WO2023077199A1 - Modified cereal grain - Google Patents

Modified cereal grain Download PDF

Info

Publication number
WO2023077199A1
WO2023077199A1 PCT/AU2022/051328 AU2022051328W WO2023077199A1 WO 2023077199 A1 WO2023077199 A1 WO 2023077199A1 AU 2022051328 W AU2022051328 W AU 2022051328W WO 2023077199 A1 WO2023077199 A1 WO 2023077199A1
Authority
WO
WIPO (PCT)
Prior art keywords
grain
cereal
plant
fad2
bran
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/AU2022/051328
Other languages
English (en)
French (fr)
Inventor
Jixun LUO
Qing Liu
Zhongyi Li
Xue-Rong Zhou
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Commonwealth Scientific and Industrial Research Organization CSIRO
Original Assignee
Commonwealth Scientific and Industrial Research Organization CSIRO
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2021903546A external-priority patent/AU2021903546A0/en
Application filed by Commonwealth Scientific and Industrial Research Organization CSIRO filed Critical Commonwealth Scientific and Industrial Research Organization CSIRO
Priority to US18/707,501 priority Critical patent/US20250304986A1/en
Priority to CN202280087136.3A priority patent/CN118488780A/zh
Priority to EP22888658.6A priority patent/EP4426104A4/en
Priority to AU2022379910A priority patent/AU2022379910A1/en
Priority to JP2024526925A priority patent/JP2024541073A/ja
Publication of WO2023077199A1 publication Critical patent/WO2023077199A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • C12N9/222Clustered regularly interspaced short palindromic repeats [CRISPR]-associated [CAS] enzymes
    • C12N9/226Class 2 CAS enzyme complex, e.g. single CAS protein
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/10Processes for modifying non-agronomic quality output traits, e.g. for industrial processing; Value added, non-agronomic traits
    • A01H1/101Processes for modifying non-agronomic quality output traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine or caffeine
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H5/00Angiosperms, i.e. flowering plants, characterised by their plant parts; Angiosperms characterised otherwise than by their botanic taxonomy
    • A01H5/10Seeds
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H6/00Angiosperms, i.e. flowering plants, characterised by their botanic taxonomy
    • A01H6/46Gramineae or Poaceae, e.g. ryegrass, rice, wheat or maize
    • A01H6/4636Oryza sp. [rice]
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23DEDIBLE OILS OR FATS, e.g. MARGARINES, SHORTENINGS OR COOKING OILS
    • A23D9/00Other edible oils or fats, e.g. shortenings or cooking oils
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L7/00Cereal-derived products; Malt products; Preparation or treatment thereof
    • A23L7/10Cereal-derived products
    • A23L7/115Cereal fibre products, e.g. bran, husk
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C12N15/8247Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified lipid metabolism, e.g. seed oil composition
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0069Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0071Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y113/00Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13)
    • C12Y113/11Oxidoreductases acting on single donors with incorporation of molecular oxygen (oxygenases) (1.13) with incorporation of two atoms of oxygen (1.13.11)
    • C12Y113/11012Linoleate 13S-lipoxygenase (1.13.11.12)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y114/00Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/19Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (1.14.19)
    • C12Y114/19003Linoleoyl-CoA desaturase (1.14.19.3)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12YENZYMES
    • C12Y114/00Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/19Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with oxidation of a pair of donors resulting in the reduction of molecular oxygen to two molecules of water (1.14.19)
    • C12Y114/19006DELTA12-fatty-acid desaturase (1.14.19.6), i.e. oleoyl-CoA DELTA12 desaturase
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/04Processes of selection involving genotypic or phenotypic markers; Methods of using phenotypic markers for selection
    • AHUMAN NECESSITIES
    • A01AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01HNEW PLANTS OR NON-TRANSGENIC PROCESSES FOR OBTAINING THEM; PLANT REPRODUCTION BY TISSUE CULTURE TECHNIQUES
    • A01H1/00Processes for modifying genotypes ; Plants characterised by associated natural traits
    • A01H1/12Processes for modifying agronomic input traits, e.g. crop yield
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8201Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
    • C12N15/8202Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
    • C12N15/8205Agrobacterium mediated transformation
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/20Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C12Q1/6895Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/13Plant traits
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the present invention relates to cereal grain and bran, such as rice grain and bran, having a high oleic acid content and improved oil stability.
