WO2023089506A1 - Procédés sans amplification pour la mesure de miarn - Google Patents

Procédés sans amplification pour la mesure de miarn Download PDF

Info

Publication number
WO2023089506A1
WO2023089506A1 PCT/IB2022/061047 IB2022061047W WO2023089506A1 WO 2023089506 A1 WO2023089506 A1 WO 2023089506A1 IB 2022061047 W IB2022061047 W IB 2022061047W WO 2023089506 A1 WO2023089506 A1 WO 2023089506A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
nucleotides
oligonucleotide
aspects
mirna
Prior art date
Application number
PCT/IB2022/061047
Other languages
English (en)
Inventor
Dae Hoon Kim
Hyun Su Min
Yu Na Lim
Ju Ye Ro
Original Assignee
Biorchestra Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biorchestra Co., Ltd. filed Critical Biorchestra Co., Ltd.
Publication of WO2023089506A1 publication Critical patent/WO2023089506A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6818—Hybridisation assays characterised by the detection means involving interaction of two or more labels, e.g. resonant energy transfer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the present disclosure relates to amplification-free systems that can be used to measure the level of a microRNA in a subject.
  • the present disclosure also relates to the use of such systems to identify and/or treat subjects afflicted with a disease or disorder (e.g., cognitive disorders).
  • a disease or disorder e.g., cognitive disorders.
  • BACKGROUND OF THE DISCLOSURE [0004] Cognitive disorders are common and growing cause of mortality and morbidity worldwide. The costs of AD are estimated at more than 800 billion USD globally. To date, there is still no known cure for many cognitive disorders. Available treatment options are generally limited to alleviating the various symptoms, as opposed to addressing the underlying causes of the disorders.
  • any treatment options to help alleviate some of the symptoms associated with cognitive disorders are not made available until long after the onset of the disorder.
  • the available methods of diagnosing cognitive disorders are often subjective (e.g., questionnaires), potentially harmful (e.g., use of radioactive isotopes for nuclear brain imaging), and/or prone to misdiagnosis (e.g., requiring amplification step which can result in amplification of irrelevant molecules). Therefore, new and more effective approaches to treating and/or diagnosing cognitive disorders are highly desirable.
  • RNA level a level of a miRNA
  • a method of determining a level of a miRNA comprising detecting whether an expression level of a probe is increased in a biological sample obtained from the subject compared to a corresponding expression level in a reference sample by: (a) contacting the biological sample with a first oligonucleotide conjugated to a quencher and a second oligonucleotide conjugated to the probe, wherein the first oligonucleotide specifically binds to the miRNA to form a duplex when the miRNA is present, wherein the second oligonucleotide specifically binds to the first oligonucleotide when the first oligonucleotide is not part of a duplex, and wherein the binding of the second oligonucleotide to the first oligonucleotide results in the que
  • Also disclosed herein is a method of identifying a subject afflicted with a disease or disorder, comprising: (a) contacting a biological sample obtained from the subject with a first oligonucleotide conjugated to a quencher and a second oligonucleotide conjugated to a probe, wherein the first oligonucleotide specifically binds to the miRNA to form a duplex when the miRNA is present, wherein the second oligonucleotide specifically binds to the first oligonucleotide when the first oligonucleotide is not part of a duplex, and wherein the binding of the second oligonucleotide to the first oligonucleotide results in the quencher inhibiting the expression of the probe; and (b) measuring the expression level of the probe, wherein an increase in the expression of the probe compared to a corresponding expression level in a reference sample indicates that the subject is afflicted with the disease or disorder
  • the contacting of the biological sample with the first oligonucleotide occurs prior to the contacting of the biological sample with the second oligonucleotide.
  • the expression level of the probe is increased by at least about 1- fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30- fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, or at least about 50- fold, compared to the corresponding expression level in the reference sample.
  • the increase in the expression level of the probe is correlated with an increase in the miRNA level.
  • the above methods further comprise administering to the subject a treatment for the disease or disorder.
  • a method of treating a disease or disorder in a subject in need thereof comprising administering a treatment for the disease or disorder to the subject identified as having an increase in a level of a miRNA ("miRNA level") in a biological sample obtained from the subject, compared to a corresponding level in a reference sample, wherein the miRNA level is measured by: (a) contacting the biological sample with a first oligonucleotide conjugated to a quencher and a second oligonucleotide conjugated to the probe, wherein the first oligonucleotide specifically binds to the miRNA to form a duplex when the miRNA is present, wherein the second oligonucleotide specifically binds to the first oligonucleotide when
  • the reference sample is obtained from a subject who is not afflicted with the disease or disorder.
  • the above methods does not require an amplification step prior to the measuring step in (b).
  • the amplification step comprises amplifying a miRNA present in the biological sample prior to the contacting step in (a).
  • the miRNA is associated with the disease or condition.
  • the disease or condition comprises a dementia, Alzheimer's disease, autism spectrum disorder, mental retardation, seizure, stroke, Parkinson's disease, spinal cord injury, amyotrophic lateral sclerosis (ALS), tauopathy, Huntington's disease, Spinal muscular atrophy (SMA), Dementia with Lewy bodies (DLB), CAA cerebral amyloid angiopathy (CAA), CDB corticobasal degeneration (CDB), Frontotemporal lobar degeneration due to FUS pathology (FTLD-fus), Frontotemporal lobar degeneration due to tau pathology (FTLD-tau), Frontotemporal lobar degeneration due to TDP 43 (FTLD-tdp), Multiple system atrophy (MSA), Progressive supranuclear palsy (PSP), pulmonary disease, inflammatory disease, or metabolic disease, or combinations thereof.
  • SMA Spinal muscular atrophy
  • DLB Dementia with Lewy bodies
  • CAA CAA cerebral amyloid angiopathy
  • the probe comprises a fluorescent marker, radioisotope, bioluminescent compound, chemiluminescent compound, enzyme, or combinations thereof.
  • the quencher comprises a dark quencher.
  • the biological sample comprises a saliva, tissue, cell, blood, serum, plasma, cerebrospinal fluid, intravitreal fluid, urine, or combinations thereof.
  • the miRNA comprises a miR-485-3p.
  • the first oligonucleotide is capable of specifically binding to the miR-485-3p ("anti-miR-485-3p oligonucleotide").
  • the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence comprising 5'-UGUAUGA-3' (SEQ ID NO: 2) and wherein the anti-miR-485-3p oligonucleotide comprises about 6 to about 30 nucleotides in length.
  • the anti- miR-485-3p oligonucleotide comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides at the '5 of the nucleotide sequence; and/or wherein the anti- miR-485-3p oligonucleotide comprises at least 1 nucleotide, at least 2 nucleotides, at least
  • the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence selected from the group consisting of: 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'- GUGUAUGA-3' (SEQ ID NO: 3), 5'-CGUGUAUGA-3' (SEQ ID NO: 4), 5'- CCGUGUAUGA-3' (SEQ ID NO: 5), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'- AGCCGUGUAUGA-3' (SEQ ID NO: 7), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'- AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO:
  • the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence selected from the group consisting of: 5'-TGTATGA-3' (SEQ ID NO: 62), 5'- GTGTATGA-3' (SEQ ID NO: 63), 5'-CGTGTATGA-3' (SEQ ID NO: 64), 5'- CCGTGTATGA-3' (SEQ ID NO: 65), 5'-GCCGTGTATGA-3' (SEQ ID NO: 66), 5'- AGCCGTGTATGA-3' (SEQ ID NO: 67), 5'-GAGCCGTGTATGA-3' (SEQ ID NO: 68), 5'- AGAGCCGTGTATGA-3' (SEQ ID NO: 69), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO: 70), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO: 71), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO:
  • the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90).
  • the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence that is at least 90% identical to 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90).
  • the anti-miR- 485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90) with one substitution or two substitutions.
  • the anti-miR-485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). In some aspects, the anti-miR- 485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 30). [0020] In some aspects, the anti-miR-485-3p oligonucleotide comprises at least one modified nucleotide.
  • the at least one modified nucleotide comprises a locked nucleic acid (LNA), unlocked nucleic acid (UNA), arabino nucleic acid (ABA), bridged nucleic acid (BNA), peptide nucleic acid (PNA), or any combination thereof.
  • LNA locked nucleic acid
  • UNA unlocked nucleic acid
  • ABA arabino nucleic acid
  • BNA bridged nucleic acid
  • PNA peptide nucleic acid
  • the anti-miR-485-3p oligonucleotide comprises a backbone modification.
  • the backbone modification comprises a phosphorodiamidate morpholino oligomer (PMO) and/or phosphorothioate (PS) modification.
  • a method comprises a treating
  • the treatment comprises an anti-miR-485-3p oligonucleotide, which is not conjugated to a probe or a quencher ("miR-485- 3p inhibitor").
  • the miR-485-3p inhibitor is administered to the subject by a viral vector.
  • the viral vector is an AAV, an adenovirus, a retrovirus, or a lentivirus.
  • the viral vector is an AAV that has a serotype of AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or any combination thereof.
  • the miR-485-3p inhibitor is administered to the subject with a delivery agent.
  • the delivery agent comprises a micelle, exosome, lipid nanoparticle, extracellular vesicle, synthetic vesicle, lipidoid, liposome, lipoplex, polymeric compound, peptide, protein, cell, nanoparticle mimic, nanotube, conjugate, or any combination thereof.
  • the delivery agent comprises a cationic carrier unit comprising [WP]-L1-[CC]-L2-[AM] (formula I) or [WP]-L1-[AM]-L2-[CC] (formula II) wherein WP is a water-soluble polymer moiety; CC is a cationic carrier moiety; AM is an adjuvant moiety; and, L1 and L2 are independently optional linkers.
  • the miR-485-3p inhibitor and the cationic carrier unit are capable of associating with each other to form a micelle when mixed together.
  • the association is via a covalent bond.
  • the association is via a non-covalent bond.
  • the non-covalent bond comprises an ionic bond.
  • the water-soluble polymer moiety comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly( ⁇ -hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines (“POZ”) poly(N-acryloylmorpholine), or any combinations thereof.
  • the water-soluble polymer moiety comprises polyethylene glycol (“PEG”), polyglycerol, or poly(propylene glycol) (“PPG”). [0028] In some aspects, the water-soluble polymer moiety comprises: wherein n is 1-1000.
  • the n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141.
  • the n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, about 150 to about 160.
  • the water-soluble polymer moiety is linear, branched, or dendritic.
  • the cationic carrier moiety comprises one or more basic amino acids.
  • the cationic carrier moiety comprises at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at last about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, or at least about 50 basic amino acids.
  • the cationic carrier moiety comprises about 30 to about 50 basic amino acids.
  • the basic amino acid comprises arginine, lysine, histidine, or any combination thereof.
  • the cationic carrier moiety comprises about 40 lysine monomers.
  • the adjuvant moiety of a cationic carrier unit is capable of modulating an immune response, an inflammatory response, and/or a tissue microenvironment.
  • the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof.
  • the adjuvant moiety comprises: wherein each of G1 and G2 is H, an aromatic ring, or 1-10 alkyl, or G1 and G2 together form an aromatic ring, and wherein n is 1-10.
  • the adjuvant moiety comprises nitroimidazole.
  • the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof.
  • the adjuvant moiety comprises an amino acid.
  • the adjuvant moiety comprises wherein Ar is wherein each of Z1 and Z2 is H or OH.
  • the adjuvant moiety comprises a vitamin.
  • the vitamin comprises a cyclic ring or cyclic hetero atom ring and a carboxyl group or hydroxyl group.
  • the vitamin comprises: wherein each of Y1 and Y2 is C, N, O, or S, and wherein n is 1 or 2.
  • the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof.
  • the vitamin is vitamin B3.
  • the adjuvant moiety comprises at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 vitamin B3.
  • the adjuvant moiety comprises about 10 vitamin B3.
  • the delivery agent comprises a water-soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3.
  • a system for determining a level of a miRNA comprising (i) a first oligonucleotide conjugated to a quencher and (ii) a second oligonucleotide conjugated to a probe, wherein the first oligonucleotide is capable of specifically binding to the miRNA to form a duplex when the miRNA is present, wherein the second oligonucleotide is capable of specifically binding to the first oligonucleotide when the first oligonucleotide is not part of a duplex, and wherein the quencher of the first oligonucleotide is capable of inhibiting the expression of the probe of the second oligonucleotide when the first and second oligonucleotides are bound to each other.
  • the probe comprises a fluorescent marker, radioisotope, bioluminescent compound, chemiluminescent compound, enzyme, or combinations thereof.
  • the quencher comprises a BBQ-650.
  • the miRNA comprises a miR-485-3p.
  • the first oligonucleotide is capable of specifically binding to the miR-485-3p ("anti-miR-485-3p oligonucleotide").
  • the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence comprising 5'- UGUAUGA-3' (SEQ ID NO: 2) and wherein the anti-miR-485-3p oligonucleotide comprises about 6 to about 30 nucleotides in length.
  • the anti- miR-485-3p oligonucleotide comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides at the '5 of the nucleotide sequence; and/or wherein the anti- miR-485-3p oligonucleotide comprises at least 1 nucleotide, at least 2 nucleotides, at least
  • the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence selected from the group consisting of: 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'- GUGUAUGA-3' (SEQ ID NO: 3), 5'-CGUGUAUGA-3' (SEQ ID NO: 4), 5'- CCGUGUAUGA-3' (SEQ ID NO: 5), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'- AGCCGUGUAUGA-3' (SEQ ID NO: 7), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'- AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO:
  • the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence selected from the group consisting of: 5'-TGTATGA-3' (SEQ ID NO: 62), 5'- GTGTATGA-3' (SEQ ID NO: 63), 5'-CGTGTATGA-3' (SEQ ID NO: 64), 5'- CCGTGTATGA-3' (SEQ ID NO: 65), 5'-GCCGTGTATGA-3' (SEQ ID NO: 66), 5'- AGCCGTGTATGA-3' (SEQ ID NO: 67), 5'-GAGCCGTGTATGA-3' (SEQ ID NO: 68), 5'- AGAGCCGTGTATGA-3' (SEQ ID NO: 69), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO: 70), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO: 71), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO:
  • the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90).
  • the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence that is at least 90% identical to 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90).
  • the anti-miR- 485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90) with one substitution or two substitutions.
  • the anti-miR-485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). In some aspects, the anti-miR- 485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 30). [0047] In some aspects, the anti-miR-485-3p oligonucleotide comprises at least one modified nucleotide.
  • the at least one modified nucleotide comprises a locked nucleic acid (LNA), unlocked nucleic acid (UNA), arabino nucleic acid (ABA), bridged nucleic acid (BNA), peptide nucleic acid (PNA), or any combination thereof.
  • the anti-miR-485-3p oligonucleotide comprises a backbone modification.
  • the backbone modification comprises a phosphorodiamidate morpholino oligomer (PMO) and/or phosphorothioate (PS) modification.
  • PMO phosphorodiamidate morpholino oligomer
  • PS phosphorothioate
  • FIG. 1 provides a schematic describing how the system described herein can measure the level of a miRNA in a biological sample (e.g., human saliva) from a subject.
  • FIGs. 2A and 2B show the quenching effects of anti-miRNA oligonucleotides conjugated to a quencher described herein.
  • FIG.2A provides a schematic of the experimental set-up.
  • FIG. 2B provides the fluorescence intensity (y-axis) observed at different ratios of the anti-miRNA oligonucleotide and miRNA mimic (x-axis).
  • FIGs.3A, 3B, 3C, and 3D show the ability of the oligonucleotides described herein (i.e., conjugated to a quencher or fluorescent probe) to detect sense oligonucleotides in a sample.
  • the sense oligonucleotides were used to represent miRNA.
  • FIGs. 3A and 3C provide schematics of the experimental set-up.
  • a high (20 ⁇ M) (see FIG. 3A) or low (10 ⁇ M) (see FIG. 3C) fixed concentration of the anti-miRNA oligonucleotide conjugated to a quencher (BBQ-650) (“BBQ-ASO”) were added to a sample comprising different concentrations (0-10 ⁇ M) of the sense oligonucleotides to allow the formation of a first duplex.
  • BBQ-650 quencher
  • the same high or low fixed concentration of the oligonucleotide conjugated to a fluorescent probe (Cy5.5) (“miRNA mimic”) were added to the sample to allow any unbound BBQ-ASO to form a duplex with the miRNA mimic (“second duplex").
  • FIG.3B provides the fluorescence intensity (y-axis) observed as a function of the concentration of the sense oligonucleotide (x-axis) using the high fixed concentration (20 ⁇ M) for both the anti-miRNA oligonucleotide and the miRNA mimic.
  • FIG. 3D provides the fluorescence intensity (y-axis) observed as a function of the concentration of the sense oligonucleotide (x-axis) using the low fixed concentration (10 ⁇ M) for both the anti-miRNA oligonucleotide and the miRNA mimic.
  • the present disclosure is generally directed to systems (e.g., diagnostic systems) comprising multiple oligonucleotides (e.g., two or more) and the use of such systems to measure the expression level of a microRNA ("miRNA") in a subject.
  • miRNA microRNA
  • RT-PCR reverse transcriptase polymerase chain reaction
  • the systems and methods provided herein do not require an amplification step. Therefore, compared to approaches known in the art, the systems and methods described herein are capable of measuring miRNA levels much more quickly and with greater accuracy (e.g., less risk of false reads resulting from amplified contaminants).
  • ranges recited are understood to be shorthand for all of the values within the range, inclusive of the recited endpoints.
  • a range of 1 to 10 is understood to include any number, combination of numbers, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.
  • nucleotide sequences are written left to right in 5' to 3' orientation. Nucleotides are referred to herein by their commonly known one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Accordingly, 'a' represents adenine, 'c' represents cytosine, 'g' represents guanine, 't' represents thymine, and 'u' represents uracil. [0064] Amino acid sequences are written left to right in amino to carboxy orientation. Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
  • AAV adeno-associated virus
  • AAV includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAVrh.74, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, those AAV serotypes and clades disclosed by Gao et al. (J. Virol.78:6381 (2004)) and Moris et al.
  • an "AAV” includes a derivative of a known AAV.
  • an “AAV” includes a modified or an artificial AAV.
  • the terms "administration,” “administering,” and grammatical variants thereof refer to introducing a composition, such as a miRNA inhibitor described herein (e.g., miRNA- 485-3p inhibitor), into a subject via a pharmaceutically acceptable route.
  • a composition such as a micelle comprising a miRNA inhibitor described herein
  • introduction of a composition is by any suitable route, including intratumorally, orally, pulmonarily, intranasally, parenterally (intravenously, intra-arterially, intramuscularly, intraperitoneally, or subcutaneously), rectally, intralymphatically, intrathecally, periocularly or topically.
  • Administration includes self-administration and the administration by another.
  • a suitable route of administration allows the composition or the agent to perform its intended function. For example, if a suitable route is intravenous, the composition is administered by introducing the composition or agent into a vein of the subject.
  • the term “approximately,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In some aspects, the term “approximately” refers to a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
  • the term "afflicted with” can be used interchangeably with the term “suffering from” and refers to the state of having a disease or condition, such as that associated with abnormal level and/or activity of a miRNA (e.g., cognitive disorder disclosed herein).
  • a subject afflicted with a disease or condition e.g., cognitive disorder
  • exhibits one or more symptoms associated with the disease or condition e.g., cognitive disorder (e.g., loss of memory for Alzheimer's disease patients)).
  • a subject does not need to exhibit one or more symptoms to be afflicted with a disease or disorder disclosed herein (e.g., can have a genetic predisposition to the disease or disorder).
  • the term "associated with” refers to a close relationship between two or more entities or properties.
  • the term "associated with” refers to an increased likelihood that a subject suffers from (i.e., afflicted with) the disease or condition when the subject exhibits an abnormal miRNA (e.g., miR-485-3p) expression level.
  • the abnormal expression causes the disease or condition.
  • the abnormal expression does not necessarily cause but is correlated with the disease or condition.
  • abnormal level refers to a level (expression and/or activity) that differs (e.g., increased or decreased) from a reference subject, e.g., who does not suffer from a disease or condition described herein (e.g., cognitive disorder).
  • an abnormal level refers to a level that is increased by at least about 0.1-fold, at least about 0.2-fold, at least about 0.3-fold, at least about 0.4-fold, at least about 0.5-fold, at least about 0.6-fold, at least about 0.7-fold, at least about 0.8-fold, at least about 0.9-fold, at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100- fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500- fold, at least about 750-fold, or at least about 1,000-fold or more compared to the corresponding level in a reference subject (e.g., subject
  • an abnormal level refers to a level that is decreased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% compared to the corresponding level in a reference subject (e.g., subject who does not suffer from a disease or condition described herein).
  • a reference subject e.g., subject who does not suffer from a disease or condition described herein.
  • the term "cognitive disorder” refers to any disorder that affects mental processes, including, but not limited to, impairments in memory, learning, awareness, attention, communication, motor coordination, and/or intellectual capacity.
  • the cognitive disorder is Alzheimer’s disease (AD) and/or Mild Cognitive Impairment (MCI).
  • a “cognitive disorder” refers to AD, MCI, amnesia, corticobasal syndrome, dementia, Lewy body dementia (LBD), frontotemporal dementia, primary progressive aphasia, progressive non-fluent aphasia, progressive supranuclear palsy, pseudosenility, semantic dementia, severe cognitive impairment, subcortical dementia, vascular dementia, amyotrophic lateral sclerosis (ALS), and/or logopenic progressive aphasia.
  • the cognitive disorder is associated with amyloid- ⁇ accumulation.
  • Nucleotides or amino acids that are relatively conserved are those that are conserved amongst more related sequences than nucleotides or amino acids appearing elsewhere in the sequences.
  • two or more sequences are said to be "completely conserved” or “identical” if they are 100% identical to one another.
  • two or more sequences are said to be "highly conserved” if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some aspects, two or more sequences are said to be “highly conserved” if they are about 70% identical, about 80% identical, about 90% identical, about 95%, about 98%, or about 99% identical to one another. In some aspects, two or more sequences are said to be "conserved” if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another.
