WO2023081900A1 - Lymphocytes t modifiés exprimant un récepteur recombiné de lymphocytes t (tcr) et systèmes et procédés apparentés - Google Patents

Lymphocytes t modifiés exprimant un récepteur recombiné de lymphocytes t (tcr) et systèmes et procédés apparentés Download PDF

Info

Publication number
WO2023081900A1
WO2023081900A1 PCT/US2022/079418 US2022079418W WO2023081900A1 WO 2023081900 A1 WO2023081900 A1 WO 2023081900A1 US 2022079418 W US2022079418 W US 2022079418W WO 2023081900 A1 WO2023081900 A1 WO 2023081900A1
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
seq
cell
cells
locus
Prior art date
Application number
PCT/US2022/079418
Other languages
English (en)
Inventor
Cedric CLEYRAT
Andreia COSTA
Stephanie BUSCH
Gabriela DIAZ
Amar Patel
Gail TURNER
Original Assignee
Juno Therapeutics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Juno Therapeutics, Inc. filed Critical Juno Therapeutics, Inc.
Publication of WO2023081900A1 publication Critical patent/WO2023081900A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
    • C12N5/06—Animal cells or tissues; Human cells or tissues
    • C12N5/0602—Vertebrate cells
    • C12N5/0634—Cells from the blood or the immune system
    • C12N5/0636—T lymphocytes
    • C12N5/0638—Cytotoxic T lymphocytes [CTL] or lymphokine activated killer cells [LAK]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5156—Animal cells expressing foreign proteins
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/515—Animal cells
    • A61K2039/5158—Antigen-pulsed cells, e.g. T-cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/58—Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation
    • A61K2039/585—Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation wherein the target is cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/80—Vaccine for a specifically defined cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/80—Vaccine for a specifically defined cancer
    • A61K2039/892—Reproductive system [uterus, ovaries, cervix, testes]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2501/00—Active agents used in cell culture processes, e.g. differentation
    • C12N2501/10—Growth factors
    • C12N2501/15—Transforming growth factor beta (TGF-β)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2510/00—Genetically modified cells
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
    • C12N2710/00011—Details
    • C12N2710/20011—Papillomaviridae
    • C12N2710/20071—Demonstrated in vivo effect