  • BACKGROUND OF THE INVENTION Rice (Oryza sativa L.) is one of the most important staple foods for over half of the world population, especially in Asia which produces about 90% of the world total.
  • the vast majority of rice in the world is eaten as “white rice” which is essentially the endosperm of the rice grain, having been produced by milling of harvested grain to remove the outer bran layer and germ (embryo and scutellum). This is done primarily because “brown rice” does not keep well on storage, particularly under hot tropical conditions.
  • Rice Bran Rice bran is the outer brown coloured layer of the rice grain and it includes the embryo, pericarp, aleurone and sub-aleurone layer. Although it is known to be rich in minerals, proteins, oils and crude fiber rice bran is primarily obtained as a by-product of white rice milling. Current global production is approximately 66-75 million tons. In general rice bran is composed of 14–16% protein, 12–23% lipid and 8–10% crude fibre (Juliano, 1985). Rice Bran Oil Rice bran is the source of rice bran oil (RBO). Interest in RBO as an edible oil, e.g.
  • RBO consumption significantly decreases low- density lipoprotein cholesterol (LDL-C) and increases antioxidant capacity in hyperlipidemic subjects (Bumrungpert et al 2019; Berger et al., 2005).
  • LDL-C low- density lipoprotein cholesterol
  • RBO health characteristics have been associated with the 3–4.5% high unsaponifiable important minor components such as tocopherols, phytosterols, terpenes and mixed isoprenoids compared to approximately 1% oil content of other vegetable oils.
  • RBO generally contains 1.8% phytosterols, 1.2-1.7% gamma-oryzanol, tocotrienols up to 0.17% and tocopherols 0.08% (Pal and Pratap, 2017).
  • the present invention provides fertile cereal grain comprising a genetically modified FAD2-1 gene and a genetically modified LOX3 gene, wherein the grain comprises i) at least some FAD 2-1 protein activity, wherein the FAD2-1 activity is reduced when compared to a wild type cereal grain, and ii) reduced LOX3 protein activity when compared to the wild type cereal grain.
  • the cereal grain is rice, sorghum, wheat, oats, rye, barley or maize grain.
  • the grain is a sorghum grain.
  • the grain is a rice grain.
  • oil extracted from the grain is more stable than oil extracted from the wild type cereal therefrom.
  • the grain has a total fatty acid content comprising at least 50%, at least 60%, at least 70%, at least 75%, between 50% and 80%, between 55% and 75%, between 55% and 70%, oleic acid (w/w dry weight). In an embodiment, wherein the grain has a total fatty acid content comprises between 55% and 75% oleic acid (w/w dry weight). In an embodiment, the grain has a total fatty acid content which comprises between 55% and 65% oleic acid (w/w dry weight).
  • the grain has a total fatty acid content comprising less than 22%, less than 21%, less than 20%, less than 18%, less than 15%, between 15% and 22% or between 15% and 21%, palmitic acid (w/w dry weight). In an embodiment, the grain has a total fatty acid content comprising between 10% and 15% palmitic acid (w/w dry weight). In an embodiment, the grain has a total fatty acid content comprising between 10% and 13% palmitic acid (w/w dry weight). In an embodiment, the grain has a total fatty acid content comprising less than 20%, less than 15%, less than 10%, less than 5%, between 2% and 20% or between 5% and 15%, linoleic acid (w/w dry weight).
  • the grain has a total fatty acid content comprising between 15% and 25% linoleic acid (w/w dry weight). In an embodiment, the grain has a total fatty acid content comprising between 55% and 65% oleic acid, between 10% and 15% palmitic acid and between 15% and 25% linoleic acid. In an embodiment, the grain is homozygous for a FAD 2-1 allele which produces a reduced amount of FAD2-1 protein and/or which encodes a FAD2-1 protein with reduced FAD2-1 protein activity, a LOX3 knockout, a FATB2 knockout, a FATB3 knockout, and a FATB4 knockout.
