WO2023077720A1

WO2023077720A1 - Method for detecting activity of nucleic acid-metabolizing enzyme

Info

Publication number: WO2023077720A1
Application number: PCT/CN2022/086204
Authority: WO
Inventors: 周蓉; 王攀
Original assignee: 深圳铭毅智造科技有限公司
Priority date: 2021-11-03
Filing date: 2022-04-12
Publication date: 2023-05-11
Also published as: CN114250281A

Abstract

Disclosed in the present invention is a method for detecting the activity of a nucleic acid-metabolizing enzyme, comprising the following steps: S1. artificially synthesizing a single-stranded nucleic acid fragment and a primer complementary from the 3' end, and forming a template by means of an annealing reaction; S2. reacting the template with a reaction buffer solution, a fluorescently-modified nucleotide derivative or fluorescently-modified nucleotide derivative analog, and a nucleic acid-metabolizing enzyme to be detected, and performing purification to obtain a primary purified product; S3. reacting the primary purified product with a Taq reaction buffer solution, dNTP, and Taq DNA polymerase, and performing purification to obtain a secondary purified product; S4. analyzing the secondary purified product by using a capillary electrophoresis instrument; and S5. creating a standard curve, and substituting the result in S4 into the standard curve to obtain a detection result.

Description

A method for detecting the activity of nucleic acid metabolizing enzymes

technical field

The invention relates to the field of biotechnology, in particular to a method for detecting the activity of nucleic acid metabolizing enzymes.

Background technique

Nucleic acid metabolism, including DNA and RNA synthesis and degradation, is fundamental to all nucleic acid research and related life science fields of study. Standard activity assays for nucleic acid metabolizing enzymes involved in DNA replication and repair are by assays that measure DNA or RNA product synthesis or degradation of radioactive or fluorescently labeled nucleic acid substrates. For example, the method of isotope labeling and the fluorescent dye method combined with DNA (PicoGreen or EvaGreen) are widely used in DNA quantification, and then applied in the activity detection method of nucleic acid metabolizing enzymes to measure the synthesis activity or degradation activity of nucleic acid metabolizing enzymes. In order to better study reaction intermediates or by-products, more comprehensively capture the specific steps and details of the reaction pathway, and fully understand the activity of nucleases, polyacrylamide gel electrophoresis (PAGE) is widely used to analyze substrates, intermediates In experimental studies such as the size distribution of nucleases, further characterization and standard determination of nucleases are carried out. However, compared with the aforementioned radioactive or fluorescent labeling methods, the analysis method of polyacrylamide gel electrophoresis has the disadvantages of long experiment time, low efficiency and low throughput. Such shortcomings limit the scope of nuclease analysis.

technical problem

Aiming at the existing deficiencies, the invention provides a method for detecting the activity of nucleic acid metabolizing enzymes.

technical solution

The technical scheme adopted by the present invention to solve its technical problems is: a kind of nucleic acid metabolizing enzyme activity detection method, it is characterized in that: its steps are as follows:

S1, artificially synthesize a single-stranded nucleic acid fragment and a complementary primer from the 3' end, and form a nucleic acid-primer complex through annealing reaction, which is called a template;

S2, add the template, reaction buffer, fluorescently modified nucleotide derivatives or fluorescently modified nucleotide derivative analogs, and nucleic acid metabolizing enzymes to be determined into the same PCR tube, and react in the PCR reactor to obtain the initial product, and the initial product is subjected to kit purification to obtain the primary purified product;

S3, add the primary purification product, Taq reaction buffer, dNTP, and Taq DNA polymerase into another PCR tube, react in the PCR reactor to obtain the secondary reaction product, and perform kit purification on the secondary reaction product to obtain the secondary purification product;

S4, analyzing the secondary purification product with capillary electrophoresis, collecting the separation spectrum and calculating the base extension efficiency per unit time;

S5, making a standard curve, and substituting the elongation efficiency calculated in S4 into the standard curve to obtain the activity of the nucleic acid metabolizing enzyme to be determined; wherein the PCR reaction conditions in steps S2 and S3 are that the temperature is 10°C-90°C, and the time is 10s- 60min.

Preferably, the template is a single-stranded nucleic acid fragment with a fragment length of 50-150 bp.

Preferably, the length of the primer is 15-25 bp.

Preferably, the reaction conditions of the step S2 are a temperature of 45-65° C. and a time of 1 min.

Preferably, the reaction conditions of the step S3 are a temperature of 72° C. and a time of 20 min.

Preferably, the preparation method of the standard curve is: in step S2, the nucleic acid metabolizing enzyme to be determined is changed to a nucleic acid metabolizing enzyme of known activity that is diluted into different concentrations according to the activity gradient, and then sequentially undergoes steps S2, S3, and S4 The initial slope of each gradient unit activity was obtained, and a standard curve was made.

