquired deficiency. With congenital defects, growth hormone deficiency can occur when the pituitary gland does not develop a growth hormone secretion disorder. The occurrence of acquired growth hormone deficiency may result in hypoxia-induced brain tissue damage due to difficulty in delivery. Other causes of growth hormone deficiency include damage to the pituitary gland caused by radiation used to treat brain tumors or postnatal tuberculous meningitis. Growth hormone deficiency manifests symptoms such as growth retardation and short stature, and congenital growth hormone deficiency manifests symptoms of hypoglycemia, starting in neonates. Additionally, children showed symptoms such as increased anxiety and decreased vitality.

In some embodiments, “treatment” or “treating” includes an approach for obtaining beneficial or desired results including clinical results. Beneficial or desired clinical results may include one or more of the following: a) inhibiting the disease or condition (e.g., decreasing one or more symptoms resulting from the disease or condition, and/or diminishing the extent of the disease or condition) ; b) slowing or arresting the development of one or more clinical symptoms associated with the disease or condition (e.g., stabilizing the disease or condition, preventing or delaying the worsening or progression of the disease or condition, and/or preventing or delaying the spread of the disease or condition) ; and/or c) relieving the disease, that is, causing the regression of clinical symptoms (e.g., ameliorating the disease state, providing partial or total remission of the disease or condition, enhancing effect of another medication, delaying the progression of the disease, increasing the quality of life, and/or prolonging survival.

The present invention provides an Fc fragment mutant, a fusion protein, a nucleic acid molecule, an expression vector, a recombinant cell, a pharmaceutical composition, and a method of preventing or treating a disease associated with abnormal growth hormone, which is described in detail below.

Fc fragmentmutant

In one aspect, the present invention relates to an Fc fragmentmutant. According to an embodiment of the present invention, the Fc fragment mutantcomprises a first peptide, wherein the first peptide comprisesmutations at the following positions in comparison to a wild-type IgG1 Fc fragment: positions 228, 229, 366, 368, 395 and 409, and optional position 230.

In the research and development process, the inventors found that the above-mentioned mutations could be beneficial to the formation of monomeric Fc fragment mutant after the expression of the Fc fragment in the native dimer form. The Fc fragment mutant in the form of a monomer could be fused with bioactive molecules, which could be subsequently purified by ProteinA andsimplify the purification process. More importantly, the fusion protein obtained by the Fc fragmentmutanthad higher in vitro and in vivo activity, and lower ADCC and CDC effects.

In some embodiments, the first peptide comprises mutations at the following positions in comparison to the wild-type IgG1 Fc fragment: positions 228, 229, 230, 366, 368, 395 and 409; and at least one of positions 351, 428 and 447. The mutations mentioned above can form Fc fragment mutants in monomer form.

In some embodiments, the first peptidecomprises mutations at the following positions in comparison to the wild-type IgG1 Fc fragment: (1) positions 228, 229, 230, 366, 368, 395, 409 and 447; or (2) positions 228, 229, 230, 366, 368, 395, 409 and 447; or (3) positions 228, 229, 230, 351, 366, 368, 395, 409 and 428; or (4) positions 228, 229, 230, 351, 366, 368, 395, 409, 428 and 447. The mutations mentioned above can form Fc fragment mutants in monomer form.

In some embodiments, the first peptide comprises mutations at the following positions in comparison to the wild-type IgG1 Fc fragment: P228 Delete, C229 Delete, P230 Delete, T366R, L368H, P395K, and K409D or K409T; and at least one of L351S, M428Y and K447A. The mutations mentioned above can form Fc fragmentmutants in monomer form.

In some embodiments, the first peptide comprises mutations at the following positions in comparison to the wild-type IgG1 Fc fragment: (1) P228 del, C229 del, P230 del, T366R, L368H, P395K and K409Xaa; (2) P228 del, C229 del, P230 del, T366R, L368H, P395K, K447A and K409Xaa; (3) P228 del, C229 del, P230 del, L351S, T366R, L368H, P395K, M428Y and K409Xaa; (4) P228 del, C229 del, P230 del, L351S, T366R, L368H, P395K, M428Y, K447A and K409Xaa; (5) P228 del, C229 del, T366R, L368H, P395K and K409Xaa; where in K409Xaa, Xaa represent D or T.

After a lot of experiments, the inventors mutated specific sites to obtain the above-mentioned Fc fragment mutant in the form of monomers. The fusion protein fused with the Fc fragment mutant and the biologically active molecule is secreted and expressed in the form of monomers, and the fusion protein has higher in vitro and in vivo activity and lower ADCC and CDC effects. For example, the fusion protein formed by the fusion of Fc fragmentmutant with growth hormone has the advantages of strong binding capacity to a human growth hormone receptor, good cell proliferation activity and high in vitro activity.

In some embodiments, the first peptide comprises mutations at the following positions in comparison to the wild-type IgG1 Fc fragment: P228 del, C229 del, P230 del, L351S, T366R, L368H, P395K, M428Y, K447A, and K409Xaa, where in K409Xaa, Xaa represent D or T.

After extensive experiments, the inventors found that the fusion protein obtained by fusing the above-mentioned Fc fragment mutant with human growth hormone has stronger binding capacity to a human growth hormone receptor, higher cell proliferation activity, and higher in vitro activity. For example, the Fc fragmentmutants of fusion proteins J16 and J18 in the examples of the present invention had different mutation sites. The Fcfragment mutants of J18 contained mutations of the above sites simultaneously, while the Fcfragment mutants of J16 did not have L351S and M428Y mutations compared with J18. The results showed that the fusion protein J18 has stronger binding ability to a human growth hormone receptor, better cell proliferation activity, and better in vitro activity. Moreover, compared with fusion protein J2 (P228 Delete, C229 Delete, P230 Delete, T366R, L368H, P395K and K409D) , the fusion protein J17 increased L351S and M428Y mutations, and the 409thposition of J2 and J17 is different (J17 is K409T) . The results showed that the J17 has stronger activity on cell proliferation and better in vitro activity. Therefore, the fusion protein obtained by the Fc fragment mutation with both L351S and M428Y mutations hasstronger binding ability to a human growth hormone receptor, better cell proliferation activity, and better in vitro activity.