  • two or more sequences are said to be "conserved” if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another.
  • Conservation of sequence can apply to the entire length of a polynucleotide or polypeptide or can apply to a portion, region or feature thereof.
  • the term "derived from,” as used herein, refers to a component that is isolated from or made using a specified molecule or organism, or information (e.g., amino acid or nucleic acid sequence) from the specified molecule or organism.
  • a nucleic acid sequence that is derived from a second nucleic acid sequence can include a nucleotide sequence that is identical or substantially similar to the nucleotide sequence of the second nucleic acid sequence.
  • the derived species can be obtained by, for example, naturally occurring mutagenesis, artificial directed mutagenesis or artificial random mutagenesis.
  • the mutagenesis used to derive nucleotides or polypeptides can be intentionally directed or intentionally random, or a mixture of each.
  • the mutagenesis of a nucleotide or polypeptide to create a different nucleotide or polypeptide derived from the first can be a random event (e.g., caused by polymerase infidelity) and the identification of the derived nucleotide or polypeptide can be made by appropriate screening methods, e.g., as discussed herein.
  • a nucleotide or amino acid sequence that is derived from a second nucleotide or amino acid sequence has a sequence identity of at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 8
  • a "coding region” or “coding sequence” is a portion of polynucleotide which consists of codons translatable into amino acids. Although a “stop codon” (TAG, TGA, or TAA) is typically not translated into an amino acid, it can be considered to be part of a coding region, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, and the like, are not part of a coding region.
  • a coding region typically determined by a start codon at the 5' terminus, encoding the amino terminus of the resultant polypeptide, and a translation stop codon at the 3' terminus, encoding the carboxyl terminus of the resulting polypeptide.
  • the terms "complementary” and “complementarity” refer to two or more oligomers (i.e., each comprising a nucleobase sequence), or between an oligomer and a target gene, that are related with one another by Watson-Crick base-pairing rules.
  • nucleobase sequence "T-G-A (5' ⁇ 3'),” is complementary to the nucleobase sequence "A-C- T (3' ⁇ 5').”
  • Complementarity can be “partial,” in which less than all of the nucleobases of a given nucleobase sequence are matched to the other nucleobase sequence according to base pairing rules.
  • complementarity between a given nucleobase sequence and the other nucleobase sequence can be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.
  • the term "complementary” refers to at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% match or complementarity to a target nucleic acid sequence (e.g., miR-485 nucleic acid sequence). Or, there can be “complete” or “perfect” (100%) complementarity between a given nucleobase sequence and the other nucleobase sequence to continue the example. In some aspects, the degree of complementarity between nucleobase sequences has significant effects on the efficiency and strength of hybridization between the sequences.
  • the term "diagnosing” refers to methods that can be used to determine or predict whether a subject is afflicted with, suffering from, or at a risk (e.g., genetically predisposed) for a given disease or condition, thereby identifying a subject who is suitable for a treatment.
  • the treatment can be therapeutic (e.g., administered to a subject exhibiting one or more symptoms associated with the disease or disorder).
  • the treatment can be prophylactic (e.g., administered to an at-risk subject to prevent and/or reduce the onset of the disease or disorder).
  • a skilled artisan can make a diagnosis on the basis of one or more diagnostic marker (e.g., miR- 485-3p), where the presence, absence, amount, or change in the amount of the diagnostic marker is indicative of the presence, severity, or absence of the condition.
  • an abnormal level e.g., increased or decreased compared to a reference control
  • the diagnostic marker e.g., miR-485-3p expression
  • an increase in miR-485-3p expression e.g., in a biological sample from the subject
  • a cognitive disorder e.g., Alzheimer's disease.
  • diagnosis does not refer to the ability to determine the presence or absence of a particular disease or disorder with 100% accuracy, or even that a given course or outcome is more likely to occur than not. Instead, the skilled artisan will understand that the term “diagnosis” refers to an increased probability that a certain disease or disorder is present in the subject. In some aspects, the term “diagnosis” includes one or more diagnostic methods of identifying a subject who has a cognitive disorder (e.g., those described herein). [0079] The term “downstream” refers to a nucleotide sequence that is located 3' to a reference nucleotide sequence. In some aspects, downstream nucleotide sequences relate to sequences that follow the starting point of transcription.
  • duplex refers to a double stranded structure formed by two complementary or substantially complementary polynucleotides that form base pairs with one another, including Watson-Crick base pairs and U-G wobble pairs that allow for a stabilized double stranded structure between polynucleotide strands that are at least partially complementary.
  • the strands of a duplex need not be perfectly complementary for a duplex to form, i.e., a duplex can include one or more base mismatches.
  • excipient and “carrier” are used interchangeably and refer to an inert substance added to a pharmaceutical composition to further facilitate administration of a compound, e.g., a miRNA inhibitor described herein (e.g., miR-485-3p inhibitor).
  • expression refers to a process by which a polynucleotide produces a gene product, e.g., RNA or a polypeptide. It includes without limitation transcription of the polynucleotide into micro RNA binding site, small hairpin RNA (shRNA), small interfering RNA (siRNA), or any other RNA product.
  • shRNA small hairpin RNA
  • siRNA small interfering RNA
  • RNA messenger RNA
  • expression produces a "gene product.”
  • a gene product can be, e.g., a nucleic acid, such as an RNA produced by transcription of a gene.
  • a gene product can be either a nucleic acid, RNA or miRNA produced by the transcription of a gene, or a polypeptide which is translated from a transcript.
  • Gene products described herein further include nucleic acids with post transcriptional modifications, e.g., polyadenylation or splicing, or polypeptides with post translational modifications, e.g., phosphorylation, methylation, glycosylation, the addition of lipids, association with other protein subunits, or proteolytic cleavage.
  • expression can be used interchangeable with the term “level.”
  • miR-485-3p expression can be synonymous with the term “miR-485-3p level.”
  • the term “homology” refers to the overall relatedness between polymeric molecules, e.g. between nucleic acid molecules.
  • polymeric molecules are considered to be "homologous" to one another if at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of the monomers in the molecule are identical (exactly the same monomer) or are similar (conservative substitutions).
  • homologous necessarily refers to a comparison between at least two sequences (e.g., polynucleotide sequences).
  • substitutions are conducted at the nucleic acid level, i.e., substituting an amino acid residue with an alternative amino acid residue is conducted by substituting the codon encoding the first amino acid with a codon encoding the second amino acid.
  • identity refers to the overall monomer conservation between polymeric molecules, e.g., between polynucleotide molecules.
  • polynucleotide A is identical to polynucleotide B
  • polynucleotide sequences are 100% identical (100% sequence identity).
  • Describing two sequences as, e.g., "70% identical,” is equivalent to describing them as having, e.g., "70% sequence identity.”
  • Calculation of the percent identity of two polypeptide or polynucleotide sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second polypeptide or polynucleotide sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
  • the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence.
  • the amino acids at corresponding amino acid positions, or bases in the case of polynucleotides are then compared.
  • a position in the first sequence is occupied by the same amino acid or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
  • Suitable software programs that can be used to align different sequences are available from various sources.
  • One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of program available from the U.S. government's National Center for Biotechnology Information BLAST web site (blast.ncbi.nlm.nih.gov).
  • Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm.
  • BLASTN is used to compare nucleic acid sequences
  • BLASTP is used to compare amino acid sequences.
  • 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer.
  • sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystallographic protein structures), functional data (e.g., location of mutations), or phylogenetic data.
  • a suitable program that integrates heterogeneous data to generate a multiple sequence alignment is T-Coffee, available at www.tcoffee.org, and alternatively available, e.g., from the EBI. It will also be appreciated that the final alignment used to calculate percent sequence identity can be curated either automatically or manually.
  • isolating or purifying as used herein is the process of removing, partially removing (e.g., a fraction) of a composition of the present disclosure, e.g., a miRNA inhibitor, from a sample containing contaminants.
  • an isolated composition has no detectable undesired activity or, alternatively, the level or amount of the undesired activity is at or below an acceptable level or amount. In some aspects, an isolated composition has an amount and/or concentration of desired composition of the present disclosure, at or above an acceptable amount and/or concentration and/or activity. In some aspects, the isolated composition is enriched as compared to the starting material from which the composition is obtained.
  • This enrichment can be by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.9%, at least about 99.99%, at least about 99.999%, at least about 99.9999%, or greater than 99.9999% as compared to the starting material.
  • isolated preparations are substantially free of residual biological products.
  • the isolated preparations are 100% free, at least about 99% free, at least about 98% free, at least about 97% free, at least about 96% free, at least about 95% free, at least about 94% free, at least about 93% free, at least about 92% free, at least about 91% free, or at least about 90% free of any contaminating biological matter.
  • Residual biological products can include abiotic materials (including chemicals) or unwanted nucleic acids, proteins, lipids, or metabolites.
  • the term "linked" as used herein refers to a first amino acid sequence or polynucleotide sequence covalently or non-covalently joined to a second amino acid sequence or polynucleotide sequence, respectively.
  • the first amino acid or polynucleotide sequence can be directly joined or juxtaposed to the second amino acid or polynucleotide sequence or alternatively an intervening sequence can covalently join the first sequence to the second sequence.
  • the term "linked" means not only a fusion of a first polynucleotide sequence to a second polynucleotide sequence at the 5'-end or the 3'-end, but also includes insertion of the whole first polynucleotide sequence (or the second polynucleotide sequence) into any two nucleotides in the second polynucleotide sequence (or the first polynucleotide sequence, respectively).
  • the first polynucleotide sequence can be linked to a second polynucleotide sequence by a phosphodiester bond or a linker.
  • the linker can be, e.g., a polynucleotide.
  • a "miRNA inhibitor,” as used herein, refers to a compound that can decrease, alter, and/or modulate miRNA expression, function, and/or activity.
  • the miRNA inhibitor can be a polynucleotide sequence that is at least partially complementary to the target miRNA nucleic acid sequence, such that the miRNA inhibitor hybridizes to the target miRNA sequence.
  • a miRNA inhibitor comprises an anti-miRNA oligonucleotide described herein that is not conjugated to a probe or a quencher.
  • a non-limiting example of a miRNA inhibitor is a miR-485-3p inhibitor described herein.
  • MicroRNAs recognize and bind to target mRNAs through imperfect base pairing leading to destabilization or translational inhibition of the target mRNA and thereby downregulate target gene expression.
  • targeting miRNAs via molecules comprising a miRNA binding site can reduce or inhibit the miRNA- induced translational inhibition leading to an upregulation of the target gene.
  • mismatch refers to one or more nucleobases (whether contiguous or separate) in an oligomer nucleobase sequence (e.g., anti-miRNA oligonucleotides and/or miRNA mimics described herein) that are not matched to a target nucleic acid sequence (e.g., miRNA, e.g., miR-485-3p) according to base pairing rules. While perfect complementarity is often desired, in some aspects, one or more (e.g., 6, 5, 4, 3, 2, or 1 mismatches) can occur with respect to the target nucleic acid sequence. Variations at any location within the oligomer are included.
  • antisense oligomers of the disclosure include variations in nucleobase sequence near the termini, variations in the interior, and if present are typically within about 6, 5, 4, 3, 2, or 1 subunits of the 5' and/or 3' terminus.
  • one, two, or three nucleobases can be removed and still provide on-target binding.
  • the terms “modulate,” “modify,” and grammatical variants thereof, generally refer when applied to a specific concentration, level, expression, function or behavior, to the ability to alter, by increasing or decreasing, e.g., directly or indirectly promoting/stimulating/up-regulating or interfering with/inhibiting/down-regulating the specific concentration, level, expression, function or behavior, such as, e.g., to act as an antagonist or agonist.
  • a modulator can increase and/or decrease a certain concentration, level, activity or function relative to a control, or relative to the average level of activity that would generally be expected or relative to a control level of activity.
  • a miRNA inhibitor disclosed herein can modulate (e.g., decrease, alter, or abolish) miRNA expression, function, and/or activity.
  • "Nucleic acid,” “nucleic acid molecule,” “nucleotide sequence,” “polynucleotide,” and grammatical variants thereof are used interchangeably and refer to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix.
  • Single stranded nucleic acid sequences refer to single-stranded DNA (ssDNA) or single- stranded RNA (ssRNA). Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible.
  • nucleic acid molecule and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA and chromosomes.
  • a "recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
  • DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA.
  • a "nucleic acid composition" of the disclosure comprises one or more nucleic acids as described herein.
  • pharmaceutically acceptable carrier encompass any of the agents approved by a regulatory agency of the U.S. Federal government or listed in the U.S. Pharmacopeia for use in animals, including humans, as well as any carrier or diluent that does not cause the production of undesirable physiological effects to a degree that prohibits administration of the composition to a subject and does not abrogate the biological activity and properties of the administered compound. Included are excipients and carriers that are useful in preparing a pharmaceutical composition and are generally safe, non-toxic, and desirable.
  • the term “pharmaceutical composition” refers to one or more of the compounds described herein, such as, e.g., a miRNA inhibitor, mixed or intermingled with, or suspended in one or more other chemical components, such as pharmaceutically acceptable carriers and excipients.
  • a pharmaceutical composition is to facilitate administration of preparations comprising a miRNA inhibitor to a subject.
  • polynucleotide refers to polymers of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof.
  • the term refers to the primary structure of the molecule.
  • the term includes triple-, double- and single-stranded deoxyribonucleic acid ("DNA”), as well as triple-, double- and single-stranded ribonucleic acid (“RNA”). It also includes modified, for example by alkylation, and/or by capping, and unmodified forms of the polynucleotide.
  • polynucleotide includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, shRNA, siRNA, miRNA and mRNA, whether spliced or unspliced, any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing normucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids "PNAs”) and polymorpholino polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA.
  • PNAs peptide nucleic acids
  • a polynucleotide can be, e.g., an oligonucleotide, such as an antisense oligonucleotide.
  • the oligonucleotide is an RNA.
  • the RNA is a synthetic RNA.
  • the synthetic RNA comprises at least one unnatural nucleobase.
  • all nucleobases of a certain class have been replaced with unnatural nucleobases (e.g., all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g., 5-methoxyuridine).
  • polypeptide polypeptide
  • peptide protein
  • protein polymers of amino acids of any length.
  • the polymer can comprise modified amino acids.
  • the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
  • polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine
  • polypeptide refers to proteins, polypeptides, and peptides of any size, structure, or function.
  • Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing.
  • a polypeptide can be a single polypeptide or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multichain polypeptides. Most commonly disulfide linkages are found in multichain polypeptides.
  • the term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.
  • a "peptide" can be less than or equal to about 50 amino acids long, e.g., about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 amino acids long.
  • prevent refers partially or completely delaying onset of an disease, disorder and/or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular disease, disorder, and/or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular disease, disorder, and/or condition; partially or completely delaying progression from a particular disease, disorder and/or condition; and/or decreasing the risk of developing pathology associated with the disease, disorder, and/or condition. In some aspects, preventing an outcome is achieved through prophylactic treatment.
  • promoter and “promoter sequence” are interchangeable and refer to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
  • a coding sequence is located 3' to a promoter sequence. Promoters can be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions.
  • Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters.” Promoters that cause a gene to be expressed in a specific cell type are commonly referred to as “cell-specific promoters” or “tissue-specific promoters.” Promoters that cause a gene to be expressed at a specific stage of development or cell differentiation are commonly referred to as “developmentally-specific promoters” or “cell differentiation-specific promoters.” Promoters that are induced and cause a gene to be expressed following exposure or treatment of the cell with an agent, biological molecule, chemical, ligand, light, or the like that induces the promoter are commonly referred to as “inducible promoters” or “regulatable promoters.” It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths can have identical promoter activity.
  • the promoter sequence is typically bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase.
  • a promoter that can be used with the present disclosure includes a tissue specific promoter.
  • prolactic refers to a therapeutic or course of action used to prevent the onset of a disease or condition, or to prevent or delay a symptom associated with a disease or condition.
  • a "prophylaxis” refers to a measure taken to maintain health and prevent the onset of a disease or condition, or to prevent or delay a symptom associated with a disease or condition.
  • the term “quencher” refers to any substance that can reduce and/or inhibit a detectable signal produced by a probe.
  • the term “probe” refers to any moiety that can exhibit a detectable signal, which signal can be suppressed by a quencher.
  • the probe comprises a fluorophore and the detectable signal comprises a fluorescence (or light).
  • excitation of the fluorophore in the presence of the quencher can lead to an emission signal that is reduced in intensity or even completely absent.
  • the quenching can occur through energy transfer between the excited fluorophore and the quencher.
  • quenchers and probes e.g., fluorophores
  • regulatory region and “gene regulatory region” are interchangeable and refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding region, and which influence the transcription, RNA processing, stability, or translation of the associated coding region. Regulatory regions can include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, or stem- loop structures. If a coding region is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
  • similarity refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. miRNA molecules). Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art. It is understood that percentage of similarity is contingent on the comparison scale used, i.e., whether the nucleic acids are compared, e.g., according to their evolutionary proximity, charge, volume, flexibility, polarity, hydrophobicity, aromaticity, isoelectric point, antigenicity, or combinations thereof.
  • subject refers to any mammalian subject, including without limitation, humans, domestic animals (e.g., dogs, cats and the like), farm animals (e.g., cows, sheep, pigs, horses and the like), and laboratory animals (e.g., monkey, rats, mice, rabbits, guinea pigs and the like) for whom diagnosis, treatment, or therapy is desired, particularly humans.
  • domestic animals e.g., dogs, cats and the like
  • farm animals e.g., cows, sheep, pigs, horses and the like
  • laboratory animals e.g., monkey, rats, mice, rabbits, guinea pigs and the like for whom diagnosis, treatment, or therapy is desired, particularly humans.
  • laboratory animals e.g., monkey, rats, mice, rabbits, guinea pigs and the like
  • the term "therapeutically effective amount” is the amount of reagent or pharmaceutical compound comprising a compound (e.g., miRNA inhibitor described herein) that is sufficient to a produce a desired therapeutic effect, pharmacologic and/or physiologic effect on a subject in need thereof.
  • a therapeutically effective amount can be a "prophylactically effective amount” as prophylaxis can be considered therapy.
  • treat refers to, e.g., the reduction in severity of a disease or condition; the reduction in the duration of a disease course; the amelioration or elimination of one or more symptoms associated with a disease or condition (e.g., diabetes); the provision of beneficial effects to a subject with a disease or condition, without necessarily curing the disease or condition.
  • the term also includes prophylaxis or prevention of a disease or condition or its symptoms thereof.
  • upstream refers to a nucleotide sequence that is located 5' to a reference nucleotide sequence.
  • a "vector” refers to any vehicle for the cloning of and/or transfer of a nucleic acid into a host cell.
  • a vector can be a replicon to which another nucleic acid segment can be attached so as to bring about the replication of the attached segment.
  • a "replicon” refers to any genetic element (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of replication in vivo, i.e., capable of replication under its own control.
  • the term “vector” includes both viral and nonviral vehicles for introducing the nucleic acid into a cell in vitro, ex vivo or in vivo.
  • Vectors can be engineered to encode selectable markers or reporters that provide for the selection or identification of cells that have incorporated the vector. Expression of selectable markers or reporters allows identification and/or selection of host cells that incorporate and express other coding regions contained on the vector.
  • selectable marker genes known and used in the art include: genes providing resistance to ampicillin, streptomycin, gentamycin, kanamycin, hygromycin, bialaphos herbicide, sulfonamide, and the like; and genes that are used as phenotypic markers, i.e., anthocyanin regulatory genes, isopentanyl transferase gene, and the like.
  • reporter known and used in the art include: luciferase (Luc), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), ⁇ -galactosidase (LacZ), ⁇ -glucuronidase (Gus), and the like. Selectable markers can also be considered to be reporters. II.