Definitions

  • the present disclosure relates to engineered T cells expressing a recombinant T cell receptor (TCR) from a T cell receptor alpha constant (TRAC) locus and also having reduced expression of transforming growth factor beta receptor 2 (TGFBR2), such as by genetic disruption at the TGFBR2 locus.
  • TCR recombinant T cell receptor
  • TGFBR2 transforming growth factor beta receptor 2
  • cell compositions containing the engineered T cells, and related methods, kits and systems for producing the engineered T cells are also provided.
  • methods of making and using the engineered T cells for cell therapy including in connection with cancer immunotherapy comprising adoptive transfer of the engineered T cells.
  • TCRs T cell receptors
  • expression and function of recombinant TCRs can be limited in a composition of engineered cells. Improved strategies are needed to achieve high expression and function of the recombinant TCRs. These strategies can facilitate generations of cells exhibiting desired properties, function or expression for use in adoptive immunotherapy, e.g., in treating cancer, infectious diseases, and autoimmune diseases.
  • T cells expressing a recombinant T cell receptor (TCR) and compositions, methods, uses, kits, and articles of manufacture related to genetically engineered T cells.
  • the provided embodiments relate to T cells genetically engineered using high efficiency CRISPR-Cas9 editing as follows: 1) TRAC knock-out (KO) to prevent endogenous TCR expression; 2) knock-in (KI) of an HPV-specific recombinant TCR at the TRAC locus; and 3) KO of TGFBR2 to prevent TGFP signaling.
  • the genetically engineered T cell comprises a recombinant T cell receptor (TCR) comprising a TCR alpha (TCRa) chain comprising a variable alpha (Va) region, and a TCR beta (TCRP) chain comprising a variable beta (VP) region, and a first genetic disruption at a first target site at an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus; wherein the genetically engineered T cell comprises a modified T cell receptor alpha constant (TRAC) locus comprising a transgene encoding the TCRa chain and the TCRP chain of the recombinant TCR, and has reduced expression of the gene product of the endogenous TGFBR2 locus.
  • TCR TCR alpha
  • Va variable alpha
  • TCRP TCR beta
  • VP variable beta
  • the first genetic disruption is a knockout (KO) of the TGFBR2 gene.
  • all alleles of the TGFBR2 locus are knocked out in the cell.
  • both alleles of the TGFBR2 locus are knocked out in the cell.
  • expression of a gene product from the endogenous TGFBR2 locus is eliminated or prevented.
  • the genetically engineered T cell does not encode a functional TGFBR2 polypeptide. In some of any embodiments, the genetically engineered T cell does not encode a TGFBR2 polypeptide.
  • the genetically engineered T cell does not encode a full length TGFBR2 polypeptide. In some of any embodiments, the expression of TGFBR2 polypeptide is reduced or eliminated in the genetically engineered T cell. In some of any embodiments, TGFP signal transmission is reduced or eliminated in the genetically engineered T cell.
  • the transgene has been integrated via homology directed repair (HDR) at the TRAC locus in a cell comprising a second genetic disruption at a second target site at an endogenous TRAC locus.
  • the second genetic disruption is a knockout (KO) of the TRAC gene.
  • all alleles of the TRAC locus are knocked out in the cell.
  • both alleles encoding TRAC are knocked out in the cell.
  • expression of a gene product from the endogenous TRAC locus is eliminated or prevented.
  • the recombinant TCR is knocked-in (KI) to the endogenous TRAC locus.
  • the knock-in of the recombinant TCR is at or near the site of the second genetic disruption.
  • the second target site is present at a promoter, a regulatory element or a control element of the endogenous TRAC locus or an open reading frame of the endogenous TRAC locus.
  • the first genetic disruption has been introduced using a first agent comprising a zinc finger nuclease (ZFN), a TAL-effector nuclease (TALEN), or a CRISPR-Cas combination.
  • the second genetic disruption has been introduced using a second agent comprising a zinc finger nuclease (ZFN), a TAL-effector nuclease (TALEN), or a CRISPR-Cas combination.
  • the first agent comprises a first CRISPR-Cas combination comprising a first guide RNA (gRNA) comprising a first targeting domain that binds to the first target site, and a Cas9 protein.
  • the second agent comprises a second CRISPR-Cas combination comprising a second gRNA comprising a second targeting domain that binds to the second target site, and a Cas9 protein.
  • the Cas9 protein is a S. pyogenes Cas9 protein.
  • the first target site comprises a sequence selected from among any one of SEQ ID NOS:59-129. In some of any embodiments, the first target site comprises the sequence of SEQ ID NO:83. In some of any embodiments, the first targeting domain comprises the sequence of SEQ ID NO:58 (GUGGAUGACCUGGCUAACAG).
  • the second target site comprises a sequence selected from among any one of SEQ ID NOS:235-265. In some of any embodiments, the second targeting domain comprises a sequence selected from among any one of SEQ ID NOS:25-55. In some of any embodiments, the second target site comprises the sequence of SEQ ID NO:238. In some of any embodiments, the second targeting domain comprises the sequence of SEQ ID NO:28 (GAGAAUCAAAAUCGGUGAAU).
  • the integration of the transgene via HDR is carried out with a polynucleotide comprising the structure [5’ homology arm] -[transgene] -[3’ homology arm].
  • the 5’ homology arm and 3’ homology arm comprises nucleic acid sequences homologous to nucleic acid sequences surrounding the second target site.
  • the 5’ homology arm comprises SEQ ID NO: 56 or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 56 or a partial sequence thereof
  • the 3’ homology arm comprises SEQ ID NO:57, a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:57 or a partial sequence thereof.
  • the 5’ homology arm comprises SEQ ID NO: 56 and the 3’ homology arm comprises SEQ ID NO:57.
  • the recombinant TCR binds to or recognizes a peptide epitope of human papillomavirus (HPV). In some of any embodiments, the recombinant TCR binds to or recognizes HPV 16 E7 in the context of an MHC molecule, wherein the peptide epitope is or comprises E7(l l-19) YMLDLQPET (SEQ ID NO: 267). In some of any embodiments, the MHC molecule is an HLA-A2 molecule.
  • the Va region includes a complementarity determining region 1 (CDR-1) comprising the sequence of SEQ ID NO: 10, a CDR-2 comprising the sequence of SEQ ID NO: 11, and a CDR-3 comprising the sequence of SEQ ID NO: 12; and the VP region includes a complementarity determining region 1 (CDR-1) comprising the sequence of SEQ ID NOG, a CDR-2 comprising the sequence of SEQ ID NO:4, and a CDR-3 comprising the sequence of SEQ ID NOG.
  • CDR-1 complementarity determining region 1
  • the VP region includes a complementarity determining region 1 (CDR-1) comprising the sequence of SEQ ID NOG, a CDR-2 comprising the sequence of SEQ ID NO:4, and a CDR-3 comprising the sequence of SEQ ID NOG.
  • the Va region comprise the sequence of SEQ ID NOG, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NOG; and the VP region comprise the sequence of SEQ ID NO:1, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:1.
  • the Va region comprise the sequence of SEQ ID NOG; and the VP region comprise the sequence of SEQ ID NO:1.
  • the TCRa chain includes a constant alpha (Ca) region and the TCRP chain includes a constant beta (CP) region.
  • the Ca region and the CP region are human constant regions.
  • the Ca region includes a sequence selected from any one of SEQ ID NOS: 9, 167-172, 175, 176, and 178-181, or a sequence that has at least at or about 90% sequence identity to any one of SEQ ID NOS: 9, 167-172, 175, 176, and 178-181; and the CP region includes a sequence selected from any one of SEQ ID NOS:2, 156, 173, 174, 177, 182, and 183, or a sequence that has at least at or about 90% sequence identity to any one of SEQ ID NOS: 2, 156, 173, 174, 177, 182, and 183.
  • the Ca region and the CP region include one or more modifications comprising cysteine residues that are capable of forming one or more non-native disulfide bridges between the TCRa chain and TCRP chain.
  • the Ca region includes the sequence of SEQ ID NO:9, or a sequence that has at least at or about 90% sequence identity to SEQ ID NO:9; and the CP region includes the sequence of SEQ ID NO:2, or a sequence that has at least at or about 90% sequence identity to SEQ ID NO:2. In some of any embodiments, the Ca region includes the sequence of SEQ ID NO:9; and the CP region includes the sequence of SEQ ID NO:2.
  • the transgene contains a nucleotide sequence encoding the TCRa chain comprising the sequence of SEQ ID NO:22, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:22; and a nucleotide sequence encoding the TCRP chain comprising the sequence of SEQ ID NO: 18, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18.
  • the transgene contains a nucleotide sequence encoding the TCRa chain comprising the sequence of SEQ ID NO:22; and a nucleotide sequence encoding the TCRP chain comprising the sequence of SEQ ID NO: 18.
  • the transgene contains a nucleotide sequence encoding at least one further protein.
  • the at least one further protein comprises a surrogate marker.
  • the surrogate marker is a truncated receptor.
  • the truncated receptor lacks an intracellular signaling domain and/or is not capable of mediating intracellular signaling when bound by its ligand.
  • the transgene contains one or more multicistronic element(s).
  • the one or more multicistronic element(s) are positioned between the nucleotide sequence encoding the TCRa chain and the nucleotide sequence encoding the TCRP chain.
  • the one or more multicistronic element(s) are positioned upstream of the nucleotide sequence encoding the recombinant TCR or a portion thereof; and/or are positioned between the nucleotide sequence encoding the recombinant TCR or a portion thereof and the nucleotide sequence encoding the at least one further protein.
  • the one or more multicistronic element is or comprises a ribosome skip sequence.
  • the ribosome skip sequence is a T2A, a P2A, an E2A, or an F2A element.
  • the one or more multicistronic element comprises a P2A element.
  • the P2A element comprises a sequence of any one of SEQ ID NOS: 221-234.
  • the P2A element comprises SEQ ID NO:233.
  • the transgene contains one or more heterologous or regulatory control element(s) operably linked to control expression of the TCR when expressed from a cell introduced with the genetically engineered T cell.
  • the heterologous regulatory or control element comprises a heterologous promoter.
  • the heterologous promoter is or comprises a human elongation factor 1 alpha (EFla) promoter or a variant thereof.
  • the genetically engineered T cell is less sensitive to or resistant to immune suppression in the tumor microenvironment (TME), such as immune suppression mediated by TGFp, when administered to a subject having a disease or disorder.
  • TEE tumor microenvironment
  • the genetically engineered T cell results in a suppression of tumor growth, a reduction in tumor burden and/or an increase in survival of a subject, when administered to a subject having a disease or disorder.
  • the genetically engineered T cell results in increased modified tumor control index (mTCI) when administered to a subject having a disease or disorder.
  • mTCI modified tumor control index
  • the genetically engineered T cell exhibits a less terminally differentiated cell phenotype after exposure to an antigen that is recognized by the recombinant TCR. In some of any embodiments, the genetically engineered T cell results in greater systemic expansion and/or longer persistence when administered to a subject having a disease or disorder. In some of any embodiments, the genetically engineered T cell results in a suppression of tumor growth, a reduction in tumor burden and/or an increase in survival of a subject, when administered to a subject having a disease or disorder at a dose that is lower than a dose of T cells engineered to express a comparator T cell receptor and/or a dose of T cells engineered that does not comprise the first genetic disruption.
  • the disease or disorder is associated with HPV. In some of any embodiments, the disease or disorder is associated with HPV 16. In some of any embodiments, the disease or disorder is a cancer or a tumor. In some of any embodiments, the disease or disorder is a solid tumor.
  • the methods involve introducing, into a T cell, a first agent for inducing a first genetic disruption at a first target site within an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus; and introducing a second agent for inducing a second genetic disruption at a second target site within a T cell receptor alpha constant (TRAC) locus; and introducing a polynucleotide comprising a transgene encoding a recombinant T cell receptor (TCR) comprising a TCR alpha (TCRa) chain comprising a variable alpha (Va) region, and a TCR beta (TCRP) chain comprising a variable beta (VP) region, or a portion thereof.
  • TCR recombinant T cell receptor
  • TCRa TCR alpha
  • Va variable alpha
  • TCRP TCR beta
  • the methods involve introducing, into a T cell, a first agent for inducing a first genetic disruption at a first target site within an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus; introducing a second agent for inducing a second genetic disruption at a second target site within a T cell receptor alpha constant (TRAC) locus; and introducing a polynucleotide comprising a transgene encoding a recombinant T cell receptor (TCR) comprising a TCR alpha (TCRa) chain comprising a variable alpha (Va) region, and a TCR beta (TCRP) chain comprising a variable beta (VP) region.
  • TGFBR2 transforming growth factor-beta receptor type-2
  • the methods involve introducing, into a T cell, a polynucleotide comprising a transgene encoding a recombinant T cell receptor (TCR) comprising a TCR alpha (TCRa) chain comprising a variable alpha (Va) region, and a TCR beta (TCRP) chain comprising a variable beta (VP) region, or a portion thereof, said T cell comprising a first genetic disruption at a first target site within an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus, and a second genetic disruption at a second target site within a T cell receptor alpha constant (TRAC) locus.
  • TCR recombinant T cell receptor
  • TCRa TCR alpha
  • Va variable alpha
  • TCRP TCR beta
  • VP variable beta
  • the methods involve introducing, into a T cell, a polynucleotide comprising a transgene encoding a recombinant T cell receptor (TCR) comprising a TCR alpha (TCRa) chain comprising a variable alpha (Va) region, and a TCR beta (TCRP) chain comprising a variable beta (VP) region, said T cell comprising a first genetic disruption at a first target site within an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus, and a second genetic disruption at a second target site within a T cell receptor alpha constant (TRAC) locus.
  • TCR recombinant T cell receptor
  • TCRa TCR alpha
  • Va variable alpha
  • TCRP TCR beta
  • VP variable beta
  • the polynucleotide such as a template polynucleotide, also includes one or more homology arm(s) linked to the transgene, wherein the one or more homology arm(s) comprise a sequence homologous to one or more region(s) of an open reading frame of a TRAC locus.
  • the transgene is integrated via homology directed repair (HDR) at the TRAC locus.
  • the first genetic disruption is a knockout (KO) of the TGFBR2 gene.
  • all alleles of the TGFBR2 locus are knocked out in the cell.
  • both alleles of the TGFBR2 locus are knocked out in the cell.
  • expression of a gene product from the endogenous TGFBR2 locus is eliminated or prevented.
  • the genetically engineered T cell produced by the described methods does not encode a functional TGFBRII polypeptide. In some of any embodiments, the genetically engineered T cell produced by the described methods does not encode a TGFBR2 polypeptide. In some of any embodiments, the genetically engineered T cell produced by the described methods does not encode a full length TGFBR2 polypeptide. In some of any embodiments, the expression of TGFBR2 polypeptide is reduced or eliminated in the genetically engineered T cell produced by the described methods. In some of any embodiments, TGFP signal transmission is reduced or eliminated in the genetically engineered T cell produced by the described methods.
  • the second agent comprises a second CRISPR-Cas combination comprising a second gRNA comprising a second targeting domain that binds to the second target site, and a Cas9 protein.
  • the Cas9 protein is a S. pyogenes Cas9 protein.
  • the polynucleotide comprises the structure [5’ homology arm] -[transgene] -[3’ homology arm].
  • the 5’ homology arm and 3’ homology arm comprises nucleic acid sequences homologous to nucleic acid sequences surrounding the second target site.
  • the 5’ homology arm and 3’ homology arm independently are at or about 200, 300, 400, 500, 600, 700 or 800 nucleotides in length, or any value between any of the foregoing, or are greater than at or about 300 nucleotides in length.
  • the 5’ homology arm and 3’ homology arm independently are at or about 400, 500 or 600 nucleotides in length.
  • the Va region includes a complementarity determining region 1 (CDR-1) comprising the sequence of SEQ ID NO: 10, a CDR-2 comprising the sequence of SEQ ID NO: 11, and a CDR-3 comprising the sequence of SEQ ID NO: 12; and the VP region includes a complementarity determining region 1 (CDR-1) comprising the sequence of SEQ ID NOG, a CDR-2 comprising the sequence of SEQ ID NO:4, and a CDR-3 comprising the sequence of SEQ ID NOG.
  • CDR-1 complementarity determining region 1
  • the VP region includes a complementarity determining region 1 (CDR-1) comprising the sequence of SEQ ID NOG, a CDR-2 comprising the sequence of SEQ ID NO:4, and a CDR-3 comprising the sequence of SEQ ID NOG.
  • the Va region comprise the sequence of SEQ ID NOG, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NOG; and the VP region comprise the sequence of SEQ ID NO:1, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:1.
  • the Va region comprise the sequence of SEQ ID NO:8; and the VP region comprise the sequence of SEQ ID NO:1.
  • the TCRa chain includes a constant alpha (Ca) region and the TCRP chain includes a constant beta (CP) region.
  • the Ca region and the CP region are human constant regions.
  • the Ca region includes a sequence selected from any one of SEQ ID NOS: 9, 167-172, 175, 176, and 178-181, or a sequence that has at least at or about 90% sequence identity to any one of SEQ ID NOS: 9, 167-172, 175, 176, and 178-181; and the CP region includes a sequence selected from any one of SEQ ID NOS:2, 156, 173, 174, 177, 182, and 183, or a sequence that has at least at or about 90% sequence identity to any one of SEQ ID NOS: 2, 156, 173, 174, 177, 182, and 183.
  • the Ca region and the CP region include one or more modifications comprising cysteine residues that are capable of forming one or more non-native disulfide bridges between the TCRa chain and TCRP chain.
  • the Ca region includes the sequence of SEQ ID NO:9, or a sequence that has at least at or about 90% sequence identity to SEQ ID NO:9; and the CP region includes the sequence of SEQ ID NO:2, or a sequence that has at least at or about 90% sequence identity to SEQ ID NO:2. In some of any embodiments, the Ca region includes the sequence of SEQ ID NO:9; and the CP region includes the sequence of SEQ ID NO:2.
  • the transgene contains a nucleotide sequence encoding the TCRa chain comprising the sequence of SEQ ID NO:22, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:22; and a nucleotide sequence encoding the TCRP chain comprising the sequence of SEQ ID NO: 18, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18.
  • the transgene contains a nucleotide sequence encoding at least one further protein.
  • the at least one further protein comprises a surrogate marker.
  • the surrogate marker is a truncated receptor.
  • the truncated receptor lacks an intracellular signaling domain and/or is not capable of mediating intracellular signaling when bound by its ligand.
  • the one or more multicistronic element is or comprises a ribosome skip sequence.
  • the ribosome skip sequence is a T2A, a P2A, an E2A, or an F2A element.
  • the one or more multicistronic element comprises a P2A element.
  • the P2A element comprises a sequence of any one of SEQ ID NOS: 221-234.
  • the P2A element comprises SEQ ID NO:233.
  • the transgene contains the sequence of SEQ ID NO:24, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:24. In some of any embodiments, the transgene contains the sequence of SEQ ID NO:24.
  • the transgene contains one or more heterologous or regulatory control element(s) operably linked to control expression of the TCR when expressed from a cell introduced with the genetically engineered T cell.
  • the heterologous regulatory or control element comprises a heterologous promoter.
  • the heterologous promoter is or comprises a human elongation factor 1 alpha (EFla) promoter or a variant thereof.
  • the polynucleotide e.g., a template polynucleotide
  • the viral vector is an AAV vector.
  • the AAV vector is an AAV6 vector.
  • the viral vector is a retroviral vector.
  • the viral vector is a lentiviral vector.
  • the polynucleotide is a linear polynucleotide. In some of any embodiments, the polynucleotide is a double- stranded polynucleotide or a single-stranded polynucleotide.
  • the polynucleotide is between at or about 2500 and at or about 5000 nucleotides, at or about 3500 and at or about 4500 nucleotides, or at or about 3750 nucleotides and at or about 4250 nucleotides in length.
  • the systems include a first agent for inducing a first genetic disruption at a first target site at an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus of a T cell; a second agent for inducing a second genetic disruption at a second target site within a T cell receptor alpha constant (TRAC) locus of the T cell; and a polynucleotide comprising a transgene encoding a recombinant T cell receptor (TCR) comprising a TCR alpha (TCRa) chain comprising a variable alpha (Va) region, and a TCR beta (TCRP) chain comprising a variable beta (VP) region, or a portion thereof; and one or more homology arm(s) linked to the transgene, wherein the one or more homology arm(s) comprise a sequence
  • the systems include a first agent for inducing a first genetic disruption at a first target site at an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus of a T cell; a second agent for inducing a second genetic disruption at a second target site within a T cell receptor alpha constant (TRAC) locus of the T cell; and a polynucleotide comprising a transgene encoding a recombinant T cell receptor (TCR) comprising a TCR alpha (TCRa) chain comprising a variable alpha (Va) region, and a TCR beta (TCRP) chain comprising a variable beta (VP) region; and one or more homology arm(s) linked to the transgene, wherein the one or more homology arm(s) comprise a sequence homologous to one or more region(s) of an open reading frame of the TRAC locus.
  • TGFBR2 transforming growth factor-beta receptor type-2
  • the transgene is a sequence that is exogenous or heterologous to the T cell.
  • the first agent, the second agent and the polynucleotide are for introduction into the T cell, and the transgene is integrated via homology directed repair (HDR) at the TRAC locus.
  • HDR homology directed repair
  • the first target site is present at a promoter, a regulatory element or a control element of the endogenous TGFBR2 locus or an open reading frame of the endogenous TGFBR2 locus. In some of any embodiments, the first target site is present downstream of exon 1 and upstream of exon 8 of an open reading frame of the endogenous TGFBR2 locus. In some of any embodiments, the first target site is present downstream of exon 4 and upstream of exon 6, of the open reading frame of the endogenous TGFBR2 locus.
  • the genetically engineered T cell does not encode a functional TGFBR2 polypeptide. In some of any embodiments, the genetically engineered T cell does not encode a TGFBR2 polypeptide. In some of any embodiments, the genetically engineered T cell does not encode a full length TGFBR2 polypeptide. In some of any embodiments, the expression of TGFBR2 polypeptide is reduced or eliminated in the genetically engineered T cell. In some of any embodiments, TGFP signal transmission is reduced or eliminated in the genetically engineered T cell.
  • the first genetic disruption has been introduced using a first agent comprising a zinc finger nuclease (ZFN), a TAL-effector nuclease (TALEN), or a CRISPR-Cas combination.
  • the second genetic disruption has been introduced using a second agent comprising a zinc finger nuclease (ZFN), a TAL-effector nuclease (TALEN), or a CRISPR-Cas combination.
  • the first agent comprises a first CRISPR-Cas combination comprising a first guide RNA (gRNA) comprising a first targeting domain that binds to the first target site, and a Cas9 protein.
  • the second agent comprises a second CRISPR-Cas combination comprising a second gRNA comprising a second targeting domain that binds to the second target site, and a Cas9 protein.
  • the Cas9 protein is a S. pyogenes Cas9 protein.
  • the 5’ homology arm comprises SEQ ID NO: 56 or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO: 56 or a partial sequence thereof
  • the 3’ homology arm comprises SEQ ID NO:57, a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% sequence identity to SEQ ID NO:57 or a partial sequence thereof.
  • the 5’ homology arm comprises SEQ ID NO: 56 and the 3’ homology arm comprises SEQ ID NO:57.
  • the recombinant TCR binds to or recognizes a peptide epitope of human papillomavirus (HPV). In some of any embodiments, the recombinant TCR binds to or recognizes HPV 16 E7 in the context of an MHC molecule, wherein the peptide epitope is or comprises E7(l l-19) YMLDLQPET (SEQ ID NO: 267). In some of any embodiments, the MHC molecule is an HLA-A2 molecule.
  • the Va region comprise the sequence of SEQ ID NOG, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NOG; and the VP region comprise the sequence of SEQ ID NO:1, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:1.
  • the Va region comprise the sequence of SEQ ID NO:8; and the VP region comprise the sequence of SEQ ID NO:1.
  • the TCRa chain includes a constant alpha (Ca) region and the TCRP chain includes a constant beta (CP) region.
  • the Ca region and the CP region are human constant regions.
  • the Ca region and the CP region include one or more modifications comprising cysteine residues that are capable of forming one or more non-native disulfide bridges between the TCRa chain and TCRP chain.
  • the transgene contains a nucleotide sequence encoding the TCRa chain comprising the sequence of SEQ ID NO:22, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:22; and a nucleotide sequence encoding the TCRP chain comprising the sequence of SEQ ID NO: 18, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18.
  • the transgene contains a nucleotide sequence encoding the TCRa chain comprising the sequence of SEQ ID NO:22; and a nucleotide sequence encoding the TCRP chain comprising the sequence of SEQ ID NO: 18.
  • the transgene contains a nucleotide sequence encoding at least one further protein.
  • the at least one further protein comprises a surrogate marker.
  • the surrogate marker is a truncated receptor.
  • the truncated receptor lacks an intracellular signaling domain and/or is not capable of mediating intracellular signaling when bound by its ligand.
  • the transgene contains one or more multicistronic element(s).
  • the one or more multicistronic element(s) are positioned between the nucleotide sequence encoding the TCRa chain and the nucleotide sequence encoding the TCRP chain.
  • the one or more multicistronic element(s) are positioned upstream of the nucleotide sequence encoding the recombinant TCR or a portion thereof; and/or are positioned between the nucleotide sequence encoding the recombinant TCR or a portion thereof and the nucleotide sequence encoding the at least one further protein.
  • the transgene contains one or more heterologous or regulatory control element(s) operably linked to control expression of the TCR when expressed from a cell introduced with the genetically engineered T cell.
  • the heterologous regulatory or control element comprises a heterologous promoter.
  • the heterologous promoter is or comprises a human elongation factor 1 alpha (EFla) promoter or a variant thereof.
  • the polynucleotide is a linear polynucleotide. In some of any embodiments, the polynucleotide is a double- stranded polynucleotide or a single-stranded polynucleotide.
  • the concentration of the first RNP and/or the second RNP are between at or about 1 pM and at or about 5 pM, between at or about 1.5 pM and at or about 2.5 pM, between at or about 1.7 pM and at or about 2.5 pM, or between at or about 2 pM and at or about 2.5 pM. In some of any embodiments, the concentration of the first RNP and/or the second RNP are at or about 1.0 pM, at or about 1.5 pM, at or about 1.7 pM, at or about 2 pM, at or about 2.2 pM, or at or about 2.5 pM.
  • the first agent comprises a first ribonucleoprotein (RNP) complex comprising the first gRNA and the Cas9 protein.
  • the second agent comprises a second RNP complex comprising the second gRNA and the Cas9 protein.
  • the polynucleotide is introduced after the introduction of the first agent and/or the second agent. In some of any embodiments, the polynucleotide is introduced immediately after, or within about 30 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 6 minutes, 8 minutes, 9 minutes, 10 minutes, 15 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, 90 minutes, 2 hours, 3 hours or 4 hours after the introduction of the agent.
  • compositions that include a plurality of any of the genetically engineered T cells provided herein.
  • a dose of the genetically engineered T cells is administered to the subject.
  • the dose of genetically engineered T cells comprises between at or about 3 x 10 7 recombinant TCR-expressing T cells and at or about 3 x 10 10 recombinant TCR-expressing T cells, inclusive. In some of any embodiments, the dose of genetically engineered T cells comprises between at or about 1 x 10 8 recombinant TCR- expressing T cells and at or about 1 x 10 10 recombinant TCR-expressing T cells, inclusive. In some of any embodiments, the dose of genetically engineered T cells comprises between at or about 1 x 10 8 recombinant TCR-expressing T cells and at or about 1 x 10 9 recombinant TCR- expressing T cells, inclusive.
  • FIG. IB depicts cell surface expression of MHC-peptide tetramer complexed with the antigen recognized by the recombinant TCR and Vbeta2, as assessed by flow cytometry, for CD4+ or CD8+ T cells in mock-transduced (left four panels) and transduced (left right panels) T cells subject to knockout of endogenous TCR encoding gene (TRAC), engineered to express TCR1 (TCR1 TRAC KI; top panels) or without a knock-in of TCR1 (TCR1 TRAC KO; bottom panels).
  • TCR1 TRAC KI endogenous TCR encoding gene
  • FIGS. 8A-8B depict the percentage of CD 103 -expressing cells among CD3+ TCR+ cells, as assessed by flow cytometry, of T cells subject to knockout of endogenous TCR encoding gene (TRAC), engineered to express TCR1 and engineered with (TCR1 TRAC KI TGFBR2 KO) or without (TCR1 TRAC KI TGFBR2 WT) a knockout of endogenous TGFBR2 locus, at a dose of 3.33 x 10 5 cells (FIG. 8A) or at a dose of 1 x 10 6 cells (FIG. 8B).
  • TCR encoding gene TRAC
  • TCR1 TRAC KI TGFBR2 KO engineered to express TCR1 and engineered with (TCR1 TRAC KI TGFBR2 KO) or without (TCR1 TRAC KI TGFBR2 WT) a knockout of endogenous TGFBR2 locus
  • FIGS. 10A-10C depict cell expansion of T cells engineered to express the exemplary anti-HPV TCR1 by targeted knock-in at the endogenous TRAC locus, with (TCR1 TRAC KI TGFBR2 KO) or without (TCR1 TRAC KI TGFBR2 WT) a knockout of endogenous TGFBR2 locus, or a knockout of an endogenous TCR encoding gene and a knockout of an endogenous TGFBR2 locus (TRAC KO TGFBR2 KO) as measured by circulating CD4+ (FIG. 10A) and CD8+ (FIG. 10B) T cells in blood. A tumor only group was used as control.
  • FIG. 10C shows the percentage of CD103-expressing cells among CD3+ TCR+ cells, as assessed by flow cytometry at day 14.
  • FIGS. 14A-14C depict the tumor volume changes over time in individual UM- SCC-104 mice administered TCR1 TRAC KI TGFBR2 KO, TCR1 TRAC KI TGFBR2 WT, TRAC KO TGFBR2 KO, at a dose of 6 x 10 6 cells (FIG. 14A), 2 x 10 6 cells (FIG. 14B), or 6 x 10 5 cells (FIG. 14C), or a control without T cell addition (tumor only).
  • FIGS. 16A-16C depict the survival curve of UM-SCC-104 mice administered TCR1 TRAC KI TGFBR2 KO, TCR1 TRAC KI TGFBR2 WT, TRAC KO TGFBR2 KO, at a dose of 6 x 10 6 cells (FIG. 16A), 2 x 10 6 cells (FIG. 16B), or 6 x 10 5 cells (FIG. 16C), or a control without T cell addition (tumor only).
  • FIG. 17 depict the percentage of CD 103 -expressing cells among CD3+ TCR+ cells, as assessed by flow cytometry, in UM-SCC-104 mice administered T cells engineered to express the exemplary anti-HPV TCR1 by targeted knock-in at the endogenous TRAC locus, with (TCR1 TRAC KI TGFBR2 KO) or without (TCR1 TRAC KI TGFBR2 WT) a knockout of endogenous TGFBR2 locus.
  • polynucleotides that contain a transgene encoding a recombinant TCR or a portion thereof, and methods for introducing such polynucleotides into the cells, such as by transduction or by physical delivery, such as electroporation, and vectors for introducing such polynucleotides.
  • the integration of the transgene is achieved by inducing a targeted genetic disruption, e.g., generation of a DNA break, using gene editing methods, and homology-directed repair (HDR) for targeted knock-in (KI) of the recombinant TCR-encoding transgene at a gene locus encoding the endogenous TCR (e.g., TRAC), thereby reducing or eliminating the expression of the endogenous TCR, at the same time allowing for expression of the recombinant (and typically exogenous or heterologous) TCR.
  • a targeted genetic disruption e.g., generation of a DNA break
  • HDR homology-directed repair
  • KI targeted knock-in
  • Adoptive cell therapy with transfer of recombinant receptor-expressing T cells targeting cell surface antigens has shown success in hematological malignancies.
  • CAR chimeric antigen receptor
  • TCR recombinant T cell receptor
  • effectively targeting solid tumors has been limited, in part due to challenges in identifying highly expressed, tumor specific antigens and the immune suppressive tumor microenvironment mediated by cellular and secreted factors such as TGFp, known to suppress intra-tumoral immunity and substantially elevated in many human cancers, including in human papilloma virus-associated cancers (e.g., head and neck squamous cell carcinoma and cervical cancers).
  • TGFp chimeric antigen receptor
  • TCR recombinant T cell receptor
  • compositions comprising the engineered T cells, characterized using flow cytometry and molecular techniques, were shown to exhibit more than 95% TRAC KO, more than 80% TGFBR 2 KO and more than 75% anti-HPV recombinant TCR expression (e.g., TCR1 as referred to in the disclosure that targets the tumor restricted HPV 16 E7(l 1-19) onco -pep tide).