In some embodiments, the Fc fragment mutant further comprises: ahinge region fragment of the wild-type IgG1, wherein a C-terminal of the hinge region fragment of the wild-type IgG1 is connected with an N-terminal of the first peptide segment.

In some embodiments, the hinge region fragment of the wild-type IgG1 comprisesan amino acid sequence as shown in SEQ ID NO: 41.

In some embodiments, the Fc fragment mutant comprises an amino acid sequence as shown in any one of SEQ ID NOs: 2 to 7. The fusion protein obtained by fusion of the Fc fragment mutants with bioactive molecules has high in vitro and in vivo bioactivity.

In some embodiments, the Fc fragment mutant is a monomer.

Fusion protein

In another aspect, the present invention relates to a fusion protein. According to an embodiment of the present invention, the fusion protein comprises: a second peptide comprising a bioactive molecular functional region; and a third peptideconnected with the second peptide, the third peptide comprising an Fc fragment mutant according to any one of the above-mentioned Fc fragment mutant.

After a lot of experiments, the inventor found that the fusion protein of the invention is a monomer, which has higher in vitro and in vivo activity and lower ADCC and CDC effects. And, the fusion protein can be subsequently purified by ProteinA and simplify the purification process.

It should be noted that "monomer" refers to having one Fc fragment mutant, and the specific structure is shown in FIG. 1.

In some embodiments, the second peptide comprises a growth hormone, a growth hormone analog, a growth hormone functional region or a growth hormone analog functional region. The above-mentioned fusion protein is a monomer, which has higher in vitro and in vivo activity and lower ADCC and CDC effects. And, the fusion protein hasthe advantages of strong binding ability to a human growth hormone receptor, good cell proliferation activity, and high in vitro activity.

In some embodiments, the second peptide comprises the human growth hormone or the human growth hormone functional region.

In some embodiments, the human growth hormone comprises an amino acid sequence as shown in SEQ ID NO: 1 or at least 90%homologous thereof.

In some embodiments, an N-terminal of the second peptide is connected to a C-terminal of the third peptide; ora C-terminal of the second peptide is connected with an N-terminal of the third peptide. The fusion protein obtained by the above-mentioned connection method has higher in vitro and in vivo activity.

In some embodiments, the N-terminal of the second peptide is connected to the C-terminal of the third peptide. After a lot of experiments, the inventor found that the fusion protein obtained by the above-mentioned connection method can further improve its binding ability to the corresponding receptor, cell proliferation activity and in vitro activity. For example, the fusion protein obtained by fusion of Fc fragment mutant and growth hormone has better efficacy in animals.

In some embodiments, the fusion protein further comprises a linker peptide, wherein the linker peptide is arranged between the second peptide and the third peptide. The fusion protein is obtained by which the second peptide and the third peptide can be fused by the above-mentioned linker peptide. And the biological activity of the fusion protein can be improved. For example, the fusion proteins J1, J2, J6 and J7 have different linker peptides. Compared with J1 without the linker peptide, J2, J6 and J7 have better binding activity to hGHR and better effect on promoting cell proliferation.

In some embodiments, an N-terminal of the linker peptide is connected with a C-terminal of the third peptide, and a C-terminal of the linker peptide is connected with an N-terminal of the second peptide; oran N-terminal of the linker peptide is connected with a C-terminal of the second peptide, and a C-terminal of the linker peptide is connected with an N-terminal of the third peptide.

In some embodiments, the N-terminal of the linker peptide is connected with the C-terminal of the third peptide. The fusion protein obtained by the above-mentioned method can further improve its binding ability to corresponding receptors, cell proliferation activity and in vitro activity. For example, the fusion protein obtained by the fusion of Fc fragment mutant and growth hormone can be more effective in animals.

In some embodiments, the linker peptide comprises an amino acid sequence of (GGGGS) _n, n being an integer greater than or equal to 1. The fusion protein was obtained by using the second peptide and the third peptide that can be fused by the above-mentioned linker peptide. And the biological activity of the fusion protein can be improved.

In some embodiments, the n is 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. The fusion protein was obtained by using the second peptide and the third peptide that can be fused by the above-mentioned linker peptide, and the biological activity of the fusion protein can be improved.

In some embodiments, the linker peptide comprises an amino acid sequence as shown in any one of SEQ ID NOs: 8-10. The fusion protein is obtained by which the second peptide and the third peptide can be fused by the above-mentioned linker peptide. And the biological activity of the fusion protein can be improved.

In some embodiments, the fusion protein comprises an amino acid sequence as shown in any one of SEQ ID NOs: 24-31. The above-mentioned fusion protein has strong binding ability to corresponding receptors, better cell proliferation activity, and better in vitro activity.

Technical personnel in this field can understand that the characteristics and advantages described for the above-mentioned Fc fragment mutants are also applicable to this fusion protein, and details are not repeated here.

Nucleic acid molecule

In another aspect, the present invention relates to a nucleic acid molecule. According to an embodiment of the present invention, the nucleic acid moleculeencodesthe above-mentionedFc fragment mutant andthe above-mentioned fusion protein. The nucleic acid molecule can be effectively used to express the above-mentionedFc fragment mutants or the above-mentioned fusion proteins, especially in prokaryotes or low eukaryotes. The fusion protein is a monomer form, which has higher in vitro and in vivo activity and lower ADCC and CDC effects.