  • RNA level a level of a miRNA
  • the diagnostic methods of the present disclosure differ from the more traditional methods (e.g., RT-PCR) in that no amplification step is required.
  • Applicant has identified that through the use of oligonucleotides conjugated to probes and quenchers, it is possible to measure the level of a miRNA in a biological sample without the need to first amplify the miRNA present in the biological sample prior to the measuring.
  • a method of determining a miRNA level in a subject afflicted with a disease or condition comprising detecting whether an expression level of a probe is increased in a biological sample obtained from the subject compared to a corresponding expression level in a reference sample by: (a) contacting the biological sample with a first oligonucleotide conjugated to a quencher and a second oligonucleotide conjugated to a probe, (i) wherein the first oligonucleotide specifically binds to the miRNA (also referred to herein as "anti-miRNA oligonucleotide”) to form a duplex when the miRNA is present in the biological sample, (ii) wherein the second oligonucleotide specifically binds to the first oligonucleotide
  • a method of identifying a subject afflicted with a disease or disorder comprising: (a) contacting a biological sample obtained from the subject with a first oligonucleotide conjugated to a quencher (i.e., anti-miRNA oligonucleotide) and a second oligonucleotide conjugated to a probe (i.e., miRNA mimic), (i) wherein the anti-miRNA oligonucleotide specifically binds to a miRNA to form a duplex when the miRNA is present in the biological sample, (ii) wherein the miRNA mimic specifically binds to the anti-miRNA oligonucleotide when the anti-miRNA oligonucleotide is not part of the duplex, and (iii) wherein the binding of the miRNA mimic to the anti-miRNA oligonucleotide results in the quencher inhibiting the expression of the
  • the contacting of the biological sample with the first oligonucleotide occurs prior to the contacting of the biological sample with the second oligonucleotide (i.e., miRNA mimic).
  • the second oligonucleotide i.e., miRNA mimic.
  • the anti-miRNA oligonucleotide is contacted with the biological sample at least about one minute, at least about two minutes, at least about three minutes, at least about four minutes, at least about five minutes, at least about six minutes, at least about seven minutes, at least about eight minutes, at least about nine minutes, at least about 10 minutes, at least about 15 minutes, at least about 20 minutes, at least about 25 minutes, at least about 30 minutes, at least about 45 minutes, or at least about 60 minutes prior to the contacting of the biological sample with the miRNA mimic.
  • the biological sample is contacted with the anti-miRNA oligonucleotide at least about 10 minutes before the biological sample is contacted with the miRNA mimic.
  • the biological sample can be contacted with the first and second oligonucleotides concurrently with the proviso that the first oligonucleotide (i.e., anti-miRNA oligonucleotide) preferentially binds to the miRNA of interest (e.g., present in the biological sample) as compared to the second oligonucleotide (i.e., miRNA mimic).
  • the first oligonucleotide i.e., anti-miRNA oligonucleotide
  • the first oligonucleotide preferentially binds to the miRNA of interest (e.g., present in the biological sample) as compared to the second oligonucleotide (i.e., miRNA mimic).
  • the first oligonucleotide binds to the miRNA of interest with greater binding affinity.
  • the binding affinity between the first oligonucleotide and the miRNA of interest is greater than about one-fold, greater than about two-fold, greater than about three-fold, greater than about four-fold, greater than about five-fold, greater than about ten-fold, greater than about 15-fold, greater than about 20-fold, greater than about 25-fold, greater than about 30-fold, greater than about 35-fold, greater than about 40-fold, greater than about 45-fold, or greater than about 50- fold, compared to the binding affinity between the first oligonucleotide and the second oligonucleotide.
  • the methods described herein can determine the amount of miRNA present in a sample (without the need for amplification) by measuring a detectable signal (e.g., fluorescence intensity) exhibited by a probe described herein.
  • a detectable signal e.g., fluorescence intensity
  • the amount of detectable signal from the probe measured can be correlated to the amount of miRNA present in the biological sample. For instance, in some aspects, the amount of detectable signal measured and the amount of miRNA present in the biological sample are directly correlated (i.e., a sample with increased miRNA level would be associated with higher detectable signal).
  • the expression level of the probe is greater than about one-fold, greater than about two-fold, greater than about three- fold, greater than about four-fold, greater than about five-fold, greater than about ten-fold, greater than about 15-fold, greater than about 20-fold, greater than about 25-fold, greater than about 30-fold, greater than about 35-fold, greater than about 40-fold, greater than about 45- fold, or greater than about 50-fold, compared to the corresponding expression level in the reference sample.
  • the reference sample is the corresponding biological sample obtained from a subject who is not afflicted with the disease or disorder.
  • the reference sample is the corresponding biological sample obtained from the subject prior to being afflicted with the disease or disorder.
  • the expression level of the probe is greater than the corresponding expression level in the reference sample, the subject is afflicted with the disease or disorder, wherein the disease or disorder is associated with an increased expression of the miRNA.
  • certain diseases or conditions can be associated with a decreased level of a miRNA.
  • the systems and methods provided herein can also be useful in identifying subjects suffering from or afflicted with such diseases or conditions. Accordingly, the disclosures provided above are not limited to diseases or conditions associated with increased miRNA expression.
  • a method of determining a miRNA level in a subject in need thereof comprises detecting whether an expression level of a probe is decreased in a biological sample obtained from the subject compared to a corresponding expression level in a reference sample (e.g., obtained from a healthy subject) by: (a) contacting the biological sample with a first oligonucleotide conjugated to a quencher (i.e., anti-miRNA oligonucleotide) and a second oligonucleotide conjugated to a probe (i.e., miRNA mimic), (i) wherein the anti-miRNA oligonucleotide specifically binds to the miRNA to form a duplex when the miRNA is present in the biological sample, (ii) wherein the miRNA mimic specifically binds to the anti-miRNA oligonucleotide when the anti-miRNA oligonucleotide is not part of the
  • a decrease in the expression of the probe compared to the corresponding expression level in the reference sample indicates that the subject is suffering from or at risk of developing a disease or condition which is associated with the decreased expression of the miRNA.
  • the reference sample is the corresponding biological sample obtained from a subject who is not afflicted with the disease or disorder. In some aspects, the reference sample is the corresponding biological sample obtained from the subject prior to being afflicted with the disease or disorder.
  • the expression level of the probe i.e., amount of detectable signal measured
  • the expression level of the probe is decreased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100%.
  • suitable biological samples include: a saliva, tissue, cell, blood, serum, plasma, cerebrospinal fluid, intravitreal fluid, urine, or combinations thereof. Methods of obtaining such biological samples are known in the art.
  • the biological sample is derived from an epithelial cell of the subject.
  • the epithelial cell comprises oral epithelial cells, e.g., such as those that can be obtained through a swab sample.
  • the biological sample is derived from a subject's serum and/or plasma.
  • II.A. Oligonucleotides II.A.1. First Oligonucleotide As is apparent from the present disclosure, a first oligonucleotide useful for the present disclosure is not particularly limited as long as the first oligonucleotide is capable of specifically binding to a target miRNA to form a duplex (i.e., hybridizes to the miRNA of interest).
  • the anti-miRNA oligonucleotide comprises a nucleotide sequence encoding a nucleotide molecule that comprises at least one miRNA binding site, wherein the nucleotide molecule does not encode a protein.
  • the miRNA binding site is at least partially complementary to the target miRNA nucleic acid sequence, such that the anti-miRNA oligonucleotide is capable of hybridizing to the miRNA nucleic acid sequence.
  • the anti-miRNA oligonucleotide has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence of the target miRNA.
  • the anti-miRNA oligonucleotide is fully complementary to the nucleic acid sequence of the target miRNA.
  • the anti-miRNA oligonucleotide can be designed to target (e.g., specifically bind to) any suitable miRNAs known in the art.
  • an anti-miRNA oligonucleotide can be designed to specifically target a miRNA that is associated with a certain disease or disorder (e.g., increased or decreased expression in a subject afflicted with a disease compared to the expression in a subject not afflicted with the disease).
  • Such miRNAs are known, and non-limiting examples are described in, e.g., Ardekani et al., Avicenna J Med Biotechnol 2(4): 151-179 (Oct/Dec 2010); U.S. Pat. No. 10,844,380; and U.S. Publ. No. 2020/0392576; each of which is incorporated herein by reference in its entirety.
  • Such non-limiting examples include: miR-134-5p, miR-155-5p, miR- 132-3p, miR-132-5p, miR-129-1-3p, miR-129-2-3p, miR-129-5p, miR-211-3p, miR-211-5p, miR-324-3p, miR-324-5p, miR-92a-1-5p, miR-92a-2-5p, miR-92a-3p, miR-101-2-5p, miR- 101-3p, miR-101-5p, miR-135a-2-3p, miR-135a-3p, miR-135a-5p, miR-135b-3p, miR-135b- 5p, miR-21-3p, miR-21-5p, miR-31-3p, miR-31-5p, miR-146a-3p, miR-146a-5p, miR-146b- 3p, miR-146b-5p, miR-124-3p, miR-124-5p, miR-122-3p, miR
  • a miRNA that can be targeted using an anti-miRNA oligonucleotide described herein comprises a miR-485-3p.
  • an anti-miRNA oligonucleotide i.e., first oligonucleotide
  • the miR-485-3p binding site is at least partially complementary to the target miRNA nucleic acid sequence (i.e., miR-485-3p), such that the anti-miR-485-3p oligonucleotide hybridizes to the miR-485-3p nucleic acid sequence.
  • miR-485-3p target miRNA nucleic acid sequence
  • the disclosures provided herein are generally described in the context of miR- 485-3p (e.g., anti-miR485-3p oligonucleotide), it will be apparent to those skilled in the art that relevant disclosures can equally apply to other suitable miRNA molecules known in the art (e.g., those associated with certain diseases or disorders).
  • the miRNA binding site of an anti-miR-485-3p oligonucleotide disclosed herein has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence of a miR-485-3p.
  • the miR-485-3p binding site is fully complementary to the nucleic acid sequence of a miR-485-3p.
  • the miR-485-3p hairpin precursor can generate miR-485-3p.
  • the human mature miR-485-3p has the sequence 5'- GUCAUACACGGCUCUCCUCUCU-3' (SEQ ID NO: 1; miRBase Acc. No. MIMAT0002176).
  • a 5' terminal subsequence of miR-485-3p 5'- UCAUACA-3' (SEQ ID NO: 49) is the seed sequence.
  • the human mature miR-485-3p has significant sequence similarity to that of other species.
  • the mouse mature miR-485-3p differs from the human mature miR-485-3p by a single amino acid at each of the 5'- and 3'- ends (i.e., has an extra "A” at the 5'-end and missing "C” at the 3'-end).
  • the mouse mature miR-485-3p has the following sequence: 5'-AGUCAUACACGGCUCUCCUCUC-3' (SEQ ID NO: 34; miRBase Acc. No. MIMAT0003129; underlined portion corresponds to overlap to human mature miR-485-3p).
  • an anti-miR- 485-3p oligonucleotide disclosed herein is capable of binding miR-485-3p from one or more species, e.g., human and mouse. Accordingly, in some aspects, the diagnostic methods described herein can be used to determine the level of miR-485-3p from various mammalian subjects (e.g., human and mouse).
  • the miRNA binding site of an anti-miRNA oligonucleotide described herein is a single-stranded polynucleotide sequence that is complementary (e.g., fully complementary) to a sequence of a target miRNA (e.g., miRNA-485-3p) (or a subsequence thereof).
  • the miRNA subsequence comprises the seed sequence.
  • the miR-485-3p binding site of an anti-miRNA oligonucleotide described herein has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence set forth in SEQ ID NO: 49.
  • the miR-485-3p binding site is complementary to miR-485-3p except for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches.
  • the miR-485-3p binding site is fully complementary to the nucleic acid sequence set forth in SEQ ID NO: 1.
  • the seed region of a miRNA forms a tight duplex with the target mRNA. Most miRNAs imperfectly base-pair with the 3' untranslated region (UTR) of target mRNAs, and the 5' proximal "seed" region of miRNAs provides most of the pairing specificity. Without being bound to any one theory, it is believed that the first nine miRNA nucleotides (encompassing the seed sequence) provide greater specificity whereas the miRNA ribonucleotides 3' of this region allow for lower sequence specificity and thus tolerate a higher degree of mismatched base pairing, with positions 2-7 being the most important.
  • a miRNA binding site (e.g., miR-485-3p binding site) comprises a subsequence that is fully complementary (i.e., 100% complementary) over the entire length of the seed sequence of the target miRNA (e.g., miRNA-485-3p).
  • miRNA sequences and miRNA binding sequences that can be used in the context of the disclosure include, but are not limited to, all or a portion of those sequences in the sequence listing provided herein, as well as the miRNA precursor sequence, or complement of one or more of these miRNAs.
  • any aspects of the disclosure involving specific miRNAs or miRNA binding sites by name is contemplated also to cover miRNAs or complementary sequences thereof whose sequences are at least about at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the mature sequence of the specified miRNA
  • miRNA binding sequences of the present disclosure can include additional nucleotides at the 5′, 3′, or both 5′ and 3′ ends of those sequences in the sequence listing provided herein, as long as the modified sequence is still capable of specifically binding to the target miRNA (e.g., miR-485-3p).
  • miRNA binding sequences of the present disclosure can differ in at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides with respect to those sequence in the sequence listing provided, as long as the modified sequence is still capable of specifically binding to the target miRNA (e.g., miR-485-3p).
  • any disclosures provided herein with respect to miRNA binding molecules or miRNA can be implemented with respect to synthetic miRNAs binding molecules. It is also understood that the disclosures related to RNA sequences in the present disclosure are equally applicable to corresponding DNA sequences.
  • an anti-miRNA oligonucleotide described herein comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 5' of the nucleotide sequence.
  • an anti-miRNA oligonucleotide comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 3' of the nucleotide sequence.
  • an anti-miRNA oligonucleotide disclosed herein is about 6 to about 30 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide disclosed herein is 7 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide disclosed herein is 8 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide is 9 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide of the present disclosure is 10 nucleotides in length.
  • an anti- miRNA oligonucleotide is 11 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide is 12 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide disclosed herein is 13 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide disclosed herein is 14 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide disclosed herein is 15 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide is 16 nucleotides in length.
  • an anti-miRNA oligonucleotide of the present disclosure is 17 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide is 18 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide is 19 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide is 20 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide of the present disclosure is 21 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide is 22 nucleotides in length.
  • an anti-miRNA oligonucleotide disclosed herein comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from SEQ ID NOs: 2 to 30.
  • an anti-miRNA oligonucleotide comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2 to 30, wherein the nucleotide sequence can optionally comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches.
  • an anti-miRNA oligonucleotide comprises 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'-GUGUAUGA-3' (SEQ ID NO: 3), 5'-CGUGUAUGA-3' (SEQ ID NO: 4), 5'- CCGUGUAUGA-3' (SEQ ID NO: 5), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'- AGCCGUGUAUGA-3' (SEQ ID NO: 7), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'- AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 12), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO:
  • an anti-miRNA oligonucleotide has 5'-UGUAUGAC-3' (SEQ ID NO: 16), 5'-GUGUAUGAC-3' (SEQ ID NO: 17), 5'-CGUGUAUGAC-3' (SEQ ID NO: 18), 5'-CCGUGUAUGAC-3' (SEQ ID NO: 19), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 20), 5'- AGCCGUGUAUGAC-3' (SEQ ID NO: 21), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 22), 5'-AGAGCCGUGUAUGAC-3' (SEQ ID NO: 23), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 24), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25), 5'- AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 26), 5'-GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25
  • an anti-miRNA oligonucleotide has a sequence selected from the group consisting of: 5'-TGTATGA-3' (SEQ ID NO: 62), 5'-GTGTATGA-3' (SEQ ID NO: 63), 5'-CGTGTATGA-3' (SEQ ID NO: 64), 5'-CCGTGTATGA-3' (SEQ ID NO: 65), 5'- GCCGTGTATGA-3' (SEQ ID NO: 66), 5'-AGCCGTGTATGA-3' (SEQ ID NO: 67), 5'- GAGCCGTGTATGA-3' (SEQ ID NO: 68), 5'-AGAGCCGTGTATGA-3' (SEQ ID NO: 69), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO: 70), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO: 71), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO: 72), 5'
  • an anti-miRNA oligonucleotide disclosed herein comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 88).
  • an anti-miRNA oligonucleotide comprises a nucleotide sequence that has at least 90% similarity to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 88). In some aspects, an anti-miRNA oligonucleotide comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 88) with one substitution or two substitutions.
  • an anti-miRNA oligonucleotide comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 88).
  • sequence of an anti-miRNA oligonucleotide is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% sequence identity to 5'-AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 90).
  • an anti-miRNA oligonucleotide has a sequence that has at least 90% similarity to 5'- AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90).
  • an anti-miRNA oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90) with one substitution or two substitutions.
  • an anti-miRNA oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90).
  • an anti- miRNA oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 30).
  • an anti-miRNA oligonucleotide of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and at least one, at least two, at least three, at least four or at least five additional nucleic acid at the N terminus, at least one, at least two, at least three, at least four, or at least five additional nucleic acid at the C terminus, or both.
  • an anti-miRNA oligonucleotide of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one additional nucleic acid at the N terminus and/or one additional nucleic acid at the C terminus.
  • an anti-miRNA oligonucleotide of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one or two additional nucleic acids at the N terminus and/or one or two additional nucleic acids at the C terminus.
  • an anti-miRNA oligonucleotide of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one to three additional nucleic acids at the N terminus and/or one to three additional nucleic acids at the C terminus.
  • an anti-miRNA oligonucleotide comprises 5'-GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 29). In some aspects, an anti-miRNA oligonucleotide comprises 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30). [0158] In some aspects, an anti-miRNA oligonucleotide of the present disclosure comprises one miRNA (e.g., miR-485-3p) binding site. In some aspects, an anti-miRNA oligonucleotide disclosed herein comprises at least two miRNA (e.g., miR-485-3p) binding sites.
  • an anti-miRNA oligonucleotide comprises three miRNA (e.g., miR-485- 3p) binding sites. In some aspects, an anti-miRNA oligonucleotide comprises four miRNA (e.g., miR-485-3p) binding sites. In some aspects, an anti-miRNA oligonucleotide comprises five miRNA (e.g., miR-485-3p) binding sites. In some aspects, an anti-miRNA oligonucleotide comprises six or more miRNA (e.g., miR-485-3p) binding sites. In some aspects, all the miRNA binding sites are identical. In some aspects, all the miRNA binding sites are different.
  • a second oligonucleotide useful for the present disclosure is also not particularly limited so long as the oligonucleotide is capable of specifically binding to the anti-miRNA oligonucleotide (i.e., first oligonucleotide described herein) when the anti-miRNA oligonucleotide is not part of a duplex (i.e., not bound to the target miRNA).
  • the miRNA mimic has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the target miRNA, such that the anti- miRNA is capable of binding to the miRNA mimic.
  • the target miRNA comprises miR-485-3p.
  • the miRNA mimic useful for the present disclosure comprises a nucleic acid sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the human miR-485-3p sequence set forth in SEQ ID NO: 1.
  • the miRNA mimic comprises the nucleic acid sequence set forth in SEQ ID NO: 1.
  • the miRNA mimic consists of the nucleic acid sequence set forth in SEQ ID NO: 1.
  • the miRNA mimic consists essentially of the nucleic acid sequence set forth in SEQ ID NO: 1.
  • the target miRNA comprises miR-485-3p.
  • the miRNA mimic useful for the present disclosure comprises a nucleic acid sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the mouse miR-485-3p sequence set forth in SEQ ID NO: 34.
  • the miRNA mimic comprises the nucleic acid sequence set forth in SEQ ID NO: 34. In some aspects, the miRNA mimic consists of the nucleic acid sequence set forth in SEQ ID NO: 34. In some aspects, the miRNA mimic consists essentially of the nucleic acid sequence set forth in SEQ ID NO: 34. II.A.3. Chemical Modifications [0162] In some aspects, a first and/or second oligonucleotide disclosed herein comprises at least one chemically modified nucleoside and/or nucleotide.
  • oligonucleotides can also be referred to herein as "modified oligonucleotides.”
  • a “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”).
  • a “nucleotide” refers to a nucleoside including a phosphate group.
  • Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides.
  • An oligonucleotide described herein e.g., an anti-miRNA oligonucleotide and/or miRNA mimic
  • the linkages can be standard phosphodiester linkages, in which case the oligonucleotides would comprise regions of nucleotides.
  • the modified oligonucleotides disclosed herein can comprise various distinct modifications.
  • the modified oligonucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications.
  • a modified oligonucleotide can exhibit one or more desirable properties, e.g., improved thermal or chemical stability, reduced immunogenicity, reduced degradation, increased binding to the target microRNA, reduced non-specific binding to other microRNA or other molecules, as compared to an unmodified oligonucleotide.
  • an oligonucleotide described herein e.g., anti-miRNA oligonucleotide, miRNA mimic, or both is chemically modified.
  • the terms "chemical modification” or, as appropriate, “chemically modified” refer to modification with respect to adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C) ribo- or deoxyribonucleosides in one or more of their position, pattern, percent or population, including, but not limited to, its nucleobase, sugar, backbone, or any combination thereof.
  • an oligonucleotide described herein can have a uniform chemical modification of all or any of the same nucleoside type or a population of modifications produced by downward titration of the same starting modification in all or any of the same nucleoside type, or a measured percent of a chemical modification of all any of the same nucleoside type but with random incorporation
