WO2023079499A1 - Utilisation d'inhibiteurs de mir-485 pour traiter des maladies ou des pathologies associées au vieillissement - Google Patents

Utilisation d'inhibiteurs de mir-485 pour traiter des maladies ou des pathologies associées au vieillissement Download PDF

Info

Publication number
WO2023079499A1
WO2023079499A1 PCT/IB2022/060622 IB2022060622W WO2023079499A1 WO 2023079499 A1 WO2023079499 A1 WO 2023079499A1 IB 2022060622 W IB2022060622 W IB 2022060622W WO 2023079499 A1 WO2023079499 A1 WO 2023079499A1
Authority
WO
WIPO (PCT)
Prior art keywords
fold
aspects
seq
mir
nucleotides
Prior art date
Application number
PCT/IB2022/060622
Other languages
English (en)
Inventor
Jin-Hyeob RYU
Dae Hoon Kim
Han Seok Koh
Young Jin Park
Hyun Su Min
Yu Na Lim
Original Assignee
Biorchestra Co., Ltd.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Biorchestra Co., Ltd. filed Critical Biorchestra Co., Ltd.
Publication of WO2023079499A1 publication Critical patent/WO2023079499A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2330/00—Production
    • C12N2330/50—Biochemical production, i.e. in a transformed host cell
    • C12N2330/51—Specially adapted vectors