In some embodiments, the nucleic acid molecule is DNA.

Technical personnel in this field can understand that the characteristics and advantages described for the above-mentioned Fc fragment mutants, and the above-mentionedfusion protein are also applicable to this nucleic acid molecule, and details are not repeated here.

Expression vector

In another aspect, the present invention relates to an expression vector. According to an embodiment of the present invention, theexpression vector carries the above-mentionednucleic acid molecule. The above-mentioned expression vector can effectively express the above-mentioned Fc fragment mutant or the above-mentionedfusion protein, especially in prokaryotes or lower eukaryotes. The fusion protein is a monomer, which has higher in vitro and in vivo activity and lower ADCC and CDC effects.

In some embodiments, the expression vector is a eukaryotic expression vector.

In some embodiments, the expression vector is a lentiviral vector.

Technical personnel in this field can understand that the characteristics and advantages described for the above-mentioned Fc fragment mutants, the above-mentionedfusion protein and the above-mentioned nucleic acid moleculeare also applicable to thisexpression vector, and details are not repeated here.

Recombinant cell

In another aspect, the present invention relates to a recombinant cell. According to an embodiment of the present invention, the recombinant cell carries the above-mentionednucleic acid molecule; or expresses the above-mentionedFc fragmentmutant and the above-mentionedfusion protein. The recombinant cells can effectively express the above-mentioned Fc fragment mutant or fusion protein, especially in prokaryotes or lower eukaryotes. The fusion protein is a monomer form, which has higher in vitro and in vivo activity and lower ADCC and CDC effects.

In some embodiments, the recombinant cell is obtainable by introducing the above-mentioned expression vector into a host cell.

In some embodiments, the recombinant cell isa eukaryotic cell.

In some embodiments, the recombinant cell isa mammalian cell.

Technical personnel in this field can understand that the characteristics and advantages described for the above-mentioned Fc fragment mutants, the above-mentionedfusion protein, the above-mentionednucleic acid molecule, and the above-mentionedexpression vectorare also applicable to thisrecombinant cell, and details are not repeated here.

Pharmaceutical composition

In another aspect, the present invention relates to a pharmaceutical composition. According to an embodiment of the present invention, the pharmaceutical composition comprises the above-mentioned fusion protein. The above-mentioned pharmaceutical compositions can be used to prevent and treat a disease associated with abnormal growth hormone.

In some embodiments, the pharmaceutical composition is the dosage form of an injection.

In some embodiments, the pharmaceutical composition has an administration routinecomprising subcutaneous or intravenous injection.

Technical personnel in this field can understand that the characteristics, and advantages described for the above-mentioned fusion proteinare also applicable to this pharmaceutical composition, and details are not repeated here.

Method for preventing or treating a disease associated with abnormal growth hormone

In another aspect, the present invention relates to a method for preventing or treating a disease associated withabnormal growth hormone. According to an embodiment of the present invention, the method comprises: administering to the subject in need a pharmaceutically effective amount of the above-mentioned fusion protein and the above-mentionedpharmaceutical composition. This method can effectively prevent or treat a diseases related to abnormal growth hormone.

In some embodiments, the fusion protein is administered by subcutaneous injection or intravenous injection.

In some embodiments, the disease associated withabnormal growth hormonecomprises at least one of the followingchildhood growth hormone deficiency, idiopathic short stature, adult growth hormone deficiency, Turner's syndrome, Prader-Willi syndrome, kidney failure, disorders caused by alienated states during chemotherapy and AIDS treatment, and intrauterine growth retardation.

Technical personnel in this field can understand that the characteristics and advantages described for the above-mentioned fusion proteinand the above-mentionedpharmaceutical composition are also applicable to this method, and details are not repeated here.

Use of afusion protein, a nucleic acid molecule, an expression vector, a recombinant cell and a pharmaceutical composition

In another aspect, the present invention relates to the use of the above-mentioned fusion protein, the above-mentioned nucleic acid molecule, the above-mentioned expression vector, the above-mentioned recombinant cell, and the above-mentioned pharmaceutical composition in the preparation of a medicament for preventing or treating a disease associated with abnormal growth hormone.

In some embodiments, the disease associated with abnormal growth hormonecomprises at least one of the following: childhood growth hormone deficiency, idiopathic short stature, adult growth hormone deficiency, Turner's syndrome, Prader-Willi syndrome, kidney failure, disorders caused by alienated states during chemotherapy and AIDS treatment, and intrauterine growth retardation.

In another aspect, the present invention relates to the above-mentioned fusion protein, the above-mentioned nucleic acid molecule, the above-mentioned expression vector, the above-mentioned recombinant cell, and the above-mentioned pharmaceutical composition, for use in preventing or treating a disease associated with abnormal growth hormone.

In another aspect, the present invention relates to the above-mentioned fusion protein, the above-mentioned nucleic acid molecule, the above-mentioned expression vector, the above-mentioned recombinant cell, and the above-mentioned pharmaceutical composition, for use in preventing or treating a disease associated with abnormal growth hormonecomprises at least one of the following: childhood growth hormone deficiency, idiopathic short stature, adult growth hormone deficiency, Turner's syndrome, Prader-Willi syndrome, kidney failure, disorders caused by alienated states during chemotherapy and AIDS treatment, and intrauterine growth retardation.

Technical personnel in this field can understand that the characteristics and advantages described for the above-mentioned fusion protein, the above-mentionednucleic acid molecule, the above-mentionedexpression vector, the above-mentionedrecombinant cell, and the above-mentionedpharmaceutical composition, are also applicable to these use, and details are not repeated here.