  • the grain is homozygous for a FAD 2-1 allele which produces a reduced amount of FAD2-1 protein and/or which encodes a FAD2-1 protein with reduced FAD2-1 protein activity, a LOX3 knockout, a FATB1 knockout and a FATB4 knockout.
  • the grain is homozygous for a FAD 2-1 allele which produces a reduced amount of FAD2-1 protein and/or which encodes a FAD2-1 protein with reduced FAD2-1 protein activity, a LOX3 knockout, a FATB1 knockout, a FATB2 knockout, a FATB3 knockout, and a FATB4 knockout.
  • the grain has no LOX3 protein activity.
  • the genetic modification is a premature stop codon in the LOX3 gene.
  • the grain is homozygous for the genetic modification in the LOX3 gene.
  • the genetic modification of the LOX3 gene is a premature stop codon in the LOX3 gene.
  • the grain is homozygous for the genetic modification in the FAD2-1 gene.
  • the grain is heterozygous for the genetic modification in the FAD2-1 gene.
  • the grain comprises a wild type FAD2-1 allele and a knock out FAD 2-1 allele.
  • the grain comprises a wild type FAD2-1 allele and a FAD 2- 1 allele which produces a reduced amount of FAD2-1 protein and/or which encodes a FAD2-1 protein with reduced FAD2-1 protein activity.
  • the grain comprises a FAD 2-1 allele which produces a reduced amount of FAD2-1 protein and/or which encodes a FAD2-1 protein with reduced FAD2-1 protein activity and a knock out FAD 2-1 allele.
  • the genetically modified FAD2-1 gene encodes a mutant FAD2-1 protein.
  • the mutant FAD2-1 has between 5% and 95% less, between 20% and 80% less, between 40% and 70% less, or between 50% and 60% less, ⁇ 12 desaturase activity than a wild type FAD2-1 protein.
  • the grain the mutant FAD2-1 has between 5% and 95% less, between 20% and 80% less, between 40% and 70% less, or between 50% and 60% less, ⁇ 12 desaturase activity than a wild type FAD2-1 protein such as a FAD 2-1 protein consisting an amino acid sequence set forth in any one of SEQ ID NO’s 1 to 9.
  • the FAD2-1 protein with reduced FAD2-1 protein activity comprises or consists of an amino acid sequence as set forth in SEQ ID NO:10 or SEQ ID NO:11.
  • the FAD2-1 protein with reduced FAD2-1 protein activity has a modified translation start site.
  • the grain has wild type activity for other FAD2 genes in the genome of the grain.
  • rice grain of the invention has wild type FAD 2-2, FAD 2-3 and FAD 2-4 activity.
  • one or both of the genetic modifications were introduced by gene editing an ancestral cereal plant.
  • the grain has reduced FATB activity when compared to the wild type cereal grain.
  • the FATB is FATB1.
  • the grain does not comprise exogenous dsRNA.
  • the present invention provides cereal bran comprising genetically modified cells comprising i) at least some FAD 2-1 protein activity, wherein the FAD2-1 activity is reduced when compared to a wild type cereal bran, and ii) reduced LOX3 protein activity when compared to the wild type cereal bran.
  • the bran may have any of the relevant features defined above for the cereal grain of the invention such as the fatty acid profile.
  • the bran is rice bran.
  • the present invention provides extracted cereal grain oil, or cereal bran oil, having a total fatty acid content comprising between 50% and 80%, or between 55% and 80%, oleic acid (w/w dry weight), and having an induction time of at least 25 hours as measured by Rancimat test conducted at 110°C at an airflow rate of 20 L/hr.
  • the present invention provides extracted cereal grain oil, or cereal bran oil, which is more stable than cereal oil extracted from a cereal grain or bran lacking i) and ii) of the invention.
  • extracted cereal grain or bran oil of this aspect has a total fatty acid content comprising between 50% and 80%, or between 55% and 80%, oleic acid (w/w dry weight).
  • the cereal oil is rice, sorghum, wheat, oats, rye, barley or maize oil.
  • the bran oil is rice, sorghum, wheat, oats, rye, barley or maize bran oil.
  • the oil is a sorghum grain oil or bran oil.
  • the oil is a rice grain oil or bran oil.