Definitions

  • a miR-485 inhibitor e.g., polynucleotide encoding a nucleotide molecule comprising at least one miR-485 binding site
  • a disease or condition associated with abnormal shortening of telomeres such as the age- associated diseases or conditions described herein (e.g., neurodegenerative disease, e.g., Alzheimer's disease).
  • BACKGROUND OF THE DISCLOSURE [0004] Improvements in health care and social circumstances have resulted in people living longer. It is estimated that by 2050 the population of older individuals (i.e., 65 years and older) worldwide will triple to nearly 1.5 billion.
  • AD Alzheimer's disease
  • telomere a method of extending the length of a telomere in a cell of a subject in need thereof comprising contacting the cell with a compound that inhibits miR-485 activity ("miRNA inhibitor").
  • miRNA inhibitor a compound that inhibits miR-485 activity
  • the contacting occurs in vivo in the subject.
  • the miRNA inhibitor is administered to the subject prior to the contacting.
  • the contacting occurs in vitro.
  • the subject has a disease or condition associated with a reduced length of a telomere.
  • the length of the telomere is extended by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8- fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more after the contacting.
  • the increase in the length of the telomere improves and/or ameliorates one or more symptoms of a disease or condition associated with a reduced length of a telomere.
  • a method of protecting against a reduction in the length of a telomere in a cell of a subject in need thereof comprising contacting the cell with a compound that inhibits miR-485 activity ("miRNA inhibitor").
  • miRNA inhibitor a compound that inhibits miR-485 activity
  • the contacting occurs in vivo in the subject.
  • the miRNA inhibitor is administered to the subject prior to the contacting.
  • the contacting occurs in vitro.
  • the subject has or is susceptible to a disease or condition associated with a reduced length of a telomere.
  • the length of the telomere is not reduced by more than about 1%, not reduced by more than about 2%, not reduced by more than about 3%, not reduced by more than about 4%, not reduced by more than about 5%, not reduced by more than about 6%, not reduced by more than about 7%, not reduced by more than about 8%, not reduced by more than about 9%, not reduced by more than about 10%, not reduced by more than about 15%, or not reduced by more than about 20% compared to a reference (e.g., length of a telomere in a corresponding cell in a subject who does not suffer from a disease or condition associated with reduced telomere length).
  • a reference e.g., length of a telomere in a corresponding cell in a subject who does not suffer from a disease or condition associated with reduced telomere length.
  • Present disclosure additionally provides a method of increasing an activity of a protein comprising a LIM domain ("LIM-domain protein) in a cell of a subject in need thereof, comprising contacting the cell with a compound that inhibits miR-485 activity ("miRNA inhibitor").
  • the contacting occurs in vivo in the subject.
  • the miRNA inhibitor is administered to the subject prior to the contacting.
  • the contacting occurs in vitro.
  • the subject has or is susceptible to a disease or condition associated with a reduced length of a telomere.
  • the length of the telomere is not reduced by more than about 1%, not reduced by more than about 2%, not reduced by more than about 3%, not reduced by more than about 4%, not reduced by more than about 5%, not reduced by more than about 6%, not reduced by more than about 7%, not reduced by more than about 8%, not reduced by more than about 9%, not reduced by more than about 10%, not reduced by more than about 15%, or not reduced by more than about 20% compared to a reference (e.g., length of a telomere in a corresponding cell in a subject who does not suffer from a disease or condition associated with reduced telomere length).
  • a reference e.g., length of a telomere in a corresponding cell in a subject who does not suffer from a disease or condition associated with reduced telomere length.
  • a method of increasing an activity of a protein comprising a LIM domain ("LIM-domain protein) in a cell of a subject in need thereof comprising contacting the cell with a compound that inhibits miR-485 activity ("miRNA inhibitor").
  • miRNA inhibitor a compound that inhibits miR-485 activity
  • the contacting occurs in vivo in the subject.
  • the miRNA inhibitor is administered to the subject prior to the contacting.
  • the contacting occurs in vitro.
  • the subject has a disease or condition associated with a reduced activity of a LIM-domain protein.
  • the activity of the LIM-domain protein in the cell is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8- fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more after the contacting.
  • the LIM-domain protein comprises a TRIP6 protein, LPP protein, or both.
  • the increased activity of the LIM-domain protein comprises an (i) increased level of the TRIP6 protein, or level of a gene encoding thereof, in the cell; (ii) an increased level of the LPP protein, or level of a gene encoding thereof, in the cell; or (iii) both.
  • the increased activity of the LIM-domain protein results in greater interaction of the LIM-domain protein to a telomere of the cell.
  • the greater interaction of the LIM-domain protein to the telomere of the cell results in a reduced loss in the length of the telomere.
  • the increased activity of the LIM-domain protein in the cell improves and/or ameliorates one or more symptoms of the disease or condition associated with a reduced activity of a LIM-domain protein.
  • a method of regulating an expression of a gene and/or protein associated with aging in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 activity ("miRNA inhibitor").
  • miRNA inhibitor a compound that inhibits miR-485 activity
  • the gene and/or protein associated with aging is selected from c-Fos, SIRT1, CTBP1, TRIP6, CD36, PGC-1 ⁇ , or combinations thereof.
  • regulating the expression of a gene and/or protein associated with aging comprises reducing the expression of c-Fos in the subject.
  • the expression of c-Fos is reduced in the subject by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100%, as compared to a reference c-Fos expression (e.g., c- Fos expression in the subject prior to the administration and/or the c-Fos expression in a corresponding subject that did not receive the administration).
  • a reference c-Fos expression e.g., c- Fos expression in the subject prior to the administration and/or the c-Fos expression in a corresponding subject that did not receive the administration.
  • regulating the expression of a gene and/or protein associated with aging comprises increasing the expression of SIRT1 in the subject.
  • the expression of SIRT1 is increased in the subject by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9- fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, or at least about 50-fold, as compared to a reference SIRT1 expression (e.g., SIRT1 expression in the subject prior to the administration and/or the SIRT1 expression in a corresponding subject that did not receive the administration).
  • a reference SIRT1 expression e.g., SIRT1 expression in the subject prior to the administration and/or the SIRT1 expression in a corresponding subject that did not receive the administration.
  • regulating the expression of the gene and/or protein associated with aging is capable of: (i) extending the length of a telomere in a cell of the subject, (ii) protects against a reduction in the length of a telomere in a cell of the subject, (iii) increasing an activity of a protein comprising a LIM domain in a cell of the subject, (iv) improves one or more symptoms of a disease or condition associated with aging, or (v) any combination of (i) to (iv).
  • RNA inhibitor a compound that inhibits miR-485 activity
  • the disease or condition associated with aging is further associated with (i) a reduced activity of a LIM-domain protein in a cell of the subject, (ii) a reduced telomere length of a cell in the subject, or (iii) both.
  • the activity of the LIM- domain protein in the cell is increased after the administration of the miRNA inhibitor.
  • the activity of the LIM-domain protein in the cell is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10- fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more after the administration.
  • the increased activity of the LIM-domain protein improves one or more symptoms of a disease or condition associated with aging.
  • telomere length of the cell is increased after the administration of the miRNA inhibitor. In some aspects, the telomere length of the cell is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5- fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more in the subject after the administration.
  • telomere length of the cell improves one or more symptoms of a disease or condition associated with aging.
  • a cell that can be used with the methods disclosed herein comprises a neural stem cell, hematopoietic stem cell, mesenchymal stem cell, epithelial stem cell, skin stem cell, neuron, glial cell, or any combination thereof.
  • the neural stem cell is an adult neural stem cell.
  • the administration of the miRNA inhibitor has one or more of the following effects on the neural stem cell: reduces telomere shortening, increases proliferation, increases cell growth, promotes cell differentiation, increases survival, or any combination thereof.
  • the proliferation, cell growth, differentiation, and/or survival of the neural stem cell is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9- fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more after the administration.
  • the neuron comprises a motor neuron, sensory neuron, interneuron, or any combination thereof.
  • the administration of the miRNA inhibitor has one or more of the following effects on the neuron: promotes protein homeostasis (e.g., proteinopathy controlled by autophagy and ubiquitin proteasome system), reduces apoptosis, promotes synaptogenesis, or any combination thereof.
  • the glial cell comprises an astrocyte, oligodendrocyte, microglial cell, or any combination thereof.
  • the administration of the miRNA inhibitor has one or more of the following effects on the glial cell: increases phagocytic activity, increases autophagy, reduces neuroinflammation, or any combination thereof.
  • the administration of the miRNA inhibitor promotes neurogenesis in the subject.
  • promoting neurogenesis comprises an increased axon, dendrite, and/or synapse development.
  • the disease or condition as recited in any of the above methods comprises Alzheimer's disease, Amyotrophic lateral sclerosis (ALS), Spinal muscular atrophy (SMA), Dementia with Lewy bodies (DLB), CAA cerebral amyloid angiopathy (CAA), CDB corticobasal degeneration (CDB), Frontotemporal lobar degeneration due to FUS pathology (FTLD-fus), Frontotemporal lobar degeneration due to tau pathology (FTLD-tau) , Frontotemporal lobar degeneration due to TDP 43 (FTLD-tdp), Multiple system atrophy (MSA), Progressive supranuclear palsy (PSP), Parkinson’s disease, Frontotemporal dementia, Huntington’s disease, or any combination thereof.
  • ALS Amyotrophic lateral sclerosis
  • SMA Spinal muscular atrophy
  • DLB Dementia with Lewy bodies
  • a miRNA inhibitor that is useful for the methods disclosed herein inhibits miR485-3p.
  • the miR485-3p comprises 5'-gucauacacggcucuccucucu- 3' (SEQ ID NO: 1).
  • the miRNA inhibitor comprises a nucleotide sequence comprising 5'- UGUAUGA-3' (SEQ ID NO: 2) and wherein the miRNA inhibitor comprises about 6 to about 30 nucleotides in length.
  • the miRNA inhibitor comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 5' of the nucleotide sequence.
  • the miRNA inhibitor comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 3' of the nucleotide sequence.
  • the miRNA inhibitor has a sequence selected from the group consisting of: [0028] In some aspects, the miRNA inhibitor has a sequence selected from the group consisting of ( Q ) [0029] In some aspects, the sequence of the miRNA inhibitor is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% sequence identity to 5'- or . In some aspects, the miRNA inhibitor has a sequence that has at least 90% similarity to 5'- . In some aspects, the miRNA inhibitor comprises the nucleotide sequence with one substitution or two substitutions.
  • the miRNA inhibitor comprises the nucleotide sequence ( Q ) . In some aspects, the miR-485 inhibitor comprises the nucleotide sequence ). [0030] In some aspects, the miRNA inhibitor comprises at least one modified nucleotide. In some aspects, the at least one modified nucleotide is a locked nucleic acid (LNA), an unlocked nucleic acid (UNA), an arabino nucleic acid (ABA), a bridged nucleic acid (BNA), and/or a peptide nucleic acid (PNA). In some aspects, the miRNA inhibitor comprises a backbone modification.
  • LNA locked nucleic acid
  • UPA unlocked nucleic acid
  • ABA arabino nucleic acid
  • BNA bridged nucleic acid
  • PNA peptide nucleic acid
  • the miRNA inhibitor comprises a backbone modification.
  • the backbone modification is a phosphorodiamidate morpholino oligomer (PMO) and/or phosphorothioate (PS) modification.
  • the miRNA inhibitor is delivered in a delivery agent.
  • the delivery agent comprises a micelle, an exosome, a lipidoid, a liposome, a lipoplex, a lipid nanoparticle, an extracellular vesicle, a synthetic vesicle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, a conjugate, a viral vector, or combinations thereof.
  • the miRNA inhibitor is delivered by a viral vector.
  • the viral vector is an AAV, an adenovirus, a retrovirus, or a lentivirus.
  • the viral vector is an AAV that has a serotype of AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or any combination thereof.
  • the delivery agent comprises a cationic carrier unit comprising [WP]-L1-[CC]-L2-[AM] (formula I) or [WP]-L1-[AM]-L2-[CC] (formula II) wherein WP is a water-soluble polymer moiety; CC is a cationic carrier moiety; AM is an adjuvant moiety; and, L1 and L2 are independently optional linkers.
  • the delivery agent comprises a cationic carrier unit comprising [CC]-L1-[CM]-L2-[AM] (Schema I); [CC]-L1-[AM]-L2-[CM] (Schema II); [AM]-L1-[CM]-L2-[CC] (Schema III); [AM]-L1-[CC]-L2-[CM] (Schema IV); [CM]-L1-[CC]-L2-[AM] (Schema V); or [CM]-L1-[AM]-L2-[CC] (Schema VI); wherein CC is a cationic carrier moiety; CM is a crosslinking moiety; AM is an adjuvant moiety; and, L1 and L2 are independently optional linkers.
  • the above-described cationic carrier unit further comprises a water-soluble polymer moiety (WP).
  • WP water-soluble polymer moiety
  • the cationic carrier unit comprises: [WP]-L3-[CC]-L1-[CM]-L2-[AM] (Schema I’); [WP]-L3-[CC]-L1-[AM]-L2-[CM] (Schema II’); [WP]-L3-[AM]-L1-[CM]-L2-[CC] (Schema III’); [WP]-L3-[AM]-L1-[CC]-L2-[CM] (Schema IV’); [WP]-L3-[CM]-L1-[CC]-L2-[AM] (Schema V’); or [WP]-L3-[CM]-L1-[AM]-L2-[CC] (Schema VI’), wherein L3 is an optional linker.
  • the cationic carrier unit and the miRNA inhibitor are capable of associating with each other to form a micelle when mixed together.
  • the association is via a covalent bond.
  • the association is via a non-covalent bond.
  • the non-covalent bond comprises an ionic bond.
  • the water-soluble polymer comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly( ⁇ -hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines ("POZ") poly(N-acryloylmorpholine), or any combinations thereof.
  • the water- soluble polymer comprises polyethylene glycol (“PEG”), polyglycerol, or poly(propylene glycol) (“PPG").
  • the water-soluble polymer comprises: [0039] , (formula I), wherein, n is 1-1000.
  • the n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141.
  • the n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, or about 150 to about 160.
  • the water-soluble polymer is linear, branched, or dendritic.
  • the cationic carrier moiety comprises one or more basic amino acids.
  • the cationic carrier moiety comprises at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at last about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, at least about 50, at least about 51, at least about 52, at least about 53, at least about 54, at least about
  • the cationic carrier moiety comprises about 30 to about 50 basic amino acids.
  • the basic amino acid comprises arginine, lysine, histidine, or any combination thereof.
  • the cationic carrier moiety comprises about 40 lysine monomers.
  • the adjuvant moiety is capable of modulating an immune response, an inflammatory response, and/or a tissue.
  • the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof.
  • the adjuvant moiety comprises: [0046] , (formula II), [0047] wherein each of G1 and G2 is H, an aromatic ring, or 1-10 alkyl, or G1 and G2 together form an aromatic ring, and wherein n is 1-10.
  • the adjuvant moiety comprises nitroimidazole.
  • the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof.
  • the adjuvant moiety comprises an amino acid.
  • the adjuvant moiety comprises [0051] (formula III), [0052] wherein Ar is or , and [0053] wherein each of Z1 and Z2 is H or OH.
  • the adjuvant moiety comprises a vitamin.
  • the vitamin comprises a cyclic ring or cyclic hetero atom ring and a carboxyl group or hydroxyl group.
  • the vitamin comprises: [0056] (formula IV), [0057] wherein each of Y1 and Y2 is C, N, O, or S, and wherein n is 1 or 2.
  • the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof.
  • the vitamin can be vitamin B3.
  • the adjuvant moiety comprises at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, or at least about 50 vitamin B3.
  • the adjuvant moiety comprises about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 vitamin B3.
  • the delivery agent comprises a water-soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3.
  • the delivery agent is associated with the miRNA inhibitor, thereby forming a micelle.
  • the association can be a covalent bond, a non-covalent bond, or an ionic bond.
  • a delivery agent used to deliver a miRNA inhibitor described herein is a micelle.
  • the micelle comprises (i) about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines, each with an amine group, (iii) about 15 to about 20 lysines, each with a thiol group, and (iv) about 30 to about 40 lysines, each linked to vitamin B3.
  • the micelle comprises (i) about 120 to about 130 PEG units, (ii) about 32 lysines, each with an amine group, (iii) about 16 lysines, each with a thiol group, and (iv) about 32 lysines, each linked to vitamin B3.
  • the micelle comprises (i) about 100 to about 200 PEG units, (ii) about 30 to about 100 lysines, each with an amine group, (iii) about 3 to about 50 lysines, each with a thiol group, and (iv) about 2 to about 20 lysines, each linked to vitamin B3.
  • the micelle comprises (i) about 110 to about 130 PEG units, (ii) about 40 lysines, each with an amine group, (iii) about 35 lysines, each with a thio group, and (iv) about 5 lysines, each linked to vitamin B3.
  • the cationic carrier unit further comprises a targeting moiety.
  • the targeting moiety is linked to the water-soluble polymer moiety.
  • the targeting moiety is linked to the PEG units.
  • the targeting moiety comprises a LAT1 targeting ligand.
  • the targeting moiety comprises phenylalanine.
  • FIGs.1A and 1B show the effect of miR-485 inhibitor on increasing the expression of SIRT1 in primary cortical neurons isolated from mice. After treatment with miR-485 inhibitors (300 nM) for 48 hours, primary cortical neurons were analyzed for SIRT1 protein expression using Western Blot analysis. Non-treated primary cortical neurons were used as control.
  • FIG.1A provides a representative Western blot showing SIRT1 protein expression in the control (left) and treated (right) primary cortical neurons. ⁇ -Actin was used as an internal control.
  • FIG.1B provides a quantitative comparison of the results provided in FIG.1A. [0066] FIGs.
  • FIG.2A shows the c-Fos mRNA level in N2a cells after treatment with miR-485 inhibitors. GAPDH expression was used as an internal control.
  • FIG. 2B shows the c-Fos protein level in N2a cells after treatment with miR-485 inhibitors.
  • FIG.3A and 3B show the effect of miR-485 inhibitor on decreasing the expression of c-Fos protein in primary cortical neurons isolated from mice. After treatment with miR-485 inhibitors for 48 hours (100 nM or 300 nM), primary cortical neurons were collected, and c- Fos protein expression was assessed using Western Blot analysis. Non-treated primary cortical neurons were used as control.
  • FIG.3A provides a representative Western blot showing c-Fos protein expression. ⁇ -Actin expression was used as an internal control.
  • FIG. 3B provides a quantitative comparison of the results provided in FIG.3A.
  • a miR-485 inhibitor described herein is capable of extending the length of a telomere in a cell of the subject.
  • a miR-485 inhibitor can protect against a reduction in the length of a telomere in a cell of the subject.
  • the miR-485 inhibitors provided herein are capable of regulating the expression of one or more genes associated with aging. Non-limited examples of such genes are provided elsewhere in the present disclosure.
  • ranges recited are understood to be shorthand for all of the values within the range, inclusive of the recited endpoints.
  • a range of 1 to 10 is understood to include any number, combination of numbers, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10.
  • nucleotide sequences are written left to right in 5' to 3' orientation. Nucleotides are referred to herein by their commonly known one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Accordingly, 'a' represents adenine, 'c' represents cytosine, 'g' represents guanine, 't' represents thymine, and 'u' represents uracil. [0079] Amino acid sequences are written left to right in amino to carboxy orientation. Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
  • AAV adeno-associated virus
  • AAV includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAVrh.74, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, those AAV serotypes and clades disclosed by Gao et al. (J. Virol.78:6381 (2004)) and Moris et al.
  • an "AAV” includes a derivative of a known AAV.
  • an “AAV” includes a modified or an artificial AAV.
  • the terms "administration,” “administering,” and grammatical variants thereof refer to introducing a composition, such as a miRNA inhibitor of the present disclosure, into a subject via a pharmaceutically acceptable route.
  • a composition such as a micelle comprising a miRNA inhibitor of the present disclosure
  • introduction of a composition is by any suitable route, including intratumorally, orally, pulmonarily, intranasally, parenterally (intravenously, intra-arterially, intramuscularly, intraperitoneally, or subcutaneously), rectally, intralymphatically, intrathecally, periocularly or topically.
  • Administration includes self-administration and the administration by another.
  • a suitable route of administration allows the composition or the agent to perform its intended function. For example, if a suitable route is intravenous, the composition is administered by introducing the composition or agent into a vein of the subject.
  • aging-associated diseases or conditions and “aging- related diseases or conditions” are used interchangeably and refer to diseases or conditions that arise from complications associated with senescence.
  • Spenescence refers to the gradual deterioration of cellular function, e.g., due to aging.
  • Age-associated diseases are to be distinguished from the aging process itself because all adult animals age, save for a few rare exceptions, but not all adult animals necessarily experience aging-associated diseases or conditions.
  • Non-limiting examples of aging-associated diseases or conditions include: atherosclerosis and cardiovascular disease, cancer, arthritis, cataracts, osteoporosis, type 2 diabetes, hypertension and Alzheimer's disease. The incidence of all of these diseases increases exponentially with age.
  • an aging-associated disease or condition disclosed herein is associated with a reduction in telomere length.
  • the term “approximately” refers to a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).
  • the term “associated with” refers to a close relationship between two or more entities or properties.
  • the term "associated with” refers to an increased likelihood that a subject suffers from the disease or condition when the subject exhibits an abnormal expression of the protein and/or gene.
  • the abnormal expression of the protein and/or gene causes the disease or condition.
  • the abnormal expression does not necessarily cause but is correlated with the disease or condition.
  • suitable methods that can be used to determine whether a subject exhibits an abnormal expression of a protein and/or gene associated with a disease or condition are provided elsewhere in the present disclosure.
  • abnormal level refers to a level (expression and/or activity) that differs (e.g., decreased or increased) from a reference subject who does not suffer from a disease or condition described herein (e.g., age-associated disease or condition described herein).
  • an abnormal level refers to a level that is decreased by at least about 0.1-fold, at least about 0.2-fold, at least about 0.3-fold, at least about 0.4-fold, at least about 0.5-fold, at least about 0.6-fold, at least about 0.7-fold, at least about 0.8-fold, at least about 0.9-fold, at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 750-fold, or at least about 1,000-fold or more compared to the corresponding level in a reference subject (e.g., subject who does not suffer from a disease or condition described herein).
  • a reference subject e.g., subject who
  • an abnormal level refers to a level that is increased by at least about 0.1-fold, at least about 0.2-fold, at least about 0.3- fold, at least about 0.4-fold, at least about 0.5-fold, at least about 0.6-fold, at least about 0.7- fold, at least about 0.8-fold, at least about 0.9-fold, at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, at least about 750-fold, or at least about 1,000-fold or more compared to the corresponding level in a reference subject (e.g., subject who does not suffer from a disease or condition described here
  • a reference subject e.g., subject who does not
  • Nucleotides or amino acids that are relatively conserved are those that are conserved amongst more related sequences than nucleotides or amino acids appearing elsewhere in the sequences.
  • two or more sequences are said to be “completely conserved” or “identical” if they are 100% identical to one another.
  • two or more sequences are said to be "highly conserved” if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some aspects, two or more sequences are said to be “highly conserved” if they are about 70% identical, about 80% identical, about 90% identical, about 95%, about 98%, or about 99% identical to one another. In some aspects, two or more sequences are said to be "conserved” if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another.
  • two or more sequences are said to be "conserved” if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another.
  • Conservation of sequence can apply to the entire length of a polynucleotide or polypeptide or can apply to a portion, region or feature thereof.
  • the term "derived from,” as used herein, refers to a component that is isolated from or made using a specified molecule or organism, or information (e.g., amino acid or nucleic acid sequence) from the specified molecule or organism.
  • a nucleic acid sequence that is derived from a second nucleic acid sequence can include a nucleotide sequence that is identical or substantially similar to the nucleotide sequence of the second nucleic acid sequence.
  • the derived species can be obtained by, for example, naturally occurring mutagenesis, artificial directed mutagenesis or artificial random mutagenesis.
  • the mutagenesis used to derive nucleotides or polypeptides can be intentionally directed or intentionally random, or a mixture of each.
  • the mutagenesis of a nucleotide or polypeptide to create a different nucleotide or polypeptide derived from the first can be a random event (e.g., caused by polymerase infidelity) and the identification of the derived nucleotide or polypeptide can be made by appropriate screening methods, e.g., as discussed herein.
  • a nucleotide or amino acid sequence that is derived from a second nucleotide or amino acid sequence has a sequence identity of at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 8
  • a "coding region” or “coding sequence” is a portion of polynucleotide which consists of codons translatable into amino acids.
  • a “stop codon” (TAG, TGA, or TAA) is typically not translated into an amino acid, it can be considered to be part of a coding region, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, and the like, are not part of a coding region.
  • a coding region typically determined by a start codon at the 5' terminus, encoding the amino terminus of the resultant polypeptide, and a translation stop codon at the 3' terminus, encoding the carboxyl terminus of the resulting polypeptide.
  • the terms "complementary” and “complementarity” refer to two or more oligomers (i.e., each comprising a nucleobase sequence), or between an oligomer and a target gene, that are related with one another by Watson-Crick base-pairing rules.
  • nucleobase sequence "T-G-A (5' ⁇ 3'),” is complementary to the nucleobase sequence "A-C-T (3' ⁇ 5').”
  • Complementarity can be “partial,” in which less than all of the nucleobases of a given nucleobase sequence are matched to the other nucleobase sequence according to base pairing rules.
  • complementarity between a given nucleobase sequence and the other nucleobase sequence can be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%.
  • the term "complementary” refers to at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% match or complementarity to a target nucleic acid sequence (e.g., miR-485 nucleic acid sequence). Or, there can be “complete” or “perfect” (100%) complementarity between a given nucleobase sequence and the other nucleobase sequence to continue the example. In some aspects, the degree of complementarity between nucleobase sequences has significant effects on the efficiency and strength of hybridization between the sequences.
  • downstream refers to a nucleotide sequence that is located 3' to a reference nucleotide sequence.
  • downstream nucleotide sequences relate to sequences that follow the starting point of transcription.
  • the translation initiation codon of a gene is located downstream of the start site of transcription.
  • carrier refers to an inert substance added to a pharmaceutical composition to further facilitate administration of a compound, e.g., a miRNA inhibitor of the present disclosure.
  • RNA or a polypeptide refers to a process by which a polynucleotide produces a gene product, e.g., RNA or a polypeptide. It includes without limitation transcription of the polynucleotide into micro RNA binding site, small hairpin RNA (shRNA), small interfering RNA (siRNA), or any other RNA product. It includes, without limitation, transcription of the polynucleotide into messenger RNA (mRNA), and the translation of mRNA into a polypeptide. Expression produces a "gene product.”
  • a gene product can be, e.g., a nucleic acid, such as an RNA produced by transcription of a gene.
  • a gene product can be either a nucleic acid, RNA or miRNA produced by the transcription of a gene, or a polypeptide which is translated from a transcript.
  • Gene products described herein further include nucleic acids with post transcriptional modifications, e.g., polyadenylation or splicing, or polypeptides with post translational modifications, e.g., phosphorylation, methylation, glycosylation, the addition of lipids, association with other protein subunits, or proteolytic cleavage.
  • the term “homology” refers to the overall relatedness between polymeric molecules, e.g. between nucleic acid molecules. Generally, the term “homology” implies an evolutionary relationship between two molecules.
  • polymeric molecules are considered to be "homologous" to one another if at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of the monomers in the molecule are identical (exactly the same monomer) or are similar (conservative substitutions).
  • homologous necessarily refers to a comparison between at least two sequences (e.g., polynucleotide sequences).
  • substitutions are conducted at the nucleic acid level, i.e., substituting an amino acid residue with an alternative amino acid residue is conducted by substituting the codon encoding the first amino acid with a codon encoding the second amino acid.
  • identity refers to the overall monomer conservation between polymeric molecules, e.g., between polynucleotide molecules.
  • polynucleotide A is identical to polynucleotide B
  • polynucleotide sequences are 100% identical (100% sequence identity).
  • Describing two sequences as, e.g., "70% identical,” is equivalent to describing them as having, e.g., "70% sequence identity.”
  • Calculation of the percent identity of two polypeptide or polynucleotide sequences can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second polypeptide or polynucleotide sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes).
  • the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence.
  • the amino acids at corresponding amino acid positions, or bases in the case of polynucleotides are then compared. [0100] When a position in the first sequence is occupied by the same amino acid or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position.
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences.
  • Suitable software programs that can be used to align different sequences are available from various sources.
  • One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of program available from the U.S. government's National Center for Biotechnology Information BLAST web site (blast.ncbi.nlm.nih.gov).
  • Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm.
  • BLASTN is used to compare nucleic acid sequences
  • BLASTP is used to compare amino acid sequences.
  • 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer.
  • sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystallographic protein structures), functional data (e.g., location of mutations), or phylogenetic data.
  • a suitable program that integrates heterogeneous data to generate a multiple sequence alignment is T-Coffee, available at www.tcoffee.org, and alternatively available, e.g., from the EBI. It will also be appreciated that the final alignment used to calculate percent sequence identity can be curated either automatically or manually.
  • isolating or purifying as used herein is the process of removing, partially removing (e.g., a fraction) of a composition of the present disclosure, e.g., a miRNA inhibitor of the present disclosure from a sample containing contaminants.
  • an isolated composition has no detectable undesired activity or, alternatively, the level or amount of the undesired activity is at or below an acceptable level or amount. In some aspects, an isolated composition has an amount and/or concentration of desired composition of the present disclosure, at or above an acceptable amount and/or concentration and/or activity. In some aspects, the isolated composition is enriched as compared to the starting material from which the composition is obtained.
  • This enrichment can be by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.9%, at least about 99.99%, at least about 99.999%, at least about 99.9999%, or greater than 99.9999% as compared to the starting material.
  • isolated preparations are substantially free of residual biological products.