Examples

The following Examples are merely illustrative and is not meant to limit any aspects of the present disclosure in any way.

Generally, the compounds disclosed herein may be prepared by methods described herein, wherein the substituents are as defined for Formula (I) above, except where further noted. The following non-limiting schemes and examples are presented to further exemplify the present invention.

Professionals skilled in the art will recognize that the chemical reactions described may be readily adapted to prepare a number of other compounds disclosed herein, and alternative methods for preparing the compounds disclosed herein are deemed to be within the scope disclosed herein. For example, the synthesis of non-exemplified compounds according to the present invention may be successfully performed by modifications apparent to those skilled in the art, e.g., by appropriately protecting interfering groups, by utilizing other suitable reagents known in the art other than those described, and/or by making routine modifications of reaction conditions. Alternatively, the known reaction conditions or the reaction disclosed in the present invention will be recognized as having applicability for preparing other compounds disclosed herein.

Example 1: Preparation the expression vector of recombinant long-acting human growth hormone fusion protein.

The human growth hormone (SEQ ID NO: 1) was linked with the Fc fragmentmutant (SEQ ID NO: 2 or SEQ ID NO: 7) to construct a fusion protein, and J1 and J3 are obtained respectively. Andthe human growth hormone (SEQ ID NO: 1) was linked with various Fc fragmentmutants (SEQ ID NO: 2 or any one of SEQ ID NOs: 4-6) through linker peptides (any one of SEQ ID NOs: 8-10) to construct fusion proteins, and J2, J6, J7 and J16-18 were obtained respectively. The specific experimental operations are as follows:

The nucleotide sequences encoding human growth hormone (SEQ ID NO: 11) , the nucleotide sequences encoding linker peptides (SEQ ID NOs: 21-23) , and the nucleotide sequences encoding various Fc fragmentmutants (SEQ ID NOs: 16-20) ware linked, and the nucleotide sequences (SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 35, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 35, ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39) were cloned into the expression vector pCDNA3.4 (Thermo Fisher) by total gene synthesis and molecular cloning, and the fusion protein expression vector of each nucleotide sequence was obtained respectively.

Example 2: Expression of recombinant long-acting human growth hormone fusion protein.

Using Expi CHO-S (Gibco, A29133) as the host cell, the multiple plasmids obtained in Example 1 were transfected into the host cell, and the chemical transfection reagent Polyplus-FectoPRO (polyplus, 116-010) was used to transiently express the fusion protein (as the recombinant long-acting human growth hormone fusion protein) corresponding to amino acid sequence SEQ ID NOs: 24-31. The experimental operation is as follows:

1) Expi Cho-Scells were subcultured one day before transient transfection, and the cell density was adjusted to about 3×10 ⁶ cells /mL by the medium. The cell culture flask was returned to the shaker (37℃, 8%CO ₂) for further culture.

2) On the day of transfection: Expi Cho-Scell fluid was taken for cell count, and the cell density was adjusted to about 6×10 ⁶ cells /mL by the medium. Then 1L cell fluid with a density of 6×10 ⁶ cells /mLwas required for each fusion protein expression vector to be transfected.

3) To prepare the transfection complex: 16 sterile cell culture flasks were taken, 8 labeled "DNA" and 8 labeled "FectoPRO" . And transfection reagent Polyplus-fectoPRO was added into the "FectoPRO" flask and mixed; 60mL opti-mem solution and 500μg fusion protein expression vectors obtained in Example 1 were added into each "DNA" flask and mixed. And the diluent of the fusion protein expression vector was obtainded. And the diluent of the fusion protein expression vector of each nucleotide sequence was added to the "FectoPRO" flask and mixed. Then the diluent mixedwas incubated at room temperature for 10 minutes, then the diluent was added to the cell solution and shaken, and the cell culture flask was returned to the shaker to continue culture and transfection.

4) After the cell culture medium obtained in step 3) was transfected for 18-22 hours, an appropriate amount of OPM-CHO ProFeed was added, and the biochemical indicators of the cell solution were measured. According to biochemical indicators, supplement glucose to 6g/L. Titer was measured 4 days after transfection, and supplemented with sugar and culture solution every other day. The CHO cell fermentation broth could be obtained when the cell viability is less than 80%, and the supernatant can be harvested for purification.

Example 3: Purification of recombinant long-acting human growth hormone fusion protein.

The CHO cell fermentation liquid obtained in Example 2 was centrifuged in two stages (first stage: 3, 000×g, 30 min; second stage: 12,000×g, 20 min) . The supernatant was collected and filtered through a 0.2μm filter, and set aside.

Protein A affinity chromatography: The aqueous solution containing 20 mM phosphate and 150 mM NaCl at pH 7.2 was used to equilibrate the chromatographycolumnfor at least 3 columnvolumes, and the filtered clarified filtrate was loaded and remained on the chromatography column for 5 minutes. After loading the sample, the aqueous solution containing 20 mM phosphate and 150 mM NaCl at pH 7.2 was used to equilibrate the chromatographycolumnfor at least 1 column volume, followed by 50 mM pH 4.5 Acetic acid (HAc) buffer, 50 mM pH 4.0 HAc buffer, and 50 mM pH 3.5 HAcbuffer were used to elute the target protein respectively. When an absorption peak appeared, the peak range was 50 mAU-peak-50 mAU, and the desired SEC purity (> 98.0) fusion protein is obtained. A variety of Expi Cho-Scells respectively containing nucleotide sequence SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38 or SEQ ID NO: 39, were fermented and chromatographed to obtain J1 fusion protein, J2 fusion protein, J3 fusion protein, J6 fusion protein, respectively , J7 fusion protein, J16 fusion protein, J17 fusion protein, J18 fusion protein. The specific structure of the fusion protein is shown in FIG. 1, wherein the structures of J1, J2, J3, J6, J7 and J17 are shown in the left figure of FIG. 1, and the structures of J16 and J18 are shown in the right figure of FIG. 1.