  • T cell-based therapies such as adoptive T cell therapies (including those involving the administration of engineered cells expressing recombinant, engineered or chimeric receptors specific for a disease or disorder of interest, such as a recombinant T cell receptor (TCR) or other recombinant, engineered or chimeric receptors) can be effective in the treatment of cancer and other diseases and disorders.
  • adoptive T cell therapies including those involving the administration of engineered cells expressing recombinant, engineered or chimeric receptors specific for a disease or disorder of interest, such as a recombinant T cell receptor (TCR) or other recombinant, engineered or chimeric receptors
  • TCR recombinant T cell receptor
  • other approaches for generating engineered cells for adoptive cell therapy may not always be entirely satisfactory.
  • optimal activity or outcome can depend on the ability of the administered cells to uniformly and/or continuously express the recombinant receptor, become activated, expand, to exert various effector functions, including cytotoxic killing and secretion of various factors such as cytokines, to persist, including long-term, to differentiate, transition or engage in reprogramming into certain phenotypic states (such as long-lived memory, less-differentiated, and effector states), to avoid or reduce immunosuppressive conditions in the local microenvironment of a disease, to provide effective and robust recall responses following clearance and re-exposure to target ligand or antigen, and avoid or reduce exhaustion, anergy, peripheral tolerance, terminal differentiation, and/or differentiation into a suppressive state.
  • cytotoxic killing and secretion of various factors such as cytokines
  • the provided embodiments involve inducing a genetic disruption at the endogenous TGFBR2 locus, thereby altering, reducing or eliminating the expression of TGFBR2 from the endogenous TGFBR2 gene.
  • the provided embodiments are based on observations that reduction and/or elimination of expression of TGFBR2, for example by a genetic disruption (e.g., knock-out) results in improved activity and/or function, such as anti-tumor activity, cytokine production, expansion and/or persistence, of the engineered cells expressing a recombinant receptor, such as a recombinant TCR.
  • the provided methods can be used in connection with solid tumor targets or other disease microenvironments where TGFP immunosuppressive activity may otherwise impair or reduce the function, survival or activity of a T cell therapy.
  • the provided cells, compositions, nucleic acids, kits and methods also offer advantages in controlling and regulating expression of the recombinant TCR on cells of the T cell therapy.
  • the resulting genetically engineered cells or cell compositions can be used in adoptive cell therapy methods.
  • the provided embodiments are also based on observations of improved expression of an exemplary fully human recombinant TCR, such as certain provided TCRs specific to HPV 16 E7 (for example, TCR1 as referred to in the disclosure that targets the tumor restricted HPV 16 E7(l 1-19) onco-peptide), and improved activity of engineered T cells expressing the exemplary recombinant TCR at the modified TRAC locus and with a genetic disruption at TGFBR2 (e.g., reducing or eliminating expression of the TGFBR2 gene product), even at a low effector to target (E:T) ratio or a low dose administration (e.g., a sub-optimal E:T ratio or a sub-optimal dose).
  • TCR1 as referred to in the disclosure that targets the tumor restricted HPV 16 E7(l 1-19) onco-peptide
  • engineered T cells expressing the exemplary recombinant TCR at the modified TRAC locus and with a genetic disruption at TGFBR2 e.g.,
  • compositions containing the provided engineered T cells can be used for treating an HPV-associated cancer at a dosage administration of between 1 x 10 8 recombinant TCR-expressing T cells and 1 xlO 10 recombinant TCR-expressing T cells, for instance at or about IxlO 9 recombinant TCR- expressing T cells or IxlO 8 recombinant TCR-expressing T cells.
  • the number of TCR-expressing T cells in a population of engineered T cells is determined by flow cytometry.
  • the recombinant TCR-expressing T cells are the number of such viable cells (e.g. viable cell concentration, cells/mL; or cell viability, % viable), such as determined using an automated cell counter.
  • kits for generating or producing genetically engineered cells that contain TRAC locus includes nucleic acid sequences encoding a recombinant TCR or a portion thereof, such as a TCR alpha (TCRa) chain or a TCR beta (TCRP) chain of a recombinant TCR.
  • the methods involve inducing a targeted genetic disruption and homology-directed repair (HDR), using one or more polynucleotides (e.g., a template polynucleotide) containing the transgene encoding all or a portion of the recombinant TCR, thereby targeting integration of the transgene at the TRAC locus.
  • HDR homology-directed repair
  • cells and cell compositions generated by the methods are also provided. In some aspects, elimination of expression of the endogenous TCRa chain can reduce mispairing between an endogenous and the engineered or recombinant chains.
  • suboptimal expression of an engineered or recombinant TCR can occur due to competition with an endogenous TCR and/or with TCRs having mispaired chains, for signaling molecules and/or domains such as the invariant CD3 signaling molecules (e.g., availability of co-expressed co-expression of CD3 6, a, y and C, chains) that are involved in permitting expression of the complex on the cell surface.
  • available CD3( ⁇ molecules can limit the expression and function of the TCRs in the cells.
  • currently available methods for delivery of transgenes, e.g., encoding recombinant TCR may show inefficient integration and/or reduced expression of the recombinant TCRs.
  • the efficiency of integration and/or expression of the recombinant TCR within a population may be low and/or varied.
  • the TCRs thus also exhibit improved expression and activity, with minimal risk of cross reactivity to other antigens, such as non-target antigens, that can be present in the subject, or peptide epitopes present on non-target HLA subtypes. Accordingly, the described embodiments provide numerous advantages over conventional methods of adoptive cell therapy.
  • the provided cells are engineered by CRISPR/Cas9 mediated gene editing to introduce a genetic disruption at a target site, and/or targeted integration (targeted knock-in, KI) of transgene sequences, for example encoding the recombinant TCR, at or near one of the target sites with the genetic disruption.
  • the cells are engineered to comprise a genetic disruption to knockout (KO) the endogenous TGFBR2 locus.
  • one or more targeted genetic disruption is induced at the endogenous TRAC locus.
  • one or more targeted genetic disruption is induced at one or more target sites, for example a second target site, at or near the endogenous TRAC locus.
  • the second genetic disruption is induced in an exon of the endogenous TRAC locus.
  • the second genetic disruption is induced in an intron of the endogenous TRAC locus.
  • the presence of the one or more second genetic disruption and a polynucleotide e.g., a template polynucleotide that contains transgene sequences encoding a recombinant TCR or a portion thereof, can result in targeted integration of the transgene sequences at or near the one or more genetic disruption (e.g., second target site) at the endogenous TRAC locus.
  • targeted integration produces a modified TRAC locus comprising a transgene encoding the recombinant TCR, or a portion of the recombinant TCR.
  • TGFBR2 a transmembrane protein that is a member of the serine/threonine protein kinase family and the TGFB receptor subfamily.
  • TGFBR2 forms a heterodimeric complex with TGF-beta type I serine/threonine kinase receptor (TGFBRI), a non-promiscuous receptor for the transforming growth factor beta (TGFP) cytokines TGFpi, TGFP2 and TGFP3 to transduce signals from the cytokines and regulate various physiological and pathological processes, including cell cycle arrest in epithelial and hematopoietic cells, control of mesenchymal cell proliferation and differentiation, wound healing, extracellular matrix production, immunosuppression and carcinogenesis (see, e.g., Yang et al., Trends Immunol.
  • TGFP can promote tumors, e.g., by dysregulation of cyclin-dependent kinase inhibitors, alteration in cytoskeletal architecture, increases in proteases and extracellular matrix formation, decreased immune surveillance and increased angiogenesis.
  • TGFP can control immune responses and maintains immune homeostasis through its impact on proliferation, differentiation and survival of multiple immune cell lineages.
  • TGFpi is the primary isoform expressed in the immune system, and has a wide-ranging regulatory activity affecting multiple types of immune cells.
  • binding of TGFP to TGFBR2 can downregulate, inhibit or hinder T cell activation, proliferation and differentiation.
  • TGFP also can control immune tolerance by virtue of its effect on T cells.
  • TME tumor microenvironment
  • TGFP may have an adverse effect on anti-tumor immunity and significantly inhibits tumor immune surveillance.
  • the genetic disruption is within the fourth exon of the TGFBR2 locus or the open reading frame of the transcript encoding isoform 1 of an exemplary human TGFBR2 locus (such as described in Table 1 herein). In some embodiments, the genetic disruption is within 500 base pairs (bp) downstream from the 5’ end of the fourth exon in the TGFBR2 locus or an open reading frame thereof. In particular embodiments, the genetic disruption is between the 5’ nucleotide of exon 4 and upstream of the 3’ nucleotide of exon 4.
  • the target site is at or near exon 1 of the endogenous TGFBR2 locus, e.g., within less than 500, 450, 400, 350, 300, 250, 200, 150, 100 or 50 bp of exon 1.
  • the target site is at or near exon 2 of the endogenous TGFBR2 locus, or within less than 500, 450, 400, 350, 300, 250, 200, 150, 100 or 50 bp of exon 2.
  • the target site is at or near exon 3 of the endogenous TGFBR2 locus, e.g., within less than 500, 450, 400, 350, 300, 250, 200, 150, 100 or 50 bp of exon 3.
  • a genetic disruption is targeted at, near, or within a TGFBR2 locus.
  • the genetic disruption is targeted at, near, or within an open reading frame of the TGFBR2 locus (such as described in Table 1 or 2 herein).
  • the genetic disruption is targeted at, near, or within an open reading frame that encodes a TGFBR2.
  • the first target site comprises SEQ ID NO:87. In some aspects, the first target site comprises SEQ ID NO:88. In some aspects, the first target site comprises SEQ ID NO:89. In some aspects, the first target site comprises SEQ ID NO:90. In some aspects, the first target site comprises SEQ ID NO:91. In some aspects, the first target site comprises SEQ ID NO:92. In some aspects, the first target site comprises SEQ ID NO:93. In some aspects, the first target site comprises SEQ ID NO:94. In some aspects, the first target site comprises SEQ ID NO:95. In some aspects, the first target site comprises SEQ ID NO:96. In some aspects, the first target site comprises SEQ ID NO:97.
  • Exemplary first gRNA targeting domain sequences include a sequence selected from any one of SEQ ID NOS: 58, and ISO- 135.
  • the first gRNA targeting domain comprises SEQ ID NO:58.
  • the first gRNA targeting domain comprises SEQ ID NO: 130.
  • the first gRNA targeting domain comprises SEQ ID NO: 131.
  • the first gRNA targeting domain comprises SEQ ID NO: 132.
  • the first gRNA targeting domain comprises SEQ ID NO: 133.
  • the first gRNA targeting domain comprises SEQ ID NO: 134.
  • the first gRNA targeting domain comprises SEQ ID NO: 135.
  • the genetically engineered T cell does not encode a functional endogenous Ca polypeptide. In some aspects, the genetically engineered T cell does not encode an endogenous Ca polypeptide. In some aspects, the genetically engineered T cell does not encode a full length endogenous Ca polypeptide. In some aspects, the expression of an endogenous Ca polypeptide is reduced or eliminated in the genetically engineered T cell. In some aspects, the pairing of a TCRP chain with a TCRa chain comprising an endogenous Ca is reduced or eliminated in the genetically engineered T cell.
  • the genetic disruption is targeted at, near, or within an open reading frame that encodes a TCRa constant domain. In some embodiments, the genetic disruption is targeted at, near, or within a locus having the nucleic acid sequence set forth in SEQ ID NO:278, or a sequence having at or at least 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, 99.5%, or 99.9% sequence identity to all or a portion, e.g., at or at least 500, 1,000, 1,500, 2,000, 2,500, 3,000, 3,500, or 4,000 contiguous nucleotides, of the nucleic acid sequence set forth in SEQ ID NO:278.
  • the genetic disruption is targeted at or in close proximity to the beginning of the coding region (e.g., the early coding region, e.g., within 500bp from the start codon or the remaining coding sequence, e.g., downstream of the first 500bp from the start codon).
  • the genetic disruption is targeted at early coding region of a gene of interest, e.g., TRAC, including sequence immediately following a transcription start site, within a first exon of the coding sequence, or within 500 bp of the transcription start site (e.g., less than 500, 450, 400, 350, 300, 250, 200, 150, 100 or 50 bp), or within 500 bp of the start codon (e.g., less than 500, 450, 400, 350, 300, 250, 200, 150, 100 or 50 bp).
  • a gene of interest e.g., TRAC
  • sequence immediately following a transcription start site e.g., within a first exon of the coding sequence, or within 500 bp of the transcription start site (e.g., less than 500, 450, 400, 350, 300, 250, 200, 150, 100 or 50 bp), or within 500 bp of the start codon (e.g., less than 500, 450, 400, 350, 300, 250, 200,
  • the second gRNA targeting domain comprises SEQ ID NO:25. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:26. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:27. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:28. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:29. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:30. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:31. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:32. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:33. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:34.
  • the second gRNA targeting domain comprises SEQ ID NO:45. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:46. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:47. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:48. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:49. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:50. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:51. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:52. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:53. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:54. In some aspects, the second gRNA targeting domain comprises SEQ ID NO:55.
  • the methods for generating the genetically engineered cells involve introducing a genetic disruption at one or more target site(s), e.g., one or more target sites at a TGFBR2 and/or TRAC locus.
  • the one or more agent(s) capable of inducing a genetic disruption comprises a DNA binding protein or DNA-binding nucleic acid that specifically binds to or hybridizes to a particular site or position in the genome, e.g., a target site or target position.
  • the targeted genetic disruption, e.g., DNA break or cleavage, of the endogenous genes encoding TCR or TGFBR2 is achieved using a protein or a nucleic acid is coupled to or complexed with a gene editing nuclease, such as in a chimeric or fusion protein.
  • the one or more agent(s) capable of inducing a genetic disruption comprises an RNA-guided nuclease, or a fusion protein comprising a DNA-targeting protein and a nuclease.
  • the CRISPR/Cas nuclease or CRISPR/Cas nuclease system includes a non-coding guide RNA (gRNA), which sequence-specifically binds to DNA, and a Cas protein (e.g., Cas9), with nuclease functionality.
  • gRNA non-coding guide RNA
  • Cas protein e.g., Cas9
  • a guide sequence is selected to reduce the degree of secondary structure within the guide sequence. Secondary structure may be determined by any suitable polynucleotide folding algorithm.
  • the gRNA is a unimolecular or chimeric gRNA comprising, from 5’ to 3’: a targeting domain which targets a target site (e.g., at the TGFBR2 locus or TRAC locus); a first complementarity domain; a linking domain; a second complementarity domain (which is complementary to the first complementarity domain); a proximal domain; and optionally, a tail domain.
  • a targeting domain which targets a target site (e.g., at the TGFBR2 locus or TRAC locus); a first complementarity domain; a linking domain; a second complementarity domain (which is complementary to the first complementarity domain); a proximal domain; and optionally, a tail domain.
  • the targeting domain is part of an RNA molecule and will therefore comprise the base uracil (U), while any DNA encoding the gRNA molecule will comprise the base thymine (T). While not wishing to be bound by theory, in some embodiments, it is believed that the complementarity of the targeting domain with the target sequence contributes to specificity of the interaction of the gRNA molecule/Cas9 molecule complex with a target nucleic acid. It is understood that in a targeting domain and target sequence pair, the uracil bases in the targeting domain will pair with the adenine bases in the target sequence. In some embodiments, the target domain itself comprises in the 5’ to 3’ direction, an optional secondary domain, and a core domain.
  • the first gRNA targeting domain comprises SEQ ID NO: 134. In some aspects, the first gRNA targeting domain comprises SEQ ID NO: 135. In some embodiments, the first target site at the TGFBR2 locus comprises the sequence of SEQ ID NO:83. In some embodiments, first targeting domain for targeting the TGFBR2 locus comprises the sequence of SEQ ID NO:58 (GUGGAUGACCUGGCUAAC AG) .
  • Exemplary targeting domains contained within the gRNA for targeting the genetic disruption of the human TRAC include those described in, e.g., WO2015/161276, W02017/193107, WO2017/093969, US2016/272999 and US2015/056705 or a targeting domain that can bind to the targeting sequences described in the foregoing.
  • Exemplary targeting domains contained within the gRNA for targeting the genetic disruption of the human TRAC locus using S. pyogenes or S. aureus Cas9 can include any of those set forth in Table 4.
  • the second target site at the TRAC locus comprises the sequence of SEQ ID NO:238.
  • the second targeting domain for targeting the TRAC locus comprises the sequence of SEQ ID NO:28 (GAGAAUCAAAAUCGGUGAAU).
  • the gRNA for targeting a TGFBR2 locus or a TRAC locus can be any that are described herein, or are described elsewhere e.g., in WO2015/161276, W02017/193107, WO2017/093969, US2016/272999, US2015/056705, WO2015/070083, WO20 19/070541, WO2019/ 195491, WO2019/195492, WO2019/089884, and WO2020/223535, or a targeting domain that can bind to the targeting sequences described in the foregoing.
  • Exemplary methods for gene editing of an endogenous locus of the T cell include those described in, e.g.
  • targeting domains include those for introducing a genetic disruption at a TGFBR2 locus or a TRAC locus using S. pyogenes Cas9 or using N. meningitidis Cas9. In some embodiments, targeting domains include those for introducing a genetic disruption at a TGFBR2 locus or a TRAC locus using S. pyogenes Cas9. Any of the targeting domains can be used with a S. pyogenes Cas9 molecule that generates a double stranded break (Cas9 nuclease) or a single- stranded break (Cas9 nickase).
  • the presence of a genetic disruption e.g., a DNA break, such as described in Section I.A, including a second genetic disruption at a TRAC locus, described in Section I.A.
  • a genetic disruption e.g., a DNA break, such as described in Section I.A, including a second genetic disruption at a TRAC locus, described in Section I.A.
  • a template polynucleotide containing one or more homology arms e.g., containing nucleic acid sequences homologous sequences surrounding the genetic disruption
  • cellular DNA repair machinery can use the template polynucleotide to repair the DNA break and resynthesize genetic information at the site of the genetic disruption, thereby effectively inserting or integrating the transgene sequences in the template polynucleotide at or near the site of the genetic disruption.
  • the genetic disruption e.g., TRAC locus
  • the genetic disruption can be generated by any of the methods for generating a targeted genetic disruption described herein.
  • Alteration of nucleic acid sequences at the target site can occur by HDR with an exogenously provided polynucleotide (also referred to as donor polynucleotide or template sequence).
  • the template polynucleotide provides for alteration of the target sequence, such as insertion of the transgene contained within the template polynucleotide.
  • a plasmid or a vector can be used as a template for homologous recombination.
  • a linear DNA fragment can be used as a template for homologous recombination.
  • “recombination” refers to a process of exchange of genetic information between two polynucleotides.
  • “homologous recombination (HR)” refers to the specialized form of such exchange that takes place, for example, during repair of double-strand breaks in cells via homology-directed repair mechanisms.
  • DNA repair mechanisms can be induced by a nuclease after (1) a single double-strand break, (2) two single strand breaks, (3) two double stranded breaks with a break occurring on each side of the target site, (4) one double stranded break and two single strand breaks with the double strand break and two single strand breaks occurring on each side of the target site (5) four single stranded breaks with a pair of single stranded breaks occurring on each side of the target site, or (6) one single stranded break.
  • a single-stranded template polynucleotide is used and the target site can be altered by alternative HDR.
  • DNA repair pathways such as single strand annealing (SSA), single- stranded break repair (SSBR), mismatch repair (MMR), base excision repair (BER), nucleotide excision repair (NER), intrastrand cross-link (ICL), translesion synthesis (TLS), error-free postreplication repair (PRR) can be employed by the cell to repair a doublestranded or single-stranded break created by the nucleases.
  • SSA single strand annealing
  • SSBR single- stranded break repair
  • MMR mismatch repair
  • BER base excision repair
  • NER nucleotide excision repair
  • ICL intrastrand cross-link
  • TLS translesion synthesis
  • PRR error-free postreplication repair
  • a polynucleotide such as a template polynucleotide having homology with sequences at or near one or more target site(s) in the endogenous DNA can be used to alter the structure of a target DNA, e.g., targeted insertion of the transgene encoding a recombinant TCR or a portion thereof.
  • the template polynucleotide contains homology sequences (e.g., homology arms) flanking the transgene, e.g., nucleic acid sequences encoding a recombinant TCR or a portion thereof, for targeted insertion.
  • the homology sequences target the transgene at a TRAC locus.
  • the transgene encodes a TCR alpha (TCRa) chain and a TCR beta (TCRP) chain of a recombinant TCR that binds to or recognizes a peptide epitope of human papillomavirus (HPV).
  • the polynucleotide e.g., template polynucleotide, comprises any transgene sequences provided herein or a nucleic acid sequence encoding any recombinant TCR described herein, e.g., in Section III.A.
  • the polynucleotide e.g., template polynucleotide
  • Va variable alpha
  • VP variable beta
  • Ca constant alpha
  • CP constant beta
  • the transgene comprises: a nucleotide sequence encoding the TCRa chain comprising the sequence of SEQ ID NO:22, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:22; and a nucleotide sequence encoding the TCRP chain comprising the sequence of SEQ ID NO: 18, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:18.
  • the transgene encoding the recombinant TCR or a portion thereof encodes one chain of a recombinant TCR and a second transgene encodes a different chain of the recombinant TCR.
  • the transgene encoding the recombinant TCR or a portion thereof encodes the alpha (TCRa) chain of the recombinant TCR and a second transgene encodes the beta (TCRP) chain of the recombinant TCR.
  • two or more transgene encoding different domains of the recombinant TCRs are targeted for integration at two or more target sites.
  • sequence of interest in the template polynucleotide may comprise one or more sequences encoding a functional polypeptide (e.g., a cDNA), with or without a promoter.
  • a functional polypeptide e.g., a cDNA
  • the double-stranded template polynucleotide includes sequences (also referred to as transgene) greater than 1 kb in length, for example between 2 and 200 kb, between 2 and 10 kb (or any value therebetween).
  • the double-stranded template polynucleotide also includes at least one nuclease target site, for example.
  • the template polynucleotide includes at least 2 target sites, for example for a pair of ZFNs or TALENs.
  • the nuclease target sites are outside the transgene sequences, for example, 5’ and/or 3’ to the transgene sequences, for cleavage of the transgene.
  • the template polynucleotide contains the transgene, e.g., recombinant TCR-encoding nucleic acid sequences, flanked by homology sequences (also called “homology arms”) on the 5’ and 3’ ends, to allow the DNA repair machinery, e.g., homologous recombination machinery, to use the template polynucleotide as a template for repair, effectively inserting the transgene into the target site of integration in the genome.
  • the homology arm should extend at least as far as the region in which end resection may occur, e.g., in order to allow the resected single stranded overhang to find a complementary region within the template polynucleotide. The overall length could be limited by parameters such as plasmid size or viral packaging limits.
  • a homology arm does not extend into repeated elements, e.g., ALU repeats or LINE repeats.
  • the template polynucleotide comprises about 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000, or 5000 base pairs homology 3’ of the target site. In some embodiments, the template polynucleotide comprises about 100 to 500, 200 to 400 or 250 to 350, base pairs homology 3’ of the transgene and/or target site.
  • the 3’ homology arm can extend at least 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, 2000, 3000, 4000, or 5000 nucleotides 3’ from the 3’ end of the transgene.
  • the template polynucleotide has a 5’ homology arm, a transgene, and a 3’ homology arm, such that the template polynucleotide extends substantially the same distance on either side of the target site.
  • the homology arms may have different lengths, but the transgene may be selected to compensate for this.
  • the transgene may extend further 5’ from the target site than it does 3’ of the target site, but the homology arm 5’ of the target site is shorter than the homology arm 3’ of the target site, to compensate.
  • a double stranded template polynucleotide has a length of about 160 nucleotides, e.g., about 200-4000, 300-3500, 400-3000, 500-2500, 600-2000, 700-1900, 800- 1800, 900-1700, 1000-1600, 1100-1500 or 1200-1400 nucleotides.
  • the template polynucleotide comprises at least 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides of homology 5’ of the target site or transgene, 3’ of the target site or transgene, or both 5’ and 3’ of the target site or transgene. In some embodiments, the template polynucleotide comprises no more than 10, 20, 30, 40, 50, 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 1500, or 2000 nucleotides of homology 5’ of the target site or transgene, 3’ of the target site or transgene, or both 5’ and 3’ of the target site or transgene.
  • the template polynucleotide comprises about 500, 600, 700, 800, 900 or 1000 nucleotides of 5’ homology arm sequences, which is homologous to 500, 600, 700, 800, 900 or 1000 nucleotides of sequences 5’ of the genetic disruption (e.g., at TRAC locus), the transgene, and about 500, 600, 700, 800, 900 or 1000 nucleotides of 3’ homology arm sequences, which is homologous to 500, 600, 700, 800, 900 or 1000 nucleotides of sequences 3’ of the genetic disruption (e.g., at TRAC locus).
  • the linker can contain from or from about 10 to 45 amino acids, such as 10 to 30 amino acids or 26 to 41 amino acids residues, for example 29, 30, 31 or 32 amino acids.
  • the linker between the TCRa chain or potion thereof and the TCRP chain or portion thereof contains a ribosome skipping element or a self-cleaving element.
  • the transgene may be inserted into an endogenous gene such that all, some or none of the endogenous gene is expressed.
  • the transgene e.g., with or without peptide-encoding sequences
  • the transgene is integrated into any endogenous locus.
  • the transgene is integrated into an endogenous TRAC locus.
  • the template polynucleotide is delivered by viral and/or non-viral gene transfer methods.
  • the template polynucleotide is delivered to the cell via an adeno associated virus (AAV), such as any described herein.
  • AAV adeno associated virus
  • the double-stranded template polynucleotides described herein may include one or more non-natural bases and/or backbones.
  • insertion of a template polynucleotide with methylated cytosines may be carried out using the methods described herein to achieve a state of transcriptional quiescence in a region of interest.
  • the surrogate marker is encoded on the same polynucleotide that encodes the recombinant TCR.
  • the nucleic acid sequence encoding the recombinant TCR is operably linked to a nucleic acid sequence encoding a marker, optionally separated by an internal ribosome entry site (IRES), or a nucleic acid encoding a self-cleaving peptide or a peptide that causes ribosome skipping, such as a 2A sequence, such as a T2A, a P2A, an E2A or an F2A.
  • Extrinsic marker genes may in some cases be utilized in connection with engineered cell to permit detection or selection of cells and, in some cases, also to promote cell suicide.
  • the marker is a molecule, e.g., cell surface protein, not naturally found on T cells or not naturally found on the surface of T cells, or a portion thereof.
  • the genetic disruption such as a first genetic disruption at an endogenous TGFBR2 and/or a second genetic disruption at an endogenous TRAC locus is carried out by delivering or introducing one or more agent(s), such as a first agent and/or a second agent, capable of inducing a genetic disruption, e.g., Cas9 and/or gRNA components, to a cell, using any of a number of known delivery method or vehicle for introduction or transfer to cells, for example, using viral delivery vectors, or any of the known methods or vehicles for delivering Cas9 molecules and gRNAs. Exemplary methods are described in, e.g., Wang et al. (2012) J. Immunother.
  • the RNP is delivered into the cell via electroporation or other physical means, e.g., particle gun, Calcium Phosphate transfection, cell compression or squeezing.
  • the RNP can cross the plasma membrane of a cell without the need for additional delivery agents (e.g., small molecule agents, lipids, etc.).
  • delivery of the one or more agent(s) capable of inducing genetic disruption, e.g., CRISPR/Cas9, as an RNP offers an advantage that the targeted disruption occurs transiently, e.g., in cells to which the RNP is introduced, without propagation of the agent to cell progenies.
  • Agent(s) and components capable of inducing a genetic disruption can be introduced into target cells in a variety of forms using a variety of delivery methods and formulations, as set forth in Tables 5 and 6, or methods described in, e.g., WO 2015/161276; US 2015/0056705, US 2016/0272999, US 2017/0211075; or US 2017/0016027.
  • the delivery methods and formulations can be used to deliver template polynucleotides and/or other agents to the cell (such as those required for engineering the cells) in prior or subsequent steps of the methods described herein.
  • a promoter for a Cas9 molecule or a gRNA molecule may be, independently, inducible, tissue specific, or cell specific.
  • an agent capable of inducing a genetic disruption is introduced RNP complexes. Table 5. Exemplary Delivery Methods
  • DNA encoding Cas9 molecules and/or gRNA molecules, or RNP complexes comprising a Cas9 molecule and/or gRNA molecules can be delivered into cells by known methods or as described herein.
  • Cas9-encoding and/or gRNA- encoding DNA can be delivered, e.g., by vectors (e.g., viral or non-viral vectors), non-vector based methods (e.g., using naked DNA or DNA complexes), or a combination thereof.
  • the polynucleotide containing the agent(s) and/or components thereof is delivered by a vector (e.g., viral vector/virus or plasmid).
  • the vector may be any described herein.
  • delivery via electroporation is performed using a system in which cells are mixed with the Cas9-and/or gRNA-encoding DNA in a vessel connected to a device (e.g., a pump) which feeds the mixture into a cartridge, chamber or cuvette wherein one or more electrical impulses of defined duration and amplitude are applied, after which the cells are delivered to a second vessel.
  • a device e.g., a pump
  • Exemplary organic nanoparticles include, e.g., SNALP liposomes that contain cationic lipids together with neutral helper lipids which are coated with polyethylene glycol (PEG), and protamine-nucleic acid complexes coated with lipid.
  • Exemplary lipids and polymers for gene transfer include those described in, for example, WO 2019/195492 and WO 2020/223535.
  • delivery via electroporation comprises mixing the cells with the Cas9 molecules with or without gRNA molecules in a cartridge, chamber or cuvette and applying one or more electrical impulses of defined duration and amplitude.
  • delivery via electroporation is performed using a system in which cells are mixed with the Cas9 molecules with or without gRNA molecules in a vessel connected to a device (e.g., a pump) which feeds the mixture into a cartridge, chamber or cuvette wherein one or more electrical impulses of defined duration and amplitude are applied, after which the cells are delivered to a second vessel.
  • a device e.g., a pump
  • one polynucleotide can encode agents that target a first target site at a TGFBR2 locus and a second target site at a TRAC locus.
  • two or more different polynucleotides can encode the agents that target a first target site at a TGFBR2 locus and a second target site at a TRAC locus.
  • the one or more agents such as a first agent and a second agent, capable of inducing a genetic disruption can be delivered as ribonucleoprotein (RNP) complexes, and two or more different RNP complexes can be delivered together as a mixture, or separately.
  • RNP ribonucleoprotein
  • the polynucleotide e.g., template polynucleotide
  • the polynucleotide includes one or more exogenous sequences, e.g., transgene sequences that encode a recombinant TCR or a portion thereof and/or other exogenous gene nucleic acid sequences.
  • the polynucleotide e.g., a polynucleotide such as a template polynucleotide encoding the recombinant TCR
  • the polynucleotide are introduced into the cells in nucleotide form, e.g., as a polynucleotide or a vector.
  • the polynucleotide contains a transgene that encodes the recombinant TCR or a portion thereof.
