WO2023081855A1 - Base editing enzymes - Google Patents

Base editing enzymes Download PDF

Info

Publication number
WO2023081855A1
WO2023081855A1 PCT/US2022/079345 US2022079345W WO2023081855A1 WO 2023081855 A1 WO2023081855 A1 WO 2023081855A1 US 2022079345 W US2022079345 W US 2022079345W WO 2023081855 A1 WO2023081855 A1 WO 2023081855A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
sequence
polypeptide
endonuclease
nos
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2022/079345
Other languages
English (en)
French (fr)
Inventor
Brian C. Thomas
Jyun-Liang LIN
Alan Brooks
Cristina Butterfield
Christopher Brown
Cindy CASTELLE
Morayma TEMOCHE-DIAZ
Benjamin Freeman
Christine ROMANO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Metagenomi Therapeutics Inc
Original Assignee
Metagenomi Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Metagenomi Inc filed Critical Metagenomi Inc
Priority to CA3234217A priority Critical patent/CA3234217A1/en
Priority to MX2024005505A priority patent/MX2024005505A/es
Priority to KR1020247015992A priority patent/KR20240099283A/ko
Priority to JP2024519975A priority patent/JP2024541811A/ja
Priority to EP22891120.2A priority patent/EP4426826A4/en
Priority to AU2022380842A priority patent/AU2022380842A1/en
Priority to CN202280074006.6A priority patent/CN118202044A/zh
Publication of WO2023081855A1 publication Critical patent/WO2023081855A1/en
Priority to US18/653,454 priority patent/US12503710B2/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/87Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
    • C12N15/90Stable introduction of foreign DNA into chromosome
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/78Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y305/00Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y305/00Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04001Cytosine deaminase (3.5.4.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y305/00Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04002Adenine deaminase (3.5.4.2)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y305/00Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04004Adenosine deaminase (3.5.4.4)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y305/00Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5)
    • C12Y305/04Hydrolases acting on carbon-nitrogen bonds, other than peptide bonds (3.5) in cyclic amidines (3.5.4)
    • C12Y305/04005Cytidine deaminase (3.5.4.5)
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide
    • C07K2319/80Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/31Chemical structure of the backbone
    • C12N2310/315Phosphorothioates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/34Spatial arrangement of the modifications
    • C12N2310/344Position-specific modifications, e.g. on every purine, at the 3'-end