  • the isolated preparations are 100% free, at least about 99% free, at least about 98% free, at least about 97% free, at least about 96% free, at least about 95% free, at least about 94% free, at least about 93% free, at least about 92% free, at least about 91% free, or at least about 90% free of any contaminating biological matter.
  • Residual biological products can include abiotic materials (including chemicals) or unwanted nucleic acids, proteins, lipids, or metabolites.
  • the term "linked" as used herein refers to a first amino acid sequence or polynucleotide sequence covalently or non-covalently joined to a second amino acid sequence or polynucleotide sequence, respectively.
  • the first amino acid or polynucleotide sequence can be directly joined or juxtaposed to the second amino acid or polynucleotide sequence or alternatively an intervening sequence can covalently join the first sequence to the second sequence.
  • the term "linked" means not only a fusion of a first polynucleotide sequence to a second polynucleotide sequence at the 5'-end or the 3'-end, but also includes insertion of the whole first polynucleotide sequence (or the second polynucleotide sequence) into any two nucleotides in the second polynucleotide sequence (or the first polynucleotide sequence, respectively).
  • the first polynucleotide sequence can be linked to a second polynucleotide sequence by a phosphodiester bond or a linker.
  • the linker can be, e.g., a polynucleotide.
  • a "miRNA inhibitor,” as used herein, refers to a compound that can decrease, alter, and/or modulate miRNA expression, function, and/or activity.
  • the miRNA inhibitor can be a polynucleotide sequence that is at least partially complementary to the target miRNA nucleic acid sequence, such that the miRNA inhibitor hybridizes to the target miRNA sequence.
  • a miR-485 inhibitor of the present disclosure comprises a nucleotide sequence encoding a nucleotide molecule that is at least partially complementary to the target miR-485 nucleic acid sequence, such that the miR-485 inhibitor hybridizes to the miR-485 sequence.
  • the hybridization of the miR-485 to the miR-485 sequence decreases, alters, and/or modulates the expression, function, and/or activity of miR-485.
  • miRNA inhibitor can be used interchangeably.
  • miRNA refers to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation. The term will be used to refer to the single-stranded RNA molecule processed from a precursor. In some aspects, the term “antisense oligomers” can also be used to describe the microRNA molecules of the present disclosure. Names of miRNAs and their sequences related to the present disclosure are provided herein. MicroRNAs recognize and bind to target mRNAs through imperfect base pairing leading to destabilization or translational inhibition of the target mRNA and thereby downregulate target gene expression.
  • miRNA binding site a molecule comprising a sequence complementary to the seed region of the miRNA
  • targeting miRNAs via molecules comprising a miRNA binding site can reduce or inhibit the miRNA- induced translational inhibition leading to an upregulation of the target gene.
  • miRNA binding site generally a molecule comprising a sequence complementary to the seed region of the miRNA
  • mismatch or mismatches refer to one or more nucleobases (whether contiguous or separate) in an oligomer nucleobase sequence (e.g., miR-485 inhibitor) that are not matched to a target nucleic acid sequence (e.g., miR-485) according to base pairing rules.
  • one or more can occur with respect to the target nucleic acid sequence. Variations at any location within the oligomer are included.
  • antisense oligomers of the disclosure e.g., miR-485 inhibitor
  • antisense oligomers of the disclosure include variations in nucleobase sequence near the termini, variations in the interior, and if present are typically within about 6, 5, 4, 3, 2, or 1 subunits of the 5' and/or 3' terminus.
  • one, two, or three nucleobases can be removed and still provide on-target binding.
  • the terms “modulate,” “modify,” “regulate,” and grammatical variants thereof, generally refer when applied to a specific concentration, level, expression, function or behavior, to the ability to alter, by increasing or decreasing, e.g., directly or indirectly promoting/stimulating/up-regulating or interfering with/inhibiting/down-regulating the specific concentration, level, expression, function or behavior, such as, e.g., to act as an antagonist or agonist.
  • a modulator can increase and/or decrease a certain concentration, level, activity or function relative to a control, or relative to the average level of activity that would generally be expected or relative to a control level of activity.
  • a miRNA inhibitor disclosed herein can modulate (e.g., decrease, alter, or abolish) miR-485 expression, function, and/or activity, and thereby, modulate the expression and/or activity of one or more genes associated with the regulation of telomere length.
  • regulating the expression and/or activity of a gene results in the regulation of the expression and/or activity of the corresponding encoded protein. Therefore, unless indicated otherwise, regulating the expression and/or activity of a gene also comprises regulating the expression and/or activity of the encoded protein.
  • regulating the expression and/or activity of a protein can also comprise regulating the expression and/or activity of the corresponding gene that encodes the protein. Additionally, it will be apparent to those skilled in the art that regulating the expression of a gene (or a protein encoded thereof) can result in the regulation an activity associated with the gene (or a protein encoded thereof). Therefore, unless indicated otherwise, increasing the expression of a gene (or a protein encoded thereof) also comprises increasing the activity of the gene (or protein encoded thereof). Similarly, unless indicated otherwise, decreasing the expression of a gene (or a protein encoded thereof) also comprises decreasing the activity of the gene (or protein encoded thereof).
  • NSCs neural stem cells
  • Nucleic acid refers to self-renewing, multipotent cells that are capable of further differentiating into multiple cell types.
  • Nucleic acid refers to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules”) or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules”), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix.
  • Single stranded nucleic acid sequences refer to single-stranded DNA (ssDNA) or single- stranded RNA (ssRNA). Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible.
  • nucleic acid molecule and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA and chromosomes.
  • a "recombinant DNA molecule” is a DNA molecule that has undergone a molecular biological manipulation.
  • DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA.
  • a "nucleic acid composition" of the disclosure comprises one or more nucleic acids as described herein.
  • pharmaceutically acceptable carrier encompass any of the agents approved by a regulatory agency of the U.S. Federal government or listed in the U.S. Pharmacopeia for use in animals, including humans, as well as any carrier or diluent that does not cause the production of undesirable physiological effects to a degree that prohibits administration of the composition to a subject and does not abrogate the biological activity and properties of the administered compound. Included are excipients and carriers that are useful in preparing a pharmaceutical composition and are generally safe, non-toxic, and desirable.
  • the term "pharmaceutical composition” refers to one or more of the compounds described herein, such as, e.g., a miRNA inhibitor of the present disclosure, mixed or intermingled with, or suspended in one or more other chemical components, such as pharmaceutically acceptable carriers and excipients.
  • a pharmaceutical composition is to facilitate administration of preparations comprising a miRNA inhibitor of the present disclosure to a subject.
  • polynucleotide refers to polymers of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. In some aspects, the term refers to the primary structure of the molecule.
  • the term includes triple-, double- and single-stranded deoxyribonucleic acid ("DNA”), as well as triple- , double- and single-stranded ribonucleic acid (“RNA”). It also includes modified, for example by alkylation, and/or by capping, and unmodified forms of the polynucleotide.
  • polynucleotide includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, shRNA, siRNA, miRNA and mRNA, whether spliced or unspliced, any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing normucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids "PNAs”) and polymorpholino polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA.
  • PNAs peptide nucleic acids
  • a polynucleotide can be, e.g., an oligonucleotide, such as an antisense oligonucleotide.
  • the oligonucleotide is an RNA.
  • the RNA is a synthetic RNA.
  • the synthetic RNA comprises at least one unnatural nucleobase.
  • all nucleobases of a certain class have been replaced with unnatural nucleobases (e.g., all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g., 5-methoxyuridine).
  • polypeptide refers to polymers of amino acids of any length, e.g., that are encoded by a gene involved in the regulation of telomere length (e.g., CTBP1, TRIP6, SIRT1, FOS, CD36, or PGC-1 ⁇ ).
  • the polymer can comprise modified amino acids.
  • the terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component.
  • polypeptides containing one or more analogs of an amino acid including, for example, unnatural amino acids such as homocysteine, ornithine, p- acetylphenylalanine, D-amino acids, and creatine
  • polypeptide refers to proteins, polypeptides, and peptides of any size, structure, or function.
  • Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing.
  • a polypeptide can be a single polypeptide or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multichain polypeptides. Most commonly disulfide linkages are found in multichain polypeptides.
  • the term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid.
  • a "peptide" can be less than or equal to about 50 amino acids long, e.g., about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 amino acids long.
  • prevent refers partially or completely delaying onset of an disease, disorder and/or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular disease, disorder, and/or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular disease, disorder, and/or condition; partially or completely delaying progression from a particular disease, disorder and/or condition; and/or decreasing the risk of developing pathology associated with the disease, disorder, and/or condition. In some aspects, preventing an outcome is achieved through prophylactic treatment.
  • promoter and “promoter sequence” are interchangeable and refer to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA.
  • a coding sequence is located 3' to a promoter sequence. Promoters can be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions.
  • Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as “constitutive promoters.” Promoters that cause a gene to be expressed in a specific cell type are commonly referred to as “cell-specific promoters” or “tissue-specific promoters.” Promoters that cause a gene to be expressed at a specific stage of development or cell differentiation are commonly referred to as “developmentally-specific promoters” or “cell differentiation-specific promoters.” Promoters that are induced and cause a gene to be expressed following exposure or treatment of the cell with an agent, biological molecule, chemical, ligand, light, or the like that induces the promoter are commonly referred to as “inducible promoters” or “regulatable promoters.” It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths can have identical promoter activity.
  • the promoter sequence is typically bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. In some aspects, a promoter that can be used with the present disclosure includes a tissue specific promoter. [0127] As used herein, “prophylactic” refers to a therapeutic or course of action used to prevent the onset of a disease or condition, or to prevent or delay a symptom associated with a disease or condition.
  • a “prophylaxis” refers to a measure taken to maintain health and prevent the onset of a disease or condition, or to prevent or delay a symptom associated with a disease or condition.
  • the term “gene regulatory region” or “regulatory region” refers to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding region, and which influence the transcription, RNA processing, stability, or translation of the associated coding region. Regulatory regions can include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, or stem-loop structures.
  • a coding region is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence.
  • a miR-485 inhibitor disclosed herein e.g., a polynucleotide encoding a RNA comprising one or more miR-485 binding site
  • a coding region for a gene product is associated with one or more regulatory regions in such a way as to place expression of the gene product under the influence or control of the regulatory region(s).
  • a coding region and a promoter are "operably associated” if induction of promoter function results in the transcription of mRNA encoding the gene product encoded by the coding region, and if the nature of the linkage between the promoter and the coding region does not interfere with the ability of the promoter to direct the expression of the gene product or interfere with the ability of the DNA template to be transcribed.
  • Other expression control elements besides a promoter, for example enhancers, operators, repressors, and transcription termination signals, can also be operably associated with a coding region to direct gene product expression.
  • similarity refers to the overall relatedness between polymeric molecules, e.g.
  • polynucleotide molecules e.g. miRNA molecules
  • Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art. It is understood that percentage of similarity is contingent on the comparison scale used, i.e., whether the nucleic acids are compared, e.g., according to their evolutionary proximity, charge, volume, flexibility, polarity, hydrophobicity, aromaticity, isoelectric point, antigenicity, or combinations thereof.
  • subject refers to any mammalian subject, including without limitation, humans, domestic animals (e.g., dogs, cats and the like), farm animals (e.g., cows, sheep, pigs, horses and the like), and laboratory animals (e.g., monkey, rats, mice, rabbits, guinea pigs and the like) for whom diagnosis, treatment, or therapy is desired, particularly humans.
  • domestic animals e.g., dogs, cats and the like
  • farm animals e.g., cows, sheep, pigs, horses and the like
  • laboratory animals e.g., monkey, rats, mice, rabbits, guinea pigs and the like for whom diagnosis, treatment, or therapy is desired, particularly humans.
  • laboratory animals e.g., monkey, rats, mice, rabbits, guinea pigs and the like
  • the phrase "subject in need thereof” includes subjects, such as mammalian subjects, that would benefit from administration of a miRNA inhibitor of the disclosure (e.g., miR-485 inhibitor), e.g., to increase the expression level of one or more genes that can extend the length and/or protect against a reduction in the length of a telomere.
  • a miRNA inhibitor of the disclosure e.g., miR-485 inhibitor
  • Non- limiting examples of such genes are provided elsewhere in the present disclosure.
  • to "protect against a reduction in the length of a telomere” comprises both preventing and reducing the loss of telomere length.
  • a subject described herein suffers (i.e., exhibits one or more symptoms) from an age-associated disease or condition.
  • a subject described herein does not suffer from an age-associated disease or condition but is susceptible to the disease or condition.
  • a subject who is "susceptible" to an age-associated disease or condition has an increased likelihood of suffering from the disease or condition, compared to a normal subject (i.e., who is not susceptible to an age-associated disease or condition).
  • factors that can increase the susceptibility of a subject to an age-associated disease or condition include: genetic predisposition, age, environmental factors (e.g., diet, pollutants), other health considerations, and combinations thereof.
  • telomere refers to a region of repetitive nucleotide sequences at each end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. Over time, due to each cell division, the telomere ends can become shorter. However, under normal physiological conditions (e.g., in a subject not suffering from an age-associated disease or condition), the telomeres are replenished by telomerase reverse transcriptase. See, e.g., Leao et al., J Biomed Sci 25(1): 22 (Mar.2018), which is incorporated herein by reference in its entirety.
  • the term "therapeutically effective amount” is the amount of reagent or pharmaceutical compound comprising a miRNA inhibitor of the present disclosure that is sufficient to a produce a desired therapeutic effect, pharmacologic and/or physiologic effect on a subject in need thereof.
  • a therapeutically effective amount can be a "prophylactically effective amount” as prophylaxis can be considered therapy.
  • treat refers to, e.g., the reduction in severity of a disease or condition; the reduction in the duration of a disease course; the amelioration or elimination of one or more symptoms associated with a disease or condition (e.g., diabetes); the provision of beneficial effects to a subject with a disease or condition, without necessarily curing the disease or condition.
  • the term also includes prophylaxis or prevention of a disease or condition or its symptoms thereof.
  • upstream refers to a nucleotide sequence that is located 5' to a reference nucleotide sequence.
  • a "vector” refers to any vehicle for the cloning of and/or transfer of a nucleic acid into a host cell.
  • a vector can be a replicon to which another nucleic acid segment can be attached so as to bring about the replication of the attached segment.
  • a "replicon” refers to any genetic element (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of replication in vivo, i.e., capable of replication under its own control.
  • the term "vector” includes both viral and nonviral vehicles for introducing the nucleic acid into a cell in vitro, ex vivo or in vivo.
  • Vectors can be engineered to encode selectable markers or reporters that provide for the selection or identification of cells that have incorporated the vector. Expression of selectable markers or reporters allows identification and/or selection of host cells that incorporate and express other coding regions contained on the vector.
  • selectable marker genes known and used in the art include: genes providing resistance to ampicillin, streptomycin, gentamycin, kanamycin, hygromycin, bialaphos herbicide, sulfonamide, and the like; and genes that are used as phenotypic markers, i.e., anthocyanin regulatory genes, isopentanyl transferase gene, and the like.
  • reporter known and used in the art include: luciferase (Luc), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), ⁇ -galactosidase (LacZ), ⁇ -glucuronidase (Gus), and the like. Selectable markers can also be considered to be reporters. II.
  • miR-485 inhibitors of the present disclosure can exert therapeutic effects (e.g., in a subject suffering from and/or susceptible to an age-associated disease or condition) by regulating the expression and/or activity of one or more genes, such as those associated with the regulation of telomere length.
  • miR- 485 inhibitors disclosed herein are capable of regulating the expression and/or activity of a gene comprising the seed sequence of miR-485-3p, i.e., 5'-UCAUACA-3' (SEQ ID NO: 49).
  • Non-limiting examples of such genes include CTBP1, TRIP6, SIRT1, FOS, CD36, PGC1-a, LRRK2, NRG1, STMN2, VLDLR, NRXN1, GRIA4, NXPH1, and combinations thereof.
  • miR-485 inhibitors of the present disclosure are capable of regulating the expression and/or activity of a gene selected from CTBP1, TRIP6, SIRT1, FOS, CD36, PGC-1 ⁇ , or combinations thereof.
  • a miR-485 inhibitor described herein is capable of increasing the expression and/or activity of CTBP1.
  • a miR-485 inhibitor is capable of increasing the expression and/or activity of TRIP6.
  • a miR-485 inhibitor described herein is capable of increasing the expression and/or activity of SIRT1. In some aspects, a miR-485 inhibitor is capable of decreasing the expression and/or activity of FOS. In some aspects, a miR-485 inhibitor is capable of increasing the expression and/or activity of CD36. In some aspects, a miR-485 inhibitor of the present disclosure is capable of increasing the expression of PGC-1 ⁇ . Not to be bound by any one theory, through such regulation, the miR-485 inhibitors described herein can help rejuvenate senescent cells and/or delay cells from senescence.
  • the miR-485 inhibitors described herein have distinct properties that are not present in other methods known in the art for treating and/or preventing senescence in cells. For instance, compared to antibodies (e.g., immune checkpoint inhibitors), miR-485 inhibitors can be administered less frequently and/or at much lower doses and still exert therapeutic effects (e.g., extend the length and/or protect against a reduction in the length of a telomere). Contrary to antibodies which bind to surface proteins, the miR-485 inhibitors of the present disclosure are capable of epigenetically modifying the cells, such that the modification will be passed down to daughter cells. Additionally, the epigenetic modification can have divergent effects on the target cells.
  • antibodies e.g., immune checkpoint inhibitors
  • the miR-485 inhibitors of the present disclosure are capable of epigenetically modifying the cells, such that the modification will be passed down to daughter cells. Additionally, the epigenetic modification can have divergent effects on the target cells.
  • miR-485 inhibitors disclosed herein can have the following effects on neural stem cells (NSCs): reduce telomere shortening, induce cell proliferation, induce cell growth, or any combination thereof. Similar effects can also be observed with other types of stem cells, including, but not limited to, hematopoietic stem cell, mesenchymal stem cell, epithelial stem cell, skin stem cell, or any combination thereof.
  • NSCs neural stem cells
  • miR-485 inhibitors disclosed herein can have the following effects on more differentiated cells, such as neurons (e.g., motor neurons, sensory neurons, interneurons, or combinations thereof) and glial cells (e.g., astrocytes, oligodendrocytes, microglial cells, or combinations thereof): induce neurorestoration (e.g., by promoting synapse formation between neurons; also referred to herein as "synaptogenesis"), enhance neuroprotection (e.g., by decreasing apoptosis), promote protein homeostasis (e.g., proteinopathy controlled by autophagy and ubiquitin proteasome system), enhance phagocytosis and autophagy, reduce neuroinflammation, or any combination thereof.
  • neurons e.g., motor neurons, sensory neurons, interneurons, or combinations thereof
  • glial cells e.g., astrocytes, oligodendrocytes, microglial cells, or combinations thereof
  • induce neurorestoration
  • miR-485 inhibitors of the present disclosure can help transform old and dysfunctional cells (e.g., senescent cells) to young and more functional cells.
  • the therapeutic effects of the miR-485 inhibitors described herein are much more lasting and diverse compared to other methods available in the art, e.g., antibody-mediated treatment.
  • senescence arising from aging is associated with a reduction in the length of a telomere.
  • one or more cells of a subject suffering from an age-associated disease or condition disclosed herein comprises a telomere with reduced length.
  • the length of the telomere is reduced by at least about 5%, at least about 10%, at least about 15% , at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%, compared to the length of a reference telomere (e.g., telomere in a subject who is not suffering from an age-associated disease or condition).
  • a reference telomere e.g., telomere in a subject who is not suffering from an age-associated disease or condition.
  • miR-485 inhibitors disclosed herein can help rejuvenate senescent cells from a subject suffering from an age-associated disease or condition by extending the length of a telomere in the senescent cells. Accordingly, in some aspects, the present disclosure is directed to a method of extending the length of a telomere in a cell of a subject in need thereof, comprising contacting the cell with a miR-485 inhibitor disclosed herein. In some aspects, the contacting can occur in vitro. In some aspects, the contacting can occur in vivo, e.g., by administering the miR-485 inhibitor to the subject.
  • the length of the telomere is extended by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8- fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more after the contacting.
  • extending the length of the telomere can restore one or more properties of the cell, such that the cell is no longer senescent (i.e., have become rejuvenated). Accordingly, in some aspects, after the contacting with a miR-485 inhibitor, the cell exhibits increased survival.
  • the survival of the cell is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10- fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more after the contacting.
  • the cell after the contacting with a miR-485 inhibitor, the cell exhibits increased ability to proliferate.
  • the cell after the contacting with a miR-485 inhibitor, the cell exhibits increased ability to differentiate.
  • the ability of the cell to proliferate is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more after the contacting.
  • the ability of the cell to differentiate is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50- fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more after the contacting.
  • a miR-485 inhibitor can help protect against further shortening of a telomere in a cell of a subject suffering from an age-associated disease or condition.
  • a therapeutic method provided herein comprises contacting the cell with an miR-485 inhibitor, wherein the further loss in the length of the telomere is reduced after the contacting.
  • the contacting occurs in vitro.
  • the contacting occurs in vivo, e.g., after administering the miR-485 inhibitor to the subject.
  • the further loss in the length of the telomere is reduced by at least about 5%, at least about 10%, at least about 15% , at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100%, compared to the further loss in the length of a reference telomere (e.g., telomere in a corresponding cell that was not contacted with the miR-485 inhibitor).
  • a reference telomere e.g., telomere in a corresponding cell that was not contacted with the miR-485 inhibitor.
  • the reduced further loss in the length of the telomere can help prevent and/or delay the progression of the age-associated disease or condition in the subject.
  • the miR-485 inhibitors of the present disclosure can also have therapeutic effects in subjects not currently suffering from an age-associated disease or condition.
  • a method disclosed herein comprises contacting an miR-485 inhibitor to a cell of a subject who is susceptible (e.g., genetic predisposition) to an age-associated disease or condition but does not yet suffer from the disease or condition, wherein the contacting prevents and/or reduces a reduction in the length of a telomere in the cell.
  • the contacting occurs in vitro.
  • the contacting occurs in vivo, e.g., after administering the miR-485 inhibitor to the subject.
  • the length of the telomere is not reduced by more than about 1%, not reduced by more than about 2%, not reduced by more than about 3%, not reduced by more than about 4%, not reduced by more than about 5%, not reduced by more than about 6%, not reduced by more than about 7%, not reduced by more than about 8%, not reduced by more than about 9%, not reduced by more than about 10%, not reduced by more than about 15%, or not reduced by more than about 20% compared to the length of a reference telomere (e.g., telomere in a corresponding cell of a subject who does not suffer from an age-associated disease or condition).
  • a reference telomere e.g., telomere in a corresponding cell of a subject who does not suffer from an age-associated disease or condition.
  • administering an miR-485 inhibitor to a subject can prevent and/or delay the onset of the age-associated disease or condition in the subject.
  • onset of the age- associated disease or condition refers to when a subject first exhibits one or more clinical manifestations (e.g., symptoms) of the disease or condition. Non-limiting examples of such clinical manifestations are provided elsewhere in the present disclosure.
  • the onset of the age-associated disease or condition is delayed by at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, at least about 1 year, at least about 2 years, at least about 3 years, at least about 4 years, or at least about 5 years or more, compared to the onset of the disease or condition in a corresponding subject that did not receive an administration of the miR-485 inhibitor.
  • miR-485 inhibitors disclosed herein can be used to treat an aging- associated disease or condition. Accordingly, in some aspects, provided herein are methods of treating an aging-associated disease or condition in a subject in need thereof, comprising administering an miR-485 inhibitor to the subject. [0152] In some aspects, miR-485 inhibitors of the present disclosure can treat an aging- associated disease or condition by extending the length and/or protecting against a reduction in the length of a telomere in a cell of the subject.
  • the length of the telomere in the cell of the subject is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more in the subject after the administration.
  • the length of the telomere in the cell of the subject is at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% of the length of a reference telomere (e.g., corresponding telomere in a cell of a subject not suffering from an age-associated disease or condition; or the telomere in the subject prior to the onset of the age-associated disease or condition).
  • a reference telomere e.g., corresponding telomere in a cell of a subject not suffering from an age-associated disease or condition; or the telomere in the subject prior to the onset of the age-associated disease or condition.
  • the methods disclosed herein can be used to treat any age-associated disease or condition.
  • aging-associated disease or condition that can be treated include atherosclerosis and cardiovascular disease, cancer, arthritis, eye disease (e.g., cataracts, macular degeneration, diabetic retinopathy, or glaucoma), osteoporosis, type 2 diabetes, hypertension, neurodegenerative disease, hearing loss (e.g., presbycusis), loss of smell, and combinations thereof.
  • the age-associated disease or condition is a neurodegenerative disease.
  • neurodegenerative disease refers to a disease caused by the progressive pathologic changes within the nervous system, particularly within the neurons of the brain. In some aspects, such progressive destruction of the nervous system can result in physical (e.g., ataxias) and/or mental (e.g., dementia) impairments.
  • Non-limiting examples of neurodegenerative diseases or disorders that can be treated with the present disclosure include Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis (ALS), Spinal muscular atrophy (SMA), Dementia with Lewy bodies (DLB), CAA cerebral amyloid angiopathy (CAA), CDB corticobasal degeneration (CDB), Frontotemporal lobar degeneration due to FUS pathology (FTLD-fus), Frontotemporal lobar degeneration due to tau pathology (FTLD-tau), Frontotemporal lobar degeneration due to TDP 43 (FTLD-tdp), Multiple system atrophy (MSA), Progressive supranuclear palsy (PSP), Frontotemporal dementia, Huntington’s disease, or any combination thereof.
  • ALS Amyotrophic lateral sclerosis
  • SMA Spinal muscular atrophy
  • DLB Dementia with Lewy bodies
  • CAA CAA cerebral amyloid angiopathy
  • CDB corticobasal degeneration CDB
  • a neurodegenerative disease that can be treated with the present disclosure comprises Alzheimer's disease.
  • Alzheimer's disease comprises pre- dementia Alzheimer's disease, early Alzheimer's disease, moderate Alzheimer's disease, advanced Alzheimer's disease, early onset familial Alzheimer's disease, inflammatory Alzheimer's disease, non-inflammatory Alzheimer's disease, cortical Alzheimer's disease, early-onset Alzheimer's disease, late-onset Alzheimer's disease, or any combination thereof.
  • a neurodegenerative disease that can be treated comprises a parkinsonism.
  • the term "parkinsonism" refers to a group of neurological disorders that causes a combination of the movement abnormalities seen in Parkinson's disease.
  • Non-limiting examples of such movement abnormalities include tremor, slow movement (bradykinesia), postural instability, loss of postural reflexes, flexed posture, freezing phenomenon (when the feet are transiently "glued” to the ground), impaired speech, muscle stiffness (rigidity), or combinations thereof.
  • parkinsonism comprises a Parkinson's disease, progressive supranuclear palsy (PSP), multiple system atrophy (MSA), corticalbasal degeneration (CBD), normal pressure hydrocephalus (NSA), vascular parkinsonism (also known as cerebrovascular disease), diffuse Lewy body disease, Parkinson- dementia, X-linked dystonia-parkinsonism, secondary Parkinsonism (resulting from environmental etiology, e.g., toxins, drugs, post encephalitic, brain tumors, head trauma, normal pressure hydrocephalus), or combinations thereof.
  • a parkinsonism that can be treated with the present disclosure is a Parkinson's disease.
  • PD Parkinson's disease
  • PD refers to neurodegenerative disorder leading to motor and non-motor manifestations (i.e., symptoms) and characterized by extensive degeneration of dopaminergic neurons in the nigrostriatal system.
  • motor and non-motor manifestations of PD are provided elsewhere in the present disclosure.
  • Proteinopathy ⁇ -synuclein abnormal aggregation
  • Other exemplary features of PD include dopaminergic neuron damage, mitochondrial dysfunction, neuroinflammation, protein homeostasis (e.g., autophagic clearance of damaged proteins and organelles glial cell dysfunction), and combinations thereof.
  • miR-485 inhibitors of the present disclosure can treat PD by improving one or more of these features of PD.
  • a miR-485 inhibitor of the present disclosure can treat a neurodegenerative disease by extending the length and/or protecting against a reduction in the length of a telomere in a neural stem cell of a subject. Accordingly, as described herein, in some aspects, contacting a neural stem cell with a miR- 485 inhibitor promotes the survival of the neural stem cell. In some aspects, contacting a neural stem cell with a miR-485 inhibitor described herein increases the ability of the neural stem cell to proliferate and thereby, self-renew.
  • contacting a neural stem cell with a miR-485 inhibitor increases the ability of the neural stem cell to differentiate into other cell types (e.g., neurons, astrocytes, and/or oligodendrocytes) (i.e., neurogenesis).
  • other cell types e.g., neurons, astrocytes, and/or oligodendrocytes
  • the proliferation, differentiation, and/or survival of the neural stem cell is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5- fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more in the subject after the contacting.
  • a telomere in a cell improves and/or ameliorates one or more symptoms of an age-associated disease or condition (e.g., neurodegenerative disease).