  • the polynucleotides are delivered prior to the agents, for example, seconds to hours to days before the agents, including, but not limited to, 1 to 60 minutes (or any time therebetween) before the agents, 1 to 24 hours (or any time therebetween) before the agents or more than 24 hours before the agents.
  • the one or more agent(s) and the polynucleotide are in different formats, e.g., ribonucleic acid-protein complex (RNP) for the Cas9-gRNA agent and a linear DNA for the polynucleotide, but they are delivered using the same method.
  • RNP ribonucleic acid-protein complex
  • the concentration of the RNP is at or about 1.7 pM to at or about 2.5 pM.
  • the concentration of the first RNP and/or the second RNP is between at or about 1 pM to at or about 5 pM.
  • the concentration of the first RNP and/or the second RNP is at or about 1.5 pM.
  • the concentration of the first RNP and/or the second RNP is at or about 1.7 pM.
  • the concentration of the first RNP and/or the second RNP is at or about 2 pM.
  • the concentration of the first RNP and/or the second RNP is at or about 2.2 pM.
  • the concentration of the first RNP and/or the second RNP is at or about 2.5 pM.
  • the Cas9 and the gRNA are introduced in the form of a ribonucleoprotein (RNP) complex, and the polynucleotide is introduced as a polynucleotide molecule, e.g., in a vector or a linear polynucleotide, e.g., linear DNA.
  • RNP ribonucleoprotein
  • Types or nucleic acids and vectors for delivery include any of those described in Section II herein.
  • the promoter is selected from among an RNA pol I, pol II or pol III promoter.
  • the promoter is recognized by RNA polymerase II (e.g., a CMV, SV40 early region or adenovirus major late promoter).
  • the promoter is recognized by RNA polymerase III (e.g., a U6 or Hl promoter).
  • the promoter is a regulated promoter (e.g., inducible promoter).
  • the promoter is an inducible promoter or a repressible promoter.
  • the non-viral polynucleotide is delivered into the cell by a non-viral method described herein, such as a non-viral method listed in Table 6 herein.
  • TCRs Encoded T Cell Receptors
  • TCRs or antigen binding fragment thereof or an antibody or antigen fragments thereof and proteins such as chimeric molecules containing one or more of the foregoing, such as the chimeric receptors, e.g., TCR-like CARs.
  • the recombinant TCR or antigen-binding fragment thereof binds to or recognizes an antigen expressed on the surface of the cell line designated SCC152 (ATCC® CRL-3240TM), which is a cell line derived from a squamous cell carcinoma and that contains HPV DNA sequences.
  • SCC152 ATCC® CRL-3240TM
  • cytotoxic activity of T cells containing the recombinant TCRs is stimulated upon contact of such cells with target cells, expressing the antigen, such as cancer cells and/or those that express HPV 16, such as HPV 16 E7, e.g. SCC 152 cells.
  • TCRs or antigen-binding fragments thereof are TCRs or antigen-binding fragments thereof that contain any of the variable alpha (Va) regions and/or a variable beta (VP) regions as described, individually, or a sufficient antigen-binding portion of such chain(s).
  • the provided recombinant TCRs comprise a TCR alpha (TCRa) chain comprising a variable alpha (Va) region, and a TCR beta (TCRP) chain comprising a variable beta (VP) region.
  • TCRa TCR alpha
  • TCRP TCR beta
  • the provided recombinant TCR or antigen-binding fragment thereof e.g.
  • the recombinant TCR binds to a peptide epitope derived from HPV 16 E7 protein and/or to a peptide epitope expressed on a cell infected with HPV.
  • the TCR is an anti-HPV- 16 TCR, such as an anti-HPV 16 E7 TCR.
  • HLA-A2 positive Caucasian population more than 95% of the HLA-A2 positive Caucasian population is HLA-A*0201, whereas in the Chinese population the frequency has been reported to be approximately 23% HLA-A*0201, 45% HLA-A*0207, 8% HLA-A*0206 and 23% HLA-A*0203.
  • the MHC molecule is HLA-A*0201.
  • the TCR or antigen-binding fragment thereof recognizes or binds to an epitope or region of HPV 16 E7 or HPV 16 E6, such as a peptide epitope containing an amino acid sequence set forth in any of SEQ ID NOS: 267 and 297-303, and as shown below in Table 7.
  • the provided recombinant TCRs have one or more specified functional features, such as binding properties, including binding to particular epitopes, and/or particular binding affinities as described.
  • TCR is found on the surface of T cells (or T lymphocytes) where it is generally responsible for recognizing antigens, such as peptides bound to major histocompatibility complex (MHC) molecules.
  • MHC major histocompatibility complex
  • anti-HPV 16 E7 11-19 TCRs or antigen-binding fragments thereof.
  • the TCR recognizes or binds a peptide epitope derived from HPV 16 E7 that is or contains E7(l l-19) YMLDLQPET (SEQ ID NO: 267).
  • the TCR recognizes or binds a peptide epitope derived from HPV 16 E7 that is or contains E7(l l-19) YMLDLQPET (SEQ ID NO: 267).
  • the TCR recognizes or binds a peptide epitope derived from HPV 16 E7 that is or contains E7(l l-19) YMLDLQPET (SEQ ID NO: 267).
  • the TCR recognizes or binds a peptide epitope derived from HPV 16 E7 that is or contains E7(l l-19) YMLDLQPET (SEQ ID NO: 267).
  • the TCR recognizes or binds
  • TCR recognizes or binds HPV 16 E7(l 1-19) in the context of an MHC, such as an MHC class I, e.g., HLA-A2.
  • MHC such as an MHC class I, e.g., HLA-A2.
  • the provided TCRs or antigen-binding fragments thereof are capable of or bind to a HPV 16 E7 (11-19)- peptide-MHC tetramer complex.
  • engineered T cells containing or expressing such a TCR or antigen-binding fragment thereof exhibits cytotoxic activity upon contact with a cancer target cell and/or a target cell infected with HPV or that contains HPV DNA sequences, e.g. SCC152 cell.
  • the Va region comprises the sequence set forth in SEQ ID NO:8, or a sequence that comprises at least at or about 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto. In some embodiments, the Va region comprises the sequence set forth in SEQ ID NO:8.
  • the VP region comprises a complementarity determining region 1 (CDR-2) comprising the sequence of SEQ ID NO:4 or a sequence that comprises at least at or about 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto.
  • the VP region comprises a CDR-2 comprising the sequence of SEQ ID NO:4.
  • the VP region comprises a complementarity determining region 1 (CDR-3) comprising the sequence of SEQ ID NO:5 or a sequence that comprises at least at or about 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% sequence identity thereto.
  • the VP region comprises a CDR-3 comprising the sequence of SEQ ID NO:5.
  • the Va region comprise the sequence of SEQ ID NO:8; and the VP region comprise the sequence of SEQ ID NO:1.
  • the TCR can contain an introduced disulfide bond or bonds.
  • the native disulfide bonds are not present.
  • the one or more of the native cysteines (e.g. in the constant domain of the a chain and P chain) that form a native interchain disulfide bond are substituted to another residue, such as to a serine or alanine.
  • an introduced disulfide bond can be formed by mutating noncysteine residues on the alpha and beta chains, such as in the constant domain of the a chain and P chain, to cysteine.
  • resulting in one or more non-native disulfide bonds) in a recombinant TCR can favor production of the desired recombinant TCR in a cell in which it is introduced over expression of a mismatched TCR pair containing a native TCR chain.
  • the TCRa and/or TCRP chain and/or a TCRa and/or TCRP chain constant domains are modified to replace one or more non-cysteine residues to a cysteine.
  • the one or more non-native cysteine residues are capable of forming non-native disulfide bonds, e.g., between the recombinant TCRa and TCRP chain encoded by the transgene.
  • the cysteine is introduced at one or more of residue Thr48, Thr45, TyrlO, Thr45, and Serl5 with reference to numbering of a TCRa constant domain (Ca) set forth in SEQ ID NO: 168.
  • cysteines can be introduced at residue Ser57, Ser77, Serl7, Asp59, of Glul5 of the TCRP chain with reference to numbering of TCRP constant domain (CP) set forth in SEQ ID NO: 173.
  • CP TCRP constant domain
  • Exemplary non-native disulfide bonds of a TCR are described in W02006/000830, WO 2006/037960 and Kuball et al. (2007) Blood, 109:2331-2338.
  • the transgene encodes a portion of a TCRa chain and/or a TCRa constant domain containing one or more modifications to introduce one or more disulfide bonds.
  • cysteines can be introduced or substituted at a residue corresponding to Thr48 of the Ca chain and Ser57 of the CP chain, at residue Thr45 of the Ca chain and Ser77 of the CP chain, at residue TyrlO of the Ca chain and Serl7 of the CP chain, at residue Thr45 of the Ca chain and Asp59 of the CP chain and/or at residue Serl5 of the Ca chain and Glul5 of the CP chain with reference to numbering of a Ca set forth in SEQ ID NO: 168, or a CP set forth in SEQ ID NO: 173.
  • the Ca region comprises a sequence selected from any one of SEQ ID NOS: 9, 167-172, 175, 176, and 178-181 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any of SEQ ID NOS: 9, 167-172, 175, 176, and 178-181 and/or the CP region comprises a sequence selected from any one of SEQ ID NOS:2, 156, 173, 174, 177, 182, and 183 or a sequence of amino acids that exhibits at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to any of SEQ ID NOS: 2, 156, 173, 174, 177, 182, and 183.
  • the Ca region comprises the sequence of SEQ ID NO:9, or a sequence that has at least at or about 90% sequence identity to SEQ ID NO:9; and the CP region comprises the sequence of SEQ ID NO:2, or a sequence that has at least at or about 90% sequence identity to SEQ ID NO:2.
  • the Ca region comprises the sequence of SEQ ID NO:9; and the CP region comprises the sequence of SEQ ID NO:2.
  • such TCRs containing a human constant region are expressed at similar or improved levels on the cell surface, exhibit the similar or greater functional activity (e.g. cytolytic activity) and/or exhibit similar or greater anti-tumor activity, when expressed by human cells that contain or express an endogenous human TCR, such as human T cells, as compared to the level of expression, functional activity and/or anti-tumor activity of a similar TCR containing the same VP and Va regions but that is formatted with a mouse constant region when expressed in the human cells.
  • functional activity e.g. cytolytic activity
  • anti-tumor activity e.g. anti-tumor activity
  • a TCR containing a human constant region when expressed in human T cells, exhibits an antigen-dependent functional activity, such as cytolytic activity, that is at least or at least about 80%, 85%, 90%, 95%, 100%, 105%, 110%, 115% or 120% of the activity of a similar TCR containing the same VP and Va regions but that is formatted with a mouse constant region when expressed in the human T cells.
  • an antigen-dependent functional activity such as cytolytic activity
  • a TCR containing a human constant region when expressed in human T cells, exhibits anti-tumor activity, such as when administered in vivo to a subject, that is at least or at least about 80%, 85%, 90%, 95%, 100%, 105%, 110%, 115% or 120% of the anti-tumor activity of a similar TCR containing the same VP and Va regions but that is formatted with a mouse constant region when expressed in the human T cells.
  • Exemplary TCRs or antigen-binding fragments include those set forth in Table 9, such as in each row therein.
  • the Va and VP regions contain the amino acid sequences corresponding to the SEQ ID NOs: set forth in Table 9, such as in each row therein.
  • the Va and VP regions contain the CDR-1, the CDR-2 and the CDR-3 sequences contained within the Va and VP regions set forth in Table 9, such as in each row therein.
  • the TCR contains constant alpha and constant beta region sequences, such as those corresponding to the SEQ ID NOs: set forth in Table 9, such as in each row therein.
  • the TCRs (or functional portions thereof) comprising the substituted amino acid sequence(s) advantageously provide one or more of decreased mis-pairing with an endogenous TCR chain(s), increased expression by a host cell, increased recognition of HPV 16 targets, and increased anti-tumor activity as compared to the parent TCR comprising an unsubstituted amino acid sequence.
  • TCRs containing a human constant region are expressed at similar or improved levels on the cell surface, exhibit the similar or greater functional activity (e.g.
  • engineered cells e.g., genetically engineered or modified cells
  • methods of engineering cells including genetically engineered cells comprising a genetic disruption at a target site at an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus, and a modified TRAC locus that comprises a transgene sequence encoding a recombinant TCR or a portion thereof.
  • TGFBR2 transforming growth factor-beta receptor type-2
  • the method produces a modified TRAC locus, said modified TRAC locus comprising a nucleic acid sequence encoding the recombinant TCR.
  • a genetically engineered T cell that involves introducing, into a T cell, one or more agent(s) capable of inducing a genetic disruption at a first target site within an endogenous TGFBR2 locus and/or a TRAC locus of the T cell; and introducing any of the provided polynucleotides, e.g., described herein in Section I.B.2, into a T cell comprising a genetic disruption at a TGFBR2 locus and/or a TRAC locus, wherein the method produces a modified TRAC locus, said modified TRAC locus comprising a nucleic acid sequence encoding the recombinant TCR, such as a recombinant TCR.
  • the nucleic acids are heterologous, i.e., normally not present in a cell or sample obtained from the cell, such as one obtained from another organism or cell, which for example, is not ordinarily found in the cell being engineered and/or an organism from which such cell is derived.
  • the nucleic acids are not naturally occurring, such as a nucleic acid not found in nature, including one comprising chimeric combinations of nucleic acids encoding various domains from multiple different cell types.
  • the cells are resuspended in a variety of biocompatible buffers after washing, such as, for example, Ca++/Mg++ free PBS.
  • components of a blood cell sample are removed and the cells directly resuspended in culture media.
  • the methods include density-based cell separation methods, such as the preparation of white blood cells from peripheral blood by lysing the red blood cells and centrifugation through a Percoll or Ficoll gradient.
  • the isolation methods include the separation of different cell types based on the expression or presence in the cell of one or more specific molecules, such as surface markers, e.g., surface proteins, intracellular markers, or nucleic acid. In some embodiments, any known method for separation based on such markers may be used. In some embodiments, the separation is affinity- or immunoaffinity-based separation.
  • the isolation in some aspects includes separation of cells and cell populations based on the cells’ expression or expression level of one or more markers, typically cell surface markers, for example, by incubation with an antibody or binding partner that specifically binds to such markers, followed generally by washing steps and separation of cells having bound the antibody or binding partner, from those cells having not bound to the antibody or binding partner.
  • the separation need not result in 100% enrichment or removal of a particular cell population or cells expressing a particular marker.
  • positive selection of or enrichment for cells of a particular type refers to increasing the number or percentage of such cells, but need not result in a complete absence of cells not expressing the marker.
  • negative selection, removal, or depletion of cells of a particular type refers to decreasing the number or percentage of such cells, but need not result in a complete removal of all such cells.
  • CD3 + , CD28 + T cells can be positively selected using anti-CD3/anti- CD28 conjugated magnetic beads (e.g., DYNABEADS® M-450 CD3/CD28 T Cell Expander).
  • anti-CD3/anti- CD28 conjugated magnetic beads e.g., DYNABEADS® M-450 CD3/CD28 T Cell Expander.
  • T cells are separated from a PBMC sample by negative selection of markers expressed on non-T cells, such as B cells, monocytes, or other white blood cells, such as CD 14.
  • a CD4 + or CD8 + selection step is used to separate CD4 + helper and CD8 + cytotoxic T cells.
  • Such CD4 + and CD8 + populations can be further sorted into sub-populations by positive or negative selection for markers expressed or expressed to a relatively higher degree on one or more naive, memory, and/or effector T cell subpopulations.
  • the separated CD4 + and CD8 + populations or further separated populations are combined at a specific ratio, such as CD4+ T cells to CD8+ T cells ratio of from at or about 1:3 to at or about 3:1, such as at or about 1:1, prior to further engineering the cells to introduce the one or more genetic disruptions and/or to introduce the polynucleotides comprising transgenes encoding the recombinant receptor.
  • a specific ratio such as CD4+ T cells to CD8+ T cells ratio of from at or about 1:3 to at or about 3:1, such as at or about 1:1
  • the separation and/or other steps is carried out using CliniMACS system (Miltenyi Biotec), for example, for automated separation of cells on a clinical-scale level in a closed and sterile system.
  • Components can include an integrated microcomputer, magnetic separation unit, peristaltic pump, and various pinch valves.
  • the integrated computer in some aspects controls all components of the instrument and directs the system to perform repeated procedures in a standardized sequence.
  • the magnetic separation unit in some aspects includes a movable permanent magnet and a holder for the selection column.
  • the peristaltic pump controls the flow rate throughout the tubing set and, together with the pinch valves, ensures the controlled flow of buffer through the system and continual suspension of cells.
  • the cells are incubated and/or cultured prior to or in connection with genetic engineering.
  • the incubation steps can include culture, cultivation, stimulation, activation, and/or propagation.
  • the incubation and/or engineering may be carried out in a culture vessel, such as a unit, chamber, well, column, tube, tubing set, valve, vial, culture dish, bag, or other container for culture or cultivating cells.
  • the compositions or cells are incubated in the presence of stimulating conditions or a stimulatory agent. Such conditions include those designed to induce proliferation, expansion, activation, and/or survival of cells in the population, to mimic antigen exposure, and/or to prime the cells for genetic engineering, such as for the introduction of a recombinant antigen receptor.
  • the T cells are expanded by adding to a culture-initiating composition feeder cells, such as non-dividing peripheral blood mononuclear cells (PBMC), (e.g., such that the resulting population of cells contains at least about 5, 10, 20, or 40 or more PBMC feeder cells for each T lymphocyte in the initial population to be expanded); and incubating the culture (e.g. for a time sufficient to expand the numbers of T cells).
  • PBMC peripheral blood mononuclear cells
  • the non-dividing feeder cells can comprise gamma-irradiated PBMC feeder cells.
  • the PBMC are irradiated with gamma rays in the range of about 3000 to 3600 rads to prevent cell division.
  • the feeder cells are added to culture medium prior to the addition of the populations of T cells.
  • RNA molecules encoding recombinant receptors e.g., recombinant TCRs
  • exemplary methods include those for transfer of nucleic acids encoding the polypeptides or receptors, including via viral vectors, e.g., retroviral or lentiviral, non-viral vectors or transposons, e.g. Sleeping Beauty transposon system.
  • Methods of gene transfer can include transduction, electroporation or other method that results into gene transfer into the cell, or any delivery methods described in Section EC or Section II herein.
  • Other approaches and vectors for transfer of the nucleic acids encoding the recombinant products are those described, e.g., in WO2014055668 and U.S. Patent No. 7,446,190.
  • recombinant nucleic acids are transferred into T cells via electroporation (see, e.g., Chicaybam et al, (2013) PLoS ONE 8(3): e60298 and Van Tedeloo et al. (2000) Gene Therapy 7(16): 1431-1437).
  • recombinant nucleic acids are transferred into T cells via transposition (see, e.g., Manuri et al. (2010) Hum Gene Ther 21(4): 427-437; Sharma et al. (2013) Molec Ther Nucl Acids 2, e74; and Huang et al. (2009) Methods Mol Biol 506: 115-126).
  • the engineered cells include gene segments that cause the cells to be susceptible to negative selection in vivo, such as upon administration in adoptive immunotherapy.
  • the cells are engineered so that they can be eliminated as a result of a change in the in vivo condition of the patient to which they are administered.
  • the negative selectable phenotype may result from the insertion of a gene that confers sensitivity to an administered agent, for example, a compound.
  • the cells may be engineered either during or after expansion.
  • This engineering for the introduction of the gene of the desired polypeptide or receptor can be carried out with any suitable retroviral vector, for example.
  • the genetically modified cell population can then be liberated from the initial stimulus (the CD3/CD28 stimulus, for example) and subsequently be stimulated with a second type of stimulus (e.g. via a de novo introduced receptor).
  • This second type of stimulus may include an antigenic stimulus in form of a peptide/MHC molecule, the cognate (cross-linking) ligand of the recombinant (e.g.
  • genes for introduction are those to improve the efficacy of therapy, such as by promoting viability and/or function of transferred cells; genes to provide a genetic marker for selection and/or evaluation of the cells, such as to assess in vivo survival or localization; genes to improve safety, for example, by making the cell susceptible to negative selection in vivo as described by Lupton S. D. et al., Mol. and Cell Biol., 11:6 (1991); and Riddell et al., Human Gene Therapy 3:319-338 (1992); see also the publications of PCT/US91/08442 and PCT/US 94/05601 by Lupton et al.
  • the provided cells and cell composition can be engineered using any of the methods described herein, e.g., using agent(s) or methods for introducing genetic disruption, for example, as described in Section I.A herein, and/or using polynucleotides, such as template polynucleotide descried herein, for example in Section I.B.2, via homology-directed repair (HDR).
  • HDR homology-directed repair
  • such cell population and/or compositions provided herein is or are comprised in a pharmaceutical composition or a composition for therapeutic uses or methods, for example, as described in Section IV and Section V herein.
  • the provided compositions comprises cells in which cells comprising a genetic disruption at the TGFBR2 locus make up at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more of the total cells in the composition, or cells of a certain type, such as T cells or CD8+ or CD4+ cells.
  • cell population and/or compositions that include a plurality of engineered immune cells expressing a recombinant TCR, wherein the nucleic acid sequence encoding the recombinant TCR is present at the TRAC locus, e.g., by integration of a transgene encoding recombinant TCR or a portion thereof at the TRAC locus via homology directed repair (HDR).
  • HDR homology directed repair
  • At least or greater than 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of the cells in the composition and/or cells in the composition that contains a genetic disruption at the TGFBR2 locus comprise integration of the transgene encoding recombinant TCR or a portion thereof at the TRAC locus.
  • TRAC TRAC
  • TGFBR2 TGFBR2 KO
  • TGFBR2 KO TGFBR2 KO
  • 70% have knock-in of the recombinant TCR.
  • TRAC TRAC
  • TGFBR2 TGFBR2 KO
  • 75% have knock-in of the recombinant TCR.
  • knock-in of the recombinant TCR is determined by a PCR-based method, such as ddPCR. In some of any embodiments, knock-in of the recombinant TCR is determined by flow cytometry for expression of the recombinant TCR. In some of any embodiments, knock-out of the endogenous TGFBR2 locus or TRAC locus is determined molecularly, such as by PCR-based methods (e.g. ddPCR) or next genome sequencing (NGS).
  • PCR-based methods e.g. ddPCR
  • NGS next genome sequencing
  • At least at or about 70% of the engineered T cells in a composition or a plurality of T cells comprise a genetic disruption at a first target site within an endogenous TGFBR2 locus; at least at or about 50% of the engineered T cells in a composition or a plurality of T cells express the recombinant TCR and/or exhibits binding to the antigen recognized by the recombinant TCR; and at least at or about 70% of the engineered T cells in a composition or a plurality of T cells do not express a gene product of an endogenous TRAC locus.
  • At least at or about 80% of the total cells or total T cells, in a composition containing a plurality of engineered T cells comprise a genetic disruption at a first target site within an endogenous TGFBR2 locus; at least at or about 75% of the total cells or total T cells, in a composition containing a plurality of engineered T cells express the recombinant TCR or exhibits binding to the antigen recognized by the recombinant TCR; and at least at or about 95% of the total cells or total T cells, in a composition containing a plurality of engineered T cells do not express a gene product of an endogenous TRAC locus.
  • the provided cell population and/or compositions containing engineered cells include a cell population that exhibits minimal or reduced random integration of the transgene encoding a recombinant TCR or a portion thereof.
  • random integration of transgene into the genome of the cell can result in adverse effects or cell death due to integration of the transgene into undesired location in the genome, e.g., into an essential gene or a gene critical in regulating the activity of the cell, and/or unregulated or uncontrolled expression of the receptor.
  • random integration of the transgene is reduced by at least or greater than 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or more compared to cell populations generated using other methods.
  • the composition of cells comprises CD4+ T cells and/or CD8+ T cells. In some aspects, the composition of cells comprises CD4+ T cells and CD8+ T cells. In some aspects, the percentage of CD4+ T cells in the composition is between at or about 20% and at or about 80%, or at or about 20%, 30%, 40%, 50%, 60%, 70%, or 80% of the total cells in the composition. In some aspects, the percentage of CD8+ T cells in the composition is between at or about 20% and at or about 80%, or at or about 20%, 30%, 40%, 50%, 60%, 70%, or 80% of the total cells in the composition.
  • the provided engineered T cells or pharmaceutical compositions comprising the engineered T cells result in greater systemic expansion and/or longer persistence when administered to a subject having a disease or disorder. In some aspects, the provided engineered T cells or pharmaceutical compositions comprising the engineered T cells, result in a suppression of tumor growth, a reduction in tumor burden and/or an increase in survival of a subject, when administered to a subject having a disease or disorder at a dose that is lower than a dose of T cells engineered to express a comparator T cell receptor and/or a dose of T cells engineered that does not comprise the first genetic disruption.
  • the T cells or T cell compositions are assessed for cell surface expression of the recombinant TCR, e.g., for the ability or capability to express a functional TCR, such as TCRaP, on the surface of the cell.
  • the T cells or T cell compositions are assessed for the ability or capability of the expressed TCRs for recognition of a peptide in the context of an MHC molecule, e.g., binding antigens or epitopes in the context of an MHC molecule.
  • the methods include assessing the T cells or T cell compositions for T cell activity and/or functionality.
  • the T cells or T cell compositions are assessed for is expression of the marker for transduction or introduction of the transgene.
  • the T cells or T cell compositions are assessed for cell surface expression of the recombinant TCR, e.g., for the ability or capability to express a functional TCR, such as TCRaP, on the surface of the cell.
  • assessing surface expression of the TCR comprises contacting cells of each T cell composition with a binding reagent specific for the TCRa chain or the TCRP chain and assessing binding of the reagent to the cells.
  • the binding reagent is an antibody.
  • the binding reagent is detectably labeled, optionally fluorescently labeled, directly or indirectly.
  • the binding reagent is a fluorescently labeled antibody, such as an antibody labeled directly or indirectly.
  • the binding reagent is an anti-pan-TCR VP antibody or is an anti-pan-TCR Va antibody.
  • the binding reagent recognizes a specific family of chains.
  • the binding reagent is an anti- TCR VP or anti-TCR Va antibody that recognizes or binds a specific family, such as an anti- TCR VP22 antibody or an anti-TCR VP2 antibody.
  • the expression is detected using antibodies against one or more common portions, e.g., extracellular portions, of the TCR.
  • T cells or T cell compositions that express the TCR on the surface of the cell e.g., stain positive using pan-reactive anti-TCR antibodies, such as a pan-reactive TCR VP antibody, or a pan-reactive TCR Va antibody, are identified and/or selected.
  • pan-reactive anti-TCR antibodies such as a pan-reactive TCR VP antibody, or a pan-reactive TCR Va antibody
  • the TCR ligand can be a peptide-MHC tetramer, and in some cases the peptide- MHC tetramer can be detectably labeled, such as labeled with a fluorescent label.
  • the peptide- MHC tetramer can be labeled directly or indirectly.
  • the fluorescent label can be detected using flow cytometry or fluorescence activated cell sorting (FACS) or fluorescence microscopy.
  • the methods include identifying one or more T cells or T cell compositions that recognize the peptide in the context of the MHC molecule, i.e. peptide-MHC complex.
  • the methods further include assessing aspects of T cell activation, such as assessing release of cytokines and/or assessing functional activity of the T cell, e.g., cytolytic activity and/or helper T cell activity.
  • the assessments can be performed in T cells or T cell compositions generated using the embodiments described herein.
  • the molecule, cell, and/or composition is administered in an effective amount to effect treatment of the disease or disorder.
  • Uses include uses of the recombinant TCRs and cells in such methods and treatments, and in the preparation of a medicament in order to carry out such therapeutic methods.
  • the methods are carried out by administering the recombinant TCRs or cells, or compositions comprising the same, to the subject having, having had, or suspected of having the disease or condition. In some embodiments, the methods thereby treat the disease or condition or disorder in the subject.
  • treatment refers to complete or partial amelioration or reduction of a disease or condition or disorder, or a symptom, adverse effect or outcome, or phenotype associated therewith. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. The terms do not imply complete curing of a disease or complete elimination of any symptom or effect(s) on all symptoms or outcomes.
  • “delaying development of a disease” means to defer, hinder, slow, retard, stabilize, suppress and/or postpone development of the disease (such as cancer). This delay can be of varying lengths of time, depending on the history of the disease and/or individual being treated. As is evident to one skilled in the art, a sufficient or significant delay can, in effect, encompass prevention, in that the individual does not develop the disease. For example, a late stage cancer, such as development of metastasis, may be delayed.
  • a “therapeutically effective amount” of an agent refers to an amount effective, at dosages and for periods of time necessary, to achieve a desired therapeutic result, such as for treatment of a disease, condition, or disorder, and/or pharmacokinetic or pharmacodynamic effect of the treatment.
  • the therapeutically effective amount may vary according to factors such as the disease state, age, sex, and weight of the subject, and the populations of cells administered.
  • the provided methods involve administering the recombinant TCRs, cells, and/or compositions at effective amounts, e.g., therapeutically effective amounts.
  • the cancer is an HPV-associated cancers, and any HPV-associated, e.g., HPV 16-associated, diseases or conditions or diseases or conditions in which an HPV oncoprotein, e.g., E7, such as an HPV 16 oncoprotein, e.g., HPV 16 E7 is expressed.
  • an HPV oncoprotein e.g., E7
  • HPV 16 E7 an HPV 16 oncoprotein
  • the viral protein such as the oncoprotein such as the HPV 16 E7 is expressed in or by malignant cells and cancers, and/or a peptide epitope thereof is expressed on such malignant cancers or tissues, such as by way of MHC presentation.
  • the disease or condition is an HPV 16- expressing cancer.
  • HPV 16-associated diseases or conditions that can be treated include, but are not limited to, cervical cancer, uterine cancer, anal cancer, colorectal cancer, vaginal cancer, vulvar cancer, penile cancer, oropharyngeal cancers, tonsil cancer, pharyngeal cancers (pharynx cancer), laryngeal cancer (larynx cancer), oral cancer, skin cancer, esophageal cancer, head and neck cancer such as a squamous cell carcinoma (SCC) head and neck cancer, or small cell lung cancer.
  • the disease or condition is a cervical cancer.
  • the disease or condition is a cervical carcinoma.
  • a subject may be screened for the presence of a disease or disorder associated with HPV 16 E7 expression, such as an HPV 16 E7-expressing cancer.
  • the methods include screening for or detecting the presence of an HPV 16 E7- associated disease, e.g. a tumor.
  • a sample may be obtained from a patient suspected of having a disease or disorder associated with HPV 16 E7 expression and assayed for the expression level of HPV 16 E7.
  • the subject has persistent or relapsed disease, e.g., following treatment with another HPV 16-specific recombinant TCR and/or cells expressing an HPV 16- targeting recombinant TCR and/or other therapy, including chemotherapy, radiation, and/or hematopoietic stem cell transplantation (HSCT), e.g., allogenic HSCT.
  • HSCT hematopoietic stem cell transplantation
  • the administration effectively treats the subject despite the subject having become resistant to another HPV 16-targeted therapy.
  • the methods include adoptive cell therapy, whereby genetically engineered cells expressing the provided recombinant TCRs are administered to subjects. Such administration can promote activation of the cells (e.g., T cell activation) in an HPV 16-targeted manner, such that the cells of the disease or disorder are targeted for destruction.
  • adoptive cell therapy whereby genetically engineered cells expressing the provided recombinant TCRs are administered to subjects.
  • Such administration can promote activation of the cells (e.g., T cell activation) in an HPV 16-targeted manner, such that the cells of the disease or disorder are targeted for destruction.