Definitions

  • Cas enzymes along with their associated Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) guide ribonucleic acids (RNAs) appear to be a pervasive ( ⁇ 45% of bacteria, ⁇ 84% of archaea) component of prokaryotic immune systems, serving to protect such microorganisms against non-self nucleic acids, such as infectious viruses and plasmids by CRISPR-RNA guided nucleic acid cleavage. While the deoxyribonucleic acid (DNA) elements encoding CRISPR RNA elements may be relatively conserved in structure and length, their CRISPR-associated (Cas) proteins are highly diverse, containing a wide variety of nucleic acid- interacting domains.
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • the present disclosure provides for a method of deaminating a cytosine residue in a eukaryotic nucleic acid sequence in a cell, comprising: contacting to said eukaryotic nucleic acid sequence a polypeptide with cytosine deaminase activity comprising a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof.
  • said eukaryotic nucleic acid sequence is a mammalian, primate, or human nucleic acid sequence.
  • said cell is a mammalian, primate, or human cell.
  • said eukaryotic nucleic acid sequence comprises single-stranded DNA (ssDNA) or ribonucleic acid (RNA).
  • said polypeptide with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, 668-671, 675, 650, 752, 774, 777, 806, 812, 816, 817, 818, 825, 827, 832, 970-982, or a variant thereof.
  • said polypeptide with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 808, 810-811, 819, 826, 752, 777, or 823, or a variant thereof.
  • said eukaryotic nucleic acid sequence comprises double-stranded DNA (dsDNA).
  • said polypeptide with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 810-811.
  • said polypeptide with cytosine deaminase activity further comprises a nucleic acid binding domain, an endonuclease, or a nickase.
  • said polypeptide with cytosine deaminase activity further comprises said endonuclease or said nickase, wherein said endonuclease or said nickase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597, 1120, 1122-1127, 1647, or a variant thereof.
  • said polypeptide with cytosine deaminase activity further comprises a nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof.
  • said polypeptide with cytosine deaminase activity further comprises a uracil DNA glycosylase inhibitor sequence.
  • said uracil DNA glycosylase inhibitor comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof.
  • said polypeptide with cytosine deaminase activity further comprises a FAM72A sequence.
  • said FAM72A sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1121, or a variant thereof.
  • the present disclosure provides for a method of deaminating a cytosine residue in a primate nucleic acid sequence in a cell, comprising: contacting to a primate nucleic acid sequence a polypeptide with cytosine deaminase activity comprising a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 599-638, 660-675, 828-835, or a variant thereof.
  • said eukaryotic nucleic acid sequence comprises double-stranded DNA (dsDNA), single-stranded DNA (ssDNA) or ribonucleic acid (RNA).
  • said polypeptide with cytosine deaminase activity further comprises a nucleic acid binding domain, an endonuclease, or a nickase.
  • said polypeptide with cytosine deaminase activity further comprises said endonuclease or said nickase, wherein said endonuclease or said nickase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597, 1120, 1122-1127, 1647, or a variant thereof.
  • said polypeptide with cytosine deaminase activity further comprises a nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof.
  • said polypeptide with cytosine deaminase activity further comprises a uracil DNA glycosylase inhibitor sequence.
  • said uracil DNA glycosylase inhibitor comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof.
  • said polypeptide with cytosine deaminase activity further comprises a FAM72A sequence.
  • said FAM72A sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1121, or a variant thereof.
  • the present disclosure provides for a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in a mammalian organism, wherein said nucleic acid encodes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof.
  • said nucleic acid encodes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, 668- 671, 675, 650, 752, 774, 777, 806, 812, 816, 817, 818, 825, 827, 832, 832, 970-982, or a variant thereof [0007]
  • the present disclosure provides for a nucleic acid encoding any of the polypeptides described herein.
  • the present disclosure provides for a vector comprising any of the nucleic acids described herein.
  • the present disclosure provides for a fusion polypeptide comprising: (a) a domain with cytosine deaminase activity comprising a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof; and (b) a nucleic acid binding domain, an endonuclease domain, or a nickase domain.
  • said domain with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, 668-671, 675, 650, 752, 774, 777, 806, 812, 816, 817, 818, 825, 827, 832, 832, 970-982, or a variant thereof.
  • said domain with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, or a variant thereof.
  • said fusion polypeptide comprises said endonuclease domain or said nickase domain, wherein said endonuclease domain or said nickase domain comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof.
  • said fusion protein comprises said nickase domain, wherein said nickase domain comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof.
  • said fusion protein comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 877-916 or 968-969, or a variant thereof.
  • the present disclosure comprising: (a) any of the fusion proteins (e.g.
  • an engineered guide polynucleotide configured to form a complex with said endonuclease domain comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to said endonuclease domain.
  • said engineered guide polynucleotide further comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 917-931, 963-967, 1099-1105, or a variant thereof.
  • the present disclosure provides for a polypeptide with adenosine deaminase activity comprising: a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 50, 51, 385-443, 448-475, or a variant thereof, wherein said polypeptide comprises a substitution at least one of residues T2, D7, E10, M13, W24, G32, K38, G45, G51, A63, E66, R75, C91, G93, H97, A107, E108, D109, P110, H124, A126, H129, F150, or
  • said substitution comprises T2X 1 , D7X 1 , E10X 1 , M13X 4 , W24X 1 , G32X 1 , K38X 2 , G45X 2 , G51X 5 , A63X 7 , E66X 5 , E66X 2 , R75H, C91R, G93X 6 , H97X 6 , H97X 5 , A107X 5 , E108X 2 , D109N, P110H, H124X 6 , A126X 2 , H129R, H129N, F150P, F150S, S165X5, or any combination thereof relative to SEQ ID NO: 50 or MG68-4 when optimally aligned, wherein X 1 is A or G; X 2 is D or E; X 3 is N or Q; X 4 is R or K; X 5 is I, L, M, or V; X 6 is F, Y, or W; and X 7 is S or T.
  • said polypeptide comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 836-860, or a variant thereof.
  • said polypeptide comprises any one of SEQ ID NOs: 839, 841, 843, 844, 847, 848, 849, 850, 851, 852, 859, or a variant thereof.
  • said substitution comprises W24G, G51V, E108D, P110H, F150P, D7G, E10G, or H129N, or any combination thereof, relative to SEQ ID NO: 50 or MG68-4 when optimally aligned.
  • said polypeptide further comprises a nucleic acid binding domain, an endonuclease domain, or a nickase domain.
  • said polypeptide comprises said endonuclease domain or said nickase domain, wherein said endonuclease domain or said nickase domain comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof.
  • said polypeptide comprises said nickase domain, wherein said nickase domain comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof.
  • the present disclosure provides for a system comprising:(a) any of the polypeptides or fusion polypeptides described herein; and (b) an engineered guide polynucleotide configured to form a complex with said endonuclease domain comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to said endonuclease domain.
  • said engineered guide polynucleotide further comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 917-931, 963-967, 1099-1105, or a variant thereof; [0013]
  • the present disclosure provides for a method of deaminating a cytosine residue in a cell, comprising introducing to said cell: (a) a vector encoding a polypeptide with cytosine deaminase activity; and (b) a vector encoding a FAM72A
  • said vector encoding said FAM72A protein comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1115, or a variant thereof, or encodes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1121, or
  • said polypeptide with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970- 982, or a variant thereof.
  • said polypeptide with cytosine deaminase activity further comprises a nucleic acid binding domain, an endonuclease domain, or a nickase domain.
  • said polypeptide with cytosine deaminase activity comprises said endonuclease domain or said nickase domain, wherein said endonuclease domain or said nickase domain comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof
  • said polypeptide with cytosine deaminase activity comprises said nickase domain, wherein said nickase domain comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof.
  • the present disclosure provides for an engineered nucleic acid editing polypeptide, comprising (i) a sequence with cytosine deaminase activity; and (ii) a sequence derived from a FAM72A protein.
  • said sequence with cytosine deaminase activity has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof.
  • said sequence derived from said FAM72A protein has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1121, or a variant thereof.
  • the polypeptide further comprises an endonuclease sequence comprising a RuvC domain and an HNH domain, wherein said endonuclease sequence is a sequence of a class 2, type II endonuclease.
  • said RuvC domain lacks nuclease activity.
  • said endonuclease comprises a nickase.
  • said class 2, type II endonuclease sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof.
  • said class 2, type II endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597 when optimally aligned.
  • the present disclosure provides for a method of editing a cytosine residue to a thymine residue in a cell, comprising contacting to said cell any of the cytosine deaminase fusion polypeptides described herein.
  • said cell is a prokaryotic, eukaryotic, mammalian, primate, or human cell.
  • an engineered nucleic acid editing polypeptide comprising: a plurality of domains derived from a Class 2, Type II endonuclease, wherein said domains comprise RUVC-I, REC, HNH, RUVC-III, and WED domains; and a domain comprising a base editor sequence, wherein said base editor sequence is inserted:(a) within said RUVC-I domain; (b) within said REC domain; (c) within said HNH domain; (d) within said RUV-CIII domain; (e) within said WED domain; (f) prior to said HNH domain; (g) prior to said RUV-CIII domain; or (h) between said RUVC-III and said WED domain.
  • said Class 2, Type II endonuclease comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof.
  • said Class 2, Type II endonuclease comprises a sequence having at least 80% sequence identity to SEQ ID NO: 1647, or a variant thereof.
  • said base editor sequence comprises a deaminase sequence.
  • said deaminase sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, 50, 51, 385-443, 448-475, or a variant thereof.
  • said deaminase sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof.
  • said deaminase sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 50, 51, 385-443, 448-475, or a variant thereof.
  • said deaminase has at least 80% sequence identity to SEQ ID NO: 386, or a variant thereof.
  • said deaminase sequence comprises a substitution of one of residues T2, D7, E10, M13, W24, G32, K38, G45, G51, A63, E66, R75, C91, G93, H97, A107, E108, D109, P110, H124, A126, H129, F150, or S165, or any combination thereof relative to SEQ ID NO: 50 or MG68-4 when optimally aligned.
  • said engineered nucleic acid editing polypeptide comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1128-1160, or a variant thereof.
  • said engineered nucleic acid editing polypeptide comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1137, 1140, 1142, 1143, 1146, 1149, 1151-1158, or a variant thereof.
  • said engineered nucleic acid editing polypeptide comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1139,1152,1158, or a variant thereof.
  • polypeptide with adenosine deaminase activity comprising: a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 50, 51, 385-443, 448-475, or a variant thereof, wherein said polypeptide comprises a substitution of a wild-type residue for a non-wild-type residue at residue 109 and one other residue comprising any one of 24, 37, 49, 52, 83, 85, 107, 110, 112, 120, 123, 124, 147, 148, 150, 156, 157, 158, 166,
  • said sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 386.
  • the polypeptide comprises a substitution of 109N and at least one other substitution comprising any one of 24R, 37L, 49A, 52L, 83S, 85F, 107V, 110S, 112R, 120N, 123N, 124Y, 147C, 148Y, 148R, 150Y, 156V, 157F, 158N, 166I, or 129N, or any combination thereof relative to SEQ ID NO: 386 when optimally aligned.
  • the peptide comprises any of the substitutions depicted in FIG.34B.
  • said polypeptide has at least 80% sequence identity to any one of SEQ ID NOs: 1161-1183, or a variant thereof.
  • said polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1170, 1179, or 1166, or a variant thereof.
  • said polypeptide further comprises an endonuclease or a nickase.
  • said polypeptide comprises said endonuclease or said nickase, wherein said endonuclease or said nickase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof.
  • said polypeptide comprises said nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof [0018]
  • the present disclosure provides for a polypeptide with cytosine deaminase activity comprising: a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%
  • said polypeptide has at least one substitution of a wild-type amino acid for a non-wild-type amino acid comprising any one of W90A, W90F, W90H, W90Y, Y120F, Y120H, Y121F, Y121H, Y121Q, Y121A, Y121D, Y121W, H122Y, H122F, H122I, H122A, H122W, H122D, Y121T, R33A, R34A, R34K, H122A, R33A, R34A, R52A, N57G, H122A, E123A, E123Q, W127F, W127H, W127Q, W127A, W127D, R39A, K40A, H128A, N63G, R58A, H121F, H121Y, H121Q, H121A, H121D, H121W, R33A, K34A, H122A, H121A, R52A, P26R,
  • the polypeptide comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1208-1315, or a variant thereof [0019]
  • the present disclosure provides for a polypeptide with cytosine deaminase activity comprising: a cytosine deaminase sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%
  • said endonuclease or said nickase comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, or 1122-1127, 1647, or a variant thereof.
  • said polypeptide comprises said nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof.
  • said cytosine deaminase sequence has at least 80% sequence identity to any one of SEQ ID NOs: 1275, 835, or 774, or a combination thereof.
  • the present disclosure provides for a polypeptide with adenosine deaminase activity comprising: a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 50, 51, 385-443, 448-475, 1015-1098, or a variant thereof, wherein said polypeptide comprises any of the combinations of substitutions of a wild-type residue for a non-wild-type residue
  • said polypeptide has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1556- 1638, or a variant thereof.
  • said polypeptide further comprises an endonuclease or a nickase.
  • said polypeptide comprises said endonuclease or said nickase, wherein said endonuclease or said nickase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, or 1122-1127, 1647, or a variant thereof.
  • said polypeptide comprises said nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof [0021]
  • the present disclosure provides for a polypeptide with adenosine deaminase activity comprising: a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least
  • said sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 386, or a variant thereof.
  • said polypeptide further comprises an endonuclease or a nickase.
  • said polypeptide comprises said endonuclease or said nickase, wherein said endonuclease or said nickase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, or 1122-1127, 1647, or a variant thereof.
  • said polypeptide comprises said nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof.
  • the present disclosure provides for a method of editing an APOA1 locus in a cell, comprising contacting to said cell (a) an RNA-guided endonuclease; and (b) an engineered guide nucleic acid structure, wherein said engineered guide nucleic acid structure is configured to form a complex with said endonuclease and said engineered guide nucleic acid structure comprises a spacer sequence configured to hybridize to a region of said APOA1 locus, wherein said engineered guide nucleic acid structure comprises a targeting sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to at least 18, 19, 20, 21, 22, 23,
  • said engineered guide nucleic acid structure has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1431-1454.
  • said engineered guide nucleic acid structure comprises any of the nucleotide modifications recited in Table 13A.
  • said RNA-guided endonuclease is a class 2, type II endonuclease. In some embodiments, said RNA-guided endonuclease has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof.
  • the present disclosure provides for a method of editing an ANGPTL3 locus in a cell, comprising contacting to said cell (a) an RNA-guided endonuclease; and (b) an engineered guide nucleic acid structure, wherein said engineered guide nucleic acid structure is configured to form a complex with said endonuclease and said engineered guide nucleic acid structure comprises a spacer sequence configured to hybridize to a region of said ANGPTL3 locus, wherein said engineered guide nucleic acid structure comprises a targeting sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to at least 18, 19, 20, 21,
  • said engineered guide nucleic acid structure has at least 80% identity to any one of SEQ ID NOs: 1479-1483. In some embodiments, said engineered guide nucleic acid structure comprises any of the nucleotide modifications recited in Table 13A. In some embodiments, said RNA-guided endonuclease is a class 2, type II endonuclease.
  • said RNA-guided endonuclease has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof.
  • the present disclosure provides for a method of editing a TRAC locus in a cell, comprising contacting to said cell (a) an RNA-guided endonuclease; and (b) an engineered guide nucleic acid structure, wherein said engineered guide nucleic acid structure is configured to form a complex with said endonuclease and said engineered guide nucleic acid structure comprises a spacer sequence configured to hybridize to a region of said TRAC locus, wherein said engineered guide nucleic acid structure comprises a targeting sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to at least 18, 19, 20, 21, 22, 23, 24, 25, or
  • said engineered guide nucleic acid structure has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1489-1490.
  • aid engineered guide nucleic acid structure comprises any of the nucleotide modifications recited in Table 13A.
  • said RNA-guided endonuclease is a class 2, type II endonuclease. In some embodiments, said RNA-guided endonuclease has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, 1122-1127, 1647, or a variant thereof.
  • the present disclosure provides for an engineered adenosine base editor polypeptide, wherein said polypeptide comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1647-1653.
  • the present disclosure provides for a method of deaminating a cytosine residue in a eukaryotic nucleic acid sequence in a cell, comprising: contacting to said eukaryotic nucleic acid sequence a polypeptide with cytosine deaminase activity comprising a sequence having at least at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof.
  • said eukaryotic nucleic acid sequence is a mammalian, primate, or human nucleic acid sequence.
  • said cell is a mammalian, primate, or human cell.
  • said eukaryotic nucleic acid sequence comprises single-stranded DNA (ssDNA) or ribonucleic acid (RNA).
  • said polypeptide with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, 668-671, 675, 650, 752, 774, 777, 806, 812, 816, 817, 818, 825, 827, 832, 970-982, or a variant thereof.
  • said polypeptide with cytosine deaminase activity comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 808, 810-811, 819, 826, 752, 777, or 823, or a variant thereof.
  • said eukaryotic nucleic acid sequence comprises double-stranded DNA (dsDNA).
  • said polypeptide with cytosine deaminase activity comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 810-811.
  • said polypeptide with cytosine deaminase activity further comprises a nucleic acid binding domain, an endonuclease, or a nickase.
  • said polypeptide with cytosine deaminase activity further comprises said endonuclease or said nickase, wherein said endonuclease or said nickase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597, 1120, or 1122-1127, or a variant thereof.
  • said polypeptide with cytosine deaminase activity further comprises a nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof.
  • said polypeptide with cytosine deaminase activity further comprises a uracil DNA glycosylase inhibitor sequence.
  • said uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof.
  • said polypeptide with cytosine deaminase activity further comprises a FAM72A sequence.
  • said FAM72A sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1121, or a variant thereof.
  • the present disclosure provides for a method of deaminating a cytosine residue in a primate nucleic acid sequence in a cell, comprising: contacting to said primate nucleic acid sequence a polypeptide with cytosine deaminase activity comprising a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 599-638, 660-675, or 828-835, or a variant thereof.
  • said eukaryotic nucleic acid sequence comprises double-stranded DNA (dsDNA), single-stranded DNA (ssDNA) or ribonucleic acid (RNA).
  • said polypeptide with cytosine deaminase activity further comprises a nucleic acid binding domain, an endonuclease, or a nickase.
  • said polypeptide with cytosine deaminase activity further comprises said endonuclease or said nickase, wherein said endonuclease or said nickase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity identity to any one of SEQ ID NOs: 70-78, 596, 597, 1120, or 1122-1127, or a variant thereof.
  • said polypeptide with cytosine deaminase activity further comprises a nickase, wherein said nickase comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof.
  • said polypeptide with cytosine deaminase activity further comprises a uracil DNA glycosylase inhibitor sequence.
  • said uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof.
  • said polypeptide with cytosine deaminase activity further comprises a FAM72A sequence.
  • said FAM72A sequence has at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to SEQ ID NO: 1121, or a variant thereof.
  • the present disclosure provides for a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in a mammalian organism, wherein said nucleic acid encodes a sequence having at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identityto any one of SEQ ID NOs: 1- 49, 444-447, 599-675, 744-835, 970-982, or a variant thereof.
  • said nucleic acid encodes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, 668-671, 675, 650, 752, 774, 777, 806, 812, 816, 817, 818, 825, 827, 832, 832, 970-982, or a variant thereof.
  • the present disclosure provides for a vector comprising any of the nucleic acids described herein.
  • the vector is a non-viral or a viral vector.
  • the vector is a plasmid, minicircle, or plasmid vector.
  • the viral vector is an AAV vector.
  • the present disclosure provides for a fusion polypeptide comprising: (a) a domain with cytosine deaminase activity comprising a sequence having at least 80% identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof; and (b) a nucleic acid binding domain, an endonuclease domain, or a nickase domain.
  • said domain with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, 668-671, 675, 650, 752, 774, 777, 806, 812, 816, 817, 818, 825, 827, 832, 832, 970-982, or a variant thereof.
  • said domain with cytosine deaminase activity comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 809-811, 819, 826, 752, 777, 823, or a variant thereof.
  • said fusion polypeptide comprises said endonuclease domain or said nickase domain, wherein said endonuclease domain or said nickase domain comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, or 1122-1127, or a variant thereof.
  • said fusion protein comprises said nickase domain, wherein said nickase domain comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof.
  • said fusion protein comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 877-916 or 968-969, or a variant thereof.
  • the present disclosure provides for a system comprising: (a) any of the the fusion polypeptides described herein; and (b) an engineered guide polynucleotide configured to form a complex with said endonuclease domain comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to said endonuclease domain.
  • said engineered guide polynucleotide further comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 917-931, 963-967, or 1099-1105, or a variant thereof.
  • the present disclosure provides for a polypeptide with adenosine deaminase activity comprising: a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 50, 51, 385-443, 448-475, or a variant thereof, wherein said polypeptide comprises a substitution at least one of residues T2, D7, E10, M13, W24, G32, K38, G45, G51, A63, E66, R75, C91, G93, H97, A107, E108, D109, P110, H124, A126, H129, F150, or
  • said substitution comprises T2X 1 , D7X 1 , E10X 1 , M13X 4 , W24X 1 , G32X 1 , K38X 2 , G45X 2 , G51X 5 , A63X 7 , E66X 5 , E66X 2 , R75H, C91R, G93X6, H97X6, H97X5, A107X5, E108X2, D109N, P110H, H124X6, A126X2, H129R, H129N, F150P, F150S, S165X5, or any combination thereof relative to SEQ ID NO: 50 when optimally aligned, wherein X 1 is A or G; X 2 is D or E; X 3 is N or Q; X 4 is R or K; X 5 is I, L, M, or V; X6 is F, Y, or W; and X7 is S or T.
  • said polypeptide comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity any one of SEQ ID NOs.836-860, or a variant thereof.
  • said polypeptide comprises any one of SEQ ID NOs: 839, 841, 843, 844, 847, 848, 849, 850, 851, 852, or 859.
  • said substitution comprises W24G, G51V, E108D, P110H, F150P, D7G, E10G, or H129N, or any combination thereof, relative to SEQ ID NO: 50 when optimally aligned.
  • said polypeptide further comprises a nucleic acid binding domain, an endonuclease domain, or a nickase domain.
  • said polypeptide comprises said endonuclease domain or said nickase domain, wherein said endonuclease domain or said nickase domain comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, or 1122-1127, or a variant thereof.
  • said polypeptide comprises said nickase domain, wherein said nickase domain comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof.
  • the present disclosure provides for a system comprising: (a) any of the polypeptides for base editor fusions described herein (e.g.
  • an engineered guide polynucleotide configured to form a complex with said endonuclease domain comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to said endonuclease domain.
  • said engineered guide polynucleotide further comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 917-931, 963-967, or 1099-1105.
  • the present disclosure provides for a method of deaminating a cytosine residue in a cell, comprising introducing to said cell: (a) a vector encoding a polypeptide with cytosine deaminase activity; and (b) a vector encoding a FAM72A protein.
  • said vector encoding said FAM72A protein comprises a sequence having at least 80% identity to SEQ ID NO: 1115, or encodes a sequence having at least 80% identity to SEQ ID NO: 1121.
  • said polypeptide with cytosine deaminase activity comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 1-49, 444-447, 599-675, 744-835, 970-982, or a variant thereof.
  • said polypeptide with cytosine deaminase activity further comprises a nucleic acid binding domain, an endonuclease domain, or a nickase domain.
  • said polypeptide with cytosine deaminase activity comprises said endonuclease domain or said nickase domain, wherein said endonuclease domain or said nickase domain comprises a sequence having at least 80% identity to any one of SEQ ID NOs: 70-78, 596, 597-598, 1120, or 1122-1127, or a variant thereof.
  • said polypeptide with cytosine deaminase activity comprises said nickase domain, wherein said nickase domain comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597, or any combination thereof.
  • an engineered nucleic acid editing system comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein said endonuclease is derived from an uncultivated microorganism, wherein said endonuclease is a class 2, type II endonuclease, wherein said endonuclease is configured to be deficient in nuclease activity; a base editor coupled to said endonuclease; and an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a ribonucleic acid sequence configured to bind to said endonuclease.
  • said RuvC domain lacks nuclease activity.
  • said class 2, type II endonuclease comprises a nickase mutation.
  • said class 2, type II endonuclease comprises the aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597 when optimally aligned.
  • said endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NO: 72, or residue 17 relative to SEQ ID NO: 75 when optimally aligned.
  • said endonuclease comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof.
  • an engineered nucleic acid editing system comprising: an endonuclease having at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof; a base editor coupled to said endonuclease; and an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a ribonucleic acid sequence configured to bind to said endonuclease.
  • an engineered nucleic acid editing system comprising: an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 360-368 or 598, or a variant thereof, wherein said endonuclease is a class 2, type II endonuclease, and wherein said endonuclease is configured to be deficient in nuclease activity; a base editor coupled to said endonuclease; and an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a ribonucleic acid sequence configured to bind to said endonuclease.
  • PAM protospacer adjacent motif
  • said endonuclease comprises a nickase mutation. In some embodiments, said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid. In some embodiments, said class 2, type II endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597 when optimally aligned.
  • said base editor comprises a sequence having at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof. In some embodiments, said base editor comprises a sequence having at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51 or 385-390. In some embodiments, said RuvC domain lacks nuclease activity. In some embodiments, said endonuclease is derived from an uncultivated microorganism. In some embodiments, said endonuclease has less than 80% identity to a Cas9 endonuclease.
  • said endonuclease further comprises an HNH domain.
  • said engineered guide ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof.
  • an engineered nucleic acid editing system comprising, an engineered guide ribonucleic acid structure comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a ribonucleic acid sequence configured to bind to an endonuclease, wherein said engineered ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof; a class 2, type II endonuclease configured to bind to said engineered guide ribonucleic acid; and a base editor coupled to said endonuclease.
  • said base editor comprises a sequence having at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51 or 385-390.
  • said endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence selected from the group consisting of SEQ ID NOs: 360-368 or 598.
  • PAM protospacer adjacent motif
  • said base editor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof.
  • said base editor is an adenine deaminase.
  • said adenosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51, 57, 385-443, 448-475, or 595, or a variant thereof.
  • said base editor is a cytosine deaminase.
  • said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-49, 444-447, 594, or 58- 66, or a variant thereof.
  • the system further comprises a uracil DNA glycosylase inhibitor coupled to said endonuclease or said base editor.
  • said uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67.
  • said engineered guide ribonucleic acid structure comprises at least two ribonucleic acid polynucleotides.
  • said engineered guide ribonucleic acid structure comprises one ribonucleic acid polynucleotide comprising said guide ribonucleic acid sequence and said tracr ribonucleic acid sequence.
  • said guide ribonucleic acid sequence is complementary to a prokaryotic, bacterial, archaeal, eukaryotic, fungal, plant, mammalian, or human genomic sequence. In some embodiments, said guide ribonucleic acid sequence is 15-24 nucleotides in length.
  • said endonuclease comprises one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease. In some embodiments, said NLS comprises a sequence with at least 90% identity to a selected from SEQ ID NOs: 369-384, or a variant thereof.
  • said endonuclease is covalently coupled directly to said base editor or covalently coupled to said base editor through a linker.
  • said endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73 or 78, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, residue 8 relative to SEQ ID NO: 77, or residue 10 relative to SEQ ID NO: 597 when optimally aligned.
  • said endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NO: 72, or residue 17 relative to SEQ ID NO: 75 when optimally aligned.
  • a polypeptide comprises said endonuclease and said base editor.
  • said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid.
  • said system further comprises a source of Mg 2+ .
  • said endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to any one of SEQ ID NOs: 70, 71, 73, 74, 76, 78, 77, or 78, or a variant thereof;
  • said guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to non-degenerate nucleotides of any one of SEQ ID NOs: 88, 89, 91, 92, 94, 96, 95, or 488;
  • said endonuclease is configured to bind to a PAM comprising any one of SEQ ID NOs: 360, 361, 363, 365, 367, or 368; or
  • said base editor comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NOs: 58 or 595, or a variant thereof.
  • said endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to any one of SEQ ID NOs: 70, 71, or 78, or a variant thereof;
  • said guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to non- degenerate nucleotides of at least one of SEQ ID NOs: 88, 89, or 96;
  • said endonuclease is configured to bind to a PAM comprising any one of SEQ ID NOs: 360, 362, or 368; or
  • said base editor comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 594, or a variant thereof.
  • said sequence identity is determined by a BLASTP, CLUSTALW, MUSCLE, MAFFT, or Smith-Waterman homology search algorithm. In some embodiments, said sequence identity is determined by said BLASTP homology search algorithm using parameters of a wordlength (W) of 3, an expectation (E) of 10, and a BLOSUM62 scoring matrix setting gap costs at existence of 11, extension of 1, and using a conditional compositional score matrix adjustment.
  • said endonuclease is configured to be catalytically dead. In some embodiments, said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid.
  • the present disclosure provides for a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein said nucleic acid encodes a class 2, type II endonuclease coupled to a base editor, and wherein said endonuclease is derived from an uncultivated microorganism.
  • the present disclosure provides for a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein said nucleic acid encodes an endonuclease having at least 70% sequence identity to any one of SEQ ID NOs: 70-78 coupled to a base editor.
  • said endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease.
  • NLS nuclear localization sequences
  • said NLS comprises a sequence with at least 90% identity to a selected from SEQ ID NOs: 369-384, or a variant thereof.
  • said organism is prokaryotic, bacterial, eukaryotic, fungal, plant, mammalian, rodent, or human.
  • the present disclosure provides for a vector comprising a nucleic acid sequence encoding a class 2, type II endonuclease coupled to a base editor, wherein said endonuclease is derived from an uncultivated microorganism.
  • the present disclosure provides for a vector comprising the nucleic acid of any of the aspects or embodiments described herein.
  • the vector further comprises a nucleic acid encoding an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a ribonucleic acid sequence configured to binding to said endonuclease.
  • the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus.
  • AAV adeno-associated virus
  • the present disclosure provides for a method of manufacturing an endonuclease, comprising cultivating the cell of any of the aspects or embodiments described herein.
  • the present disclosure provides for a method for modifying a double- stranded deoxyribonucleic acid polynucleotide comprising contacting said double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein said endonuclease is derived from an uncultivated microorganism, wherein said endonuclease is a class 2, type II endonuclease, and wherein the endonuclease is configured to be deficient in nuclease activity; a base editor coupled to said endonuclease; and an engineered guide ribonucleic acid structure configured to bind to said endonuclease and
  • said endonuclease comprising a RuvC domain and an HNH domain is covalently coupled directly to said base editor or covalently coupled to said base editor through a linker.
  • said endonuclease comprising a RuvC domain and an HNH domain comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof.
  • the present disclosure provides for a method for modifying a double- stranded deoxyribonucleic acid polynucleotide, comprising contacting said double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: a class 2, type II endonuclease, a base editor coupled to said endonuclease, and an engineered guide ribonucleic acid structure configured to bind to said endonuclease and said double-stranded deoxyribonucleic acid polynucleotide; wherein said double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM); and wherein said PAM comprises a sequence selected from the group consisting of SEQ ID NOs: 70-78 or 597.
  • PAM protospacer adjacent motif
  • said class 2, type II endonuclease is covalently coupled to said base editor or coupled to said base editor through a linker.
  • said base editor comprises a sequence with at least 70%, at least 80%, at least 90% or at least 95% identity to a sequence selected from SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof.
  • said base editor comprises an adenine deaminase; said double-stranded deoxyribonucleic acid polynucleotide comprises an adenine; and modifying said double-stranded deoxyribonucleic acid polypeptide comprises converting said adenine to guanine.
  • said adenine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 50-51, 57, 385-443, 448-475, or 595, or a variant thereof.
  • said base editor comprises a cytosine deaminase; said double-stranded deoxyribonucleic acid polynucleotide comprises a cytosine; and modifying said double-stranded deoxyribonucleic acid polypeptide comprises converting said cytosine to uracil.
  • said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 594, or 58-66, or a variant thereof.
  • said complex further comprises a uracil DNA glycosylase inhibitor coupled to said endonuclease or said base editor.
  • said uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof.
  • said double-stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of said engineered guide ribonucleic acid structure and a second strand comprising said PAM.
  • said PAM is directly adjacent to the 3' end of said sequence complementary to said sequence of said engineered guide ribonucleic acid structure.
  • said class 2, type II endonuclease is not a Cas9 endonuclease, a Cas14 endonuclease, a Cas12a endonuclease, a Cas12b endonuclease, a Cas 12c endonuclease, a Cas12d endonuclease, a Cas12e endonuclease, a Cas13a endonuclease, a Cas13b endonuclease, a Cas13c endonuclease, or a Cas 13d endonuclease.
  • said class 2, type II endonuclease is derived from an uncultivated microorganism.
  • said double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide.
  • the present disclosure provides for a method of modifying a target nucleic acid locus, said method comprising delivering to said target nucleic acid locus said engineered nucleic acid editing system of any of the aspects or embodiments described herein, wherein said endonuclease is configured to form a complex with said engineered guide ribonucleic acid structure, and wherein said complex is configured such that upon binding of said complex to said target nucleic acid locus, said complex modifies a nucleotide of said target nucleic locus.