  • an age-associated disease or condition e.g., neurodegenerative disease
  • the primary symptoms of Alzheimer's disease comprises memory loss and confusion.
  • a miR-485 inhibitor of the present disclosure can improve memory and/or other cognitive function.
  • the memory and/or cognitive function is increased in the subject by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more, compared to that of a reference subject (e.g., corresponding subject that did not receive an administration of the miR-485 inhibitor).
  • a reference subject e.g., corresponding subject that did not receive an administration of the miR-485 inhibitor.
  • Non-limiting examples of other clinical manifestations of the disease include: mental decline, difficulty thinking and understanding, confusion in the evening hours, delusion, disorientation, forgetfulness, making things up, mental confusion, difficulty concentrating, inability to create new memories, inability to do simple math, inability to recognize common things, aggression, agitation, difficulty with self- care, irritability, meaningless repetition of own words, personality changes, restlessness, lack of restraint, wandering and getting lost, anger, apathy, general discontent, loneliness, mood swings, depression, hallucination, paranoia, inability to combine muscle movements, jumbled speech, loss of appetite, or combinations thereof.
  • a miR-485 inhibitor disclosed herein can improve any one or more of such symptoms.
  • a miR-485 inhibitor of the present disclosure reduces the occurrence or risk of occurrence of one or more symptoms of cognitive impairments in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR-485 inhibitor.
  • a miR-485 inhibitor of the present disclosure reduces memory loss in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) compared to a reference (e.g., memory loss in the subject prior to the treatment with the miR-485 inhibitor).
  • a miR-485 inhibitor of the present disclosure reduces memory loss or the risk of occurrence of memory loss in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR-485 inhibitor.
  • a miR-485 inhibitor of the present disclosure improves memory retention in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) compared to a reference (e.g., memory retention in the subject prior to the treatment with the miR-485 inhibitor).
  • a miR-485 inhibitor of the present disclosure improves and/or increases memory retention in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that were not treated with the miR- 485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR- 485 inhibitor.
  • a miR-485 inhibitor of the present disclosure improves spatial working memory in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) compared to a reference (e.g., spatial working memory in the subject prior to the treatment with the miR-485 inhibitor).
  • a reference e.g., spatial working memory in the subject prior to the treatment with the miR-485 inhibitor.
  • spatial working memory refers to the ability to keep spatial information activity in working memory over a short period of time.
  • spatial working memory is improved and/or increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR-485 inhibitor.
  • a miR-485 inhibitor of the present disclosure increases the phagocytic activity of scavenger cells (e.g., glial cells) (e.g., by extending the length of the telomere in the cell) in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) compared to a reference (e.g., phagocytic activity in the subject prior to the treatment with the miR-485 inhibitor).
  • scavenger cells e.g., glial cells
  • a reference e.g., phagocytic activity in the subject prior to the treatment with the miR-485 inhibitor.
  • a miR-485 inhibitor of the present disclosure increases dendritic spine density of a neuron in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR-485 inhibitor.
  • a miR-485 inhibitor of the present disclosure reduces an amyloid beta (A ⁇ ) plaque load in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) (e.g., by extending the length of a telomere in a neural stem cell) compared to a reference (e.g., amyloid beta (A ⁇ ) plaque load in the subject prior to the treatment with the miR-485 inhibitor).
  • a ⁇ amyloid beta plaque load in a subject
  • a subject e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease
  • a ⁇ amyloid beta
  • a ⁇ amyloid beta
  • Amyloid beta (A ⁇ ) plaque is known to cause neuronal changes, e.g., aberrations in synapse composition, synapse shape, synapse density, loss of synaptic conductivity, changes in dendrite diameter, changes in dendrite length, changes in spine density, changes in spine area, changes in spine length, or changes in spine head diameter.
  • administering a miR-485 inhibitor of the present disclosure reduces an amyloid beta plaque load in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR-485 inhibitor.
  • a miR-485 inhibitor disclosed herein increases neurogenesis in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) (e.g., by extending the length of a telomere in a cell, e.g., neural stem cell) compared to a reference (e.g., neurogenesis in the subject prior to the treatment with the miR-485 inhibitor).
  • a reference e.g., neurogenesis in the subject prior to the treatment with the miR-485 inhibitor.
  • neurogenesis refers to the process by which neurons are created. Neurogenesis encompasses proliferation of neural stem and progenitor cells, differentiation of these cells into new neural cell types, as well as migration and survival of the new cells.
  • a miR-485 inhibitor of the present disclosure increases neurogenesis in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR-485 inhibitor.
  • increasing and/or inducing neurogenesis is associated with increased proliferation, differentiation, migration, and/or survival of neural stem cells and/or progenitor cells. Accordingly, in some aspects, a miR-485 inhibitor of the present disclosure can increase the proliferation of neural stem cells and/or progenitor cells in the subject.
  • the proliferation of neural stem cells and/or progenitor cells is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR-485 inhibitor.
  • the survival of neural stem cells and/or progenitor cells is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR-485 inhibitor.
  • increasing and/or inducing neurogenesis is associated with an increased number of neural stem cells and/or progenitor cells.
  • the number of neural stem cells and/or progenitor cells is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR-485 inhibitor.
  • increasing and/or inducing neurogenesis is associated with increased axon, dendrite, and/or synapse development.
  • axon, dendrite, and/or synapse development is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR-485 inhibitor.
  • a miR-485 inhibitor disclosed herein prevents and/or inhibits the development of an amyloid beta plaque load in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease). In some aspects, a miR-485 inhibitor disclosed herein delays the onset of the development of an amyloid beta plaque load in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease). In some aspects, a miR-485 inhibitor of the present disclosure lowers the risk of development an amyloid beta plaque load in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease).
  • a miR-485 inhibitor of the present disclosure increases dendritic spine density of a neuron in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) compared to a reference (e.g., dendritic spine density of a neuron in the subject prior to the treatment with the miR-485 inhibitor).
  • a miR-485 inhibitor of the present disclosure increases dendritic spine density of a neuron in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR-485 inhibitor
  • a miR-485 inhibitor disclosed herein decreases the loss of dendritic spines of a neuron in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) compared to a reference (e.g., loss of dendritic spines of a neuron in the subject prior to the treatment with the miR-485 inhibitor).
  • a miR-485 inhibitor decreases the loss of dendritic spines of a neuron in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR-485 inhibitor.
  • administering a miR-485 inhibitor of the present disclosure decreases neuroinflammation in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) compared to a reference (e.g., neuroinflammation in the subject prior to the treatment with the miR-485 inhibitor).
  • a miR-485 inhibitor decreases neuroinflammation in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR-485 inhibitor.
  • decreased neuroinflammation comprises glial cells producing decreased amounts of inflammatory mediators.
  • a miR-485 inhibitor disclosed herein to a subject decreases the amount of inflammatory mediators produced by glial cells by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • an inflammatory mediator produced by glial cells comprises TNF- ⁇ . In some aspects, the inflammatory mediator comprises IL-1 ⁇ . In some aspects, an inflammatory mediator produced by glial cells comprises both TNF- ⁇ and IL-1 ⁇ .
  • a miR-485 inhibitor disclosed herein increases autophagy in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease).
  • autophagy refers to cellular stress response and a survival pathway that is responsible for the degradation of long-lived proteins, protein aggregates, as well as damaged organelles in order to maintain cellular homeostasis.
  • a miR-485 inhibitor disclosed herein increases autophagy by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, or at least about 300% or more, compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR-485 inhibitor.
  • Increase in autophagy can be measured by any suitable methods known in the art. For instance, in some aspects, increase in autophagy can be observed by measuring the expression of a gene associated with autophagosome biogenesis (e.g., LC3B).
  • a miR-485 inhibitor disclosed herein increases alpha-secretase activity in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease).
  • the term "alpha-secretase” refers to a family of proteolytic enzymes that cleave amyloid precursor protein (APP) in its transmembrane region.
  • Alpha secretases are members of the ADAM ("a disintegrin and metalloprotease domain") family (e.g., ADAM10), which are expressed on the surfaces of cells and anchored in the cell membrane. Specifically, alpha secretases cleave within the fragment that gives rise to the Alzheimer's disease-associated peptide amyloid beta when APP is instead processed by beta secretase and gamma secretase. Thus, in some aspects, alpha-secretase cleavage precludes amyloid beta formation and is considered to be part of the non-amyloidogenic pathway in APP processing.
  • ADAM disintegrin and metalloprotease domain
  • a miR-485 inhibitor disclosed herein increases alpha-secretase activity by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, or at least about 300% or more, compared to a reference (e.g., corresponding subjects that were not treated with the miR- 485 inhibitor).
  • a reference e.g., corresponding subjects that were not treated with the miR- 485 inhibitor.
  • a miR-485 inhibitor disclosed herein decreases beta-secretase 1 (BACE1) activity (in a subject (e.g., suffering from an age-associated disease or condition, e.g., a neurodegenerative disease).
  • BACE1 beta-secretase 1
  • BACE1 refers to an enzyme that is expressed mainly in neurons.
  • BACE1 is an aspartic acid protease important in the formation of myelin sheaths in peripheral nerve cells.
  • a miR-485 inhibitor disclosed herein decreases BACE1 activity by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that were not treated with the miR-485 inhibitor).
  • a miR-485 inhibitor disclosed herein can be administered by any suitable route known in the art.
  • a miR-485 inhibitor is administered parenthetically, intramuscularly, subcutaneously, ophthalmic, intravenously, intraperitoneally, intradermally, intraorbitally, intracerebrally, intracranially, intracerebroventricularly, intraspinally, intraventricular, intrathecally, intracistemally, intracapsularly, intratumorally, or any combination thereof.
  • a miR-485 inhibitor is administered intracerebroventricularly (ICV).
  • a miR-485 inhibitor is administered intravenously.
  • a miR-485 inhibitor of the present disclosure can be used in combination with one or more additional therapeutic agents.
  • the additional therapeutic agent and the miR-485 inhibitor are administered concurrently. In some aspects, the additional therapeutic agent and the miR-485 inhibitor are administered sequentially. [0179] In some aspects, the administration of a miR-485 inhibitor disclosed herein does not result in any adverse effects. In some aspects, miR-485 inhibitors of the present disclosure does not adversely affect body weight when administered to a subject. In some aspects, miR- 485 inhibitors disclosed herein do not result in increased mortality or cause pathological abnormalities when administered to a subject.
  • exemplary miR-485 inhibitors that can be used with the present disclosure are provided elsewhere in the present disclosure (see Section III).
  • CTBP1 Regulation [0181] In some aspects, contacting a miR-485 inhibitor described herein with a cell (e.g., neural stem cell) can increase the expression of a CTBP1 protein and/or a CTBP1 gene in the cell.
  • CTBP1 increasing the expression of CTBP1 protein (or derivatives thereof) comprises (i) increasing the expression of CTBP1 protein, (ii) increasing the expression of CTBP1 gene, or (iii) both (i) and (ii).
  • the increase in the expression of the CTBP1 protein and/or a CTBP1 gene can help extend the length and/or protect against a reduction in the length of a telomere in the cell.
  • C-terminal-binding protein 1 is a protein that in humans is encoded by the CTBP1 gene.
  • CTBP1 is a regulatory protein that binds to sequence-specific DNA-binding proteins and help turn genes off, e.g., by recruiting histone modifying enzymes that add repressive histone marks and remove activating marks.
  • CTBP1 protein can also self-associate and bring together gene regulatory complexes.
  • gene regulatory complexes have been described to play a role in repairing double-stranded breaks that can occur when telomeres are first produced during DNA synthesis. See, e.g., de Lange, T., Annu Rev Genet 52:223-247 (Nov.2018), which is incorporated by reference in its entirety.
  • CTBP1 gene is located on chromosome 4 (nucleotides 1,211,444 to 1,250,355 of GenBank Accession Number NC_000004.12, minus strand orientation). Synonyms of the CTBP1 gene, and the encoded protein thereof, are known and include "Brefeldin A-Ribosylated Substrate,” “BARS,” “HADDTS,” CtBP1,” or "CTBP.” [0184] There are at least two known isoforms of human CTBP1 protein, resulting from alternative splicing. CTBP1 isoform 1 (UniProt identifier: Q13363-1; SEQ ID NO: 1) consists of 440 amino acids and has been chosen as the canonical sequence.
  • CTBP1 isoform 2 (UniProt identifier: Q13363-2; SEQ ID NO: 136) consists of 429 amino acids and differs from the canonical sequence as follows: 1-13: MGSSHLLNKGLPL ⁇ MS. Table 1 below provides the sequences for the two CTBP1 isoforms. Table 1.
  • CTBP1 Protein Isoforms [0185] As used herein, the term "CTBP1" includes any variants or isoforms of CTBP1 which are naturally expressed by cells. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of CTBP1 isoform 1. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of CTBP1 isoform 2.
  • a miR-485 inhibitor disclosed herein can increase the expression of both CTBP1 isoform 1 and isoform 2. Unless indicated otherwise, both isoform 1 and isoform 2 are collectively referred to herein as "CTBP1.”
  • CTBP1 both isoform 1 and isoform 2 are collectively referred to herein as "CTBP1.”
  • contacting a cell with a miR-485 inhibitor provided herein is capable of increasing the expression of CTBP1 in the cell by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100%, as compared to a reference cell (e.g., corresponding cell that has not been contacted with the miR-485 inhibitor).
  • contacting a cell with a miR-485 inhibitor increases the expression and/or activity of CTBP1 protein and/or CTBP1 gene in the cell by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more, compared to the expression and/or activity in a reference cell (e.g., corresponding cell that has not been contacted with the miR-485 inhibitor).
  • a reference cell e.g., corresponding cell that has not been contacted with the miR-485 inhibitor.
  • a miR-485 inhibitor disclosed herein increases the expression of CTBP1 protein and/or CTBP1 gene by reducing the expression and/or activity of miR-485, e.g., miR-485-3p.
  • a miR-485 inhibitor of the present disclosure can reduce the expression and/or activity of miR-485-3p, which can in turn help extend the length and/or protect against a reduction in the length of a telomere in the cell.
  • contacting a miR-485 inhibitor described herein with a cell can increase the expression of a TRIP6 protein and/or a TRIP6 gene in the cell.
  • a cell e.g., neural stem cell
  • increasing the expression of TRIP6 comprises (i) increasing the expression of TRIP6 protein, (ii) increasing the expression of TRIP6 gene, or (iii) both (i) and (ii).
  • the increase in the expression of the TRIP6 protein and/or a TRIP6 gene can help extend the length and/or protect against a reduction in the length of a telomere in the cell.
  • a miR-485 inhibitor provided herein is capable of increasing the expression of both TRIP6 and CTBP1.
  • Thyroid receptor-interacting protein 6 (TRIP6) is a protein that in humans is encoded by the TRIP6 gene.
  • TRIP6 protein is a member of the zyxin family and comprises three LIM zinc-binding domains.
  • TRIP6 protein has been shown to localize to focal adhesion sites and along actin stress fibers.
  • TRIP6 has also been shown to interact with other LIM- domain containing proteins (e.g., LPP) to protect short telomeres and lower the critical point at which telomeres signal into senescence.
  • the TRIP6 gene is located on chromosome 7 (nucleotides 100,867,387 to 100,873,454 of GenBank Accession Number NC_000007.14, plus strand orientation).
  • TRIP6 Synonyms of the TRIP6 gene, and the encoded protein thereof, are known and include: “Thyroid Hormone Receptor Interactor 6,” “ZRP-1,” “OIP1,” “Thyroid Hormone Receptor Interacting Protein 6,” “OPA-Interacting Protein 1,” and “Zyxin Related Protein 1.”
  • TRIP6 isoform 1 (UniProt identifier: Q15654-1; SEQ ID NO: 137) consists of 476 amino acids and has been chosen as the canonical sequence.
  • TRIP6 isoform 2 (UniProt identifier: Q15654-2; SEQ ID NO: 138) consists of 106 amino acids and differs from the canonical sequence as follows: (i) 37-106: ALQPHPRVNF...IDLLSSTLAE ⁇ VLPGPRGTGG...CVTATRPTGI; (ii) 107-476: Missing.
  • TRIP6 isoform 3 (UniProt identifier: Q15654-3; SEQ ID NO: 139) consists of 80 amino acids and differs from the canonical sequence as follows: (i) 37-80: ALQPHPRVNF...SHGVLQHTQG ⁇ GAPCRQGGPS...CVTATRPTGI; (ii) 81-476: Missing.
  • TRIP6 Protein Isoforms [0192] As used herein, the term "TRIP6" includes any variants or isoforms of TRIP6 which are naturally expressed by cells. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of TRIP6 isoform 1. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of TRIP6 isoform 2. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of TRIP6 isoform 3. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of both TRIP6 isoform 1, isoform 2, and isoform 3.
  • contacting a cell with a miR-485 inhibitor provided herein is capable of increasing the expression of TRIP6 in the cell by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100%, as compared to a reference cell (e.g., corresponding cell that has not been contacted with the miR-485 inhibitor).
  • contacting a cell with a miR-485 inhibitor increases the expression and/or activity of TRIP6 protein and/or TRIP6 gene in the cell by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more, compared to the expression and/or activity in a reference cell (e.g., corresponding cell that has not been contacted with the miR-485 inhibitor).
  • a reference cell e.g., corresponding cell that has not been contacted with the miR-485 inhibitor.
  • a miR-485 inhibitor can also increase the expression and/or activity of other LIM-domain containing proteins, such as those that associate with TRIP6 to protect telomere length (e.g., LPP).
  • a miR-485 inhibitor disclosed herein increases the expression of TRIP6 protein and/or TRIP6 gene by reducing the expression and/or activity of miR-485, e.g., miR-485-3p.
  • a miR-485 inhibitor of the present disclosure can reduce the expression and/or activity of miR-485-3p, which can in turn help extend the length and/or protect against a reduction in the length of a telomere in the cell.
  • contacting a miR-485 inhibitor described herein with a cell can increase the expression of a SIRT1 protein and/or a SIRT1 gene in the cell.
  • a cell e.g., neural stem cells
  • increasing the expression of SIRT1 comprises (i) increasing the expression of SIRT1 protein, (ii) increasing the expression of SIRT1 gene, or (iii) both (i) and (ii).
  • the increase in the expression of the SIRT1 protein and/or SIRT1 gene can help extend the length and/or protect against a reduction in the length of a telomere in the cell.
  • a miR-485 inhibitor provided herein is capable of increasing the expression of both SIRT1 and CTBP1.
  • a miR-485 inhibitor is capable of increasing the expression of both SIRT1 and TRIP6.
  • a miR-584 inhibitor is capable of increasing the expression of each of the following: SIRT1, CTBP1, and TRIP6.
  • SIRT1 also known as NAD-dependent deacetylase sirtuin-1, is a protein that in humans is encoded by the SIRT1 gene.
  • the SIRT1 gene is located on chromosome 10 in humans (nucleotides 67,884,656 to 67,918,390 of GenBank Accession Number NC_000010.11, plus strand orientation).
  • Synonyms of the SIRT1 gene, and the encoded protein thereof, are known and include "regulatory protein SIR2 homolog 1,” “silent mating-type information regulation 2 homolog 1,” “SIR2,” “SIR2-Like Protein 1,” “SIR2L1,” “SIR2alpha,” “Sirtuin Type 1,” “hSIRT1,” or “hSIR2.”
  • SIRT1 isoform 1 (UniProt identifier: Q96EB6-1) consists of 747 amino acids and has been chosen as the canonical sequence (SEQ ID NO: 31).
  • SIRT1 isoform 2 (also known as "delta-exon8) (UniProt identifier: Q96EB6-2) consists of 561 amino acids and differs from the canonical sequence as follows: 454-639: missing (SEQ ID NO: 32). Table 3 below provides the sequences for the two SIRT1 isoforms. Table 3.
  • SIRT1 Protein Isoforms [0199] As used herein, the term "SIRT1" includes any variants or isoforms of SIRT1 which are naturally expressed by cells.
  • a miR-485 inhibitor disclosed herein can increase the expression of SIRT1 isoform 1.
  • a miR-485 inhibitor disclosed herein can increase the expression of SIRT1 isoform 2.
  • a miR-485 inhibitor disclosed herein can increase the expression of both SIRT1 isoform 1 and isoform 2.
  • SIRT1 isoform 1 and isoform 2 are collectively referred to herein as "SIRT1.”
  • contacting a cell with a miR-485 inhibitor provided herein is capable of increasing the expression of SIRT1 in the cell by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100%, as compared to a reference cell (e.g., corresponding cell that has not been contacted with the miR-485 inhibitor).
  • contacting a cell with a miR-485 inhibitor increases the expression and/or activity of SIRT1 protein and/or SIRT1 gene in the cell by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more, compared to the expression and/or activity in a reference cell (e.g., corresponding cell that has not been contacted with the miR-485 inhibitor).
  • a reference cell e.g., corresponding cell that has not been contacted with the miR-485 inhibitor.
  • a miR-485 inhibitor disclosed herein increases the expression of SIRT1 protein and/or SIRT1 gene by reducing the expression and/or activity of miR-485, e.g., miR-485-3p.
  • a miR-485 inhibitor of the present disclosure can reduce the expression and/or activity of miR-485-3p, which can in turn help extend the length and/or protect against a reduction in the length of a telomere in the cell.
  • contacting a miR-485 inhibitor described herein with a cell can decrease the expression of a protein c-Fos protein and/or a FOS gene in the cell.
  • reducing the expression of c-Fos comprises (i) reducing the expression of c-Fos protein, (ii) reducing the expression of FOS gene, or (iii) both (i) and (ii).
  • the decrease in the expression of the c-Fos protein and/or FOS gene can help extend the length and/or protect against a reduction in the length of a telomere in the cell.
  • a miR-485 inhibitor provided herein is capable of decreasing the expression of c-Fos and increasing the expression of CTBP1.
  • a miR-485 inhibitor is capable of decreasing the expression of c-Fos and increasing the expression of TRIP6.
  • a miR-485 inhibitor is capable of decreasing the expression of c-Fox and increasing the expression of SIRT1.
  • a miR-485 inhibitor is capable of decreasing the expression of c-Fos and increasing the expression of any combination of the following: CTBP1, TRIP6, and SIRT1.
  • Fos proto-oncogene, AP-1 transcription factor subunit (C-FOS), also known as Protein c-Fos, is a protein that in humans is encoded by the FOS gene.
  • the FOS gene is located on chromosome 14 in humans (nucleotides 75,278,828 to 75,282,230 of GenBank Accession Number NC_000014.9, plus strand orientation).
  • C-FOS isoform 1 (UniProt identifier: P01100-1) consists of 380 amino acids and has been chosen as the canonical sequence (SEQ ID NO: 140).
  • C-FOS isoform 2 (UniProt identifier: P01100-2) consists of 266 amino acids and differs from the canonical sequence as follows: 1-114: missing (SEQ ID NO: 141).
  • C-FOS isoform 3 (UniProt identifier: P01100-3) consists of 344 amino acids and differs from the canonical sequence as follows: 132-167: missing (SEQ ID NO: 142). Table 4 below provides the sequences for the three C- FOS isoforms. Table 4.
  • C-FOS includes any variants or isoforms of C-FOS which are naturally expressed by cells. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can decrease the expression of C-FOS isoform 1. In some aspects, a miR-485 inhibitor disclosed herein can decrease the expression of C-FOS isoform 2. In some aspects, a miR-485 inhibitor disclosed herein can decrease the expression of C-FOS isoform 3. In some aspects, a miR-485 inhibitor disclosed herein can decrease the expression of one or more of C- FOS isoform 1, isoform 2, and isoform 3.
  • contacting a cell with a miR-485 inhibitor provided herein is capable of increasing the expression of c-Fos in the cell by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100%, as compared to a reference cell (e.g., corresponding cell that has not been contacted with the miR-485 inhibitor).
  • contacting a cell with a miR-485 inhibitor decreases the expression and/or activity of C-FOS protein and/or C-FOS gene in the cell by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more, compared to the expression and/or activity in a reference cell (e.g., corresponding cell that has not been contacted with the miR-485 inhibitor).
  • a reference cell e.g., corresponding cell that has not been contacted with the miR-485 inhibitor.
  • a miR-485 inhibitor disclosed herein decreases the expression of C-FOS protein and/or C-FOS gene by reducing the expression and/or activity of miR-485, e.g., miR-485-3p.
  • a miR-485 inhibitor of the present disclosure can reduce the expression and/or activity of miR-485-3p, which can in turn help extend the length and/or protect against a reduction in the length of a telomere in the cell.
  • contacting a miR-485 inhibitor described herein with a cell can increase the expression of a CD36 protein and/or a CD36 gene in the cell.
  • a cell e.g., neural stem cell
  • increasing the expression of CD36 comprises (i) increasing the expression of CD36 protein, (ii) increasing the expression of CD36 gene, or (iii) both (i) and (ii).
  • the increase in the expression of the CD36 protein and/or CD36 gene can help extend the length and/or protect against a reduction in the length of a telomere in the cell.
  • a miR-485 inhibitor provided herein is capable of increasing the expression of both CD36 and CTBP1. In some aspects, a miR-485 inhibitor provided herein is capable of increasing the expression of both CD36 and TRIP6. In some aspects, a miR-485 inhibitor provided herein is capable of increasing the expression of both CD36 and SIRT1. In some aspects, a miR-485 inhibitor provided herein is capable of increasing the expression of CD36 and decreasing the expression of c-Fos.
  • a miR-485 inhibitor is capable of increasing the expression of CD36 and any combination of the following: (i) increasing the expression of CTBP1, (ii) increasing the expression of TRIP6, (iii) increasing the expression of SIRT1, and (iv) decreasing the expression of c-Fos.
  • Cluster determinant 36 (CD36) is also known as platelet glycoprotein 4, is a protein that in humans is encoded by the CD36 gene.
  • the CD36 gene is located on chromosome 7 (nucleotides 80,602,656 to 80,679,277 of GenBank Accession Number NC_000007.14, plus strand orientation).
  • CD36 gene and the encoded protein thereof, are known and include "platelet glycoprotein IV,” “fatty acid translocase,” “scavenger receptor class B member 3,” “glycoprotein 88,” “glycoprotein IIIb,” “glycoprotein IV,” “thrombospondin receptor,” “GPIIIB,” “PAS IV,” “GP3B,” “GPIV,” “FAT,” “GP4,” “BDPLT10,” “SCARB3,” “CHDS7,” “PASIV,” or “PAS-4.” [0210] There are at least four known isoform of human CD36 protein, resulting from alternative splicing.
  • CD36 isoform 1 (UniProt identifier: P16671-1) consists of 472 amino acids and has been chosen as the canonical sequence (SEQ ID NO: 36).
  • CD36 isoform 2 (also known as "ex8-del") (UniProt identifier: P16671-2) consists of 288 amino acids and differs from the canonical sequence as follows: 274-288: SIYAVFESDVNLKGI ⁇ ETCVHFTSSFSVCKS; and 289-472: missing (SEQ ID NO: 37).
  • CD36 Isoform 3 (also known as "ex6-7-del") (UniProt identifier: P16671-3) consists of 433 amino acids and differs from the canonical sequence as follows: 234-272: missing (SEQ ID NO: 38).
  • CD36 isoform 4 (also known as "ex4-del” (UniProt identifier: P16671-4) consists of 412 amino acids and differs from the canonical sequence as follows: 144-203: missing (SEQ ID NO: 39). Table 5 below provides the sequences for the four CD36 isoforms. Table 5.
  • a miR-485 inhibitor disclosed herein can increase the expression of CD36 isoform 1.
  • a miR-485 inhibitor disclosed herein can increase the expression of CD36 isoform 2.
  • a miR-485 inhibitor disclosed herein can increase the expression of CD36 isoform 3.
  • a miR-485 inhibitor disclosed herein can increase the expression of CD36 isoform 4.
  • a miR-485 inhibitor disclosed herein can increase the expression of both CD36 isoform 1 and isoform 2, and/or isoform 3 and isoform 4, and/or isoform 1 and isoform 4, and/or isoform 2 and isoform 3.
  • a miR-485 inhibitor disclosed herein can increase the expression of all CD36 isoforms. Unless indicated otherwise, isoform 1, isoform 2, isoform 3, and isoform 4 are collectively referred to herein as "CD36.” [0212] In some aspects, contacting a cell with a miR-485 inhibitor provided herein is capable of increasing the expression of CD36 in the cell by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100%, as compared to a reference cell (e.g., corresponding cell that has not been contacted with the miR-485 inhibitor).
  • a reference cell e.g., corresponding cell that has not been contacted with the miR-485 inhibitor.
  • contacting a cell with a miR-485 inhibitor increases the expression and/or activity of CD36 protein and/or CD36 gene in the cell by at least about 1-fold, at least about 2- fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more, compared to the expression and/or activity in a reference cell (e.g., corresponding cell that has not been contacted with the miR-485 inhibitor).
  • a reference cell e.g., corresponding cell that has not been contacted with the miR-485 inhibitor.
  • a miR-485 inhibitor disclosed herein increases the expression of CD36 protein and/or CD36 gene by reducing the expression and/or activity of miR-485, e.g., miR-485-3p.
  • a miR-485 inhibitor of the present disclosure can reduce the expression and/or activity of miR-485-3p, which can in turn help extend the length and/or protect against a reduction in the length of a telomere in the cell.
  • contacting a miR-485 inhibitor described herein with a cell can increase the expression of a PGC-1 ⁇ protein and/or a PGC-1 ⁇ gene in the cell.
  • a cell e.g., neural stem cell
  • increasing the expression of PGC-1 ⁇ comprises (i) increasing the expression of PGC-1 ⁇ protein, (ii) increasing the expression of PGC-1 ⁇ gene, or (iii) both (i) and (ii).
  • the increase in the expression of the PGC-1 ⁇ protein and/or PGC-1 ⁇ gene can help extend the length and/or protect against a reduction in the length of a telomere in the cell.
  • a miR-485 inhibitor provided herein is capable of increasing the expression of both PGC-1 ⁇ and CTBP1. In some aspects, a miR-485 inhibitor provided herein is capable of increasing the expression of both PGC-1 ⁇ and TRIP6. In some aspects, a miR-485 inhibitor provided herein is capable of increasing the expression of both PGC-1 ⁇ and SIRT1. In some aspects, a miR-485 inhibitor provided herein is capable of increasing the expression of PGC-1 ⁇ and reducing the expression of c-Fos. In some aspects, a miR-485 inhibitor provided herein is capable of increasing the expression of PGC-1 ⁇ and increasing the expression of CD36.
  • a miR-485 inhibitor provided herein is capable of increasing the expression of PGC-1 ⁇ and any combination of the following: (i) increasing the expression of CTBP1, (ii) increasing the expression of TRIP6, (iii) increasing the expression of SIRT1, (iv) decreasing the expression of c-Fos, and (v) increasing the expression of CD36.
  • PGC1- ⁇ Peroxisome proliferator-activated receptor gamma coactivator 1-alpha
  • PPARG Coactivator 1 Alpha or Ligand Effect Modulator-6 is a protein that in humans is encoded by the PPARGC1A gene.
  • the PGC1- ⁇ gene is located on chromosome 4 in humans (nucleotides 23,792,021 to 24,472,905 of GenBank Accession Number NC_000004.12, plus strand orientation). Synonyms of the PGC1- ⁇ gene, and the encoded protein thereof, are known and include "PPARGC1A,” “LEM6,” “PGC1,” “PGC1A,” “PGC- 1v,” “PPARGC1, “PGC1alpha,” or “PGC-1(alpha).” [0216] There are at least nine known isoforms of human PGC1- ⁇ protein, resulting from alternative splicing.
  • PGC1- ⁇ isoform 1 (UniProt identifier: Q9UBK2-1) consists of 798 amino acids and has been chosen as the canonical sequence (SEQ ID NO: 40).
  • PGC1- ⁇ isoform 2 (also known as "Isoform NT-7a") (UniProt identifier: Q9UBK2-2) consists of 271 amino acids and differs from the canonical sequence as follows: 269-271: DPK ⁇ LFL; 272-798: Missing (SEQ ID NO: 41).
  • PGC1- ⁇ isoform 3 (also known as "Isoform B5") (UniProt identifier: Q9UBK2-3) consists of 803 amino acids and differs from the canonical sequence as follows: 1-18: MAWDMCNQDSESVWSDIE ⁇ MDETSPRLEEDWKKVLQREAGWQ (SEQ ID NO: 42).
  • PGC1- ⁇ isoform 4 (also known as "Isoform B4") (UniProt identifier: Q9UBK2-4) consists of 786 amino acids and differs from the canonical sequence as follows: 1-18: MAWDMCNQDSESVWSDIE ⁇ MDEGYF (SEQ ID NO: 43).
  • PGC1- ⁇ isoform 5 (also known as "Isoform B4-8a") (UniProt identifier: Q9UBK2-5) consists of 289 amino acids and differs from the canonical sequence as follows: 1-18: MAWDMCNQDSESVWSDIE ⁇ MDEGYF; 294-301: LTPPTTPP ⁇ VKTNLISK; 302-798: Missing (SEQ ID NO: 44).
  • PGC1- ⁇ isoform 6 (also known as "Isoform B5-NT") (UniProt identifier: Q9UBK2-6) consists of 276 amino acids and differs from the canonical sequence as follows: 1-18: MAWDMCNQDSESVWSDIE ⁇ MDETSPRLEEDWKKVLQREAGWQ; 269-271: DPK ⁇ LFL; 272-798: Missing (SEQ ID NO: 45).