  • the cell therapy e.g., adoptive cell therapy, e.g., adoptive T cell therapy
  • the cells are isolated and/or otherwise prepared from the subject who is to receive the cell therapy, or from a sample derived from such a subject.
  • the cells are derived from a subject, e.g., patient, in need of a treatment and the cells, following isolation and processing are administered to the same subject.
  • the cell therapy e.g., adoptive cell therapy, e.g., adoptive T cell therapy
  • the cells are isolated and/or otherwise prepared from a subject other than a subject who is to receive or who ultimately receives the cell therapy, e.g., a first subject.
  • the cells then are administered to a different subject, e.g., a second subject, of the same species.
  • the first and second subjects are genetically identical.
  • the first and second subjects are genetically similar.
  • the second subject expresses the same HLA class or supertype as the first subject.
  • the subject, to whom the cells, cell populations, or compositions are administered is a primate, such as a human.
  • the primate is a monkey or an ape.
  • the subject can be male or female and can be any suitable age, including infant, juvenile, adolescent, adult, and geriatric subjects.
  • the subject is a non-primate mammal, such as a rodent.
  • the patient or subject is a validated animal model for disease, adoptive cell therapy, and/or for assessing toxic outcomes such as cytokine release syndrome (CRS).
  • CRS cytokine release syndrome
  • the provided recombinant TCRs or antigen-binding fragments thereof, and cells expressing the same can be administered by any suitable means, for example, by injection, e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, subconjuntival injection, sub-Tenon's injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery. In some embodiments, they are administered by parenteral, intrapulmonary, and intranasal, and, if desired for local treatment, intralesional administration.
  • injection e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, sub
  • a subject in the context of genetically engineered cells comprising the recombinant TCRs, is administered at or about 10 million cells, at or about 100 million cells, at or about 1 billion cells, at or about 10 billion cells, at or about 100 billion cells, or any value in between these ranges and/or per kilogram of body weight.
  • dosages may vary depending on attributes particular to the disease or disorder and/or patient and/or other treatments.
  • Dosages may vary depending on attributes particular to the disease or disorder and/or patient and/or other treatments. In some embodiments, such values refer to numbers of recombinant receptor-expressing cells.
  • the dose of genetically engineered T cells comprises between at or about 3 x 10 7 recombinant TCR-expressing T cells and at or about 3 x 10 10 recombinant TCR-expressing T cells, inclusive. In some embodiments, the dose of genetically engineered T cells comprises between at or about 1 x 10 8 recombinant TCR-expressing T cells and at or about 1 x 10 10 recombinant TCR-expressing T cells, inclusive. In some embodiments, the dose of genetically engineered T cells comprises between at or about 1 x 10 8 recombinant TCR- expressing T cells and at or about 1 x 10 9 recombinant TCR-expressing T cells, inclusive.
  • the dose of genetically engineered T cells comprises: at or about 1 x 10 8 recombinant TCR-expressing T cells; at or about 3 x 10 8 recombinant TCR- expressing T cells; at or about 1 x 10 9 recombinant TCR-expressing T cells; at or about 3 x 10 8 recombinant TCR-expressing T cells; or at or about 1 x IO 10 recombinant TCR-expressing T cells.
  • the dose of genetically engineered T cells comprises at or about 1 x 10 8 recombinant TCR-expressing T cells. In some embodiments, the dose of genetically engineered T cells comprises at or about 3 x 10 8 recombinant TCR-expressing T cells. In some embodiments, the dose of genetically engineered T cells comprises at or about 1 x 10 9 recombinant TCR-expressing T cells. In some embodiments, the dose of genetically engineered T cells comprises at or about 3 x 10 9 recombinant TCR-expressing T cells. In some embodiments, dose of genetically engineered T cells comprises at or about 1 x 10 10 recombinant TCR-expressing T cells. In some embodiments, the dose of genetically engineered T cells comprises CD4+ T cells and/or CD8+ T cells.
  • the dose includes fewer than about 3 x 10 11 total recombinant TCR-expressing cells, e.g., in the range of from at or about 1 x 10 6 to at or about 1.5 x 10 11 total of such cells, such as at or about 1 x 10 7 , 3 x 10 7 , 1 x 10 8 , 5 x 10 8 , 1 x 10 9 , 1 x 10 10 , 5 x 10 10 , 1 x 10 11 , 1.25 x 10 11 , 2 x 10 11 total such cells, or the range between any two of the foregoing values.
  • the dose includes more than at or about 1 x 10 7 total recombinant TCR- expressing cells, and fewer than at or about 1 x 10 11 total recombinant TCR-expressing cells, e.g., in the range of at or about 1 x 10 7 to at or about 1 x 10 11 such cells, such as at or about 5 x 10 7 , 1 x 10 8 , 5 x 10 8 , 1 x 10 9 , 1 x 10 10 , 5 x 10 10 , 7.5 x 10 10 , 1 x 10 11 total of such cells, or the range between any two of the foregoing values.
  • the dose of genetically engineered cells comprises from or from about 1 x 10 7 to at or about 1 x 10 11 total TCR-expressing cells, such as from or from about 1 x 10 9 to or to about 1 x IO 10 total TCR-expressing cells.
  • the dose of genetically engineered cells comprises less than at or about 2 x 10 11 TCR-expressing cells, less than at or about 1.75 x 10 11 TCR-expressing cells, less than at or about 1.5 x 10 11 TCR-expressing cells, less than at or about 1.25 x 10 11 TCR-expressing cells, less than at or about 1 x 10 11 TCR-expressing cells, less than at or about 7.5 x 10 10 TCR-expressing cells, less than at or about 5 x 10 10 TCR-expressing cells, less than at or about 2.5 x 10 10 TCR-expressing cells, less than at or about 1 x 10 10 TCR-expressing cells, less than at or about 5 x 10 9 TCR-expressing cells, less than at or about 1 x 10 9 TCR-expressing cells, less than at or about 5 x 10 8 TCR-expressing cells, less than at or about 6 x 10 7 TCR- expressing cells, less than at or about 3 x 10 7 TCR-expressing cells, less than at or about 1 x
  • the dose of genetically engineered cells comprises at or about 3 x 10 11 TCR-expressing cells, at or about 2 x 10 11 TCR-expressing cells, at or about 1.75 x 10 11 TCR-expressing cells, at or about 1.5 x 10 11 TCR-expressing cells, at or about 1.25 x 10 11 TCR-expressing cells, at or about 1 x 10 11 TCR-expressing cells, at or about 7.5 x 10 10 TCR-expressing cells, at or about 5 x 10 10 TCR-expressing cells, at or about 2.5 x 10 10 TCR- expressing cells, at or about 1 x 10 10 TCR-expressing cells, at or about 5 x 10 9 TCR-expressing cells, at or about 1 x 10 9 TCR-expressing cells, at or about 5 x 10 8 TCR-expressing cells, at or about 1 x 10 8 TCR-expressing cells, at or about 5 x 10 7 TCR-expressing cells, at or about 3 x 10 7 TCR-expressing cells, at or about 1 x 10
  • the dose of cells comprises between at or about 2 x 10 5 of the cells/kg and at or about 2 x 10 6 of the cells/kg, such as between at or about 4 x 10 5 of the cells/kg and at or about 1 x 10 6 of the cells/kg or between at or about 6 x 10 5 of the cells/kg and at or about 8 x 10 5 of the cells/kg.
  • the dose of cells comprises no more than 2 x 10 5 of the cells (e.g.
  • the dose of cells comprises at least at or about 2 x 10 5 of the cells (e.g.
  • the cells are administered at or within a tolerated difference of a desired dose of one or more of the individual populations or sub-types of cells, such as a desired dose of CD4+ cells and/or a desired dose of CD8+ cells.
  • the desired dose is a desired number of cells of the sub-type or population, or a desired number of such cells per unit of body weight of the subject to whom the cells are administered, e.g., cells/kg.
  • the desired dose is at or above a minimum number of cells of the population or subtype, or minimum number of cells of the population or sub-type per unit of body weight.
  • the dosage is based on a desired fixed dose of total cells and a desired ratio, and/or based on a desired fixed dose of one or more, e.g., each, of the individual sub-types or sub-populations.
  • the dosage is based on a desired fixed or minimum dose of T cells and a desired ratio of CD4 + to CD8 + cells, and/or is based on a desired fixed or minimum dose of CD4 + and/or CD8 + cells.
  • the tolerated difference is within about 1%, about 2%, about 3%, about 4% about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50% of the desired ratio, including any value in between these ranges.
  • the dose of genetically engineered T cells comprises CD4+ T cells and CD8+ T cells
  • the percentage of CD4+ T cells in the dose is between at or about 20% and at or about 80%, or at or about 20%, 30%, 40%, 50%, 60%, 70%, or 80% of the total cells in the dose
  • the percentage of CD8+ T cells in the dose is between at or about 20% and at or about 80%, or at or about 20%, 30%, 40%, 50%, 60%, 70%, or 80% of the total cells in the dose.
  • the dose of genetically engineered T cells comprises CD4+ T cells and CD8+ T cells, and the percentage of CD4+ T cells in the dose is at or about 50% of the total cells in the dose; and the percentage of CD8+ T cells in the dose is at or about 50% of the total cells in the dose.
  • the dose of genetically engineered T cells comprises CD4+ T cells and CD8+ T cells, and the ratio of CD4+ T cells to CD8+ T cells is from at or about 1:3 to at or about 3:1. In some embodiments, the dose of genetically engineered T cells comprises CD4+ T cells and CD8+ T cells, and the ratio of CD4+ T cells to CD8+ T cells is at or about 1:1.
  • the dose of cells e.g., recombinant TCR-expressing T cells
  • the subject is administered one or more doses.
  • the cells or antibodies in some embodiments are co-administered with one or more additional therapeutic agents or in connection with another therapeutic intervention, either simultaneously or sequentially in any order.
  • the cells are co-administered with another therapy sufficiently close in time such that the cell populations enhance the effect of one or more additional therapeutic agents, or vice versa.
  • the cells or antibodies are administered prior to the one or more additional therapeutic agents. In some embodiments, the cells or antibodies are administered after to the one or more additional therapeutic agents.
  • the biological activity of the engineered cell populations and/or recombinant TCRs in some aspects is measured by any of a number of known methods.
  • Parameters to assess include specific binding of an engineered or natural T cell or other immune cell to antigen, in vivo, e.g., by imaging, or ex vivo, e.g., by ELISA or flow cytometry.
  • the ability of the engineered cells to destroy target cells can be measured using any suitable method known in the art, such as cytotoxicity assays described in, for example, Kochenderfer et al., J.
  • the biological activity of the cells also can be measured by assaying expression and/or secretion of certain cytokines, such as CD 107a, IFNy, IL-2, and TNF. In some aspects the biological activity is measured by assessing clinical outcome, such as reduction in tumor burden or load.
  • engineered cells are modified in any number of ways, such that their therapeutic or prophylactic efficacy is increased.
  • the engineered TCRs or antibody-expressing CARs expressed by the engineered cells in some embodiments are conjugated either directly or indirectly through a linker to a targeting moiety.
  • compositions such as pharmaceutical compositions and formulations for administration, such as for adoptive cell therapy.
  • the pharmaceutical compositions contain any of the engineered cells or compositions containing the engineered cells described herein, e.g., engineered to express a recombinant TCR.
  • the dose of cells comprising the provided engineered cells, e.g., engineered to express a recombinant TCR is provided as a composition or formulation, such as a pharmaceutical composition or formulation.
  • Such compositions can be used in accord with the provided methods, and/or with the provided articles of manufacture or compositions, such as in the prevention or treatment of diseases, conditions, and disorders, or in detection, diagnostic, and prognostic methods.
  • pharmaceutical formulation refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a subject to which the formulation would be administered.
  • a “pharmaceutically acceptable carrier” refers to an ingredient in a pharmaceutical formulation, other than an active ingredient, which is nontoxic to a subject.
  • a pharmaceutically acceptable carrier includes, but is not limited to, a buffer, excipient, stabilizer, or preservative.
  • Pharmaceutically acceptable carriers are generally nontoxic to recipients at the dosages and concentrations employed, and include, but are not limited to: buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyldimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride; benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arg
  • the formulation or composition may also contain more than one active ingredient useful for the particular indication, disease, or condition being prevented or treated with the cells or agents, where the respective activities do not adversely affect one another.
  • active ingredients are suitably present in combination in amounts that are effective for the purpose intended.
  • the pharmaceutical composition further includes other pharmaceutically active agents or drugs, such as chemotherapeutic agents, e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rituximab, vinblastine, vincristine, etc.
  • chemotherapeutic agents e.g., asparaginase, busulfan, carboplatin, cisplatin, daunorubicin, doxorubicin, fluorouracil, gemcitabine, hydroxyurea, methotrexate, paclitaxel, rit
  • the agents or cells are administered in the form of a salt, e.g., a pharmaceutically acceptable salt.
  • Suitable pharmaceutically acceptable acid addition salts include those derived from mineral acids, such as hydrochloric, hydrobromic, phosphoric, metaphosphoric, nitric, and sulphuric acids, and organic acids, such as tartaric, acetic, citric, malic, lactic, fumaric, benzoic, glycolic, gluconic, succinic, and arylsulphonic acids, for example, p-toluenesulphonic acid.
  • the pharmaceutical composition in some embodiments contains agents or cells in amounts effective to treat or prevent the disease or condition, such as a therapeutically effective or prophylactic ally effective amount.
  • Therapeutic or prophylactic efficacy in some embodiments is monitored by periodic assessment of treated subjects. For repeated administrations over several days or longer, depending on the condition, the treatment is repeated until a desired suppression of disease symptoms occurs.
  • other dosage regimens may be useful and can be determined.
  • the desired dosage can be delivered by a single bolus administration of the composition, by multiple bolus administrations of the composition, or by continuous infusion administration of the composition.
  • the agents or cells can be administered by any suitable means, for example, by bolus infusion, by injection, e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, subconjuntival injection, sub-Tenon’s injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery.
  • injection e.g., intravenous or subcutaneous injections, intraocular injection, periocular injection, subretinal injection, intravitreal injection, trans-septal injection, subscleral injection, intrachoroidal injection, intracameral injection, subconjectval injection, subconjuntival injection, sub-Tenon’s injection, retrobulbar injection, peribulbar injection, or posterior juxtascleral delivery.
  • injection e.g., intravenous or sub
  • Parenteral infusions include intramuscular, intravenous, intraarterial, intraperitoneal, or subcutaneous administration.
  • a given dose is administered by a single bolus administration of the cells or agent.
  • it is administered by multiple bolus administrations of the cells or agent, for example, over a period of no more than 3 days, or by continuous infusion administration of the cells or agent.
  • the appropriate dosage may depend on the type of disease to be treated, the type of agent or agents, the type of cells or recombinant receptors, the severity and course of the disease, whether the agent or cells are administered for preventive or therapeutic purposes, previous therapy, the subject’s clinical history and response to the agent or the cells, and the discretion of the attending physician.
  • the compositions are in some embodiments suitably administered to the subject at one time or over a series of treatments.
  • Formulations include those for oral, intravenous, intraperitoneal, subcutaneous, pulmonary, transdermal, intramuscular, intranasal, buccal, sublingual, or suppository administration.
  • the agent or cell populations are administered parenterally.
  • parenteral includes intravenous, intramuscular, subcutaneous, rectal, vaginal, and intraperitoneal administration.
  • the agent or cell populations are administered to a subject using peripheral systemic delivery by intravenous, intraperitoneal, or subcutaneous injection.
  • compositions in some embodiments are provided as sterile liquid preparations, e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may in some aspects be buffered to a selected pH.
  • sterile liquid preparations e.g., isotonic aqueous solutions, suspensions, emulsions, dispersions, or viscous compositions, which may in some aspects be buffered to a selected pH.
  • Liquid preparations are normally easier to prepare than gels, other viscous compositions, and solid compositions. Additionally, liquid compositions are somewhat more convenient to administer, especially by injection. Viscous compositions, on the other hand, can be formulated within the appropriate viscosity range to provide longer contact periods with specific tissues.
  • Liquid or viscous compositions can comprise carriers, which can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol) and suitable mixtures thereof.
  • carriers can be a solvent or dispersing medium containing, for example, water, saline, phosphate buffered saline, polyol (for example, glycerol, propylene glycol, liquid polyethylene glycol) and suitable mixtures thereof.
  • Sterile injectable solutions can be prepared by incorporating the agent or cells in a solvent, such as in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, or the like.
  • a suitable carrier such as in admixture with a suitable carrier, diluent, or excipient such as sterile water, physiological saline, glucose, dextrose, or the like.
  • the formulations to be used for in vivo administration are generally sterile. Sterility may be readily accomplished, e.g., by filtration through sterile filtration membranes.
  • the articles of manufacture or kits can be used in methods for engineering T cells to express a recombinant TCR and/or other molecules as described herein, for example, to generate the engineered cells comprising a genetic disruption at an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus and a modified TRAC locus comprising a transgene encoding a recombinant TCR or a portion thereof.
  • TGFBR2 transforming growth factor-beta receptor type-2
  • the articles of manufacture or kits include polypeptides, nucleic acids, vectors and/or polynucleotides useful in performing the provided methods.
  • the articles of manufacture or kits include one or more agent(s) capable of inducing a genetic disruption, for example, at a TGFBR2 locus and/or a TRAC locus (such as those described in Section LA herein).
  • the one or more agent(s) is a ribonucleoprotein (RNP) complex comprising a Cas9/gRNA complex.
  • RNP ribonucleoprotein
  • the gRNA included in the RNP targets a target site in the TGFBR2 locus or a TRAC locus or both, such as any first target site and/or a second target site described herein.
  • the template polynucleotide is any of the template polynucleotide described herein.
  • the articles of manufacture or kits include one or more containers, typically a plurality of containers, packaging material, and a label or package insert on or associated with the container or containers and/or packaging, generally including instructions for use, e.g., instructions for introducing the components into the cells for engineering.
  • the articles of manufacture provided herein contain packaging materials.
  • Packaging materials for use in packaging the provided materials are well known. See, for example, U.S. Patent Nos. 5,323,907, 5,052,558 and 5,033,252, each of which is incorporated herein in its entirety.
  • packaging materials include, but are not limited to, blister packs, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes, disposable laboratory supplies, e.g., pipette tips and/or plastic plates, or bottles.
  • the articles of manufacture or kits can include a device so as to facilitate dispensing of the materials or to facilitate use in a high-throughput or large-scale manner, e.g., to facilitate use in robotic equipment.
  • the packaging is non- reactive with the compositions contained therein.
  • the one or more agent(s) capable of inducing genetic disruption and/or template polynucleotide(s) are packaged separately.
  • each container can have a single compartment.
  • other components of the articles of manufacture or kits are packaged separately, or together in a single compartment.
  • the articles of manufacture or kits provided herein contain T cells, and/or T cell compositions, such as any T cells, and/or pharmaceutical compositions comprising T cells described herein. In some embodiments, the T cells, and/or Pharmaceutical compositions any of the modified T cells used the screening methods described herein. In some embodiments, the articles of manufacture or kits provided herein contain control or unmodified T cells and/or Pharmaceutical compositions. In some embodiments, the article of manufacture or kits include one or more instructions for administration of the engineered cells and/or cell compositions for therapy.
  • the label or package insert may indicate that the composition is used for treating a disease or condition.
  • the article of manufacture may include (a) a first container with a composition contained therein, wherein the composition includes engineered cells expressing a recombinant receptor; and (b) a second container with a composition contained therein, wherein the composition includes the second agent.
  • the article of manufacture may include (a) a first container with a first composition contained therein, wherein the composition includes a subtype of engineered cells expressing a recombinant receptor; and (b) a second container with a composition contained therein, wherein the composition includes a different subtype of engineered cells expressing a recombinant receptor.
  • the article of manufacture may further include a package insert indicating that the compositions can be used to treat a particular condition.
  • the article of manufacture may further include another or the same container comprising a pharmaceutically-acceptable buffer. It may further include other materials such as other buffers, diluents, filters, needles, and/or syringes.
  • Domain is used to describe a segment of a protein or nucleic acid. Unless otherwise indicated, a domain is not required to have any specific functional property.
  • variant refers to an entity such as a polypeptide, polynucleotide or small molecule that shows significant structural identity with a reference entity but differs structurally from the reference entity in the presence or level of one or more chemical moieties as compared with the reference entity. In many embodiments, a variant also differs functionally from its reference entity. In general, whether a particular entity is properly considered to be a "variant" of a reference entity is based on its degree of structural identity with the reference entity.
  • host cell refers to cells into which exogenous nucleic acid has been introduced, including the progeny of such cells.
  • Host cells include “transformants” and “transformed cells,” which include the primary transformed cell and progeny derived therefrom without regard to the number of passages. Progeny may not be completely identical in nucleic acid content to a parent cell, but may contain mutations. Mutant progeny that have the same function or biological activity as screened or selected for in the originally transformed cell are included herein.
  • a statement that a cell or population of cells is “positive” for a particular marker refers to the detectable presence on or in the cell of a particular marker, typically a surface marker.
  • a surface marker refers to the presence of surface expression as detected by flow cytometry, for example, by staining with an antibody that specifically binds to the marker and detecting said antibody, wherein the staining is detectable by flow cytometry at a level substantially above the staining detected carrying out the same procedure with an isotype-matched control under otherwise identical conditions and/or at a level substantially similar to that for cell known to be positive for the marker, and/or at a level substantially higher than that for a cell known to be negative for the marker.
  • percent (%) amino acid sequence identity and “percent identity” when used with respect to an amino acid sequence (reference polypeptide sequence) is defined as the percentage of amino acid residues in a candidate sequence (e.g., the subject antibody or fragment) that are identical with the amino acid residues in the reference polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various known ways, in some embodiments, using publicly available computer software such as BLAST, BLAST-2, ALIGN or Megalign (DNASTAR) software. Appropriate parameters for aligning sequences can be determined, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared.
  • “operably linked” may include the association of components, such as a DNA sequence, e.g. a heterologous nucleic acid) and a regulatory sequence(s), in such a way as to permit gene expression when the appropriate molecules (e.g. transcriptional activator proteins) are bound to the regulatory sequence.
  • a DNA sequence e.g. a heterologous nucleic acid
  • a regulatory sequence e.g. a promoter for transcription
  • the components described are in a relationship permitting them to function in their intended manner.
  • Amino acids generally can be grouped according to the following common sidechain properties:
  • a “subject” is a mammal, such as a human or other animal, and typically is human.
  • package insert is used to refer to instructions customarily included in commercial packages of therapeutic products, that contain information about the indications, usage, dosage, administration, combination therapy, contraindications and/or warnings concerning the use of such therapeutic products.
  • a genetically engineered T cell comprising: a recombinant T cell receptor (TCR) comprising a TCR alpha (TCRa) chain comprising a variable alpha (Va) region, and a TCR beta (TCRP) chain comprising a variable beta (VP) region, and a first genetic disruption at a first target site at an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus; wherein: the genetically engineered T cells comprises a modified T cell receptor alpha constant (TRAC) locus comprising a transgene encoding the recombinant TCR or portion thereof; and reduced expression of the endogenous TGFBR2 locus.
  • TCR TCR alpha
  • Va variable alpha
  • TCRP TCR beta
  • VP variable beta
  • TGFBR2 transforming growth factor-beta receptor type-2
  • a genetically engineered T cell comprising: a recombinant T cell receptor (TCR) comprising a TCR alpha (TCRa) chain comprising a variable alpha (Va) region, and a TCR beta (TCRP) chain comprising a variable beta (VP) region, and a first genetic disruption at a first target site at an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus; wherein: the genetically engineered T cells comprises a modified T cell receptor alpha constant (TRAC) locus comprising a transgene encoding the TCRa chain and the TCRP chain of the recombinant TCR; and reduced expression of the endogenous TGFBR2 locus.
  • TCR TCR alpha
  • Va variable alpha
  • TCRP TCR beta
  • VP variable beta
  • TGFP signal transmission is reduced or eliminated in the genetically engineered T cell.
  • T cell of any of embodiments 1-6 wherein the transgene has been integrated via homology directed repair (HDR) at the TRAC locus in a cell comprising a second genetic disruption at a second target site at an endogenous TRAC locus.
  • HDR homology directed repair
  • gRNA comprising a first targeting domain that binds to the first target site, and a Cas9 protein
  • the second agent comprises a second CRISPR-Cas combination comprising a second gRNA comprising a second targeting domain that binds to the second target site, and a Cas9 protein.
  • the Va region comprises a complementarity determining region 1 (CDR-1) comprising the sequence of SEQ ID NO: 10, a CDR-2 comprising the sequence of SEQ ID NO: 11, and a CDR-3 comprising the sequence of SEQ ID NO: 12; and the VP region comprises a complementarity determining region 1 (CDR-1) comprising the sequence of SEQ ID NO:3, a CDR-2 comprising the sequence of SEQ ID NO:4, and a CDR- 3 comprising the sequence of SEQ ID NO:5.
  • CDR-1 complementarity determining region 1
  • the VP region comprises a complementarity determining region 1 (CDR-1) comprising the sequence of SEQ ID NO:3, a CDR-2 comprising the sequence of SEQ ID NO:4, and a CDR- 3 comprising the sequence of SEQ ID NO:5.
  • the Va region comprise the sequence of SEQ ID NO:8, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:8; and the VP region comprise the sequence of SEQ ID NO:1, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:1.
  • TCRa chain comprises a constant alpha (Ca) region and the TCRP chain comprises a constant beta (CP) region.
  • the Ca region comprises a sequence selected from any one of SEQ ID NOS: 9, 167-172, 175, 176, and 178-181, or a sequence that has at least at or about 90% sequence identity to any one of SEQ ID NOS: 9, 167-172, 175, 176, and 178-181; and the CP region comprises a sequence selected from any one of SEQ ID NOS:2, 156, 173, 174, 177, 182, and 183, or a sequence that has at least at or about 90% sequence identity to any one of SEQ ID NOS: 2, 156, 173, 174, 177, 182, and 183. 31.
  • the Ca region comprises the sequence of SEQ ID NO:9, or a sequence that has at least at or about 90% sequence identity to SEQ ID NO:9; and the CP region comprises the sequence of SEQ ID NO:2, or a sequence that has at least at or about 90% sequence identity to SEQ ID NO:2.
  • TCRa chain comprises the sequence of SEQ ID NO: 14
  • TCRP chain comprises the sequence of SEQ ID NO:7.
  • the transgene comprises: a nucleotide sequence encoding the TCRa chain comprising the sequence of SEQ ID NO:22, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO:22; and a nucleotide sequence encoding the TCRP chain comprising the sequence of SEQ ID NO: 18, or a sequence that has at least at or about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity to SEQ ID NO: 18.
  • transgene comprises: a nucleotide sequence encoding the TCRa chain comprising the sequence of SEQ ID NO:22; and a nucleotide sequence encoding the TCRP chain comprising the sequence of SEQ ID NO:18.
  • heterologous promoter is or comprises a human elongation factor 1 alpha (EFla) promoter or a variant thereof.
  • T cell is a primary T cell derived from a subject, optionally wherein the subject is a human.
  • a method of producing a genetically engineered T cell comprising:
  • TGFBR2 transforming growth factor-beta receptor type-2
  • TCR recombinant T cell receptor
  • TCRa TCR alpha
  • Va variable alpha
  • TCRP TCR beta
  • a method of producing a genetically engineered T cell comprising: (a) introducing, into a T cell, a first agent for inducing a first genetic disruption at a first target site within an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus; and
  • TCR recombinant T cell receptor
  • TCRa TCR alpha
  • Va variable alpha
  • TCRP TCR beta
  • a method of producing a genetically engineered T cell comprising introducing, into a T cell, a polynucleotide comprising a transgene encoding a recombinant T cell receptor (TCR) comprising a TCR alpha (TCRa) chain comprising a variable alpha (Va) region, and a TCR beta (TCRP) chain comprising a variable beta (VP) region, or a portion thereof, said T cell comprising a first genetic disruption at a first target site within an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus, and a second genetic disruption at a second target site within a T cell receptor alpha constant (TRAC) locus.
  • TCR recombinant T cell receptor
  • TCRa TCR alpha
  • Va variable alpha
  • TCRP TCR beta
  • VP variable beta
  • a method of producing a genetically engineered T cell comprising introducing, into a T cell, a polynucleotide comprising a transgene encoding a recombinant T cell receptor (TCR) comprising a TCR alpha (TCRa) chain comprising a variable alpha (Va) region, and a TCR beta (TCRP) chain comprising a variable beta (VP) region, said T cell comprising a first genetic disruption at a first target site within an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus, and a second genetic disruption at a second target site within a T cell receptor alpha constant (TRAC) locus.
  • TCR recombinant T cell receptor
  • TCRa TCR alpha
  • Va variable alpha
  • TCRP TCR beta
  • VP variable beta
  • first genetic disruption and the second genetic disruption is carried out by introducing, into the T cell, a first agent for inducing a first genetic disruption at a first target site within an endogenous transforming growth factorbeta receptor type-2 (TGFBR2) locus and a second agent for inducing a second genetic disruption at a second target site within a T cell receptor alpha constant (TRAC) locus.
  • TGFBR2 transforming growth factorbeta receptor type-2
  • polynucleotide further comprises one or more homology arm(s) linked to the transgene, wherein the one or more homology arm(s) comprise a sequence homologous to one or more region(s) of an open reading frame of a TRAC locus.
  • T cell receptor alpha constant (TRAC) locus comprising the transgene encoding the recombinant T cell receptor (TCR) or portion thereof; and the first genetic disruption at the first target site at an endogenous transforming growth factor-beta receptor type-2 (TGFBR2) locus, and reduced expression of the endogenous TGFBR2 locus.
  • TGFBR2 transforming growth factor-beta receptor type-2
  • the genetically engineered T cell produced by the method does not encode a functional TGFBR2 polypeptide; the genetically engineered T cell produced by the method does not encode a TGFBR2 polypeptide; the genetically engineered T cell produced by the method does not encode a full length TGFBR2 polypeptide; the expression of TGFBR2 polypeptide is reduced or eliminated in the genetically engineered T cell produced by the method; and/or
  • TGFP signal transmission is reduced or eliminated in the genetically engineered T cell produced by the method.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biotechnology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Biochemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Engineering & Computer Science (AREA)
  • Cell Biology (AREA)
  • Hematology (AREA)
  • Virology (AREA)
  • Mycology (AREA)
  • Epidemiology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