  • the oligonucleotide described herein e.g., anti-miRNA oligonucleotide, miRNA mimic, or both
  • Modified nucleotide base pairing encompasses not only the standard adenine- thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non- standard base structures.
  • non-standard base pairing is the base pairing between the modified nucleobase inosine and adenine, cytosine or uracil.
  • TD's of the present disclosure can be administered as RNAs, as DNAs, or as hybrid molecules comprising both RNA and DNA units.
  • oligonucleotides described herein include a combination of at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20 or more) modified nucleobases.
  • the nucleobases, sugar, backbone linkages, or any combination thereof in an oligonucleotide are modified by at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100%.
  • the chemical modification is at nucleobases in an oligonucleotide of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both).
  • the at least one chemically modified nucleoside is a modified uridine (e.g., pseudouridine ( ⁇ ), 2-thiouridine (s2U), 1-methyl-pseudouridine (m1 ⁇ ), 1-ethyl-pseudouridine (e1 ⁇ ), or 5-methoxy-uridine (mo5U)), a modified cytosine (e.g., 5-methyl-cytidine (m5C)) a modified adenosine (e.g., 1-methyl-adenosine (m1A), N6-methyl-adenosine (m6A), or 2- methyl-adenine (m2A)), a modified guanosine (e.g., 7-methyl-guanosine (m7G) or 1-methyl- guanosine (m1G)), or a combination thereof.
  • a modified uridine e.g., pseudouridine ( ⁇ ), 2-thiouridine (s2U), 1-methyl-pseu
  • an oligonucleotide useful for the present disclosure e.g., an anti- miRNA oligonucleotide, miRNA mimic, or both described herein
  • an oligonucleotide is uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification.
  • an oligonucleotide can be uniformly modified with the same type of base modification, e.g., 5-methyl-cytidine (m5C), meaning that all cytosine residues in the oligonucleotide sequence are replaced with 5-methyl-cytidine (m5C).
  • m5C 5-methyl-cytidine
  • oligonucleotide described herein can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified nucleoside such as any of those set forth above.
  • oligonucleotides of the present disclosure include a combination of at least two (e.g., 2, 3, 4 or more) of modified nucleobases.
  • a type of nucleobases in an oligonucleotide of the present disclosure e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both
  • oligonucleotides of the present disclosure can include any useful linkage between the nucleosides.
  • Such linkages, including backbone modifications, that are useful in the composition of the present disclosure include, but are not limited to the following: 3'-alkylene phosphonates, 3'-amino phosphoramidate, alkene containing backbones, aminoalkylphosphoramidates, aminoalkylphosphotriesters, boranophosphates, -CH 2 -O- N(CH3)-CH 2 -, -CH 2 -N(CH3)-N(CH3)-CH 2 -, -CH 2 -NH-CH 2 -, chiral phosphonates, chiral phosphorothioates, formacetyl and thioformacetyl backbones, methylene (methylimino), methylene formacetyl and thioformacetyl backbones, methyleneimino and methylenehydrazino backbones, morpholino linkages, -N(CH3)-CH 2 -CH 2 -, oligonucleosides with hetero
  • the presence of a backbone linkage disclosed above increase the stability and resistance to degradation of an oligonucleotide of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both).
  • At least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% of the backbone linkages in an oligonucleotide of the present disclosure e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both
  • modified e.g., all of them are phosphorothioate.
  • a backbone modification that can be included in an oligonucleotide of the present disclosure comprises phosphorodiamidate morpholino oligomer (PMO), phosphorothioate (PS) modification, or both.
  • PMO phosphorodiamidate morpholino oligomer
  • PS phosphorothioate
  • sugar modifications [0179] The modified nucleosides and nucleotides which can be incorporated into oligonucleotides of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both) can be modified on the sugar of the nucleic acid.
  • a miR-485 inhibitor described herein comprises a nucleic acid which comprises at least one nucleoside analog (e.g., a nucleoside with a sugar modification).
  • the sugar modification increases the affinity of the binding of an anti-miRNA oligonucleotide to a target miRNA nucleic acid sequence.
  • affinity-enhancing nucleotide (or nucleoside) analogues such as LNA or 2'-substituted sugars, can allow the length and/or the size of an oligonucleotide (e.g., an anti-miRNA oligonucleotide, , miRNA mimic, or both) to be reduced.
  • At least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% of the nucleotides in an oligonucleotide of the present disclosure e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both
  • sugar modifications e.g., LNA
  • nucleotide units in an oligonucleotide of the present disclosure are sugar modified (e.g., LNA).
  • sugar modified e.g., LNA
  • RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen.
  • modified nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone); multicyclic forms (e.g., tricyclo; and "unlocked" forms, such as glycol nucleic acid (GNA) (e.
  • GAA glyco
  • the sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose.
  • oligonucleotides described herein e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both
  • the 2′ hydroxyl group (OH) of ribose can be modified or replaced with a number of different substituents.
  • substitutions at the 2′-position include, but are not limited to, H, halo, optionally substituted C 1-6 alkyl; optionally substituted C 1-6 alkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 3-8 cycloalkyl; optionally substituted C 3-8 cycloalkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 6-10 aryl- C 1-6 alkoxy, optionally substituted C 1-12 (heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG), -O(CH 2 CH 2 O) n CH 2 CH 2 OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from
  • nucleotide analogues present in an oligonucleotide of the present disclosure comprise, e.g., 2'-O-alkyl-RNA units, 2'- OMe-RNA units, 2'-O-alkyl-SNA, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, arabino nucleic acid (ANA) units, 2'-fluoro-ANA units, HNA units, INA (intercalating nucleic acid) units, 2'MOE units, or any combination thereof.
  • the LNA is, e.g., oxy- LNA (such as beta-D-oxy-LNA, or alpha-L-oxy-LNA), amino-LNA (such as beta-D-amino- LNA or alpha-L-amino-LNA), thio-LNA (such as beta-D-thio-LNA or alpha-L-thio-LNA), ENA (such a beta-D-ENA or alpha-L-ENA), or any combination thereof.
  • oxy- LNA such as beta-D-oxy-LNA, or alpha-L-oxy-LNA
  • amino-LNA such as beta-D-amino- LNA or alpha-L-amino-LNA
  • thio-LNA such as beta-D-thio-LNA or alpha-L-thio-LNA
  • ENA such a beta-D-ENA or alpha-L-ENA
  • nucleotide analogues that can be included in a polynucleotide of the present disclosure comprises a locked nucleic acid (LNA), an unlocked nucleic acid (UNA), an arabino nucleic acid (ABA), a bridged nucleic acid (BNA), and/or a peptide nucleic acid (PNA).
  • LNA locked nucleic acid
  • UNA unlocked nucleic acid
  • ABA arabino nucleic acid
  • BNA bridged nucleic acid
  • PNA peptide nucleic acid
  • nucleoside analog comprises a LNA; 2'-0-alkyl-RNA; 2'-amino- DNA; 2'-fluoro-DNA; arabino nucleic acid (ANA); 2'-fluoro-ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleoside (cEt), 2'-0-methyl nucleic acid (2'-OMe), 2'-0- methoxyethyl nucleic acid (2'-MOE), or any combination thereof.
  • oligonucleotides of the present disclosure can comprise both modified RNA nucleotide analogues (e.g., LNA) and DNA units.
  • an oligonucleotide e.g., an anti- miRNA oligonucleotide, miRNA mimic, or both
  • is a gapmer See, e.g., U.S. Pat. Nos. 8,404,649; 8,580,756; 8,163,708; 9,034,837; all of which are herein incorporated by reference in their entireties.
  • an oligonucleotide e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both
  • a micromir See U.S. Pat. Appl. Publ. No. US20180201928, which is herein incorporated by reference in its entirety.
  • oligonucleotides of the present disclosure e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both
  • Modifications include, but are not limited to, for example, (a) end modifications, e.g., 5' end modifications (phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.), (b) base modifications, e.g., replacement with modified bases, stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar, as well as (d) internucleoside linkage modifications, including modification or replacement of the phosphodiester linkages. II.B.
  • end modifications e.g., 5' end modifications (phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.
  • base modifications e.g., replacement with modified bases, stabilizing
  • the probes and quenchers that can be used with the present disclosure are not particularly limited, as long as the probe exhibits a detectable signal (e.g., fluorescence) and the quencher is able to reduce and/or inhibit the detection of the detectable signal.
  • a probe that can be used with the present disclosure comprises a fluorescent marker, radioisotope, bioluminescent compound, chemiluminescent compound, enzyme, or combinations thereof.
  • the probe has been modified with a suitable linking group for conjugation to the miRNA mimic (i.e., second oligonucleotide).
  • a probe useful for the present disclosure is a fluorescent marker (also referred to herein as "fluorophore").
  • the fluorophore can be a non-protein organic fluorophore or a fluorescent protein.
  • Non-limiting exemplary families of non-protein organic fluorophores include: Xanthene derivatives (such as fluorescein, rhodamine, Oregon green, eosin, and Texas red), cyanine derivatives (such as cyanine, indocarbocyanine, oxacarbocyanine, thiacarbocyanine, and merocyanine), squaraine derivatives and ring-substituted squaraines (including Seta, SeTau, and Square dyes), naphthalene derivatives (such as dansyl and prodan derivatives), coumarin derivatives, oxadiazole derivatives (such as pyridyloxazole, nitrobenzoxadiazole and benzoxadiazole), anthracene derivatives (such as anthraquinones, including DRAQ5, DRAQ7 and CyTRAK Orange
  • Non-limiting examples of such probes are known in the art and include LC ® Red640, LC ® Red705, ALEXA FLUORTM 633, ALEXA FLUORTM 647, ALEXA FLUORTM 660, ALEXA FLUORTM 680, ALEXA FLUORTM 700, ALEXA FLUORTM 750, BODIPYTM 630/650-X, BODIPYTM 650/665-X, Cy5, Cy5.5, R6G, ALEXA FLUORTM 594, ALEXA FLUORTM 568, ALEXA FLUORTM 555, ALEXA FLUORTM 546, TAMRA (tetramethylrhodamine), RHODAMINE REDTM-X, BODIPYTM 564/570, BODIPYTM TMR- X, BODIPYTM TR-X, BODIPYTM 581/591, BODIPYTM 630/650-X, REDMON
  • the probe comprises Cy5.5.
  • a suitable quencher for conjugating to an anti-miRNA oligonucleotide i.e., first oligonucleotide
  • the selection of a suitable quencher for conjugating to an anti-miRNA oligonucleotide (i.e., first oligonucleotide) of the present disclosure depends on the selection of the particular probe (e.g., quencher should be able to suppress the detection of the probe when the probe and the quencher are in close proximity).
  • an absorbance band of the quencher should substantially overlap with the emission band of the probe (e.g., fluorophore), such that the emission signal is reduced and/or inhibited when the quencher and the probe are in close proximity.
  • the probe and the quencher are selected, such that there is donor-acceptor (i.e., probe-quencher) energy transfer when the probe is excited.
  • donor-acceptor i.e., probe-quencher
  • the efficiency of the energy transfer (“fluorescence resonance energy transfer” or "FRET") is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% or more.
  • FRET fluorescence resonance energy transfer
  • a quencher that can be used with the present disclosure comprises a dark quencher.
  • dark quenchers refers to substances that can absorb excitation energy from a probe (e.g., fluorophore) and dissipates the energy as heat. Accordingly, dark quenchers can be useful when used in combination with fluorescent probes.
  • Non-limiting examples of dark quenchers include dimethylaminoazobenzenesulfonic acid (dabsyl), Black Hole Quencher (BHQTM), QXL ® quenchers (e.g., QXL 570, QXL 670), IOWA BLACK ® quenchers (e.g., Iowa Black FQ, Iowa Black RQ), IRDYE ® QC-1, BLACKBERRY ® Quencher (BBQ-650), and combinations thereof.
  • the quencher is BBQ-650
  • the probe is selected from LC ® Red640, LC ® Red705, Alexa FluorTM 633, Alexa FluorTM 647, Alexa FluorTM 660, Alexa FluorTM 680, Alexa FluorTM 700, Alexa FluorTM 750, BODIPYTM 630/650-X, BODIPYTM 650/665-X, Cy5, Cy5.5, or combinations thereof.
  • the quencher is BBQ-650 and the probe is LC ® Red640.
  • the quencher is BBQ-650 and the probe is LC ® Red705.
  • the quencher is BBQ-650 and the probe is Alexa FluorTM 633.
  • the quencher is BBQ-650 and the probe is Alexa FluorTM 647. In some aspects, the quencher is BBQ-650 and the probe is Alexa FluorTM 660. In some aspects, the quencher is BBQ-650 and the probe is Alexa FluorTM 680. In some aspects, the quencher is BBQ-650 and the probe is Alexa FluorTM 700. In some aspects, the quencher is BBQ-650 and the probe is Alexa FluorTM 750. In some aspects, the quencher is BBQ-650 and the probe is BODIPYTM 630/650-X. In some aspects, the quencher is BBQ-650 and the probe is BODIPYTM 650/665- X.
  • the quencher is BBQ-650 and the probe is Cy5. In some aspects, the quencher is BBQ-650 and the probe is Cy5.5. [0193] In some aspects, the quencher is BHQ-2, and the probe is selected from R6G, Alexa FluorTM 594, Alexa FluorTM 568, Alexa FluorTM 555, Alexa FluorTM 546, TAMRA (tetramethylrhodamine), Rhodamine RedTM-X, BODIPYTM 564/570, BODIPYTM TMR-X, BODIPYTM TR-X, BODIPYTM 581/591, BODIPYTM 630/650-X, Redmond Red ® , Cal Fluor Red ® 590, Cal Fluor Red ® 610, Cal Fluor Red ® 635, ROX (carboxyrhodamine), Cy3, Cy3.5, Pulsar 650, or combinations thereof.
  • the quencher is BHQ-2, and the probe is R6G. In some aspects, the quencher is BHQ-2, and the probe is Alexa FluorTM 594. In some aspects, the quencher is BHQ-2, and the probe is Alexa FluorTM 568. In some aspects, the quencher is BHQ-2, and the probe is Alexa FluorTM 555. In some aspects, the quencher is BHQ- 2, and the probe is Alexa FluorTM 546. In some aspects, the quencher is BHQ-2, and the probe is TAMRA (tetramethylrhodamine). In some aspects, the quencher is BHQ-2, and the probe is Rhodamine RedTM-X.
  • the quencher is BHQ-2, and the probe is BODIPYTM 564/570. In some aspects, the quencher is BHQ-2, and the probe is BODIPYTM TMR-X. In some aspects, the quencher is BHQ-2, and the probe is BODIPYTM TR-X. In some aspects, the quencher is BHQ-2, and the probe is BODIPYTM 581/591. In some aspects, the quencher is BHQ-2, and the probe is BODIPYTM 630/650-X. In some aspects, the quencher is BHQ-2, and the probe is Redmond Red ® . In some aspects, the quencher is BHQ-2, and the probe is Cal Fluor Red ® 590.
  • the quencher is BHQ-2, and the probe is Cal Fluor Red ® 610. In some aspects, the quencher is BHQ-2, and the probe is Cal Fluor Red ® 635. In some aspects, the quencher is BHQ-2, and the probe is ROX (carboxyrhodamine). In some aspects, the quencher is BHQ-2, and the probe is Cy3. In some aspects, the quencher is BHQ-2, and the probe is Cy3.5. In some aspects, the quencher is BHQ-2, and the probe is Pulsar 650.
  • the fluorophore and/or quencher can include substituents enhancing a desirable property, e.g., solubility in water, cell permeability, or an altered absorption and emission spectrum, relative to the "parent" compound (i.e., the fluorophore and/or quencher without the substituents).
  • Means of detecting fluorescent labels are well known to those of skill in the art. Thus, for example, fluorescent labels can be detected by exciting the fluorophore with the appropriate wavelength of light and detecting the resulting fluorescence. The fluorescence can be detected visually, by means of photographic film, by the use of electronic detectors such as charge coupled devices (CCDs) or photomultipliers and the like.
  • enzymatic labels can be detected by providing the appropriate substrates for the enzyme and detecting the resulting reaction product.
  • the signal from the probe can be detected using a biomolecular imager (e.g., gel doc).
  • the signal from the probe can be detected using a specific wavelength (e.g., ELISA assay).
  • the therapy is capable of treating, controlling, ameliorating, or reducing one or more symptoms of the disease or disorder.
  • the therapy can comprise any agent (e.g., therapeutic agent) that can treat, control, ameliorate, or reduce one or more symptoms associated with a disease or disorder disclosed herein.
  • a disease or disorder that can be treated with the present disclosure comprises a cognitive disorder.
  • Non-limiting examples of symptoms associated with a cognitive disorder described herein include: memory loss, frequently asking the same question or repeating the same story over and over, difficulty recognizing familiar people and places, having trouble exercising judgment (e.g., knowing what to do in an emergency), change in mood or behavior, vision problems, difficulty planning and carrying out tasks (e.g., following a recipe or keeping track of monthly bills), and combinations thereof.
  • the therapy comprises a compound that is capable of modulating the activity of the target miRNA.
  • the compound is capable of inhibiting or reducing the activity and/or expression of the target miRNA (also referred to herein as "miRNA inhibitor").
  • a target miRNA comprises miR- 485-3p
  • the disease or disorder is associated with increased miR-485-3p expression and/or activity.
  • the therapy can comprise a compound that inhibits or reduces the expression and/or activity of miR-485-3p.
  • Such compounds are also referred to herein as “mir-485 inhibitor” or “miR-485-3p inhibitor.”
  • a compound that is capable of modulating the expression and/or activity of a target miRNA comprises any of the anti-miRNA oligonucleotides described herein.
  • a miR-485-3p inhibitor comprises an anti-miR-485-3p oligonucleotide described herein. Accordingly, in some aspects, certain disclosures relating to an anti-miRNA oligonucleotide provided herein are equally applicable to miRNA inhibitors of the present disclosure (e.g., miR-485-3p inhibitor).
  • the present disclosure is related to a method of treating a disease or disorder in a subject in need thereof, comprising administering a treatment for the disease or disorder to the subject identified as having an increase in the level of a miRNA ("miRNA level") in a biological sample obtained from the subject, compared to a corresponding level in a reference sample (e.g., biological sample obtained from (i) a subject who is not afflicted with the disease or disorder, (ii) the subject prior to being afflicted with the disease or disorder, or (iii) both (i) and (ii)) , wherein the miRNA level is measured by: (a) contacting the biological sample with a first oligonucleotide conjugated to a quencher and a second oligonucleotide conjugated to a probe, (i) wherein the first oligonucleotide specifically binds to the miRNA to form a duplex when the miRNA is present in the biological sample,
  • the methods provided herein can be used to treat a disease or condition associated with a decreased miRNA level.
  • the present disclosure is related to a method of treating a disease or disorder in a subject in need thereof, comprising administering a treatment for the disease or disorder to the subject identified as having a decrease in the level of a miRNA in a biological sample obtained from the subject, compared to a corresponding level in a reference sample (e.g., biological sample obtained from (i) a subject who is not afflicted with the disease or disorder, (ii) the subject prior to being afflicted with the disease or disorder, or (iii) both (i) and (ii)) , wherein the miRNA level is measured by: (a) contacting the biological sample with a first oligonucleotide conjugated to a quencher (i.e., anti-miRNA oligonucleotide) and a second oligonucleot
  • the treatment comprises a miRNA inhibitor (e.g., miR-485-3p inhibitor).
  • administering a miRNA inhibitor to a subject decreases the activity of the target miRNA (e.g., miRNA-485-3p) in the subject by at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% or more, compared to a reference (e.g., target miRNA activity in a corresponding subject not treated with the miRNA inhibitor).
  • a reference e.g., target miRNA activity in a corresponding subject not treated with the miRNA inhibitor.
  • administering a miRNA inhibitor decreases the expression and/or level of the target miRNA (e.g., miR- 485-3p) in the subject by at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% or more, compared to a reference (e.g., target miRNA expression and/or level in a corresponding subject not treated with the miRNA inhibitor).
  • a reference e.g., target miRNA expression and/or level in a corresponding subject not treated with the miRNA inhibitor.
  • a treatment comprises an agent that increases the level and/or activity of the miRNA when administered to a subject (e.g., identified as having the disease or condition using a method provided herein).
  • administering such an agent to a subject increases the level and/or activity of the miRNA in the subject by at least about 1-fold, at least about 2- fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, or at least about 50-fold, compared to the corresponding expression level in a reference sample (e.g., obtained from a corresponding subject that did not receive an administration of the agent).
  • a reference sample e.g., obtained from a corresponding subject that did not receive an administration of the agent.
  • the level of the miRNA in the subject is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the level of the miRNA in a reference sample (e.g., obtained from a corresponding subject who is not suffering from the disease or disorder).
  • a reference sample e.g., obtained from a corresponding subject who is not suffering from the disease or disorder.
  • Non-limiting examples of such diseases or disorders include: a dementia, Alzheimer's disease, autism spectrum disorder, mental retardation, seizure, stroke, Parkinson's disease, spinal cord injury, amyotrophic lateral sclerosis (ALS), tauopathy, Huntington's disease, Spinal muscular atrophy (SMA), Dementia with Lewy bodies (DLB), CAA cerebral amyloid angiopathy (CAA), CDB corticobasal degeneration (CDB), Frontotemporal lobar degeneration due to FUS pathology (FTLD-fus), Frontotemporal lobar degeneration due to tau pathology (FTLD-tau), Frontotemporal lobar degeneration due to TDP 43 (FTLD-tdp), Multiple system atrophy (MSA), Progressive supranuclear palsy (PSP), pulmonary disease, inflammatory disease, or metabolic disease, or combinations thereof.
  • SMA Spinal muscular atrophy
  • DLB Dementia with Lewy bodies
  • CAA CAA cerebral amyloid angiopathy
  • modulating e.g., decreasing
  • the activity and/or expression of a miRNA can reduce an amyloid beta (A ⁇ ) plaque load in the subject identified as being afflicted with a disease or disorder described herein (e.g., cognitive disorder), compared to a reference (e.g., amyloid beta (A ⁇ ) plaque load in the subject prior to the administering or amyloid beta (A ⁇ ) plaque load in a corresponding subject not treated with the miRNA inhibitor).
  • a reference e.g., amyloid beta (A ⁇ ) plaque load in the subject prior to the administering or amyloid beta (A ⁇ ) plaque load in a corresponding subject not treated with the miRNA inhibitor.
  • amyloid beta plaque refers to all forms of aberrant deposition of amyloid beta including large aggregates and small associations of a few amyloid beta peptides and can contain any variation of the amyloid beta peptides.
  • Amyloid beta (A ⁇ ) plaque is known to cause neuronal changes, e.g., aberrations in synapse composition, synapse shape, synapse density, loss of synaptic conductivity, changes in dendrite diameter, changes in dendrite length, changes in spine density, changes in spine area, changes in spine length, or changes in spine head diameter.
  • administering a miRNA inhibitor reduces an amyloid beta plaque load in a subject (e.g., identified as suffering from a disease or disorder described herein, e.g., cognitive disorder) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., subjects that did not receive an administration of the miRNA inhibitor
  • administering a miRNA inhibitor e.g., miR-485-3p inhibitor
  • a subject e.g., identified as suffering from a disease or disorder described herein, e.g., cognitive disorder
  • administering a miRNA inhibitor reduces the occurrence or risk of occurrence of one or more symptoms of a disease or disorder by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor
  • administering a miRNA inhibitor e.g., miR-485-3p inhibitor
  • a subject e.g., identified as suffering from a disease or disorder described herein
  • reduces memory loss compared to a reference e.g., memory loss in the subject prior to the administering or memory loss in a corresponding subject not treated with the miRNA inhibitor.
  • administering a miRNA inhibitor reduces memory loss or the risk of occurrence of memory loss by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor
  • administering a miRNA inhibitor e.g., miR-485-3p inhibitor
  • a subject e.g., identified as suffering from a disease or disorder described herein
  • a reference e.g., memory retention in the subject prior to the administering or memory retention in a corresponding subject that was not treated with the miRNA inhibitor