  • extracted cereal grain or bran oil of the invention has a total fatty acid content comprising between 55% and 75%, or between 55% and 70%, oleic acid (w/w dry weight). In an embodiment, extracted cereal grain or bran oil of the invention has a total fatty acid content comprises between 55% and 65% oleic acid (w/w dry weight). In an embodiment, extracted cereal grain or bran oil of the invention has a total fatty acid content comprising less than 22%, less than 21%, less than 20%, less than 18%, less than 15%, between 15% and 22% or between 15% and 21%, palmitic acid (w/w dry weight).
  • extracted cereal grain or bran oil of the invention has a total fatty acid content comprising between 10% and 15% palmitic acid (w/w dry weight). In an embodiment, extracted cereal grain or bran oil of the invention has a total fatty acid content comprising between 10% and 13% palmitic acid (w/w dry weight). In an embodiment, extracted cereal grain or bran oil of the invention has a total fatty acid content comprising less than 20%, less than 15%, less than 10%, less than 5%, between 2% and 20% or between 5% and 15%, linoleic acid (w/w dry weight). In an embodiment, extracted cereal grain or bran oil of the invention has a total fatty acid content comprising between 15% and 25% linoleic acid (w/w dry weight).
  • extracted cereal grain or bran oil of the invention has a total fatty acid content comprising between 55% and 65% oleic acid, between 10% and 15% palmitic acid and between 15% and 25% linoleic acid.
  • the present invention provides a substantially purified and/or recombinant mutant FAD 2-1 protein which has between 5% and 95% less, between 20% and 80% less, between 40% and 70% less, or between 50% and 60% less, ⁇ 12 desaturase activity than a FAD2-1 protein consisting of the amino acid sequence set forth in SEQ ID NO:1, than a corresponding wild type FAD2-1 protein.
  • this aspect excludes wild type FAD 2-1 proteins such as those consisting of an amino acid sequence set forth as any one of SEQ ID NO’s 1 to 9.
  • the mutant FAD 2-1 comprises an amino acid sequence which is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 95.5%, identical to the amino acid sequence set forth in and one or more of SEQ ID NOs 1 to 9.
  • the mutant FAD 2-1 comprises an amino acid sequence which is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 95.5%, identical to the amino acid sequence set forth in SEQ ID NO:1.
  • the mutant FAD 2-1 comprises an amino acid sequence which is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 95.5%, identical to the amino acid sequence set forth in SEQ ID NO:6.
  • the protein comprises a sequence of amino acids set forth in SEQ ID NO:10 or SEQ ID NO:11.
  • the mutant is an N-terminal truncation of the wild type protein.
  • the mutant lacks one or more or all of the first six amino acids of the wild type FAD 2-1 protein.
  • the mutant is encoded by a FAD2-1 gene with a genetically modified translation start site.
  • the present invention provides an isolated and/or exogenous polynucleotide encoding the protein of the invention.
  • the present invention provides a vector comprising the polynucleotide of the invention.
  • the polynucleotide is operably linked to a promoter.
  • a cell preferably a rice cell, which comprises the genetic modifications as defined herein, the polynucleotide of the invention or the vector of the invention.
  • the cell is a cereal plant cell. Examples of cereal plant cells of the invention include, but are not limited to, wheat, oats, rye, barley, rice, corn, sorghum or maize cells.
  • the cell is a sorghum cell.
  • the cell is a rice cell.
  • the cell is a rice grain cell such as a rice bran cell.
  • the polynucleotide is integrated into the genome of the cell.
  • the present invention provides a cereal plant comprising one or more or all of cereal grain of the invention, cereal bran of the invention, the protein of the invention, the polynucleotide of the invention, the vector of the invention or the cell of the invention.
  • the plant is a sorghum plant. Also provided is a population of at least 100 plants, such as rice plants, of the invention growing in a field.
  • the present invention provides a method of producing the cell of the invention, the method comprising a step of introducing genetic modifications as defined herein, the polynucleotide of the invention or the vector of the invention, into a cell.