La présente invention concerne des lymphocytes T modifiés exprimant un récepteur recombiné de lymphocytes T (TCR) à partir d'un locus de récepteur alpha constant de lymphocytes T (TRAC) et possédant également une expression réduite du récepteur 2 du facteur de croissance transformant bêta (TGFBR2), afin de permettre une perturbation génétique au niveau du locus TGFBR2. Sont également divulguées des compositions de cellules contenant les lymphocytes T modifiés, ainsi que des procédés, des kits et des systèmes de production de lymphocytes T modifiés. La présente invention concerne également des procédés de fabrication et d'utilisation des lymphocytes T modifiés à des fins de thérapie cellulaire, notamment dans le cadre d'une thérapie anticancéreuse comprenant le transfert adoptif des lymphocytes T modifiés.
PCT/US2022/079418 2021-11-08 2022-11-07 Lymphocytes t modifiés exprimant un récepteur recombiné de lymphocytes t (tcr) et systèmes et procédés apparentés WO2023081900A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163277154P 2021-11-08 2021-11-08
US63/277,154 2021-11-08

Publications (1)

Publication Number Publication Date
WO2023081900A1 true WO2023081900A1 (fr) 2023-05-11

Family

ID=84767277

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/079418 WO2023081900A1 (fr) 2021-11-08 2022-11-07 Lymphocytes t modifiés exprimant un récepteur recombiné de lymphocytes t (tcr) et systèmes et procédés apparentés

Country Status (1)

Country Link
WO (1) WO2023081900A1 (fr)