Example 4: Binding of fusion protein to hGHR.

The purified fusion protein obtained in Example 3 was subjected to in vitro receptor (hGHR) binding activity detection, and Genexine GX-H9 was used as a control group. The specific experimental operations are as follows:

hGHR was diluted to obtain a 0.5 μg/ml coating solution, which was added to ELISA plate at 100μL/well, and coated for more than 12 hours at 2～8℃. The plate residue was discarded, 300 μLof 1%BSA-PBST (phosphate Tween buffer containing 1%bovine serum albumin) was added into each well, and blocked for 1 hour at 37℃. 300 μL of PBST (Phosphate Tween Buffer) was added to each well for 3 washes, then dilute the recombinant long-acting human growth hormone fusion protein and Genexine GX-H9 were diluted to 5 μg/ml, and then diluted 5 times to 8 gradient concentrations, added to100 μL/well to ELISA plate. The ELISA plate comprising the long-acting human growth hormone fusion protein or Genexine GX-H9 was incubated at 37℃ for 1 hour, then 300 μL of PBST was added to each wellfor 3 washes, and the Goat anti-human IgG Fc-HRP that dilute 10000 foldwith 1%BSA-PBST was added, 100 μL/well of a sample. After incubation at 37℃ for 1 hour, 300μL of PBST was added to each wellfor 3 washes, and patted dry. TMB Substrate was added, 100μL per well. After 5 minutes of reaction at room temperature, 2M H ₂SO ₄ aqueous solution was added to stop the reaction, 100 μL/well. The ELISA plate that stopped the reaction was put on a microplate reader, the absorbance OD ₄₅₀ value was read at a wavelength of 450nm and the EC ₅₀ of each fusion protein's binding activity to hGHR was calculated, as shown in Table 1.

The results show that from the perspective of binding activity, the fusion proteins have a low EC ₅₀ value for binding to hGHR, and has strong binding activity to hGHR. And compared with Genexine GX-H9, the fusion proteins binding activity with human GHR are similar or better.

The amino acid sequence of Genexine GX-H9 isas follows:

Table 1: Results of hGHR binding activity test of the fusion protein

Example 5: Promoting proliferation of NB2-11 cells of Recombinant long-acting Human growth hormone fusion protein.

The purified fusion protein obtained in Example 3 was subjected to the following experiments, and the above-mentioned Genexine GX-H9 was used as the control group.

Cells were collected and suspended in the medium (PRMI 1640 medium containing 1%FBS and 50μM β -mercaptoethanol) at a concentration of 1×10 ⁵ cells per ml. 50 μL of each cell sample was added to each well of a 96-well cell culture plate. The cells were cultured with 50 μL of assay medium containing various concentrations of recombinant long-acting human growth hormone fusion protein and Genexine GX-H9 from 0.051 ng/mL to 3000 ng/mL. The cell plates were cultured at 37℃ in a 5%CO ₂ humidified incubator for 96 hours, and then 50 μL of cellTiter-Glo Luminescent Cell Viability Assay (Promega, G7571) was added to each well. After 10 minutes, the chemiluminescence signal was detected by a microplate reader. The biological activity of the recombinant long-acting human growth hormone fusion protein can be determined from the obtained dose-response curve. The results are shown in Table 2.

The fusion proteins have a low EC ₅₀ value to promote the proliferation of NB2-11 cells, and have a good proliferation of Nb2-11 cells. Compared with Genexine GX-H9, the relative activity of Nb2-11 cell proliferation was convergent or better.

Table 2: Results of fusion protein promoting Nb2-11 cell proliferation

Example 6: Biological activity of recombinant long-acting human growth hormone fusion protein on reporter cells.

The reporter gene cells (293-GHR/STAT5 cell line) in the logarithmic growth phase were taken, and trypsin was used to digest the reporter gene cells. Then the reporter gene cells were plated (costar, 3917) at 4×10 ⁴ cells/well, 50 μL/well, and the 96-well white plate was incubated at 37 ℃ in a 5%CO2 incubator to incubate overnight. The reporter gene cells were added with the recombinant long-acting human growth hormone fusion protein diluted in gradient, the initial concentration was 100 nM, 5-fold gradient dilution, a total of 10 gradient concentrations; the dilution was added to the reporter gene cells, and the additional volume was 50 μL/well, and the 96-well white plate was incubated at 37 ℃ in a 5%CO ₂incubatorfor 6 hours. After the incubation, the 96-well white plate and Nano-Glo Luciferase Assay kit (promega, N112B) were taken out, and equilibrated to room temperature, the reaction substrate was added to the sample wells at a volume of 50 μL/well and placed at room temperature for 10 minutes. The instrument (Promega, GM2000) recorded the luminescence signal value, with the protein concentration as the X-axis and the luminescence signal value as the Y-axis. GraphPad Prisim 5 was used for four-parameter fitting to calculate the EC ₅₀ value, and the results were shown in Table 3.

The results show that the EC ₅₀ value of the fusion proteins to promote the reporter gene cells to express luciferase is low, which is equal to or lower than that of the control group. And the fusion proteins have excellent activity in promoting the reporter gene cells to express luciferase.