  • the present invention provides a method of identifying a FAD 2-1 protein with reduced FAD 2-1 protein activity, the method comprising i) obtaining a polypeptide having an amino acid sequence which is at least 90%, least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical, but not identical, to the amino acid sequence set forth in any one or more of SEQ ID NO’s 1 to 9, ii) assessing FAD 2-1 protein activity of the polypeptide by determining the ability of the polypeptide to introduce a double bond into oleic acid at ⁇ 12 position, and iii) selecting a polypeptide which has some FAD 2-1 protein activity, but less FAD 2-1 protein activity than a protein consisting of
  • the polypeptide of part i) is assessed in comparison to a corresponding wild type FAD2-1.
  • the method comprises i) obtaining a polypeptide having an amino acid sequence which is at least 90%, least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 99.5% identical, but not identical, to the amino acid sequence set forth in SEQ ID NO: 1, ii) assessing FAD 2-1 protein activity of the polypeptide by determining the ability of the polypeptide to introduce a double bond into oleic acid at ⁇ 12 position, and iii) selecting a polypeptide which has some FAD 2-1 protein activity, but less FAD 2-1 protein activity than a protein consisting of an amino acid sequence set forth in SEQ ID NO:1.
  • the polypeptide of i) is a N-terminal and/or C-terminal truncation of a wild type FAD2-1 polypeptide.
  • the present invention provides a method of producing a genetically modified cereal plant, the method comprising i) introducing a genetic modification into a cereal cell such that it encodes a protein of the invention, and ii) producing a plant from the cell.
  • the method further comprises analysing the fertility of the plant, and selecting a plant which is fertile.
  • the method further comprises analysing the fatty acid composition of grain and/or bran of the plant, or a descendent thereof, and selecting a plant which produces grain and/or bran having a total fatty acid content as defined herein.
  • the cell does not encode a functional LOX3 protein.
  • the method further comprising introducing a genetic modification such that the plant, or a descendent thereof, does not encode a functional LOX3 protein in its grain and/or bran.
  • the method further comprises harvesting grain from the plant of step ii), the grain having the genetic modification(s).
  • the method further comprises producing one or more generations of genetically modified progeny plants from the genetically modified grain, the progeny plants having the genetic modification(s).
  • the present invention provides a method of producing a cereal plant of the invention, the method comprising crossing a first genetically modified parental plant having grain comprising at least some FAD 2-1 protein activity, wherein the FAD 2-1 protein activity is reduced when compared to a wild type cereal grain, with a second genetically modified parental plant having grain comprising reduced LOX3 protein activity when compared to the wild type cereal grain.
  • the present invention provides a method of selecting a cereal plant of the invention, or grain from the plant, the method comprising the steps of i) screening a population of cereal plants, grain or bran each of which were obtained from a mutagenic treatment of progenitor cereal cells, grain or plants, for the production of grain or bran as defined herein, or for the presence of the genetic modifications, and ii) selecting from the population of step (i) a cereal plant or grain which produces grain as defined herein, thereby selecting the cereal plant or grain.
  • step ii) comprises: i) analysing a sample comprising DNA from a progeny plant, or grain therefrom, for the genetic modifications, and/or ii) analysing the fatty acid content of the grain or bran therefrom.
  • the present invention provides a method for identifying a cereal plant of the invention, the method comprising the steps of i) obtaining a nucleic acid sample from a cereal plant, and ii) screening the sample for the presence or absence of a first genetic modification which reduces but does not abolish FAD 2-1 protein activity in grain of a plant when compared to a wild type cereal grain, and a second genetic modification which reduces LOX3 protein activity in grain of the plant when compared to a wild type cereal grain.
  • the present invention provides a process of producing extracted cereal grain and/or cereal bran oil, the process comprising; i) obtaining grain and/or bran from a cereal plant of the invention, and ii) extracting oil from the grain and/or cereal bran.
  • the extracted oil is as defined herein.
  • the present invention provides a method of producing a cereal plant part, the method comprising, a) growing a cereal plant, or at least 100 such cereal plants in a field, of the invention, and b) harvesting the cereal plant part from the cereal plant or cereal plants.
  • the part is grain.
  • the present invention provides a method of producing cereal flour, bran, wholemeal, malt, starch or oil obtained from grain, the method comprising; a) obtaining grain of a plant of the invention, or the grain and/or bran of the invention, and b) processing the grain to produce the flour, bran, wholemeal, malt starch or oil.