Citations (105)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4452773A (en) 1982-04-05 1984-06-05 Canadian Patents And Development Limited Magnetic iron-dextran microspheres
US4690915A (en) 1985-08-08 1987-09-01 The United States Of America As Represented By The Department Of Health And Human Services Adoptive immunotherapy as a treatment modality in humans
US4795698A (en) 1985-10-04 1989-01-03 Immunicon Corporation Magnetic-polymer particles
US5033252A (en) 1987-12-23 1991-07-23 Entravision, Inc. Method of packaging and sterilizing a pharmaceutical product
US5052558A (en) 1987-12-23 1991-10-01 Entravision, Inc. Packaged pharmaceutical product
US5087616A (en) 1986-08-07 1992-02-11 Battelle Memorial Institute Cytotoxic drug conjugates and their delivery to tumor cells
US5200084A (en) 1990-09-26 1993-04-06 Immunicon Corporation Apparatus and methods for magnetic separation
US5219740A (en) 1987-02-13 1993-06-15 Fred Hutchinson Cancer Research Center Retroviral gene transfer into diploid fibroblasts for gene therapy
US5323907A (en) 1992-06-23 1994-06-28 Multi-Comp, Inc. Child resistant package assembly for dispensing pharmaceutical medications
US5356802A (en) 1992-04-03 1994-10-18 The Johns Hopkins University Functional domains in flavobacterium okeanokoites (FokI) restriction endonuclease
EP0452342B1 (fr) 1988-12-28 1994-11-30 MILTENYI, Stefan Procedes et matieres pour la separation magnetique a gradient eleve de matieres biologiques
WO1995019431A1 (fr) 1994-01-18 1995-07-20 The Scripps Research Institute Derives de proteine a doigts zinciques et procedes associes
US5436150A (en) 1992-04-03 1995-07-25 The Johns Hopkins University Functional domains in flavobacterium okeanokoities (foki) restriction endonuclease
US5487994A (en) 1992-04-03 1996-01-30 The Johns Hopkins University Insertion and deletion mutants of FokI restriction endonuclease
WO1996006166A1 (fr) 1994-08-20 1996-02-29 Medical Research Council Ameliorations concernant des proteines de liaison permettant de reconnaitre l'adn
US5789538A (en) 1995-02-03 1998-08-04 Massachusetts Institute Of Technology Zinc finger proteins with high affinity new DNA binding specificities
WO1998053058A1 (fr) 1997-05-23 1998-11-26 Gendaq Limited Proteines de liaison d'acide nucleique
WO1998053059A1 (fr) 1997-05-23 1998-11-26 Medical Research Council Proteines de liaison d'acide nucleique
WO1998054311A1 (fr) 1997-05-27 1998-12-03 The Scripps Research Institute Derives de proteines a doigts de zinc et procedes associes
US5925523A (en) 1996-08-23 1999-07-20 President & Fellows Of Harvard College Intraction trap assay, reagents and uses thereof
US6040177A (en) 1994-08-31 2000-03-21 Fred Hutchinson Cancer Research Center High efficiency transduction of T lymphocytes using rapid expansion methods ("REM")
US6060273A (en) 1992-08-27 2000-05-09 Beiersdorf Ag Multicistronic expression units and their use
WO2000027878A1 (fr) 1998-11-09 2000-05-18 Gendaq Limited Systeme de criblage de polypeptides a motifs en doigt de zinc, destine a mettre en evidence une certaine capacite de liaison
US6140081A (en) 1998-10-16 2000-10-31 The Scripps Research Institute Zinc finger binding domains for GNN
US6207453B1 (en) 1996-03-06 2001-03-27 Medigene Ag Recombinant AAV vector-based transduction system and use of same
WO2001060970A2 (fr) 2000-02-18 2001-08-23 Toolgen, Inc. Domaines a doigts de zinc et leurs procedes d'identification
WO2001088197A2 (fr) 2000-05-16 2001-11-22 Massachusetts Institute Of Technology Methodes et compositions de dosage de piegeage par interaction
WO2002016536A1 (fr) 2000-08-23 2002-02-28 Kao Corporation Detergent bactericide antisalissures, destine aux surfaces dures
US6355424B1 (en) 1997-12-12 2002-03-12 Digene Corporation Assessment of human papillomavirus-related disease
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
WO2002099084A2 (fr) 2001-04-04 2002-12-12 Gendaq Limited Polypeptides de liaison composites
US6503717B2 (en) 1999-12-06 2003-01-07 Sangamo Biosciences, Inc. Methods of using randomized libraries of zinc finger proteins for the identification of gene function
WO2003016496A2 (fr) 2001-08-20 2003-02-27 The Scripps Research Institute Domaines de fixation en doigt de zinc pour cnn
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6599692B1 (en) 1999-09-14 2003-07-29 Sangamo Bioscience, Inc. Functional genomics using zinc finger proteins
US20030170238A1 (en) 2002-03-07 2003-09-11 Gruenberg Micheal L. Re-activated T-cells for adoptive immunotherapy
US20030232410A1 (en) 2002-03-21 2003-12-18 Monika Liljedahl Methods and compositions for using zinc finger endonucleases to enhance homologous recombination
US6689558B2 (en) 2000-02-08 2004-02-10 Sangamo Biosciences, Inc. Cells for drug discovery
US20050026157A1 (en) 2002-09-05 2005-02-03 David Baltimore Use of chimeric nucleases to stimulate gene targeting
US20050064474A1 (en) 2003-08-08 2005-03-24 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US20050208489A1 (en) 2002-01-23 2005-09-22 Dana Carroll Targeted chromosomal mutagenasis using zinc finger nucleases
WO2006000830A2 (fr) 2004-06-29 2006-01-05 Avidex Ltd Substances
US20060063231A1 (en) 2004-09-16 2006-03-23 Sangamo Biosciences, Inc. Compositions and methods for protein production
WO2006037960A2 (fr) 2004-10-01 2006-04-13 Avidex Ltd. Recepteurs de lymphocytes t a liaison intercatenaire disulfure exogene reliee a des agents therapeutiques
US7067317B2 (en) 2000-12-07 2006-06-27 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
US20070116690A1 (en) 2001-12-10 2007-05-24 Lili Yang Method for the generation of antigen-specific lymphocytes
US7262054B2 (en) 2002-01-22 2007-08-28 Sangamo Biosciences, Inc. Zinc finger proteins for DNA binding and gene regulation in plants
US20080159996A1 (en) 2006-05-25 2008-07-03 Dale Ando Methods and compositions for gene inactivation
US7446190B2 (en) 2002-05-28 2008-11-04 Sloan-Kettering Institute For Cancer Research Nucleic acids encoding chimeric T cell receptors
WO2009072003A2 (fr) 2007-12-07 2009-06-11 Miltenyi Biotec Gmbh Système et procédés de traitement d'échantillons
US20100047805A1 (en) 2008-08-22 2010-02-25 Sangamo Biosciences, Inc. Methods and compositions for targeted single-stranded cleavage and targeted integration
WO2010033140A2 (fr) 2008-05-06 2010-03-25 Innovative Micro Technology Appareil amovible/jetable pour dispositif de tri de particules de mems
US20100218264A1 (en) 2008-12-04 2010-08-26 Sangamo Biosciences, Inc. Genome editing in rats using zinc-finger nucleases
US7914796B2 (en) 2006-05-25 2011-03-29 Sangamo Biosciences, Inc. Engineered cleavage half-domains
US20110158957A1 (en) 2009-11-10 2011-06-30 Sangamo Biosciences, Inc. Targeted disruption of T cell receptor genes using engineered zinc finger protein nucleases
US7972854B2 (en) 2004-02-05 2011-07-05 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US20110207221A1 (en) 2010-02-09 2011-08-25 Sangamo Biosciences, Inc. Targeted genomic modification with partially single-stranded donor molecules
US20110265198A1 (en) 2010-04-26 2011-10-27 Sangamo Biosciences, Inc. Genome editing of a Rosa locus using nucleases
US20110301073A1 (en) 2010-05-17 2011-12-08 Sangamo Biosciences, Inc. Novel DNA-binding proteins and uses thereof
US8110379B2 (en) 2007-04-26 2012-02-07 Sangamo Biosciences, Inc. Targeted integration into the PPP1R12C locus
WO2012138927A2 (fr) 2011-04-05 2012-10-11 Philippe Duchateau Procédé de génération de nucléases tale compactes et leurs utilisations
US8409861B2 (en) 2003-08-08 2013-04-02 Sangamo Biosciences, Inc. Targeted deletion of cellular DNA sequences
US20130122591A1 (en) 2011-10-27 2013-05-16 The Regents Of The University Of California Methods and compositions for modification of the hprt locus
US20130177983A1 (en) 2011-09-21 2013-07-11 Sangamo Bioscience, Inc. Methods and compositions for regulation of transgene expression
US20130196373A1 (en) 2011-11-16 2013-08-01 Sangamo Biosciences, Inc. Modified dna-binding proteins and uses thereof
US20130326645A1 (en) 2012-05-07 2013-12-05 Dow Agrosciences Llc Methods and compositions for nuclease-mediated targeted integration of transgenes
WO2014055668A1 (fr) 2012-10-02 2014-04-10 Memorial Sloan-Kettering Cancer Center Compositions et procédés d'immunothérapie
US20140120622A1 (en) 2012-10-10 2014-05-01 Sangamo Biosciences, Inc. T cell modifying compounds and uses thereof
US20140301990A1 (en) 2013-03-21 2014-10-09 Ospedale San Raffaele Srl Targeted disruption of t cell receptor genes using engineered zinc finger protein nucleases
WO2014191128A1 (fr) 2013-05-29 2014-12-04 Cellectis Procédé de manipulation de cellules t pour l'immunothérapie au moyen d'un système de nucléase cas guidé par l'arn
US8945868B2 (en) 2010-07-21 2015-02-03 Sangamo Biosciences, Inc. Methods and compositions for modification of a HLA locus
US20150056705A1 (en) 2013-05-15 2015-02-26 Sangamo Biosciences, Inc. Methods and compositions for treatment of a genetic condition
US8968995B2 (en) 2008-11-12 2015-03-03 Oncohealth Corp. Detection, screening, and diagnosis of HPV-associated cancers
US20150098954A1 (en) 2013-10-08 2015-04-09 Elwha Llc Compositions and Methods Related to CRISPR Targeting
WO2015070083A1 (fr) 2013-11-07 2015-05-14 Editas Medicine,Inc. Méthodes et compositions associées à crispr avec arng de régulation
US9045763B2 (en) 2005-07-26 2015-06-02 Sangamo Biosciences, Inc. Linear donor constructs for targeted integration
US20150203817A1 (en) 2012-05-25 2015-07-23 Cellectis Use of pre t alpha or functional variant thereof for expanding tcr alpha deficient t cells
US9108442B2 (en) 2013-08-20 2015-08-18 Ricoh Company, Ltd. Image forming apparatus
WO2015136001A1 (fr) 2014-03-11 2015-09-17 Cellectis Procédé d'obtention de lymphocytes t compatibles avec la transplantation allogénique
WO2015161276A2 (fr) 2014-04-18 2015-10-22 Editas Medicine, Inc. Méthodes, compositions et constituants associés à crispr/cas pour l'immunothérapie du cancer
US20150335708A1 (en) 2014-05-08 2015-11-26 Sangamo Biosciences, Inc. Methods and compositions for treating huntington's disease
WO2015184228A1 (fr) 2014-05-29 2015-12-03 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Récepteurs de lymphocytes t anti-papillomavirus humain 16 e7
US20160024474A1 (en) 2014-07-25 2016-01-28 Sangamo BioSciences,Inc. Methods and compositions for modulating nuclease-mediated genome engineering in hematopoietic stem cells
WO2016016341A1 (fr) 2014-07-29 2016-02-04 Cellectis Récepteurs d'antigènes chimériques spécifiques de l'egfrviii pour l'immunothérapie du cancer
US20160030477A1 (en) 2014-07-30 2016-02-04 Sangamo Biosciences, Inc. Gene correction of scid-related genes in hematopoietic stem and progenitor cells
US9255250B2 (en) 2012-12-05 2016-02-09 Sangamo Bioscience, Inc. Isolated mouse or human cell having an exogenous transgene in an endogenous albumin gene
WO2016069283A1 (fr) 2014-10-31 2016-05-06 The Trustees Of The University Of Pennsylvania Modification de l'expression génétique dans les cellules cart et utilisations associées
US20160208243A1 (en) 2015-06-18 2016-07-21 The Broad Institute, Inc. Novel crispr enzymes and systems
US9405601B2 (en) 2012-12-20 2016-08-02 Mitsubishi Electric Corporation In-vehicle apparatus and program
US20170016027A1 (en) 2015-07-13 2017-01-19 Sangamo Biosciences, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
WO2017070429A1 (fr) 2015-10-22 2017-04-27 Regents Of The University Of Minnesota Procédés consistant à éditer des polynucléotides codant pour un récepteur de lymphocytes t
WO2017093969A1 (fr) 2015-12-04 2017-06-08 Novartis Ag Compositions et procédés d'immuno-oncologie
US20170211075A1 (en) 2015-12-18 2017-07-27 Sangamo Biosciences, Inc. Targeted disruption of the t cell receptor
WO2017193107A2 (fr) 2016-05-06 2017-11-09 Juno Therapeutics, Inc. Cellules génétiquement modifiées et leurs procédés de fabrication
WO2018067618A1 (fr) 2016-10-03 2018-04-12 Juno Therapeutics, Inc. Molécules se liant spécifiquement au vph
WO2018075541A1 (fr) * 2016-10-17 2018-04-26 Bluebird Bio, Inc. VARIANTS DE L'ENDONUCLÉASE TGFβR2, COMPOSITIONS ET PROCÉDÉS D'UTILISATION
WO2019070541A1 (fr) 2017-10-03 2019-04-11 Juno Therapeutics, Inc. Molécules de liaison spécifique à l'hpv
WO2019089884A2 (fr) 2017-11-01 2019-05-09 Editas Medicine, Inc. Procédés, compositions et composants pour l'édition crispr-cas9 de tgfbr2 dans des cellules t pour l'immunothérapie
WO2019195486A1 (fr) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. Récepteurs de lymphocytes t et cellules modifiées les exprimant
WO2019195491A1 (fr) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. Lymphocytes t exprimant un récepteur recombinant, polynucléotides et procédés associés
WO2019195492A1 (fr) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. Procédés de production de cellules exprimant un récepteur recombinant et compositions associées
WO2020113029A2 (fr) * 2018-11-28 2020-06-04 Board Of Regents, The University Of Texas System Édition de génome multiplex de cellules immunitaires pour améliorer la fonctionnalité et la résistance à un environnement de suppression
WO2020223535A1 (fr) 2019-05-01 2020-11-05 Juno Therapeutics, Inc. Cellules exprimant un récepteur recombinant à base d'un locus modifié du tgfbr2, et polynucléotides et méthodes associés
EP3854877A1 (fr) * 2018-09-17 2021-07-28 Institute Of Zoology, Chinese Academy Of Sciences Lymphocyte t modifié, son procédé de préparation et son utilisation
WO2022109277A1 (fr) * 2020-11-20 2022-05-27 Pact Pharma, Inc. COMPOSITIONS ET MÉTHODES DE TRAITEMENT DU CANCER PAR UNE THÉRAPIE CELLULAIRE FAISANT APPEL À DES LYMPHOCYTES T À TGFβRII MODIFIÉ