  • PGC1- ⁇ isoform 7 (also known as "B4-3ext") (UniProt identifier: Q9UBK2-7) consists of 138 amino acids and differs from the canonical sequence as follows: 1-18: MAWDMCNQDSESVWSDIE ⁇ MDEGYF; 144-150: LKKLLLA ⁇ VRTLPTV; 151-798: Missing (SEQ ID NO: 46).
  • PGC1- ⁇ isoform 8 (also known as "Isoform 8a") (UniProt identifier: Q9UBK2-8) consists of 301 amino acids and differs from the canonical sequence as follows: 294-301: LTPPTTPP ⁇ VKTNLISK; 302- 798: Missing (SEQ ID NO: 47).
  • PGC1- ⁇ isoform 9 (also known as "Isoform 9" or "L-PGG- 1alpha") (UniProt identifier: Q9UBK2-9) consists of 671 amino acids and differs from the canonical sequence as follows: 1-127: Missing (SEQ ID NO: 48). Table 6 below provides the sequences for the nine PGC1- ⁇ isoforms. Table 6.
  • PGC1- ⁇ Protein Isoforms [0217] As used herein, the term "PGC1- ⁇ " includes any variants or isoforms of PGC1- ⁇ which are naturally expressed by cells. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 1. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 2. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 1. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 2.
  • a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 3.
  • a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 4.
  • a miR- 485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 5.
  • a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 6.
  • a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 7.
  • a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 8.
  • a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 9.
  • a miR-485 inhibitor disclosed herein can increase the expression of PGC1- ⁇ isoform 1, isoform 2, isoform 3, isoform 4, isoform 5, isoform 6, isoform 7, isoform 8, and isoform 9..
  • contacting a cell with a miR-485 inhibitor provided herein is capable of increasing the expression of PGC1- ⁇ in the cell by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100%, as compared to a reference cell (e.g., corresponding cell that has not been contacted with the miR-485 inhibitor).
  • contacting a cell with a miR-485 inhibitor increases the expression and/or activity of PGC1- ⁇ protein and/or PGC1- ⁇ gene in the cell by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6- fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more, compared to the expression and/or activity in a reference cell (e.g., corresponding cell that has not been contacted with the miR-485 inhibitor).
  • a reference cell e.g., corresponding cell that has not been contacted with the miR-485 inhibitor.
  • a miR-485 inhibitor disclosed herein increases the expression of PGC1- ⁇ protein and/or PGC1- ⁇ gene by reducing the expression and/or activity of miR-485, e.g., miR-485-3p.
  • a miR-485 inhibitor of the present disclosure can reduce the expression and/or activity of miR-485-3p, which can in turn help extend the length and/or protect against a reduction in the length of a telomere in the cell.
  • miRNA-485 Inhibitors Disclosed herein are compounds that can inhibit miR-485 activity (miR-485 inhibitor).
  • a miR-485 inhibitor of the present disclosure comprises a nucleotide sequence encoding a nucleotide molecule that comprises at least one miR-485 binding site, wherein the nucleotide molecule does not encode a protein.
  • the miR-485 binding site is at least partially complementary to the target miRNA nucleic acid sequence (i.e., miR-485), such that the miR-485 inhibitor hybridizes to the miR-485 nucleic acid sequence.
  • the miR-485 binding site of a miR inhibitor disclosed herein has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence of a miR-485.
  • the miR-485 binding site is fully complementary to the nucleic acid sequence of a miR-485.
  • the miR-485 hairpin precursor can generate both miR-485-5p and miR-485-3p.
  • miR-485" encompasses both miR-485-5p and miR-485- 3p unless specified otherwise.
  • the human mature miR-485-3p has the sequence 5' ( Q ; .
  • a 5' terminal subsequence of miR-485-3p 5'-UCAUACA-3' (SEQ ID NO: 49) is the seed sequence.
  • the human mature miR-485-5p has the sequence 5'- AGAGGCUGGCCGUGAUGAAUUC 3' (SEQ ID NO 33 miRBase Acc. No. MIMAT0002175).
  • a 5' terminal subsequence of miR-485-5p 5'-GAGGCUG-3' is the seed sequence.
  • the human mature miR-485-3p has significant sequence similarity to that of other species.
  • the mouse mature miR-485-3p differs from the human mature miR-485-3p by a single amino acid at each of the 5'- and 3'- ends (i.e., has an extra "A” at the 5'-end and missing "C” at the 3'-end).
  • the mouse mature miR-485-3p has the following sequence: 5'-AGUCAUACACGGCUCUCCUCUC-3' (SEQ ID NO: 34; miRBase Acc. No. MIMAT0003129; bolded and italicized portion corresponds to overlap to human mature miR-485-3p).
  • the sequence for the mouse mature miR-485-5p is identical to that of the human: 5'-agaggcuggccgugaugaauuc-3' (SEQ ID NO: 33; miRBase Acc. No. MIMAT0003128).
  • a miR-485 inhibitor disclosed herein is capable of binding to miR-485-3p and/or miR-485-5p from both human and mouse.
  • the miR-485 binding site is a single-stranded polynucleotide sequence that is complementary (e.g., fully complementary) to a sequence of a miR-485-3p (or a subsequence thereof).
  • the miR-485-3p subsequence comprises the seed sequence.
  • the miR-485 binding site has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence set forth in SEQ ID NO: 49.
  • the miR-485 binding site is complementary to miR-485-3p except for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches.
  • the miR-485 binding site is fully complementary to the nucleic acid sequence set forth in SEQ ID NO: 1.
  • the miR-485 binding site is a single-stranded polynucleotide sequence that is complementary (e.g., fully complementary) to a sequence of a miR-485-5p (or a subsequence thereof). In some aspects, the miR-485-5p subsequence comprises the seed sequence.
  • the miR-485 binding site has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence set forth in SEQ ID NO: 50.
  • the miR-485 binding site is complementary to miR-485-5p except for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches.
  • the miR-485 binding site is fully complementary to the nucleic acid sequence set forth in SEQ ID NO: 35.
  • the seed region of a miRNA forms a tight duplex with the target mRNA.
  • Most miRNAs imperfectly base-pair with the 3' untranslated region (UTR) of target mRNAs, and the 5' proximal "seed" region of miRNAs provides most of the pairing specificity.
  • UTR 3' untranslated region
  • the 5' proximal "seed" region of miRNAs provides most of the pairing specificity.
  • the first nine miRNA nucleotides (encompassing the seed sequence) provide greater specificity whereas the miRNA ribonucleotides 3' of this region allow for lower sequence specificity and thus tolerate a higher degree of mismatched base pairing, with positions 2-7 being the most important.
  • the miR-485 binding site comprises a subsequence that is fully complementary (i.e., 100% complementary) over the entire length of the seed sequence of miR- 485.
  • miRNA sequences and miRNA binding sequences that can be used in the context of the disclosure include, but are not limited to, all or a portion of those sequences in the sequence listing provided herein, as well as the miRNA precursor sequence, or complement of one or more of these miRNAs.
  • any aspects of the disclosure involving specific miRNAs or miRNA binding sites by name is contemplated also to cover miRNAs or complementary sequences thereof whose sequences are at least about at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the mature sequence of the specified miRNA
  • miRNA binding sequences of the present disclosure can include additional nucleotides at the 5′, 3′, or both 5′ and 3′ ends of those sequences in the sequence listing provided herein, as long as the modified sequence is still capable of specifically binding to miR-485.
  • miRNA binding sequences of the present disclosure can differ in at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides with respect to those sequence in the sequence listing provided, as long as the modified sequence is still capable of specifically binding to miR-485.
  • any methods and compositions discussed herein with respect to miRNA binding molecules or miRNA can be implemented with respect to synthetic miRNAs binding molecules.
  • a miRNA-485 inhibitor of the present disclosure comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 5' of the nucleotide sequence.
  • a miRNA-485 inhibitor comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 3' of the nucleotide sequence.
  • a miR-485 inhibitor disclosed herein is about 6 to about 30 nucleotides in length. In some aspects, a miR-485 inhibitor disclosed herein is 7 nucleotides in length. In some aspects, a miR-485 inhibitor disclosed herein is 8 nucleotides in length. In some aspects, a miR-485 inhibitor is 9 nucleotides in length. In some aspects, a miR-485 inhibitor of the present disclosure is 10 nucleotides in length. In some aspects, a miR-485 inhibitor is 11 nucleotides in length. In some aspects, a miR-485 inhibitor is 12 nucleotides in length. In some aspects, a miR-485 inhibitor disclosed herein is 13 nucleotides in length.
  • a miR-485 inhibitor disclosed herein is 14 nucleotides in length. In some aspects, a miR-485 inhibitor disclosed herein is 15 nucleotides in length. In some aspects, a miR-485 inhibitor is 16 nucleotides in length. In some aspects, a miR-485 inhibitor of the present disclosure is 17 nucleotides in length. In some aspects, a miR-485 inhibitor is 18 nucleotides in length. In some aspects, a miR-485 inhibitor is 19 nucleotides in length. In some aspects, a miR-485 inhibitor is 20 nucleotides in length. In some aspects, a miR-485 inhibitor of the present disclosure is 21 nucleotides in length.
  • a miR-485 inhibitor is 22 nucleotides in length.
  • a miR-485 inhibitor disclosed herein comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from SEQ ID NOs: 2 to 30.
  • a miR-485 inhibitor comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2 to 30, wherein the nucleotide sequence can optionally comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches.
  • a miRNA inhibitor comprises the sequence [0234] In some aspects, the miRNA inhibitor comprises the sequence 5 UGU UG C 3 [0235] In some aspects, the miRNA inhibitor has a sequence selected from the group consisting of: ( Q ), ( Q ), [0236] In some aspects, a miRNA inhibitor disclosed herein (i.e., miR-485 inhibitor) comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to 5'- In some aspects, the miRNA inhibitor comprises a nucleotide sequence that has at least 90% similarity to ( Q ) In some aspects, the miRNA inhibitor comprises the nucleotide sequence ( Q with one substitution or two substitutions.
  • the miRNA inhibitor comprises the nucleotide sequence ( Q ) . In some aspects, the miRNA inhibitor comprises the nucleotide sequence 5 28). In some aspects, the miRNA inhibitor comprises the nucleotide sequence [0237] In some aspects, a miRNA inhibitor disclosed herein (i.e., miR-485 inhibitor) comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to 5 ( Q ) .
  • the miRNA inhibitor comprises a nucleotide sequence that has at least 90% similarity to In some aspects, the miRNA inhibitor comprises the nucleotide sequence with one substitution or two substitutions. In some aspects, the miRNA inhibitor comprises the nucleotide sequence ( Q ).
  • the miRNA inhibitor comprises the nucleotide sequence [0238]
  • a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and at least one, at least two, at least three, at least four or at least five additional nucleic acid at the N terminus, at least one, at least two, at least three, at least four, or at least five additional nucleic acid at the C terminus, or both.
  • a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one additional nucleic acid at the N terminus and/or one additional nucleic acid at the C terminus.
  • a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one or two additional nucleic acids at the N terminus and/or one or two additional nucleic acids at the C terminus.
  • a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one to three additional nucleic acids at the N terminus and/or one to three additional nucleic acids at the C terminus.
  • a miR-485 inhibitor comprises 5 In some aspects, a miR-485 inhibitor comprises [0239] In some aspects, a miR-485 inhibitor of the present disclosure comprises one miR- 485 binding site. In some aspects, a miR-485 inhibitor disclosed herein comprises at least two miR-485 binding sites. In some aspects, a miR-485 inhibitor comprises three miR-485 binding sites. In some aspects, a miR-485 inhibitor comprises four miR-485 binding sites. In some aspects, a miR-485 inhibitor comprises five miR-485 binding sites. In some aspects, a miR- 485 inhibitor comprises six or more miR-485 binding sites. In some aspects, all the miR-485 binding sites are identical. In some aspects, all the miR-485 binding sites are different.
  • a miR-485 binding sites is different. In some aspects, all the miR-485 binding sites are miR-485-3p binding sites. In some aspects, all the miR-485 binding sites are miR-485-5p binding sites. In some aspects, a miR-485 inhibitor comprises at least one miR- 485-3p binding site and at least one miR-485-5p binding site.
  • Chemically Modified Polynucleotides [0240] In some aspects, a miR-485 inhibitor disclosed herein comprises a polynucleotide which includes at least one chemically modified nucleoside and/or nucleotide.
  • a “nucleoside” refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as “nucleobase”).
  • a “nucleotide” refers to a nucleoside including a phosphate group.
  • Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides.
  • Polynucleotides can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides.
  • the modified polynucleotides disclosed herein can comprise various distinct modifications. In some aspects, the modified polynucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications.
  • a modified polynucleotide can exhibit one or more desirable properties, e.g., improved thermal or chemical stability, reduced immunogenicity, reduced degradation, increased binding to the target microRNA, reduced non-specific binding to other microRNA or other molecules, as compared to an unmodified polynucleotide.
  • a polynucleotide of the present disclosure e.g., a miR-485 inhibitor is chemically modified.
  • the terms "chemical modification” or, as appropriate, “chemically modified” refer to modification with respect to adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C) ribo- or deoxyribonucleosides in one or more of their position, pattern, percent or population, including, but not limited to, its nucleobase, sugar, backbone, or any combination thereof.
  • a polynucleotide of the present disclosure can have a uniform chemical modification of all or any of the same nucleoside type or a population of modifications produced by downward titration of the same starting modification in all or any of the same nucleoside type, or a measured percent of a chemical modification of all any of the same nucleoside type but with random incorporation
  • the polynucleotide of the present disclosure e.g., a miR-485 inhibitor
  • Modified nucleotide base pairing encompasses not only the standard adenine- thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non- standard base structures.
  • non-standard base pairing is the base pairing between the modified nucleobase inosine and adenine, cytosine or uracil.
  • TD's of the present disclosure can be administered as RNAs, as DNAs, or as hybrid molecules comprising both RNA and DNA units.
  • the polynucleotide (e.g., a miR-485 inhibitor) includes a combination of at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20 or more) modified nucleobases.
  • the nucleobases, sugar, backbone linkages, or any combination thereof in a polynucleotide are modified by at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100%.
  • the chemical modification is at nucleobases in a polynucleotide of the present disclosure (e.g., a miR-485 inhibitor).
  • the at least one chemically modified nucleoside is a modified uridine (e.g., pseudouridine ( ⁇ ), 2-thiouridine (s2U), 1- methyl-pseudouridine (m1 ⁇ ), 1-ethyl-pseudouridine (e1 ⁇ ), or 5-methoxy-uridine (mo5U)), a modified cytosine (e.g., 5-methyl-cytidine (m5C)) a modified adenosine (e.g, 1-methyl- adenosine (m1A), N6-methyl-adenosine (m6A), or 2-methyl-adenine (m2A)), a modified guanosine (e.g., 7-methyl-guanosine (m7G) or 1-methyl-guanosine
  • the polynucleotide of the present disclosure is uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification.
  • a polynucleotide can be uniformly modified with the same type of base modification, e.g., 5-methyl-cytidine (m5C), meaning that all cytosine residues in the polynucleotide sequence are replaced with 5-methyl-cytidine (m5C).
  • m5C 5-methyl-cytidine
  • a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified nucleoside such as any of those set forth above.
  • the polynucleotide of the present disclosure includes a combination of at least two (e.g., 2, 3, 4 or more) of modified nucleobases.
  • the polynucleotide of the present disclosure can include any useful linkage between the nucleosides.
  • linkages, including backbone modifications, that are useful in the composition of the present disclosure include, but are not limited to the following: 3'-alkylene phosphonates, 3'-amino phosphoramidate, alkene containing backbones, aminoalkylphosphoramidates, aminoalkylphosphotriesters, boranophosphates, -CH 2 -O-N(CH 3 )-CH 2 -, -CH 2 -N(CH 3 )-N(CH 3 )-CH 2 -, -CH 2 -NH-CH 2 -, chiral phosphonates, chiral phosphorothioates, formacetyl and thioformacetyl backbones, methylene (methylimino), methylene formacetyl and thioformacetyl backbones, methylene (methylimino), methylene formacetyl and
  • the presence of a backbone linkage disclosed above increase the stability and resistance to degradation of a polynucleotide of the present disclosure (i.e., miR- 485 inhibitor).
  • at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% of the backbone linkages in a polynucleotide of the present disclosure (i.e., miR-485 inhibitor) are modified (e.g., all of them are phosphorothioate).
  • a backbone modification that can be included in a polynucleotide of the present disclosure comprises phosphorodiamidate morpholino oligomer (PMO) and/or phosphorothioate (PS) modification.
  • PMO phosphorodiamidate morpholino oligomer
  • PS phosphorothioate
  • Sugar modifications [0257] The modified nucleosides and nucleotides which can be incorporated into a polynucleotide of the present disclosure (i.e., miR-485 inhibitor) can be modified on the sugar of the nucleic acid.
  • a miR-485 inhibitor described herein comprises a nucleic acid which comprises at least one nucleoside analog (e.g., a nucleoside with a sugar modification).
  • the sugar modification increases the affinity of the binding of a miR-485 inhibitor to miR-485 nucleic acid sequence.
  • Incorporating affinity- enhancing nucleoside analogues in the miR-485 inhibitor, such as LNA or 2'-substituted sugars, can allow the length and/or the size of the miR-485 inhibitor to be reduced.
  • sugar modifications e.g., LNA
  • RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen.
  • modified nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone); multicyclic forms (e.g., tricyclo; and "unlocked" forms, such as glycol nucleic acid (GNA) (e.
  • GAA glyco
  • the sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose.
  • a polynucleotide molecule can include nucleotides containing, e.g., arabinose, as the sugar.
  • the 2′ hydroxyl group (OH) of ribose can be modified or replaced with a number of different substituents.
  • substitutions at the 2′-position include, but are not limited to, H, halo, optionally substituted C 1-6 alkyl; optionally substituted C 1-6 alkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 3-8 cycloalkyl; optionally substituted C 3-8 cycloalkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 6-10 aryl-C1-6 alkoxy, optionally substituted C 1-12 (heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG), -O(CH 2 CH 2 O) n CH 2 CH 2 OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1
  • nucleoside analogues present in a polynucleotide of the present disclosure comprise, e.g., 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-O-alkyl-SNA, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, arabino nucleic acid (ANA) units, 2'-fluoro-ANA units, HNA units, INA (intercalating nucleic acid) units, 2'MOE units, or any combination thereof.
  • ANA arabino nucleic acid
  • INA intercalating nucleic acid
  • the LNA is, e.g., oxy-LNA (such as beta- D-oxy-LNA, or alpha-L-oxy-LNA), amino-LNA (such as beta-D-amino-LNA or alpha-L- amino-LNA), thio-LNA (such as beta-D-thio0-LNA or alpha-L-thio-LNA), ENA (such a beta- D-ENA or alpha-L-ENA), or any combination thereof.
  • oxy-LNA such as beta- D-oxy-LNA, or alpha-L-oxy-LNA
  • amino-LNA such as beta-D-amino-LNA or alpha-L- amino-LNA
  • thio-LNA such as beta-D-thio0-LNA or alpha-L-thio-LNA
  • ENA such a beta- D-ENA or alpha-L-ENA
  • nucleoside analogues that can be included in a polynucleotide of the present disclosure comprises a locked nucleic acid (LNA), an unlocked nucleic acid (UNA), an arabino nucleic acid (ABA), a bridged nucleic acid (BNA), and/or a peptide nucleic acid (PNA).
  • LNA locked nucleic acid
  • UNA unlocked nucleic acid
  • ABA arabino nucleic acid
  • BNA bridged nucleic acid
  • PNA peptide nucleic acid
  • nucleoside analog comprises a LNA; 2'-0-alkyl-RNA; 2'-amino-DNA; 2'-fluoro-DNA; arabino nucleic acid (ANA); 2'-fluoro-ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleoside (cEt), 2'-0-methyl nucleic acid (2'-OMe), 2'-0- methoxyethyl nucleic acid (2'-MOE), or any combination thereof.
  • a polynucleotide of the present disclosure can comprise both modified RNA nucleoside analogues (e.g., LNA) and DNA units.
  • a miR-485 inhibitor is a gapmer. See, e.g., U.S. Pat. Nos. 8,404,649; 8,580,756; 8,163,708; 9,034,837; all of which are herein incorporated by reference in their entireties.
  • a miR-485 inhibitor is a micromir. See U.S. Pat. Appl. Publ. No. US20180201928, which is herein incorporated by reference in its entirety.
  • a polynucleotide of the present disclosure can include modifications to prevent rapid degradation by endo- and exo-nucleases.
  • Modifications include, but are not limited to, for example, (a) end modifications, e.g., 5' end modifications (phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.), (b) base modifications, e.g., replacement with modified bases, stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar, as well as (d) internucleoside linkage modifications, including modification or replacement of the phosphodiester linkages.
  • end modifications e.g., 5' end modifications (phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (conjugation
  • the miR-485 inhibitors of the present disclosure can be administered, e.g., to a subject suffering from an age-associated disease or condition, using any relevant delivery system known in the art.
  • the delivery system is a vector.
  • the present disclosure provides a vector comprising a miR-485 inhibitor of the present disclosure.
  • the vector is viral vector.
  • the viral vector is an adenoviral vector or an adeno-associated viral vector.
  • the viral vector is an AAV that has a serotype of AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or any combination thereof.
  • the adenoviral vector is a third generation adenoviral vector.
  • ADEASYTM is by far the most popular method for creating adenoviral vector constructs. The system consists of two types of plasmids: shuttle (or transfer) vectors and adenoviral vectors. The transgene of interest is cloned into the shuttle vector, verified, and linearized with the restriction enzyme PmeI. This construct is then transformed into ADEASIER-1 cells, which are BJ5183 E. coli cells containing PADEASYTM.
  • PADEASYTM is a ⁇ 33Kb adenoviral plasmid containing the adenoviral genes necessary for virus production.
  • the shuttle vector and the adenoviral plasmid have matching left and right homology arms which facilitate homologous recombination of the transgene into the adenoviral plasmid.
  • Recombinant adenoviral plasmids are then verified for size and proper restriction digest patterns to determine that the transgene has been inserted into the adenoviral plasmid, and that other patterns of recombination have not occurred. Once verified, the recombinant plasmid is linearized with PacI to create a linear dsDNA construct flanked by ITRs.293 or 911 cells are transfected with the linearized construct, and virus can be harvested about 7-10 days later.
  • PacI PacI
  • ITRs.293 or 911 cells are transfected with the linearized construct, and virus can be harvested about 7-10 days later.
  • other methods for creating adenoviral vector constructs known in the art at the time the present application was filed can be used to practice the methods disclosed herein.
  • the viral vector is a retroviral vector, e.g., a lentiviral vector (e.g., a third or fourth generation lentiviral vector).
  • Lentiviral vectors are usually created in a transient transfection system in which a cell line is transfected with three separate plasmid expression systems. These include the transfer vector plasmid (portions of the HIV provirus), the packaging plasmid or construct, and a plasmid with the heterologous envelop gene (env) of a different virus.
  • the three plasmid components of the vector are put into a packaging cell which is then inserted into the HIV shell.
  • the virus portions of the vector contain insert sequences so that the virus cannot replicate inside the cell system.
  • AAV vector Any AAV vector known in the art can be used in the methods disclosed herein.
  • the AAV vector can comprise a known vector or can comprise a variant, fragment, or fusion thereof.
  • the AAV vector is selected from the group consisting of AAV type 1 (AAV1), AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, bovine AAV, shrimp AAV, snake AAV, and any combination thereof.
  • AAV type 1 AAV1
  • AAV2 AAV3A
  • AAV3B AAV4
  • AAV5 AAV6, AAV7, AAV8, AAV9
  • AAV10 AAV11, AAV12, AAV13, AAVrh.74
  • avian AAV bovine AAV
  • bovine AAV canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, bovine AAV, shrimp A
  • the AAV vector is derived from an AAV vector selected from the group consisting of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, and any combination thereof.
  • the AAV vector is a chimeric vector derived from at least two AAV vectors selected from the group consisting of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, and any combination thereof.
  • the AAV vector comprises regions of at least two different AAV vectors known in the art.
  • the AAV vector comprises an inverted terminal repeat from a first AAV (e.g., AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, or any derivative thereof) and a second inverted terminal repeat from a second AAV (e.g., AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate
  • the AAV vector comprises a portion of an AAV vector selected from the group consisting of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, and any combination thereof.
  • the AAV vector comprises AAV2.
  • the AAV vector comprises a splice acceptor site.
  • the AAV vector comprises a promoter. Any promoter known in the art can be used in the AAV vector of the present disclosure.
  • the promoter is an RNA Pol III promoter.
  • the RNA Pol III promoter is selected from the group consisting of the U6 promoter, the H1 promoter, the 7SK promoter, the 5S promoter, the adenovirus 2 (Ad2) VAI promoter, and any combination thereof.
  • the promoter is a cytomegalovirus immediate-early gene (CMV) promoter, an EF1a promoter, an SV40 promoter, a PGK1 promoter, a Ubc promoter, a human beta actin promoter, a CAG promoter, a TRE promoter, a UAS promoter, a Ac5 promoter, a polyhedrin promoter, a CaMKIIa promoter, a GAL1 promoter, a GAL10 promoter, a TEF promoter, a GDS promoter, a ADH1 promoter, a CaMV35S promoter, or a Ubi promoter.
  • the promoter comprises the U6 promoter.
  • the AAV vector comprises a constitutively active promoter (constitutive promoter).
  • the constitutive promoter is selected from the group consisting of hypoxanthine phosphoribosyl transferase (HPRT), adenosine deaminase, pyruvate kinase, beta-actin promoter, cytomegalovirus (CMV), simian virus (e.g., SV40), papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, a retrovirus long terminal repeat (LTR), Murine stem cell virus (MSCV) and the thymidine kinase promoter of herpes simplex virus.
  • HPRT hypoxanthine phosphoribosyl transferase
  • CMV cytomegalovirus
  • simian virus e.g., SV40
  • papilloma virus adenovirus
  • the promoter is an inducible promoter.
  • the inducible promoter is a tissue specific promoter.
  • the tissue specific promoter drives transcription of the coding region of the AAV vector in a neuron, a glial cell, or in both a neuron and a glial cell.
  • the AAV vector comprises one or more enhancers.
  • the one or more enhancer are present in the AAV alone or together with a promoter disclosed herein.
  • the AAV vector comprises a 3'UTR poly(A) tail sequence.
  • the 3'UTR poly(A) tail sequence is selected from the group consisting of bGH poly(A), actin poly(A), hemoglobin poly(A), and any combination thereof. In some aspects, the 3'UTR poly(A) tail sequence comprises bGH poly(A). [0278] In some aspects, a miR-485 inhibitor disclosed herein is administered with a delivery agent.
  • Non-limiting examples of delivery agents that can be used include an exosome, a lipidoid, a liposome, a lipoplex, a lipid nanoparticle, an extracellular vesicle, a synthetic vesicle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, a micelle, a viral vector, a conjugate, and combinations thereof.
  • Carrier Units [0279]
  • the present disclosure also provides a composition comprising a miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) and a delivery agent.
  • the delivery agent comprises a carrier unit, e.g., that can self-assemble into micelles or be incorporated into micelles. Therefore, the present disclosure also provides a micelle comprising a miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) wherein the miRNA inhibitor and the delivery agent are associated with each other.
  • a miR-485 inhibitor provided herein can be administered (e.g., to a subject suffering from an age-associated disease or condition) using a carrier unit.
  • carrier units of the present disclosure comprise a water-soluble biopolymer moiety (e.g., PEG), a charged carrier moiety, a crosslinking moiety, and an adjuvant moiety.
  • the charged carrier moiety is cationic (e.g., a polylysine).
  • the resulting carrier unit:payload (i.e., miR-485 inhibitor) complex can have a "head” comprising the water-soluble biopolymer moiety and a "tail” comprising the cationic carrier moiety electrostatically bound to the payload.
  • Carrier unit:payload (i.e., miR-485 inhibitor) complexes can self-associate, alone or in combination with other molecules, to yield micelles in which the payload (i.e., miR-485 inhibitor) is located in the core of the micelle and the water-soluble biopolymer moiety is facing the solvent.
  • the term "micelles of the present disclosure” encompasses not only classic micelles but also small particles, small micelles, micelles, rod-like structures, or polymersomes. Given that polymersomes comprise a luminal space, it is to be understood that all the disclosures related to the "core" of classic micelles are equally applicable to the luminal space in polymersomes comprising carrier units of the present disclosure.
  • the carrier units of the present disclosure can also comprise a targeting moiety (e.g., a targeting ligand) covalently linked to the water-soluble biopolymer moiety via one or more optional linkers.
  • a targeting moiety e.g., a targeting ligand
  • the targeting moiety can be located on the surface of the micelle and can deliver the micelle to a specific target tissue, to a specific cell type, and/or facilitate transport across a physiological barrier (e.g., cell plasma membrane).
  • the micelles of the present disclosure can comprises more than one type of targeting moieties.
  • the carrier units of the present disclosure can also comprise an adjuvant moiety (AM) covalently linked to the charged cationic carrier moiety.
  • the adjuvant moiety can have, e.g., a therapeutic, a co-therapeutic effect, or positively affect the homeostasis of the target cell or target tissue.
  • the AM comprises one or more amino acids.
  • the AM comprises one or more amino acids linked to an adjuvant molecule (e.g., a vitamin). In some aspects, the AM comprises one or more lysine residues covalently bound to an adjuvant molecule (e.g., a vitamin). Adjuvant moiety (AM) can also be referred to as a hydrophobic moiety (HM). [0283] In some aspects, the miR-485 inhibitor is not covalently linked to the carrier unit. In some aspects, the miR-485 inhibitor can be covalently linked to the cationic carrier unit, e.g., a linker such as cleavable linker.
  • the delivery agent comprises a cationic carrier unit comprising [WP]-L1-[CC]-L2-[AM] (formula I) or [WP]-L1-[AM]-L2-[CC] (formula II) wherein WP is a water-soluble biopolymer moiety; CC is a positively charged (i.e., cationic) carrier moiety; AM is an adjuvant moiety; and, L1 and L2 are independently optional linkers, and wherein when mixed with a nucleic acid at an ionic ratio of about 1:1, the cationic carrier unit forms a micelle.
  • a delivery agent useful for the present disclosure comprises cationic carrier units of Schema I through Schema VI: [CC]-L1-[CM]-L2-[AM] (Schema I); [CC]-L1-[AM]-L2-[CM] (Schema II); [AM]-L1-[CM]-L2-[CC] (Schema III); [AM]-L1-[CC]-L2-[CM] (Schema IV); [CM]-L1-[CC]-L2-[AM] (Schema V); or [CM]-L1-[AM]-L2-[CC] (Schema VI); wherein CC is a cationic carrier moiety, e.g., a polylysine; CM is
  • the cationic carrier unit further comprises a water-soluble polymer (WP).
  • WP water-soluble polymer
  • the water-soluble polymer is attached to [CC], [AM], and/or [CM].
  • the water-soluble polymer is attached to the N terminus of [CC], [AM], or [CM].
  • the water-soluble polymer is attached to the N terminus of [CC].
  • the water-soluble polymer is attached to the C terminus of [CC], [AM], or [CM].
  • the water-soluble polymer is attached to the C terminus of [CC].
  • the cationic carrier unit comprises: [WP]-L3-[CC]-L1-[CM]-L2-[AM] (Schema I’); [WP]-L3-[CC]-L1-[AM]-L2-[CM] (Schema II’); [WP]-L3-[AM]-L1-[CM]-L2-[CC] (Schema III’); [WP]-L3-[AM]-L1-[CC]-L2-[CM] (Schema IV’); [WP]-L3-[CM]-L1-[CC]-L2-[AM] (Schema V’); or [WP]-L3-[CM]-L1-[AM]-L2-[CC] (Schema VI’).
  • the [WP] component can be connected to at least one targeting moiety, i.e., [T]n-[WP]-... wherein n is an integer, e.g., 1, 2 or 3.
  • the carrier unit can comprise the CC, CM, and AM moieties in a linear fashion.
  • the carrier units can comprises the CC, CM, and AM moieties organized in a branched scaffold arrangement, for example, with (i) a polymeric CC moiety comprising positively charged units (e.g., polylysines) and (ii) a CMs (e.g., lysine linked to a crosslinking agent, e.g., lysine-thiol) attached to the N or C terminus of the CC moiety and (iii) a AM (e.g., lysine linked to an adjuvant agent, e.g., lysine linked to Vitamin B3) attached to the N or C terminus of the CM moiety.
  • a polymeric CC moiety comprising positively charged units (e.g., polylysines) and (ii) a CMs (e.g., lysine linked to a crosslinking agent, e.g., lysine-thiol) attached to the N or C terminus of the
  • the carrier units can comprises the CC, CM, and AM moieties organized in a branched scaffold arrangement, for example, with (i) a polymeric CC moiety comprising positively charged units (e.g., polylysines) and (ii) a CMs (e.g., lysine linked to a crosslinking agent, e.g., lysine-thiol) attached to the N or C terminus of the CC moiety and (iii) a AM (e.g., lysine linked to an adjuvant agent, e.g., lysine linked to Vitamin B3) attached to the N or C terminus of the CM moiety.