Preferably, in said step S2, the nucleic acid metabolizing enzyme to be determined is diluted into different concentrations of nucleic acid metabolizing enzyme according to the concentration gradient, and then each concentration of nucleic acid metabolizing enzyme is successively passed through steps S2, S3, and S4 to obtain the activity of each concentration unit The initial slope and substituted into the standard curve yielded relative activity units.

Preferably, the capillary electrophoresis analysis is calculated based on the type of fluorescent dye and the peak size of the separation spectrum.

Preferably, the nucleic acid metabolizing enzymes include high-throughput nucleic acid metabolizing enzymes.

Preferably, the fluorescently modified nucleotide derivatives and fluorescently modified nucleotide derivative analogs are nucleotide derivatives modified with protecting groups at the 3' hydroxyl and carrying fluorescent labeling groups on the bases.

Beneficial effect

The beneficial effects of the present invention are: the present invention is quick to operate, the activity detection result is accurate, the sensitivity is high, the detection of high flux is realized, and the characterization precision accurate to a single nucleotide can be realized. In high flux capillary electrophoresis, fluorescent marker Nucleic acid substrates, intermediates and products are separated by size and charge, and/or detected by laser excitation, detection sample injection, gel electrophoresis and data acquisition processes are all automated, allowing a single experiment to be performed within one hour 96 samples can be detected, which is applicable to the detection of all templates with or without fluorescent dyes, and also solves the problems of multiple operation steps, complex design of multiple fluorescent labels, environmental pollution caused by isotope labeling, and limitation of instrument resolution in the prior art. restrictions etc.

Description of drawings

Fig. 1 is a schematic diagram of the principle of the present invention;

Fig. 2 is the electrophoretic spectrum that the embodiment of the present invention 1 obtains;

Embodiments of the present invention

In order to more clearly illustrate the purpose, technical solutions and advantages of the embodiments of the present invention, the present invention will be further described below in conjunction with the embodiments, and a clear and complete description will be made. Obviously, the described embodiments are part of the embodiments of the present invention. rather than all examples. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.

In the present invention, "extending" means linking the modified nucleotide to the 5' phosphate group of the fluorescently modified nucleotide derivative by forming a phosphodiester bond with the 5' phosphate group of the fluorescently modified nucleotide derivative. The free 3' hydroxyl, the second nucleotide to which the modified nucleotide is attached, usually occurs at the 3' end of the polynucleotide chain. "Extension" may be at low temperature and/or over a wider temperature range, may be in a short time and/or over a wider time range, reaction with fluorescently modified nucleotide derivatives or analogs ability. In the present invention, "extension" may be the ability to respond when a lower concentration of a fluorescently modified nucleotide or analogue is used as a substrate.

In the present invention, "fluorescence-modified nucleotide derivative derivatives" and "fluorescence-modified nucleotide derivative analogs" refer to those that have been modified by the protecting group at the 3' sugar hydroxyl group and carry fluorescent labels on the bases. Nucleotide derivatives of the group. Such nucleotide derivatives or analogs can act as chain reaction terminators, preventing the chain reaction from continuing after the addition of dNTPs. These terms are used interchangeably.

In the present invention, the template is preferably a single-stranded nucleic acid fragment with a length of 99 bp, and the primer length is preferably 16-19 bp; the capillary electrophoresis instrument used is any instrument that can perform accounting capillary electrophoresis analysis, such as QSEP, CE etc.; the diluent used to dilute the synthesized primers and templates during the reaction can be sterile purified water or 1XTE (pH8.0); Invention principle as shown in Figure 1,

Example 1

single base extension efficiency assay (capillary electrophoresis assay),

Design and synthesis of primers and templates:

Single-stranded nucleic acid sequence (5'-3'):

GACCGCGACTCCAGCCCTCTTACACCCAGTGGAGAAGCTCCCAACCAAGCTCTCTTGAGGATCTTGAAGGA AACTGAATTCAAAGTCGTCGCGGGATCA (SEQ ID NO. 1)

Primer sequence (5′-3′): TGATCCCGCGACGACT (SEQ ID NO.2)

TGATCCCGCGACGACTTT(SEQ ID NO.3) TGATCCCGCGACGACTTTG (SEQ ID NO.4) TGATCCCGCGACGACTTTGAATT (SEQ ID NO.5)

It is used to detect the reaction ability of different nucleic acid metabolizing enzymes and different fluorescently modified nucleotide derivatives or analogues. Add a general template and one of four different fluorescently labeled nucleotides or analogues into the reaction system. For the extension reaction, the reaction is started by adding the nucleic acid metabolizing enzyme to be detected into the reaction system, and within 1 min, use a capillary electrophoresis analyzer to carry out the extension of a base with a fluorescent modification at the 3' end of the universal template. Analysis, calculated by the ratio of the fluorescence peak area of the electrophoresis graph, the elongation efficiency per unit time is obtained, as shown in Figure 2, and then by changing the concentration gradient of the added nucleic acid metabolizing enzyme, the concentration of the nucleic acid metabolizing enzyme at different concentrations can be obtained. The extension efficiency of the nucleic acid metabolism enzyme can be calculated by substituting it into the standard curve.