Patent Citations (125)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4452773A (en) 1982-04-05 1984-06-05 Canadian Patents And Development Limited Magnetic iron-dextran microspheres
US4690915A (en) 1985-08-08 1987-09-01 The United States Of America As Represented By The Department Of Health And Human Services Adoptive immunotherapy as a treatment modality in humans
US4795698A (en) 1985-10-04 1989-01-03 Immunicon Corporation Magnetic-polymer particles
US5087616A (en) 1986-08-07 1992-02-11 Battelle Memorial Institute Cytotoxic drug conjugates and their delivery to tumor cells
US5219740A (en) 1987-02-13 1993-06-15 Fred Hutchinson Cancer Research Center Retroviral gene transfer into diploid fibroblasts for gene therapy
US5033252A (en) 1987-12-23 1991-07-23 Entravision, Inc. Method of packaging and sterilizing a pharmaceutical product
US5052558A (en) 1987-12-23 1991-10-01 Entravision, Inc. Packaged pharmaceutical product
EP0452342B1 (fr) 1988-12-28 1994-11-30 MILTENYI, Stefan Procedes et matieres pour la separation magnetique a gradient eleve de matieres biologiques
US5200084A (en) 1990-09-26 1993-04-06 Immunicon Corporation Apparatus and methods for magnetic separation
US5356802A (en) 1992-04-03 1994-10-18 The Johns Hopkins University Functional domains in flavobacterium okeanokoites (FokI) restriction endonuclease
US5436150A (en) 1992-04-03 1995-07-25 The Johns Hopkins University Functional domains in flavobacterium okeanokoities (foki) restriction endonuclease
US5487994A (en) 1992-04-03 1996-01-30 The Johns Hopkins University Insertion and deletion mutants of FokI restriction endonuclease
US5323907A (en) 1992-06-23 1994-06-28 Multi-Comp, Inc. Child resistant package assembly for dispensing pharmaceutical medications
US6060273A (en) 1992-08-27 2000-05-09 Beiersdorf Ag Multicistronic expression units and their use
WO1995019431A1 (fr) 1994-01-18 1995-07-20 The Scripps Research Institute Derives de proteine a doigts zinciques et procedes associes
WO1996006166A1 (fr) 1994-08-20 1996-02-29 Medical Research Council Ameliorations concernant des proteines de liaison permettant de reconnaitre l'adn
US6007988A (en) 1994-08-20 1999-12-28 Medical Research Council Binding proteins for recognition of DNA
US6013453A (en) 1994-08-20 2000-01-11 Medical Research Council Binding proteins for recognition of DNA
US6040177A (en) 1994-08-31 2000-03-21 Fred Hutchinson Cancer Research Center High efficiency transduction of T lymphocytes using rapid expansion methods ("REM")
US5789538A (en) 1995-02-03 1998-08-04 Massachusetts Institute Of Technology Zinc finger proteins with high affinity new DNA binding specificities
US6207453B1 (en) 1996-03-06 2001-03-27 Medigene Ag Recombinant AAV vector-based transduction system and use of same
US6200759B1 (en) 1996-08-23 2001-03-13 President And Fellows Of Harvard College Interaction trap assay, reagents and uses thereof
US5925523A (en) 1996-08-23 1999-07-20 President & Fellows Of Harvard College Intraction trap assay, reagents and uses thereof
WO1998053058A1 (fr) 1997-05-23 1998-11-26 Gendaq Limited Proteines de liaison d'acide nucleique
WO1998053060A1 (fr) 1997-05-23 1998-11-26 Gendaq Limited Proteines de liaison d'acide nucleique
WO1998053057A1 (fr) 1997-05-23 1998-11-26 Gendaq Limited Bibliotheque de polypeptides de fixation d'acide nucleique
WO1998053059A1 (fr) 1997-05-23 1998-11-26 Medical Research Council Proteines de liaison d'acide nucleique
WO1998054311A1 (fr) 1997-05-27 1998-12-03 The Scripps Research Institute Derives de proteines a doigts de zinc et procedes associes
US6355424B1 (en) 1997-12-12 2002-03-12 Digene Corporation Assessment of human papillomavirus-related disease
US6140081A (en) 1998-10-16 2000-10-31 The Scripps Research Institute Zinc finger binding domains for GNN
WO2000027878A1 (fr) 1998-11-09 2000-05-18 Gendaq Limited Systeme de criblage de polypeptides a motifs en doigt de zinc, destine a mettre en evidence une certaine capacite de liaison
US6453242B1 (en) 1999-01-12 2002-09-17 Sangamo Biosciences, Inc. Selection of sites for targeting by zinc finger proteins and methods of designing zinc finger proteins to bind to preselected sites
US6534261B1 (en) 1999-01-12 2003-03-18 Sangamo Biosciences, Inc. Regulation of endogenous gene expression in cells using zinc finger proteins
US6599692B1 (en) 1999-09-14 2003-07-29 Sangamo Bioscience, Inc. Functional genomics using zinc finger proteins
US6503717B2 (en) 1999-12-06 2003-01-07 Sangamo Biosciences, Inc. Methods of using randomized libraries of zinc finger proteins for the identification of gene function
US6689558B2 (en) 2000-02-08 2004-02-10 Sangamo Biosciences, Inc. Cells for drug discovery
WO2001060970A2 (fr) 2000-02-18 2001-08-23 Toolgen, Inc. Domaines a doigts de zinc et leurs procedes d'identification
WO2001088197A2 (fr) 2000-05-16 2001-11-22 Massachusetts Institute Of Technology Methodes et compositions de dosage de piegeage par interaction
WO2002016536A1 (fr) 2000-08-23 2002-02-28 Kao Corporation Detergent bactericide antisalissures, destine aux surfaces dures
US7067317B2 (en) 2000-12-07 2006-06-27 Sangamo Biosciences, Inc. Regulation of angiogenesis with zinc finger proteins
WO2002099084A2 (fr) 2001-04-04 2002-12-12 Gendaq Limited Polypeptides de liaison composites
WO2003016496A2 (fr) 2001-08-20 2003-02-27 The Scripps Research Institute Domaines de fixation en doigt de zinc pour cnn
US20070116690A1 (en) 2001-12-10 2007-05-24 Lili Yang Method for the generation of antigen-specific lymphocytes
US7262054B2 (en) 2002-01-22 2007-08-28 Sangamo Biosciences, Inc. Zinc finger proteins for DNA binding and gene regulation in plants
US20050208489A1 (en) 2002-01-23 2005-09-22 Dana Carroll Targeted chromosomal mutagenasis using zinc finger nucleases
US20030170238A1 (en) 2002-03-07 2003-09-11 Gruenberg Micheal L. Re-activated T-cells for adoptive immunotherapy
US20030232410A1 (en) 2002-03-21 2003-12-18 Monika Liljedahl Methods and compositions for using zinc finger endonucleases to enhance homologous recombination
US7446190B2 (en) 2002-05-28 2008-11-04 Sloan-Kettering Institute For Cancer Research Nucleic acids encoding chimeric T cell receptors
US20050026157A1 (en) 2002-09-05 2005-02-03 David Baltimore Use of chimeric nucleases to stimulate gene targeting
US8409861B2 (en) 2003-08-08 2013-04-02 Sangamo Biosciences, Inc. Targeted deletion of cellular DNA sequences
US20050064474A1 (en) 2003-08-08 2005-03-24 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US7888121B2 (en) 2003-08-08 2011-02-15 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
US7972854B2 (en) 2004-02-05 2011-07-05 Sangamo Biosciences, Inc. Methods and compositions for targeted cleavage and recombination
WO2006000830A2 (fr) 2004-06-29 2006-01-05 Avidex Ltd Substances
US20060063231A1 (en) 2004-09-16 2006-03-23 Sangamo Biosciences, Inc. Compositions and methods for protein production
WO2006037960A2 (fr) 2004-10-01 2006-04-13 Avidex Ltd. Recepteurs de lymphocytes t a liaison intercatenaire disulfure exogene reliee a des agents therapeutiques
US9045763B2 (en) 2005-07-26 2015-06-02 Sangamo Biosciences, Inc. Linear donor constructs for targeted integration
US7951925B2 (en) 2006-05-25 2011-05-31 Sangamo Biosciences, Inc. Methods and compositions for gene inactivation
US20080159996A1 (en) 2006-05-25 2008-07-03 Dale Ando Methods and compositions for gene inactivation
US7914796B2 (en) 2006-05-25 2011-03-29 Sangamo Biosciences, Inc. Engineered cleavage half-domains
US8110379B2 (en) 2007-04-26 2012-02-07 Sangamo Biosciences, Inc. Targeted integration into the PPP1R12C locus
US20110003380A1 (en) 2007-12-07 2011-01-06 Stefan Miltenyi Sample Processing System and Methods
WO2009072003A2 (fr) 2007-12-07 2009-06-11 Miltenyi Biotec Gmbh Système et procédés de traitement d'échantillons
WO2010033140A2 (fr) 2008-05-06 2010-03-25 Innovative Micro Technology Appareil amovible/jetable pour dispositif de tri de particules de mems
US20100047805A1 (en) 2008-08-22 2010-02-25 Sangamo Biosciences, Inc. Methods and compositions for targeted single-stranded cleavage and targeted integration
US8703489B2 (en) 2008-08-22 2014-04-22 Sangamo Biosciences, Inc. Methods and compositions for targeted single-stranded cleavage and targeted integration
US9200266B2 (en) 2008-08-22 2015-12-01 Sangamo Biosciences, Inc. Methods and compositions for targeted single-stranded cleavage and targeted integration
US8968995B2 (en) 2008-11-12 2015-03-03 Oncohealth Corp. Detection, screening, and diagnosis of HPV-associated cancers
US20100218264A1 (en) 2008-12-04 2010-08-26 Sangamo Biosciences, Inc. Genome editing in rats using zinc-finger nucleases
US20150164954A1 (en) 2009-11-10 2015-06-18 Sangamo Biosciences, Inc. Targeted disruption of t cell receptor genes using engineered zinc finger protein nucleases
US20110158957A1 (en) 2009-11-10 2011-06-30 Sangamo Biosciences, Inc. Targeted disruption of T cell receptor genes using engineered zinc finger protein nucleases
US8956828B2 (en) 2009-11-10 2015-02-17 Sangamo Biosciences, Inc. Targeted disruption of T cell receptor genes using engineered zinc finger protein nucleases
US9005973B2 (en) 2010-02-09 2015-04-14 Sangamo Biosciences, Inc. Targeted genomic modification with partially single-stranded donor molecules
US20110207221A1 (en) 2010-02-09 2011-08-25 Sangamo Biosciences, Inc. Targeted genomic modification with partially single-stranded donor molecules
US20120017290A1 (en) 2010-04-26 2012-01-19 Sigma Aldrich Company Genome editing of a Rosa locus using zinc-finger nucleases
US20110265198A1 (en) 2010-04-26 2011-10-27 Sangamo Biosciences, Inc. Genome editing of a Rosa locus using nucleases
US20110301073A1 (en) 2010-05-17 2011-12-08 Sangamo Biosciences, Inc. Novel DNA-binding proteins and uses thereof
US8586526B2 (en) 2010-05-17 2013-11-19 Sangamo Biosciences, Inc. DNA-binding proteins and uses thereof
US8945868B2 (en) 2010-07-21 2015-02-03 Sangamo Biosciences, Inc. Methods and compositions for modification of a HLA locus
WO2012138927A2 (fr) 2011-04-05 2012-10-11 Philippe Duchateau Procédé de génération de nucléases tale compactes et leurs utilisations
US20130177983A1 (en) 2011-09-21 2013-07-11 Sangamo Bioscience, Inc. Methods and compositions for regulation of transgene expression
US9150847B2 (en) 2011-09-21 2015-10-06 Sangamo Biosciences, Inc. Methods and compositions for regulation of transgene expression
US20130137104A1 (en) 2011-10-27 2013-05-30 The Regents Of The University Of California Methods and compositions for modification of the hprt locus
US20130122591A1 (en) 2011-10-27 2013-05-16 The Regents Of The University Of California Methods and compositions for modification of the hprt locus
US9458205B2 (en) 2011-11-16 2016-10-04 Sangamo Biosciences, Inc. Modified DNA-binding proteins and uses thereof
US20130196373A1 (en) 2011-11-16 2013-08-01 Sangamo Biosciences, Inc. Modified dna-binding proteins and uses thereof
US20130326645A1 (en) 2012-05-07 2013-12-05 Dow Agrosciences Llc Methods and compositions for nuclease-mediated targeted integration of transgenes
US20150203817A1 (en) 2012-05-25 2015-07-23 Cellectis Use of pre t alpha or functional variant thereof for expanding tcr alpha deficient t cells
WO2014055668A1 (fr) 2012-10-02 2014-04-10 Memorial Sloan-Kettering Cancer Center Compositions et procédés d'immunothérapie
US20140120622A1 (en) 2012-10-10 2014-05-01 Sangamo Biosciences, Inc. T cell modifying compounds and uses thereof
US9255250B2 (en) 2012-12-05 2016-02-09 Sangamo Bioscience, Inc. Isolated mouse or human cell having an exogenous transgene in an endogenous albumin gene
US9405601B2 (en) 2012-12-20 2016-08-02 Mitsubishi Electric Corporation In-vehicle apparatus and program
US20140301990A1 (en) 2013-03-21 2014-10-09 Ospedale San Raffaele Srl Targeted disruption of t cell receptor genes using engineered zinc finger protein nucleases
US20150056705A1 (en) 2013-05-15 2015-02-26 Sangamo Biosciences, Inc. Methods and compositions for treatment of a genetic condition
US20160272999A1 (en) 2013-05-29 2016-09-22 Cellectis Methods for engineering t cells for immunotherapy by using rna-guided cas nuclease system
WO2014191128A1 (fr) 2013-05-29 2014-12-04 Cellectis Procédé de manipulation de cellules t pour l'immunothérapie au moyen d'un système de nucléase cas guidé par l'arn
US9108442B2 (en) 2013-08-20 2015-08-18 Ricoh Company, Ltd. Image forming apparatus
US20150098954A1 (en) 2013-10-08 2015-04-09 Elwha Llc Compositions and Methods Related to CRISPR Targeting
WO2015070083A1 (fr) 2013-11-07 2015-05-14 Editas Medicine,Inc. Méthodes et compositions associées à crispr avec arng de régulation
WO2015136001A1 (fr) 2014-03-11 2015-09-17 Cellectis Procédé d'obtention de lymphocytes t compatibles avec la transplantation allogénique
US20170016025A1 (en) 2014-03-11 2017-01-19 Cellectis Method for generating t-cells compatible for allogenic transplantation
WO2015161276A2 (fr) 2014-04-18 2015-10-22 Editas Medicine, Inc. Méthodes, compositions et constituants associés à crispr/cas pour l'immunothérapie du cancer
US20150335708A1 (en) 2014-05-08 2015-11-26 Sangamo Biosciences, Inc. Methods and compositions for treating huntington's disease
WO2015184228A1 (fr) 2014-05-29 2015-12-03 The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Récepteurs de lymphocytes t anti-papillomavirus humain 16 e7
US20160024474A1 (en) 2014-07-25 2016-01-28 Sangamo BioSciences,Inc. Methods and compositions for modulating nuclease-mediated genome engineering in hematopoietic stem cells
WO2016016341A1 (fr) 2014-07-29 2016-02-04 Cellectis Récepteurs d'antigènes chimériques spécifiques de l'egfrviii pour l'immunothérapie du cancer
US20160030477A1 (en) 2014-07-30 2016-02-04 Sangamo Biosciences, Inc. Gene correction of scid-related genes in hematopoietic stem and progenitor cells
WO2016069283A1 (fr) 2014-10-31 2016-05-06 The Trustees Of The University Of Pennsylvania Modification de l'expression génétique dans les cellules cart et utilisations associées
US20160208243A1 (en) 2015-06-18 2016-07-21 The Broad Institute, Inc. Novel crispr enzymes and systems
US20170016027A1 (en) 2015-07-13 2017-01-19 Sangamo Biosciences, Inc. Delivery methods and compositions for nuclease-mediated genome engineering
WO2017070429A1 (fr) 2015-10-22 2017-04-27 Regents Of The University Of Minnesota Procédés consistant à éditer des polynucléotides codant pour un récepteur de lymphocytes t
WO2017093969A1 (fr) 2015-12-04 2017-06-08 Novartis Ag Compositions et procédés d'immuno-oncologie
US20170211075A1 (en) 2015-12-18 2017-07-27 Sangamo Biosciences, Inc. Targeted disruption of the t cell receptor
WO2017193107A2 (fr) 2016-05-06 2017-11-09 Juno Therapeutics, Inc. Cellules génétiquement modifiées et leurs procédés de fabrication
WO2018067618A1 (fr) 2016-10-03 2018-04-12 Juno Therapeutics, Inc. Molécules se liant spécifiquement au vph
WO2018075541A1 (fr) * 2016-10-17 2018-04-26 Bluebird Bio, Inc. VARIANTS DE L'ENDONUCLÉASE TGFβR2, COMPOSITIONS ET PROCÉDÉS D'UTILISATION
WO2019070541A1 (fr) 2017-10-03 2019-04-11 Juno Therapeutics, Inc. Molécules de liaison spécifique à l'hpv
WO2019089884A2 (fr) 2017-11-01 2019-05-09 Editas Medicine, Inc. Procédés, compositions et composants pour l'édition crispr-cas9 de tgfbr2 dans des cellules t pour l'immunothérapie
WO2019195486A1 (fr) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. Récepteurs de lymphocytes t et cellules modifiées les exprimant
WO2019195491A1 (fr) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. Lymphocytes t exprimant un récepteur recombinant, polynucléotides et procédés associés
WO2019195492A1 (fr) 2018-04-05 2019-10-10 Juno Therapeutics, Inc. Procédés de production de cellules exprimant un récepteur recombinant et compositions associées
EP3854877A1 (fr) * 2018-09-17 2021-07-28 Institute Of Zoology, Chinese Academy Of Sciences Lymphocyte t modifié, son procédé de préparation et son utilisation
WO2020113029A2 (fr) * 2018-11-28 2020-06-04 Board Of Regents, The University Of Texas System Édition de génome multiplex de cellules immunitaires pour améliorer la fonctionnalité et la résistance à un environnement de suppression
WO2020223535A1 (fr) 2019-05-01 2020-11-05 Juno Therapeutics, Inc. Cellules exprimant un récepteur recombinant à base d'un locus modifié du tgfbr2, et polynucléotides et méthodes associés
WO2022109277A1 (fr) * 2020-11-20 2022-05-27 Pact Pharma, Inc. COMPOSITIONS ET MÉTHODES DE TRAITEMENT DU CANCER PAR UNE THÉRAPIE CELLULAIRE FAISANT APPEL À DES LYMPHOCYTES T À TGFβRII MODIFIÉ

Non-Patent Citations (76)

* Cited by examiner, † Cited by third party
Title
"Remington's Pharmaceutical Sciences", 1980
"Uniprot", Database accession no. P37173-2
ALONSO-CAMINO ET AL., MOL THER NUCL ACIDS, vol. 2, 2013, pages e93
BARRETT ET AL., CHIMERIC ANTIGEN RECEPTOR THERAPY FOR CANCER ANNUAL REVIEW OF MEDICINE, vol. 65, 2014, pages 333 - 347
BORIS-LAWRIETEMIN, CUR. OPIN. GENET. DEVELOP., vol. 3, 1993, pages 102 - 109
BRASH ET AL., MOL. CELL BIOL., vol. 7, 1987, pages 2031 - 2034
CAMERON ET AL., SCIENCE TRANSLATIONAL MEDICINE, vol. 5, no. 197, 2013, pages 197ral03
CARLENS ET AL., EXP HEMATOL, vol. 28, no. 10, 2000, pages 1137 - 46
CAVALIERI ET AL., BLOOD, vol. 102, no. 2, 2003, pages 1637 - 1644
CHALLITA ET AL., J. VIROL., vol. 69, no. 2, 1995, pages 748 - 755
CHANG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 84, 1987, pages 4959 - 4963
CHEADLE ET AL.: "Chimeric antigen receptors for T-cell based therapy", METHODS MOL BIOL, vol. 907, 2012, pages 645 - 66, XP009179541, DOI: 10.1007/978-1-61779-974-7_36
CHICAYBAM ET AL., PLOS ONE, vol. 8, no. 4, 2013, pages e61338
CHO ET AL., LAB CHIP, vol. 10, 2010, pages 1567 - 1573
CHOTHIA ET AL., EMBO J., vol. 7, 1988, pages 3745
CHRISTIAN ET AL., GENETICS, vol. 186, no. 2, 2010, pages 757 - 61
DE FELIPE ET AL., TRAFFIC, vol. 5, 2004, pages 616 - 626
DEVELOPMENTAL AND COMPARATIVE IMMUNOLOGY, vol. 27, no. 1, 2003, pages 55 - 77
FELIPE, GENETIC VACCINES AND THER, vol. 2, 2004, pages 13
FU Y ET AL., NAT BIOTECHNOL, 2014
GAJ ET AL., TRENDS IN BIOTECHNOLOGY, vol. 31, no. 7, 2013, pages 397 - 405
GORELIK ET AL., NAT. REV. IMMUNOL.
HERMAN ET AL., J. IMMUNOLOGICAL METHODS, vol. 285, no. 1, 2004, pages 25 - 40
HUMAN GENE THERAPY, vol. 1, 1990, pages 5 - 14
J BIOPHOTON, vol. 1, no. 5, 2008, pages 355 - 376
J. IMMUNOTHER., vol. 35, no. 9, 2012, pages 689 - 701
JANEWAY ET AL.: "Current Biology Publications", vol. 33, 1997, article "Immunobiology: The Immune System in Health and Disease", pages: 4
JOHNSTON, NATURE, vol. 346, 1990, pages 776 - 777
JORES ET AL., PROC. NAT'L ACAD. SCI. U.S.A., vol. 57, 1990, pages 9138
KIM ET AL., J. BIOL. CHEM., vol. 269, 1994, pages 978 - 982
KIM ET AL., PROC. NATL. ACAD. SCI. USA, vol. 91, 1994, pages 883 - 887
KLEBANOFF ET AL., J IMMUNOTHER, vol. 35, no. 9, 2012, pages 651 - 660
KOCHENDERFER ET AL., J. IMMUNOTHERAPY, vol. 32, no. 7, 2009, pages 689 - 702
KOLLMANNSPERGER ET AL., NAT COMM, vol. 7, 2016, pages 10372
KOSTE ET AL., GENE THERAPY, 3 April 2014 (2014-04-03)
KOTB, CLINICAL MICROBIOLOGY REVIEWS, vol. 8, 1995, pages 411 - 426
KUBALL ET AL., BLOOD, vol. 109, 2007, pages 2331 - 2338
LEE ET AL., NANO LETT, vol. 12, 2012, pages 6322 - 27
LEFRANC ET AL., DEV. COMP. IMMUNOL., vol. 27, 2003, pages 55
LEFRANCLEFRANC: "The T Cell Factsbook", 2001, ACADEMIC PRESS
LI ET AL., NUCLEIC ACIDS RES, vol. 39, no. 1, 2011, pages 359 - 72
LI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 4275 - 4279
LI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 8033 - 8037
LLOYD ET AL., FRONTIERS IN IMMUNOLOGY, vol. 4, no. 221, 2013, pages 1 - 7
LUPTON S. D. ET AL., MOL. AND CELL BIOL., vol. 11, 1991, pages 6
MANURI ET AL., HUM GENE THER, vol. 21, no. 4, 2010, pages 427 - 437
METASTASIS RESEARCH PROTOCOLS, vol. 2
METHODS IN MOLECULAR MEDICINE, vol. 58
MILLERROSMAN, BIOTECHNIQUES, vol. 7, 1989, pages 980 - 990
MOL. THER., vol. 24, no. 3, 2016, pages 570 - 581
MOSCOUBOGDANOVE, SCIENCE, vol. 326, no. 5959, 2009, pages 1501 - 12
MULLEN ET AL., PROC. NATL. ACAD. SCI. USA., vol. 89, 1992, pages 33
NEHLS ET AL., SCIENCE, vol. 272, 1996, pages 886 - 889
OH ET AL., J IMMUNOL., vol. 191, no. 8, 2013, pages 3973 - 3979
PARK ET AL., TRENDS BIOTECHNOL, no. 11, 29 November 2011 (2011-11-29), pages 550 - 557
PRINCIPE ET AL., CANCER RES., vol. 76, no. 9, 2016, pages 2525 - 2539
REMINGTON: "The Science and Practice of Pharmacy", 1 May 2005, LIPPINCOTT WILLIAMS & WILKINS
RIDDELL ET AL., HUMAN GENE THERAPY, vol. 3, 1992, pages 319 - 338
ROSENBERG, NAT REV CLIN ONCOL, vol. 8, no. 10, 2011, pages 577 - 85
SANDERJOUNG, NATURE BIOTECHNOLOGY, vol. 32, no. 4, 2014, pages 347 - 355
SANJANA ET AL., NAT. METHODS, vol. 11, 2014, pages 783 - 4
SCARPA ET AL., VIROLOGY, vol. 180, 1991, pages 849 - 852
SHARMA ET AL., MOLEC THER NUCL ACIDS, vol. 2, 2013, pages e74
SHENG ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 111, 2013, pages 652
STERNBERG SH ET AL., NATURE, vol. 507, no. 7491, 2014, pages 258 - 261
TERAKURA ET AL., BLOOD, vol. 119, 2012, pages 5697 - 5705
THEMELI ET AL., NAT BIOTECHNOL., vol. 31, no. 10, 2013, pages 928 - 933
TSUKAHARA ET AL., BIOCHEM BIOPHYS RES COMMUN, vol. 438, no. 1, 2013, pages 84 - 9
TURNER G ET AL: "TGF[beta]-armoring boosts potency and persistence of engineered TCR T cells, unlocking superior efficacy against HPV-positive solid tumors", JOURNAL FOR IMMUNOTHERAPY OF CANCER, vol. 9, no. Suppl. 2, 200, 10 November 2021 (2021-11-10), 36th Annual Meeting of the Society for Immunotherapy of Cancer; virtual; 11-14 November 2021, pages A211, XP093024967, DOI: 10.1136/jitc-2021-SITC2021.200 *
VAN TEDELOO ET AL., GENE THERAPY, vol. 7, no. 16, 2000, pages 1431 - 1437
VERHOEYEN ET AL., METHODS MOL BIOL, vol. 506, 2009, pages 115 - 126
WADWA ET AL., J. DRUG TARGETING, vol. 3, 1995, pages 1 1 1
WANG ET AL., SCIENCE, vol. 3, 2014, pages 343 - 80
WIGLER ET AL., CELL, vol. 11, 1977, pages 223
YANG ET AL., TRENDS IMMUNOL, vol. 31, no. 6, 2010, pages 220 - 227
ZHAO ET AL., J. IMMUNOL., vol. 174, 2005, pages 4415 - 4423

Similar Documents

Publication Publication Date Title
US11952408B2 (en) HPV-specific binding molecules
US20210017249A1 (en) Methods of producing cells expressing a recombinant receptor and related compositions
AU2016271147B2 (en) Composition and methods for regulating inhibitory interactions in genetically engineered cells
US20210015869A1 (en) T cells expressing a recombinant receptor, related polynucleotides and methods
KR20180133496A (ko) 유전자이식 t 세포 및 키메라 항원 수용체 t 세포 조성물 및 관련 방법
CA3136737A1 (fr) Cellules exprimant un recepteur recombinant a base d'un locus modifie du tgfbr2, et polynucleotides et methodes associes
US20210214415A1 (en) Immunoresponsive cells expressing dominant negative fas and uses thereof
CN116234558A (zh) 条件性地表达重组受体的工程化t细胞、相关多核苷酸和方法
JP2022531577A (ja) 改変されたｃｄ２４７遺伝子座からキメラ受容体を発現する細胞、関連ポリヌクレオチド、および方法
US20230398148A1 (en) Cells expressing a chimeric receptor from a modified invariant cd3 immunoglobulin superfamily chain locus and related polynucleotides and methods
WO2023081900A1 (fr) Lymphocytes t modifiés exprimant un récepteur recombiné de lymphocytes t (tcr) et systèmes et procédés apparentés

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22835183

Country of ref document: EP

Kind code of ref document: A1