  • the oil is cereal bran oil such as rice bran oil.
  • the present invention provides lipid or oil obtained, or obtainable, by the process of the invention.
  • the present invention provides a product produced from a plant of the invention, or from the grain and/or bran of the invention.
  • the product comprises the genetic modifications.
  • the product is a food ingredient, beverage ingredient, food product or beverage product.
  • the food ingredient or beverage ingredient is selected from the group consisting of wholemeal, flour, bran, starch, malt and oil.
  • the food product is selected from the group consisting of: animal fodder, breakfast cereals, and snack foods.
  • the beverage product is a packaged beverage or a beverage comprising ethanol.
  • the present invention provides a method of preparing a food or beverage ingredient of the invention, the method comprising processing grain of a cereal plant of the invention, the grain and/or bran of the invention, or bran, flour, wholemeal, malt, starch or oil from the grain, to produce the food or beverage ingredient.
  • the present invention provides a method of preparing a food or beverage product of the invention, the method comprising processing grain of a cereal plant of the invention, the grain and/or bran of the invention, or bran, flour, wholemeal, malt, starch or oil from the grain, to produce the food or beverage.
  • the present invention provides a method of preparing food, the method comprising cooking an edible substance in cereal oil, such as rice oil, of the invention. Also provided is the use of a cereal plant of the invention or part thereof, or the grain and/or bran of the invention, as animal feed or food, or to produce feed for animal consumption or food for human consumption.
  • the present invention provides a composition comprising one or more of a polypeptide of the invention, a polynucleotide of the invention, a vector of the invention, a cell of the invention, or oil of the invention, and one or more acceptable carriers. Any embodiment herein shall be taken to apply mutatis mutandis to any other embodiment unless specifically stated otherwise.
  • the present invention is not to be limited in scope by the specific embodiments described herein, which are intended for the purpose of exemplification only. Functionally-equivalent products, compositions and methods are clearly within the scope of the invention, as described herein.
  • FIG. 1 CRISPR gene editing vector V1 in pYLCRISPR_Cas9Pubi-H.
  • Figure 3. Alignment of translated protein sequences of OsFATB genes with Arabidopsis FATB1. The asterisk * shows the site of the catalytic triad (aspartate N- 227, histidine H-229 and cysteine C-264) in the aligned sequences.
  • Figure 4. Vector 2 FATB gRNA ligation product (Golden Gate, BsaI): pYLCRISPR_Cas9Pubi-H-V2.
  • Figure 5. Half seed fatty acid composition. A, T3 seeds of V1-13 and Neg; B, T2 seeds from a single panicle of V1-13.
  • A) Line genotype key is as follows: KD refers to the fad2-1 KD/KD+lox3KO genotype; LOX is FAD2WT+lox3-KO genotype; and Neg is the Negative control.
  • B) FAD2-KO is the homozygous fad2-1 KO/KO line; Neg refers to the Negative Control; FAD2-KD refers to the fad2-1 KD/KD+lox3KO genotype; FAD2-KD/KO refers to the fad2-1 KD/KO +lox3-KO; and LOX3 refers to the FAD2-1WT+lox3 KO genotype.
  • Figure 7. Half seed fatty acid composition T3 seeds of V2 mutants as described in Tables 5 and 7.
  • b1, b2, b3 and b4 refers to the presence of a mutated version of one or more of the FATB1, FATB2, FATB3 and FATB4 respectively.
  • NEG is a Negative Control and Nip refers to wild type Niponnbare.
  • Figure 8. Total fatty acid composition of high oleic and low palmitic acid genotypes. There are five major fatty acids in brown rice (16:0, 18:0, 18:1, 18:2, and 18:3) and some minor fatty acids, such as myristic (14:0) and 20:0.
  • A Total fatty acid composition of rice bran oil extract from genetically modified mutants and FAD2- RNAi line.
  • KD refers to the fad2-1 KD/KD+lox3KO genotype; LOX is FAD2WT+lox3-KO genotype; and Neg is the Negative control.