Table 3: Results of fusion proteins promoting luciferase expression in reporter cells

Example 7: The ADCC effect of test sample-induced effector cell Jurkat-CD16a-luc on target cell CHO-K1-PD-L1/GHR1) Sample information

sample name	concentration (mg/mL)
M7824	2.05
2 (J2)	0.6
5 (Genexine GX-H9)	1.33
18 (J18)	2.66
Acterma	20

2) Cell processing

Target cells CHO-K1-PD-L1/GHR (Shanghai Kabe Biomedical Technology Co., LTD., SBTCL015) treatment:

The cells were passaged 2 days before the experiment, and the supernatant was discarded. After washing the cells with 5 mL of PBS, 1 mL of 0.25%Trypsin-EDTA was added. After digestion in a 37℃ incubator for 1 min, 6 mL of medium 1 (450 mL of F12 medium + 50 mL of FBS) was added to terminate digestion, and resuspend to single cell suspension. 5mL of cell suspension was discarded, and 8mL of medium 1 (450mL of F12 medium + 50mL of fetal bovine serum (FBS) ) was added, then 120μL of G418 was added and mixed, G418 work concentration was 600 μg/mL. The cells were put into the incubator to continue culturing.

Effector cells Jurkat-CD16a-luc (Shanghai Jiabei Biomedical Technology Co., Ltd., SBTCL001) treatment:

The cells were passaged 2 days before the experiment, and the cell suspension was mixed by pipetting. The 5mL cell suspension was taken into the new T75 culture flask, then 15mL medium 2 (450mL RPMI 1640 medium +50mL FBS) was added, and 320μL G418 was added, the work concentration of G418 was 800μg/mL. Then 60μL Hygromycin Bwas added and mixed, and the action concentration of Hygromycin B was 150μg/mL. The cells were put into the incubator to continue culturing.

3) experimental process

On the first day, the density of target cells cho-K1-PD-L1 /GHR was adjusted to 1.83×10 ⁵ cells /mL in analysis medium 1 (40mL F12 medium + 0.4ml FBS) , and the target cells were plated overnight at 50μL/well. On the second day, the test samples (i.e. J2 or J18) , positive control M7824 (Shanghai Jiabei Biomedical Technology Co., Ltd. ) , and negative control Acterma (Roche) were first diluted to 0.1mg/mL in an analysis medium 2 (RPMI 1640 medium) and were second diluted to 24μg/mL in analysis medium 2, and then diluted by 3 times to 9 gradients, 25μL/well was added to the cell plate, and mixed. After incubating at 37℃ for 45min, the cell plate was removed. The density of effector cells Jurkat-CD16A-Luc was adjusted to 1.47×10 ⁶ cells /mL with the analysis medium 2, and 25μL/well was added to the cell plate, mixed, and placed in a 37℃ incubator for 5.5hours of co-incubation. After the cell plate was removed and equilibrated at room temperature, 100 μL/well of one-GLo Luciferase Assay System (Promega, E6120) was added to the cell plate and pipetted blow 10 times, mixed well. After lysing at room temperature for 10 min in the dark, the chemiluminescence signal was detected by a microplate analyzer. The results are shown in FIG. 2.

After adding positive control PD-L1 antibody M7824, negative control IL-6R antibody Acterma and test samples in the ADCC experiment, the positive control M7824 induces effector cell Jurkat-CD16A-Luc to havean obvious ADCC effect on target cell CHO-K1-PD-L1/GHR, the negative control Acterma has no ADCC effect, and the test sample has no ADCC effect, wherein the concentration unit of the abscissa in FIG. 2 is ng/ml.

Example 8: The CDC effect of test sample induced human serum complement on target cells

1) Sample information

sample name	concentration (mg/mL)
Avelumab	2.05
2 (J2)	0.6
Genexine GX-H9	1.33
18 (J18)	2.66
Acterma	20

2) Cell processing

The cells were passaged 2 days before the experiment, and the supernatant was discarded. After washing the cells with 5 mL of PBS, 1 mL of 0.25%Trypsin-EDTA was added. After digestion in a 37℃ incubator for 1 min, 6 mL of medium 1 (450 mL of F12 medium + 50 mL of FBS) was added to terminate digestion, and resuspend to single cell suspension, 5mL of cell suspension was discarded, and 8mL of medium 1 (450mL of F12 medium + 50mL of fetal bovine serum (FBS) ) was added, then 120μL of G418was added and mixed, G418 work concentration was 600 μg/mL. The cells were put into the incubator to continue culturing.

3) experimental process

On the first day, the density of target cells cho-K1-PD-L1 /GHR was adjusted to 2.0×10 ⁵ cells /mL in the differentiation medium (99%F12 medium + 1%FBS) , and the target cells were plated overnight at 50μL/well. On the second day, the test samples (i.e. J2 or J18) , positive control Avelumab (PD-1 antibody, Shanghai Jiabei Biomedical Technology Co., Ltd. ) and negative control Acterma (Roche) were first diluted to 0.1mg/mL in the differentiation medium (99%F12 medium + 1%FBS) , and were second diluted to 15μg/mL in the differentiation medium (99%F12 medium + 1%FBS) and then diluted by 3 times to 7 gradients, 50μL/well was added to the cell plate, and mixed. After incubating at 37℃ for 30min, the cell plate was removed. The 50μL/well of 30%complement (containing 70%differentiation medium +30%complement) was added and mixed. And placed in a 37℃ incubator for 6 hours of co-incubation. After the cell plate was removed and equilibrated at room temperature, the 50 μL/well of one-GLo Luciferase Assay System (Promega, E6120) was added to the cell plate and pipetted blow 10 times and mixed well. After lysing at room temperature for 10 min in the dark, the chemiluminescence signal was detected by a microplate analyzer.