  • administering a miRNA inhibitor improves and/or increases memory retention by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor
  • administering a miRNA inhibitor e.g., miR-485-3p inhibitor
  • a subject e.g., identified as suffering from a disease or disorder described herein
  • spatial working memory improves spatial working memory compared to a reference (e.g., spatial working memory in the subject prior to the administering or spatial working memory in a corresponding subject that was not treated with the miRNA inhibitor).
  • a reference e.g., spatial working memory in the subject prior to the administering or spatial working memory in a corresponding subject that was not treated with the miRNA inhibitor.
  • spatial working memory refers to the ability to keep spatial information activity in working memory over a short period of time.
  • spatial working memory is improved and/or increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor.
  • administering a miRNA inhibitor e.g., miR-485-3p inhibitor
  • a subject e.g., identified as suffering from a disease or disorder described herein
  • increases the phagocytic activity of scavenger cells e.g., glial cells
  • a reference e.g., phagocytic activity in the subject prior to the administering or phagocytic activity in a corresponding subject not treated with the miRNA inhibitor.
  • administering a miRNA inhibitor increases dendritic spine density of a neuron in the subject (e.g., identified as suffering from a disease or disorder described herein) by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor
  • administering a miRNA inhibitor e.g., miR-485-3p inhibitor
  • a subject e.g., identified as suffering from a disease or disorder described herein
  • increases neurogenesis compared to a reference e.g., neurogenesis in the subject prior to the administering or neurogenesis in a corresponding subject not treated with the miRNA inhibitor.
  • neurogenesis refers to the process by which neurons are created. Neurogenesis encompasses proliferation of neural stem and progenitor cells, differentiation of these cells into new neural cell types, as well as migration and survival of the new cells.
  • administering a miRNA inhibitor increases neurogenesis in the subject (e.g., identified as suffering from a disease or disorder described herein) by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor.
  • increasing and/or inducing neurogenesis is associated with increased proliferation, differentiation, migration, and/or survival of neural stem cells and/or progenitor cells.
  • administering a miRNA inhibitor e.g., miR- 485-3p inhibitor
  • a subject e.g., identified as suffering from a disease or disorder described herein
  • the proliferation of neural stem cells and/or progenitor cells is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor.
  • the survival of neural stem cells and/or progenitor cells is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor.
  • increasing and/or inducing neurogenesis is associated with an increased number of neural stem cells and/or progenitor cells.
  • the number of neural stem cells and/or progenitor cells is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor.
  • increasing and/or inducing neurogenesis is associated with increased axon, dendrite, and/or synapse development.
  • axon, dendrite, and/or synapse development is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor.
  • administering a miRNA inhibitor e.g., miR-485-3p inhibitor
  • a subject e.g., identified as suffering from a disease or disorder described herein
  • administering a miRNA inhibitor e.g., miR-485-3p inhibitor
  • administering a miRNA inhibitor e.g., miR-485-3p inhibitor
  • administering a miRNA inhibitor e.g., miR-485-3p inhibitor
  • administering a miRNA inhibitor increases dendritic spine density of a neuron in the subject compared to a reference (e.g., dendritic spine density of a neuron in the subject prior to the administering or dendritic spine density of a neuron in a corresponding subject that was not treated with the miRNA inhibitor).
  • administering a miRNA inhibitor increases dendritic spine density of a neuron in a subject (e.g., identified as suffering from a disease or disorder described herein) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor
  • administering a miRNA inhibitor to a subject decreases the loss of dendritic spines of a neuron in the subject compared to a reference (e.g., loss of dendritic spines of a neuron in the subject prior to the administering or loss of dendritic spines of a neuron in a corresponding subject that was not treated with the miRNA inhibitor).
  • a reference e.g., loss of dendritic spines of a neuron in the subject prior to the administering or loss of dendritic spines of a neuron in a corresponding subject that was not treated with the miRNA inhibitor.
  • administering a miRNA inhibitor decreases the loss of dendritic spines of a neuron in a subject (e.g., identified as suffering from a disease or disorder described herein) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor
  • administering a miRNA inhibitor e.g., miR-485-3p inhibitor
  • a subject e.g., identified as suffering from a disease or disorder described herein
  • administering a miRNA inhibitor decreases neuroinflammation in the subject compared to a reference (e.g., neuroinflammation in the subject prior to the administering or neuroinflammation in a corresponding subject that was not treated with the miRNA inhibitor).
  • administering a miRNA inhibitor decreases neuroinflammation by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • decreased neuroinflammation comprises glial cells producing decreased amounts of inflammatory mediators.
  • administering a miRNA inhibitor decreases the amount of inflammatory mediators produced by glial cells by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor
  • an inflammatory mediator produced by glial cells comprises TNF- ⁇ . In some aspects, the inflammatory mediator comprises IL-1 ⁇ . In some aspects, an inflammatory mediator produced by glial cells comprises both TNF- ⁇ and IL-1 ⁇ .
  • administering a miRNA inhibitor e.g., miR-485-3p inhibitor
  • a subject e.g., identified as suffering from a disease or disorder described herein
  • autophagy refers to cellular stress response and a survival pathway that is responsible for the degradation of long-lived proteins, protein aggregates, as well as damaged organelles in order to maintain cellular homeostasis.
  • administering a miRNA inhibitor increases autophagy by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, or at least about 300% or more, compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor
  • administering a miRNA inhibitor e.g., miR-485-3p inhibitor
  • a subject e.g., identified as having a cognitive disorder
  • synaptic function refers to the ability of the synapse of a cell (e.g., a neuron) to pass an electrical or chemical signal to another cell (e.g., a neuron).
  • administering a miRNA inhibitor improves synaptic function in a subject (e.g., identified as suffering from a disease or disorder described herein) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor
  • administering a miRNA inhibitor e.g., miR-485-3p inhibitor
  • a subject e.g., identified as suffering from a disease or disorder described herein
  • administering a miRNA inhibitor can prevent, delay, and/or ameliorate the loss of synaptic function in the subject compared to a reference (e.g., loss of synaptic function in the subject prior to the administering or loss of synaptic function in a corresponding subject that was not treated with the miRNA inhibitor).
  • administering a miRNA inhibitor prevents, delays, and/or ameliorates the loss of synaptic function in a subject (e.g., identified as suffering from a disease or disorder described herein) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor).
  • a reference e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor
  • a miRNA inhibitor e.g., miR-485-3p inhibitor
  • a miRNA inhibitor can be administered by any suitable route known in the art.
  • a miRNA inhibitor is administered parenthetically, intramuscularly, subcutaneously, ophthalmic, intravenously, intraperitoneally, intradermally, intraorbitally, intracerebrally, intracranially, intracerebroventricularly, intraspinally, intraventricular, intrathecally, intracistemally, intracapsularly, intratumorally, or any combination thereof.
  • a miRNA inhibitor e.g., miR-485-3p inhibitor
  • the additional therapeutic agent and the miRNA inhibitor are administered concurrently. In some aspects, the additional therapeutic agent and the miRNA inhibitor are administered sequentially. [0224] In some aspects, the administration of a miRNA inhibitor (e.g., miR-485-3p inhibitor) disclosed herein does not result in any adverse effects. In some aspects, miRNA inhibitors of the present disclosure does not adversely affect body weight when administered to a subject. In some aspects, miRNA inhibitors disclosed herein do not result in increased mortality or cause pathological abnormalities when administered to a subject. IV. Diagnostic Systems [0225] Disclosed herein are diagnostic systems (e.g., kits or products of manufacture) that can be used to measure miRNA expression levels in a subject.
  • diagnostic systems e.g., kits or products of manufacture
  • the diagnostic systems of the present disclosure comprise (i) a first oligonucleotide conjugated to a quencher (e.g., anti-miRNA oligonucleotides described herein) and (ii) a second oligonucleotide conjugated to a probe (e.g., miRNA mimics described herein).
  • the diagnostic system further comprises an instruction for use.
  • the first oligonucleotide can be conjugated to a probe
  • the second oligonucleotide can be conjugated to a quencher.
  • the diagnostic systems of the present disclosure differ from the more traditional approaches in the art (e.g., RT-PCR) in that amplification of the miRNA is not required. Accordingly, the diagnostic systems described herein require less reagents and complex equipment, and therefore, in some aspects, can be used as a point-of-care diagnostic system.
  • the term "point-of-care” or "POC” system refers to diagnostic systems (e.g., portable devices) that allow patients, physicians, and/or medical staff to accurately achieve real-time, lab-quality diagnostic results at or near the point of care (i.e., at the time and place of patient care).
  • a POC system does not require, for instance, any material (e.g., biological sample) to be shipped to an outside medical laboratory, the results can be obtained within second or minutes instead of hours or days.
  • the diagnostic systems described herein can be used as a home diagnostic system, where a subject can diagnose, monitor the progression of a disease, and/or assess the efficacy of a treatment in the privacy of the subject's home.
  • a diagnostic system of the present disclosure comprises a container in which a subject provides his or her biological sample.
  • the biological sample can be readily obtained without the need for a medical professional, such as saliva or urine.
  • the diagnostic system further comprises one or more additional storage devices which comprise the first and/or second oligonucleotides of the present disclosure.
  • the content of the one or more additional storage devices i.e., the first and/or second oligonucleotides described herein
  • the first and/or second oligonucleotides from the one or more additional storage devices can be added to the container containing the biological sample, such that biological sample is contacted with the first and/or second oligonucleotides.
  • a diagnostic system described herein further comprises a detecting device to measure the expression level of the probe.
  • the detecting device comprises any suitable detecting device known in the art that can measure the detectable signal exhibited by the probe (i.e., expression level of the probe).
  • the detecting device can comprise any detector capable of reading fluorescence wavelength values (e.g., microplate-reader as used in Example 2).
  • the diagnostic systems described herein can be used as part of a companion diagnostic.
  • the term "companion diagnostic” refers to a diagnostic method or diagnostic system that can be used to determine the safe and effective use of a therapeutic agent (e.g., miRNA inhibitors described herein).
  • a companion diagnostic is used to customize dosage of a therapeutic agent (e.g., miRNA inhibitors described herein) for a given subject, identify appropriate subpopulations for treatment, and/or identify populations who should not receive a particular treatment because of an increased risk of a serious side effect.
  • a subject if a subject is determined to have an elevated miRNA level compared to a reference (e.g., subject who is not afflicted with a disease or disorder described herein) using the methods and diagnostic systems described herein, the subject receives a treatment described herein (e.g., miRNA inhibitor).
  • a treatment described herein e.g., miRNA inhibitor
  • the treatment regimen can be adjusted or maintained depending on the subject's miRNA level (which can be determined using the methods and diagnostic systems described herein) after the treatment. For instance, in some aspects, if the miRNA level is elevated compared to a corresponding level in the subject prior to the treatment, the treatment regimen is adjusted.
  • adjusting the treatment regimen can comprise (i) administering a higher dose of the treatment to the subject; (ii) administering the treatment (at the same dose or different dose) to the subject more frequently; (iii) administering a different treatment to the subject (alone or in combination with the original treatment); or (iv) any combination of (i), (ii), and (iii).
  • the miRNA level is determined to be reduced compared to a corresponding level in the subject prior to the treatment, the treatment regimen for the subject is maintained or stopped.
  • the treatment regimen for the subject is adjusted or maintained.
  • adjusting the treatment regimen can comprise (i) administering a higher dose of the treatment to the subject; (ii) administering the treatment (at the same dose or different dose) to the subject more frequently; (iii) administering a different treatment to the subject (alone or in combination with the original treatment); or (iv) any combination of (i), (ii), and (iii).
  • V. Vectors and Delivery Systems [0232] As described herein, in some aspects, a subject identified as being afflicted with a disease or disorder using the methods and diagnostic systems described herein receives a treatment, which is suitable for treating the disease or disorder.
  • the treatment comprises a miRNA inhibitor (e.g., miR-485-3p inhibitor).
  • the treatment can be administered to the subject using any suitable delivery system known in the art.
  • the delivery system is a vector.
  • the present disclosure provides a vector comprising a miRNA inhibitor described herein.
  • the vector is viral vector.
  • the viral vector is an adenoviral vector or an adeno-associated viral vector.
  • the viral vector is an AAV that has a serotype of AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or any combination thereof.
  • the adenoviral vector is a third generation adenoviral vector.
  • ADEASYTM is by far the most popular method for creating adenoviral vector constructs.
  • the system consists of two types of plasmids: shuttle (or transfer) vectors and adenoviral vectors.
  • the transgene of interest is cloned into the shuttle vector, verified, and linearized with the restriction enzyme PmeI.
  • This construct is then transformed into ADEASIER-1 cells, which are BJ5183 E. coli cells containing PADEASYTM.
  • PADEASYTM is a ⁇ 33Kb adenoviral plasmid containing the adenoviral genes necessary for virus production.
  • the shuttle vector and the adenoviral plasmid have matching left and right homology arms which facilitate homologous recombination of the transgene into the adenoviral plasmid.
  • Recombinant adenoviral plasmids are then verified for size and proper restriction digest patterns to determine that the transgene has been inserted into the adenoviral plasmid, and that other patterns of recombination have not occurred.
  • the recombinant plasmid is linearized with PacI to create a linear dsDNA construct flanked by ITRs.293 or 911 cells are transfected with the linearized construct, and virus can be harvested about 7-10 days later.
  • the viral vector is a retroviral vector, e.g., a lentiviral vector (e.g., a third or fourth generation lentiviral vector). Lentiviral vectors are usually created in a transient transfection system in which a cell line is transfected with three separate plasmid expression systems.
  • the transfer vector plasmid portions of the HIV provirus
  • the packaging plasmid or construct and a plasmid with the heterologous envelop gene (env) of a different virus.
  • the three plasmid components of the vector are put into a packaging cell which is then inserted into the HIV shell.
  • the virus portions of the vector contain insert sequences so that the virus cannot replicate inside the cell system.
  • Current third generation lentiviral vectors encode only three of the nine HIV-1 proteins (Gag, Pol, Rev), which are expressed from separate plasmids to avoid recombination-mediated generation of a replication- competent virus.
  • AAV vector known in the art can be used in the methods disclosed herein.
  • the AAV vector can comprise a known vector or can comprise a variant, fragment, or fusion thereof.
  • the AAV vector is selected from the group consisting of AAV type 1 (AAV1), AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, bovine AAV, shrimp AAV, snake AAV, and any combination thereof.
  • AAV type 1 AAV1
  • AAV2 AAV3A
  • AAV3B AAV4
  • AAV5 AAV6, AAV7, AAV8, AAV9
  • AAV10 AAV11, AAV12, AAV13, AAVrh.74
  • avian AAV bovine AAV
  • bovine AAV canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, bovine AAV, shrimp A
  • the AAV vector is derived from an AAV vector selected from the group consisting of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, and any combination thereof.
  • the AAV vector is a chimeric vector derived from at least two AAV vectors selected from the group consisting of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, and any combination thereof.
  • the AAV vector comprises regions of at least two different AAV vectors known in the art.
  • the AAV vector comprises an inverted terminal repeat from a first AAV (e.g., AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, or any derivative thereof) and a second inverted terminal repeat from a second AAV (e.g., AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate
  • the AAV vector comprises a portion of an AAV vector selected from the group consisting of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, and any combination thereof.
  • the AAV vector comprises AAV2.
  • the AAV vector comprises a splice acceptor site.
  • the AAV vector comprises a promoter. Any promoter known in the art can be used in the AAV vector of the present disclosure.
  • the promoter is an RNA Pol III promoter.
  • the RNA Pol III promoter is selected from the group consisting of the U6 promoter, the H1 promoter, the 7SK promoter, the 5S promoter, the adenovirus 2 (Ad2) VAI promoter, and any combination thereof.
  • the promoter is a cytomegalovirus immediate-early gene (CMV) promoter, an EF1a promoter, an SV40 promoter, a PGK1 promoter, a Ubc promoter, a human beta actin promoter, a CAG promoter, a TRE promoter, a UAS promoter, a Ac5 promoter, a polyhedrin promoter, a CaMKIIa promoter, a GAL1 promoter, a GAL10 promoter, a TEF promoter, a GDS promoter, a ADH1 promoter, a CaMV35S promoter, or a Ubi promoter.
  • the promoter comprises the U6 promoter.
  • the AAV vector comprises a constitutively active promoter (constitutive promoter).
  • the constitutive promoter is selected from the group consisting of hypoxanthine phosphoribosyl transferase (HPRT), adenosine deaminase, pyruvate kinase, beta-actin promoter, cytomegalovirus (CMV), simian virus (e.g., SV40), papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, a retrovirus long terminal repeat (LTR), Murine stem cell virus (MSCV) and the thymidine kinase promoter of herpes simplex virus.
  • HPRT hypoxanthine phosphoribosyl transferase
  • CMV cytomegalovirus
  • simian virus e.g., SV40
  • papilloma virus adenovirus
  • the promoter is an inducible promoter.
  • the inducible promoter is a tissue specific promoter.
  • the tissue specific promoter drives transcription of the coding region of the AAV vector in a neuron, a glial cell, or in both a neuron and a glial cell.
  • the AAV vector comprises one or more enhancers.
  • the one or more enhancer are present in the AAV alone or together with a promoter disclosed herein.
  • the AAV vector comprises a 3'-UTR poly(A) tail sequence.
  • the 3'-UTR poly(A) tail sequence is selected from the group consisting of bGH poly(A), actin poly(A), hemoglobin poly(A), and any combination thereof. In some aspects, the 3'-UTR poly(A) tail sequence comprises bGH poly(A).
  • a miRNA inhibitor e.g., miR-485-3p inhibitor disclosed herein is administered with a delivery agent.
  • Non-limiting examples of delivery agents that can be used include a lipidoid, a liposome, a lipoplex, a lipid nanoparticle, an extracellular vesicle (e.g., exosome), a synthetic vesicle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, a micelle, a viral vector, a conjugate, or combinations thereof.
  • V.A. Carrier Units [0246]
  • the present disclosure also provides a composition comprising a miRNA inhibitor of the present disclosure (e.g., miR-485-3p inhibitor) and a delivery agent.
  • the delivery agent comprises a carrier unit, e.g., that can self- assemble into micelles or be incorporated into micelles. Therefore, the present disclosure also provides a micelle comprising a miRNA inhibitor of the present disclosure (i.e., miR-485-3p inhibitor) wherein the miRNA inhibitor and the delivery agent are associated with each other.
  • a miR-485-3p inhibitor provided herein can be administered (e.g., to a subject suffering from a disease or disorder based on the diagnosis described herein) using a carrier unit.
  • carrier units of the present disclosure comprise a water-soluble biopolymer moiety (e.g., PEG), a charged carrier moiety, a crosslinking moiety, and an adjuvant moiety.
  • the charged carrier moiety is cationic (e.g., a polylysine).
  • payload i.e., miR-485-3p inhibitor
  • the resulting carrier unit:payload (i.e., miR-485-3p inhibitor) complex can have a "head” comprising the water-soluble biopolymer moiety and a "tail” comprising the cationic carrier moiety electrostatically bound to the payload.
  • Carrier unit:payload complexes can self-associate, alone or in combination with other molecules, to yield micelles in which the payload (i.e., miR-485-3p inhibitor) is located in the core of the micelle and the water-soluble biopolymer moiety is facing the solvent.
  • the payload i.e., miR-485-3p inhibitor
  • micelles of the present disclosure encompasses not only classic micelles but also small particles, small micelles, micelles, rod-like structures, or polymersomes.
  • the carrier units of the present disclosure can also comprise a targeting moiety (e.g., a targeting ligand) covalently linked to the water-soluble biopolymer moiety via one or more optional linkers.
  • a targeting moiety e.g., a targeting ligand
  • targeting moieties are provided elsewhere in the present disclosure.
  • the micelles of the present disclosure can comprises more than one type of targeting moieties.
  • the carrier units of the present disclosure can also comprise an adjuvant moiety (AM) covalently linked to the charged cationic carrier moiety.
  • the adjuvant moiety can have, e.g., a therapeutic, a co-therapeutic effect, or positively affect the homeostasis of the target cell or target tissue.
  • the AM comprises one or more amino acids.
  • the AM comprises one or more amino acids linked to an adjuvant molecule (e.g., a vitamin).
  • the AM comprises one or more lysine residues covalently bound to an adjuvant molecule (e.g., a vitamin).
  • Adjuvant moiety can also be referred to as a hydrophobic moiety (HM).
  • the delivery agent comprises a cationic carrier unit comprising [WP]-L1-[CC]-L2-[AM] (formula I) or [WP]-L1-[AM]-L2-[CC] (formula II) wherein WP is a water-soluble biopolymer moiety; CC is a positively charged (i.e., cationic) carrier moiety; AM is an adjuvant moiety; and, L1 and L2 are independently optional linkers, and wherein when mixed with a nucleic acid at an ionic ratio of about 1:1, the cationic carrier unit forms a micelle.
  • a delivery agent useful for the present disclosure comprises cationic carrier units of Schema I through Schema VI: [CC]-L1-[CM]-L2-[AM] (Schema I); [CC]-L1-[AM]-L2-[CM] (Schema II); [AM]-L1-[CM]-L2-[CC] (Schema III); [AM]-L1-[CC]-L2-[CM] (Schema IV); [CM]-L1-[CC]-L2-[AM] (Schema V); or [CM]-L1-[AM]-L2-[CC] (Schema VI); wherein CC is a cationic carrier moiety, e.g., a polylysine; CM is
  • the cationic carrier unit further comprises a water-soluble polymer (WP).
  • WP water-soluble polymer
  • the water-soluble polymer is attached to [CC], [AM], and/or [CM].
  • the water-soluble polymer is attached to the N terminus of [CC], [AM], or [CM].
  • the water-soluble polymer is attached to the N terminus of [CC].