Example 2

Single base extension error assay (capillary electrophoresis assay)

Design and synthesis of primers and templates:

Single-stranded nucleic acid sequence (5'-3'):

Primer sequence (5′-3′): TGATCCCGCGACGACT (SEQ ID NO.2) TGATCCCGCGACGACTTT (SEQ ID NO.3)

TGATCCCGCGACGACTTTG (SEQ ID NO.4)

TGATCCCGCGACGACTTTGAATT (SEQ ID NO.5)

It is used to detect the reaction ability of different nucleic acid metabolizing enzymes and different fluorescently modified nucleotide derivatives, adding a general template and one of four different fluorescently labeled nucleotides (wrong nucleotides that do not match the template) into the reaction system Within 1 min, for the extension reaction, start the reaction by adding the nucleic acid metabolizing enzyme whose activity is to be detected to the reaction system. Within 1 min, use a capillary electrophoresis analyzer to detect a fluorescently modified base at the 3′ end of the universal template The extension situation was analyzed, and the ratio of the fluorescence peak area of the electrophoresis graph was calculated to obtain the extension efficiency of the wrong nucleotide incorporated per unit time.

It should be understood that those skilled in the art can make improvements or changes based on the above description, and all these improvements and changes should fall within the protection scope of the appended claims of the present invention.

Claims

A nucleic acid metabolizing enzyme activity detection method is characterized in that: its steps are as follows: S1, artificially synthesize a single-stranded nucleic acid fragment and a section of primer complementary from the 3' end, and form a nucleic acid primer complex by annealing reaction, which is called a template; S2, add the template, reaction buffer, fluorescently modified nucleotide derivatives or fluorescently modified nucleotide derivative analogs, and nucleic acid metabolizing enzymes to be determined into the same PCR tube, and react in the PCR reactor to obtain the initial product, and purify the initial product with kit to obtain the primary purified product; S3, add the primary purified product, Taq reaction buffer, dNTP, and Taq DNA polymerase into another PCR tube, and react in the PCR reactor to obtain the secondary reaction product , and carry out kit purification to the secondary reaction product to obtain the secondary purification product; S4, analyze the secondary purification product with capillary electrophoresis, collect the separation spectrum and calculate the base extension efficiency per unit time; S5, make a standard curve, Substituting the elongation efficiency calculated and analyzed in S4 into the standard curve to obtain the activity of the nucleic acid metabolizing enzyme to be determined; the PCR reaction conditions in steps S2 and S3 are that the temperature is 10°C-90°C, and the time is 10s-60min.
According to the described nucleic acid metabolizing enzyme activity detection method of claim 1, it is characterized in that: described template is a single-stranded nucleic acid fragment, and its fragment length is 50-150 bp.
The nucleic acid metabolizing enzyme activity detection method according to claim 1, is characterized in that: described primer length is 15-25 bp.
The nucleic acid metabolizing enzyme activity detection method according to claim 1, characterized in that: the reaction conditions of the step S2 are that the temperature is 45-65° C., and the time is 1 min.
The nucleic acid metabolizing enzyme activity detection method according to claim 1, characterized in that: the reaction conditions of the step S3 are that the temperature is 72° C., and the time is 20 min.
According to the described nucleic acid metabolizing enzyme activity detection method of claim 1, it is characterized in that: the preparation method of described standard curve is, in step S2, the nucleic acid metabolizing enzyme to be determined is changed into the known activity of different concentrations according to activity gradient dilution Nucleic acid metabolizing enzymes, and then through steps S2, S3, and S4 to obtain the initial slope of each gradient unit activity, and make a standard curve.
According to the described nucleic acid metabolizing enzyme activity detection method of claim 1, it is characterized in that: in described step S2, the nucleic acid metabolizing enzyme to be determined is diluted into the nucleic acid metabolizing enzyme of different concentrations according to the concentration gradient, and then the nucleic acid metabolizing enzyme of each concentration is After steps S2, S3, and S4 in sequence, the initial slope of the activity of each concentration unit was obtained, and substituted into the standard curve to obtain the relative activity unit.
The method for detecting nucleic acid metabolizing enzyme activity according to claim 1, characterized in that: the capillary electrophoresis analysis is calculated based on the type of fluorescent dye and the peak size of the separation spectrum.
The method for detecting the activity of nucleic acid metabolizing enzymes according to claim 1, characterized in that: the nucleic acid metabolizing enzymes comprise high-throughput nucleic acid metabolizing enzymes.
According to the described nucleic acid metabolizing enzyme activity detection method of claim 1, it is characterized in that: the nucleotide derivatives of described fluorescent modification and the nucleotide derivative analog of fluorescent modification are modified at 3 ' hydroxyl place protecting group and base Nucleotide derivatives with fluorescent labeling groups on the base.