  • a polymeric CC moiety comprising positively charged units (e.g., polylysines) and (ii) a CMs (e.g., lysine linked to a crosslinking agent, e.g., lysine-thiol) attached to the N or C terminus of the
  • cationic carrier units of the present disclosure are mixed with an anionic payload (e.g., a nucleic acid) at an ionic ratio of about 20:about 1, i.e., the number of negative charges in the anionic payload is about 20 times higher than the number of positive charges in the cationic carrier moiety, to about 20:1, i.e., the number of positive charges in the cationic carrier moiety is about ten times higher than the number of negative charges in the anionic payload
  • the neutralization of negative charges in the anionic payload by positive charges in the cationic carrier moiety mainly via electrostatic interaction leads to the formation of a cationic carrier unit:anionic payload complex having an unaltered hydrophilic portion (comprising the WP moiety) and a substantially more hydrophobic portion (resulting from the association between the cationic carrier moiety plus hydrophobic moiety and the anionic payload).
  • the adjuvant moiety can contribute its own positive charges to the positive charges of the cationic carrier moiety, which would interact with the negative charges of the anionic payload (e.g., polynucleotides disclosed herein). It is to be understood that references to the interactions (e.g., electrostatic interactions) between a cationic carrier moiety and an anionic payload (e.g., polynucleotides disclosed herein) also encompass interactions between the charges of a cationic carrier moiety plus adjuvant moiety and the charges of an anionic payload.
  • amphipathic complex results in an amphipathic complex.
  • amphipathic complexes can self-organize, alone or combination with other amphipathic components, into micelles.
  • the resulting micelles comprise the WP moieties facing the solvent (i.e., the WP moieties are facing the external surface of the micelle), whereas the CC and AM moieties as well as the associate payload (e.g., a nucleotide sequence, e.g., RNA, DNA, or any combination thereof) are in the core of the micelle.
  • the composition comprises a water-soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3.
  • the composition comprises a water-soluble biopolymer moiety with about 100 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 100 lysines (e.g., about 80 lysines), and an adjuvant moiety with about 5 to about 50 vitamin B3 (e.g., about 35 vitamin B3).
  • the composition comprises (i) a water-soluble biopolymer moiety with about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (e.g., about 16 lysines, each with a thiol group), and (iv) about 30 to 40 lysines fused to vitamin B3 (e.g., about 32 lysines, each fused to vitamin B3).
  • an amine group e.g., about 32 lysines
  • a thiol group e.g., about 16 lysines, each with a thiol group
  • vitamin B3 e.g., about 32 lysines, each fused to vitamin B3
  • the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the water soluble polymer.
  • a targeting moiety e.g., a LAT1 targeting ligand, e.g., phenyl alanine
  • the thiol groups in the composition form disulfide bonds.
  • the composition comprises (i) a water-soluble biopolymer moiety with about 100 to about 200 PEG units, (ii) about 30 to about 100 lysines with an amine group (e.g., about 40 lysines), (iii) about 1 to about 20 lysines, each having a thiol group (e.g., about 5 lysines, each with a thiol group), and (iv) about 5 to 50 lysines fused to vitamin B3 (e.g., about 35 lysines, each fused to vitamin B3).
  • an amine group e.g., about 40 lysines
  • a thiol group e.g., about 5 lysines, each with a thiol group
  • vitamin B3 e.g., about 35 lysines, each fused to vitamin B3
  • the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the water soluble polymer.
  • a targeting moiety e.g., a LAT1 targeting ligand, e.g., phenyl alanine
  • the thiol groups in the composition form disulfide bonds.
  • the composition comprises (1) a micelle comprising (i) about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (e.g., about 16 lysines, each with a thiol group), and (iv) about 30 to 40 lysines fused to vitamin B3 (e.g., about 32 lysines, each fused to vitamin B3), and (2) a miR-485 inhibitor (e.g., SEQ ID NO: 30), wherein the miR-485 inhibitor is encapsulated within the micelle.
  • a micelle comprising (i) about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (
  • the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the PEG units.
  • a targeting moiety e.g., a LAT1 targeting ligand, e.g., phenyl alanine
  • the thiol groups in the micelle form disulfide bonds.
  • the composition comprises (1) a micelle comprising (i) about 100 to about 200 PEG units (e.g., about 114 units), (ii) about 30 to about 100 lysines with an amine group (e.g., about 40 lysines), (iii) about 3 to about 50 lysines, each having a thiol group (e.g., about 35 lysines, each with a thiol group), and (iv) about 2 to about 20 lysines fused to vitamin B3 (e.g., about 5 lysines, each fused to vitamin B3), and (2) an isolated polynucleotide described herein (e.g., miR-485 inhibitor), wherein the isolated polynucleotide is encapsulated within the micelle.
  • a micelle comprising (i) about 100 to about 200 PEG units (e.g., about 114 units), (ii) about 30 to about 100 lysines with an amine group (e.g., about 40
  • the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the PEG units.
  • a targeting moiety e.g., a LAT1 targeting ligand, e.g., phenyl alanine
  • the thiol groups in the micelle form disulfide bonds.
  • the cationic carrier unit comprises: (a) a WP moiety, wherein the water-soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), wherein n is between about 120 to about PEG 130 (e.g., PEG is a PEG5000 or a PEG6000); (b) a CC moiety, wherein the cationic carrier moiety comprises, e.g., about 20 to about 100 lysines (e.g., a linear poly(L-lysine)n wherein n is between about 30 and about 40), a polyethylenimine (PEI), or chitosan; (c) a CM moiety, wherein the crosslinking moiety comprises about 10 to about 50 lysines, each of which is linked to a crosslinking agent, e.g., 10-40 lysine-thiol, and (d) an AM moiety, wherein the adjuvant moiety has about 1 to about 20
  • PEG polyethylene glyco
  • the cationic carrier unit comprises: (a) a WP moiety, wherein the water-soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), wherein n is between about 120 to about PEG 130 (e.g., PEG is a PEG5000 or a PEG6000); (b) a CC moiety, wherein the cationic carrier moiety comprises, e.g., about 20 to about 100 lysines (e.g., a linear poly(L-lysine)n wherein n is between about 30 and about 40), a polyethyleneimine (PEI), or chitosan; (c) a CM moiety, wherein the crosslinking moiety comprises about 10 to about 50 lysines, each of which is linked to a crosslinking agent, e.g., 10-40 lysine-thiol, and (d) an AM moiety, wherein the adjuvant moiety has about 1 to about 10 ly
  • PEG polyethylene glyco
  • the cationic carrier unit comprises: (a) a WP moiety, wherein the water-soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), wherein n is between about 120 to about PEG 130 (e.g., PEG is a PEG5000 or a PEG6000); (b) a CC moiety, wherein the cationic carrier moiety comprises, e.g., about 20 to about 100 lysines (e.g., a linear poly(L-lysine)n wherein n is between about 30 and about 40), a polyethyleneimine (PEI), or chitosan; (c) a CM moiety, wherein the crosslinking moiety comprises about 10 to about 50 lysines, each of which is linked to a crosslinking agent, e.g., 10-40 lysine-thiol, and (d) an AM moiety, wherein the adjuvant moiety has about 5 to about 10 ly
  • PEG polyethylene glyco
  • the cationic carrier unit comprises: (a) a WP moiety, wherein the water-soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), wherein n is between about 120 to about PEG 130 (e.g., PEG is a PEG5000 or a PEG6000); (b) a CC moiety, wherein the cationic carrier moiety comprises, e.g., about 20 to about 100 lysines (e.g., a linear poly(L-lysine)n, wherein n is between about 30 and about 40, e.g., about 40), a polyethyleneimine (PEI), or chitosan; (c) a CM moiety, wherein the crosslinking moiety comprises about 10 to about 50 lysines, each of which is linked to a crosslinking agent, e.g., 10-40 lysine-thiol, e.g., 35 lysine-thiol
  • PEG polyethylene glyco
  • the cationic carrier unit further comprises at least one targeting moiety attached to the WP moiety of the cationic carrier unit.
  • the number and/or density of targeting moieties displayed on the surface of the micelle can be modulated by using a specific ratio of cationic carrier units having targeting moieties to cationic carrier units not having targeting moieties.
  • the ratio of cationic carrier units having a targeting moiety to cationic carrier units not having a targeting moiety is at least about 1:5, at least about 1:10, at least about 1:20, at least about 1:30, at least about 1:40, at least about 1:50, at least about 1:60, at least about 1:70, at least about 1:80, at least about 1:90, at least about 1:100, at least about 1:120, at least about 1:140, at least about 1:160, at least about 1:180, at least about 1:200, at least about 1:250, at least about 1:300, at least about 1:350, at least about 1:400, at least about 1:450, at least about 1:500, at least about 1:600, at least about 1:700, at least about 1:800, at least about 1:900, or at least about 1:1000.
  • the cationic carrier unit comprises (i) a targeting moiety (A) which targets the transporter LAT1 (e.g., phenylalanine), (ii) a water soluble polymer which is PEG, (iii) a cationic carrier moiety comprising cationic polymer blocks which are lysine (iv) a crosslinking moiety comprising crosslinking polymer blocks which are lysines linked to crosslinking moieties, and (v) an adjuvant moiety comprising hydrophobic polymer blocks which are lysines linked to vitamin B3.
  • a targeting moiety A
  • targets the transporter LAT1 e.g., phenylalanine
  • a water soluble polymer which is PEG
  • a cationic carrier moiety comprising cationic polymer blocks which are lysine
  • iv a crosslinking moiety comprising crosslinking polymer blocks which are lysines linked to crosslinking moieties
  • an adjuvant moiety compris
  • a targeting moiety A
  • the transporter LAT1 e.g., phenylalanine
  • A which targets the transporter LAT1 (e.g., phenylalanine)
  • the number (percentage) of AM is less than 39%, less than about 35%, less than about 30%, less than about 25%, less than about 20%, less than about 15%, less than about 10%, less than about 9%, less than about 8%, less than about 7%, less than about 6%, less than about 5%, less than about 4%, less than about 3%, less than about 2%, or about 1% relative to [CC] and [CM].
  • the number (percentage) of AM is between about 35% and about 1%, about 35% and about 5%, about 35% and about 10%, about 35% and about 15%, about 35% and about 20%, about 35% and about 25%, about 35% and about 30%, about 30% and about 1%, about 30% and about 5%, about 30% and about 10%, about 30% and about 15%, about 30% and about 20%, about 30% and about 25%, about 25% and about 1%, about 25% and about 5%, about 25% and about 10%, about 25% and about 15%, about 25% and about 20%, about 20% and about 1%, about 20% and about 5%, about 20% and about 10%, about 20% and about 15%, about 15% and about 1%, about 15% and about 5%, about 15% and about 10%, about 10% and about 1%, or about 10% and about 5% relative to [CC] and [CM].
  • the number (percentage) of AM is between about 39% and about 30%, about 30% and about 20%, about 20% and about 10%, about 10% and about 5%, and about 5% and about 1% relative to [CC] and [CM]. In some aspects, the number (percentage) of AM is about 39%, about 30%, about 25%, about 20%, about 15%, about 10%, about 5%, or about 1% relative to [CC] and [CM]. In some aspects, the number of AM is expressed as the percentage of [AM] relative to [CC] and [CM].
  • the vitamin B3 unit are introduced into the side chains of the AM moiety, e.g., by a coupling reaction between NH2 groups in the lysines and COOH groups of vitamin B3, in the presence of suitable conjugation reagents, for example, 1-ethyl-3-(3- dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxy succinimide (NHS).
  • suitable conjugation reagents for example, 1-ethyl-3-(3- dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxy succinimide (NHS).
  • EDC 1-ethyl-3-(3- dimethylaminopropyl)-carbodiimide
  • NHS N-hydroxy succinimide
  • the present disclosure provides complexes comprising a carrier unit (e.g., a cationic carrier unit unit) of the present disclosure non-covalently attached to a payload (e.g., an anionic payload such a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof), wherein the carrier unit and the payload interact electrostatically.
  • a carrier unit e.g., a cationic carrier unit unit
  • a payload e.g., an anionic payload such a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof
  • the present disclosure provides conjugates comprising a carrier unit (e.g., a cationic carrier unit unit) of the present disclosure covalently attached to a payload (e.g., an anionic payload such a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof), wherein the carrier unit and the payload interact electrostatically.
  • a carrier unit e.g., a cationic carrier unit unit
  • a payload e.g., an anionic payload such a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof
  • the carrier unit and the payload can be linked via a cleavable linker.
  • the carrier unit and the payload in addition to interacting electrostatically, can interact covalently (e.g., after electrostatic interaction the carrier unit and the payload can be "locked" via a disulfide bond or a cleavable bond).
  • the association is a covalent bond, a non-covalent bond, or an ionic bond.
  • the positive charge of the cationic carrier moiety of the cationic carrier unit is sufficient to form a micelle when mixed with the miR-485 inhibitor disclosed herein in a solution, wherein the overall ionic ratio of the positive charges of the cationic carrier moiety of the cationic carrier unit and the negative charges of the miR-485 inhibitor (or vector comprising the inhibitor) in the solution is about 1: 1.
  • the cationic carrier unit is capable of protecting the miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) from enzymatic degradation. See PCT Publication No.
  • the cationic carrier unit comprises a water-soluble polymer comprising a PEG with about 100 to about 130 units (e.g., about 114 units), a cationic carrier moiety comprising a polylysine with about 20 to about 60 lysine units, (e.g., about 40 lysines) a crosslinking moiety comprising about 3 to about 40 lysine-thiol units (e.g., about 35 lysines, each with a thiol group), and an adjuvant moiety comprising about 1 to about 50 lysines linked to a vitamin B3 units (e.g., about 5 lysines, each fused to vitamin B3).
  • a cationic carrier moiety comprising a polylysine with about 20 to about 60 lysine units, (e.g., about 40 lysines)
  • a crosslinking moiety comprising about 3 to about 40 lysine-thiol units (e.g., about 35 lysines, each
  • the cationic carrier unit is associated with a negatively charged payload (e.g., a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof), which interacts with the cationic carrier unit via at least one ionic bond (i.e., via electrostatic interaction) with the cationic carrier moiety of the cationic carrier unit.
  • a negatively charged payload e.g., a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof.
  • a cationic carrier unit that be used in delivering a miR-485 inhibitor comprises a water-soluble biopolymer moiety.
  • water-soluble biopolymer refers to a biocompatible, biologically inert, non-immunogenic, non-toxic, and hydrophilic polymer, e.g., PEG.
  • the water-soluble polymer comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly( ⁇ -hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines ("POZ") poly(N-acryloylmorpholine), or any combinations thereof.
  • the water- soluble polymer comprises polyethylene glycol (“PEG”), polyglycerol, or poly(propylene glycol) (“PPG").
  • the water-soluble polymer comprises: , (formula III), wherein n is 1-1000.
  • the n of the water-soluble polymer has a value of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94
  • n is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about 450, at least about
  • n is between about 50 and about 100, between about 100 and about 150, between about 150 and about 200, between about 200 and about 250, between about 250 and about 300, between about 300 and about 350, between about 350 and about 400, between about 400 and about 450, between about 450 and about 500, between about 500 and about 550, between about 550 and about 600, between about 600 and about 650, between about 650 and about 700, between about 700 and about 750, between about 750 and about 800, between about 800 and about 850, between about 850 and about 900, between about 900 and about 950, or between about 950 and about 1000.
  • n is at least about 80, at least about 81, at least about 82, at least about 83, at least about 84, at least about 85, at least about 86, at least about 87, at least about 88, at least about 89, at least about 90, at least about 91, at least about 92, at least about 93, at least about 94, at least about 95, at least about 96, at least about 97, at least about 98, at least about 99, at least about 100, at least about 101, at least about 102, at least about 103, at least about 104, at least about 105, at least about 106, at least about 107, at least about 108, at least about 109, at least 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about
  • n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 85 to about 95, about 95 to about 105, about 105 to about 115, about 115 to about 125, about 125 to about 135, about 135 to about 145, about 145 to about 155, about 155 to about 165, about 80 to about 100, about 100 to about 120, about 120 to about 140, about 140 to about 160, about 85 to about 105, about 105 to about 125, about 125 to about 145, or about 145 to about 165. [0319] In some aspects, n is about 100 to about 150.
  • n is about 100 to about 140. In some aspects, n is about 100 to about 130. In some aspects, n is about 110 to about 150. In some aspects, n is about 110 to about 140. In some aspects, n is about 110 to about 130. In some aspects, n is about 110 to about 120. In some aspects, n is about 120 to about 150. In some aspects, n is about 120 to about 140. In some aspects, n is about 120 to about 130. In some aspects, n is about 130 to about 150. In some aspects, n is about 130 to about 140. In some aspects, n is about 114.
  • the n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141.
  • the n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, about 150 to about 160.
  • the water-soluble polymer moiety is PEG.
  • the PEG is a branched PEG.
  • the PEG moiety is a monodisperse polyethylene glycol.
  • mdPEG monodisperse polyethylene glycol
  • mdPEG is a PEG that has a single, defined chain length and molecular weight. mdPEGs are typically generated by separation from the polymerization mixture by chromatography.
  • a monodisperse PEG moiety is assigned the abbreviation mdPEG.
  • the PEG is a Star PEG. Star PEGs have 10 to 100 PEG chains emanating from a central core group. In some aspects, the PEG is a Comb PEGs. Comb PEGs have multiple PEG chains normally grafted onto a polymer backbone.
  • the PEG has a molar mass between about 1000 g/mol and about 2000 g/mol, between about 2000 g/mol and about 3000 g/mol, between about 3000 g/mol to about 4000 g/mol, between about 4000 g/mol and about 5000 g/mol, between about 5000 g/mol and about 6000 g/mol, between about 6000 g/mol and about 7000 g/mol, or between 7000 g/mol and about 8000 g/mol.
  • the PEG is PEG 100 , PEG 200, PEG 300, PEG 400, PEG 500, PEG 600, PEG 700, PEG 800, PEG 900, PEG 1000, PEG 1100, PEG 1200, PEG 1300, PEG 1400, PEG 1500, PEG 1600, PEG 1700, PEG1800, PEG1 900, PEG2000, PEG2100, PEG2200, PEG2300, PEG2400, PEG2500, PEG1600, PEG1700, PEG 1800, PEG 1900, PEG 2000, PEG 2100, PEG 2200, PEG 2300, PEG 2400, PEG 2500, PEG 2600, PEG 2700, PEG 2800, PEG 2900, PEG 3000, PEG 3100, PEG 3200 , PEG 3300 , PEG 3400 , PEG 3500 , PEG 3600 , PEG 3700 , PEG3800, PEG3 900, PEG4000,
  • the PEG is PEG5000. In some aspects, the PEG is PEG 6000 . In some aspects, the PEG is PEG 4000 . [0325] In some aspects, the PEG is monodisperse, e.g., mPEG 100 , mPEG 200, mPEG 300, mPEG400, mPEG500, mPEG600, mPEG700, mPEG800, mPEG 900, mPEG 1000, mPEG1100, mPEG1200, mPEG 1300, mPEG 1400, mPEG 1500, mPEG 1600, mPEG 1700, mPEG 1800, mPEG 1900, mPEG 2000, mPEG 2100, mPEG 2200, mPEG 2300, mPEG 2400, mPEG 2500, mPEG 1600, mPEG 1700, mPEG 1800, mPEG1 900, mP
  • the mPEG is mPEG 5000 . In some aspects, the mPEG is mPEG 6000 . In some aspects, the mPEG is mPEG 4000 .
  • the water-soluble biopolymer moiety is a polyglycerol (PG) described by the formula ((R3—O—(CH2—CHOH—CH2O)n—) with R3 being hydrogen, methyl or ethyl, and n having a value from 3 to 200.
  • PG polyglycerol
  • the water-soluble biopolymer moiety is a branched polyglycerol described by the formula (R 3 —O—(CH2— CHOR 5 —CH2—O)n—) with R 5 being hydrogen or a linear glycerol chain described by the formula (R 3 —O—(CH 2 —CHOH—CH 2 —O) n —) and R 3 being hydrogen, methyl or ethyl.
  • the water-soluble biopolymer moiety is a hyperbranched polyglycerol described by the formula (R 3 —O—(CH2—CHOR 5 —CH2—O)n—) with R 5 being hydrogen or a glycerol chain described by the formula (R 3 —O—(CH 2 —CHOR 6 —CH 2 —O) n —), with R 6 being hydrogen or a glycerol chain described by the formula (R 3 —O—(CH 2 —CHOR 7 —CH 2 — O)n—), with R 7 being hydrogen or a linear glycerol chain described by the formula (R 3 —O— (CH 2 —CHOH—CH 2 —O) n —) and R 3 being hydrogen, methyl or ethyl.
  • the PG has a molar mass between about 1000 g/mol and about 2000 g/mol, between about 2000 g/mol and about 3000 g/mol, between about 3000 g/mol to about 4000 g/mol, between about 4000 g/mol and about 5000 g/mol, between about 5000 g/mol and about 6000 g/mol, between about 6000 g/mol and about 7000 g/mol, or between 7000 g/mol and about 8000 g/mol.
  • the PG is PG 100 , PG 200, PG 300, PG 400, PG 500, PG 600, PG 700, PG 800, PG 900, PG 1000, PG 1100, PG1200, PG1300, PG1400, PG1500, PG1600, PG1700, PG1800, PG1 900, PG2000, PG2100, PG 2200, PG 2300, PG 2400, PG 2500, PG 1600, PG 1700, PG 1800, PG 1900, PG 2000, PG 2100, PG 2200, PG 2300, PG 2400, PG 2500, PG 2600, PG 2700, PG 2800, PG 2900, PG 3000, PG 3100, PG 3200 , PG 3300 , PG 3400 , PG 3500 , PG 3600 , PG 3700, PG3800, PG3 900, PG4000,
  • the PG is PG5000. In some aspects, the PG is PG6000. In some aspects, the PG is PG4000. [0329] In some aspects, the PG is monodisperse, e.g., mPG 100 , mPG 200, mPG 300, mPG 400, mPG 500, mPG 600, mPG 700, mPG 800, mPG 900, mPG 1000, mPG 1100, mPG 1200, mPG 1300, mPG 1400, mPG 1500, mPG1600, mPG1700, mPG1800, mPG1 900, mPG2000, mPG2100, mPG2200, mPG2300, mPG2400, mPG2500, mPG 1600, mPG 1700, mPG 1800, mPG 1900, mPG 2000, mPG 2100, mPG 2200, mPG 2300, mPG 2400, mPG 2500
  • the water-soluble biopolymer comprises poly(propylene glycol) ("PPG").
  • PPG is characterized by the following formula, with n having a value from 1 to 1000.
  • the n of the PPG has a value of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89,
  • n of the PPG is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about
  • the n of the PPG is between about 50 and about 100, between about 100 and about 150, between about 150 and about 200, between about 200 and about 250, between about 250 and about 300, between about 300 and about 350, between about 350 and about 400, between about 400 and about 450, between about 450 and about 500, between about 500 and about 550, between about 550 and about 600, between about 600 and about 650, between about 650 and about 700, between about 700 and about 750, between about 750 and about 800, between about 800 and about 850, between about 850 and about 900, between about 900 and about 950, or between about 950 and about 1000.
  • the n of the PPG is at least about 80, at least about 81, at least about 82, at least about 83, at least about 84, at least about 85, at least about 86, at least about 87, at least about 88, at least about 89, at least about 90, at least about 91, at least about 92, at least about 93, at least about 94, at least about 95, at least about 96, at least about 97, at least about 98, at least about 99, at least about 100, at least about 101, at least about 102, at least about 103, at least about 104, at least about 105, at least about 106, at least about 107, at least about 108, at least about 109, at least 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about
  • the n of the PPG is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 85 to about 95, about 95 to about 105, about 105 to about 115, about 115 to about 125, about 125 to about 135, about 135 to about 145, about 145 to about 155, about 155 to about 165, about 80 to about 100, about 100 to about 120, about 120 to about 140, about 140 to about 160, about 85 to about 105, about 105 to about 125, about 125 to about 145, or about 145 to about 165.
  • the PPG is a branched PPG. Branched PPGs have three to ten PPG chains emanating from a central core group.
  • the PPG moiety is a monodisperse polyethylene glycol.
  • a monodisperse polyethylene glycol is a PPG that has a single, defined chain length and molecular weight. mdPEGs are typically generated by separation from the polymerization mixture by chromatography.
  • mdPPG is assigned the abbreviation mdPPG.
  • the PPG is a Star PPG.
  • Star PPGs have 10 to 100 PPG chains emanating from a central core group.
  • the PPG is a Comb PPGs.
  • Comb PPGs have multiple PPG chains normally grafted onto a polymer backbone.
  • the PPG has a molar mass between about 1000 g/mol and about 2000 g/mol, between about 2000 g/mol and about 3000 g/mol, between about 3000 g/mol to about 4000 g/mol, between about 4000 g/mol and about 5000 g/mol, between about 5000 g/mol and about 6000 g/mol, between about 6000 g/mol and about 7000 g/mol, or between 7000 g/mol and about 8000 g/mol.
  • the PPG is PPG100, PPG200, PPG300, PPG400, PPG500, PPG600, PPG700, PPG 800, PPG 900, PPG 1000, PPG 1100, PPG 1200, PPG 1300, PPG 1400, PPG 1500, PPG 1600, PPG 1700, PPG 1800, PPG1 900, PPG2000, PPG2100, PPG2200, PPG2300, PPG2400, PPG2500, PPG1600, PPG1700, PPG1800, PPG1 900, PPG2000, PPG2100, PPG2200, PPG2300, PPG2400, PPG2500, PPG2600, PPG2700, PPG2800, PPG 2900, PPG 3000, PPG 3100, PPG 3200 , PPG 3300 , PPG 3400 , PPG 3500 , PPG 3600 , PPG 3700 , PPG 3800 , PPG 3900 , PPG 4
  • the PPG is PPG5000. In some aspects, the PPG is PPG6000. In some aspects, the PPG is PPG4000. [0340] In some aspects, the PPG is monodisperse, e.g., mPPG 100 , mPPG 200, mPPG 300, mPPG400, mPPG500, mPPG600, mPPG700, mPPG800, mPPG 900, mPPG 1000, mPPG1100, mPPG1200, mPPG1300, mPPG1400, mPPG1500, mPPG1600, mPPG1700, mPPG1800, mPPG1 900, mPPG2000, mPPG 2100, mPPG 2200, mPPG 2300, mPPG 2400, mPPG 2500, mPPG 1600, mPPG 1700, mPPG 1800, mPPG 1900, mPPG
  • a cationic carrier unit useful for the present disclosure comprises a cationic carrier moiety.
  • the term "cationic carrier” refers to a moiety or portion of a cationic carrier unit of the present disclosure comprising a plurality of positive charges that can interact and bind electrostatically an anionic payload (or an anionic carrier attached to a payload).
  • the number of positive charges or positively charged groups on the cationic carrier is similar to the number of negative charges or negatively charged groups on the anionic payload (or an anionic carrier attached to a payload).
  • the cationic carrier comprises a biopolymer, e.g., a peptide (e.g., a polylysine). [0343] In some aspects, the cationic carrier moiety comprises one or more basic amino acids.
  • the cationic carrier moiety comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at last 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, or at least 50 basic amino acids.
  • the cationic carrier moiety comprises at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99, or at least about 100.
  • the cationic carrier moiety comprises about 30 to about 50 basic amino acids. In some aspects, the cationic carrier moiety comprises about 30 to about 40 basic amino acids. In some aspects, the cationic carrier moiety comprises about 60, about 70, about 80, about 90, or about 100 basic amino acids. In some aspects, the cationic carrier moiety comprises about 80 basic amino acids. In some aspects, the basic amino acid comprises arginine, lysine, histidine, or any combination thereof. In some aspects, the cationic carrier moiety comprises about 40 lysine monomers. [0344] In some aspects, the cationic carrier unit comprises at least about 40 basic amino acids, e.g., lysines.
  • the cationic carrier unit comprises at least about 45 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 50 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 55 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 60 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 65 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 70 basic amino acids, e.g., lysines.
  • the cationic carrier unit comprises at least about 75 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 80 basic amino acids, e.g., lysines. [0345] In some aspects, the cationic carrier unit comprises about 30 to about 1000, about 30 to about 900, about 30 to about 800, about 30 to about 700, about 30 to about 600, about 30 to about 500, about 30 to about 400, about 30 to about 300, about 30 to about 200, about 30 to about 100, about 40 to about 1000, about 40 to about 900, about 40 to about 800, about 40 to about 700, about 40 to about 600, about 40 to about 500, about 40 to about 400, about 40 to about 300, about 40 to about 200, or about 40 to about 100 basic amino acids, e.g., lysines.
  • the basic amino acids e.g., lysines
  • the basic amino acids are not modified such that they possess – NH3+(e.g., positive charge).
  • the cationic carrier unit comprises about 30 to about 100, about 30 to about 90, about 30 to about 80, about 30 to about 70, about 30 to about 60, about 30 to about 50, about 30 to about 40, about 40 to about 100, about 40 to about 90, about 40 to about 80, about 40 to about 70, about 40 to about 60, about 70 to about 80, about 75 to about 85, about 65 to about 75, about 65 to about 80, about 60 to about 85, or about 40 to about 500 basic amino acids, e.g., lysines.
  • the cationic carrier unit comprises about 100 to about 1000, about 100 to about 900, about 100 to about 800, about 100 to about 700, about 100 to about 600, about 100 to about 500, about 100 to about 400, about 100 to about 300, about 100 to about 200, about 200 to about 1000, about 200 to about 900, about 200 to about 800, about 200 to about 700, about 200 to about 600, about 200 to about 500, about 200 to about 400, about 200 to about 300, about 300 to about 1000, about 300 to about 900, about 300 to about 800, about 300 to about 700, about 300 to about 600, about 300 to about 500, about 300 to about 400, about 400 to about 1000, about 400 to about 900, about 400 to about 800, about 400 to about 700, about 400 to about 600, about 400 to about 500, about 500 to about 1000, about 500 to about 600, about 600 to about 1000, about 600 to about 900, about 600 to about 800, about 600 to about 700, about 400 to about 600, about 400 to about 500, about 500 to about 1000, about 500 to about 600, about 600
  • the number of basic amino acids can be adjusted based on the length of the anionic payload. For example, an anionic payload with a longer sequence can be paired with higher number of basic amino acids, e.g., lysines.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit can be calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is at least about 1, at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20.
  • N/P ratio molar ratio of protonated amine in polymer to phosphate in an anionic payload
  • the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA is between about 1 to about 20, about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 1 to about 10, e.g., about 3 to about 4, about 4 to about 5, about 5 to about 6, about 6 to about 7, or about 7 to about 8.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 1 to about 2.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 3 to about 4.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 2 to about 3.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 4 to about 5. In some aspects, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 5 to about 6.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 6 to about 7.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 7 to about 8.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 8 to about 9.
  • the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 9 to about 10.
  • a role of the cationic carrier moiety is to neutralize negative charges on the payload (e.g., negative changes in the phosphate backbone of an mRNA) via electrostatic interaction, in some aspects (e.g., when the payload is a nucleic acid such as an antimir), the length of the cationic carrier, number of positively charged groups on the cationic carrier, and distribution and orientation of charges present on the cationic carrier will depend on the length and charge distribution on the payload molecule.
  • the cationic carrier comprises between about 5 and about 10, between about 10 and about 15, between about 15 and about 20, between about 20 and about 25, between about 25 and about 30, between about 30 and about 35, between about 35 and about 40, between about 40 and about 45, between about 45 and about 50, between about 50 and about 55, between about 55 and about 60, between about 60 and about 65, between about and about 70, between about 70 and about 75, or between about 75 and about 80 basic amino acids.
  • the positively charged carrier comprises between 30 and about 50 basic amino acids.
  • the positively charged carrier comprises between 70 and about 80 basic amino acids.
  • the basic amino acid comprises arginine, lysine, histidine, or any combination thereof.
  • the basic amino acid is a D-amino acid. In some aspects, the basic amino acid is an L-amino acid. In some aspects, the positively charged carrier comprises D-amino acids and L-amino acids. In some aspects, the basic amino acid comprises at least one unnatural amino acid or a derivative thereof.
  • the basic amino acid is arginine, lysine, histidine, L-4-aminomethyl-phenylalanine, L-4-guanidine-phenylalanine, L-4-aminomethyl-N-isopropyl-phenylalanine, L-3-pyridyl-alanine, L-trans-4- aminomethylcyclohexyl-alanine, L-4-piperidinyl-alanine, L-4-aminocyclohexyl-alanine, 4- guanidinobutyric acid, L-2-amino-3-guanidinopropionic acid, DL-5-hydroxylysine, pyrrolysine, 5-hydroxy-L-lysine, methyllysine, hypusine, or any combination thereof.
  • the positively charged carrier comprises about 40 lysines. In a particular aspect, the positively charged carrier comprises about 50 lysines. . In a particular aspect, the positively charged carrier comprises about 60 lysines. . In a particular aspect, the positively charged carrier comprises about 70 lysines. In a particular aspect, the positively charged carrier comprises about 80 lysines.
  • the cationic carrier comprises a polymer or copolymer comprising at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at last 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63,