After adding positive control PD-L1 antibody Avelumab, negative control IL-6R antibody Acterma and test samples in the CDC experiment, the positive control Avelumab induces human serum complement to havean obvious CDC effect on target cell CHO-K1-PD-L1/GHR, the negative control Acterma has no CDC effect, and the test sample has no CDC effect.

Example 9: In vivo biological activity test

Pharmacodynamics study on long-term growth promotion in vivo of the J2 fusion protein and J18 fusion protein:

4-week-old SPF male SD rats with a body weight of 60g-80g were selected. Two weeks before the experiment, the pituitary gland was surgically removed under clean conditions, and the recovery period was 2 weeks after the pituitary removal operation. Before drug administration, qualified healthy animals whose body weight changes were less than ±10%of the preoperative body weight were selected, and the pituitary-removed rats were randomly divided according to their body weight. There were 5 groups, 8 mice in each group, namely the model group, J2 fusion protein low-dose group, J2 fusion protein high-dose group, J18 fusion protein low-dose group and J18 fusion protein high-dose group. The mode of administration was a subcutaneous injection in the neck. and the J2 fusion protein low-dose group was given 9.35 nmol/kg J2 fusion protein. J18 fusion protein low-dose group was given 9.35 nmol/kg J18 fusion protein. J2 fusion protein high-dose group was administered with 56.1 nmol/kg J2 fusion protein. J18 fusion protein high-dose group was administered with 56.1 nmol/kg J18 fusion protein; the model group was given solvent. The drug or solvent was administered once a week in the above manner, and the drug or solvent were given twice in total. After drug administration, each rat was weighed at the same time every day, and the changes in body weight of the rats was calculated every day. After 14 days, the experiment was stopped and the rats were weighed. Body weight gain (g) on a day after dosing is the difference between each animal's body weight on that day and its pre-dose body weight. At the end of the experiment, an anatomical examination confirms that there was no pituitary in the sella region. The changes in body weight gain of each group within 14 days were compared. The results are shown in FIG. 3, wherein "2#-low" was the low-dose J2 fusion protein group, "2#-high" was the high-dose J2 fusion protein group, "18#-low" was the low-dose J18 fusion protein group, and "18#-high" was the high-dose J18 fusion protein group. 2#-low VS model group, P =0.0083; 2#-high vs model group, P < 0.0001; 18#-low VS model group, P =0.0030; 18#-high vs model group, P =0.0003.

According to the results of FIG. 3:

(1) Compared with the model group, J2 fusion protein and J18 fusion protein can significantly increase the body weight of rats at both low-dose and high-dose, indicating that the fusion protein provided by the invention has good in vivo activity.

(2) The weight gain of the high-dose group was greater than that of the low-dose group.

(3) The high-dose J18 fusion protein group had a more significant effect than the high-dose J2 group.

Reference throughout this specification to "an embodiment, " "some embodiments, " "one embodiment" , "another example, " "an example, " "a specific examples, " or "some examples, " means that a particular feature, structure, material, or characteristic described in connection with the embodiment or example is included in at least one embodiment or example of the present disclosure. Thus, the appearances of the phrases such as "in some embodiments, " "in one embodiment" , "in an embodiment" , "in another example, " in an example, " "in a specific examples, " or "in some examples, " in various places throughout this specification are not necessarily referring to the same embodiment or example of the present disclosure. Furthermore, the particular features, structures, materials, or characteristics may be combined in any suitable manner in one or more embodiments or examples.

Claims

AnFc fragment mutant comprising afirst peptide, wherein the first peptide comprises mutations atthe followingpositions in comparison toa wild-type IgG1 Fc fragment:

positions 228, 229, 366, 368, 395 and 409; and

optional position 230.
The Fc fragment mutantof claim 1, wherein the first peptide comprises mutations at the following positions in comparison to the wild-type IgG1 Fc fragment:

positions 228, 229, 230, 366, 368, 395 and 409; and

at least one of positions 351, 428 and 447.
The Fc fragment mutantof claim 1, wherein the first peptide comprises mutations at the following positions in comparison to the wild-type IgG1 Fc fragment:

(1) positions 228, 229, 230, 366, 368, 395, 409 and 447;

(2) positions 228, 229, 230, 366, 368, 395 and 409;

(3) positions 228, 229, 230, 351, 366, 368, 395, 409 and 428; or

(4) positions 228, 229, 230, 351, 366, 368, 395, 409, 428 and 447.
The Fc fragment mutantof claim1, wherein the first peptide comprises mutations at the following positions in comparison to the wild-type IgG1 Fc fragment:

(1) P228 del, C229 del, P230 del, T366R, L368H, P395K and K409Xaa;

(2) P228 del, C229 del, P230 del, T366R, L368H, P395K, K447A and K409Xaa;

(3) P228 del, C229 del, P230 del, L351S, T366R, L368H, P395K, M428Y and K409Xaa;

(4) P228 del, C229 del, P230 del, L351S, T366R, L368H, P395K, M428Y, K447A and K409Xaa; or