  • the water-soluble polymer is attached to the C terminus of [CC], [AM], or [CM].
  • the water-soluble polymer is attached to the C terminus of [CC].
  • the cationic carrier unit comprises: [WP]-L3-[CC]-L1-[CM]-L2-[AM] (Schema I’); [WP]-L3-[CC]-L1-[AM]-L2-[CM] (Schema II’); [WP]-L3-[AM]-L1-[CM]-L2-[CC] (Schema III’); [WP]-L3-[AM]-L1-[CC]-L2-[CM] (Schema IV’); [WP]-L3-[CM]-L1-[CC]-L2-[AM] (Schema V’); or [WP]-L3-[CM]-L1-[AM]-L2-[CC] (Schema VI’).
  • the [WP] component can be connected to at least one targeting moiety, i.e., [T] n -[WP]-... wherein n is an integer, e.g., 1, 2 or 3.
  • the carrier unit can comprise the CC, CM, and AM moieties in a linear fashion.
  • the carrier units can comprises the CC, CM, and AM moieties organized in a branched scaffold arrangement, for example, with (i) a polymeric CC moiety comprising positively charged units (e.g., polylysines) and (ii) a CMs (e.g., lysine linked to a crosslinking agent, e.g., lysine-thiol) attached to the N or C terminus of the CC moiety and (iii) a AM (e.g., lysine linked to an adjuvant agent, e.g., lysine linked to Vitamin B3) attached to the N or C terminus of the CM moiety.
  • a polymeric CC moiety comprising positively charged units (e.g., polylysines) and (ii) a CMs (e.g., lysine linked to a crosslinking agent, e.g., lysine-thiol) attached to the N or C terminus of the
  • the carrier units can comprises the CC, CM, and AM moieties organized in a branched scaffold arrangement, for example, with (i) a polymeric CC moiety comprising positively charged units (e.g., polylysines) and (ii) a CMs (e.g., lysine linked to a crosslinking agent, e.g., lysine-thiol) attached to the N or C terminus of the CC moiety and (iii) a AM (e.g., lysine linked to an adjuvant agent, e.g., lysine linked to Vitamin B3) attached to the N or C terminus of the CM moiety.
  • a polymeric CC moiety comprising positively charged units (e.g., polylysines) and (ii) a CMs (e.g., lysine linked to a crosslinking agent, e.g., lysine-thiol) attached to the N or C terminus of the
  • cationic carrier units of the present disclosure are mixed with an anionic payload (e.g., a nucleic acid) at an ionic ratio of about 20:1, i.e., the number of negative charges in the anionic payload is about 20 times higher than the number of positive charges in the cationic carrier moiety, to about 20:1, i.e., the number of positive charges in the cationic carrier moiety is about ten times higher than the number of negative charges in the anionic payload
  • the neutralization of negative charges in the anionic payload by positive charges in the cationic carrier moiety mainly via electrostatic interaction leads to the formation of a cationic carrier unit:anionic payload complex having an unaltered hydrophilic portion (comprising the WP moiety) and a substantially more hydrophobic portion (resulting from the association between the cationic carrier moiety plus hydrophobic moiety and the anionic payload).
  • the adjuvant moiety can contribute its own positive charges to the positive charges of the cationic carrier moiety, which would interact with the negative charges of the anionic payload (e.g., polynucleotides disclosed herein). It is to be understood that references to the interactions (e.g., electrostatic interactions) between a cationic carrier moiety and an anionic payload (e.g., polynucleotides disclosed herein) also encompass interactions between the charges of a cationic carrier moiety plus adjuvant moiety and the charges of an anionic payload.
  • amphipathic complex results in an amphipathic complex.
  • amphipathic complexes can self-organize, alone or combination with other amphipathic components, into micelles.
  • the resulting micelles comprise the WP moieties facing the solvent (i.e., the WP moieties are facing the external surface of the micelle), whereas the CC and AM moieties as well as the associate payload (e.g., a nucleotide sequence, e.g., RNA, DNA, or any combination thereof) are in the core of the micelle.
  • the composition comprises a water-soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3.
  • the composition comprises a water-soluble biopolymer moiety with about 100 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 100 lysines (e.g., about 80 lysines), and an adjuvant moiety with about 5 to about 50 vitamin B3 (e.g., about 35 vitamin B3).
  • the composition comprises (i) a water-soluble biopolymer moiety with about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (e.g., about 16 lysines, each with a thiol group), and (iv) about 30 to 40 lysines fused to vitamin B3 (e.g., about 32 lysines, each fused to vitamin B3).
  • an amine group e.g., about 32 lysines
  • a thiol group e.g., about 16 lysines, each with a thiol group
  • vitamin B3 e.g., about 32 lysines, each fused to vitamin B3
  • the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the water soluble polymer.
  • a targeting moiety e.g., a LAT1 targeting ligand, e.g., phenyl alanine
  • the thiol groups in the composition form disulfide bonds.
  • the composition comprises (i) a water-soluble biopolymer moiety with about 100 to about 200 PEG units, (ii) about 30 to about 100 lysines with an amine group (e.g., about 40 lysines), (iii) about 1 to about 20 lysines, each having a thiol group (e.g., about 5 lysines, each with a thiol group), and (iv) about 5 to 50 lysines fused to vitamin B3 (e.g., about 35 lysines, each fused to vitamin B3).
  • an amine group e.g., about 40 lysines
  • a thiol group e.g., about 5 lysines, each with a thiol group
  • vitamin B3 e.g., about 35 lysines, each fused to vitamin B3
  • the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the water soluble polymer.
  • a targeting moiety e.g., a LAT1 targeting ligand, e.g., phenyl alanine
  • the thiol groups in the composition form disulfide bonds.
  • the composition comprises (1) a micelle comprising (i) about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (e.g., about 16 lysines, each with a thiol group), and (iv) about 30 to 40 lysines fused to vitamin B3 (e.g., about 32 lysines, each fused to vitamin B3), and (2) a miR-485 inhibitor (e.g., SEQ ID NO: 30), wherein the miR-485 inhibitor is encapsulated within the micelle.
  • a micelle comprising (i) about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (
  • the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the PEG units.
  • a targeting moiety e.g., a LAT1 targeting ligand, e.g., phenyl alanine
  • the thiol groups in the micelle form disulfide bonds.
  • the composition comprises (1) a micelle comprising (i) about 100 to about 200 PEG units (e.g., about 114 units), (ii) about 30 to about 100 lysines with an amine group (e.g., about 40 lysines), (iii) about 3 to about 50 lysines, each having a thiol group (e.g., about 35 lysines, each with a thiol group), and (iv) about 2 to about 20 lysines fused to vitamin B3 (e.g., about 5 lysines, each fused to vitamin B3), and (2) an isolated polynucleotide described herein (e.g., miR-485 inhibitor), wherein the isolated polynucleotide is encapsulated within the micelle.
  • a micelle comprising (i) about 100 to about 200 PEG units (e.g., about 114 units), (ii) about 30 to about 100 lysines with an amine group (e.g., about 40
  • the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the PEG units.
  • a targeting moiety e.g., a LAT1 targeting ligand, e.g., phenyl alanine
  • the thiol groups in the micelle form disulfide bonds.
  • the cationic carrier unit comprises: (a) a WP moiety, wherein the water-soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), wherein n is between about 120 to about PEG 130 (e.g., PEG is a PEG5000 or a PEG6000); (b) a CC moiety, wherein the cationic carrier moiety comprises, e.g., about 20 to about 100 lysines (e.g., a linear poly(L-lysine)n wherein n is between about 30 and about 40), a polyethylenimine (PEI), or chitosan; (c) a CM moiety, wherein the crosslinking moiety comprises about 10 to about 50 lysines, each of which is linked to a crosslinking agent, e.g., 10-40 lysine-thiol, and (d) an AM moiety, wherein the adjuvant moiety has about 1 to about 20
  • PEG polyethylene glyco
  • the cationic carrier unit comprises: (a) a WP moiety, wherein the water-soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), wherein n is between about 120 to about PEG 130 (e.g., PEG is a PEG5000 or a PEG6000); (b) a CC moiety, wherein the cationic carrier moiety comprises, e.g., about 20 to about 100 lysines (e.g., a linear poly(L-lysine)n wherein n is between about 30 and about 40), a polyethyleneimine (PEI), or chitosan; (c) a CM moiety, wherein the crosslinking moiety comprises about 10 to about 50 lysines, each of which is linked to a crosslinking agent, e.g., 10-40 lysine-thiol, and (d) an AM moiety, wherein the adjuvant moiety has about 1 to about 10 ly
  • PEG polyethylene glyco
  • the cationic carrier unit comprises: (a) a WP moiety, wherein the water-soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), wherein n is between about 120 to about PEG 130 (e.g., PEG is a PEG5000 or a PEG6000); (b) a CC moiety, wherein the cationic carrier moiety comprises, e.g., about 20 to about 100 lysines (e.g., a linear poly(L-lysine)n wherein n is between about 30 and about 40), a polyethyleneimine (PEI), or chitosan; (c) a CM moiety, wherein the crosslinking moiety comprises about 10 to about 50 lysines, each of which is linked to a crosslinking agent, e.g., 10-40 lysine-thiol, and (d) an AM moiety, wherein the adjuvant moiety has about 5 to about 10 ly
  • PEG polyethylene glyco
  • the cationic carrier unit comprises: (a) a WP moiety, wherein the water-soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), wherein n is between about 120 to about PEG 130 (e.g., PEG is a PEG5000 or a PEG6000); (b) a CC moiety, wherein the cationic carrier moiety comprises, e.g., about 20 to about 100 lysines (e.g., a linear poly(L-lysine)n, wherein n is between about 30 and about 40, e.g., about 40), a polyethyleneimine (PEI), or chitosan; (c) a CM moiety, wherein the crosslinking moiety comprises about 10 to about 50 lysines, each of which is linked to a crosslinking agent, e.g., 10-40 lysine-thiol, e.g., 35 lysine-thiol
  • PEG polyethylene glyco
  • the cationic carrier unit further comprises at least one targeting moiety attached to the WP moiety of the cationic carrier unit.
  • the number and/or density of targeting moieties displayed on the surface of the micelle can be modulated by using a specific ratio of cationic carrier units having targeting moieties to cationic carrier units not having targeting moieties.
  • the ratio of cationic carrier units having a targeting moiety to cationic carrier units not having a targeting moiety is at least about 1:5, at least about 1:10, at least about 1:20, at least about 1:30, at least about 1:40, at least about 1:50, at least about 1:60, at least about 1:70, at least about 1:80, at least about 1:90, at least about 1:100, at least about 1:120, at least about 1:140, at least about 1:160, at least about 1:180, at least about 1:200, at least about 1:250, at least about 1:300, at least about 1:350, at least about 1:400, at least about 1:450, at least about 1:500, at least about 1:600, at least about 1:700, at least about 1:800, at least about 1:900, or at least about 1:1000.
  • the cationic carrier unit comprises (i) a targeting moiety (A) which targets the transporter LAT1 (e.g., phenylalanine), (ii) a water soluble polymer which is PEG, (iii) a cationic carrier moiety comprising cationic polymer blocks which are lysine (iv) a crosslinking moiety comprising crosslinking polymer blocks which are lysines linked to crosslinking moieties, and (v) an adjuvant moiety comprising hydrophobic polymer blocks which are lysines linked to vitamin B3.
  • a targeting moiety A
  • targets the transporter LAT1 e.g., phenylalanine
  • a water soluble polymer which is PEG
  • a cationic carrier moiety comprising cationic polymer blocks which are lysine
  • iv a crosslinking moiety comprising crosslinking polymer blocks which are lysines linked to crosslinking moieties
  • an adjuvant moiety compris
  • a targeting moiety A
  • the transporter LAT1 e.g., phenylalanine
  • A which targets the transporter LAT1 (e.g., phenylalanine)
  • the vitamin B3 unit are introduced into the side chains of the AM moiety, e.g., by a coupling reaction between NH 2 groups in the lysines and COOH groups of vitamin B3, in the presence of suitable conjugation reagents, for example, 1-ethyl-3-(3- dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxy succinimide (NHS).
  • suitable conjugation reagents for example, 1-ethyl-3-(3- dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxy succinimide (NHS).
  • EDC 1-ethyl-3-(3- dimethylaminopropyl)-carbodiimide
  • NHS N-hydroxy succinimide
  • the present disclosure provides complexes comprising a carrier unit (e.g., a cationic carrier unit unit) of the present disclosure non-covalently attached to a payload (e.g., an anionic payload such a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof), wherein the carrier unit and the payload interact electrostatically.
  • a carrier unit e.g., a cationic carrier unit unit
  • a payload e.g., an anionic payload such a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof
  • the present disclosure provides conjugates comprising a carrier unit (e.g., a cationic carrier unit unit) of the present disclosure covalently attached to a payload (e.g., an anionic payload such a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof), wherein the carrier unit and the payload interact electrostatically.
  • a carrier unit e.g., a cationic carrier unit unit
  • a payload e.g., an anionic payload such a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof
  • the carrier unit and the payload can be linked via a cleavable linker.
  • the carrier unit and the payload in addition to interacting electrostatically, can interact covalently (e.g., after electrostatic interaction the carrier unit and the payload can be "locked" via a disulfide bond or a cleavable bond).
  • the association is a covalent bond, a non-covalent bond, or an ionic bond.
  • the positive charge of the cationic carrier moiety of the cationic carrier unit is sufficient to form a micelle when mixed with the miR-485 inhibitor disclosed herein in a solution, wherein the overall ionic ratio of the positive charges of the cationic carrier moiety of the cationic carrier unit and the negative charges of the miR-485 inhibitor (or vector comprising the inhibitor) in the solution is about 1: 1.
  • the cationic carrier unit is capable of protecting the miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) from enzymatic degradation. See PCT Publication No.
  • the cationic carrier unit comprises a water-soluble polymer comprising a PEG with about 100 to about 130 units (e.g., about 114 units), a cationic carrier moiety comprising a polylysine with about 20 to about 60 lysine units, (e.g., about 40 lysines) a crosslinking moiety comprising about 3 to about 40 lysine-thiol units (e.g., about 35 lysines, each with a thiol group), and an adjuvant moiety comprising about 1 to about 50 lysines linked to a vitamin B3 units (e.g., about 5 lysines, each fused to vitamin B3).
  • a cationic carrier moiety comprising a polylysine with about 20 to about 60 lysine units, (e.g., about 40 lysines)
  • a crosslinking moiety comprising about 3 to about 40 lysine-thiol units (e.g., about 35 lysines, each
  • composition comprising a miRNA inhibitor of the present disclosure (e.g., miR-485-3p inhibitor) interacts with the cationic carrier unit via an ionic bond.
  • the cationic carrier unit is associated with a negatively charged payload (e.g., a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof), which interacts with the cationic carrier unit via at least one ionic bond (i.e., via electrostatic interaction) with the cationic carrier moiety of the cationic carrier unit.
  • a negatively charged payload e.g., a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof
  • a cationic carrier unit that be used in delivering a miR-485 inhibitor comprises a water-soluble biopolymer moiety.
  • water-soluble biopolymer refers to a biocompatible, biologically inert, non-immunogenic, non-toxic, and hydrophilic polymer, e.g., PEG.
  • the water-soluble polymer comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly( ⁇ -hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines ("POZ") poly(N-acryloylmorpholine), or any combinations thereof.
  • the water- soluble polymer comprises polyethylene glycol (“PEG”), polyglycerol, or poly(propylene glycol) (“PPG").
  • the water-soluble polymer comprises: , (formula III), wherein n is 1-1000.
  • the n of the water-soluble polymer e.g., PEG
  • the n of the water-soluble polymer has a value of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96,
  • n is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about 450, at least about
  • n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 85 to about 95, about 95 to about 105, about 105 to about 115, about 115 to about 125, about 125 to about 135, about 135 to about 145, about 145 to about 155, about 155 to about 165, about 80 to about 100, about 100 to about 120, about 120 to about 140, about 140 to about 160, about 85 to about 105, about 105 to about 125, about 125 to about 145, or about 145 to about 165.
  • the n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141.
  • the n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, about 150 to about 160.
  • the water-soluble polymer moiety is PEG.
  • the PEG is a branched PEG.
  • the PEG moiety is a monodisperse polyethylene glycol.
  • mdPEG monodisperse polyethylene glycol
  • mdPEG is a PEG that has a single, defined chain length and molecular weight. mdPEGs are typically generated by separation from the polymerization mixture by chromatography.
  • a monodisperse PEG moiety is assigned the abbreviation mdPEG.
  • the PEG is a Star PEG. Star PEGs have 10 to 100 PEG chains emanating from a central core group.
  • the PEG is a Comb PEGs. Comb PEGs have multiple PEG chains normally grafted onto a polymer backbone.
  • the PEG has a molar mass between about 1000 g/mol and about 2000 g/mol, between about 2000 g/mol and about 3000 g/mol, between about 3000 g/mol to about 4000 g/mol, between about 4000 g/mol and about 5000 g/mol, between about 5000 g/mol and about 6000 g/mol, between about 6000 g/mol and about 7000 g/mol, or between 7000 g/mol and about 8000 g/mol.
  • the PEG is PEG 100 , PEG 200 , PEG 300 , PEG 400 , PEG 500 , PEG 600 , PEG 700 , PEG 800 , PEG 900 , PEG 1000 , PEG 1100 , PEG 1200 , PEG 1300 , PEG 1400 , PEG 1500 , PEG 1600 , PEG 1700 , PEG 1800 , PEG 1900 , PEG 2000 , PEG 2100 , PEG 2200 , PEG 2300 , PEG 2400 , PEG 2500 , PEG 1600 , PEG 1700 , PEG 1800 , PEG 1900 , PEG 2000 , PEG 2100 , PEG 2200 , PEG 2300 , PEG 2400 , PEG 2500 , PEG 2600 , PEG 1700 , PEG 2800 , PEG 2900 , PEG 3000 , PEG 3100 , PEG 3200 , PEG 3300 , PEG 3
  • the PEG is PEG5000. In some aspects, the PEG is PEG 6000 . In some aspects, the PEG is PEG 4000 . [0286] In some aspects, the PEG is monodisperse. [0287] In some aspects, the water-soluble biopolymer moiety is a polyglycerol (PG) described by the formula ((R 3 —O—(CH 2 —CHOH—CH 2 O) n —) with R 3 being hydrogen, methyl or ethyl, and n having a value from 3 to 200.
  • PG polyglycerol
  • the water-soluble biopolymer moiety is a branched polyglycerol described by the formula (R 3 —O—(CH 2 — CHOR 5 —CH 2 —O) n —) with R 5 being hydrogen or a linear glycerol chain described by the formula (R 3 —O—(CH 2 —CHOH—CH 2 —O) n —) and R 3 being hydrogen, methyl or ethyl.
  • the water-soluble biopolymer moiety is a hyperbranched polyglycerol described by the formula (R 3 —O—(CH 2 —CHOR 5 —CH 2 —O) n —) with R 5 being hydrogen or a glycerol chain described by the formula (R 3 —O—(CH 2 —CHOR 6 —CH 2 —O) n —), with R 6 being hydrogen or a glycerol chain described by the formula (R 3 —O—(CH 2 —CHOR 7 —CH 2 — O) n —), with R 7 being hydrogen or a linear glycerol chain described by the formula (R 3 —O— (CH 2 —CHOH—CH 2 —O) n —) and R 3 being hydrogen, methyl or ethyl.
  • the PG has a molar mass between about 1000 g/mol and about 2000 g/mol, between about 2000 g/mol and about 3000 g/mol, between about 3000 g/mol to about 4000 g/mol, between about 4000 g/mol and about 5000 g/mol, between about 5000 g/mol and about 6000 g/mol, between about 6000 g/mol and about 7000 g/mol, or between 7000 g/mol and about 8000 g/mol.
  • the PG is PG 100 , PG 200 , PG 300 , PG 400 , PG 500 , PG 600 , PG 700 , PG 800 , PG 900 , PG 1000 , PG 1100 , PG 1200 , PG 1300 , PG 1400 , PG 1500 , PG 1600 , PG 1700 , PG 1800 , PG 1900 , PG 2000 , PG 2100 , PG 2200 , PG 2300 , PG 2400 , PG 2500 , PG 1600 , PG 1700 , PG 1800 , PG 1900 PG 2000 , PG 2100 , PG 2200 , PG 2300 , PG 2400 , PG 2500 , PG 2600 , PG 1700 , PG 2800 , PG 2900 , PG 3000 , PG 3100 , PG 3200 , PG 3300 , PG 3000 , PG 3100 ,
  • the PG is PG 5000. In some aspects, the PG is PG 6000 . In some aspects, the PG is PG 4000 . [0290] In some aspects, the PG is monodisperse. [0291] In some aspects, the water-soluble biopolymer comprises poly(propylene glycol) ("PPG"). In some aspects, PPG is characterized by the following formula, with n having a value from 1 to 1000.
  • the n of the PPG has a value of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112,
  • n of the PPG is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about
  • the n of the PPG is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 85 to about 95, about 95 to about 105, about 105 to about 115, about 115 to about 125, about 125 to about 135, about 135 to about 145, about 145 to about 155, about 155 to about 165, about 80 to about 100, about 100 to about 120, about 120 to about 140, about 140 to about 160, about 85 to about 105, about 105 to about 125, about 125 to about 145, or about 145 to about 165.
  • the PPG is a branched PPG. Branched PPGs have three to ten PPG chains emanating from a central core group.
  • the PPG moiety is a monodisperse polyethylene glycol.
  • a monodisperse polyethylene glycol is a PPG that has a single, defined chain length and molecular weight. mdPEGs are typically generated by separation from the polymerization mixture by chromatography.
  • mdPPG is assigned the abbreviation mdPPG.
  • the PPG is a Star PPG.
  • Star PPGs have 10 to 100 PPG chains emanating from a central core group.
  • the PPG is a Comb PPGs.
  • Comb PPGs have multiple PPG chains normally grafted onto a polymer backbone.
  • the PPG has a molar mass between about 1000 g/mol and about 2000 g/mol, between about 2000 g/mol and about 3000 g/mol, between about 3000 g/mol to about 4000 g/mol, between about 4000 g/mol and about 5000 g/mol, between about 5000 g/mol and about 6000 g/mol, between about 6000 g/mol and about 7000 g/mol, or between 7000 g/mol and about 8000 g/mol.
  • the PPG is PPG 100 , PPG 200 , PPG 300 , PPG 400 , PPG 500 , PPG 600 , PPG 700 , PPG 800 , PPG 900 , PPG 1000 , PPG 1100 , PPG 1200 , PPG 1300 , PPG 1400 , PPG 1500 , PPG 1600 , PPG 1700 , PPG 1800 , PPG 1900 , PPG 2000 , PPG 2100 , PPG 2200 , PPG 2300 , PPG 2400 , PPG 2500 , PPG 1600 , PPG 1700 , PPG 1800 , PPG 1900 , PPG 2000 , PPG 2100 , PPG 2200 , PPG 2300 , PPG 2400 , PPG 2500 , PPG 2600 , PPG 1700 , PPG 2800 , PPG 2900 , PPG 3000 , PPG 3100 , PPG 3200 , PPG 3300 , PPG 3
  • the PPG is PPG 5000 . In some aspects, the PPG is PPG 6000 . In some aspects, the PPG is PPG4000. [0299] In some aspects, the PPG is monodisperse. [0300] In some aspects, the water-soluble polymer is linear, branched, or dendritic. V.C. Cationic Carrier [0301] As is apparent from the present disclosure, in some aspects, a cationic carrier unit useful for the present disclosure comprises a cationic carrier moiety.
  • cationic carrier refers to a moiety or portion of a cationic carrier unit of the present disclosure comprising a plurality of positive charges that can interact and bind electrostatically an anionic payload (or an anionic carrier attached to a payload).
  • the number of positive charges or positively charged groups on the cationic carrier is similar to the number of negative charges or negatively charged groups on the anionic payload (or an anionic carrier attached to a payload).
  • the cationic carrier comprises a biopolymer, e.g., a peptide (e.g., a polylysine).
  • the cationic carrier moiety comprises one or more basic amino acids.
  • the cationic carrier moiety comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at last 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, or at least 50 basic amino acids.
  • the cationic carrier moiety comprises about 30 to about 50 basic amino acids. In some aspects, the cationic carrier moiety comprises at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 97, at
  • the cationic carrier moiety comprises about 30 to about 50 basic amino acids. In some aspects, the cationic carrier moiety comprises about 30 to about 40 basic amino acids. In some aspects, the cationic carrier moiety comprises about 60, about 70, about 80, about 90, or about 100 basic amino acids. In some aspects, the cationic carrier moiety comprises about 80 basic amino acids. In some aspects, the basic amino acid comprises arginine, lysine, histidine, or any combination thereof. In some aspects, the cationic carrier moiety comprises about 40 lysine monomers. [0303] In some aspects, the cationic carrier unit comprises at least about 40 basic amino acids, e.g., lysines.