  • the cationic carrier comprises a polymer or copolymer comprising between about 5 and about 10 cationic groups, between about 10 and about 15 cationic groups, between about 15 and about 20 cationic groups, between about 20 and about 25 cationic groups, between about 25 and about 30 cationic groups, between about 30 and about 35 cationic groups, between about 35 and about 40 cationic groups, between about 40 and about 45 cationic groups, between about 45 and about 50 cationic groups, between about 50 and about 55 cationic groups, between about 55 and about 60 cationic groups, between about 60 and about 65 cationic groups, between about 65 and about 70 cationic groups, between about 70 and about 75 cationic groups, or between about 45 and about 50 cationic groups (e.g., amino groups).
  • amino groups e.g., amino groups
  • the cationic carrier comprises a polymer or copolymer comprising between 30 and about 50 cationic groups (e.g., amino groups). In some aspects, the cationic carrier comprises a polymer or copolymer comprising between 70 and about 80 cationic groups (e.g., amino groups). In some aspects, the polymer or copolymer is an acrylate, a polyalcohol, or a polysaccharide. [0353] In some aspects, the cationic carrier moiety binds to a single payload molecule. In some aspects, a cationic carrier moiety can bind to multiple payload molecules, which can be identical or different.
  • the positive charges of the cationic carrier moiety and negative charges of a nucleic acid payload are at an ionic ratio of about 20:1, about 19:1, about 18:1, about 17:1, about 16:1, about 15:1, about 14:1, about 13:1, about 12:1, about 11:1, about 10:1, about 9:1, about 8:1 about 7:1, about 6:1 about 5:1, about 4:1, about 3:1, about 2:1, or about 1:1.
  • the negative charges of a nucleic acid payload and the positive charges of the cationic carrier moiety are at an ionic ratio of about 20:1, about 19:1, about 18:1, about 17:1, about 16:1, about 15:1, about 14:1, about 13:1, about 12:1, about 11:1, about 10:1, about 9:1, about 8:1 about 7:1, about 6:1 about 5:1, about 4:1, about 3:1, about 2:1, or about 1:1.
  • the anionic payload comprises a nucleotide sequence having about 10 to about 1000 (e.g., about 100 to about 1000) in length, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is about 2 to about 10, e.g., about 2 to about 9, about 2 to about 8, about 2 to about 7, about 2 to about 6, about 2 to about 5, about 2 to about 4, about 2 to about 3, e.g., e.g., about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10.
  • an N/P ratio of the cationic carrier moiety and the anionic payload of about 10 to about 1000 nucleotides in length is between about 1 and about 10, e.g., about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10.
  • the anionic payload comprises a nucleotide sequence having about 1000 to about 2000 in length, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is about 3 to about 12, e.g., about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, or about 12.
  • the N/P ratio of the cationic carrier moiety and the anionic payload is between about 4 and about 7, e.g., about 4, about 5, about 6, or about 7.
  • the anionic payload comprises a nucleotide sequence having about 2000 to about 3000 in length, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is about 3 to about 16, e.g., about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16.
  • the N/P ratio of the cationic carrier moiety and the anionic payload is between about 6 and about 9, e.g., about 6, about 7, about 8, or about 9.
  • the anionic payload comprises a nucleotide sequence having about 3000 to about 4000 in length, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is about 3 to about 20, e.g., about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20. In some aspects, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is between about 7 and about 10, e.g., about 7, about 8, about 9, or about 10. [0359] In some aspects, the cationic carrier moiety has a free terminus wherein the end group is a reactive group.
  • the cationic carrier moiety has a free terminus (e.g., the C-terminus in a poly-lysine cationic carrier moiety) wherein the end group is an amino (- NH 2 ) group. In some aspects, the cationic carrier moiety has a free terminus wherein the end group is an sulfhydryl group. In some aspects, the reactive group of the cationic carrier moiety is attached to an adjuvant moiety, e.g., a vitamin B3.
  • the cationic carrier units of the present disclosure comprise at least one crosslinking moiety.
  • crosslinking moiety refers to a moiety or portion of a polymer block comprising a plurality of agents that are capable of forming crosslinks.
  • the number of agents that are capable of forming crosslinks comprises an amino acid with a side chain of a crosslinking agent.
  • the CM comprises a biopolymer, e.g., a peptide (e.g., a polylysine) linked to a crosslinking agent.
  • the crosslinking moiety comprises one or more amino acids (e.g., lysine, arginine, histidine, or a combination thereof).
  • the crosslinking moiety comprises at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, or at least about 50 amino acids, e.g., lysine, arginine, or combinations thereof, each
  • the crosslinking moiety comprises at least about 10 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 11 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 12 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 13 amino acids, e.g., lysines, each of which is linked to a crosslinking agent.
  • the crosslinking moiety comprises at least about 14 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 15 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 16 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 17 amino acids, e.g., lysines, each of which is linked to a crosslinking agent.
  • the crosslinking moiety comprises at least about 18 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 19 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 20 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. [0363] In some aspects, a crosslinking agent is a thiol. In some aspects, a crosslinking agent is a thiol derivative.
  • a cationic carrier unit useful for the present disclosure comprises at least one adjuvant moiety.
  • adjuvant moiety refers to a molecular entity that can, e.g., (i) complement the therapeutic or prophylactic activity of the payload, (ii) modulate the therapeutic or prophylactic activity of the payload, (iii) function as a therapeutic and/or prophylactic agent in the target tissue or target cells, (iv) facilitate the transport of the cationic carrier unit across a physiological barrier, e.g., the BBB and/or the plasma membrane, (v) improve the homeostasis of the target tissue or target cell, (vi) contribute positively charges groups to the cationic carried moiety, or (vii) any combination thereof.
  • a physiological barrier e.g., the BBB and/or the plasma membrane
  • the adjuvant moiety is capable of modulating an immune response, an inflammatory response, and/or a tissue microenvironment.
  • the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof.
  • the adjuvant moiety comprises, e.g., an amino acid linked to an imidazole derivative, a vitamin, or any combination thereof.
  • the adjuvant moiety comprises: , (formula IV), wherein each of G1 and G2 is H, an aromatic ring, or 1-10 alkyl, or G1 and G2 together form an aromatic ring, and wherein n is 1-10.
  • the adjuvant moiety comprises nitroimidazole.
  • the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof.
  • the adjuvant moiety comprises an amino acid.
  • the adjuvant moiety comprises an amino acid (e.g., lysine) linked to nitroimidazole.
  • the adjuvant moiety comprises an amino acid (e.g., lysine) linked to metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof.
  • the adjuvant moiety comprises (formula V), wherein Ar is or , and wherein each of Z1 and Z2 is H or OH.
  • the adjuvant moiety comprises a vitamin.
  • the adjuvant moiety comprises an amino acid (e.g., lysine) linked to a vitamin.
  • the vitamin comprises a cyclic ring or cyclic hetero atom ring and a carboxyl group or hydroxyl group.
  • the vitamin comprises: (formula VI), wherein each of Y1 and Y2 is C, N, O, or S, and wherein n is 1 or 2.
  • the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof.
  • the vitamin is vitamin B3.
  • the adjuvant moiety comprises at least about one, at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 vitamin B3.
  • the adjuvant moiety comprises at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, or at least about 50 vitamin B3. In some aspects, the adjuvant moiety comprises about 10 vitamin B3. In some aspects, the adjuant moiety comprises about 5 vitamin B3.
  • the adjuvant moiety comprises about 15 vitamin B3. In some aspects, the adjuvant moiety comprises about 20 vitamin B3. In some aspects, the adjuvant moiety comprises about 25 vitamin B3. In some aspects, the adjuvant moiety comprises about 30 vitamin B3. In some aspects, the adjuvant moiety comprises about 35 vitamin B3. In some aspects, the adjuvant moiety comprises about 40 vitamin B3. In some aspects, the adjuvant moiety comprises about 45 vitamin B3. In some aspects, the adjuvant moiety comprise about 50 vitamin B3. [0371] In some aspects, the adjuvant moiety comprises about 1 amino acid (e.g., lysine), each of which is linked to vitamin B3.
  • the adjuvant moiety comprises about 1 amino acid (e.g., lysine), each of which is linked to vitamin B3.
  • the adjuvant moiety comprises about 2 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 3 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 4 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 5 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 6 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • the adjuvant moiety comprises about 2 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 3 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 4 amino acids
  • the adjuvant moiety comprises about 7 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 8 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 9 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 10 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 11 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • the adjuvant moiety comprises about 7 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 8 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 9 amino acids
  • the adjuvant moiety comprises about 12 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 13 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 14 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 15 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 16 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • the adjuvant moiety comprises about 12 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 13 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 14 amino acids
  • the adjuvant moiety comprises about 17 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 18 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 19 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 20 amino acids (e.g., lysines), each of which is linked to vitamin B3.
  • a cationic carrier unit useful for the present disclosure comprises a targeting moiety.
  • the targeting moiety is linked to the water-soluble polymer, e.g., via a linker.
  • the term "targeting moiety” refers to a biorecognition molecule that binds to a specific biological substance or site.
  • the targeting moiety is specific for a certain target molecule (e.g., a ligand targeting a receptor, or an antibody targeting a surface protein), tissue (e.g., a molecule that would preferentially carry the micelle to a specific organ or tissue, e.g., liver, brain, or endothelium), or facilitate transport through a physiological barrier (e.g., a peptide or other molecule that can facilitate transport across the brain blood barrier or plasma membrane).
  • a target molecule e.g., a ligand targeting a receptor, or an antibody targeting a surface protein
  • tissue e.g., a molecule that would preferentially carry the micelle to a specific organ or tissue, e.g., liver, brain, or
  • a targeting moiety can be coupled to a cationic carrier unit, and therefore, to the external surface of a micelle, whereas the micelle has the payload entrapped within its core.
  • the targeting moiety is a targeting moiety capable of targeting the micelle of the present disclosure to a tissue.
  • the tissue is brain, liver, kidney, lung, ovary, pancreas, thyroid, breast, stomach, or any combination thereof.
  • the tissue is a tissue in the central nervous system, e.g., neural tissue.
  • the targeting moiety targeting the central nervous system is capable being transported by Large-neutral Amino Acid Transporter 1 (LAT1).
  • LAT1 (SLC7A5) is a transporter for both the uptake of large neutral amino acids and a number of pharmaceutical drugs. LAT1 can transport drugs such as L-dopa or gabapentin.
  • a targeting moiety comprises glucose, e.g., D-glucose, which can bind to Glucose transporter 1 (or GLUT1) and cross BBB.
  • GLUT1 also known as solute carrier family 2, facilitated glucose transporter member 1 (SLC2A1), is a uniporter protein that in humans is encoded by the SLC2A1 gene.
  • GLUT1 facilitates the transport of glucose across the plasma membranes of mammalian cells. This gene encodes a major glucose transporter in the mammalian blood-brain barrier.
  • a targeting moiety comprises galactose, e.g., D-galactose, which can bind to GLUT1 transporter to cross BBB.
  • a targeting moiety comprises glutamic acid, which can bind to acetylcholinesterase inhibitor (AChEI) and/or EAATs inhibitors and cross BBB.
  • Acetylcholinesterase is the enzyme that is the primary member of the cholinesterase enzyme family.
  • an acetylcholinesterase inhibitor is the inhibitor that inhibits acetylcholinesterase from breaking down acetylcholine into choline and acetate, thereby increasing both the level and duration of action of the neurotransmitter acetylcholine in the central nervous system, autonomic ganglia and neuromuscular junctions, which are rich in acetylcholine receptors.
  • Acetylcholinesterase inhibitors are one of two types of cholinesterase inhibitors; the other being butyryl-cholinesterase inhibitors.
  • the tissue targeted by a targeting moiety is a skeletal muscle.
  • the targeting moiety targeting skeletal muscle is capable being transported by Large-neutral Amino Acid Transporter 1 (LAT1).
  • LAT1 Large-neutral Amino Acid Transporter 1
  • LAT1 is consistently expressed at high levels in brain microvessel endothelial cells. Being a solute carrier located primarily in the BBB, targeting the micelles of the present disclosure to LAT1 allows delivery through the BBB.
  • the targeting moiety targeting a micelle of the present disclosure to the LAT1 transporter is an amino acid, e.g., a branched-chain or aromatic amino acid.
  • the amino acid is valine, leucine, and/or isoleucine.
  • the amino acid is tryptophan and/or tyrosine. In some aspects, the amino acid is tryptophan. In some aspects, the amino acid is tyrosine.
  • the targeting moiety is a LAT1 ligand selected from tryptophan, tyrosine, phenylalanine, tryptophan, methionine, thyroxine, melphalan, L-DOPA, gabapentin, 3,5-I-diiodotyrosine, 3-iodo-I-tyrosine, fenclonine, acivicin, leucine, BCH, methionine, histidine, valine, or any combination thereof.
  • a ligand functions as a type of targeting moiety defined as a selectively bindable material that has a selective (or specific), affinity for another substance.
  • the ligand is recognized and bound by a usually, but not necessarily, larger specific binding body or "binding partner,” or "receptor.”
  • binding partner or “receptor.”
  • ligands suitable for targeting are antigens, haptens, biotin, biotin derivatives, lectins, galactosamine and fucosylamine moieties, receptors, substrates, coenzymes and cofactors among others.
  • Other substances that can function as ligands for targeting a micelle of the present disclosure are certain vitamins (i.e.
  • the targeting moiety comprises a protein or protein fragment (e.g., hormones, toxins), and synthetic or natural polypeptides with cell affinity.
  • Ligands also include various substances with selective affinity for ligators that are produced through recombinant DNA, genetic and molecular engineering. Except when stated otherwise, ligands of the instant disclosure also include ligands as defined in U.S. Pat. No. 3,817,837, which is herein incorporated by reference in its entirety.
  • a ligator functions as a type of targeting moiety defined for this disclosure as a specific binding body or “partner” or “receptor,” that is usually, but not necessarily, larger than the ligand it can bind to. For the purposes of this disclosure, it can be a specific substance or material or chemical or “reactant” that is capable of selective affinity binding with a specific ligand.
  • a ligator can be a protein such as an antibody, a nonprotein binding body, or a "specific reactor.”
  • a ligator includes an antibody, which is defined to include all classes of antibodies, monoclonal antibodies, chimeric antibodies, Fab fractions, fragments and derivatives thereof.
  • antibody encompasses an immunoglobulin whether natural or partly or wholly synthetically produced, and fragments thereof. The term also covers any protein having a binding domain that is homologous to an immunoglobulin binding domain. “Antibody” further includes a polypeptide comprising a framework region from an immunoglobulin gene or fragments thereof that specifically binds and recognizes an antigen.
  • antibody is meant to include whole antibodies, polyclonal, monoclonal and recombinant antibodies, fragments thereof, and further includes single-chain antibodies, humanized antibodies, murine antibodies, chimeric, mouse-human, mouse-primate, primate- human monoclonal antibodies, anti-idiotype antibodies, antibody fragments, such as, e.g., scFv, scFab, (scFab)2, (scFv)2, Fab, Fab', and F(ab')2, F(ab1)2, Fv, dAb, and Fd fragments, diabodies, and antibody-related polypeptides.
  • Antibody includes bispecific antibodies and multispecific antibodies so long as they exhibit the desired biological activity or function.
  • the targeting moiety is an antibody or a molecule comprising an antigen binding fragment thereof.
  • the antibody is a nanobody.
  • the antibody is an ADC.
  • the terms "antibody-drug conjugate” and “ADC” are used interchangeably and refer to an antibody linked, e.g., covalently, to a therapeutic agent (sometimes referred to herein as agent, drug, or active pharmaceutical ingredient) or agents.
  • the targeting moiety is an antibody-drug conjugate. [0388] Under certain conditions, the instant disclosure is also applicable to using other substances as ligators.
  • ligators suitable for targeting include naturally occurring receptors, any hemagglutinins and cell membrane and nuclear derivatives that bind specifically to hormones, vitamins, drugs, antibiotics, cancer markers, genetic markers, viruses, and histocompatibility markers.
  • Another group of ligators includes any RNA and DNA binding substances such as polyethylenimine (PEI) and polypeptides or proteins such as histones and protamines.
  • Other ligators also include enzymes, especially cell surface enzymes such as neuraminidases, plasma proteins, avidins, streptavidins, chalones, cavitands, thyroglobulin, intrinsic factor, globulins, chelators, surfactants, organometallic substances, staphylococcal protein A, protein G, ribosomes, bacteriophages, cytochromes, lectins, certain resins, and organic polymers.
  • Targeting moieties also include various substances such as any proteins, protein fragments or polypeptides with affinity for the surface of any cells, tissues or microorganisms that are produced through recombinant DNA, genetic and molecular engineering.
  • the targeting moiety directs a micelle of the present disclosure to a specific tissue (i.e., liver tissue or brain tissue), to a specific type of cell (e.g., a certain type of cancer cells), or to a physiological compartment or physiological barrier (e.g., the BBB).
  • a cationic carrier unit disclosed herein can comprise one or more linkers.
  • the term "linker” refers to a peptide or polypeptide sequence (e.g., a synthetic peptide or polypeptide sequence), or a non-peptide linker for which its main function is to connect two moieties in a cationic carrier unit disclosed herein.
  • cationic carrier units of the present disclosure can comprise at least one linker connecting a tissue-specific targeting moiety (TM) with a water soluble polymer (WS), at least one linker connecting a water-soluble biopolymer (WP) with cationic carrier (CC) or an adjuvant moiety (AM) or a crosslinking moiety (CM), at least one linker connecting a cationic carrier (CC) with an adjuvant moiety (AM), or any combination thereof.
  • two or more linkers can be linked in tandem.
  • each of the linkers can be the same or different.
  • linkers provide flexibility to the cationic carrier unit.
  • Linkers are not typically cleaved; however, in some aspects, such cleavage can be desirable. Accordingly, in some aspects a linker can comprise one or more protease-cleavable sites, which can be located within the sequence of the linker or flanking the linker at either end of the linker sequence. [0393] In some aspects, the linker is a peptide linker.
  • the peptide linker can comprise at least about two, at least about three, at least about four, at least about five, at least about 10, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, or at least about 100 amino acids.
  • the peptide linker can comprise at least about 110, at least about 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, or at least about 200 amino acids.
  • the peptide linker can comprise at least about 200, at least about 250, at least about 300, at least about 350, at least about 400, at least about 450, at least about 500, at least 550, at least about 600, at least about 650, at least about 700, at least about 750, at least about 800, at least about 850, at least about 900, at least about 950, or at least about 1,000 amino acids.
  • the peptide linker can comprise between 1 and about 5 amino acids, between 1 and about 10 amino acids, between 1 and about 20 amino acids, between about 10 and about 50 amino acids, between about 50 and about 100 amino acids, between about 100 and about 200 amino acids, between about 200 and about 300 amino acids, between about 300 and about 400 amino acids, between about 400 and about 500 amino acids, between about 500 and about 600 amino acids, between about 600 and about 700 amino acids, between about 700 and about 800 amino acids, between about 800 and about 900 amino acids, or between about 900 and about 1000 amino acids.
  • Examples of peptide linkers are well known in the art. In some aspects, the linker is a glycine/serine linker.
  • the peptide linker is glycine/serine linker according to the formula [(Gly)n-Ser]m where n is any integer from 1 to 100 and m is any integer from 1 to 100.
  • the glycine/serine linker is according to the formula [(Gly)x-Sery]z (SEQ ID NO: 143) wherein x in an integer from 1 to 4, y is 0 or 1, and z is an integers from 1 to 50.
  • the peptide linker comprises the sequence Gn, where n can be an integer from 1 to 100 (SEQ ID NO: 144).
  • the sequence of the peptide linker is GGGG (SEQ ID NO: 145).
  • the peptide linker can comprise the sequence (GlyAla)n (SEQ ID NO: 146), wherein n is an integer between 1 and 100. In some aspects, the peptide linker can comprise the sequence (GlyGlySer)n (SEQ ID NO: 147), wherein n is an integer between 1 and 100. [0399] In some aspects, the peptide linker comprises the sequence (GGGS)n (SEQ ID NO: 148). In some aspects, the peptide linker comprises the sequence (GGS)n(GGGGS)n (SEQ ID NO: 149). In these instances, n can be an integer from 1-100.
  • n can be an integer from one to 20, i.e., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.
  • Examples of linkers include, but are not limited to, GGG, SGGSGGS (SEQ ID NO: 150), GGSGGSGGSGGSGGG (SEQ ID NO: 151), GGSGGSGGGGSGGGGS (SEQ ID NO: 152), GGSGGSGGSGGSGGSGGS (SEQ ID NO: 153), or GGGGSGGGGSGGGGS (SEQ ID NO: 154).
  • the linker is a poly-G sequence (GGGG)n (SEQ ID NO: 155), where n can be an integer from 1-100.
  • the peptide linker is synthetic, i.e., non-naturally occurring.
  • a peptide linker includes peptides (or polypeptides) (e.g., natural or non-naturally occurring peptides) which comprise an amino acid sequence that links or genetically fuses a first linear sequence of amino acids to a second linear sequence of amino acids to which it is not naturally linked or genetically fused in nature.
  • the peptide linker can comprise non-naturally occurring polypeptides which are modified forms of naturally occurring polypeptides (e.g., comprising a mutation such as an addition, substitution or deletion).
  • the peptide linker can comprise non-naturally occurring amino acids.
  • the peptide linker can comprise naturally occurring amino acids occurring in a linear sequence that does not occur in nature. In some aspects, the peptide linker can comprise a naturally occurring polypeptide sequence. [0402] In some aspects, the linker comprises a non-peptide linker. In some aspects, the linker consists of a non-peptide linker.
  • the non-peptide linker can be, e.g., maleimido caproyl (MC), maleimido propanoyl (MP), methoxyl polyethyleneglycol (MPEG), succinimidyl 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (SMCC), m- maleimidobenzoyl-N-hydroxysuccinimide ester (MBS), succinimidyl 4-(p- maleimidophenyl)butyrate (SMPB), N-succinimidyl(4-iodoacetyl)aminobenzonate (SIAB), succinimidyl 6-[3-(2-pyridyldithio)-propionamide]hexanoate (LC-SPDP), 4- succinimidyloxycarbonyl-alpha-methyl-alpha-(2-pyridyldithio)toluene (SMPT), etc.
  • MC maleimido caproyl
  • Linkers can be introduced into polypeptide sequences using techniques known in the art (e.g., chemical conjugation, recombinant techniques, or peptide synthesis). Modifications can be confirmed by DNA sequence analysis.
  • the linkers can be introduced using recombinant techniques.
  • the linkers can be introduced using solid phase peptide synthesis.
  • a cationic carrier unit disclosed herein can contain simultaneously one or more linkers that have been introduced using recombinant techniques and one or more linkers that have been introduced using solid phase peptide synthesis or methods of chemical conjugation known in the art.
  • the linker comprises a cleavage site.
  • the present disclosure also provides pharmaceutical compositions comprising a miR-485 inhibitor disclosed herein (e.g., a polynucleotide or a vector comprising the miR-485 inhibitor) that are suitable for administration to a subject.
  • the pharmaceutical compositions generally comprise a miR-485 inhibitor described herein (e.g., a polynucleotide or a vector) and a pharmaceutically-acceptable excipient or carrier in a form suitable for administration to a subject.
  • Pharmaceutically acceptable excipients or carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition.
  • kits or products of manufacture comprising a miRNA inhibitor of the present disclosure (e.g., a polynucleotide, vector, or pharmaceutical composition disclosed herein) and optionally instructions for use, e.g., instructions for use according to the methods disclosed herein.
  • a miRNA inhibitor of the present disclosure e.g., a polynucleotide, vector, or pharmaceutical composition disclosed herein
  • optionally instructions for use e.g., instructions for use according to the methods disclosed herein.
  • the kit or product of manufacture comprises a miR-485 inhibitor (e.g., vector, e.g., an AAV vector, a polynucleotide, or a pharmaceutical composition of the present disclosure) in one or more containers.
  • the kit or product of manufacture comprises miR-485 inhibitor (e.g., a vector, e.g., an AAV vector, a polynucleotide, or a pharmaceutical composition of the present disclosure) and a brochure.
  • miR-485 inhibitors disclosed herein can be readily incorporated into one of the established kit formats which are well known in the art.
  • the following examples are offered by way of illustration and not by way of limitation. Examples Example 1: Preparation of miRNA Inhibitors [0408] (a) Synthesis of alkyne modified tyrosine: An alkyne modified tyrosine was generated as an intermediate for the synthesis of a tissue specific targeting moiety TM of a cationic carrier unit to direct micelles of the present disclosure to the LAT1 transporter in the BBB.
  • the resulting product was dissolved in 1,4- dioxane (1.0 ml) and 6.0 M HCl (1.0 ml). The reaction mixture was heated at 100 °C overnight. Next, the dioxane was removed and extracted by EA. Aqueous NaOH (0.5 M) solution was added to the mixture until the pH value become 7. The reactant was concentrated by evaporator and centrifuged at 12,000 rpm at 0°C. The precipitate was washed with deionized water and lyophilized.
  • MeO-PEG 600 mg, 0.12 mmol
  • Lys(TFA)-NCA 2574 mg, 9.6 mmol
  • DMF 1M thiourea and DMF(or NMP)
  • Lys(TFA)-NCA solution was dropped into the MeO-PEG solution by micro syringe and the reaction mixture was stirred at 37 °C for 4 days.
  • the reaction bottles were purged with argon and vacuum. All reactions were conducted in argon atmosphere. After the reaction, the mixture was precipitated into an excess amount of diethyl ether. The precipitate was re-dissolved in methanol and precipitated again into cold diethyl ether.
  • N 3 -PEG 300 mg, 0.06 mmol
  • Lys(TFA)-NCA (1287 mg, 4.8 mmol) were separately dissolved in DMF containing 1M thiourea and DMF(or NMP).
  • Lys(TFA)-NCA solution was dropped into the N 3 -PEG solution by micro syringe and the reaction mixture was stirred at 37 °C for 4 days.
  • the reaction bottles were purged with argon and vacuum. All reactions were conducted in argon atmosphere. After the reaction, the mixture was precipitated into an excess amount of diethyl ether. The precipitate was re-dissolved in methanol and precipitated again into cold diethyl ether.
  • N 3 -PEG-PLL 500 mg was dissolved in methanol (60 mL) and 1N NaOH (6 mL) was dropped into the polymer solution with stirring. The mixture was maintained for 1 day with stirring at 37°C. The reaction mixture was dialyzed against 10 mM HEPES for 4 times and distilled water. White powder of N 3 -PEG-PLL was obtained after lyophilization.
  • tissue-specific adjuvant moieties were attached to the WP-CC component of a cationic carrier unit of the present disclosure.
  • the tissue-specific adjuvant moiety (AM) used in the cationic carrier unit was nicotinamide (vitamin B3). This step would yield the WP-CC-AM components of the cationic carrier unit.
  • N 3 -PEG-PLL(Nic/SH) Azido-poly(ethylene glycol)-b-poly(L-lysine/nicotinamide/mercaptopropanamide) was synthesized by chemical modification of N 3 -PEG-PLL and nicotinic acid in the presence of EDC/NHS.
  • N3-PEG-PLL (372 mg, 25.8 ⁇ mol) and nicotinic acid 556.7 mg, 1.02 equiv. to NH2 of PEG-PLL
  • EDC•HCl 556.7 mg, 1.5 equiv.
  • N3-PEG-PLL(Nic/SH) 130 mg, 6.5 ⁇ mol
  • alkyne modified phenyl alanine 5.7 mg, 4.0 equiv.
  • PIC Polyion Complex
  • micelles were produced.
  • the micelles described in the present example comprised cationic carrier units combined with an antisense oligonucleotide payload.
  • Nano sized PIC micelles were prepared by mixing MeO- or Phe-PEG-PLL(Nic) and miRNA. PEG-PLL(Nic) was dissolved in HEPES buffer (10 mM) at 0.5 mg/mL concentration.
  • RNAse free water was mixed with the polymer solution at 2:1 (v/v) ratio of miRNA inhibitor (SEQ ID NOs: 2-30) (e.g., AGAGAGGAGAGCCGUGUAUGAC; SEQ ID NO: 30) to polymer.
  • SEQ ID NOs: 2-30 e.g., AGAGAGGAGAGCCGUGUAUGAC; SEQ ID NO: 30
  • the mixing ratio of polymer to anti-miRNA was determined by optimizing micelle forming conditions, i.e., ratio between amine in polymer (carrier of the present disclosure) to phosphate in anti-miRNA (payload).
  • the mixture of polymer (carrier) and anti-miRNA (payload) was vigorously mixed for 90 seconds by multi-vortex at 3000 rpm, and kept at room temperature for 30 min to stabilize the micelles.
  • mice (10 ⁇ M of Anti-miRNA concentration) were stored at 4 oC prior to use. MeO- or Phe- micelles were prepared using the same method, and different amounts of Phe- containing micelles (25% ⁇ 75%) were also prepared by mixing both polymers during micelle preparation.
  • Example 2 Analysis of the Effect of miR-485 Inhibitor on Telomere Length [0427] To better understand the relationship between miR-485 inhibitors disclosed herein and telomere length, cells (e.g., mouse neural stem cells) will be transfected with one of the following: i) human miR-control, (ii) human miR485-3p, or (iii) miR-485-3p inhibitor.
  • telomere length will also be assessed in the cells. And, to assess whether an increase in telomere length can improve function, various biological functions (e.g., survival, proliferation, differentiation) will also be assessed in the transfected cells.
  • Example 3 Analysis of the Therapeutic Effects of miR-485 Inhibitor on Age-Associated Disease or Condition
  • a mouse model of Alzheimer's diseases will be used (e.g., 5XFAD mice, which overexpress mutant human amyloid precursor protein (APP) with the Swedish (K670N, M671L), Florida (I716V), and London (V717I) mutations, along with mutant human presenilin 1 (PS1) that carries two FAD mutations (M146L and L286V)).
  • the animals will be treated with one of the following: (1) human miR-control, or (ii) miR-485-3p inhibitor.
  • the inhibitor will be administered to the animals at various doses and dosing intervals. Then, various assays (e.g., Y-maze and passive avoidance, rotarod, hang wire test, pole test, and balance beam test) will be used to measure the cognitive function of the animals at several different time points. Some of the animals will also be sacrified to assess the expression of one or more genes described herein (CTBP1, TRIP6, SIRT1, CD36, and/or PGC- 1 ⁇ ), which are thought to play a role in regulating telomere length. Other clinical mainfestations of Alzheimer's disease will also be assessed in the animals (e.g., amyloid plaque formation in the brain).
  • CBP1, TRIP6, SIRT1, CD36, and/or PGC- 1 ⁇ genes described herein
  • Other clinical mainfestations of Alzheimer's disease will also be assessed in the animals (e.g., amyloid plaque formation in the brain).
  • Example 4 Analysis of the Effect of miR-485 Inhibitor on the Expression of Age-associated Genes [0429] To assess whether the miR-485 inhibitors described herein can modify the expression of one or more age-associated genes (or proteins encoded thereof), primary cortical neurons and/or N2a cells were treated with miR-485 inhibitor as described below. Then, the expression of the following exemplary genes and/or encoded proteins were assessed: SIRT1 and c-Fos.
  • Cell Culture [0430] Primary cortical neurons were obtained from C57BL6/N mouse E18 embryos. Briefly, the cortexes of mouse were harvested and cut into approximately small pieces, then digested with Hank ⁇ s Balanced Salt solution plus papain suspension (Worthington) at 37°C for 30 min.
  • tissue pieces were resuspended in NEUROBASALTM Plus Medium (ThermoFisher) with supplemented with 2% B-27, 2 mM Glutamax, 1 mM sodium pyruvate and 1% penicillin-streptomycin solution.
  • Neurons were plated in 6-well plates (Corning, United States) coated with 0.05 mg/ml poly-D lysine (Sigma-Aldrich) at a density of 5 ⁇ 10 5 cells/ml. After two hours of incubation at 37°C and 5% CO2, the complete culture medium was replaced. One-half of the culture medium was changed every 3 days.
  • the cell line N2a was obtained from ATCC and cultured in Dulbecco’s modified Eagle’s medium (ThermoFisher) containing 10% heat-inactivated fetal bovine serum (ThermoFisher), 100 U/mL penicillin, and 100 ⁇ g/mL streptomycin (ThermoFisher) under 5% CO2 at 37 °C.
  • miRNA-485 Inhibitor Treatment [0432] N2a cell and primary cortical neuron cells (DIV 4) were treated (e.g., by transfection) with miR-485 inhibitor using TRANSIT-X2® Dynamic Delivery System (Mirus) for 48 h at a final concentration of 5, 100, 300, 500 nM.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Wood Science & Technology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Neurosurgery (AREA)
  • Neurology (AREA)
  • Biochemistry (AREA)
  • Epidemiology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