  • said engineered nucleic acid editing system comprises an adenine deaminase, said nucleotide is an adenine, and modifying said target nucleic acid locus comprises converting said adenine to a guanine.
  • said engineered nucleic acid editing system comprises a cytidine deaminase and a uracil DNA glycosylase inhibitor, said nucleotide is a cytosine and modifying said target nucleic acid locus comprises converting said adenine to a uracil.
  • said target nucleic acid locus comprises genomic DNA, viral DNA, or bacterial DNA. In some embodiments, said target nucleic acid locus is in vitro.
  • said target nucleic acid locus is within a cell.
  • said cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, or a human cell.
  • said cell is within an animal.
  • said cell is within a cochlea.
  • said cell is within an embryo.
  • said embryo is a two-cell embryo. In some embodiments, said embryo is a mouse embryo.
  • delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering the nucleic acid of any of the aspects or embodiments described herein or the vector of any of the aspects or embodiments described herein. In some embodiments, delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding said endonuclease. In some embodiments, said nucleic acid comprises a promoter to which said open reading frame encoding said endonuclease is operably linked.
  • delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a capped mRNA containing said open reading frame encoding said endonuclease. In some embodiments, delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a translated polypeptide. In some embodiments, delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding said engineered guide ribonucleic acid structure operably linked to a ribonucleic acid (RNA) pol III promoter.
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • an engineered nucleic acid editing polypeptide comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein said endonuclease is derived from an uncultivated microorganism, wherein said endonuclease is a class 2, type II endonuclease, and wherein the endonuclease is configured to be deficient in nuclease activity; and a base editor coupled to said endonuclease.
  • said endonuclease comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof.
  • an engineered nucleic acid editing polypeptide comprising: an endonuclease having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof, wherein the endonuclease is configured to be deficient in nuclease activity; and a base editor coupled to said endonuclease.
  • an engineered nucleic acid editing polypeptide comprising: an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 360-368 or 598, wherein said endonuclease is a class 2, type II endonuclease, and wherein the endonuclease is configured to be deficient in nuclease activity.; and a base editor coupled to said endonuclease.
  • said endonuclease is derived from an uncultivated microorganism.
  • said endonuclease has less than 80% identity to a Cas9 endonuclease.
  • said endonuclease further comprises an HNH domain.
  • said tracr ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 88-96, 488, 489, and 679-680.
  • said base editor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof.
  • said base editor is an adenine deaminase.
  • said adenosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 50- 51, 57, 385-443, 448-475, or 595, or a variant thereof.
  • said base editor is a cytosine deaminase.
  • said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 594, or 58-66, or a variant thereof.
  • an engineered nucleic acid editing polypeptide comprising: an endonuclease, wherein said endonuclease is configured to be deficient in endonuclease activity; and a base editor coupled to said endonuclease, wherein said base editor comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 1-51, 385-386, 387-443, 444-447,488-475, or 595, or a variant thereof.
  • said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid.
  • said endonuclease is configured to be catalytically dead.
  • said endonuclease is a Class II, type II endonuclease or a Class II, type V endonuclease.
  • said endonuclease comprises a sequence having at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof.
  • said endonuclease comprises a nickase mutation.
  • said endonuclease comprises the aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597 when optimally aligned.
  • said endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence selected from the group consisting of SEQ ID NOs: 360-368 or 598.
  • said base editor is an adenine deaminase.
  • said adenosine deaminase comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 50-51, 385-443, or 448-475, or a variant thereof.
  • said adenosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51, 385-390, or 595, or a variant thereof.
  • said base editor is a cytosine deaminase.
  • said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-49, 444-447, or a variant thereof.
  • the polypeptide further comprises a uracil DNA glycosylase inhibitor coupled to said endonuclease or said base editor.
  • said uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof.
  • said endonuclease comprises one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease.
  • said NLS comprises a sequence with at least 90% identity to a selected from SEQ ID NOs: 369-384, or a variant thereof.
  • said endonuclease is covalently coupled directly to said base editor or covalently coupled to said base editor through a linker.
  • the present disclosure provides for a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein said nucleic acid encodes a sequence having at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-51, 385-386, 387-443, 444-447, or 488-475, or a variant thereof.
  • said organism is prokaryotic, bacterial, eukaryotic, fungal, plant, mammalian, rodent, or human.
  • the present disclosure provides for a vector comprising the nucleic acid of any of the aspects or embodiments described herein.
  • the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus.
  • AAV adeno-associated virus
  • the present disclosure provides for a cell comprising the vector of any one of the aspects or embodiments described herein.
  • the present disclosure provides for a method of manufacturing a base editor, comprising cultivating said cell of any one of the aspects or embodiments described herein.
  • the present disclosure provides for a system comprising: (a) the nucleic acid editing polypeptide of any of the aspects or embodiments described herein; and (b) an engineered guide ribonucleic acid structure configured to form a complex with said nucleic acid editing polypeptide comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a ribonucleic acid sequence configured to bind to said endonuclease.
  • said engineered guide ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680.
  • the present disclosure provides for a method of modifying a target nucleic acid locus, said method comprising delivering to said target nucleic acid locus said engineered nucleic acid editing polypeptide of any of the aspects or embodiments described herein or said system of any of the aspects or embodiments described herein, wherein said complex is configured such that upon binding of said complex to said target nucleic acid locus, said complex modifies a nucleotide of said target nucleic locus.
  • an engineered nucleic acid editing system comprising: (a) an endonuclease comprising a RuvC domain and an HNH domain, wherein the endonuclease is derived from an uncultivated microorganism, wherein the endonuclease is a class 2, type II endonuclease, and wherein the RuvC domain lacks nuclease activity; (b) a base editor coupled to the endonuclease; and (c) an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a tracr ribonucleic acid sequence configured to bind to the endonuclease.
  • the endonuclease comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs: 70-78.
  • an engineered nucleic acid editing system comprising: (a) an endonuclease having at least 95% sequence identity to any one of SEQ ID NOs: 70-78, wherein the endonuclease comprises a RuvC domain lacking nuclease activity; a base editor coupled to the endonuclease; and an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a tracr ribonucleic acid sequence configured to bind to the endonuclease.
  • an engineered nucleic acid editing system comprising: (a) an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising SEQ ID NOs: 360-368, wherein the endonuclease is a class 2, type II endonuclease, and wherein the endonuclease comprises a RuvC domain lacking nuclease activity; and (b) a base editor coupled to the endonuclease; and (c) an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a tracr ribonucleic acid sequence configured to bind to the endonuclease.
  • PAM protospacer adjacent motif
  • the endonuclease is derived from an uncultivated microorganism. In some embodiments, the endonuclease has less than 80% identity to a Cas9 endonuclease. In some embodiments, the endonuclease further comprises an HNH domain. In some embodiments, the tracr ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 88-96, 488, 489, and 679-680.
  • an engineered nucleic acid editing system comprising, (a) an engineered guide ribonucleic acid structure comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a tracr ribonucleic acid sequence configured to bind to an endonuclease, wherein the tracr ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 88-96, 488, 489, and 679-680; and a class 2, type II endonuclease configured to bind to the engineered guide ribonucleic acid.
  • the endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence selected from the group consisting of SEQ ID NOs: 360-368.
  • PAM protospacer adjacent motif
  • the base editor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-51 and 385-475.
  • the base editor is an adenine deaminase.
  • the adenosine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 57.
  • the base editor is a cytosine deaminase.
  • the cytosine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 58. In some embodiments, the cytosine deaminase comprises a sequence with at least 95% identity to any one of SEQ ID NOs: 59-66. [0060] In some embodiments, the engineered nucleic acid editing system further comprises a uracil DNA glycosylase inhibitor. In some embodiments, the uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67.
  • the engineered guide ribonucleic acid structure comprises at least two ribonucleic acid polynucleotides. In some embodiments, the engineered guide ribonucleic acid structure comprises one ribonucleic acid polynucleotide comprising the guide ribonucleic acid sequence and the tracr ribonucleic acid sequence. In some embodiments, the guide ribonucleic acid sequence is complementary to a prokaryotic, bacterial, archaeal, eukaryotic, fungal, plant, mammalian, or human genomic sequence. In some embodiments, the guide ribonucleic acid sequence is 15-24 nucleotides in length.
  • the endonuclease comprises one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease.
  • the endonuclease is covalently coupled directly to the base editor or covalently coupled to the base editor through a linker.
  • a polypeptide comprises the endonuclease and the base editor.
  • the endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid.
  • the endonuclease comprises SEQ ID NO: 370.
  • the system further comprises a source of Mg 2+.
  • the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 70; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 88; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 360.
  • the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 71; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 89; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 361.
  • the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 73;
  • the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 91; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 363.
  • the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 75; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 93; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 365.
  • the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 76; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 94; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 366.
  • the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 77; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 95; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 367.
  • the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 78; the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 96; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 368.
  • the base editor comprises an adenine deaminase.
  • the adenine deaminase comprises SEQ ID NO: 57.
  • the base editor comprises a cytosine deaminase.
  • the cytosine deaminase comprises SEQ ID NO: 58.
  • the engineered nucleic acid editing system described herein further comprises a uracil DNA glycosylation inhibitor.
  • the uracil DNA glycosylation inhibitor comprises SEQ ID NO: 67.
  • the sequence identity is determined by a BLASTP, CLUSTALW, MUSCLE, MAFFT, or Smith-Waterman homology search algorithm.
  • the sequence identity is determined by said BLASTP homology search algorithm using parameters of a wordlength (W) of 3, an expectation (E) of 10, and a BLOSUM62 scoring matrix setting gap costs at existence of 11, extension of 1, and using a conditional compositional score matrix adjustment.
  • W wordlength
  • E expectation
  • the present disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein the nucleic acid encodes a class 2, type II endonuclease coupled to a base editor, and wherein the endonuclease is derived from an uncultivated microorganism.
  • the present disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein the nucleic acid encodes an endonuclease having at least 70% sequence identity to any one of SEQ ID NOs: 70-78 coupled to a base editor.
  • the endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease.
  • the organism is prokaryotic, bacterial, eukaryotic, fungal, plant, mammalian, rodent, or human.
  • the present disclosure provides a vector comprising a nucleic acid sequence encoding a class 2, type II endonuclease coupled to a base editor, wherein said endonuclease is derived from an uncultivated microorganism.
  • the vector comprises the nucleic acid described herein.
  • the vector further comprises a nucleic acid encoding an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a tracr ribonucleic acid sequence configured to binding to the endonuclease.
  • the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus.
  • the present disclosure provides a cell comprising the vector described herein.
  • the present disclosure provides a method of manufacturing an endonuclease, comprising cultivating the cell described herein.
  • the present disclosure provides a method for modifying a double- stranded deoxyribonucleic acid polynucleotide comprising contacting the double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein the endonuclease is derived from an uncultivated microorganism, wherein the endonuclease is a class 2, type II endonuclease, and wherein the RuvC domain lacks nuclease activity; a base editor coupled to the endonuclease; and an engineered guide ribonucleic acid structure configured to bind to the endonuclease and the double-stranded deoxyribonucleic acid polynucleotide; wherein the double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (
  • the endonuclease comprising a RuvC domain and an HNH domain is covalently coupled directly to the base editor or covalently coupled to the base editor through a linker.
  • the endonuclease comprising a RuvC domain and an HNH domain comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs: 70-78.
  • the present disclosure provides a method for modifying a double- stranded deoxyribonucleic acid polynucleotide, comprising contacting the double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: a class 2, type II endonuclease, a base editor coupled to the endonuclease, and an engineered guide ribonucleic acid structure configured to bind to the endonuclease and the double-stranded deoxyribonucleic acid polynucleotide; wherein the double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM); and wherein the PAM comprises a sequence selected from the group consisting of SEQ ID NOs: 360-368.
  • a complex comprising: a class 2, type II endonuclease, a base editor coupled to the endonuclease, and an engineered guide ribonucleic
  • the class 2, type II endonuclease is covalently coupled to the base editor or coupled to the base editor through a linker.
  • the base editor comprises a sequence with at least 70%, at least 80%, at least 90% or at least 95% identity to a sequence selected from SEQ ID NOs: 1-51 and 385-475.
  • the base editor comprises an adenine deaminase; the double-stranded deoxyribonucleic acid polynucleotide comprises an adenine; and modifying the double-stranded deoxyribonucleic acid polypeptide comprises converting the adenine to guanine.
  • the adenine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 57.
  • the base editor comprises a cytosine deaminase; the double- stranded deoxyribonucleic acid polynucleotide comprises a cytosine; and modifying the double- stranded deoxyribonucleic acid polypeptide comprises converting the cytosine to uracil.
  • the cytosine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 58.
  • the cytosine deaminase comprises a sequence with at least 95% identity to any one of SEQ ID NOs: 59-66.
  • the complex further comprises a uracil DNA glycosylase inhibitor.
  • the uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67.
  • the double-stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of the engineered guide ribonucleic acid structure and a second strand comprising said PAM.
  • the PAM is directly adjacent to the 3' end of the sequence complementary to the sequence of the engineered guide ribonucleic acid structure.
  • the class 2, type II endonuclease is not a Cas9 endonuclease, a Cas14 endonuclease, a Cas12a endonuclease, a Cas12b endonuclease, a Cas 12c endonuclease, a Cas12d endonuclease, a Cas12e endonuclease, a Cas13a endonuclease, a Cas13b endonuclease, a Cas13c endonuclease, or a Cas 13d endonuclease.
  • the class 2, type II endonuclease is derived from an uncultivated microorganism.
  • the double- stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide.
  • the present disclosure provides a method of modifying a target nucleic acid locus, said method comprising delivering to said target nucleic acid locus the engineered nucleic acid editing system described herein, wherein the endonuclease is configured to form a complex with the engineered guide ribonucleic acid structure, and wherein the complex is configured such that upon binding of the complex to the target nucleic acid locus, the complex modifies a nucleotide of the target nucleic locus.
  • the engineered nucleic acid editing system comprises an adenine deaminase, the nucleotide is an adenine, and modifying the target nucleic acid locus comprises converting the adenine to a guanine.
  • the engineered nucleic acid editing system comprises a cytidine deaminase and a uracil DNA glycosylase inhibitor, the nucleotide is a cytosine and modifying the target nucleic acid locus comprises converting the adenine to a uracil.
  • the target nucleic acid locus comprises genomic DNA, viral DNA, or bacterial DNA.
  • the target nucleic acid locus is in vitro. In some embodiments, the target nucleic acid locus is within a cell. In some embodiments, the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, or a human cell. In some embodiments, the cell is within an animal. [0083] In some embodiments, the cell is within a cochlea. In some embodiments, the cell is within an embryo. In some embodiments, the embryo is a two-cell embryo. In some embodiments, the embryo is a mouse embryo.
  • delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering the nucleic acid described herein or the vector described herein. In some embodiments, delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding the endonuclease. [0084] In some embodiments, the nucleic acid comprises a promoter to which the open reading frame encoding the endonuclease is operably linked. In some embodiments, delivering the engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a capped mRNA containing the open reading frame encoding the endonuclease.
  • delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering a translated polypeptide. In some embodiments, delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding the engineered guide ribonucleic acid structure operably linked to a ribonucleic acid (RNA) pol III promoter.
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • the present disclosure provides an engineered nucleic acid editing polypeptide, comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein the endonuclease is derived from an uncultivated microorganism, wherein the endonuclease is a class 2, type II endonuclease, and wherein the RuvC domain lacks nuclease activity; and a base editor coupled to the endonuclease.
  • the endonuclease comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs: 70-78.
  • the present disclosure provides an engineered nucleic acid editing polypeptide, comprising: an endonuclease having at least 95% sequence identity to any one of SEQ ID NOs: 70-78, wherein the endonuclease comprises a RuvC domain lacking nuclease activity; and a base editor coupled to the endonuclease.
  • the present disclosure provides an engineered nucleic acid editing polypeptide, comprising: an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising SEQ ID NOs: 360-368, wherein the endonuclease is a class 2, type II endonuclease, and wherein the endonuclease comprises a RuvC domain lacks nuclease activity; and a base editor coupled to the endonuclease.
  • PAM protospacer adjacent motif
  • the endonuclease is derived from an uncultivated microorganism.
  • the endonuclease has less than 80% identity to a Cas9 endonuclease. In some embodiments, the endonuclease further comprises an HNH domain. In some embodiments, the tracr ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 88-96, 488, 489, and 679-680. In some embodiments, the base editor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-51 and 385-475. In some embodiments, the base editor is an adenine deaminase.
  • the adenosine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 57.
  • the base editor is a cytosine deaminase.
  • the cytosine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 58.
  • the adenosine cytosine deaminase comprises a sequence with at least 95% identity to any one of SEQ ID NOs: 59-66.
  • FIG.1 depicts example organizations of CRISPR loci of different classes and types.
  • FIG.2 shows the structure of a base editor plasmid containing a T7 promoter driving expression of the systems described herein.
  • FIG.3 shows plasmid maps for systems described herein.
  • FIG.4 shows predicted catalytic residues in the RuvCI domains of selected endonucleases described herein which are mutated to disrupt nuclease activity to generate nickase enzymes.
  • FIG.5 depicts an example method for cloning a single guide RNA expression cassette into the systems described herein.
  • One fragment comprises a T7 promoter plus spacer.
  • the other fragment comprises spacer plus single guide scaffold sequence plus bidirectional terminator.
  • FIGS.6A and 6B show sgRNA designs for lacZ targeting in E. coli.
  • the spacer length used for the systems described herein was 22 nucleotides.
  • three sgRNAs targeting lacZ in E. coli were designed to determine editing windows.
  • FIG.7 shows the nickase activity of selected mutated effectors.600bp double-stranded DNA fragments labeled with a fluorophore (6-FAM) on both 5’ ends were incubated with purified enzymes supplemented with their cognate sgRNAs.
  • 6-FAM fluorophore
  • FIGS.8A, 8B, and 8C shows Sanger sequencing results demonstrating base edits by selected systems described herein.
  • FIG.9 shows how the systems described herein expand base-editing capabilities with the endonucleases and base editors described herein.
  • FIGs.10A and 10B show base editing efficiencies of adenine base editors (ABEs) comprising TadA (ABE8.17m) and MG nickases.
  • ABEs adenine base editors
  • TadA is a tRNA adenine deaminase
  • TadA (ABE8.17m) is an engineered variant of E. coli TadA.12 MG nickases fused with TadA (ABE8.17m) were constructed and tested in E. coli.
  • Three guides were designed to target lacZ. Numbers shown in boxes indicate percentages of A to G conversion quantified by Edit R. ABE8.17m was used as the positive control for the experiment.
  • FIGs.11A and 11B show base editing efficiencies of cytosine base editors (CBEs) comprising rat APOBEC1, MG nickases, and the uracil glycosylase inhibitor of Bacillus subtilis bacteriophage (UGI (PBS1)).
  • CBEs cytosine base editors
  • APOBEC1 is a cytosine deaminase.12 MG nickases fused to rAPOBEC1 on their N-terminus and UGI on their C-terminus were constructed and tested in E. coli.
  • Three guides were designed to target lacZ. The numbers shown in boxes indicate percentages of C to T conversion quantified by Edit R. BE3 was used as the positive control in the experiment.
  • FIG.12A and 12B show effects of MG uracil glycosylase inhibitors (UGIs) on the base-editing activities of CBEs.
  • FIG.12A depicts a graph showing base-editing activity of MGC15-1 and variants, which comprise an N-terminal APOBEC1, the MG15-1 nickase, and a C-terminal UGI. Three MG UGIs were tested for improvements of cytosine base editing activities in E. coli.
  • Panel FIG.12B is a graph showing base editing activity of BE3, which comprises an N-terminal rAPOBEC1, the SpCas9 nickase, and a C-terminal UGI.
  • FIGS.13A and 13B depicts maps of edited sites showing editing efficiencies of cytosine base editors comprising A0A2K5RDN7, an MG nickases, and an MG UGI.
  • the constructs comprise an N-terminal A0A2K5RDN7, an MG nickases, and a C-terminal MG69-1.
  • BE3 was used as the positive control for base editing.
  • An empty vector was used for the negative control.
  • FIGs.14A and 14B shows a positive selection method for TadA characterization in E. coli.
  • FIG.14A shows a map of one plasmid system used for TadA selection.
  • the vector comprises CAT (H193Y), a sgRNA expression cassette targeting CAT, and an ABE expression cassette.
  • N-terminal TadA from E. coli and a C-terminal SpCas9 (D10A) from Streptococcus pyogenes are shown.
  • FIG.14B shows sequencing traces demonstrating that when introduced/transformed into E.
  • FIGs.15A and 15B shows mutations caused by TadA enable high tolerance of chloramphenicol (Cm).
  • FIG.15A shows photographs of growth plates where different concentrations of chloramphenicol were used to select for antibiotics resistance of E. coli.
  • EcTadA wild type and two variants of TadA from E. coli
  • FIG.15B shows a results summary table demonstrating that ABEs carrying mutated TadA show higher editing efficiencies than the wild type. In these experiments, colonies were picked from the plates the table.
  • FIG.16A shows photographs of growth plates to investigate MG TadA activity in chloramphenicol (ABEs comprised N-terminal TadA variants and C-terminal SpCas9 (D10A) nickase). For simplicity, identities of deaminases are shown. In this experiment, colonies were [00108]
  • FIG.16B summarizes the editing efficiencies of MG TadA candidates and demonstrates that MG68-3, and MG68-4 drove base edits of adenine.
  • FIGs.17A and 17B showsan improvement of base editing efficiency of MG68- 4_nSpCas9 via D109N mutation on MG68-4.
  • FIG.17A shows photographs of growth plates For simplicity, identities of deaminases are shown.
  • Adenine base editors in this experiment are comprise N-terminal TadA variants and C-terminal SpCas9 (D10A) nickase.
  • Panel (b) shows a summary table depicting editing efficiencies of MG TadA candidates.
  • FIG.17B demonstrates thatMG68-4 and MG68-4 (D109N) showed base edits of adenine, with the D109N mutant showing increased activity.
  • FIGs.18A and 18B show base editing of MG68-4 (D109N) _nMG34-1.
  • FIG.18A shows photographs of growth plates of an experiment where an ABE comprising N-terminal chloramphenicol.
  • FIG.18B shows a summary table depicting editing efficiencies with and without sgRNA.
  • FIG.19 shows 28 MG68-4 variants designed for improvements of MG68-4-nMG34-1 base editing activity (SEQ ID NOs: 448-475) .12 residues were selected for targeted mutagenesis to improve editing of the enzymes.
  • FIG.20 shows the results of a gel-based deaminase assay showing activity of deaminases from several selected Families (MG93, MG138, and MG139). Enzymes were expressed in a bacterial (E. coli codon optimized) Purexpress cell lysate-derived in vitro transcription-translation system and incubated with 5’FAM-labeled ssDNA and USER enzyme (uracil DNA glycosylase and endonuclease VIII) at 37 °C for 2.5 h. The resulting DNA was resolved on a denaturing polyacrylamide gel and imaged.
  • MG93 E. coli codon optimized
  • FIG.21 shows a diagram illustrating base editing efficiencies of adenine base editors at specific nucleotide sites using MG68-4v1 fusing with either nMG34-1 or nSpCas9.9 guides were designed to target genomic loci of HEK293T cells.
  • FIGs.22A, 22B, 22C, 22D, 22E, and 22F show in vivo base editing with engineered MG34-1 and MG35-1 nickases.
  • Panels (A) and (B) show base editing in the E. coli genome at four target loci.
  • FIG.22A shows ABE-MG34-1 base editor vs. a reference ABE-SpCas9 (both with TadA*(8.8m) deaminase).
  • FIG.22B shows CBE-MG34-1 base editor vs. a reference CBE- SpCas9 (both with rAPOBEC1 deaminase and PBS1 UGI).
  • FIG.22C shows base editing in human HEK293T cells with an ABE-MG34-1 nickase at three target loci.
  • the target sequence for each locus in panels A, B, and C is shown above each heatmap.
  • Expected edit positions are represented on the sequence by a subscript number and at each position on the heatmap (squares).
  • Heatmaps in FIGs.22 A, B, and C represent the percentage of NGS reads supporting an edit.
  • Values in FIGs.22 (A) and (B) represent the mean of two independent experiments, while values in panel (C) represent the mean of three independent biological replicates.
  • FIG.22D shows an E. coli survival assay. E.
  • FIG.22E top panel shows a diagram of an ABE construct with an engineered MG35- 1 nickase containing a C-terminal TadA*-(7.10) monomer and a SV40 NLS fused to the C- terminus.
  • FIGs.23A and 23B depict a gel-based deaminase assay showing activity of deaminases from one selected Family (MG139). Enzymes were expressed in a bacterial (E. coli codon optimized) Purexpress cell lysate-derived in vitro transcription-translation system and incubated with 5’FAM-labeled ssDNA and USER enzyme (uracil DNA glycosylase and endonuclease VIII) at 37 °C for 2.5 h.
  • FIG.23A depicts Percentage of deamination activity of all the active cytidine deaminases on ssDNA. The taxonomic classification of the cytidine deaminases are shown.
  • FIG.24 depicts a gel-based deaminase assay showing ssDNA and dsDNA activities of deaminases from several selected Families (MG93, MG138 and MG139). Enzymes were expressed in a bacterial (E.
  • the positive control for dsDNA activity is DddA toxin deaminase that has been documented as selective for a dsDNA substrate (Mok, B.Y., de Moraes, M.H., Zeng, J. et al. A bacterial cytidine deaminase toxin enables CRISPR-free mitochondrial base editing. Nature 583, 631–637 (2020).
  • FIGs.25A, 25B, and 25C depict data demonstrating that Cytosine Base Editors (CBEs) containing novel cytidine deaminases with spCas9, MG3-6, or MG34-1 effectors show varying editing levels in HEK293 cells.
  • CBEs Cytosine Base Editors
  • Each novel cytidine deaminase is fused via a linker to the N- terminus of the effector (spCas9, MG3-6, or MG34-1).
  • FIGs.26A, 26B, and 26C depicts the activity of cytidine deaminases (CDAs) fused to MG3-6.
  • FIG.26A shows relative activity of various CDAs, controls used were a highly active CBE from literature A0A2K5RDN7, as well as rAPOBEC1.
  • FIG.26B shows quantification of activity of various CDAs in comparison to the highly active CDA A0A2K5RDN7.
  • FIG.26C shows MG139-52 activity highlighting the G-A conversion suggesting editing of the opposite strand - the strand in the DNA/RNA heteroduplex in the R- loop.
  • FIGs.27A and 27B depict a toxicity assay in mammalian cells.
  • FIG.27A shows a picture of cells stained with crystal violet
  • FIG.27B shows quantification of FIG.27A. Absorbance was taken in a plate reader at 570nm.
  • FIG.28 depicts mutations identified from chloramphenicol selection in E. coli. r1v1 variant was the starting variant for the evolution experiment.24 variants were identified and the associated mutations were shown in the table.
  • FIG.29 depicts beneficial mutations identified from variant screening in HEK293T.
  • the predicted structure of MG68-4 is aligned with tRNA Arg2 from S. aureus TadA (PDB 2B3J). Key mutated residues are highlighted in the structural display.
  • FIG.30 depicts screening of MG68-4 variants in HEK293T cells. Four guides were used to screen the activity, editing window, and sequence preference of engineered variants.
  • FIG.31 depicts the ABE-MG35-1 E. coli survival assay sequencing results. Surviving colonies were picked from plates under chloramphenicol selection for the first experimental replicate and Sanger-sequenced.
  • FIG.32 depicts increased cytosine base editing efficiency upon Fam72a expression.
  • FIG.33 depicts data demonstrating that structurally optimized adenine base editors (ABEs) show varying editing levels in HEK293 cells.
  • FIG.34A – FIG.34B depicts rational design of MG68-4 variants.
  • FIG.34A depicts structural alignment of E. coli TadA (PDB:1z3a) and the predicted structure of MG68-4. tRNA structure was retrieved from S. aureus TadA (PDB: 2b3j).
  • FIG.34B depicts mutations identified from EcTadA for developments of adenine base editors (ABE7.10, ABE8.8m, ABE8.17m, and ABE8e) and equivalent residues of EcTadA on MG68-4. The mutations of EcTadA were installed to MG68-4 accordingly.
  • H129N was identified from a bacterial selection in E. coli.
  • FIG.35 depicts screening of adenine base editors in HEK293T cells. The top three variants are highlighted. The starting variant is MGA1.1.
  • FIG.36 depicts a table summarizing the base editing activity of rationally designed ABE variants described herein.
  • FIG.37 depicts a gel-based deaminase assay showing activity of variant deaminases from several selected Families (MG93, MG139, and MG152). Enzymes were expressed in a bacterial (E.
  • FIG.38A – FIG.38C depicts a gel-based deaminase with dual fluorophore assay.
  • FIG. 38A depicts a schematic of substrate design.
  • FIGs.38B and 38C depict TBE-Urea Gel Images imaged using a Cy3 and Cy5.5 filter, respectively.
  • RF157 is a single nucleotide substrate with a FAM molecule to act as a positive control to confirm the USER enzyme is cutting in the reaction and provide confirmation that the filter works and can discriminate between either fluorophore.
  • a mastermix is used as a negative control to provide a baseline measurement for the uncut substrate.
  • FIG. 38B Deaminases that preferentially cut the substrate at T at the -1 position give a fluorescent product of 65nts.
  • FIG.38C Deaminase that preferentially cut substrate at G at the -1 position give a fluorescent product of 65nts. Substrates cut at C at the -1 position give a product of 45 nts. Deaminases active on both A or G at the -1 position will give a product of 30 nts.
  • FIG.39 depicts the percentage of deamination for each -1 position to the target Cytidine for each variant (MG93 and MG152 families) tested in this study.
  • FIG.40 depicts the percentage of deamination for each -1 position to the target Cytidine for each variant (MG139 family) tested in this study.
  • FIG.41A – FIG.41C depicts a summary of activity data for novel and engineered CDAs as CBEs in mammalian cells.
  • FIG.41A depicts the maximum detected editing efficiency for all tested CDAs across 5 engineered spacers.
  • FIG.41B depicts the maximum detected activity normalized to internal positive control across 5 engineered spacers.
  • the internal experimental positive control used for normalization was a highly active CDA “A0A2K5RDN7”.
  • FIG.41C depicts side by side comparison of one of the lead candidates “139-52-V6” versus the highly active positive control “A0A2K5RDN7” with 2 guides.139-52-V6 shows similar editing efficiencies in comparison to the highly active tested CDA.
  • FIG.42 depicts the -1 nt preference of CDAs with more than 1% editing activity as CBEs in mammalian cells. The comparison of the -1 nt preference in mammalian cells vs in vitro is shown. -1 preference observed in mammalian cells as CBEs is by the most part comparable to the in vitro preference. The in vitro preference shows a more relaxed pattern than the CBE activity in mammalian cells.
  • FIG.43A – FIG.43C depicts an example of MG139-52 wt and mutated at N27 to A, MG139-52v6 that show differences of activity on ssDNA and/or on RNA:DNA duplex.
  • FIG. 43A depicts a structural prediction of MG139-52 using A3H as template (pdb: 5W3V). The targeted mutation at N27 is indicated by an arrow and is located far away for the catalytic center and the recognition loop 7.
  • FIG.43B depicts a cartoon showing the DNA/RNA heteroduplex in the R-loop that is targeted by 139-52 WT.
  • FIG.44 depicts the editing window of lead CDAs in comparison to the highly active CDA A0A2K5RDN7. The editing window shown corresponds to ⁇ 110nts.
  • the R loop (Cas9 target) is shown as a square.
  • FIG.45 depicts the mammalian cytotoxicity of stably expressed CDAs as CBEs.
  • CDAs, expressed as CBEs were stably expressed in mammalian cells by lentiviral integration. The cytotoxicity was measured as fold change relative to a low activity low cytotoxic CDA (rAPOBEC).
  • the lead candidates show medium cytotoxic activity under these conditions. It is understood that the cytotoxic activity will be reduced when the system is expressed transiently.
  • FIG.46A – FIG.46B depicts the dimeric design of MG68-4 variants.
  • FIG.46A depicts the predicted structure of MG68-4 and structural alignment of MG68-4 with SaTadA (PDB code: 2b3j). The distance between N-terminus of the first monomer and C-terminus of the second monomer is shown.
  • FIG.46B depicts base editing efficiency comparing the monomeric and dimeric designs. TadA*8.8m was used for benchmarking. The target sequence is shown in the bar chart. Conversion of A to G was obtained from the highest editing position A8. All deaminases were fused to the N-terminus of MG34-1 (D10A). The editing was evaluated in HEK293T cells.
  • FIG.47 depicts the effect of D109Q mutation to base substitution of C to G.
  • a to G and C to G conversions were obtained from the target sequences 633 and 634, respectively.
  • the editing efficiencies of residue C6 of target sequence 633 and residue A8 of target sequence 634 are shown. All deaminases were fused to the N-terminus of MG34-1 (D10A). The editing efficiency was evaluated in HEK293T cells.
  • FIG.48 depicts base editing efficiency of the combinatorial library in HEK293T cells. Beneficial mutations identified from rational design and directed evolution were installed into MG68-4 to make the combinatorial library. The variants were inserted into 3- 68_DIV30_M_RDr1v1_B.
  • FIG.49 depicts the effects of MG68-4 dimerization and/or MG68-4 amino acid sequence variants within the 3-68_DIV30 scaffold on A to G conversion percentage in HEK293T cells.
  • FIG.50A – FIG.50B depicts data demonstrating that the MG35-1 nickase can function as the scaffold of an adenine base editor in E. Coli cells.
  • FIG.50A depicts a schematic of the MG35-1 adenine base editor (ABE) containing a C-terminal TadA*-(7.10) monomer and an SV40 NLS fused to the C-terminus.
  • ABE MG35-1 adenine base editor
  • FIG.50B depicts a chloramphenicol selection experiment used to assess MG35-1 ABE base editing.
  • a plasmid containing the MG35-1 ABE, a non- functional chloramphenicol acetyltransferase (CAT) gene, and a sgRNA that either targets the CAT gene (targeting sgRNA) or does not target the CAT gene (non-targeting sgRNA) are transformed into BL21(DE3) (Lucigen) E. Coli cells.
  • E. Coli survival under chloramphenicol selection was dependent on the MG35-1 ABE editing the non-functional CAT gene to its wildtype sequence. Transformed E. Coli was plated on plates containing chloramphenicol mM IPTG.
  • FIG.51 depicts the activity of 3-6/8 ABE at Apoa1. High A to G conversion was observed with 26 Apoa1 guides. For all spacers shown in the graph, base conversion at all A positions within the spacer region is shown.
  • FIG.52 depicts the activity of 3-6/8 ABE at Angptl3. High A to G conversion was observed with 5 Angptl3 guides. For all spacers shown in the graph, base conversion at all A positions within the spacer region is shown.
  • FIG.53 depicts the activity of 3-6/8 ABE at Trac. High A to G conversion was observed with 2 Trac guides.
  • FIG.54 depicts the background 3-6/8 ABE activity at Apoa1. Primer pairs for active guides were tested on mock-nucleofected samples to assay background editing at targeted regions. Scale is from 0 to 1%.
  • FIG.55A – FIG.55E depicts an E. coli survival assay with an nMG35-1 ABE. E.
  • FIG.55A depicts a diagram showing the target sequences with the expected TAM. Cell growth is dependent on the ABE base editing the non- functional CAT gene (A at position 17 from the TAM/PAM, boxed) to restore activity.
  • FIGs. 55B-55E depicts the base editing activity in E. coli of base editors comprising nMG35-1 fused to the TadA deaminase with linkers of various lengths.
  • FIG.56A – FIG.56D depicts the evaluation of nMG35-1 ABE base editing in an E. coli survival assay under chloramphenicol selection, where cell growth is dependent on the ABE base editing the non-functional CAT gene stop codon and restoring activity.