  • the cationic carrier unit comprises at least about 45 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 50 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 55 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 60 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 65 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 70 basic amino acids, e.g., lysines.
  • the cationic carrier unit comprises at least about 75 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 80 basic amino acids, e.g., lysines. [0304] In some aspects, the cationic carrier unit comprises about 100 to about 1000, about 100 to about 900, about 100 to about 800, about 100 to about 700, about 100 to about 600, about 100 to about 500, about 100 to about 400, about 100 to about 300, about 100 to about 200, about 200 to about 1000, about 200 to about 900, about 200 to about 800, about 200 to about 700, about 200 to about 600, about 200 to about 500, about 200 to about 400, about 200 to about 300, about 300 to about 1000, about 300 to about 900, about 300 to about 800, about 300 to about 700, about 300 to about 600, about 300 to about 500, about 300 to about 400, about 400 to about 1000, about 400 to about 1000, about 400 to about 1000, about 400 to about 1000, about 400 to about 1000, about 400 to about 1000,
  • the number of basic amino acids can be adjusted based on the length of the anionic payload. For example, an anionic payload with a longer sequence can be paired with higher number of basic amino acids, e.g., lysines.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit can be calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is at least about 1, at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20.
  • N/P ratio molar ratio of protonated amine in polymer to phosphate in an anionic payload
  • the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA is between about 1 to about 20, about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 1 to about 10, e.g., about 3 to about 4, about 4 to about 5, about 5 to about 6, about 6 to about 7, or about 7 to about 8.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 1 to about 2.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 3 to about 4.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 2 to about 3.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 4 to about 5. In some aspects, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 5 to about 6.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 6 to about 7.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 7 to about 8.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 8 to about 9.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 9 to about 10.
  • the basic amino acid comprises arginine, lysine, histidine, or any combination thereof. In some aspects, the basic amino acid is a D-amino acid.
  • the basic amino acid is an L-amino acid.
  • the positively charged carrier comprises D-amino acids and L-amino acids.
  • the basic amino acid comprises at least one unnatural amino acid or a derivative thereof.
  • the basic amino acid is arginine, lysine, histidine, L-4-aminomethyl-phenylalanine, L-4-guanidine-phenylalanine, L-4-aminomethyl-N-isopropyl-phenylalanine, L-3-pyridyl-alanine, L-trans-4- aminomethylcyclohexyl-alanine, L-4-piperidinyl-alanine, L-4-aminocyclohexyl-alanine, 4- guanidinobutyric acid, L-2-amino-3-guanidinopropionic acid, DL-5-hydroxylysine, pyrrolysine, 5-hydroxy-L-lysine, methyllysine,
  • the cationic carrier comprises a polymer or copolymer comprising at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at last 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63,
  • the cationic carrier comprises a polymer or copolymer comprising between about 5 and about 10 cationic groups, between about 10 and about 15 cationic groups, between about 15 and about 20 cationic groups, between about 20 and about 25 cationic groups, between about 25 and about 30 cationic groups, between about 30 and about 35 cationic groups, between about 35 and about 40 cationic groups, between about 40 and about 45 cationic groups, between about 45 and about 50 cationic groups, between about 50 and about 55 cationic groups, between about 55 and about 60 cationic groups, between about 60 and about 65 cationic groups, between about 65 and about 70 cationic groups, between about 70 and about 75 cationic groups, or between about 45 and about 50 cationic groups (e.g., amino groups).
  • amino groups e.g., amino groups
  • the cationic carrier comprises a polymer or copolymer comprising between 30 and about 50 cationic groups (e.g., amino groups). In some aspects, the cationic carrier comprises a polymer or copolymer comprising between 70 and about 80 cationic groups (e.g., amino groups). In some aspects, the polymer or copolymer is an acrylate, a polyalcohol, or a polysaccharide. [0309] In some aspects, the cationic carrier moiety binds to a single payload molecule. In some aspects, a cationic carrier moiety can bind to multiple payload molecules, which can be identical or different.
  • the positive charges of the cationic carrier moiety and negative charges of a nucleic acid payload are at an ionic ratio of about 20:1, about 19:1, about 18:1, about 17:1, about 16:1, about 15:1, about 14:1, about 13:1, about 12:1, about 11:1, about 10:1, about 9:1, about 8:1 about 7:1, about 6:1 about 5:1, about 4:1, about 3:1, about 2:1, or about 1:1.
  • the negative charges of a nucleic acid payload and the positive charges of the cationic carrier moiety are at an ionic ratio of about 20:1, about 19:1, about 18:1, about 17:1, about 16:1, about 15:1, about 14:1, about 13:1, about 12:1, about 11:1, about 10:1, about 9:1, about 8:1 about 7:1, about 6:1 about 5:1, about 4:1, about 3:1, about 2:1, or about 1:1.
  • the anionic payload comprises a nucleotide sequence having about 10 to about 1000 (e.g., about 100 to about 1000) in length, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is about 2 to about 10, e.g., about 2 to about 9, about 2 to about 8, about 2 to about 7, about 2 to about 6, about 2 to about 5, about 2 to about 4, about 2 to about 3, e.g., e.g., about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10.
  • an N/P ratio of the cationic carrier moiety and the anionic payload of about 10 to about 1000 nucleotides in length is between about 1 and about 10, e.g., about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10.
  • the anionic payload comprises a nucleotide sequence having about 1000 to about 2000 in length, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is about 3 to about 12, e.g., about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, or about 12.
  • the N/P ratio of the cationic carrier moiety and the anionic payload is between about 4 and about 7, e.g., about 4, about 5, about 6, or about 7.
  • the anionic payload comprises a nucleotide sequence having about 2000 to about 3000 in length, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is about 3 to about 16, e.g., about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16.
  • the N/P ratio of the cationic carrier moiety and the anionic payload is between about 6 and about 9, e.g., about 6, about 7, about 8, or about 9.
  • the anionic payload comprises a nucleotide sequence having about 3000 to about 4000 in length, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is about 3 to about 20, e.g., about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20. In some aspects, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is between about 7 and about 10, e.g., about 7, about 8, about 9, or about 10. [0315] In some aspects, the cationic carrier moiety has a free terminus wherein the end group is a reactive group.
  • the cationic carrier moiety has a free terminus (e.g., the C-terminus in a poly-lysine cationic carrier moiety) wherein the end group is an amino (- NH 2 ) group. In some aspects, the cationic carrier moiety has a free terminus wherein the end group is an sulfhydryl group. In some aspects, the reactive group of the cationic carrier moiety is attached to an adjuvant moiety, e.g., a vitamin B3. [0316] In some aspects, the cationic carrier unit is capable of protecting the miRNA inhibitor of the present disclosure (e.g., miR-485-3p inhibitor) from enzymatic degradation. See PCT Publication No.
  • the cationic carrier units of the present disclosure comprise at least one crosslinking moiety.
  • crosslinking moiety refers to a moiety or portion of a polymer block comprising a plurality of agents that are capable of forming crosslinks.
  • the number of agents that are capable of forming crosslinks comprises an amino acid with a side chain of a crosslinking agent.
  • the CM comprises a biopolymer, e.g., a peptide (e.g., a polylysine) linked to a crosslinking agent.
  • the crosslinking moiety comprises one or more amino acids (e.g., lysine, arginine, histidine, or a combination thereof). In some aspects, the crosslinking moiety comprises at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about
  • the crosslinking moiety comprises at least about 10 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 11 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 12 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 13 amino acids, e.g., lysines, each of which is linked to a crosslinking agent.
  • the crosslinking moiety comprises at least about 14 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 15 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 16 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 17 amino acids, e.g., lysines, each of which is linked to a crosslinking agent.
  • the crosslinking moiety comprises at least about 18 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 19 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 20 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. [0320] In some aspects, a crosslinking agent is a thiol. In some aspects, a crosslinking agent is a thiol derivative. V.E.
  • a cationic carrier unit useful for the present disclosure comprises at least one adjuvant moiety.
  • adjuvant moiety refers to a molecular entity that can, e.g., (i) complement the therapeutic or prophylactic activity of the payload, (ii) modulate the therapeutic or prophylactic activity of the payload, (iii) function as a therapeutic and/or prophylactic agent in the target tissue or target cells, (iv) facilitate the transport of the cationic carrier unit across a physiological barrier, e.g., the BBB and/or the plasma membrane, (v) improve the homeostasis of the target tissue or target cell, (vi) contribute positively charges groups to the cationic carried moiety, or (vii) any combination thereof.
  • a physiological barrier e.g., the BBB and/or the plasma membrane
  • the adjuvant moiety is capable of modulating an immune response, an inflammatory response, and/or a tissue microenvironment.
  • the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof.
  • the adjuvant moiety comprises, e.g., an amino acid linked to an imidazole derivative, a vitamin, or any combination thereof.
  • the adjuvant moiety comprises: wherein each of G1 and G2 is H, an aromatic ring, or 1-10 alkyl, or G1 and G2 together form an aromatic ring, and wherein n is 1-10.
  • the adjuvant moiety comprises nitroimidazole.
  • the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof.
  • the adjuvant moiety comprises an amino acid.
  • the adjuvant moiety comprises an amino acid (e.g., lysine) linked to nitroimidazole.
  • the adjuvant moiety comprises an amino acid (e.g., lysine) linked to metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof.
  • the adjuvant moiety comprises an amino acid (e.g., lysine) linked to metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof.
  • the adjuvant moiety comprises an amino acid (e.g., lysine) linked to metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benz
  • the adjuvant moiety comprises a vitamin.
  • the adjuvant moiety comprises an amino acid (e.g., lysine) linked to a vitamin.
  • the vitamin comprises a cyclic ring or cyclic hetero atom ring and a carboxyl group or hydroxyl group.
  • the vitamin comprises: wherein each of Y1 and Y2 is C, N, O, or S, and wherein n is 1 or 2.
  • the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof.
  • the vitamin is vitamin B3.
  • the adjuvant moiety comprises at least about one, at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 vitamin B3.
  • the adjuvant moiety comprises at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, or at least about 50 vitamin B3. In some aspects, the adjuvant moiety comprises about 10 vitamin B3.
  • the composition comprises a water-soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3.
  • the composition comprises (i) a water-soluble biopolymer moiety with about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (e.g., about 16 lysines, each with a thiol group), and (iv) about 30 to 40 lysines fused to vitamin B3 (e.g., about 32 lysines, each fused to vitamin B3).
  • an amine group e.g., about 32 lysines
  • a thiol group e.g., about 16 lysines, each with a thiol group
  • vitamin B3 e.g., about 32 lysines, each fused to vitamin B3
  • the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the water soluble polymer.
  • a targeting moiety e.g., a LAT1 targeting ligand, e.g., phenyl alanine
  • the thiol groups in the composition form disulfide bonds.
  • the composition comprises (1) a micelle comprising (i) about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (e.g., about 16 lysines, each with a thiol group), and (iv) about 30 to 40 lysines fused to vitamin B3 (e.g., about 32 lysines, each fused to vitamin B3), and (2) a miRNA inhibitor (e.g., SEQ ID NO: 30), wherein the miRNA inhibitor is encapsulated within the micelle.
  • a miRNA inhibitor e.g., SEQ ID NO: 30
  • the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the PEG units.
  • a targeting moiety e.g., a LAT1 targeting ligand, e.g., phenyl alanine
  • the thiol groups in the micelle form disulfide bonds.
  • the present disclosure also provides a micelle comprising a miRNA inhibitor of the present disclosure (e.g., miR-485-3p inhibitor) wherein the miRNA inhibitor and the delivery agent are associated with each other.
  • the association is a covalent bond, a non-covalent bond, or an ionic bond.
  • the positive charge of the cationic carrier moiety of the cationic carrier unit is sufficient to form a micelle when mixed with the miRNA inhibitor disclosed herein in a solution, wherein the overall ionic ratio of the positive charges of the cationic carrier moiety of the cationic carrier unit and the negative charges of the miRNA inhibitor (or vector comprising the inhibitor) in the solution is about 1: 1.
  • the adjuvant moiety comprises about 1 amino acid (e.g., lysine), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 2 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • the adjuvant moiety comprises about 3 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 4 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 5 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 6 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 7 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • the adjuvant moiety comprises about 3 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 4 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 5 amino acids
  • the adjuvant moiety comprises about 8 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 9 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 10 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 11 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 12 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • the adjuvant moiety comprises about 8 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 9 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 10 amino acids
  • the adjuvant moiety comprises about 13 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 14 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 15 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 16 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 17 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • the adjuvant moiety comprises about 13 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 14 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 15 amino acids
  • the adjuvant moiety comprises about 18 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 19 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 20 amino acids (e.g., lysines), each of which is linked to vitamin B3. V.F. Targeting Moiety [0334] As described herein, in some aspects, a cationic carrier unit useful for the present disclosure comprises a targeting moiety. In some aspects, the targeting moiety is linked to the water-soluble polymer, e.g., via a linker.
  • targeting moiety refers to a biorecognition molecule that binds to a specific biological substance or site.
  • the targeting moiety is specific for a certain target molecule (e.g., a ligand targeting a receptor, or an antibody targeting a surface protein), tissue (e.g., a molecule that would preferentially carry the micelle to a specific organ or tissue, e.g., liver, brain, or endothelium), or facilitate transport through a physiological barrier (e.g., a peptide or other molecule that can facilitate transport across the brain blood barrier or plasma membrane).
  • a target molecule e.g., a ligand targeting a receptor, or an antibody targeting a surface protein
  • tissue e.g., a molecule that would preferentially carry the micelle to a specific organ or tissue, e.g., liver, brain, or endothelium
  • a physiological barrier e.g., a peptide or other molecule that can facilitate transport across the brain
  • a targeting moiety can be coupled to a cationic carrier unit, and therefore, to the external surface of a micelle, whereas the micelle has the payload entrapped within its core.
  • the targeting moiety is a targeting moiety capable of targeting the micelle of the present disclosure to a tissue.
  • the tissue is brain, liver, kidney, lung, ovary, pancreas, thyroid, breast, stomach, or any combination thereof.
  • the tissue is a tissue in the central nervous system, e.g., neural tissue.
  • the targeting moiety targeting the central nervous system is capable being transported by Large-neutral Amino Acid Transporter 1 (LAT1).
  • LAT1 (SLC7A5) is a transporter for both the uptake of large neutral amino acids and a number of pharmaceutical drugs. LAT1 can transport drugs such as L-dopa or gabapentin.
  • a targeting moiety comprises glucose, e.g., D-glucose, which can bind to Glucose transporter 1 (or GLUT1) and cross BBB.
  • GLUT1 also known as solute carrier family 2, facilitated glucose transporter member 1 (SLC2A1), is a uniporter protein that in humans is encoded by the SLC2A1 gene.
  • GLUT1 facilitates the transport of glucose across the plasma membranes of mammalian cells. This gene encodes a major glucose transporter in the mammalian blood-brain barrier.
  • a targeting moiety comprises galactose, e.g., D-galactose, which can bind to GLUT1 transporter to cross BBB.
  • a targeting moiety comprises glutamic acid, which can bind to acetylcholinesterase inhibitor (AChEI) and/or EAATs inhibitors and cross BBB.
  • Acetylcholinesterase is the enzyme that is the primary member of the cholinesterase enzyme family.
  • an acetylcholinesterase inhibitor is the inhibitor that inhibits acetylcholinesterase from breaking down acetylcholine into choline and acetate, thereby increasing both the level and duration of action of the neurotransmitter acetylcholine in the central nervous system, autonomic ganglia and neuromuscular junctions, which are rich in acetylcholine receptors.
  • Acetylcholinesterase inhibitors are one of two types of cholinesterase inhibitors; the other being butyryl-cholinesterase inhibitors.
  • the tissue targeted by a targeting moiety is a skeletal muscle.
  • the targeting moiety targeting skeletal muscle is capable being transported by Large-neutral Amino Acid Transporter 1 (LAT1).
  • LAT1 Large-neutral Amino Acid Transporter 1
  • LAT1 is consistently expressed at high levels in brain microvessel endothelial cells. Being a solute carrier located primarily in the BBB, targeting the micelles of the present disclosure to LAT1 allows delivery through the BBB.
  • the targeting moiety targeting a micelle of the present disclosure to the LAT1 transporter is an amino acid, e.g., a branched-chain or aromatic amino acid.
  • the amino acid is valine, leucine, and/or isoleucine.
  • the amino acid is tryptophan and/or tyrosine. In some aspects, the amino acid is tryptophan. In some aspects, the amino acid is tyrosine.
  • the targeting moiety is a LAT1 ligand selected from tryptophan, tyrosine, phenylalanine, tryptophan, methionine, thyroxine, melphalan, L-DOPA, gabapentin, 3,5-I-diiodotyrosine, 3-iodo-I-tyrosine, fenclonine, acivicin, leucine, BCH, methionine, histidine, valine, or any combination thereof.
  • compositions comprising an miRNA inhibitor (e.g., miR-485-3p inhibitor) that are suitable for administration to a subject.
  • the pharmaceutical compositions generally comprise an miRNA inhibitor described herein and a pharmaceutically-acceptable excipient or carrier in a form suitable for administration to a subject.
  • Pharmaceutically acceptable excipients or carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition.
  • suitable formulations of pharmaceutical compositions comprising an miRNA inhibitor (e.g., miR-485-3p inhibitor) of the present disclosure See, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa.
  • the pharmaceutical compositions are generally formulated sterile and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration.
  • GMP Good Manufacturing Practice
  • the following examples are offered by way of illustration and not by way of limitation. Examples Example 1: Materials and Methods [0347] The Examples described below use one or more of the following materials and methods. Synthesis of Cy5.5-Labeled miRNA Mimic [0348] All oligonucleotides were automatically synthesized by oligo synthesizer (AKTA oligopilot10, GE Healthcare). Briefly, ribo U-300 (66.89 mg, 20 ⁇ mol) as a primer support was filled into the column and the sequence information was entered into the AKTA software.
  • the dried power was dissolved into the NMP, and triethylamine and triethylamine tri-hydro fluoride were sequentially added into the solution.
  • the mixture solution was maintained with stirring for 2 hrs at 65°C.
  • 25 mL of isopropyl alcohol and 1.5 mL of sodium acetate were sequentially added into the solution and stored at - 20°C for 12 hours for precipitation.
  • the precipitate was separated by centrifuge (13,000 rpm, 30 min) and dried in vacuo.
  • Synthesized oligonucleotide was purified using Fast Protein Liquid Chromatography (FPLC) (AKTA Pure, GE Healthcare) attached with Hiscreen Capto Q column (GE Healthcare).
  • FPLC Fast Protein Liquid Chromatography
  • BBQ-650 labeled anti-miRNA oligonucleotide (“BBQ-ASO") was synthesized using the same procedure as that used to produce the Cy5.5-labeled miRNA mimic described above, except relating to the incorporation of the labeling site of the dye or quencher into the oligonucleotide.
  • BBQ-650 labeled CpG was used from the starting point instead of using dye labeled amidite because of the difference of the labeling site (5 ⁇ to 3 ⁇ ).
  • BBQ-650 labeled CpG was filled into the column and the anti-sense sequence of cy5.5 label oligonucleotide was entered into the AKTA software.
  • the separation of CPG, deprotection and purification steps were conducted with the same procedure of Cy5.5 labeled sense oligonucleotide.
  • Example 2 Analysis of the Quenching Effects of Anti-miRNA Oligonucleotides [0350] To being assessing the capability of the diagnostic systems described herein, the quenching effect of anti-miRNA oligonucleotides conjugated to BBQ-650 (“BBQ-ASO”) was assessed.
  • annealing buffer is a buffer required to form a duplex of anti-miRNA oligonucleotide and specific miRNA, anti-miRNA oligonucleotide-specific miRNA duplex miRNA and miRNA mimic, respectively.
  • Example 3 Analysis of the ability to Detect miRNA [0353] To assess whether the anti-miRNA oligonucleotides and miRNA mimics described herein are capable of detecting miRNA in a biological sample, the BBQ-ASO and miRNA mimic described in Example 2 were used to detect the presence of a sense oligonucleotide using methods described herein. Similar to when targeting a specific miRNA of interest, the sense oligonucleotide was designed to have the same sequence as the miRNA mimic. Accordingly, the BBQ-ASO was capable of specifically binding to the sense oligonucleotide when present.
  • the anti-miRNA oligonucleotides will be conjugated to a quencher (e.g., BBQ-650) and designed to be complementary (partially or fully) to the target miRNA, such that the anti-miRNA oligonucleotides can specifically bind to the target miRNA when present.
  • the miRNA mimic will be conjugated to a probe (e.g., Cy5.5) and designed to share high sequence identity with the target miRNA, such that the miRNA mimic can specifically bind to any unbound anti-miRNA oligonucleotides.
  • oligonucleotides i.e., anti-miRNA oligonucleotide and miRNA mimic
  • a biological sample obtained from a human subject as described herein (see, e.g., Example 3).
  • the biological sample will be obtained from a subject suffering from or suspected of suffering from a disease or disorder, wherein the disease or disorder is associated with abnormal level of the target miRNA.
  • the biological sample will be obtained from a healthy subject (i.e., not suffering from the disease or disorder).
  • the detectable signal exhibited by the probe e.g., fluorescence