  • C FAD2 is FAD2- RNAi silenced line, NEG is negative control.
  • Figure 10 The production of hexanal compound from the rice bran samples of the gene edited mutants and FAD2 RNAi silenced lines in a 3 day storage stimulation assay. D0 (Day 0) and D3 (Day 3) indicate the time point when samples were taken before and after the storage stimulation.
  • KD refers to the fad2-1 KD/KD+lox3KO genotype
  • KK refers to the fad2-1 KD/KO+lox3KO genotype
  • LOX is FAD2WT+lox3- KO genotype
  • Neg is the Negative control.
  • FAD2 refers to the FAD2-RNAi silenced line and NC is the corresponding negative control.
  • Figure 11. Alignment of wild type cereal FAD2-1 proteins.
  • Figure 12. Alignment of wild type cereal LOX3 proteins.
  • the term about refers to +/- 10%, more preferably +/- 5%, more preferably +/1%, of the designated value.
  • the word "comprise”, or variations such as “comprises” or “comprising”, will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or steps.
  • an “oil” is a composition comprising predominantly lipid and which is a liquid at room temperature.
  • oil of the invention preferably comprises at least 75%, at least 80%, at least 85% or at least 90% lipid by weight.
  • a purified oil comprises at least 90% triacylglycerols (TAG) by weight of the lipid in the oil.
  • oil of the invention is grain and/or bran oil.
  • rice oil refers to a composition obtained from the grain/seed, or a portion thereof such as the bran layer, of a rice plant which comprises at least 60% (w/w) lipid.
  • Rice oil is typically a liquid at room temperature.
  • the lipid comprises fatty acids that are at least 6 carbons in length.
  • the fatty acids are typically in an esterified form, such as for example as triacylglycerols, phospholipid.
  • Rice oil of the invention comprises oleic acid.
  • Rice oil of the invention may also comprise at least some other fatty acids such as palmitic acid, linoleic acid, myristic acid, stearic acid and/or linolenic acid.
  • the fatty acids may be free fatty acids and/or be found as triacylglycerols (TAGs).
  • TAGs triacylglycerols
  • at least 50%, more preferably at least 70%, more preferably at least 80% of the fatty acids in rice oil of the invention be found as TAGs.
  • Rice oil of the invention can form part of the rice grain/seed or portion thereof such as the aleurone layer or embryo/scutellum, which together are referred to as “rice bran”.
  • rice oil of the invention has been extracted from rice grain/seed or rice bran.
  • “rice oil” of the invention is “substantially purified” or “purified” rice oil that has been separated from one or more other lipids, nucleic acids, polypeptides, or other contaminating molecules with which it is associated in its native state. It is preferred that the substantially purified rice oil is at least 60% free, more preferably at least 75% free, and more preferably at least 90% free from other components with which it is naturally associated.
  • the ratio of oleic acid to linoleic acid, palmitic acid to oleic acid and/or palmitic acid to linoleic acid has not been significantly altered (for example, no greater than a 5% alteration) when compared to the ratio in the intact seed/grain or bran.
  • the rice oil has not been exposed to a procedure, such as hydrogenation, which may alter the ratio of oleic acid to linoleic acid, palmitic acid to oleic acid and/or palmitic acid to linoleic acid when compared to the ratio in the intact seed/grain or bran.
  • Rice oil of the invention may further comprise non-fatty acid molecules such as, but not limited to, ⁇ -oryzanols and sterols.
  • Rice oil may be extracted from rice grain or bran by any method known in the art. This typically involves extraction with nonpolar solvents such as diethyl ether, petroleum ether, chloroform/methanol or butanol mixtures. Lipids associated with the starch in the grain may be extracted with water-saturated butanol.
  • the rice oil may be “de-gummed” by methods known in the art to remove polysaccharides or treated in other ways to remove contaminants or improve purity, stability or colour.
  • the triacylglycerols and other esters in the oil may be hydrolysed to release free fatty acids, or the oil hydrogenated or treated chemically or enzymatically as known in the art.
  • Rice oil after extraction from rice seed or bran typically comprises the group of lipids called ⁇ -oryzanols.
  • ⁇ -oryzanol refers to the presence of at least 0.1% (w/w) ⁇ -oryzanol compounds in the oil.