  • FIGs.56A-56B depict diagrams showing the target sequences with the expected TAM. The “A” base at position 11 (A) or 10 (B) from the TAM (boxes) is expected to edit to “G” in order to revert the stop codon to glutamine and restore chloramphenicol (cm) resistance.
  • FIG.56C E.
  • coli was transformed with a plasmid containing the nMG35-1-ABE, a non-functional chloramphenicol acetyltransferase (CAT), and an sgRNA that either targets the CAT gene (targeting spacer) or not (no spacer).
  • Transformed E. coli was grown on plates containing chloramphenicol concentrations of 0, 2, 4, ABE targeting both STOP98Q and STOP122Q contains both stop codons in the same gene that need to be reverted for CAT gene functionality. MIC: minimum inhibitory concentration.
  • FIG. 56D chloramphenicol for the nMG35-1 ABE double reversion of STOP98Q and STOP122Q in the CAT gene.
  • FIG.57 depicts data demonstrating that truncation of the predicted PLMP domain at the N-terminus of MG35-1 ablates function of the MG35-1 ABE in E. coli.
  • coli was transformed with a plasmid containing the nMG35-1-ABE, a non-functional chloramphenicol acetyltransferase (CAT), and an sgRNA that either targets the CAT gene (WT (top row) or PLMP domain truncation (bottom row) MG35-1 ABE) or a non-target spacer (middle row: WT MG35-1 ABE with a scrambled spacer).
  • CAT chloramphenicol acetyltransferase
  • sgRNA that either targets the CAT gene (WT (top row) or PLMP domain truncation (bottom row) MG35-1 ABE) or a non-target spacer (middle row: WT MG35-1 ABE with a scrambled spacer).
  • Transformed E. coli was grown on plates containing Carbecillin and 0.1 mM IPTG. MIC: minimum inhibitory concentration.
  • SEQ ID NOs: 1-47 show the full-length peptide sequences of MG66 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 48-49 show the full-length peptide sequences of MG67 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 50-51 show the full-length peptide sequences of MG68 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 52-56 show the sequences of uracil DNA glycosylase inhibitors suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 57-66 show the sequences of reference deaminases.
  • SEQ ID NO: 67 shows the sequence of a reference uracil DNA glycosylase inhibitor.
  • SEQ ID NO: 68 shows the sequence of an adenine base editor.
  • SEQ ID NO: 69 shows the sequence of a cytosine base editor.
  • SEQ ID NOs: 70-78 show the full-length peptide sequences of MG nickases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 79-87 shows the protospacer and PAM used in in vitro nickase assays described herein.
  • SEQ ID NOs: 88-96 show the peptide sequences of single guide RNA used in in vitro nickase assays described herein.
  • SEQ ID NOs: 97-156 show the sequences of spacers when targeting E. coli lacZ.
  • SEQ ID NOs: 157-176 show the sequences of primers when conducting site directed mutagenesis.
  • SEQ ID NOs: 177-178 show the sequences of primers for lacZ sequencing.
  • SEQ ID NOs: 179-342 show the sequences of primers used during amplification.
  • SEQ ID NOs: 343-345 show the sequences of primers for lacZ sequencing.
  • SEQ ID NOs: 346-359 show the sequences of primers used during amplification.
  • SEQ ID NOs: 360-368 show protospacer adjacent motifs suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 369-384 show nuclear localization sequences (NLS’s) suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 385-443 show the full-length peptide sequences of MG68 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 444-447 show the full-length peptide sequences of MG121 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 448-475 show the full-length peptide sequences of MG68 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 476 and 477 show sequences of adenine base editors.
  • SEQ ID NOs: 478-482 show sequences of cytosine base editors.
  • SEQ ID NOs: 483-487 show the sequences of plasmids suitable for encoding the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 488 and 489 show the sgRNA scaffold sequences for MG15-1 and MG34- 1.
  • SEQ ID NOs: 490-522 show the sequences of spacers used to target genomic loci in E. coli and HEK293T cells.
  • SEQ ID NOs: 523-585 show the sequences of primers used during amplification and Sanger sequencing.
  • SEQ ID NOs: 584-585 show the sequences of primers used during amplification.
  • SEQ ID NO: 586 shows the sequence of an adenine base editor.
  • SEQ ID NO: 587 shows the sequence of a cytosine base editor.
  • SEQ ID NOs: 588-589 show sequences of adenine base editors.
  • SEQ ID NOs: 590-593 show the full-length peptide sequences of linkers suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 594 shows the sequence of a cytosine deaminase.
  • SEQ ID NO: 595 shows the sequence of an adenosine deaminase.
  • SEQ ID NO: 596 shows the sequence of an MG34 active effector suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 597 shows the sequence of an MG34 nickase suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 598 shows the sequence of an MG34 PAM.
  • SEQ ID NOs: 599-638 show the full-length peptide sequences of MG138 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 639-659 show the full-length peptide sequences of MG139 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 660-662 show the full-length peptide sequences of MG141 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 663-664 show the full-length peptide sequences of MG142 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 665-675 show the full-length peptide sequences of MG93 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 676-678 show sequences of adenine base editors.
  • SEQ ID NOs: 679-680 show the sgRNA scaffold sequences for MG34-1 and SpCas9.
  • SEQ ID NOs: 681-689 show spacer sequences used to target genomic loci in guide RNAs.
  • SEQ ID NOs: 690-707 show sequences of primers used to amplify genomic targets of adenine bae editors (ABE) for next generation sequencing (NGS) analysis.
  • SEQ ID NO: 708 shows the sequence of a blasticidin (BSD) resistance cassette.
  • SEQ ID NOs: 709-719 show spacer sequences used to target genomic loci in guide RNAs.
  • SEQ ID NOs: 720-726 show the sequences of plasmids suitable for encoding the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 728-729 show sequences of adenine base editors.
  • SEQ ID NOs: 730-736 show spacer sequences used to target genomic loci in guide RNAs.
  • SEQ ID NOs: 737-738 show the sequences of plasmids suitable for encoding the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 739-740 show sequences of cytidine base editors.
  • SEQ ID NO: 741 shows the sequence of a plasmid suitable for encoding the A1CF gene.
  • SEQ ID NO: 742 shows the sequence of an RNA used to test CDAs for RNA activity.
  • SEQ ID NO: 743 shows the sequence of a labelled primer for poisoned primer extension assay used to test CDAs for RNA activity.
  • SEQ ID NOs: 744-827 show the full-length peptide sequences of MG139 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 828 shows the full-length peptide sequence of an MG93 cytidine deaminase suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 829 shows the full-length peptide sequence of an MG142 cytidine deaminase suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 830-835 show the full-length peptide sequences of MG152 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 836-860 show sequences of adenine base editors.
  • SEQ ID NOs: 861-864 show spacer sequences used to target genomic loci in guide RNAs.
  • SEQ ID NOs: 865-872 show sequences of primers used to amplify genomic targets of adenine bae editors (ABE) for next generation sequencing (NGS) analysis.
  • SEQ ID NOs: 873-875 show the sequences of plasmids suitable for encoding the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 876 shows the sgRNA scaffold sequence for MG34-1.
  • SEQ ID NOs: 877-916 show sequences of cytosine base editors.
  • SEQ ID NOs: 917-931 show the sequences of sgRNAs suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 932-961 show sequences of primers used to amplify genomic targets of adenine base editors (ABE) for next generation sequencing (NGS) analysis.
  • SEQ ID NO: 962 shows a site engineered in mammalian cell line with 5 PAMs compatible with Cas9 and MG3-6 editing.
  • SEQ ID NOs: 963-967 show the sequences of sgRNAs suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 968-969 show sequences of cytosine base editors.
  • SEQ ID NO: 970 shows the full-length peptide sequence of an MG139 cytidine deaminase suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 971-977 show the full-length peptide sequences of MG93 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 978-981 show the full-length peptide sequences of MG138 cytidine deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 982 shows the full-length peptide sequence of MG142 cytidine deaminase suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 983-1014 shows the full-length peptide sequence of MG128 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 1015-1026 shows the full-length peptide sequence of MG129 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 1027-1031 shows the full-length peptide sequence of MG130 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 1032-1040 shows the full-length peptide sequence of MG131 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 1041-1043 shows the full-length peptide sequence of MG132 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 1044-1057 shows the full-length peptide sequence of MG133 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 1058-1061 shows the full-length peptide sequence of MG134 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 1062-1069 shows the full-length peptide sequence of MG135 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 1070-1081 shows the full-length peptide sequence of MG136 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NO: 1082-1098 shows the full-length peptide sequence of MG137 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 1099-1105 show the sequences of sgRNAs suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 1106-1111 show the sequences of MG35 PAMs.
  • SEQ ID NO: 1112 shows the DNA sequence of a gene encoding the ABE-MG35-1 adenine base editor.
  • SEQ ID NO: 1113 shows the protein sequence of the ABE-MG35-1 adenine base editor.
  • SEQ ID NO: 1114 shows the nucleotide sequence of a plasmid encoding a Cas9-based cytosine base editor (CBE).
  • SEQ ID NO: 1115 shows the nucleotide sequence of a plasmid encoding Fam72a.
  • SEQ ID NOs: 1116-1117 show the sequences of Cas9-CBE target sites.
  • SEQ ID NOs: 1118-1119 show the sequences of NGS amplicons.
  • SEQ ID NO: 1120 shows the full-length peptide sequence of an MG35 nuclease.
  • SEQ ID NO: 1121 shows the full-length peptide sequence of Fam72A.
  • SEQ ID NOs: 1121-1127 shows the full-length peptide sequences of MG35 nucleases.
  • SEQ ID NOs: 1128-1160 shows the full-length peptide sequences of MG3-6/3-8 adenine base editors.
  • SEQ ID NOs: 1161-1186 shows the full-length peptide sequences of MG34-1 adenine base editors.
  • SEQ ID NOs: 1187-1195 show the sequences of sgRNAs suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 1196-1204 show spacer sequences used to target genomic loci in guide RNAs.
  • SEQ ID NO: 1205 shows the nucleotide sequence of a plasmid encoding an MG3-6/3-8 adenine base editor.
  • SEQ ID NO: 1206 shows the nucleotide sequence of a plasmid encoding an sgRNA suitable for an MG3-6/3-8 adenine base editor described herein.
  • SEQ ID NO: 1207 shows the nucleotide sequence of a plasmid encoding an MG34-1 adenine base editor.
  • SEQ ID NOs: 1208-1269 show the full-length peptide sequences of MG93 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 1270-1296 show the full-length peptide sequences of MG139 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 1297-1311 show the full-length peptide sequences of MG152 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 1312-1313 show the full-length peptide sequences of MG138 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 1314-1315 show the full-length peptide sequences of MG139 deaminases suitable for the engineered nucleic acid editing systems described herein.
  • SEQ ID NOs: 1316-1319 show the nucleotide sequences of 5’-FAM-labeled ssDNAs.
  • SEQ ID NOs: 1320-1321 show the nucleotide sequences of Cy5.5-labeled ssDNAs.
  • SEQ ID NOs: 1322-1355 show sequences of cytidine base editors.
  • SEQ ID NOs: 1356-1362 show the full-length peptide sequences of MG34-1 adenine base editors.
  • SEQ ID NOs: 1363-1415 show the full-length peptide sequences of MG3-6/3-8 adenine base editors.
  • SEQ ID NOs: 1416-1417 show the nucleotide sequences of sgRNAs suitable for use with MG34-1 adenine base editors described herein.
  • SEQ ID NO: 1418 shows the nucleotide sequence of an sgRNA suitable for use with MG3-6/3-8 adenine base editors described herein.
  • SEQ ID NOs: 1419-1420 show the DNA sequences of target sites suitable for targeting by MG34-1 adenine base editors described herein.
  • SEQ ID NO: 1421 shows a DNA sequence of a target site suitable for targeting by MG3- 6/3-8 adenine base editors described herein.
  • SEQ ID NO: 1422 shows the nucleotide sequence of a plasmid suitable for expression of an MG34-1 adenine base editor described herein.
  • SEQ ID NO: 1423 shows the nucleotide sequence of a plasmid suitable for expression of an MG3-6/3-8 adenine base editor described herein.
  • SEQ ID NO: 1424 shows the full-length peptide sequence of an MG35-1 adenine base editor.
  • SEQ ID NO: 1425-1426 show the nucleotide sequences of plasmids suitable for expression of MG35-1 adenine base editors and sgRNAs described herein.
  • SEQ ID NOs: 1427-1428 show the nucleotide sequences of sgRNAs suitable for use with MG35-1 adenine base editors described herein.
  • SEQ ID NOs: 1429-1430 show the DNA sequences of target sites suitable for targeting by MG35-1 adenine base editors described herein.
  • SEQ ID NOs: 1431-1454 show the nucleotide sequences of sgRNAs engineered to function with an MG3-6/3-8 adenine base editor in order to target APOA1.
  • SEQ ID NOs: 1455-1478 show the DNA sequences of APOA1 target sites.
  • SEQ ID NOs: 1479-1483 show the nucleotide sequences of sgRNAs engineered to function with an MG3-6/3-8 adenine base editor in order to target ANGPTL3.
  • SEQ ID NOs: 1484-1488 show the DNA sequences of ANGPTL3 target sites.
  • SEQ ID NOs: 1489-1490 show the nucleotide sequences of sgRNAs engineered to function with an MG3-6/3-8 adenine base editor in order to target TRAC.
  • SEQ ID NOs: 1491-1492 show the DNA sequences of TRAC sites.
  • SEQ ID NOs: 1493-1516 show the nucleotide sequences of NGS primers suitable for use in assessing base editing of APOA1.
  • SEQ ID NOs: 1517-1521 show the nucleotide sequences of NGS primers suitable for use in assessing base editing of ANGPTL3.
  • SEQ ID NOs: 1522-1523 show the nucleotide sequences of NGS primers suitable for use in assessing base editing of TRAC.
  • SEQ ID NOs: 1524-1547 show the nucleotide sequences of NGS primers suitable for use in assessing base editing of APOA1.
  • SEQ ID NOs: 1548-1552 show the nucleotide sequences of NGS primers suitable for use in assessing base editing of ANGPTL3.
  • SEQ ID NOs: 1553-1554 show the nucleotide sequences of NGS primers suitable for use in assessing base editing of TRAC.
  • SEQ ID NO: 1555 shows the nucleotide sequence of a plasmid suitable for use in mRNA production.
  • SEQ ID NOs: 1556-1562 show the full-length peptide sequences of MG131 adenine deaminase variants.
  • SEQ ID NOs: 1563-1566 show the full-length peptide sequences of MG134 adenine deaminase variants.
  • SEQ ID NOs: 1567-1574 show the full-length peptide sequences of MG135 adenine deaminase variants.
  • SEQ ID NOs: 1575-1589 show the full-length peptide sequences of MG137 adenine deaminase variants.
  • SEQ ID NOs: 1590-1599 show the full-length peptide sequences of MG68 adenine deaminase variants.
  • SEQ ID NOs: 1600-1602 show the full-length peptide sequences of MG132 adenine deaminase variants.
  • SEQ ID NOs: 1603-1616 show the full-length peptide sequences of MG133 adenine deaminase variants.
  • SEQ ID NOs: 1617-1624 show the full-length peptide sequences of MG136 adenine deaminase variants.
  • SEQ ID NOs: 1625-1633 show the full-length peptide sequences of MG129 adenine deaminase variants.
  • SEQ ID NOs: 1634-1638 show the full-length peptide sequences of MG130 adenine deaminase variants.
  • SEQ ID NOs: 1639-1644 show the full-length peptide sequences of MG34-1 adenine base editors.
  • SEQ ID NOs: 1645-1646 show the nucleotide sequences of ssDNA substrates suitable for testing adenine deaminase activity in vitro.
  • DETAILED DESCRIPTION [00300] While various embodiments of the invention have been shown and described herein, it will be obvious to those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions may occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed.
  • a “cell” generally refers to a biological cell.
  • a cell may be the basic structural, functional or biological unit of a living organism.
  • a cell may originate from any organism having one or more cells.
  • Some non-limiting examples include: a prokaryotic cell, eukaryotic cell, a bacterial cell, an archaeal cell, a cell of a single-cell eukaryotic organism, a protozoa cell, a cell from a plant (e.g., cells from plant crops, fruits, vegetables, grains, soy bean, corn, maize, wheat, seeds, tomatoes, rice, cassava, sugarcane, pumpkin, hay, potatoes, cotton, cannabis, tobacco, flowering plants, conifers, gymnosperms, ferns, clubmosses, hornworts, liverworts, mosses), an algal cell, (e.g.,, Botryococcus braunii, Chlamydomonas reinhardtii, Nannochloropsis gaditan
  • seaweeds e.g., kelp
  • a fungal cell e.g.,, a yeast cell, a cell from a mushroom
  • an animal cell e.g., a cell from an invertebrate animal (e.g., fruit fly, cnidarian, echinoderm, nematode, etc.)
  • a cell from a vertebrate animal e.g., fish, amphibian, reptile, bird, mammal
  • a cell from a mammal e.g., a pig, a cow, a goat, a sheep, a rodent, a rat, a mouse, a non-human primate, a human, etc.
  • seaweeds e.g., kelp
  • a fungal cell e.g., a yeast cell, a cell from a mushroom
  • nucleotide generally refers to a base-sugar-phosphate combination.
  • a nucleotide may comprise a synthetic nucleotide.
  • a nucleotide may comprise a synthetic nucleotide analog.
  • Nucleotides may be monomeric units of a nucleic acid sequence (e.g., deoxyribonucleic acid (DNA) and ribonucleic acid (RNA)).
  • nucleotide may include ribonucleoside triphosphates adenosine triphosphate (ATP), uridine triphosphate (UTP), cytosine triphosphate (CTP), guanosine triphosphate (GTP) and deoxyribonucleoside triphosphates such as dATP, dCTP, dITP, dUTP, dGTP, dTTP, or derivatives thereof.
  • ddNTPs dideoxyribonucleoside triphosphates
  • Illustrative examples of dideoxyribonucleoside triphosphates may include, but are not limited to, ddATP, ddCTP, ddGTP, ddITP, and ddTTP.
  • a nucleotide may be unlabeled or detectably labeled, such as using moieties comprising optically detectable moieties (e.g., fluorophores). Labeling may also be carried out with quantum dots.
  • Detectable labels may include, for example, radioactive isotopes, fluorescent labels, chemiluminescent labels, bioluminescent labels and enzyme labels.
  • Fluorescent labels of nucleotides may include aminoethyl)aminonaphthalene-1-sulfonic acid (EDANS).
  • fluorescently labeled nucleotides can include [R6G]dUTP, [TAMRA]dUTP, [R110]dCTP, [R6G]dCTP, [TAMRA]dCTP, [JOE]ddATP, [R6G]ddATP, [FAM]ddCTP, [R110]ddCTP, [TAMRA]ddGTP, [ROX]ddTTP, [dR6G]ddATP, [dR110]ddCTP, [dTAMRA]ddGTP, and [dROX]ddTTP available from Perkin Elmer, Foster City, Calif; FluoroLink DeoxyNucleotides, FluoroLink Cy3-dCTP, FluoroLink Cy5-dCTP, FluoroLink Fluor X-dCTP, FluoroLink Cy3-dUTP, and FluoroLink Cy5- dUTP available from Amersham, Arlington Heights, Ill.; Fluorescein-15-
  • Nucleotides can also be labeled or marked by chemical modification.
  • a chemically-modified single nucleotide can be biotin-dNTP.
  • biotinylated dNTPs can include, biotin-dATP (e.g., bio-N6- ddATP, biotin-14-dATP), biotin-dCTP (e.g., biotin-11-dCTP, biotin-14-dCTP), and biotin-dUTP (e.g., biotin-11-dUTP, biotin-16-dUTP, biotin-20-dUTP).
  • polynucleotide oligonucleotide
  • nucleic acid a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof, either in single-, double-, or multi- stranded form.
  • a polynucleotide may be exogenous or endogenous to a cell.
  • a polynucleotide may exist in a cell-free environment.
  • a polynucleotide may be a gene or fragment thereof.
  • a polynucleotide may be DNA.
  • a polynucleotide may be RNA.
  • a polynucleotide may have any three-dimensional structure and may perform any function.
  • a polynucleotide may comprise one or more analogs (e.g., altered backbone, sugar, or nucleobase). If present, modifications to the nucleotide structure may be imparted before or after assembly of the polymer.
  • analogs include: 5-bromouracil, peptide nucleic acid, xeno nucleic acid, morpholinos, locked nucleic acids, glycol nucleic acids, threose nucleic acids, dideoxynucleotides, cordycepin, 7-deaza-GTP, fluorophores (e.g., rhodamine or fluorescein linked to the sugar), thiol containing nucleotides, biotin linked nucleotides, fluorescent base analogs, CpG islands, methyl-7-guanosine, methylated nucleotides, inosine, thiouridine, pseudouridine, dihydrouridine, queuosine, and wyosine.
  • fluorophores e.g., rhodamine or fluorescein linked to the sugar
  • thiol containing nucleotides biotin linked nucleotides, fluorescent base analogs, CpG islands, methyl-7-
  • Non-limiting examples of polynucleotides include coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro- RNA (miRNA), ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, cell-free polynucleotides including cell-free DNA (cfDNA) and cell-free RNA (cfRNA), nucleic acid probes, and primers.
  • loci locus
  • locus defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfer
  • the sequence of nucleotides may be interrupted by non-nucleotide components.
  • transfection or “transfected” generally refer to introduction of a nucleic acid into a cell by non-viral or viral-based methods.
  • the nucleic acid molecules may be gene sequences encoding complete proteins or functional portions thereof. See, e.g., Sambrook et al., 1989, Molecular Cloning: A Laboratory Manual, 18.1-18.88.
  • the terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein to generally refer to a polymer of at least two amino acid residues joined by peptide bond(s).
  • polymer does not connote a specific length of polymer, nor is it intended to imply or distinguish whether the peptide is produced using recombinant techniques, chemical or enzymatic synthesis, or is naturally occurring.
  • the terms apply to naturally occurring amino acid polymers as well as amino acid polymers comprising at least one modified amino acid.
  • the polymer may be interrupted by non-amino acids.
  • the terms include amino acid chains of any length, including full length proteins, and proteins with or without secondary or tertiary structure (e.g., domains).
  • amino acid polymer that has been modified, for example, by disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, oxidation, and any other manipulation such as conjugation with a labeling component.
  • amino acid and amino acids generally refer to natural and non-natural amino acids, including, but not limited to, modified amino acids and amino acid analogues.
  • Modified amino acids may include natural amino acids and non-natural amino acids, which have been chemically modified to include a group or a chemical moiety not naturally present on the amino acid.
  • Amino acid analogues may refer to amino acid derivatives.
  • amino acid includes both D- amino acids and L-amino acids.
  • non-native can generally refer to a nucleic acid or polypeptide sequence that is not found in a native nucleic acid or protein.
  • Non-native may refer to affinity tags.
  • Non-native may refer to fusions.
  • Non-native may refer to a naturally occurring nucleic acid or polypeptide sequence that comprises mutations, insertions or deletions.
  • a non-native sequence may exhibit or encode for an activity (e.g., enzymatic activity, methyltransferase activity, acetyltransferase activity, kinase activity, ubiquitinating activity, etc.) that may also be exhibited by the nucleic acid or polypeptide sequence to which the non-native sequence is fused.
  • a non- native nucleic acid or polypeptide sequence may be linked to a naturally-occurring nucleic acid or polypeptide sequence (or a variant thereof) by genetic engineering to generate a chimeric nucleic acid or polypeptide sequence encoding a chimeric nucleic acid or polypeptide.
  • promoter generally refers to the regulatory DNA region which controls transcription or expression of a gene and which may be located adjacent to or overlapping a nucleotide or region of nucleotides at which RNA transcription is initiated.
  • a promoter may contain specific DNA sequences which bind protein factors, often referred to as transcription factors, which facilitate binding of RNA polymerase to the DNA leading to gene transcription.
  • a ‘basal promoter’ also referred to as a ‘core promoter’, may generally refer to a promoter that contains all the basic elements to promote transcriptional expression of an operably linked polynucleotide. Eukaryotic basal promoters can contain a TATA-box or a CAAT box.
  • expression generally refers to the process by which a nucleic acid sequence or a polynucleotide is transcribed from a DNA template (such as into mRNA or other RNA transcript) or the process by which a transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as “gene product.” If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell.
  • operably linked As used herein, “operably linked”, “operable linkage”, “operatively linked”, or grammatical equivalents thereof generally refer to juxtaposition of genetic elements, e.g., a promoter, an enhancer, a polyadenylation sequence, etc., wherein the elements are in a relationship permitting them to operate in the expected manner.
  • a regulatory element which may comprise promoter or enhancer sequences, is operatively linked to a coding region if the regulatory element helps initiate transcription of the coding sequence. There may be intervening residues between the regulatory element and coding region so long as this functional relationship is maintained.
  • a “vector” as used herein, generally refers to a macromolecule or association of macromolecules that comprises or associates with a polynucleotide and which may be used to mediate delivery of the polynucleotide to a cell.
  • vectors include plasmids, viral vectors, liposomes, and other gene delivery vehicles.
  • the vector generally comprises genetic elements, e.g., regulatory elements, operatively linked to a gene to facilitate expression of the gene in a target.
  • an expression cassette” and “a nucleic acid cassette” are used interchangeably generally to refer to a combination of nucleic acid sequences or elements that are expressed together or are operably linked for expression.
  • an expression cassette refers to the combination of regulatory elements and a gene or genes to which they are operably linked for expression.
  • a “functional fragment” of a DNA or protein sequence generally refers to a fragment that retains a biological activity (either functional or structural) that is substantially similar to a biological activity of the full-length DNA or protein sequence.
  • a biological activity of a DNA sequence may be its ability to influence expression in a manner attributed to the full-length sequence.
  • an “engineered” object generally indicates that the object has been modified by human intervention.
  • a nucleic acid may be modified by changing its sequence to a sequence that does not occur in nature; a nucleic acid may be modified by ligating it to a nucleic acid that it does not associate with in nature such that the ligated product possesses a function not present in the original nucleic acid; an engineered nucleic acid may synthesized in vitro with a sequence that does not exist in nature; a protein may be modified by changing its amino acid sequence to a sequence that does not exist in nature; an engineered protein may acquire a new function or property.
  • An “engineered” system comprises at least one engineered component.
  • synthetic and “artificial” are used interchangeably to refer to a protein or a domain thereof that has low sequence identity (e.g., less than 50% sequence identity, less than 25% sequence identity, less than 10% sequence identity, less than 5% sequence identity, less than 1% sequence identity) to a naturally occurring human protein.
  • VPR and VP64 domains are synthetic transactivation domains.
  • tracrRNA or “tracr sequence”, as used herein, can generally refer to a nucleic acid with at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 100% sequence identity or sequence similarity to a wild type example tracrRNA sequence (e.g., a tracrRNA from S. pyogenes S. aureus, etc.).
  • tracrRNA can refer to a nucleic acid with at most about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% sequence identity or sequence similarity to a wild type example tracrRNA sequence (e.g., a tracrRNA from S. pyogenes S.
  • tracrRNA may refer to a modified form of a tracrRNA that can comprise a nucleotide change such as a deletion, insertion, or substitution, variant, mutation, or chimera.
  • a tracrRNA may refer to a nucleic acid that can be at least about 60% identical to a wild type example tracrRNA (e.g., a tracrRNA from S. pyogenes S. aureus, etc.) sequence over a stretch of at least 6 contiguous nucleotides.
  • a tracrRNA sequence can be at least about 60% identical, at least about 65% identical, at least about 70% identical, at least about 75% identical, at least about 80% identical, at least about 85% identical, at least about 90% identical, at least about 95% identical, at least about 98% identical, at least about 99% identical, or 100 % identical to a wild type example tracrRNA (e.g., a tracrRNA from S. pyogenes S. aureus, etc.) sequence over a stretch of at least 6 contiguous nucleotides.
  • Type II tracrRNA sequences can be predicted on a genome sequence by identifying regions with complementarity to part of the repeat sequence in an adjacent CRISPR array.
  • a “guide nucleic acid” can generally refer to a nucleic acid that may hybridize to another nucleic acid.
  • a guide nucleic acid may be RNA.
  • a guide nucleic acid may be DNA.
  • the guide nucleic acid may be programmed to bind to a sequence of nucleic acid site- specifically.
  • the nucleic acid to be targeted, or the target nucleic acid may comprise nucleotides.
  • the guide nucleic acid may comprise nucleotides.
  • a portion of the target nucleic acid may be complementary to a portion of the guide nucleic acid.
  • the strand of a double-stranded target polynucleotide that is complementary to and hybridizes with the guide nucleic acid may be called the complementary strand.
  • a guide nucleic acid may comprise a polynucleotide chain and can be called a “single guide nucleic acid.”
  • a guide nucleic acid may comprise two polynucleotide chains and may be called a “double guide nucleic acid.” If not otherwise specified, the term “guide nucleic acid” may be inclusive, referring to both single guide nucleic acids and double guide nucleic acids.
  • a guide nucleic acid may comprise a segment that can be referred to as a “nucleic acid-targeting segment” or a “nucleic acid-targeting sequence.”
  • a nucleic acid-targeting segment may comprise a sub-segment that may be referred to as a “protein binding segment” or “protein binding sequence” or “Cas protein binding segment”.
  • sequence identity or “percent identity” in the context of two or more nucleic acids or polypeptide sequences, generally refers to two (e.g., in a pairwise alignment) or more (e.g., in a multiple sequence alignment) sequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same, when compared and aligned for maximum correspondence over a local or global comparison window, as measured using a sequence comparison algorithm.
  • Suitable sequence comparison algorithms for polypeptide sequences include, e.g., BLASTP using parameters of a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix setting gap costs at existence of 11, extension of 1, and using a conditional compositional score matrix adjustment for polypeptide sequences longer than 30 residues; BLASTP using parameters of a wordlength (W) of 2, an expectation (E) of 1000000, and the PAM30 scoring matrix setting gap costs at 9 to open gaps and 1 to extend gaps for sequences of less than 30 residues (these are the default parameters for BLASTP in the BLAST suite available at https://blast.ncbi.nlm.nih.gov); CLUSTALW with parameters of ; the Smith-Waterman homology search algorithm with parameters of a match of 2, a mismatch of -1, and a gap of -1; MUSCLE with default parameters; MAFFT with parameters retree of 2 and maxiterations of 1000; Novafold with default parameters; HMMER hmmalign
  • RuvC_III domain generally refers to a third discontinuous segment of a RuvC endonuclease domain (the RuvC nuclease domain being comprised of three discontiguous segments, RuvC_I, RuvC_II, and RuvC_III).
  • a RuvC domain or segments thereof can generally be identified by alignment to documented domain sequences, structural alignment to proteins with annotated domains, or by comparison to Hidden Markov Models (HMMs) built based on documented domain sequences (e.g., Pfam HMM PF18541 for RuvC_III).
  • HNH domain generally refers to an endonuclease domain having characteristic histidine and asparagine residues.
  • An HNH domain can generally be identified by alignment to documented domain sequences, structural alignment to proteins with annotated domains, or by comparison to Hidden Markov Models (HMMs) built based on documented domain sequences (e.g., Pfam HMM PF01844 for domain HNH).
  • base editor generally refers to an enzyme that catalyzes the conversion of one target base or base pair into another (e.g. A:T to G:C, C:G to T:A) without requiring the creation and repair of a double-strand break.
  • the base editor is a deaminase.
  • the term “deaminase” generally refers to a protein or enzyme that catalyzes a deamination reaction.
  • the deaminase is an adenosine deaminase, which catalyzes the hydrolytic deamination of adenine or adenosine (e.g.., an engineered adenosine deaminase that deaminates adenosine in DNA).
  • the deaminase or deaminase domain is a cytidine (or cytosine) deaminase, catalyzing the hydrolytic deamination of cytidine (or cytosine) or deoxycytidine to uridine (or uracil) or deoxyuridine, respectively.
  • the deaminase or deaminase domain is a cytidine (or cytosine) deaminase domain, catalyzing the hydrolytic deamination of cytosine (or cytosine) to uracil (or uridine).
  • the deaminase or deaminase domain is a naturally- occurring deaminase from an organism, such as a human, chimpanzee, gorilla, monkey, cow, dog, rat, mouse, or bacterium (e.g. E. coli).
  • the deaminase or deaminase domain is a variant of a naturally-occurring deaminase from an organism that does not occur in nature.
  • the term “optimally aligned” in the context of two or more nucleic acids or polypeptide sequences generally refers to two (e.g., in a pairwise alignment) or more (e.g., in a multiple sequence alignment) sequences that have been aligned to maximal correspondence of amino acids residues or nucleotides, for example, as determined by the alignment producing a highest or “optimized” percent identity score.
  • Included in the current disclosure are variants of any of the enzymes described herein with one or more conservative amino acid substitutions. Such conservative substitutions can be made in the amino acid sequence of a polypeptide without disrupting the three-dimensional structure or function of the polypeptide.
  • Conservative substitutions can be accomplished by substituting amino acids with similar hydrophobicity, polarity, and R chain length for one another. Additionally, or alternatively, by comparing aligned sequences of homologous proteins from different species, conservative substitutions can be identified by locating amino acid residues that have been mutated between species (e.g., non-conserved residues) without altering the basic functions of the encoded proteins.
  • Such conservatively substituted variants may include variants with at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% identity to any one of the endonuclease protein sequences described herein.
  • such conservatively substituted variants are functional variants.
  • Such functional variants can encompass sequences with substitutions such that the activity of one or more critical active site residues or guide RNA binding residues of the endonuclease are not disrupted.
  • variants of any of the enzymes described herein with substitution of one or more catalytic residues to decrease or eliminate activity of the enzyme e.g. decreased-activity variants.
  • a decreased activity variant as a protein described herein comprises a disrupting substitution of at least one, at least two, or all three catalytic residues.
  • any of the endonucleases described herein can comprise a nickase mutation.
  • any of the endonucleases described herein can comprise a RuvC domain lacking nuclease activity. In some embodiments, any of the endonucleases described herein can be configured to cleave one strand of a double-stranded target deoxyribonucleic acid. In some embodiments, any of the endonucleases described herein can comprise can be configured to lack endonuclease activity or be catalytically dead. [00328] Conservative substitution tables providing functionally similar amino acids are available from a variety of references (see, for e.g., Creighton, Proteins: Structures and Molecular Properties (W H Freeman & Co.; 2nd edition (December 1993)).
  • the following eight groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) [00329] Overview [00330] The discovery of new CRISPR enzymes with unique functionality and structure may offer the potential to further disrupt deoxyribonucleic acid (DNA) editing technologies, improving speed, specificity, functionality, and ease of use.
  • DNA deoxyribonucleic acid
  • CRISPR Clustered Regularly Interspaced Short Palindromic Repeats
  • CRISPR systems are RNA-directed nuclease complexes that have been described to function as an adaptive immune system in microbes.
  • CRISPR systems occur in CRISPR (clustered regularly interspaced short palindromic repeats) operons or loci, which generally comprise two parts: (i) an array of short repetitive sequences (30-40bp) separated by equally short spacer sequences, which encode the RNA-based targeting element; and (ii) ORFs encoding the nuclease polypeptide directed by the RNA-based targeting element alongside accessory proteins/enzymes.
  • Efficient nuclease targeting of a particular target nucleic acid sequence generally requires both (i) complementary hybridization between the first 6-8 nucleic acids of the target (the target seed) and the crRNA guide; and (ii) the presence of a protospacer-adjacent motif (PAM) sequence within a defined vicinity of the target seed (the PAM usually being a sequence not commonly represented within the host genome).
  • PAM protospacer-adjacent motif
  • CRISPR systems are commonly organized into 2 classes, 5 types and 16 subtypes based on shared functional characteristics and evolutionary similarity (see FIG.1). [00332] Class I CRISPR systems have large, multisubunit effector complexes, and comprise Types I, III, and IV.
  • Type I CRISPR systems are considered of moderate complexity in terms of components.
  • the array of RNA-targeting elements is transcribed as a long precursor crRNA (pre-crRNA) that is processed at repeat elements to liberate short, mature crRNAs that direct the nuclease complex to nucleic acid targets when they are followed by a suitable short consensus sequence called a protospacer-adjacent motif (PAM).
  • PAM protospacer-adjacent motif
  • This processing occurs via an endoribonuclease subunit (Cas6) of a large endonuclease complex called Cascade, which also comprises a nuclease (Cas3) protein component of the crRNA-directed nuclease complex.
  • Type I nucleases function primarily as DNA nucleases.
  • Type III CRISPR systems may be characterized by the presence of a central nuclease, known as Cas10, alongside a repeat-associated mysterious protein (RAMP) that comprises Csm or Cmr protein subunits.
  • RAMP repeat-associated mysterious protein
  • the mature crRNA is processed from a pre- crRNA using a Cas6-like enzyme.
  • type III systems appear to target and cleave DNA-RNA duplexes (such as DNA strands being used as templates for an RNA polymerase).
  • Type IV CRISPR systems possess an effector complex that comprises a highly reduced large subunit nuclease (csf1), two genes for RAMP proteins of the Cas5 (csf3) and Cas7 (csf2) groups, and, in some cases, a gene for a predicted small subunit; such systems are commonly found on endogenous plasmids.
  • Class II CRISPR systems generally have single-polypeptide multidomain nuclease effectors, and comprise Types II, V and VI.
  • Type II CRISPR systems are considered the simplest in terms of components.
  • Type II CRISPR systems the processing of the CRISPR array into mature crRNAs does not require the presence of a special endonuclease subunit, but rather a small trans-encoded crRNA (tracrRNA) with a region complementary to the array repeat sequence; the tracrRNA interacts with both its corresponding effector nuclease (e.g. Cas9) and the repeat sequence to form a precursor dsRNA structure, which is cleaved by endogenous RNAse III to generate a mature effector enzyme loaded with both tracrRNA and crRNA.