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Pathology (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

La présente invention concerne des oligonucléotides conjugués à une sonde ou à un extincteur, et l'utilisation de tels oligonucléotides pour mesurer le taux d'un miARN présent chez un sujet. Dans certains aspects, le miARN est associé à une maladie ou à un trouble. L'invention concerne également des procédés de traitement d'un sujet identifié comme ayant un niveau anormal d'un miARN.
PCT/IB2022/061047 2021-11-17 2022-11-17 Procédés sans amplification pour la mesure de miarn WO2023089506A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163280528P 2021-11-17 2021-11-17
US63/280,528 2021-11-17

Publications (1)

Publication Number Publication Date
WO2023089506A1 true WO2023089506A1 (fr) 2023-05-25

Family

ID=86396372

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2022/061047 WO2023089506A1 (fr) 2021-11-17 2022-11-17 Procédés sans amplification pour la mesure de miarn

Country Status (1)

Country Link
WO (1) WO2023089506A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014124046A1 (fr) * 2013-02-08 2014-08-14 Bio-Rad Laboratories, Inc. Dosage par division et basé sur l'affinité permettant la détection de molécules cibles
WO2017057823A1 (fr) * 2015-10-02 2017-04-06 주식회사 레모넥스 Extincteur contenant un nanomatériau conjugué à un polymère soluble dans l'eau et son utilisation
US20210123051A1 (en) * 2019-06-17 2021-04-29 Biorchestra Co., Ltd. Uses for prevention or treatment of brain diseases using microrna

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014124046A1 (fr) * 2013-02-08 2014-08-14 Bio-Rad Laboratories, Inc. Dosage par division et basé sur l'affinité permettant la détection de molécules cibles
WO2017057823A1 (fr) * 2015-10-02 2017-04-06 주식회사 레모넥스 Extincteur contenant un nanomatériau conjugué à un polymère soluble dans l'eau et son utilisation
US20210123051A1 (en) * 2019-06-17 2021-04-29 Biorchestra Co., Ltd. Uses for prevention or treatment of brain diseases using microrna

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ALASTAIR W. WARK, HYE JIN LEE, ROBERT M. CORN: "Multiplexed Detection Methods for Profiling MicroRNA Expression in Biological Samples", ANGEWANDTE CHEMIE INTERNATIONAL EDITION, vol. 47, no. 4, 11 January 2008 (2008-01-11), pages 644 - 652, XP055072684, ISSN: 14337851, DOI: 10.1002/anie.200702450 *
YU LING, LI HAITING, LIU WENHU, ZHANG LIGONG, TIAN QUN, LI HAIRONG, LI MIN: "Retracted: MiR‐485‐3p serves as a biomarker and therapeutic target of Alzheimer's disease via regulating neuronal cell viability and neuroinflammation by targeting AKT3", MOLECULAR GENETICS & GENOMIC MEDICINE, vol. 9, no. 1, 1 January 2021 (2021-01-01), pages e1548, XP093063010, ISSN: 2324-9269, DOI: 10.1002/mgg3.1548 *

Similar Documents

Publication Publication Date Title
Nizzardo et al. Effect of combined systemic and local morpholino treatment on the spinal muscular atrophy Δ7 mouse model phenotype
US20230304014A1 (en) Mirna-485 inhibitor for huntington's disease
WO2023089506A1 (fr) Procédés sans amplification pour la mesure de miarn
US20230099372A1 (en) Use of mirna-485 inhibitors for treating tauopathy
US20240117350A1 (en) Use of mirna-485 inhibitor to regulate psd95, synaptophysin, and caspase-3 expression
WO2023079499A1 (fr) Utilisation d'inhibiteurs de mir-485 pour traiter des maladies ou des pathologies associées au vieillissement
US20230119699A1 (en) Diagnostic methods using sirt1 expression
US20230131083A1 (en) Use of mirna-485 inhibitors for treating amyotrophic lateral sclerosis (als)
US20230121720A1 (en) Diagnostic methods using pcg-1a expression
US20230167502A1 (en) Diagnostic methods using mir-485-3p expression
WO2022168007A1 (fr) Utilisation d'inhibiteurs de miarn-485 pour traiter des maladies ou des troubles associés à une expression de nlrp3 anormale
WO2022003609A1 (fr) Procédés de diagnostic snp
WO2022264038A1 (fr) Utilisation d'inhibiteurs de miarn-485 pour le traitement de maladies ou de troubles liés aux inflammasomes
WO2021156831A1 (fr) Inhibiteur de miarn-485 pour régulation à la hausse de gènes
CN116963785A (zh) miRNA-485抑制剂用于治疗与异常NLRP3表达相关的疾病或病症的用途

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22895074

Country of ref document: EP

Kind code of ref document: A1