(5) P228 del, C229 del, T366R, L368H, P395K and K409Xaa,

where in K409Xaa, Xaa represent D or T.
The Fc fragment mutantof claim 1, whereinthe Fc fragmentmutantfurther comprises:

a hinge region fragment of the wild-type IgG1, wherein a C-terminal of the hinge region fragment of the wild-type IgG1 is connected with an N-terminal of the first peptide.
The Fc fragment mutantof claim 5, whereinthe hinge region fragment of the wild-type IgG1comprises an amino acid sequence as shown in SEQ ID NO: 41.
The Fc fragment mutantof claim 1, wherein the Fc fragment mutantcomprises an amino acid sequence as shown in any one of SEQ ID NOs: 2 to 7.
The Fc fragment mutantof any one of claims1-7, wherein the Fc fragmentmutant is a monomer.
A fusion protein comprising:

asecond peptidecomprising a bioactive molecular functional region; and

a third peptide connected with the second peptide, the third peptide comprising an Fc fragment mutantaccording to anyone of claims1-8.
The fusion protein of claim 9, wherein the second peptide comprises a growth hormone, a growth hormone analog, a growth hormone functional region or a growth hormone analog functional region.
The fusion protein of claim 9 or 10, whereinthe second peptide comprises the human growth hormone or the human growth hormone functional region.
The fusion protein of claim 11, wherein the human growth hormone comprises an amino acid sequence as shown in SEQ ID NO: 1 or at least 90%homologous thereof.
The fusion protein of claim 9, whereinan N-terminal of the second peptide is connected with a C-terminal of the third peptide; or,

a C-terminal of the second peptide is connected with an N-terminal of the third peptide.
The fusion protein of claim 9, whereinthe fusion protein further comprises a linker peptide, wherein the linker peptide is arranged between the second peptide and the third peptide.
The fusion protein of claim 14, whereinan N-terminal of the linker peptide is connected with a C-terminal of the third peptide, and a C-terminal of the linker peptide is connected with an N-terminal of the second peptide; or

an N-terminal of the linker peptide is connected with a C-terminal of the second peptide, and a C-terminal of the linker peptide is connected with an N-terminal of the third peptide.
The fusion protein of claim 14 or 15, whereinthe linker peptide comprises an amino acid sequence of (GGGGS) _n, n being an integer greater than or equal to 1.
The fusion protein of claim 16, wherein the n is 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10.
The fusion protein of claim 14 or 15, whereinthe linker peptide comprises an amino acid sequence as shown in any one of SEQ ID NOs: 8-10.
The fusion protein of claim 9, whereinthe fusion protein comprises an amino acid sequence as shown in any one of SEQ ID NOs: 24-31.
A nucleic acid molecule encoding the Fc fragment mutant of any one of claims 1-8 or the fusion protein of any one of claims 9-19.
The nucleic acid molecule of claim 20, whereinthe nucleic acid molecule is DNA.
An expression vector carrying the nucleic acid molecule of claim 20 or 21.
The expression vector of claim 22, whereinthe expression vector is a eukaryotic expression vector.
The expression vector of claim 22 or 23, whereinthe expression vector is a lentiviral vector.
A recombinant cellcarrying the nucleic acid molecule of claims20 or 21; or

expressingthe Fc fragmentmutant of any one of claims 1-8 or the fusion protein of any one of claims 9-19.
The recombinant cell of claim 25, whereinthe recombinant cell is obtainable by introducing the expression vector of any one of claims22-24 into a host cell.
The recombinant cell of claim 25 or 26, wherein the recombinant cell isa eukaryotic cell.
The recombinant cell of claim 25 or 26, wherein the recombinant cell is a mammalian cell.
A pharmaceutical composition comprising the fusion protein of any one of claims 9-19.
The pharmaceutical composition of claim 29, whereinthe pharmaceutical compositionfurther comprisesa pharmaceutically acceptable carrier.
The pharmaceutical composition of claim 29 or 30, whereinthe pharmaceutical composition is in a dosage form of an injection.
The pharmaceutical composition of claim 29 or 30, wherein the pharmaceutical composition has an administration routine comprising subcutaneous or intravenous injection.
A method of preventing or treating a diseaseassociated withabnormal growth hormone, wherein the method comprises:

administering a subject in need a pharmaceutically effective amount ofthe fusion protein of any one of claims 9-19 or the pharmaceutical composition of any one of claims 29-32.
The method of claim 33, whereinthe fusion protein is administered by subcutaneous injection or intravenous injection.
The method of claim 33 or 34, whereinthediseaseassociated withabnormal growth hormonecomprises at least one of the following:

childhood growth hormone deficiency, idiopathic short stature, adult growth hormone deficiency, Turner's syndrome, Prader-Willi syndrome, kidney failure, disorders caused by alienated states during chemotherapy and AIDS treatment, and intrauterine growth retardation.
Use of the fusion protein of any one of claims 9-19, the nucleic acid moleculeof any one of claims 20-21, the expression vector of any one of claims 22-24, the recombinant cell of any one of claims 25-28 or the pharmaceutical composition of any one of claims 29-32 in the preparation of a medicament for preventing or treating a diseaseassociated withabnormal growth hormone.
The use of claim 36, whereinthe diseaseassociated withabnormal growth hormonecomprises at least one of the following:

childhood growth hormone deficiency, idiopathic short stature, adult growth hormone deficiency, Turner's syndrome, Prader-Willi syndrome, kidney failure, disorders caused by alienated states during chemotherapy and AIDS treatment, and intrauterine growth retardation.
The fusion protein of any one of claims 9-19, the nucleic acid molecule of any one of claims 20-21, the expression vector of any one of claims 22-24, the recombinant cell of any one of claims 25-28 or the pharmaceutical composition of any one of claims 29-32, for use in preventing or treating a diseaseassociated withabnormal growth hormone.
The fusion protein of any one of claims 9-19, the nucleic acid molecule of any one of claims 20-21, the expression vector of any one of claims 22-24, the recombinant cell of any one of claims 25-28 or the pharmaceutical composition of any one of claims 29-32, for use in preventing or treating adiseaseassociated withabnormal growth hormone comprise at least one of the following:

childhood growth hormone deficiency, idiopathic short stature, adult growth hormone deficiency, Turner's syndrome, Prader-Willi syndrome, kidney failure, disorders caused by alienated states during chemotherapy and AIDS treatment, and intrauterine growth retardation.