  • Type II nucleases are known as DNA nucleases.
  • Type 2 effectors generally exhibit a structure comprising a RuvC-like endonuclease domain that adopts the RNase H fold with an unrelated HNH nuclease domain inserted within the folds of the RuvC- like nuclease domain.
  • the RuvC-like domain is responsible for the cleavage of the target (e.g., crRNA complementary) DNA strand, while the HNH domain is responsible for cleavage of the displaced DNA strand.
  • Type V CRISPR systems are characterized by a nuclease effector (e.g. Cas12) structure similar to that of Type II effectors, comprising a RuvC-like domain.
  • Type V CRISPR systems Similar to Type II, most (but not all) Type V CRISPR systems use a tracrRNA to process pre-crRNAs into mature crRNAs; however, unlike Type II systems which requires RNAse III to cleave the pre-crRNA into multiple crRNAs, type V systems are capable of using the effector nuclease itself to cleave pre- crRNAs. Like Type-II CRISPR systems, Type V CRISPR systems are again known as DNA nucleases.
  • Type VI CRISPR systems have RNA-guided RNA endonucleases. Instead of RuvC-like domains, the single polypeptide effector of Type VI systems (e.g. Cas13) comprises two HEPN ribonuclease domains. Differing from both Type II and V systems, Type VI systems also may not require a tracrRNA in some instances for processing of pre-crRNA into crRNA.
  • Type VI systems e.g., C2C2
  • C2C2 C2C2
  • ribonuclease ribonuclease activity activated by the first crRNA directed cleavage of a target RNA.
  • Class II CRISPR have been most widely adopted for engineering and development as designer nuclease/genome editing applications.
  • Jinek et al. Science.2012 Aug 17;337(6096):816-21, which is entirely incorporated herein by reference).
  • the Jinek study first described a system that involved (i) recombinantly-expressed, purified full- length Cas9 (e.g., a Class II, Type II enzyme) isolated from S. pyogenes SF370, (ii) purified mature ⁇ 42 nt crRNA bearing a ⁇ 20 nt 5’ sequence complementary to the target DNA sequence to be cleaved followed by a 3’ tracr-binding sequence (the whole crRNA being in vitro transcribed from a synthetic DNA template carrying a T7 promoter sequence); (iii) purified tracrRNA in vitro transcribed from a synthetic DNA template carrying a T7 promoter sequence, and (iv) Mg 2+ .
  • Cas9 e.g., a Class II, Type II enzyme
  • a linker e.g., GAAA
  • sgRNA single fused synthetic guide RNA
  • Base editing is the conversion of one target base or base pair into another (e.g. A:T to G:C, C:G to T:A) without requiring the creation and repair of a double-strand break.
  • the base editing may be achieved with the help of DNA and RNA base editors that allow the introduction of point mutations at specific sites, in either DNA or RNA.
  • DNA base editors may comprise a fusion of a catalytically inactive nuclease and a catalytically active base-modification enzyme that acts on single-stranded DNAs (ssDNAs).
  • RNA base editors may comprise of similar, RNA-specific enzymes.
  • DNA base editors are engineered ribonucleoprotein complexes that act as tools for single base substitution in cells and organism. They may be created by fusing an engineered base- modification enzyme and a catalytically deficient CRISPR endonuclease variant that cannot cut dsDNA, but it is able to unfold the dsDNA in a protospacer adjacent motif (PAM) sequence- dependent manner, such that a guide RNA can find its complementary target to indicate a ssDNA scission site.
  • PAM protospacer adjacent motif
  • the guide RNA anneals to the complementary DNA, displacing a fragment of ssDNA and directing the CRISPR ‘scissors’ to the base modification site.
  • the cellular repair machinery will repair the nicked non-edited strand using information from the complementary edited template.
  • an engineered nucleic acid editing system comprising: (a) an endonuclease comprising a RuvC domain and an HNH domain, wherein the endonuclease is derived from an uncultivated microorganism, wherein the endonuclease is a class 2, type II endonuclease, and wherein the endonuclease is configured to be deficient in nuclease activity; (b) a base editor coupled to the endonuclease; and (c) an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to the endonuclease.
  • the endonuclease comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof.
  • the RuvC domain lacks nuclease activity.
  • the endonuclease comprises a nickase mutation.
  • the endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid.
  • the ribonucleic acid sequence configured to bind to the endonuclease comprises a tracr sequence.
  • an engineered nucleic acid editing system comprising: (a) an endonuclease having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof, wherein the endonuclease is configured to be deficient in nuclease activity; a base editor coupled to the endonuclease; and an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a
  • the ribonucleic acid sequence configured to bind to the endonuclease comprises a tracr sequence.
  • the RuvC domain lacks nuclease activity.
  • the endonuclease comprises a nickase mutation.
  • the endonuclease is configured to cleave one strand of a double- stranded target deoxyribonucleic acid.
  • an engineered nucleic acid editing system comprising: (a) an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 360-368 or 598, wherein the endonuclease is a class 2, type II endonuclease, and the endonuclease is configured to be deficient in nuclease activity.; and (b) a base editor coupled to the endonuclease; and (c) an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to the endonuclease.
  • PAM protospacer adjacent motif
  • the ribonucleic acid sequence configured to bind to the endonuclease comprises a tracr sequence.
  • the endonuclease comprises a nickase mutation.
  • the RuvC domain lacks nuclease activity.
  • the endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid.
  • the endonuclease is derived from an uncultivated microorganism. In some embodiments, the endonuclease has less than 80% identity to a Cas9 endonuclease.
  • the endonuclease further comprises an HNH domain.
  • the tracr ribonucleic acid sequence comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof .
  • the tracr ribonucleic acid sequence comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof.
  • an engineered nucleic acid editing system comprising, (a) an engineered guide ribonucleic acid structure comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a tracr ribonucleic acid sequence configured to bind to an endonuclease, wherein the tracr ribonucleic acid sequence comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity non-degenerate nucleotides of any one of SEQ ID NOs: 88-96,
  • the endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 360, 362, or 368.
  • the base editor comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1- 51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof .
  • the base editor is an adenine deaminase.
  • the adenosine deaminase comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SEQ ID NOs: 50-51, 57, 385-443, 448-475, or 595, or a variant thereof .
  • the base editor is a cytosine deaminase.
  • the cytosine deaminase comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 594, or 58-66, or a variant thereof .
  • the engineered nucleic acid editing system further comprises a uracil DNA glycosylase inhibitor.
  • the uracil DNA glycosylase inhibitor comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof.
  • the engineered guide ribonucleic acid structure comprises at least two ribonucleic acid polynucleotides. In some embodiments, the engineered guide ribonucleic acid structure comprises one ribonucleic acid polynucleotide comprising the guide ribonucleic acid sequence and the tracr ribonucleic acid sequence. In some embodiments, the guide ribonucleic acid sequence is complementary to a prokaryotic, bacterial, archaeal, eukaryotic, fungal, plant, mammalian, or human genomic sequence. In some embodiments, the guide ribonucleic acid sequence is 15-24 nucleotides in length.
  • the endonuclease comprises one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of the endonuclease.
  • NLS nuclear localization sequences
  • the NLS can comprise any of the sequences in Table 1 below, or a combination thereof: Table 1: Example NLS Sequences that can be used with Effectors According to the Disclosure [00357]
  • the endonuclease is covalently coupled directly to the base editor or covalently coupled to the base editor through a linker.
  • linkers joining any of the enzymes or domains described herein can comprise one or multiple copies of a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to SGGSSGGSSGSETPGTSESATPESSGGSSGGS, SGSETPGTSESATPESA, GSGGS, SGSETPGTSESATPES, SGGSS, or GAAA, or any other linker sequence described herein.
  • a polypeptide comprises the endonuclease and the base editor.
  • the endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid.
  • the endonuclease comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof.
  • the system further comprises a source of Mg 2+.
  • the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 70, or a variant thereof;
  • the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 88; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 360.
  • the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 71, or a variant thereof;
  • the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 89; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 361.
  • the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 73, or a variant thereof;
  • the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 91; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 363.
  • the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 75, or a variant thereof;
  • the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 93; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 365.
  • the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 76, or a variant thereof;
  • the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 94; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 366.
  • the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 77, or a variant thereof;
  • the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 95; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 367.
  • the endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 78, or a variant thereof;
  • the guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to at least one of SEQ ID NO: 96; and the endonuclease is configured to bind to a PAM comprising SEQ ID NO: 368.
  • the base editor comprises an adenine deaminase.
  • the adenine deaminase comprises SEQ ID NO: 57, or a variant thereof.
  • the base editor comprises a cytosine deaminase.
  • the cytosine deaminase comprises SEQ ID NO: 58, or a variant thereof.
  • the engineered nucleic acid editing system described herein further comprises a uracil DNA glycosylation inhibitor.
  • the uracil DNA glycosylation inhibitor comprises SEQ ID NO: 67, or a variant thereof.
  • the sequence identity is determined by a BLASTP, CLUSTALW, MUSCLE, MAFFT, or Smith-Waterman homology search algorithm.
  • the sequence identity is determined by said BLASTP homology search algorithm using parameters of a wordlength (W) of 3, an expectation (E) of 10, and a BLOSUM62 scoring matrix setting gap costs at existence of 11, extension of 1, and using a conditional compositional score matrix adjustment.
  • W wordlength
  • E expectation
  • the present disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein the nucleic acid encodes a class 2, type II endonuclease coupled to a base editor, and wherein the endonuclease is derived from an uncultivated microorganism.
  • the present disclosure provides a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein the nucleic acid encodes an endonuclease having at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof coupled to a base editor.
  • the endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLSs) proximal to an N- or C- terminus of said endonuclease.
  • the organism is prokaryotic, bacterial, eukaryotic, fungal, plant, mammalian, rodent, or human.
  • the present disclosure provides a vector comprising a nucleic acid sequence encoding a class 2, type II endonuclease coupled to a base editor, wherein said endonuclease is derived from an uncultivated microorganism.
  • the vector comprises the nucleic acid described herein.
  • the vector further comprises a nucleic acid encoding an engineered guide ribonucleic acid structure configured to form a complex with the endonuclease comprising: a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and a tracr ribonucleic acid sequence configured to binding to the endonuclease.
  • the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus.
  • AAV adeno-associated virus
  • the present disclosure provides a cell comprising the vector described herein.
  • the present disclosure provides a method of manufacturing an endonuclease, comprising cultivating the cell described herein.
  • the present disclosure provides a method for modifying a double- stranded deoxyribonucleic acid polynucleotide comprising contacting the double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein the endonuclease is derived from an uncultivated microorganism, wherein the endonuclease is a class 2, type II endonuclease, and wherein the RuvC domain lacks nuclease activity; a base editor coupled to the endonuclease; and an engineered guide ribonucleic acid structure configured to bind to the endonuclease and the double-stranded deoxyribonucleic acid polynucleotide;
  • the endonuclease comprising a RuvC domain and an HNH domain is covalently coupled directly to the base editor or covalently coupled to the base editor through a linker.
  • the endonuclease comprising a RuvC domain and an HNH domain comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof .
  • the present disclosure provides a method for modifying a double- stranded deoxyribonucleic acid polynucleotide, comprising contacting the double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: a class 2, type II endonuclease, a base editor coupled to the endonuclease, and an engineered guide ribonucleic acid structure configured to bind to the endonuclease and the double-stranded deoxyribonucleic acid polynucleotide; wherein the double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM); and wherein the PAM comprises a sequence selected from the group consisting of SEQ ID NOs: 360-368 or 598, or a variant thereof .
  • PAM protospacer adjacent motif
  • the class 2, type II endonuclease is covalently coupled to the base editor or coupled to the base editor through a linker.
  • the base editor comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to a sequence selected from SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof .
  • the base editor comprises an adenine deaminase; the double-stranded deoxyribonucleic acid polynucleotide comprises an adenine; and modifying the double-stranded deoxyribonucleic acid polypeptide comprises converting the adenine to guanine.
  • the adenine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 57, or a variant thereof.
  • the base editor comprises a cytosine deaminase; the double- stranded deoxyribonucleic acid polynucleotide comprises a cytosine; and modifying the double- stranded deoxyribonucleic acid polypeptide comprises converting the cytosine to uracil.
  • the cytosine deaminase comprises a sequence with at least 95% identity to SEQ ID NO: 58, or a variant thereof.
  • the cytosine deaminase comprises a sequence with at least 95% identity to any one of SEQ ID NOs: 59-66, or a variant thereof.
  • the complex further comprises a uracil DNA glycosylase inhibitor.
  • the uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof.
  • the double-stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of the engineered guide ribonucleic acid structure and a second strand comprising said PAM.
  • the PAM is directly adjacent to the 3' end of the sequence complementary to the sequence of the engineered guide ribonucleic acid structure.
  • the class 2, type II endonuclease is not a Cas9 endonuclease, a Cas14 endonuclease, a Cas12a endonuclease, a Cas12b endonuclease, a Cas 12c endonuclease, a Cas12d endonuclease, a Cas12e endonuclease, a Cas13a endonuclease, a Cas13b endonuclease, a Cas13c endonuclease, or a Cas 13d endonuclease.
  • the class 2, type II endonuclease is derived from an uncultivated microorganism.
  • the double- stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide.
  • the present disclosure provides a method of modifying a target nucleic acid locus, said method comprising delivering to said target nucleic acid locus the engineered nucleic acid editing system described herein, wherein the endonuclease is configured to form a complex with the engineered guide ribonucleic acid structure, and wherein the complex is configured such that upon binding of the complex to the target nucleic acid locus, the complex modifies a nucleotide of the target nucleic locus.
  • the engineered nucleic acid editing system comprises an adenine deaminase, the nucleotide is an adenine, and modifying the target nucleic acid locus comprises converting the adenine to a guanine.
  • the engineered nucleic acid editing system comprises a cytidine deaminase and a uracil DNA glycosylase inhibitor, the nucleotide is a cytosine and modifying the target nucleic acid locus comprises converting the adenine to a uracil.
  • the target nucleic acid locus comprises genomic DNA, viral DNA, or bacterial DNA.
  • the target nucleic acid locus is in vitro. In some embodiments, the target nucleic acid locus is within a cell. In some embodiments, the cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, or a human cell. In some embodiments, the cell is within an animal. [00379] In some embodiments, the cell is within a cochlea. In some embodiments, the cell is within an embryo. In some embodiments, the embryo is a two-cell embryo. In some embodiments, the embryo is a mouse embryo.
  • delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering the nucleic acid described herein or the vector described herein. In some embodiments, delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding the endonuclease. [00380] In some embodiments, the nucleic acid comprises a promoter to which the open reading frame encoding the endonuclease is operably linked. In some embodiments, delivering the engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a capped mRNA containing the open reading frame encoding the endonuclease.
  • delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering a translated polypeptide. In some embodiments, delivering the engineered nucleic acid editing system to the target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding the engineered guide ribonucleic acid structure operably linked to a ribonucleic acid (RNA) pol III promoter.
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • the present disclosure provides an engineered nucleic acid editing polypeptide, comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein the endonuclease is derived from an uncultivated microorganism, wherein the endonuclease is a class 2, type II endonuclease, and wherein the endonuclease is configured to be deficient in nuclease activity.
  • the endonuclease comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof .
  • the present disclosure provides an engineered nucleic acid editing polypeptide, comprising: an endonuclease having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof, wherein the endonuclease is configured to be deficient in nuclease activity; and a base editor coupled to the endonuclease.
  • the present disclosure provides an engineered nucleic acid editing polypeptide, comprising: an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 360-368 or 598, wherein the endonuclease is a class 2, type II endonuclease, and wherein the endonuclease is configured to be deficient in nuclease activity; and a base editor coupled to the endonuclease.
  • PAM protospacer adjacent motif
  • the endonuclease is derived from an uncultivated microorganism.
  • the endonuclease has less than 80% identity to a Cas9 endonuclease.
  • the endonuclease further comprises an HNH domain.
  • the ribonucleic acid sequence configured to bind the endonuclease comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof.
  • the ribonucleic acid sequence configured to bind the endonuclease comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof .
  • the base editor comprises a sequence with at least 70%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof .
  • the base editor is an adenine deaminase.
  • the adenosine deaminase comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 50-51, 57, 385-443, 448-475, or 595, or a variant thereof .
  • the base editor is a cytosine deaminase.
  • the cytosine deaminase comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 594, or 58-66, or a variant thereof .
  • Systems of the present disclosure may be used for various applications, such as, for example, nucleic acid editing (e.g., gene editing), binding to a nucleic acid molecule (e.g., sequence-specific binding).
  • nucleic acid editing e.g., gene editing
  • binding to a nucleic acid molecule e.g., sequence-specific binding
  • Such systems may be used, for example, for addressing (e.g., removing or replacing) a genetically inherited mutation that may cause a disease in a subject, inactivating a gene in order to ascertain its function in a cell, as a diagnostic tool to detect disease-causing genetic elements (e.g.
  • RNA or an amplified DNA sequence encoding a disease-causing mutation via cleavage of reverse-transcribed viral RNA or an amplified DNA sequence encoding a disease-causing mutation), as deactivated enzymes in combination with a probe to target and detect a specific nucleotide sequence (e.g. sequence encoding antibiotic resistance int bacteria), to render viruses inactive or incapable of infecting host cells by targeting viral genomes, to add genes or amend metabolic pathways to engineer organisms to produce valuable small molecules, macromolecules, or secondary metabolites, to establish a gene drive element for evolutionary selection, to detect cell perturbations by foreign small molecules and nucleotides as a biosensor.
  • a specific nucleotide sequence e.g. sequence encoding antibiotic resistance int bacteria
  • MGC Metal cytosine base editor
  • entry plasmid containing T7 promoter-His tag-APOBEC1(BE3)-UGI-SV40 NLS APOBEC1 and UGI-SV40 NLS were amplified from pAL9 and two pieces of vector backbones were amplified from pAL6 (see FIG. 3).
  • source plasmids containing MG1-4, MG1-6, MG3-6, MG3-7, MG3-8, MG4-5, MG14-1, MG15-1, or MG18-1 effector gene sequences were amplified by Q5 DNA polymerase with forward primers incorporating appropriate mutations and reverse primers.
  • one set of primers (P366 as the forward primer) was used to amplify a T7 promoter-spacer sequence while another set of primers (P367 as the reverse primer) was used to amplify spacer sequence-sgRNA scaffold-bidirectional terminator, in which pTCM plasmids were used as templates (see FIG.2).
  • the two fragments were assembled into pMGA and pMGC via XbaI sites, resulting pMGA-sgRNA and pMGC- sgRNA, respectively.
  • Example 2 Protein expression and purification
  • the T7 promoter driven mutated effector genes in the pMGA and pMGC plasmids were expressed in E. coli BL21 (DE3) cells in Magic Media per manufacturer’s instructions (Thermo) by transformation with each of the respective plasmids described in Example 1 above.
  • the protein was applied to Cytiva 5 ml HisTrap FF column on the Akta Avant FPLC per the manufacturer’s specifications and the protein was eluted in an isocratic elution of 20 mM Tris (Sigma T2319-100 ML), 300 mM sodium chloride (VWR VWRVE529-500 ML), 5% glycerol, 10 mM MgCl 2 , with 250 mM imidazole (Sigma 68268-100 ML-F); pH 7.5.
  • Eluted fractions containing the His-tagged effector proteins were concentrated and buffer exchanged into 50 mM Tris-HCl, 300 mM NaCl, 1 mM TCEP, 5% glycerol; pH 7.5.
  • the protein concentration was determined by bicinchoninic acid assay (Thermo) and adjusted after determining the relative purity by SDS PAGE densitometry in Image Lab (Bio-Rad) (see FIG.7).
  • Example 3 In vitro nickase assay [00394] 6-carboxyfluorescein (6-FAM) labeled primers P141 and P146 (SEQ ID NOs: 179 and 180) synthesized by IDT were used to amplify linear fragments of LacZ containing targeting sequences of effectors using Q5 DNA polymerase. DNA fragments containing the T7 promoter followed by sgRNAs containing 20-bp or 22-bp spacer sequences were transcribed in vitro using HiScribe T7 High Yield RNA Synthesis Kit (New England Biolabs) per manufacturer’s instructions.
  • 6-FAM 6-carboxyfluorescein
  • Synthetic sgRNAs with the sequences corresponding to the named sgRNAs in the sequence listing were purified by Monarch RNA Cleanup Kit (New England Biolabs) according to the users manual and concentrations were measured by Nanodrop. [00395] To determine DNA nickase activity, each of the purified mutated effectors was first supplemented with its cognate sgRNA. Reactions were initiated by adding the linear DNA substrate in a 15 ⁇ L reaction mixture containing 10 mM Tris pH 7.5, 10 mM MgCl 2 , and 100 mM NaCl, 150 nM enzyme, 150 nM RNA, and 15 nM DNA. The reaction was incubated at 37oC for 2h.
  • Digested DNA was purified using AMPure XP SPRI paramagnetic beads (Beckman Coulter) and eluted with 6 ⁇ L TE buffer (10 mM Tris, 1 mM EDTA; pH 8.0). The nicked DNA was resolved on a 10% TBE-Urea denaturing gel (Biorad) and imaged by ChemiDoc (Bio-Rad) (see FIG.7, which shows that the depicted enzymes display nickase activity by production of bands 600 and 200 bases versus 400 and 200 bases in the case of the wild-type enzyme).
  • Example 4 Base editor introduction into E. coli
  • Plasmids were transformed into Lucergen’s electrocompetent BL21(DE3) cells according to the manufacturer’s instructions. After electroporation, cells were recovered with expression recovery media at 37°C for 1h and spread on LB plates containing 100 L/mg ampicillin and 0.1 mM IPTG.
  • plasmids were transformed into electrocompetent BL21(DE3) (Lucergen) and the electroporated cells were recovered with expression recovery media at 37°C for 1h.10 ⁇ L of recovered cells were then inoculated into 990 ⁇ L SOB containing 100 ⁇ L/mg ampicillin and 0.1 mM IPTG in a 96-well deep well plate, and grown at 37°C for 20h.1 ⁇ L cells induced for base editor expression were used for amplification of the lacZ gene in a 20 ⁇ L PCR reaction (Q5 DNA polymerase) with primers P137 and P360. The resulting PCR products were purified and sequenced by Sanger sequencing at ELIM BIOPHARM.
  • Example 5 Protein nucleofection and amplicon seq in mammalian cells (prophetic)
  • Nucleofection is conducted in mammalian cells (e.g. K-562, Neuro-2A or RAW264.7) according to the manufacturer’s recommendations using a Lonza 4D nucleofector and the Lonza SF Cell Line 4D-Nucleofector X Kit S (cat. no. V4XC-2032). After formulating the SF Synthego is combined with 18 pmol of base editor enzymes (e.g.
  • PCR products are pooled and purified by electrophoresis with a 2% agarose gel using a Monarch DNA Gel Extraction Kit (New England Biolabs), eluting Kit (Thermo Fisher Scientific) and sequenced on an Illumina MiSeq instrument (paired-end read, R1: 250–280 cycles, R2: 0 cycles) according to the manufacturer’s protocols.
  • Example 6 Plasmid nucleofection and whole genome seq in mammalian cells (prophetic) [00404] All plasmids are assembled by the uracil-specific excision reagent (USER) cloning method. Guide RNA plasmids for SpCas9, SaCas9 and all engineered variants are assembled. Plasmids for mammalian cell transfections are prepared using the ZymoPURE Plasmid Midiprep kit (Zymo Research Corporation).
  • HEK293T cells (ATCC CRL-3216) are cultured in Dulbecco’s modified Eagle’s medium (Corning) supplemented with 10% fetal bovine serum (ThermoFisher Scientific) and maintained at 37 °C with 5% CO2. [00405] HEK293T cells are seeded on 48-well poly-d-lysine plates (Corning) in the same culture (ThermoFisher Scientific) using 750 ng base editor plasmid, 250 ng guide RNA plasmid and 10 ng green fluorescent protein as a transfection control.
  • HTS high-throughput sequencing
  • PCR products are pooled and purified by electrophoresis with a 2% agarose gel using quantified with Qubit dsDNA High Sensitivity Assay Kit (ThermoFisher Scientific) and sequenced on an Illumina MiSeq instrument (paired end read, R1: 250–280 cycles, R2: 0 cycles) according to the manufacturer’s protocols.
  • Example 7 Determining editing window (prophetic) [00408] To examine the editing window regions, the cytosine showing the highest C–T conversion frequency in a specified sgRNA is normalized to 1, and other cytosines at positions spanning from 30 nt upstream to 10 nt downstream of the PAM sequence (total 43 bp) of the same sgRNA are normalized subsequently. Then normalized C–T conversion frequencies are classified and compared according to their positions for all tested sgRNAs of a specified base editor. A comprehensive editing window (CEW) is defined to span positions with an average C– T conversion efficiency exceeding 0.6 after normalization.
  • CEW comprehensive editing window
  • C sites are initially classified according to their positions in sgRNA targeting regions and those positions containing analysis. Selected C sites are then compared depending on base types upstream or downstream of the edited cytosine (NC or CN). For cytidine deaminases showing efficient C–T conversion at both N-terminus and C–terminus of the endonuclease, the substrate preference is evaluated by integrating respective NT- and CT-CBEs together.
  • Example 8a Testing off-target analysis with whole genome sequencing and transcriptomics in mammalian cells (prophetic)
  • HEK293T cells are plated on 48-well poly-d-lysine-coated plates 16 to 20 h before lipofection at a density of 3.104 cells per well in DMEM+GlutaMAX medium (Thermo Fisher Scientific) without antibiotics.750 ng nickase or base editor expression plasmid DNA is combined with 250 ng of sgRNA expression plasmid DNA in 15 ⁇ l Opti-MEM+GlutaMAX.
  • lipid mixture comprising 1.5 ⁇ l Lipofectamine 2000 and 8.5 ⁇ l Opti-MEM + GlutaMAX per well.
  • Cells are harvested 3 d after transfection and either DNA or RNA was harvested.
  • DNA analysis cells are washed once in PBS, and then lysed in 100 ⁇ l QuickExtract Buffer (Lucigen) according to the manufacturer’s instructions.
  • the MagMAX mirVana Total RNA Isolation Kit (Thermo Fisher Scientific) is used with the KingFisher Flex.
  • Genomic DNA from mammalian cells is fragmented and adapter-ligated using the Nextera DNA Flex Library Prep Kit (Illumina) using 96-well plate Nextera indexing primers (Illumina), according to the manufacturer’s instructions. Library size and concentration is confirmed by Fragment Analyzer (Agilent) and DNA is sent to Novogene for WGS using an Illumina HiSeq system.
  • All targeted NGS data is analyzed by performing four general operations: (1) alignment; (2) duplicate marking; (3) variant calling; and (4) background filtration of variants to remove artifacts and germline mutations. The mutation reference and alternate alleles are reported relative to the plus strand of the reference genome.
  • RNA selection is performed using the NEBNext Poly(A) mRNA Magnetic Isolation Module (New England BioLabs).
  • RNA library preparation is performed using NEBNext Ultra II RNA Library Prep Kit for Illumina (New England BioLabs). Based on the RNA input amount, a cycle number of 12 is used for the PCR enrichment of adapter-ligated DNA.
  • NEBNext Sample Purification Beads (New England BioLabs) is used throughout for all of the size selection performed by this method.
  • NEBNext Multiplex Oligos for Illumina is used for the multiplex indexes in accordance with the PCR recipe outlined in the protocol.
  • RNA sequencing is then performed.
  • Complementary DNA is generated by PCR with reverse transcription (RT-PCR) from the isolated RNA using the SuperScript IV One-Step RT-PCR System with EZDnase (Thermo Fisher Scientific) according to the manufacturer’s instructions.
  • Example 8b Analysis of off-target edits by whole genome sequencing and transcriptomics (prophetic)
  • Transfected cells prepared as in Example 8a are harvested after 3 days and the genomic DNA isolated using the Agencourt DNAdvance Genomic DNA Isolation Kit (Beckman Coulter) according to the manufacturer's instructions. On-target and off-target genomic regions of interest are amplified by PCR with flanking HTS primer pairs.
  • PCR amplification is carried out with Phusion high-fidelity DNA polymerase (ThermoFisher) according to the manufacturer's instructions using 5 ng of genomic DNA as a template. Cycle numbers are determined separately for each primer pair as to ensure the reaction was stopped in the linear range of amplification (30, 28, 28, 28, 32, and 32 cycles for EMX1, FANCF, HEK293 site 2, HEK293 site 3, HEK293 site 4, and RNF2 primers, respectively). PCR products are purified using RapidTips (Diffinity Genomics). Purified DNA is amplified by PCR with primers containing sequencing adaptors.
  • the products are gel-purified and quantified using the Quant-iT PicoGreen dsDNA Assay Kit (ThermoFisher) and KAPA Library Quantification Kit-Illumina (KAPA Biosystems). Samples are sequenced on an Illumina MiSeq as previously described. [00418] Sequencing reads are automatically demultiplexed using MiSeq Reporter (Illumina), and individual FASTQ files are analyzed with a custom Matlab script. Each read is pairwise aligned to the appropriate reference sequence using the Smith-Waterman algorithm. Base calls with a Q- score below 31 are replaced with N's and are thus excluded in calculating nucleotide frequencies. This treatment yields an expected MiSeq base-calling error rate of approximately 1 in 1,000.
  • Example 9 Mouse editing experiments (prophetic) [00421] It is envisaged that a base editor comprising a novel DNA targeting nuclease domain fused to a novel deaminase domain can be validated as a therapeutic candidate by testing in appropriate mouse models of disease.
  • an appropriate model comprises mice that have been engineered to express the human PCSK9 protein, for example, as described by Herbert et al (10.1161/ATVBAHA.110.204040).
  • the PCSK9 protein regulates LDL receptor (LDLR) levels and influences serum cholesterol levels. Mice expressing the human PCSK9 protein exhibit elevated levels of cholesterol and more rapid development of atherosclerosis.
  • LDLR LDL receptor
  • PCSK9 is a validated drug target for the reduction of lipid levels in people at increased risk of cardiovascular disease due abnormally high plasma lipid levels (https://doi.org/10.1038/s41569-018-0107-8). Reducing the levels of PCSK9 via genome editing is expected to permanently lower lipid levels for the life-time of the individual thus providing a life-long reduction in cardiovascular disease risk.
  • One genome editing approach can involve targeting the coding sequence of the PCSK9 gene with the goal of editing a sequence to create a premature stop codon and thus prevent the translation of the PCSK9 mRNA into a functional protein. Targeting a region close to the 5’ end of the coding sequence is useful in order to block translation of the majority of the protein.
  • the efficiency of base editing required for a therapeutic effect is in the range of 50% or higher in order to achieve a significant reduction in plasma lipid levels.
  • An example of the use of a base editor to create a stop codon in the PCSK9 gene is that of Carreras et al (https://doi.org/10.1186/s12915-018-0624-2) in which between 10% and 34% of the PCSK9 alleles were edited to create a stop codon. While this level of editing was sufficient to result in a measurable reduction in plasma lipid levels in the mice, a higher editing efficiency will be required for therapeutic use in humans.
  • a screen may be performed in a mouse liver cell line such as Hepa1-6 cells.
  • In silico screening may first be used to identify guides that target the PCSK9 gene with the various BE systems available.
  • an in-silico analysis may be performed to determine which guides have an editing window that encompasses a sequence that when edited may create a stop codon. Preference may then be given to those guides that are closer to the 5’ end of the coding sequence.
  • the resulting set of guides and BE proteins may be combined to form a ribonucleoprotein complex (RNP) and may be nucleofected into Hepa1-6 cells. After 72 h the efficiency of editing at the target site may be determined by NGS analysis. Based on these in vitro results the one or more BE/guide combinations that resulted in the highest frequency of stop codon formation may be selected for in vivo testing.
  • RNP ribonucleoprotein complex
  • AAV Adeno Associated Virus
  • BE base editors
  • AAV AAV genomes persist as episomes inside the nucleus of transduced cells and can be maintained for years which may result in the long-term expression of BE in these cells and thus an increased risk of off-target effects because the risk of an off-target event occurring is a function of the time over which the editing enzyme is active.
  • Ad Adenovirus
  • Ad5 can efficiently deliver DNA payloads to the liver of mammals and can package up to 45 kb of DNA.
  • adenoviruses are understood to induce a strong immune response in mammals (http://dx.doi.org/10.1136/gut.48.5.733), including in patients which can result in serious adverse events including death (https://doi.org/10.1016/j.ymthe.2020.02.010).
  • Non-viral delivery vectors (reviewed in doi:10.1038/mt.2012.79) which include lipid nanoparticles and polymeric nanoparticles have several advantages compared to viral delivery vectors including lower immunogenicity and transient expression of the nucleic acid cargo.
  • a BE may be delivered in vivo using a non-viral vector such as a lipid nanoparticle (LNP) by encapsulating a synthetic mRNA encoding the BE together with the guide RNA into the LNP.
  • a non-viral vector such as a lipid nanoparticle (LNP)
  • LNP can deliver their cargo with a bias to the hepatocytes of the liver, which is also a target organ/cell type when attempting to interfere with the expression of the PCSK9 gene.
  • a BE comprised of a novel genome editing protein fused to a deaminase domain may be encoded in a synthetic mRNA and packaged in a LNP together with an appropriate guide RNA that targets the selected site in the PCSK9 gene of the mouse.
  • the guide may be designed to target selectively the human PCSK9 gene or both the human and mouse PCSK9 genes.
  • the editing efficiency at the on-target site in the genome of the liver cells may be analyzed by amplicon sequencing or other methods such as tracking of indels by decomposition (doi: 10.1093/nar/gku936).
  • the physiologic impact may be determined by measuring lipid levels in the blood of the mice, including total cholesterol and triglyceride levels using standard methods.
  • Another example of a disease that may be modeled in mice to evaluate a novel BE is Primary Hyperoxaluria type I.
  • PH1 Primary Hyperoxaluria type I (PH1) is a rare autosomal recessive disease caused by defects in the AGXT gene that encodes the enzyme alanine-glyoxylate aminotransferase. This results in a defect in glyoxylate metabolism and the accumulation of the toxic metabolite oxalate.
  • One approach to treating this disease is to reduce the expression of the enzyme glycolate oxidase (GO) that produces glyoxylate from glycolate and thereby reducing the amount of substrate (glyoxylate) available for the formation of oxalate.
  • GO glycolate oxidase
  • PH1 can be modeled in mice in which both copies of the AGXT gene have been knocked out (agxt -/- mice) resulting in a significant 3-fold increase in oxalate levels in the urine compared to wild type controls.
  • the agxt -/- mice can therefore be used to assess the efficacy of a novel base editor designed to create a stop codon in the coding sequence of the endogenous mouse GO gene.
  • a screen may be performed in a mouse liver cell line such as Hepa1-6 cells. In silico screening may first be used to identify guides that target the GO gene with the various BE systems available.
  • an in-silico analysis may be performed to determine which guides have an editing window that encompasses a sequence that when edited may create a stop codon.
  • guides closer to the 5’ end of the coding sequence may be utilized.
  • the resulting set of guides and BE proteins may be combined to form a ribonucleoprotein complex (RNP) and may be nucleofected in to Hepa1-6 cells.
  • RNP ribonucleoprotein complex
  • the efficiency of editing at the target site may be determined by NGS analysis. Based on these in vitro results the one or more BE/guide combinations that resulted in the highest frequency of stop codon formation may be selected for in vivo testing in mice.
  • the BE and guide may be delivered to the mice using an AAV virus with a split intein system to express the BE and a 3rd AAV to deliver the guide.
  • an Adenovirus type 5 may be used to deliver the BE and guide in a single virus because of the >40Kb packaging capacity of Adenovirus.
  • the BE may be delivered as a mRNA together with the guide RNA packaged in an appropriate LNP. After intravenous injection of the LNP into the agxt -/- mice the oxalate levels in the urine may be monitored over time to determine if oxalate levels were reduced which may indicate that the BE was active and had the expected therapeutic effect.
  • Example 10 Gene Discovery of new deaminases
  • 4 Tbp tera base pairs
  • metagenomic sequencing data from diverse environments (soil, sediments, groundwater, thermophilic, human, and non- human microbiomes) were mined to discover novel deaminases.