La présente divulgation comprend l'utilisation d'un inhibiteur de miARN pour augmenter la longueur et/ou protéger contre une réduction de la longueur d'un télomère dans une cellule. Dans certains aspects, ces inhibiteurs de miARN peuvent être utilisés dans le traitement d'une maladie ou pathologie liée au vieillissement.
PCT/IB2022/060622 2021-11-04 2022-11-03 Utilisation d'inhibiteurs de mir-485 pour traiter des maladies ou des pathologies associées au vieillissement WO2023079499A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163275833P 2021-11-04 2021-11-04
US63/275,833 2021-11-04

Publications (1)

Publication Number Publication Date
WO2023079499A1 true WO2023079499A1 (fr) 2023-05-11

Family

ID=86240914

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2022/060622 WO2023079499A1 (fr) 2021-11-04 2022-11-03 Utilisation d'inhibiteurs de mir-485 pour traiter des maladies ou des pathologies associées au vieillissement

Country Status (1)

Country Link
WO (1) WO2023079499A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102031256A (zh) * 2009-09-27 2011-04-27 苏州吉玛基因药物科技有限公司 人miR-485-5p反义核酸及其应用
KR20190142289A (ko) * 2019-12-12 2019-12-26 주식회사 바이오오케스트라 miR-485-3p를 이용한 알츠하이머병 진단 방법
WO2020254990A1 (fr) * 2019-06-17 2020-12-24 Biorchestra Co., Ltd. Compositions et procédés permettant la préparation d'un modèle animal de la maladie d'alzheimer à l'aide de microarn

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102031256A (zh) * 2009-09-27 2011-04-27 苏州吉玛基因药物科技有限公司 人miR-485-5p反义核酸及其应用
WO2020254990A1 (fr) * 2019-06-17 2020-12-24 Biorchestra Co., Ltd. Compositions et procédés permettant la préparation d'un modèle animal de la maladie d'alzheimer à l'aide de microarn
KR20190142289A (ko) * 2019-12-12 2019-12-26 주식회사 바이오오케스트라 miR-485-3p를 이용한 알츠하이머병 진단 방법

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
GU JUXIAN, SHAO RUSHENG, LI MENG, YAN QIUYUE, HU HONGWEI: "MiR‐485‐3p modulates neural stem cell differentiation and proliferation via regulating TRIP6 expression", JOURNAL OF CELLULAR AND MOLECULAR MEDICINE, UNIVERSITY PRESS CAROL DAVILA, BUCHAREST, RO, vol. 24, no. 1, 1 January 2020 (2020-01-01), RO , pages 398 - 404, XP093063014, ISSN: 1582-1838, DOI: 10.1111/jcmm.14743 *
YU LING, LI HAITING, LIU WENHU, ZHANG LIGONG, TIAN QUN, LI HAIRONG, LI MIN: "Retracted: MiR‐485‐3p serves as a biomarker and therapeutic target of Alzheimer's disease via regulating neuronal cell viability and neuroinflammation by targeting AKT3", MOLECULAR GENETICS & GENOMIC MEDICINE, vol. 9, no. 1, 1 January 2021 (2021-01-01), pages e1548, XP093063010, ISSN: 2324-9269, DOI: 10.1002/mgg3.1548 *

Similar Documents

Publication Publication Date Title
US20230304014A1 (en) Mirna-485 inhibitor for huntington's disease
US20240131048A1 (en) Micellar nanoparticles and uses thereof
US20240091151A1 (en) Micellar nanoparticles and uses thereof
WO2023079499A1 (fr) Utilisation d'inhibiteurs de mir-485 pour traiter des maladies ou des pathologies associées au vieillissement
US20230099372A1 (en) Use of mirna-485 inhibitors for treating tauopathy
US20230119699A1 (en) Diagnostic methods using sirt1 expression
US20230121720A1 (en) Diagnostic methods using pcg-1a expression
US20230126157A1 (en) Mirna-485 inhibitor for gene upregulation
US20230131083A1 (en) Use of mirna-485 inhibitors for treating amyotrophic lateral sclerosis (als)
WO2024127317A1 (fr) Traitement d'un dysfonctionnement mitochondrial avec un inhibiteur de miarn-485
WO2022168008A1 (fr) Utilisation d'un inhibiteur de miarn-485 pour réguler l'expression de psd95, de la synaptophysine et de caspase-3
WO2023089506A1 (fr) Procédés sans amplification pour la mesure de miarn
WO2022168007A1 (fr) Utilisation d'inhibiteurs de miarn-485 pour traiter des maladies ou des troubles associés à une expression de nlrp3 anormale
WO2022264038A1 (fr) Utilisation d'inhibiteurs de miarn-485 pour le traitement de maladies ou de troubles liés aux inflammasomes
WO2024009268A1 (fr) Nanoparticules micellaires et leurs utilisations
EP4323382A1 (fr) Polynucléotides capables d'une expression de protéine améliorée et leurs utilisations

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22889553

Country of ref document: EP

Kind code of ref document: A1