  • HMM profiles of documented deaminases were built and searched against all predicted proteins using HMMER3 (hmmer.org) to identify deaminases from our databases.
  • Predicted and reference (e.g., eukaryotic APOBEC1, bacterial TadA) deaminases were aligned with MAFFT and a phylogenetic tree was inferred using FastTree2. Novel families and subfamilies were defined by identifying clades composed of sequences disclosed herein. Candidates were selected based on the presence of critical catalytic residues indicative of enzymatic function (see e.g. SEQ ID NOs: 1-51, 385-386, 387-443, 444- 447, 488-475, 599-675, 744-835, or 970-982).
  • Example 11 Plasmid Construction
  • Plasmid DNA was amplified in Endura electrocompetent cells (Lucigen) and isolated by QIAprep Spin Miniprep Kit (Qiagen).
  • Vector backbones were prepared by restriction enzyme digestion of plasmids. Inserts were amplified by Q5 High-Fidelity DNA polymerase (New England Biolabs) using primers (SEQ ID NOs: 690-707) ordered either from Elim BIOPHARM or IDT. Both vector backbones and inserts were purified by gel extraction using the Gel DNA Recovery Kit (Zymo Research).
  • Example 12 Assessment of Base Edit Efficiency in E. coli by sequencing [00435] 5 ng extracted DNA prepared as in Example 4 was used as the template and primers (P137 and P360) were used for PCR amplification, and the resulting products were submitted for Sanger sequencing at ELIM BIOPHARM. Primers used for sequencing are shown in Tables 6 and 7 (Seq ID NOs.523-531). Table 6 – Primers used for base editing analysis of lacZ gene in E.
  • FIGs.8A-8C shows example base edits by enzymes interrogated by this experiment, as assessed by Sanger sequencing.
  • FIGs.10A-10B shows base editing efficiencies of adenine base editors (ABEs) using TadA (ABE8.17m) (SEQ ID NO: 596) and MG nickases according to Table 3.
  • TadA is a tRNA adenine deaminase
  • TadA (ABE8.17m) is an engineered variant of E. coli TadA.
  • FIGs.11A-11B shows base editing efficiencies of cytosine base editors (CBEs) comprising rat APOBEC1, MG nickases, and uracil glycosylase inhibitor of Bacillus subtilis bacteriophage (UGI (PBS1)).
  • CBEs cytosine base editors
  • PBS1 uracil glycosylase inhibitor of Bacillus subtilis bacteriophage
  • APOBEC1 is a cytosine deaminase.12 MG nickases fused with rAPOBEC1 on N-terminus and UGI on C-terminus were constructed and tested in E. coli. Three guides were designed to target lacZ. Numbers shown in boxes indicate percentages of C to T conversion quantified by Edit R. BE3 was used as the positive control in the experiment. [00439] FIG.12 shows effects of MG uracil glycosylase inhibitors (UGIs) on base editing activity when added to CBEs. (a) MGC15-1 comprises of N-terminal APOBEC1, MG15-1 nickase, and C-terminal UGI.
  • UGIs MG uracil glycosylase inhibitors
  • BE3 comprises N-terminal rAPOBEC1, SpCas9 nickase, and C- terminal UGI.
  • Two MG UGIs were tested for improvements of cytosine base editing activities in HEK293T cells. Editing efficiencies were quantified by Edit R.
  • Example 13 Cell Culture, Transfections, Next Generation Sequencing, and Base Edit Analysis
  • HEK293T cells were grown and passaged in Dulbecco’s Modified Eagle’s Medium plus GlutaMAX (Gibco) supplemented with 10% (v/v) fetal bovine serum (Gibco) at 37 oC with 5% CO 2 .5 x 10 4 cells were seeded on 96-well cell culture plates treated for cell attachment (Costar), grown for 20 to 24 h, and the spent media were refreshed with new media right before were used for transfection per well per manufacturer’s instructions. Transfected cells were grown for 3 days, harvested, and gDNA was extracted with QuickExtract (Lucigen) per manufacturer’s instructions.
  • Targeted regions for base edits were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs) with primers listed in Tables 8 and 9 (SEQ ID NOs.538- 585) and extracted DNA as the templates.
  • PCR products were purified using the HighPrep PCR Clean-up System (MAGBIO) per manufacturer’s instructions.
  • the effect of uracil glycosylase inhibitor (UGI) on base editing of candidate enzymes was analyzed by submitting PCR products to Elim BIOPHARM for Sanger sequencing, and the efficiency was quantified by Edit R.
  • UMI uracil glycosylase inhibitor
  • FIGs.13A-13B shows maps of sites targeted by base editors showing base editing efficiencies of cytosine base editors comprising CMP/dCMP-type deaminase domain-containing protein (uniprot accession A0A2K5RDN7), MG nickases, and MG UGI.
  • the constructs comprise N-terminal A0A2K5RDN7, MG nickases, and C-terminal MG69-1. For simplicity, the identities of MG nickases are shown in the figure.
  • BE3 APOBEC1
  • An empty vector was used for the negative control. Three independent experiments were performed on different days. Abbreviations: R, repeat; NEG, negative control.
  • Table 9b Protein Domains used in constructs in Example 13 [00444]
  • FIG.14 shows a positive selection method for TadA characterization in E. coli.
  • Panel (a) shows a map of one plasmid system used for TadA selection.
  • the vector comprises CAT (H193Y), a sgRNA expression cassette targeting CAT, and an ABE expression cassette.
  • CAT H193Y
  • sgRNA expression cassette targeting CAT N-terminal TadA from E. coli
  • D10A C-terminal SpCas9
  • Panel (b) shows sequencing traces demonstrating that when introduced/transformed into E. coli cells, the A2 position of CAT (H193Y)’s template strand is edited, reverting the H193Y mutant to wild type and restoring its activity.
  • FIG.15 shows mutations caused by TadA enable high tolerance of chloramphenicol (Cm).
  • Panel (a) shows photographs of growth plates where different concentrations of chloramphenicol were used to select for antibiotics resistance of E. coli. In this example, wild type and two variants of TadA from E. coli (EcTadA) were tested.
  • Panel (b) shows a results summary table demonstrating that ABEs carrying mutated TadA show higher editing efficiencies than the wild type. In these experiments, colonies were picked from the plates with greater than effectors (SpCas9) and construct organization are shown in the figures above.
  • FIGs.16A-16B shows investigation of MG TadA activity in positive selection.
  • FIG. 16A shows photographs of growth plates from an experiment where 8 MG68 TadA candidates variants and C-terminal SpCas9 (D10A) nickase). For simplicity, identities of deaminases are shown.
  • Panel (b) shows a summary table depicting editing efficiencies of MG TadA candidates.
  • FIG.16B demonstrates that MG68-3 and MG68-4 drove base edits of adenine.
  • FIG.17 shows an improvement of base editing efficiency of MG68-4_nSpCas9 via D109N mutation on MG68-4.
  • Panel (a) shows photographs of growth plates where wild type identities of deaminases are shown. Adenine base editors in this experiment comprise N-terminal TadA variants and C-terminal SpCas9 (D10A) nickase.
  • Panel (b) shows a summary table depicting editing efficiencies of MG TadA candidates.
  • Panel (b) demonstrates that MG68-4 and MG68-4 (D109N) showed base edits of adenine, with the D109N mutant showing increased activity.
  • FIG.18 shows base editing of MG68-4 (D109N) _nMG34-1.
  • Panel (a) shows photographs of growth plates of an experiment where an ABE comprising N-terminal MG68-4 chloramphenicol.
  • Panel (b) shows a summary table depicting editing efficiencies with and without sgRNA.
  • colonies were picked from the plates with greater than or [00451]
  • FIG.19 shows 28 MG68-4 variants designed for improvements of MG68-4-nMG34-1 base editing activity.12 residues were selected for targeted mutagenesis to improve editing of the enzymes.
  • coli optimized constructs [00453] All plasmids for cytidine deaminase expression were prepared by Twist Biosciences. Each construct was codon optimized for E. coli expression and inserted into the XhoI and BamHI restriction sites of the pET-21(+) vector. Sequences were designed to exclude BsaI restriction sites. The following sequence was appended to the beginning of each construct: 5’- GAAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGGGCAGCAGTCATCATC ATCACCATCAC-3’. This sequence encodes a ribosomal binding site and an N-terminal hexahistidine tag.
  • Example 16 Plasmid construction for mammalian optimized constructs
  • All plasmids for cytidine deaminase expression in mammalian cells were codon optimized and ordered from Twist Biosciences. Each construct was codon optimized for H. sapiens expression. Restriction sites avoided were: BsaI, SphI, EcoRI, BmtI, BstX, BlpI and BamHI. The following sequence was appended 5’ of the codon optimized sequences: ACCGGTGCTAGCCCACC.
  • This sequence contains a BmtI restriction site to be used for downstream cloning and a Kozak sequence for maximum translation.
  • the following sequence was appended 3’ of the codon optimized CDA: AGCGCATGC.
  • This sequence contains a SphI restriction site to allow for downstream cloning - stop codon was removed in all constructs.
  • Example 17 Cell culture, transfections, next generation sequencing, and base edit analysis
  • HEK293T cells were grown and passaged in Dulbecco’s Modified Eagle’s Medium plus GlutaMAX (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) at 37 oC with 5% CO2.2.5 x 10 4 cells were seeded on 96-well cell culture plates treated for cell attachment (Costar), grown for 20 to 24 h, and the spent media were refreshed with new media right before transfection.300 ng expression plasmid and 1 were used for transfection per well per manufacturer’s instructions.
  • Transfected cells were grown for 3 days, harvested, and gDNA was extracted with QuickExtract (Lucigen) per manufacturer’s instructions.
  • Targeted regions for base edits were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs) with primers (SEQ ID NOs: 690-707, 865-872, and 932-961) and extracted DNA as the templates.
  • PCR products were purified by HighPrep PCR Clean-up System (MAGBIO) per manufacturer’s instructions.
  • Example 18 In Vitro Deaminase in-gel assay
  • Linear DNA constructs containing the cytidine deaminases were amplified from the previously mentioned plasmids from Twist via PCR. All constructs were cleaned via SPRI Cleanup (Lucigen) and eluted in a 10mM tris buffer. Enzymes were expressed from the PCR templates in an in-vitro transcription-translation system, PURExpress (NEB), at 37°C for 2 hours.
  • PURExpress PURExpress
  • Deamination reactions were prepared by mixing 2uLs of the PURExpress reaction with 2uM 5’-FAM labeled ssDNA (IDT) and 1U USER Enzyme (NEB) in 1x Cutsmart Buffer (NEB). The reactions were incubated at 37°C for 2 hours and then quenched by adding 4 units of proteinase K (NEB) and incubation at 55°C for 10 minutes. The reaction was further treated by addition of 11uL of 2x RNA loading dye and incubation at 75°C for 10 minutes. All reaction conditions were analyzed by gel electrophoresis in a 10% denaturing gel (Biorad).
  • MG139-30/SEQ ID NO:752, MG139- 55/SEQ ID NO:777, MG139-99/SEQ ID NO:823) While most of the reported DNA cytidine deaminases operate predominantly on ssDNA, often with a preference for the base immediately FIG.24), verifying that MG139-86 and MG139-87 are capable of also deaminating dsDNA substrates.
  • Example 19 – NGS-based deep deamination in vitro assay [00462] We created an ssDNA library with a single target C to determine cytosine deaminase NNNCNNN flanked by 21-nt and 21-nt regions comprising adenine, an upstream 20nt randomized barcode, and two conserved primer binding site was synthesized (Integrated DNA Technologies). [00463] This yielded an oligonucleotides pool with 4096 unique substrate sequences. Unique barcodes were included on each oligo to determine the original variable region post-sequencing in case of non-target C deamination events.
  • deaminases were expressed from the PCR templates in an in-vitro transcription-translation system, PURExpress (NEB), at 37°C for 2 hours. Then the PURExpress was then incubated with 0.5 pmol of the substrate oligonucleotide pool for 1 h at 37 °C in 50 mM Tris, pH 7.5, 75 mM NaCl. [00464] A. Half of the treated pool was amplified using the Accel-NGS 1S Plus kit (Swift) to create a dsDNA pool. This pool was then further amplified with unique dual indexes and sequenced on a MiSeq for >15,000 reads per sample.
  • PURExpress N-vitro transcription-translation system
  • HEK293T cells were grown and passaged in Dulbecco’s Modified Eagle’s Medium plus GlutaMAX (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) at 37 oC with 5% CO 2 . The day before transfection, cells were seeded at 5x10 6 per dish.
  • MG34-1 a small type II CRISPR nuclease
  • ABE-MG34-1 SEQ ID NO: 727
  • TadA*(8.17m) is an engineered TadA from E. coli
  • a construct comprising rAPOBEC1-nMG34-1-UGI (PBS) CBE-MG34-1, SEQ ID NO: 739
  • rAPOBEC1 is rat APOBEC1
  • UGI PBS
  • TadA*(8.17m)-nSpCas9 SEQ ID NO: 728) and rAPOBEC1-nSpCas9-UGI (PBS) (SEQ ID NO: 740) were generated as positive controls for editing profile analysis.
  • Four guides that target lacZ gene in E. coli SEQ ID NOs: 729-736) were designed and prepared for each base editor construct. Plasmids were transformed into BL21(DE3), recovered in recovery carbenicillin and 0.1 mM IPTG. After growing cells at 37 oC for 16 to 20 h, colony PCR was used to amplify the targeted regions in E.
  • an ABE was constructed by fusing a TadA*- (7.10) deaminase monomer to the C-terminus of an engineered MG35-1 containing a D59A mutation (FIG.22E).
  • the A to G editing of this ABE was tested in a positive selection single- plasmid E. coli system in which the ABE is required to revert a chloramphenicol acetyltransferase (CAT) gene containing a Y193 mutation back to H193 to survive chloramphenicol selection (FIG.22D).
  • CAT chloramphenicol acetyltransferase
  • This plasmid contains a sgRNA with a spacer either targeting the mutant CAT gene or a scrambled, non-targeting spacer region (control).
  • An enrichment of colonies was detected with E. coli transformed with the ABE-MG35-1 targeting FIG.22E).
  • Sanger transformed with the target spacer contained the expected Y193H reversion (Table 11 and FIG. 31).
  • the targeting spacer contained the Y193H reversion, indicating a detectable level of editing without chloramphenicol selection.
  • the colony growth enrichment under chloramphenicol selection for the targeting ABE-MG35-1 condition confirmed that the MG35-1 nickase is a successful component for base editing.
  • the ABE-MG35-1 represents the smallest, nickase-based adenine base editor to date (Table 12).
  • Example 22 Adenine base editor in mammalian cells
  • MG68-4v1 predicted as a tRNA adenosine deaminase
  • MG68-4v1-nMG34-1 two base editors fusing deaminase with nickase, MG68-4v1-nMG34-1 and MG68-4v1-nSpCas9 were constructed.
  • an active variant engineered by Gaudelli et al. and created TadA*(8.8m)-nMG34-1 was used.
  • Example 23 Activity in mammalian cells (cytidine deaminase assay in tissue culture cells) (prophetic) [00475]
  • the cytidine deaminase assay in cells is designed so that when the mutated stop codon ACG is mutated to ATG by a cytidine deaminase, cells can translate the blasticidin gene and therefore acquire resistance to this antibiotic.
  • ACG containing cell Upon transducing a reporter cell line (ACG containing cell) with a library of cytidine deaminases fused to Cas9 or MG3-6, it is expected that a fraction of cells will mutate the ACG to ATG and therefore gain resistance to blasticidin. Cells that have acquired such resistance and thus survive the selection assay are later subjected to next generation sequencing (NGS) to unveil the identity of the successful cytidine deaminase displaying cytidine base editor activity.
  • NGS next generation sequencing
  • Example 24 Mammalian constructs for Cytosine Base Editors (CBEs) [00477] Plasmids for CBEs using the nickase forms of spCas9, MG3-6, and MG34-1 were constructed using NEB HiFi assembly mix and DNA fragments containing the novel cytidine deaminases, the nuclease enzymes, and UNG sequence. For constructs containing spCas9, pAL318 was digested with the NotI and XmaI restriction enzymes. For constructs containing MG3-6, pAL320 was digested with the NcoI restriction enzyme.
  • pAL226 was digested with the NotI and BamHI restriction enzymes.
  • CDAs were fused with MG3-6 nickase.
  • CDAs were ordered as gene fragments from Twist and digested with SphI and BmtI.
  • the plasmid backbone containing MG3-6 was digested with SphI and BmtI, and the gene fragments were ligated using T4 DNA ligase.
  • the plasmid backbone contains a mU6 promoter for cloning gRNAs targeting the engineered sites.
  • the spacers targeting the engineered sites using MG3-6 are shown in SEQ ID NOs.963-967.
  • CBEs were constructed using various combinations of cytidine deaminases, nickase effectors, and uracil glycosylase inhibitors (FIGs.25A-25C).
  • Fusions containing spCas9 were fused with a C-terminal UGI, and fusions containing MG3-6 or MG34-1 were fused with a C-terminal MG69-1 UGI.
  • Each CBE was tested with 5 sgRNAs (spCas9 (SEQ ID NOs.917-921), MG3-6 (SEQ ID NOs.922-926), or MG34-1 (SEQ ID NOs.927-931)) targeting the HEK293 genome. Editing levels (C to T (%)) are shown for all cytosines within 5bp of the spacer region. Numerous CBEs showed detectable editing levels when transiently transfected into HEK293 cells.
  • both MG93-4 and MG138-20 exceeded 5% editing at certain sites with MG93-3, MG93-7, and A0A2K5RDN7 exceeding 10% editing.
  • MG3-6 MG93-4 and A0A2K5RDN7 exceeded 5% editing at certain sites.
  • MG34-1, MG93-4, MG93-6, and MG93-9 exceeded 5% editing at certain sites
  • MG93-3, MG93-7, and MG139-12 exceeded 10% editing
  • MG93-11 and A0A2K5RDN7 exceeded 20% editing.
  • CDAs Numerous novel cytidine deaminases have been identified that are compatible with spCas9, MG3-6, and MG34-1 and are able to deaminate cytosines in mammalian cells.
  • the CDAs were fused to MG3-6 and targeted a reporter cell line with 5 engineered PAMs in tandem (sequence ID no.962).14 CDAs were tested using this system, and many show >1% editing (Panel (a) of FIG. 26).
  • the highest activity observed for a novel CDA fused to MG3-6 was 38.4% for MG152-6, with the second highest showing 17.6% for MG139-52.
  • Example 25 Cytosine base editors toxicity in mammalian cells
  • HEK293T cells were transduced with lentiviruses carrying newly discovered CDAs fused to MG3-6. Successful transformants were selected by using 2 ⁇ g/mL of puromycin for 3 days. Death cells were washed with PBS and surviving cells were fixed and stained with 50% methanol and 1% crystal violet (Panel (a) of FIG.27). Cells were then photographed in a chemidoc and the absorbance was measured by dissolving the crystal violet in 1% SDS and taking measurements at 570 nm (Panel (b) of FIG.27).
  • the highly active CDA A0A2K5RDN7 shows high editing efficiency, but it also exhibits a high degree of cell toxicity (Panel (a) of FIG.27).
  • the deaminases were assayed as base editors (fused to MG3-6) and stably expressed in HEK293T cells.
  • MG93-3 and MG93-4 both showed much less cellular toxicity than A0A2K5RDN7.
  • Quantification of the toxicity assay shows that MG93-3 and MG93-4 are less toxic than rAPOBEC.
  • Example 26 Directed evolution of adenosine deaminase in E.
  • MG68-4 harboring a D109N mutation can improve DNA editing efficiency in E. coli.
  • this variant was designated r1v1.
  • the deaminase portion of MG68-4 (D109N)-nMG34-1 was randomly mutagenized by error prone PCR.
  • the resulting library was tested for the editing activity of variants by an E. coli positive selection using chloramphenicol acetyltransferase with H193Y mutation.
  • the gene fragment of MG68-4 (D109N) was mutagenized by GeneMorph II Random mutagenesis kit according to the manufacturer’s instructions.
  • Plasmids of these cells were isolated using QIAprep Spin Miniprep Kit (Qiagen) and MG68-4 variants were subcloned into pAL478 by digestion and ligation using restriction enzymes (SacII and KpnI) and T4 DNA ligase, respectively.
  • the resulting library was transformed into Endura electrocompetent cells (Lucigen), amplified, and isolated by miniprep.
  • Collected DNA was transformed into BL21(DE3) and tested for deaminase activity using chloramphenicol selection contain mutations that facilitated deaminase activity of the MG68 enzyme and survival under and sequenced by Sanger sequencing.
  • a total of 25 variants (r2v1 to r2v24 (SEQ ID NOs.837-860) were uncovered and mutations were confirmed by Sanger sequencing. Through this evolution process, 24 residues were identified that were mutated to other amino acids (FIG.28). These mutants contained mutations at T2 (e.g. T2A), D7 (e.g. D7G), E10 (e.g. E10G), M13 (e.g. M13R), W24 (e.g. W24G), G32 (e.g. G32A), K38 (e.g. K38E), G45 (e.g. G45D), G51 (e.g. G51V), A63 (e.g. T2A), D7 (e.g. D7G), E10 (e.g. E10G), M13 (e.g. M13R), W24 (e.g. W24G), G32 (e.g. G32A), K38 (e.g. K38E), G45 (e.
  • E66 e.g. E66V or E66D
  • R75 e.g. R75H
  • C91 e.g. C91R
  • G93 e.g. G93W
  • H97 e.g. H97Y or H97L
  • A107 e.g. A107V
  • E108 e.g. E108D
  • D109 e.g. D109N
  • P110 e.g. P110H
  • H124 e.g. H124Y
  • A126 e.g. A126D
  • H129 e.g. H129R or H129N
  • F150 e.g. F150P or F150S
  • S165 e.g. S165L
  • Example 27 Adenine base editors in mammalian cells
  • Variants of adenine base editors identified from E. coli selection in Example 27 were codon-optimized for mammalian cell expression and tested in HEK293T cells.
  • Four guides were designed to test A to G conversion in cells (SEQ ID NOs.861-864 for spacers and SEQ ID NO.
  • Linear DNA constructs containing the CDA and A1CF, a cofactor are amplified from constructs prepared by Twist (SEQ ID NO.741) using the same primers developed for the in gel assay on ssDNA. Constructs are cleaned by PCR Spin Column Cleanup (Qiagen) and analyzed by gel electrophoresis. Enzymes are expressed from the PCR templates in an in vitro transcription-translation system, PURExpress (NEB), at 37°C for 2.5 hours.
  • Deamination reactions are prepared by mixing 2uLs of the PURExpress reaction (CDA and A1CF) with 2uM ssRNA substrate (IDT, SEQ ID NO.742) in the presence of an RNAse inhibitor and incubating at 37C for 2 hours.5’ FAM labeled DNA primer (IDT, SEQ ID NO. 743) is then added to a concentration of 1.3 uM. The reaction is heated at 95 °C for 10 minutes and then allowed to cool gradually to room temperature for at least 30 minutes.
  • a reverse transcription mastermix comprising 5 mM DTT, Protoscript II RT (NEB) (5 U / L), Protoscript II Buffer (NEB) (1x), RNAseOut (ThermoFisher) (0.4 U / L), dTTP (0.25 mM), dCTP (0.25 mM), dATP (0.25 mM), and ddGTP (5 mM) is added.
  • a full length transcription product is produced when the RNA substrate is deaminated.
  • a “C” will remain in the RNA substrate, and the reverse transcription reaction will terminate upon incorporation of ddGTP opposite this C.
  • the reaction is incubated at 42 °C for one hour, and then at 65 °C for 10 minutes. Aliquots are then mixed with 2x RNA loading dye (NEB) and heated at 75 °C for 10 minutes, then cooled on ice for two minutes. Samples are loaded onto 10% or 15% Urea- TBE denaturing gels (Biorad). DNA bands are visualized by a Chemi-Doc imager (Biorad). Successful deamination is observed by the visualization of a full length (55 bp) fluorescently labeled band in the gel. Non-deaminated products appear as shorter (43bp) fluorescently labeled bands.
  • Fam72a has been documented as opposing uracil DNA glycosylase (UDG) during B cell somatic hypermutation and class-switch recombination to prevent mismatch-repair-based correction of m d Immunoglobulin alleles.
  • UDG uracil DNA glycosylase
  • HEK293 cells (150,000) were lipofected using JetOptimus according to the manufacturer’s instructions with plasmids encoding a Cas9-CBE fusion (pMG3078; 500 ng), a plasmid encoding either sgRNA PE266 or PE691 (250 ng), and a plasmid encoding either Fam72a (pMG3072; 500 ng) or not.
  • Cells were harvested 72 hours post-transfection, genomic DNA prepared, and the degree of base editing was determined via computational analysis of next-generation sequencing reads (FIG.32).
  • the CMV-driven Fam72a expression construct demonstrated increased CBE activity at two loci when Fam72a was co-expressed with a Cas9- based cytosine base editor. It was determined that Fam72a can be useful to improve cytosine base editing (CBE) with any type of cytosine base editor, not just Cas9-based constructs.
  • CBE cytosine base editing
  • Example 30 Structural optimization of adenine base editors
  • 33 rationally-designed ABE variants were constructed for use in mammalian cells under control of a CMV promoter (SEQ ID NOs: 1128-1160).
  • Eights constructs contained ABEs with a MG68-4 (D109N) adenine deaminase fused to either the N- or C-terminus of a MG3-6/3-8 nickase enzyme (D13A) with linker lengths of 20, 36, 48, and 62 amino acid residues. Additionally, 25 constructs contained ABEs with an MG68-4 (D109N) adenine deaminase inlaid within the RUVC-I, REC, HNH, RUVC-III, or WED domains with 18 amino acid linkers fused to either end. These constructs are summarized in Table 12A.
  • Table 12A Rationally-designed ABE Variants from Example 30 * Inlaid denotes the upstream native residue after which the deaminase is inserted. For example, Inlaid 887AA” indicates that the deaminase is inlaid between amino acids 887 and 888.
  • Plasmids expressing the 33 ABE variants were separately transiently co-transfected into HEK293 cells with plasmids expressing 8 sgRNAs (SEQ ID NOs: 1188-1195) targeting a specific locus in the human genome. After 72 hours, cells were harvested and analyzed for on- target editing (FIG.36 and Table 12B).
  • Sequencing results showed that 19 of the 33 ABEs were capable of on-target editing at a level of at least 1% editing when co-expressed with an sgRNA targeting the TRAC locus (FIG. 33).
  • Constructs used in this experiment included 3-68_DIV1_M_RDr1v1_B, 3- 68_DIV2_M_RDr1v1_B, 3-68_DIV3_M_RDr1v1_B, 3-68_DIV4_M_RDr1v1_B, 3- 68_DIV5_M_RDr1v1_B, 3-68_DIV6_M_RDr1v1_B, 3-68_DIV7_M_RDr1v1_B, 3- 68_DIV8_M_RDr1v1_B, 3-68_DIV9_M_RDr1v1_B, 3-68_DIV10_M_RDr1v1_B, 3-68_DIV10_M_RDr1v1_B, 3-
  • NLS nuclear localization signal
  • Example 32 Engineered CBEs to relax sequence selectivity of CDA at -1 position of the target cytosine and improved on-target activity on DNA
  • Two approaches were taken toward mutagenesis to improve the editing activity and selectivity for cytosine base editors (CBEs).
  • CBEs cytosine base editors
  • CDA variants (with MG93, MG139 and MG152 families) were designed with either a point mutation or a loop 7 swapping with AID deaminase that is documented to have a 5’RC selectivity (SEQ ID NOs: 1208-1315).
  • Table 12C Cytosine Base Editor Mutants Investigated in Example 32 [00504]
  • Example 33 In vitro activity of novel CDA variants from the MG93, MG139, and MG152 families [00505]
  • In vitro deaminase in-gel assay [00506] Linear DNA constructs containing the CDA were amplified from the previously mentioned plasmids from Twist via PCR.
  • FAM labeled ssDNA 4 different ssDNA substrates were used with different -1 nucleobase (A or C or T or G) next to the target cytidine (SEQ ID NOs: 1316-1319; FIG.37 Cy3 and Cy5.5 labeled ssDNA (IDT, 2 different substrates with either AC vs GC or CC vs TC, SEQ ID NOs: 1320-1321; FIG.38) and 1U USER Enzyme (NEB) in 1x Cutsmart Buffer (NEB). The reactions were incubated at 37 °C for 2 hours and then quenched by adding 4 units of proteinase K (NEB) and incubating at 55 °C for 10 minutes.
  • IDTT FAM labeled ssDNA
  • Example 34 Mammalian editing activity of novel and engineered CDAs as CBEs
  • an engineered cell line was devised with 5 consecutive PAMs compatible with MG3-6 and Cas9. This cell line allows for gRNA tiling to test editing efficiency and find -1 nt selectivity.
  • the CDAs were cloned in a plasmid backbone containing MG3-6. The CDAs were cloned in the N termini.
  • novel and variant CDAs were transiently transfected into the engineered HEK293T cells using lipofectamine 2000.
  • a total of 32 novel CDAs and 2 engineered variants were tested in the gRNA tiling experiment described above (SEQ ID NOs: 1322-1355).
  • Out of the 34 tested CDAs, 22 showed editing activity higher than 1% (FIG. 41A).
  • the top performers were MG152-6, MG139-52v6, MG93-4, MG139-52, MG139-94, MG93-7, MG93-3, MG139-12, MG139-103, MG139-95, MG139-99, MG139-90, MG139-89, MG139-93, MG138-30, MG139-102, MG93-4v16, MG152-5, MG138-20, MG138-23, MG93-5, MG152-4, and MG152-1.
  • FIG. 41B shows side by side comparison of 2 targeting spacers.139-52-V6 shows essentially the same editing activity as A0A2K5RDN7, as observed in FIG.41C.
  • -1nt selectivity 16 candidates of interest were selected.
  • the -1 nt mammalian cell selectivity was calculated by selecting the top 4 modified cytosines per guide RNA and calculating the ratio per -1 position. The analysis was restricted to cytosines with >1% editing. The average ratio for all 5 guides were plotted.
  • the -1nt in vitro selectivity was plotted by calculating the sum of percentage cleavages (percent cleavage measures percent deamination) per -1 nt selectivity and then calculating the ratio per -1 nucleotide.
  • the mammalian cell and in vitro -1 nt selectivity is shown in FIG.42.
  • CDA families are documented as having different –1 nt selectivities, and their selectivities tend to be conserved amongst proteins belonging to the same family.
  • the MG93 family is documented to be selective for T as -1
  • the MG139 family is documented to be selective for C as -1.
  • the active candidates are documented to have different –1 nt selectivities: 152-6 is selective for T in the -1 position, whereas the 139-52 (WT and engineered variant) has a strong selectivity for C at the -1 position. Having candidates with strong -1 nt selectivities is advantageous, since having a tighter nt selectivity improves off target activity.
  • Candidates with different and strong -1 nt selectivities allow for targeting of different loci with minimal off target activity. Notably, candidates with unusual -1 selectivities were identified.
  • Candidates with purine selectivities include 139-12 and 138-20, with A and G selectivities. These properties may generate variants with G and/or A -1 selectivities with high editing efficiencies.
  • the candidate 139-52 was documented as having deaminase activity on both ssDNA and on the DNA strand forming a DNA/RNA heteroduplex (also shown in FIG.43B). Having exclusive activity in the DNA forming a DNA/RNA heteroduplex may be advantageous in terms of guide-independent off target activity and smaller editing window, as such engineering for this feature is an important venue.
  • the 139-52-V6, 152-6, and 139-52 candidates have high editing efficiencies (FIGS. 41A, 41B, and 41C) and different -1 nt selectivities (FIG.42).
  • CDA candidate was cloned as CBE (using MG3-6 as partner), lentiviruses were produced, and cells were transduced.3 days post-transduction, cells were selected for viral integration and CBE expression by puromycin selection.
  • the puromycin cassette was downstream of CBEs with a 2A peptide; thus, cells surviving selection expressed the CBEs.
  • Surviving cells were dyed with crystal violet, crystal violet was then solubilized with SDS, and absorbance was taken in a plate reader. It was determined that different CDAs have various levels of cytotoxicity (FIGS.45).
  • Example 35 Using low activity CDAs with nickases with improved target binding affinity (prophetic) [00516] Analyzing the editing windows and cytotoxic profiles demonstrated that it may be advantageous to use CDAs with slower deamination kinetics in conjunction with effector enzymes with higher residency time in the targets. In order to create such systems, a long form tracr RNA (see e.g. Workman et al.
  • Cell 2021, 184, 675-688 which is incorporated by reference herein in its entirety
  • CDAs with various kinetics (low, medium, and high).
  • These systems may improve on target editing efficiencies of low and medium CDAs, while generating a narrower editing window and a more favorable cytotoxic profile.
  • Example 36 Adenine Deaminase Engineering (prophetic) [00518] To improve on-target activity on ssDNA and minimize cellular RNA-unguided deamination, all beneficial mutations previously identified from rational design and directed evolution in the literature were used to design new adenine deaminase (ADA) variants from novel deaminases families (MG129-MG137 and MG68 families, SEQ ID NOs: 1556-1638).
  • ADA new adenine deaminase
  • Table 12D Adenosine Deaminase Mutants Designed in Example 36 [00520] In vitro activity of novel ADA variants from MG129-MG137 and MG68 families [00521] In vitro deaminase in-gel assay [00522] Linear templates for candidate deaminases are amplified using plasmids from TWIST via PCR. Products are cleaned using SPRI beads (Lucigen) and eluted in 10 mM tris. Enzymes are then expressed in PURExpress(NEB) at 37 °C for 2 hours. Deamination reactions are SEQ ID NO: 1645) labeled with Cy5.5, 1 U EndoV(NEB), and 10X NEB4 Buffer.
  • Reactions are incubated at 37 °C for 20 hours. Samples are quenched by adding 4 units of proteinase K (NEB) RNA loading dye and incubated at 75 °C for 10 minutes. All reaction conditions are analyzed by gel electrophoresis in a 10% (TBE-urea) denaturing gel (Biorad). DNA bands are visualized by a Chemi-Doc imager (Biorad) and band intensities are quantified using BioRad Image Lab v6.0. Successful deamination is observed by the visualization of an intermediate fluorescently labeled band in the gel.
  • NEB proteinase K
  • Plasmid DNA was amplified in Endura electrocompetent cells (Lucigen) and isolated by QIAprep Spin Miniprep Kit (Qiagen). Vector backbones were prepared by restriction enzyme digestion of plasmids. Inserts were amplified by Q5 High-Fidelity DNA polymerase (New England Biolabs) using primers ordered either from Elim BIOPHARM or IDT. Both vector backbones and inserts were purified by gel extraction using the Gel DNA Recovery Kit (Zymo Research). One or multiple DNA fragments were assembled into the vectors through NEBuilder HiFi DNA assembly (New England Biolabs).
  • HEK293T cells were grown and passaged in Dulbecco’s Modified Eagle’s Medium plus GlutaMAX (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) at 37 oC with 5% CO 2 .2.5 x 10 4 cells (passage 3-8) were seeded on 96-well cell culture plates treated for cell attachment (Costar), grown for 20 to 24 h, and the spent media were refreshed with new media right before transfection.
  • Dulbecco Modified Eagle’s Medium plus GlutaMAX (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) at 37 oC with 5% CO 2 .2.5 x 10 4 cells (passage 3-8) were seeded on 96-well cell culture plates treated for cell attachment (Costar), grown for 20 to 24 h, and the spent media were refreshed with new media right before transfection.
  • 300 ng expression plasmid along with 100 well according to the manufacturer’s instructions.
  • 300 ng plasmid Transfected cells were grown for 3 days, harvested, and gDNA was extracted with QuickExtract (Lucigen) according to the manufacturer’s instructions.
  • Targeted regions for base edits were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs) with primers and extracted DNA as the templates.
  • PCR products were purified by HighPrep PCR Clean-up System (MAGBIO) according to the manufacturer’s instructions. After 72 hours, individual wells were visually assessed for cell viability based on cell growth and presence of floating cells in media.
  • MG68-4 is predicted to be a tRNA adenosine deaminase. As the natural enzymes of E. coli TadA (EcTadA) and S. aureus TadA (SaTadA) are both dimers, MG68-4 was suspected be a dimer as well.
  • Plasmid construction [00535] DNA fragments of genes were either synthesized at Twist Bioscience or Integrated DNA Technologies (IDT). Plasmid DNA was amplified in Endura electrocompetent cells (Lucigen) and isolated by QIAprep Spin Miniprep Kit (Qiagen). Vector backbones were prepared by restriction enzyme digestion of plasmids. Inserts were amplified by Q5 High-Fidelity DNA polymerase (New England Biolabs) using primers ordered either from Elim BIOPHARM or IDT.
  • HEK293T cells were grown and passaged in Dulbecco’s Modified Eagle’s Medium plus GlutaMAX (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) at 37 oC with 5% CO 2 .2.5 x 10 4 cells (passage 3-8) were seeded on 96-well cell culture plates treated for cell attachment (Costar), grown for 20 to 24 h, and the spent media were refreshed with new media right before transfection.
  • Dulbecco Modified Eagle’s Medium plus GlutaMAX (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) at 37 oC with 5% CO 2 .2.5 x 10 4 cells (passage 3-8) were seeded on 96-well cell culture plates treated for cell attachment (Costar), grown for 20 to 24 h, and the spent media were refreshed with new media right before transfection.
  • GlutaMAX gibco
  • gibco
  • plasmid Transfected cells 300 ng plasmid Transfected cells were grown for 3 days, harvested, and gDNA was extracted with QuickExtract (Lucigen) according to the manufacturer’s instructions.
  • Targeted regions for base edits were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs) with primers and extracted DNA as the templates.
  • PCR products were purified by HighPrep PCR Clean-up System (MAGBIO) according to the manufacturer’s instructions. After 72 hours, individual wells were visually assessed for cell viability based on cell growth and presence of floating cells in media. Following the visual assessment of cell viability, cells were harvested and genomic DNA extracted.
  • PCR primers appropriate for use in NGS-based DNA sequencing were generated, optimized, and used to amplify the individual target sequences for each guide RNA.
  • the amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing.
  • Results [00539] Through directed evolution of the predicted tRNA adenosine deaminase of MG68-4 (D109N)-nMG34-1 (D10A) in E. coli, two mutants (D109N/D7G/E10G and D109N/H129N) were observed to outperform the D109N mutant for higher editing A to G efficiency in HEK293T cells.
  • a 3-68_DIV30_D ABE was designed in which two MG68-4 (D109N) monomers are connected by a 65AA linker and inlaid within the 3-68 scaffold at the same V30 insertion site as 3-68_DIV30_M (SEQ ID NOs: 1410-1411).
  • This dimeric form of the 3-68 ABE increased editing at position A10 of a site within the TRAC gene when co-transfected with a plasmid expressing sgRNA68 (SEQ ID NO: 1421) from 8% (3-68_DIV30_M) to 18% (3-68_DIV30_D) sgRNA68.
  • SEQ ID NO: 1421 The influence of two different MG68-4 variants (H129N or D7G/E10G) was also tested on 3-68_DIV30_M and 3-68_DIV30_D already containing D109N (SEQ ID NOs: 1412- 1415).
  • the H129N or D7G/E10G mutation was installed within the second MG68-4 D109N, and the first deaminase remained MG68-4 D109N.
  • the H129N and D7G/E10G variants were identified using an error-prone PCR library of MG68-4 fused to MG34-1 and selecting for A to G conversion in E. Coli. After addition of either the H129N or D7G/E10G variants, in both the monomeric and dimeric MG68-4 D109N, editing was slightly lower as compared to the 3-68_DIV30 MG68-4 D109N ABE in the equivalent monomeric/dimeric form (FIG.49).
  • Example 39 Engineering of nMG35-1 as a base editor [00543] E. coli selection [00544] A nickase MG35-1 containing a D59A mutation with a C-terminally fused TadA*-(7.10) monomer along with a C-terminus SV40 NLS was constructed to test MG35-1 adenine base editor (ABE) activity (SEQ ID NOs: 1424-1426).
  • This ABE was tested with its compatible sgRNA containing either a 20 nucleotide spacer sequence targeting the chloramphenicol acetyltransferase (CAT) gene or a non-targeting spacer sequence of the same 20 nucleotides in a scrambled order (SEQ ID NOs: 1429-1430).
  • the CAT gene contains a H193Y mutation that renders the CAT gene nonfunctional against chloramphenicol selection.
  • the ABE, sgRNA, and non-functional CAT gene were cloned into a pET-21 backbone containing Ampicillin resistance. E. Coli were left at 37 oC for 40 hours. Colonies were sequenced by Elim Biopharmaceuticals, Inc.
  • an adenine base editor was constructed by fusing a TadA*-(7.10) monomer to the C-terminus of a nickase form of MG35-1 containing a D59A mutation (SEQ ID NO: 1424).
  • the A to G editing of this ABE was tested in a positive selection single-plasmid E. Coli system in which the ABE is required to revert a chloramphenicol acetyltransferase (CAT) gene containing a Y193 mutation back to H193 in order for the E. Coli cell to survive chloramphenicol selection.
  • CAT chloramphenicol acetyltransferase
  • This plasmid contained an sgRNA with a spacer either targeting the mutant CAT gene or a scrambled, non-targeting spacer region.
  • An enrichment of colonies was detected with E. Coli transformed with the MG35-1 ABE targeting the CAT gene when plated on plates containing 2, 3, and 4 chloramphenicol.
  • Sanger sequencing confirmed that 26/30 colonies picked from the 2, 3, and 4 reversion. It is likely that the 4 colonies without the reverted CAT sequence contain more unedited than edited copies of the selection construct as one reverted CAT gene is sufficient to E. Coli plate transformed with the targeting MG35-1 ABE contained the Y193H reversion, indicating a detectable level of editing even without chloramphenicol selection.
  • Example 40 Guide screening for the nMG3-6/3-8 ABE in mouse hepatocytes
  • Cell culture, transfections, next generation sequencing, and base edit analysis for screens [00549] Hepa1-6 cells were grown and passaged in Dulbecco’s Modified Eagle’s Medium plus 1X NEAA (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) and 1% pen-strep at 37 oC with 5% CO2.1 x 10 5 cells were nucleofected with 500 ng IVT mRNA and 150 pmol chemically-synthesized sgRNA (IDT) using a Lonza-4D nucleofector (program EH-100).
  • gDNA was extracted with QuickExtract (Lucigen) according to the manufacturer’s instructions.
  • Targeted regions for base edits were amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs) with primers appropriate for use with NGS-based DNA sequencing (SEQ ID NOs: 1493-1554) and extracted DNA as the templates.
  • PCR products were purified by HighPrep PCR Clean-up System (MAGBIO) according to the manufacturer’s instructions. Amplicons were sequenced on an Illumina MiSeq machine and analyzed with a proprietary Python script to measure gene editing.
  • mRNA production [00550] Sequences for base editor mRNA were codon optimized for human expression (GeneArt), then synthesized and cloned into a high copy ampicillin plasmid (Twist Biosciences). Synthesized constructs encoding T7 promoter, UTRs, base editor ORF, and NLS sequences were digested from the Twist backbone with HindII and BamHI (NEB), and ligated into a pUC19 plasmid backbone (SEQ ID NO: 1555) with T4 DNA ligase and 1x reaction buffer (NEB).
  • the complete base editor mRNA plasmid comprised an origin of replication, ampicillin resistance cassette, the synthesized construct, and an encoded polyA tail.
  • Base editor mRNA was synthesized via in vitro transcription (IVT) using the linearized base editor mRNA plasmid. This plasmid was linearized by incubation at 37 °C for 16 hours with SapI (NEB) enzyme. The reaction buffer.
  • the linearized plasmid was purified with Phenol:Chloroform:Isoamyl Alcohol (25:24:1, v/v), precipitated in EtOH, and resuspended in nuclease-free water at an adjusted (NEB), and Nl-methyl pseudo-UTP (TriLink); 18750 U/mL Hi-T7 RNA Polymerase (NEB); 4 mM CleanCap AG (TriLink); 2.5 U/mL Inorganic E. coli pyrophosphatase (NEB); 1000 U/mL murine RNase Inhibitor (NEB); and 1x transcription buffer.
  • Example 41 – mRNA cytidine base editors [00556] To test the activity of the engineered cytidine deaminases at scale, 527 chemically- synthesized guides suitable for use with MG3-6/3-8 to target four therapeutically relevant loci in the mouse genome were designed and purchased from IDT. These guides were co-transfected with in vitro synthesized mRNA in Hepa1-6 (a mouse immortalized mouse hepatocyte cell line) via nucleofection, and C to T conversion was assayed three days post-nucleofection. Prior to harvesting, individual wells were visually assessed for cell viability based on cell growth and presence of floating cells in media.
  • Hepa1-6 a mouse immortalized mouse hepatocyte cell line
  • Example 42 Base editing preferences for nMG35-1 ABE [00560] As described in Example 39, E.
  • coli was transformed with a plasmid containing the nMG35-1-ABE, a non-functional chloramphenicol acetyltransferase (CAT Y193) gene, and an sgRNA that either targets the CAT gene (targeting spacer) or not (scrambled spacer).
  • Cell growth is dependent on the ABE base editing the non-functional CAT gene (A at position 17 from the TAM) (FIG.55A) to its wild-type variant (H193) and restoring activity.
  • Multiple linkers were evaluated for nMG35-1 fusions to the TadA deaminase monomer (Table 14). Table 14: Linkers evaluated for nMG35-1 fusions with a TadA deaminase.
  • E. coli positive selection As described in Example 39, a single plasmid construct encompassing a nickase MG35- 1 (D59A mutation), a C-terminally fused TadA*-(7.10) monomer, and a C-terminus SV40 NLS (SEQ ID NO: 369) was tested as a base editor with its compatible sgRNA containing a 20 bp spacer sequence targeting the chloramphenicol acetyltransferase (CAT) gene. A non-targeting sgRNA lacking a spacer sequence was used as negative control.
  • CAT chloramphenicol acetyltransferase
  • the CAT gene contained either an engineered stop codon (at amino acid positions 98 or 122) or a H193Y mutation that renders the CAT gene nonfunctional (FIGs.56A and 56B).
  • the ABE construct, sgRNA, and non- functional CAT gene were cloned into a pET-21 backbone containing Ampicillin resistance. Ten E. coli cells and containing transformed cells was plated onto plates containing chloramphenicol concentrations of mutations were verified in the resulting colonies by Sanger sequencing (Elim Biopharmaceuticals, Inc). [00566] Results [00567] The A to G editing of the nMG35-1 ABE was tested in a positive selection single- plasmid E.
  • nMG35-1 ABE Four distinct non-functional CAT genes were tested for reversion by the nMG35-1 ABE: three single mutations (a stop codon at residue 98 reversion to Q; a stop codon at residue 122 reversion to Q; and Y at residue 193 reversion to H) and a double mutation in which a CAT gene contains two stop codons at both residues 98 and 122 (both need to be reverted to Q simultaneously to restore CAT gene functionality). These four conditions were tested alongside paired negative controls in which the non-functional CAT genes were co-expressed with sgRNAs missing a spacer sequence. The nMG35-1 ABE successfully edited the four conditions, including the double mutant reversion, as shown by an enrichment of E.
  • FIG.56C “targeting” row). Few colonies stop codon mutations at residues 98 and 122 (FIG.56C, “targeting” row). Sanger sequencing of that 17 of 18 colonies showed the expected A to G edit at both target sites (FIG.56D). No E. coli transformed with the non- targeting guide (FIG.56C, “no spacer” row), confirming that the nMG35-1-ABE is a successful base editor in E. coli.
  • Example 44 Base editing in human cells with nMG35-1-ABE (prophetic)
  • a nickase MG35-1 D59A mutation
  • a C-terminally fused TadA(8.8m) deaminase monomer and a C-terminus SV40 NLS fusion system is constructed.
  • HEK293T cells are grown and passaged in Dulbecco’s Modified Eagle’s Medium plus GlutaMAX (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) at 37 oC with 5% CO2. About 2.5 x 10 4 cells are seeded on 96-well cell culture plates treated for cell attachment (Costar), and grown for 20 to 24 h (spent media are refreshed with new media before transfection). Each plate well receives 300 according to the manufacturer’s instructions. Transfected cells are grown for three days, harvested, and genomic DNA is extracted with QuickExtract (Lucigen) according to the manufacturer’s instructions.
  • Dulbecco Modified Eagle’s Medium plus GlutaMAX (gibco) supplemented with 10% (v/v) fetal bovine serum (gibco) at 37 oC with 5% CO2.
  • About 2.5 x 10 4 cells are seeded on 96-well cell culture plates treated for cell attachment (Costar), and grown for
  • Targeted regions for base edits are amplified using Q5 High-Fidelity DNA polymerase (New England Biolabs) with target-specific primers and PCR products purified with the HighPrep PCR Clean-up System (MAGBIO) according to the manufacturer’s instructions.
  • Q5 High-Fidelity DNA polymerase New England Biolabs
  • PCR products purified with the HighPrep PCR Clean-up System (MAGBIO) according to the manufacturer’s instructions.
  • NGS next generation sequencing
  • Primers used for next generation sequencing (NGS) are appended to PCR products by subsequent PCR reactions using the KAPA HiFi HotStart ReadyMix PCR Kit (Roche) and primers compatible with TruSeq DNA Library Prep Kits (Illumina). DNA concentrations of the resulting products are quantified by TapeStation (Agilent), and samples are pooled to prepare the library for NGS analysis.
  • Embodiment 1 An engineered nucleic acid editing system, comprising: (a) an endonuclease comprising a RuvC domain and an HNH domain, wherein said endonuclease is derived from an uncultivated microorganism, wherein said endonuclease is a class 2, type II endonuclease, wherein said endonuclease is configured to be deficient in nuclease activity; (b) a base editor coupled to said endonuclease; and (c) an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: i.a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and ii.a ribonucleic acid sequence configured to bind to said endonuclease.
  • Embodiment 2 The engineered nucleic acid editing system of Embodiment 1, wherein said RuvC domain lacks nuclease activity.
  • Embodiment 3. The engineered nucleic acid editing system of Embodiment 1, wherein said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid.
  • Embodiment 4. The engineered nucleic acid editing system of Embodiment 1 or Embodiment 2, wherein said class 2, type II endonuclease comprises a nickase mutation.
  • Embodiment 6 The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 4, wherein said endonuclease comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof.
  • Embodiment 6 The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 4, wherein said endonuclease comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof.
  • said class 2, type II endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597 when optimally aligned.
  • An engineered nucleic acid editing system comprising: (a) an endonuclease having at least 95% sequence identity to any one of SEQ ID NOs: 70-78, 596, or 597-598, or a variant thereof; (b) a base editor coupled to said endonuclease; and (c) an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: i.a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and ii.a ribonucleic acid sequence configured to bind to said endonuclease.
  • An engineered nucleic acid editing system comprising: (a) an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 360-368 or 598, or a variant thereof, wherein said endonuclease is a class 2, type II endonuclease, and wherein said endonuclease is configured to be deficient in nuclease activity; (b) a base editor coupled to said endonuclease; and (c) an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: i.a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and ii.a ribonucleic acid sequence configured to bind to said endonuclease.
  • PAM protospacer adjacent motif
  • Embodiment 10 The engineered nucleic acid editing system of Embodiment 9, wherein said endonuclease comprises a nickase mutation.
  • Embodiment 11 The engineered nucleic acid editing system of Embodiment 9, wherein said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid.
  • said class 2, type II endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597 when optimally aligned.
  • Embodiment 14 The engineered nucleic acid editing system of Embodiment 9, wherein said base editor comprises a sequence having at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51 or 385-390.
  • Embodiment 16 The engineered nucleic acid editing system of any one of Embodiment 8- Embodiment 15, wherein said endonuclease is derived from an uncultivated microorganism.
  • Embodiment 17. The engineered nucleic acid editing system of any one of Embodiment 8- Embodiment 16, wherein said endonuclease has less than 80% identity to a Cas9 endonuclease.
  • Embodiment 19 The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 18, wherein said engineered guide ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof.
  • Embodiment 20 is a sequence with at least 80% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof.
  • An engineered nucleic acid editing system comprising, (a) an engineered guide ribonucleic acid structure comprising: (i) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and (ii) a ribonucleic acid sequence configured to bind to an endonuclease, wherein said engineered ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680, or a variant thereof; and (b) a class 2, type II endonuclease configured to bind to said engineered guide ribonucleic acid; and (c) a base editor coupled to said endonuclease.
  • Embodiment 21 The engineered nucleic acid editing system of Embodiment 20, wherein said endonuclease is configured to bind to a protospacer adjacent motif (PAM) sequence selected from the group consisting of SEQ ID NOs: 360-368 or 598.
  • Embodiment 22 The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 21, wherein said base editor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof.
  • Embodiment 23 Embodiment 23.
  • Embodiment 24 The engineered nucleic acid editing system of any of embodiments Embodiment 1-Embodiment 22, wherein said base editor is an adenine deaminase.
  • Embodiment 25 The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 22, wherein said base editor comprises a sequence having at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51 or 385-390.
  • Embodiment 26. The engineered nucleic acid editing system of any of Embodiment 1- Embodiment 22, wherein said base editor is a cytosine deaminase.
  • Embodiment 28. The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 27, comprising a uracil DNA glycosylase inhibitor (UGI) coupled to said endonuclease or said base editor.
  • UMI uracil DNA glycosylase inhibitor
  • UMI uracil DNA glycosylase inhibitor
  • Embodiment 30 The engineered nucleic acid editing system of any one of embodiments 1- Embodiment 29, wherein said engineered guide ribonucleic acid structure comprises at least two ribonucleic acid polynucleotides.
  • the engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 31 wherein said guide ribonucleic acid sequence is complementary to a prokaryotic, bacterial, archaeal, eukaryotic, fungal, plant, mammalian, or human genomic sequence.
  • Embodiment 33 Embodiment 33.
  • Embodiment 34. The engineered nucleic acid editing system of any one of embodiments 1- Embodiment 33, further comprising one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease.
  • NLSs nuclear localization sequences
  • Embodiment 35 The engineered nucleic acid editing system of Embodiment 34, wherein said NLS comprises a sequence with at least 90% identity to a selected from SEQ ID NOs: 369-384, or a variant thereof.
  • Embodiment 37. The engineered nucleic acid editing system of Embodiment 36, wherein a polypeptide comprises said endonuclease and said base editor.
  • Embodiment 38. The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 37, wherein said endonuclease is configured to cleave one strand of a double- stranded target deoxyribonucleic acid.
  • Embodiment 40 The engineered nucleic acid editing system of any one of Embodiment 1- Embodiment 38, wherein said system further comprises a source of Mg 2+ .
  • Embodiment 40 The engineered nucleic acid editing system of any one of embodiments 1- Embodiment 39, wherein: a) said endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to any one of SEQ ID NOs: 70, 71, 73, 74, 76, 78, 77, or 78, or a variant thereof; b) said guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to non-degenerate nucleotides of any one of SEQ ID NOs: 88, 89, 91, 92, 94, 96, 95, or 488; c) said endonuclease is configured to bind to a PAM comprising any one of SEQ ID NOs: 360, 361,
  • Embodiment 41 The engineered nucleic acid editing system of any one of embodiments 1- Embodiment 39, wherein: a) said endonuclease comprises a sequence at least 70%, at least 80%, or at least 90% identical to any one of SEQ ID NOs: 70, 71, or 78, or a variant thereof; b) said guide RNA structure comprises a sequence at least 70%, at least 80%, or at least 90% identical to non-degenerate nucleotides of at least one of SEQ ID NOs: 88, 89, or 96; c) said endonuclease is configured to bind to a PAM comprising any one of SEQ ID NOs: 360, 362, or 368; or d) said base editor comprises a sequence at least 70%, at least 80%, or at least 90% identical to SEQ ID NO: 594, or a variant thereof.
  • Embodiment 42 The engineered nucleic acid editing system of any one of embodiments 1- Embodiment 41, wherein said sequence identity is determined by a BLASTP, CLUSTALW, MUSCLE, MAFFT, or Smith-Waterman homology search algorithm.
  • Embodiment 43 The engineered nucleic acid editing system of Embodiment 42, wherein said sequence identity is determined by said BLASTP homology search algorithm using parameters of a wordlength (W) of 3, an expectation (E) of 10, and a BLOSUM62 scoring matrix setting gap costs at existence of 11, extension of 1, and using a conditional compositional score matrix adjustment.
  • Embodiment 44 Embodiment 44.
  • Embodiment 45 A nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein said nucleic acid encodes a class 2, type II endonuclease coupled to a base editor, and wherein said endonuclease is derived from an uncultivated microorganism.
  • Embodiment 46 A nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein said nucleic acid encodes a class 2, type II endonuclease coupled to a base editor, and wherein said endonuclease is derived from an uncultivated microorganism.
  • a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein said nucleic acid encodes an endonuclease having at least 70% sequence identity to any one of SEQ ID NOs: 70-78 coupled to a base editor.
  • Embodiment 47. The nucleic acid of any one of emboiments Embodiment 44-Embodiment 46, wherein said endonuclease comprises a sequence encoding one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease.
  • NLSs nuclear localization sequences
  • Embodiment 47 wherein said NLS comprises a sequence with at least 90% identity to a selected from SEQ ID NOs: 369-384, or a variant thereof.
  • Embodiment 49 The nucleic acid of any one of Embodiment 44-Embodiment 48, wherein said organism is prokaryotic, bacterial, eukaryotic, fungal, plant, mammalian, rodent, or human.
  • Embodiment 50 A vector comprising a nucleic acid sequence encoding a class 2, type II endonuclease coupled to a base editor, wherein said endonuclease is derived from an uncultivated microorganism.
  • Embodiment 51 The nucleic acid of Embodiment 47, wherein said NLS comprises a sequence with at least 90% identity to a selected from SEQ ID NOs: 369-384, or a variant thereof.
  • Embodiment 49 The nucleic acid of any one of Embodiment 44-Embodiment 48, wherein
  • Embodiment 52. The vector of any of Embodiment 50-Embodiment 51, further comprising a nucleic acid encoding an engineered guide ribonucleic acid structure configured to form a complex with said endonuclease comprising: a) a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and b) a ribonucleic acid sequence configured to binding to said endonuclease.
  • Embodiment 50-Embodiment 52 wherein the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus.
  • Embodiment 54 A cell comprising the vector of any of Embodiment 50-Embodiment 53.
  • Embodiment 55. A method of manufacturing an endonuclease, comprising cultivating said cell of Embodiment 54.
  • Embodiment 56 is a method of manufacturing an endonuclease, comprising cultivating said cell of Embodiment 54.
  • a method for modifying a double-stranded deoxyribonucleic acid polynucleotide comprising contacting said double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: a) an endonuclease comprising a RuvC domain and an HNH domain, wherein said endonuclease is derived from an uncultivated microorganism, wherein said endonuclease is a class 2, type II endonuclease, and wherein said RuvC domain lacks nuclease activity; b) a base editor coupled to said endonuclease; and c) an engineered guide ribonucleic acid structure configured to bind to said endonuclease and said double-stranded deoxyribonucleic acid polynucleotide; wherein said double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM).
  • Embodiment 57 The method of Embodiment 56, wherein said endonuclease comprising a RuvC domain and an HNH domain is covalently coupled directly to said base editor or covalently coupled to said base editor through a linker.
  • Embodiment 58 The method of Embodiment 56 or Embodiment 57, wherein said endonuclease comprising a RuvC domain and an HNH domain comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof.
  • Embodiment 59 Embodiment 59.
  • Embodiment 56-Embodiment 57 wherein said endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73 or 78, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, residue 8 relative to SEQ ID NO: 77, or residue 10 relative to SEQ ID NO: 597 when optimally aligned.
  • Embodiment 60 comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73 or 78, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, residue 8 relative to SEQ ID NO: 77, or residue 10 relative to SEQ ID NO: 597 when optimally aligned.
  • Embodiment 56-Embodiment 57 wherein said endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NO: 72, or residue 17 relative to SEQ ID NO: 75 when optimally aligned.
  • Embodiment 61 the endonuclease comprises an aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NO: 72, or residue 17 relative to SEQ ID NO: 75 when optimally aligned.
  • a method for modifying a double-stranded deoxyribonucleic acid polynucleotide comprising contacting said double-stranded deoxyribonucleic acid polynucleotide with a complex comprising: a class 2, type II endonuclease, a base editor coupled to said endonuclease, and an engineered guide ribonucleic acid structure configured to bind to said endonuclease and said double-stranded deoxyribonucleic acid polynucleotide; wherein said double-stranded deoxyribonucleic acid polynucleotide comprises a protospacer adjacent motif (PAM); and wherein said PAM comprises a sequence selected from the group consisting of SEQ ID NOs:70- 78 or 597.
  • PAM protospacer adjacent motif
  • Embodiment 62 The method of Embodiment 61, wherein said class 2, type II endonuclease is covalently coupled to said base editor or coupled to said base editor through a linker.
  • Embodiment 63 The method of Embodiment 61 or Embodiment 62, wherein said base editor comprises a sequence with at least 70%, at least 80%, at least 90% or at least 95% identity to a sequence selected from SEQ ID NOs: 1-51, 57-66, 385-443, 444-475, 594-595, or 599-675, or a variant thereof.
  • Embodiment 64 Embodiment 64.
  • Embodiment 65 The method of Embodiment 64, wherein said adenine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 50- 51, 57, 385-443, 448-475, or 595, or a variant thereof.
  • Embodiment 66 The method of any one of Embodiment 61-Embodiment 63, wherein said base editor comprises an adenine deaminase; said double-stranded deoxyribonucleic acid polynucleotide comprises an adenine; and modifying said double-stranded deoxyribonucleic acid polypeptide comprises converting said adenine to guanine.
  • Embodiment 65 The method of Embodiment 64, wherein said adenine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 50- 51, 57
  • Embodiment 61-Embodiment 63 wherein said base editor comprises a cytosine deaminase; said double-stranded deoxyribonucleic acid polynucleotide comprises a cytosine; and modifying said double-stranded deoxyribonucleic acid polypeptide comprises converting said cytosine to uracil.
  • Embodiment 67 The method of Embodiment 66, wherein said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 1- 49, 444-447, 594, 58-66, or 599-675, or a variant thereof.
  • Embodiment 68 The method of any one of Embodiment 61-Embodiment 67, wherein said complex further comprises a uracil DNA glycosylase inhibitor coupled to said endonuclease or said base editor.
  • Embodiment 69 The method of Embodiment 68, wherein said uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof.
  • Embodiment 70 Embodiment 70.
  • Embodiment 61-Embodiment 69 wherein said double-stranded deoxyribonucleic acid polynucleotide comprises a first strand comprising a sequence complementary to a sequence of said engineered guide ribonucleic acid structure and a second strand comprising said PAM.
  • Embodiment 71 The method of Embodiment 70, wherein said PAM is directly adjacent to the 3' end of said sequence complementary to said sequence of said engineered guide ribonucleic acid structure.
  • Embodiment 72 is directly adjacent to the 3' end of said sequence complementary to said sequence of said engineered guide ribonucleic acid structure.
  • class 2, type II endonuclease is not a Cas9 endonuclease, a Cas14 endonuclease, a Cas12a endonuclease, a Cas12b endonuclease, a Cas 12c endonuclease, a Cas12d endonuclease, a Cas12e endonuclease, a Cas13a endonuclease, a Cas13b endonuclease, a Cas13c endonuclease, or a Cas 13d endonuclease.
  • Embodiment 73 The method of any one of Embodiment 61-Embodiment 72, wherein said class 2, type II endonuclease is derived from an uncultivated microorganism.
  • Embodiment 74 The method of any one of Embodiment 61-Embodiment 73, wherein said double-stranded deoxyribonucleic acid polynucleotide is a eukaryotic, plant, fungal, mammalian, rodent, or human double-stranded deoxyribonucleic acid polynucleotide.
  • Embodiment 75 Embodiment 75.
  • a method of modifying a target nucleic acid locus comprising delivering to said target nucleic acid locus said engineered nucleic acid editing system of any one of embodiments 1-Embodiment 44, wherein said endonuclease is configured to form a complex with said engineered guide ribonucleic acid structure, and wherein said complex is configured such that upon binding of said complex to said target nucleic acid locus, said complex modifies a nucleotide of said target nucleic locus.
  • Embodiment 76 Embodiment 76.
  • Embodiment 75 wherein said engineered nucleic acid editing system comprises an adenine deaminase, said nucleotide is an adenine, and modifying said target nucleic acid locus comprises converting said adenine to a guanine.
  • Embodiment 77 The method of Embodiment 75, wherein said engineered nucleic acid editing system comprises a cytidine deaminase and a uracil DNA glycosylase inhibitor, said nucleotide is a cytosine and modifying said target nucleic acid locus comprises converting said adenine to a uracil.
  • Embodiment 78 Embodiment 78.
  • Embodiment 75-Embodiment 77 wherein said target nucleic acid locus comprises genomic DNA, viral DNA, or bacterial DNA.
  • Embodiment 79. The method of any one of Embodiment 75-Embodiment 78, wherein said target nucleic acid locus is in vitro.
  • Embodiment 80. The method of any one of Embodiment 75-Embodiment 78, wherein said target nucleic acid locus is within a cell.
  • Embodiment 81 is
  • Embodiment 80 wherein said cell is a prokaryotic cell, a bacterial cell, a eukaryotic cell, a fungal cell, a plant cell, an animal cell, a mammalian cell, a rodent cell, a primate cell, or a human cell.
  • Embodiment 82 The method of any one of Embodiment 80-Embodiment 81, wherein said cell is within an animal.
  • Embodiment 83 The method of Embodiment 82, wherein said cell is within a cochlea.
  • Embodiment 84 The method of any one of Embodiment 80-Embodiment 81, wherein said cell is within an embryo.
  • Embodiment 85 The method of any one of Embodiment 80-Embodiment 81, wherein said cell is within an embryo.
  • Embodiment 84 wherein said embryo is a two-cell embryo.
  • Embodiment 86 The method of Embodiment 84, wherein said embryo is a mouse embryo.
  • the method of any one of Embodiment 75-Embodiment 86, wherein delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering the nucleic acid of any of embodiments Embodiment 46-Embodiment 49 or the vector of any of embodiments Embodiment 50-Embodiment 53.
  • Embodiment 88 Embodiment 88.
  • delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding said endonuclease.
  • delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a nucleic acid comprising an open reading frame encoding said endonuclease.
  • Embodiment 89. The method of Embodiment 88, wherein said nucleic acid comprises a promoter to which said open reading frame encoding said endonuclease is operably linked.
  • Embodiment 90 is delivering a nucleic acid comprising an open reading frame encoding said endonuclease.
  • Embodiment 75-Embodiment 89 The method of any one of Embodiment 75-Embodiment 89, wherein delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a capped mRNA comprising said open reading frame encoding said endonuclease.
  • Embodiment 91 The method of any one of Embodiment 75-Embodiment 86, wherein delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a polypeptide.
  • Embodiment 92 The method of any one of Embodiment 75-Embodiment 89, wherein delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a polypeptide.
  • delivering said engineered nucleic acid editing system to said target nucleic acid locus comprises delivering a deoxyribonucleic acid (DNA) encoding said engineered guide ribonucleic acid structure operably linked to a ribonucleic acid (RNA) pol III promoter.
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • An engineered nucleic acid editing polypeptide comprising: an endonuclease comprising a RuvC domain and an HNH domain, wherein said endonuclease is derived from an uncultivated microorganism, wherein said endonuclease is a class 2, type II endonuclease, and wherein said RuvC domain lacks nuclease activity; and a base editor coupled to said endonuclease.
  • Embodiment 94 The engineered nucleic acid editing polypeptide of Embodiment 93, wherein said endonuclease comprises a sequence with at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof.
  • Embodiment 95 An engineered nucleic acid editing polypeptide, comprising: an endonuclease having at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof, wherein said endonuclease comprises a RuvC domain lacking nuclease activity; and a base editor coupled to said endonuclease.
  • an engineered nucleic acid editing polypeptide comprising: an endonuclease having at least 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof, wherein said endonuclease comprises a RuvC domain lacking nuclease activity; and a base editor coupled to said endonuclease.
  • An engineered nucleic acid editing polypeptide comprising: an endonuclease configured to bind to a protospacer adjacent motif (PAM) sequence comprising any one of SEQ ID NOs: 360-368 or 598, wherein said endonuclease is a class 2, type II endonuclease, and wherein said endonuclease comprises a RuvC domain lacks nuclease activity; and a base editor coupled to said endonuclease.
  • PAM protospacer adjacent motif
  • Embodiment 99. The engineered nucleic acid editing polypeptide of any one of Embodiment 95- Embodiment 98, wherein said endonuclease further comprises an HNH domain.
  • tracr ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to about 60 to 90 consecutive nucleotides selected from any one of SEQ ID NOs: 88-96, 488, 489, and 679-680.
  • Embodiment 102. The engineered nucleic acid editing polypeptide of any one of Embodiment 93-Embodiment 101, wherein said base editor is an adenine deaminase.
  • Embodiment 103 Embodiment 103.
  • Embodiment 102 The engineered nucleic acid editing polypeptide of Embodiment 102, wherein said adenosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 50-51, 57, 385-443, 448-475, or 595, or a variant thereof.
  • Embodiment 104 The engineered nucleic acid editing polypeptide of any one of Embodiment 93-Embodiment 101, wherein said base editor is a cytosine deaminase.
  • Embodiment 105 Embodiment 105.
  • Embodiment 104 The engineered nucleic acid editing polypeptide of Embodiment 104, wherein said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 594, or 58-66, or a variant thereof.
  • Embodiment 106 The engineered nucleic acid editing polypeptide of Embodiment 104, wherein said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 1-49, 444-447, 594, or 58-66, or a variant thereof.
  • An engineered nucleic acid editing polypeptide comprising: an endonuclease, wherein said endonuclease is configured to be deficient in endonuclease activity; and a base editor coupled to said endonuclease, wherein said base editor comprises a sequence with at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs: 1-51, 385-386, 387-443, 444-447, 488-475, 595, or 599-675, or a variant thereof.
  • the engineered nucleic acid editing polypeptide of Embodiment 106 wherein said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid.
  • Embodiment 108. The engineered nucleic acid editing polypeptide of Embodiment 106, wherein said endonuclease is configured to be catalytically dead.
  • Embodiment 109. The engineered nucleic acid editing polypeptide of any one of Embodiment 106-Embodiment 108, wherein said endonuclease is an endonuclease.
  • Embodiment 110 is
  • the engineered nucleic acid editing polypeptide of Embodiment 109 wherein said endonuclease is a Class II, type II endonuclease or a Class II, type V endonuclease.
  • Embodiment 111 The engineered nucleic acid editing polypeptide of Embodiment 106, wherein said endonuclease comprises a sequence having at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof.
  • Embodiment 113 The engineered nucleic acid editing polypeptide of any one of Embodiment 109-Embodiment 111, wherein said endonuclease comprises a nickase mutation.
  • Embodiment 113 The engineered nucleic acid editing polypeptide of Embodiment 112, wherein said endonuclease comprises the aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597.
  • Embodiment 114 The engineered nucleic acid editing polypeptide of any one of Embodiment 109-Embodiment 111, wherein said endonuclease comprises a nickase mutation.
  • Embodiment 113 The engineered nucleic
  • PAM protospacer adjacent motif
  • Embodiment 115. The engineered nucleic acid editing polypeptide of any one of Embodiment 106-Embodiment 114, wherein said base editor is an adenine deaminase.
  • Embodiment 116 Embodiment 116.
  • the engineered nucleic acid editing polypeptide of Embodiment 115 wherein said adenosine deaminase comprises a sequence with at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 50- 51, 385-443, 448-475, or 595, or a variant thereof.
  • Embodiment 117 Embodiment 117.
  • the engineered nucleic acid editing polypeptide of Embodiment 116 wherein said adenosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 50-51, 385-390, or 595, or a variant thereof.
  • Embodiment 118. The engineered nucleic acid editing polypeptide of any one of Embodiment 106-Embodiment 114, wherein said base editor is a cytosine deaminase.
  • Embodiment 119 is a cytosine deaminase.
  • the engineered nucleic acid editing polypeptide of Embodiment 118 wherein said cytosine deaminase comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 1-49, 444-447, or a variant thereof.
  • Embodiment 120 The engineered nucleic acid editing polypeptide of any one of Embodiment 106-Embodiment 119, further comprising a uracil DNA glycosylase inhibitor (UGI) coupled to said endonuclease or said base editor.
  • UMI uracil DNA glycosylase inhibitor
  • the engineered nucleic acid editing polypeptide of Embodiment 120 wherein said uracil DNA glycosylase inhibitor comprises a sequence with at least 70%, 80%, 90% or 95% identity to any one of SEQ ID NOs: 52-56 or SEQ ID NO: 67, or a variant thereof.
  • Embodiment 122 The engineered nucleic acid editing polypeptide of any one of Embodiment 106-Embodiment 121, wherein a polypeptide comprising said endonuclease comprises one or more nuclear localization sequences (NLSs) proximal to an N- or C-terminus of said endonuclease.
  • NLSs nuclear localization sequences
  • Embodiment 122 wherein said NLS comprises a sequence with at least 90% identity to a selected from SEQ ID NOs: 369- 384, or a variant thereof.
  • Embodiment 124 The engineered nucleic acid editing polypeptide of any one of Embodiment 106-Embodiment 123, wherein said endonuclease is covalently coupled directly to said base editor or covalently coupled to said base editor through a linker.
  • Embodiment 125 Embodiment 125.
  • a nucleic acid comprising an engineered nucleic acid sequence optimized for expression in an organism, wherein said nucleic acid encodes a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity to any one of SEQ ID NOs: 1-51, 385-386, 387-443, 444-447, 488-475, or 595, or a variant thereof.
  • Embodiment 126 Embodiment 126.
  • Embodiment 125 wherein said organism is prokaryotic, bacterial, eukaryotic, fungal, plant, mammalian, rodent, or human.
  • Embodiment 127 A vector comprising the nucleic acid of any of Embodiment 125-Embodiment 126.
  • Embodiment 128 The vector of Embodiment 127, wherein the vector is a plasmid, a minicircle, a CELiD, an adeno-associated virus (AAV) derived virion, or a lentivirus.
  • Embodiment 129 A cell comprising the vector of any one of Embodiment 127-Embodiment 128.
  • Embodiment 130 A cell comprising the vector of any one of Embodiment 127-Embodiment 128.
  • a method of manufacturing a base editor comprising cultivating said cell of Embodiment 129.
  • Embodiment 131. A system comprising: (a) the nucleic acid editing polypeptide of any one of Embodiment 106-Embodiment 124; and (b) an engineered guide ribonucleic acid structure configured to form a complex with said nucleic acid editing polypeptide comprising: i.a guide ribonucleic acid sequence configured to hybridize to a target deoxyribonucleic acid sequence; and ii.ribonucleic acid sequence configured to bind to said endonuclease.
  • Embodiment 133 The system of Embodiment 131, wherein said engineered guide ribonucleic acid sequence comprises a sequence with at least 80% sequence identity to non-degenerate nucleotides of any one of SEQ ID NOs: 88-96, 488-489, or 679-680.
  • a method of modifying a target nucleic acid locus comprising delivering to said target nucleic acid locus said engineered nucleic acid editing polypeptide of any one of embodiments Embodiment 106-Embodiment 124 or said system of any one of embodiments Embodiment 131-Embodiment 132, wherein said complex is configured such that upon binding of said complex to said target nucleic acid locus, said complex modifies a nucleotide of said target nucleic locus.
  • Embodiment 134 Embodiment 134.
  • a nucleic acid editing polypeptide comprising: an adenosine deaminase, comprising a polypeptide sequence comprising a substitution at at least one residue selected from the group consisting of residue 24, residue 83, residue 85, residue 107, residue 109, residue 112, residue 124, residue 143, residue 147, residue 148, residue 154, or residue 158 relative to SEQ ID NO: 386 when optimally aligned.
  • the nucleic acid editing polypeptide of Embodiment 134, wherein said residue substituted is selected from W24, V83, L85, A107, D109, T112, H124, A143, S147, D148, R154, and K158.
  • Embodiment 136 Embodiment 136.
  • Embodiment 137. The nucleic acid editing polypeptide of Embodiment 134 or Embodiment 135, wherein said substitution is a non-conservative substitution.
  • Embodiment 138. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 137, comprising a substitution at W24, wherein said substitution is W24R.
  • nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 139 comprising a substitution at L85, wherein said substitution is L85F.
  • Embodiment 141 The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 140, comprising a substitution at A107, wherein said substitution is A107V.
  • Embodiment 142 The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 141, comprising a substitution at D109, wherein said substitution is D109N.
  • Embodiment 143 comprising a substitution at D109, wherein said substitution is D109N.
  • nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 142 comprising a substitution at T112, wherein said substitution is T112R.
  • Embodiment 144 The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 143, comprising a substitution at H124, wherein said substitution is H124Y.
  • Embodiment 145 The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 144, comprising a substitution at A143, wherein said substitution is A143N.
  • Embodiment 146 comprising a substitution at A143, wherein said substitution is A143N.
  • nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 145 comprising a substitution at S147, wherein said substitution is S147C.
  • nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 146 comprising a substitution at D148, wherein said substitution is D148Y or D148R.
  • Embodiment 148. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 147, comprising a substitution at R154, wherein said substitution is R154P.
  • Embodiment 149 comprising a substitution at R154, wherein said substitution is R154P.
  • Embodiment 150. The nucleic acid editing polypeptide of any one of Embodiment 134- Embodiment 149, wherein said adenosine deaminase comprises a sequence having at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% sequence identity to any one of SEQ ID NOs: 50-51 or 385-443.
  • Embodiment 151 The engineered nucleic acid editing polypeptide of any one of Embodiment 134-Embodiment 150, further comprising an endonuclease, wherein said endonuclease is configured to be deficient in endonuclease activity.
  • Embodiment 152. The engineered nucleic acid editing polypeptide of Embodiment 151, wherein said endonuclease is configured to cleave one strand of a double-stranded target deoxyribonucleic acid.
  • Embodiment 153 The engineered nucleic acid editing polypeptide of Embodiment 151, wherein said endonuclease is configured to be catalytically dead.
  • Embodiment 154 The engineered nucleic acid editing polypeptide of any one of Embodiment 134-Embodiment 150, further comprising an endonuclease, wherein said endonuclease is configured to be deficient in endon
  • Embodiment 155. The engineered nucleic acid editing polypeptide of Embodiment 154, wherein said endonuclease is a Class II, type II endonuclease or a Class II, type V endonuclease.
  • Embodiment 156 is a Class II, type II endonuclease or a Class II, type V endonuclease.
  • Embodiment 155 The engineered nucleic acid editing polypeptide of Embodiment 155, wherein said endonuclease comprises a sequence having at least 70%, 80%, 90% or 95% sequence identity to any one of SEQ ID NOs:70-78 or 597, or a variant thereof.
  • Embodiment 157 The engineered nucleic acid editing polypeptide of any one of Embodiment 151-Embodiment 156, wherein said endonuclease comprises a nickase mutation.
  • Embodiment 158 The engineered nucleic acid editing polypeptide of any one of Embodiment 151-Embodiment 156, wherein said endonuclease comprises a nickase mutation.
  • Embodiment 157 The engineered nucleic acid editing polypeptide of Embodiment 157, wherein said endonuclease comprises the aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597.
  • Embodiment 159 comprises the aspartate to alanine mutation at residue 9 relative to SEQ ID NO: 70, residue 13 relative to SEQ ID NOs: 71, 72, or 74, residue 12 relative to SEQ ID NO: 73, residue 17 relative to SEQ ID NO: 75, residue 23 relative to SEQ ID NO: 76, or residue 10 relative to SEQ ID NO: 597.
  • PAM protospacer adjacent motif

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Mycology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2022/079345 2021-11-05 2022-11-04 Base editing enzymes Ceased WO2023081855A1 (en)

Priority Applications (8)

Application Number Priority Date Filing Date Title
CA3234217A CA3234217A1 (en) 2021-11-05 2022-11-04 Base editing enzymes
MX2024005505A MX2024005505A (es) 2021-11-05 2022-11-04 Enzimas de edicion de bases.
KR1020247015992A KR20240099283A (ko) 2021-11-05 2022-11-04 염기 편집 효소
JP2024519975A JP2024541811A (ja) 2021-11-05 2022-11-04 塩基編集酵素
EP22891120.2A EP4426826A4 (en) 2021-11-05 2022-11-04 BASIC EDITION ENZYMES
AU2022380842A AU2022380842A1 (en) 2021-11-05 2022-11-04 Base editing enzymes
CN202280074006.6A CN118202044A (zh) 2021-11-05 2022-11-04 碱基编辑酶
US18/653,454 US12503710B2 (en) 2021-11-05 2024-05-02 Base editing enzymes

Applications Claiming Priority (10)

Application Number Priority Date Filing Date Title
US202163276461P 2021-11-05 2021-11-05
US63/276,461 2021-11-05
US202163289998P 2021-12-15 2021-12-15
US63/289,998 2021-12-15
US202263342824P 2022-05-17 2022-05-17
US63/342,824 2022-05-17
US202263356888P 2022-06-29 2022-06-29
US63/356,888 2022-06-29
US202263378171P 2022-10-03 2022-10-03
US63/378,171 2022-10-03

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/653,454 Continuation US12503710B2 (en) 2021-11-05 2024-05-02 Base editing enzymes

Publications (1)

Publication Number Publication Date
WO2023081855A1 true WO2023081855A1 (en) 2023-05-11

Family

ID=86242250

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/079345 Ceased WO2023081855A1 (en) 2021-11-05 2022-11-04 Base editing enzymes

Country Status (8)

Country Link
US (1) US12503710B2 (https=)
EP (1) EP4426826A4 (https=)
JP (1) JP2024541811A (https=)
KR (1) KR20240099283A (https=)
AU (1) AU2022380842A1 (https=)
CA (1) CA3234217A1 (https=)
MX (1) MX2024005505A (https=)
WO (1) WO2023081855A1 (https=)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116640743A (zh) * 2023-07-24 2023-08-25 北京志道生物科技有限公司 一种核酸内切酶及其应用
US12286654B2 (en) 2020-09-11 2025-04-29 Metagenomi, Inc. Base editing enzymes
WO2025081064A3 (en) * 2023-10-11 2025-05-15 Illumina, Inc. Thermophilic deaminase and methods for identifying modified cytosine
WO2025119295A1 (zh) * 2023-12-05 2025-06-12 广州瑞风生物科技有限公司 脱氨酶、融合蛋白、核酸、药物组合物及其应用
EP4281554A4 (en) * 2021-01-22 2025-06-18 Metagenomi, Inc. NOVEL MANIPULATED AND CHIMERIC NUCLEASES
WO2025207709A1 (en) * 2024-03-26 2025-10-02 Arbor Biotechnologies, Inc. Reverse transcription-mediated gene editing systems and uses thereof
US12503710B2 (en) 2021-11-05 2025-12-23 Metagenomi, Inc. Base editing enzymes
EP4493682A4 (en) * 2022-03-14 2026-04-15 Metagenomi Inc MODIFIED AND CHIMERIC NUCLEASE

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018176009A1 (en) * 2017-03-23 2018-09-27 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable dna binding proteins
WO2022056324A1 (en) * 2020-09-11 2022-03-17 Metagenomi Ip Technologies, Llc Base editing enzymes

Family Cites Families (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11192929B2 (en) 2016-12-08 2021-12-07 Regents Of The University Of Minnesota Site-specific DNA base editing using modified APOBEC enzymes
EP3572525A4 (en) 2017-01-17 2020-09-30 Institute for Basic Science PROCEDURE FOR IDENTIFYING AN OFF-TARGET BASIC EDITING SITE BY BREAKING A SINGLE DNA STRAND
KR102758434B1 (ko) 2017-03-30 2025-01-21 고쿠리츠 다이가쿠 호진 교토 다이가쿠 게놈 편집에 의한 엑손 스키핑 유도 방법
US9982279B1 (en) 2017-06-23 2018-05-29 Inscripta, Inc. Nucleic acid-guided nucleases
AU2018290843B2 (en) 2017-06-26 2025-04-24 Massachusetts Institute Of Technology CRISPR/Cas-adenine deaminase based compositions, systems, and methods for targeted nucleic acid editing
JP2021506251A (ja) 2017-12-14 2021-02-22 クリスパー セラピューティクス アーゲー 新規rnaプログラム可能エンドヌクレアーゼ系、ならびにゲノム編集および他の適用におけるその使用
US11946040B2 (en) 2019-02-04 2024-04-02 The General Hospital Corporation Adenine DNA base editor variants with reduced off-target RNA editing
US20220298494A1 (en) 2019-02-14 2022-09-22 Metagenomi Ip Technologies, Llc Enzymes with ruvc domains
AU2020223370B2 (en) 2019-02-14 2023-04-20 Metagenomi Therapeutics, Inc. Enzymes with RuvC domains
WO2021097118A1 (en) 2019-11-12 2021-05-20 The Broad Institute, Inc. Small type ii cas proteins and methods of use thereof
GB2608292B (en) 2020-03-31 2024-02-14 Metagenomi Inc Class II, type II CRISPR systems
GB2700205B (en) 2020-09-11 2026-04-15 Metagenomi Therapeutics Inc Base editing enzymes
AU2022380842A1 (en) 2021-11-05 2024-05-23 Metagenomi Therapeutics, Inc. Base editing enzymes

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018176009A1 (en) * 2017-03-23 2018-09-27 President And Fellows Of Harvard College Nucleobase editors comprising nucleic acid programmable dna binding proteins
WO2022056324A1 (en) * 2020-09-11 2022-03-17 Metagenomi Ip Technologies, Llc Base editing enzymes

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE UNIPROTKB ANONYMOUS : "A0A8S5MVN9 · A0A8S5MVN9_9CAUD", XP093065249, retrieved from UNIPROT *
DATABASE UNIPROTKB ANONYMOUS : "A0A8S5N1W0 · A0A8S5N1W0_9CAUD", XP093065250, retrieved from UNIPROT *
DATABASE UNIPROTKB ANONYMOUS : "A0A8S5UMQ3 · A0A8S5UMQ3_9CAUD", XP093065248, retrieved from UNIPROT *
See also references of EP4426826A4 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12286654B2 (en) 2020-09-11 2025-04-29 Metagenomi, Inc. Base editing enzymes
EP4211234A4 (en) * 2020-09-11 2025-04-30 Metagenomi, Inc. Base editing enzymes
EP4281554A4 (en) * 2021-01-22 2025-06-18 Metagenomi, Inc. NOVEL MANIPULATED AND CHIMERIC NUCLEASES
US12503710B2 (en) 2021-11-05 2025-12-23 Metagenomi, Inc. Base editing enzymes
EP4493682A4 (en) * 2022-03-14 2026-04-15 Metagenomi Inc MODIFIED AND CHIMERIC NUCLEASE
CN116640743A (zh) * 2023-07-24 2023-08-25 北京志道生物科技有限公司 一种核酸内切酶及其应用
CN116640743B (zh) * 2023-07-24 2023-11-07 北京志道生物科技有限公司 一种核酸内切酶及其应用
WO2025081064A3 (en) * 2023-10-11 2025-05-15 Illumina, Inc. Thermophilic deaminase and methods for identifying modified cytosine
WO2025119295A1 (zh) * 2023-12-05 2025-06-12 广州瑞风生物科技有限公司 脱氨酶、融合蛋白、核酸、药物组合物及其应用
WO2025207709A1 (en) * 2024-03-26 2025-10-02 Arbor Biotechnologies, Inc. Reverse transcription-mediated gene editing systems and uses thereof

Also Published As

Publication number Publication date
KR20240099283A (ko) 2024-06-28
US20240309404A1 (en) 2024-09-19
JP2024541811A (ja) 2024-11-13
EP4426826A4 (en) 2025-08-20
CA3234217A1 (en) 2023-05-11
US12503710B2 (en) 2025-12-23
AU2022380842A1 (en) 2024-05-23
MX2024005505A (es) 2024-05-23
EP4426826A1 (en) 2024-09-11

Similar Documents

Publication Publication Date Title
US12286654B2 (en) Base editing enzymes
US12503710B2 (en) Base editing enzymes
JP7785139B2 (ja) クラス2のii型crisprシステム
US12123014B2 (en) Class II, type V CRISPR systems
US12410449B2 (en) Endonuclease systems
US20230348877A1 (en) Base editing enzymes
US20240409962A1 (en) Endonuclease systems
WO2022256462A1 (en) Class ii, type v crispr systems
US20240352433A1 (en) Enzymes with hepn domains
CN118202044A (zh) 碱基编辑酶
CN118265783A (zh) 核酸内切酶系统
CN116096877B (zh) Ii类ii型crispr系统
US20250059568A1 (en) Class ii, type v crispr systems
CN116867897A (zh) 碱基编辑酶

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22891120

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2024519975

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 3234217

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 202280074006.6

Country of ref document: CN

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112024008919

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: 202417040007

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2022380842

Country of ref document: AU

Date of ref document: 20221104

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2022891120

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2022891120

Country of ref document: EP

Effective date: 20240605

ENP Entry into the national phase

Ref document number: 112024008919

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20240506