  • the levels of ⁇ - oryzanol in rice oil after extraction and before removal from the TAG is typically 1.5- 3.5% (w/w).
  • the compounds are typically a mixture of steryl and other triterpenyl esters of ferulic acid (4-hydroxy-3-methoxy cinnamic acid).
  • Cycloartyl ferulate, 24- methylene cycloartanyl ferulate and campesteryl ferulate are the predominant ferulates in oryzanol, with lower levels of ⁇ -sitosteryl ferulate and stigmasteryl ferulate.
  • the presence of ⁇ -oryzanols is thought to help protect consumers of rice oil against chronic diseases such as heart disease and cancer and therefore the presence of ⁇ -oryzanol is advantageous.
  • the “Rancimat” method is a well known test based on accelerated ageing.
  • Air is conducted through the sample in the reaction vessel at a constantly increased temperature.
  • the fatty acids are oxidized during this process.
  • Volatile secondary reaction products are formed at the end of the test that are conducted by air flow into a measuring vessel, where they are absorbed by a measuring solution (distilled water).
  • the continually recorded electrical conductivity increases as a result of the absorption of the ionic reaction products.
  • the time up to which the secondary reaction products arise is called the induction time. It characterizes the oxidation stability of oils and fats.
  • the term "rice bran” refers to the layer (aleurone layer) between the inner white rice grain and the outer hull of a rice seed/grain as well as the embryo/scutellum of the grain.
  • the rice bran is the primary by product of the polishing of brown rice to produce white rice.
  • the term “Fad2 protein” refers to a protein which performs a desaturase reaction converting oleic acid to linoleic acid.
  • the term “Fad2 protein activity” refers to the conversion of oleic acid to linoleic acid.
  • the term “Fad2-1 protein” refers to an evolutionary conserved subclass of FAD2-1 proteins which are typically expressed in seeds. Examples of FAD 2-1 proteins have an amino acid sequence as set forth in any one of SEQ ID NO’s 1 to 9.
  • Fad2 polypeptides in rice designated OsFAD2-1 (LOC_Os02g48560) (SEQ ID NO:1), OsFAD2-2 (LOC_Os07g23430) (SEQ ID NO:12), OsFAD2-3 (LOC_Os07g23410) (SEQ ID NO1:3) and OsFAD2-4 (LOC_Os07g23390) (SEQ ID NO:14) ( Figure 1).
  • Naturally occurring FAD2 enzymes typically comprise three histidine-rich motifs which have been implicated in the formation of the diiron-oxygen complex used in biochemical catalysis (Shanklin et al., 1998).
  • a rice FAD2-1 protein has an amino acid sequence which is at least 95%, at least 97%, at least 99%, or at least 99.5% identical when compared to the sequence of amino acids set forth as SEQ ID NO:1, or is identical thereto.
  • LOX lipoxygenases
  • EC 1.13.11.12 lipoxygenases
  • Lipoxygenases have an amino terminal ⁇ -barrel, now known as a PLAT (Polycystin-1, Lipoxygenase, Alpha- Toxin) domain and a much larger ⁇ -helical domain that houses the catalytic iron.
  • Lipoxygenases havean amino terminal ⁇ -barrel, now known as a PLAT (Polycystin-1, Lipoxygenase, Alpha-Toxin) domain and a much larger ⁇ -helical domain that houses the catalytic iron (Newcomer and Brash, 2015).
  • LOXs are classified into three types (Mizuno et al., 2003). Type I lipoxygenase is localized in chloroplast and stress inducible; Type II lipoxygenase is localized in cytoplasm, derived from dicots, and is not stress inducible; Type III lipoxygenase is localized in the cytoplasm, derived from monocots and related to seed germination.
  • Type I LOXs have a transit peptide, this is absent in Type II and Type III LOXs.
  • LOXs are also classified as either 9-LOXs or 13- LOXs according to the enzymes preference for carbon 9 or carbon 13 in the substrate hydrocarbon backbone, generating 9(S)-hydroperoxy- and 9(S)-hydroperoxy- derivatives (Feussner and Wasternack, 2002). Based on bioinformatic analysis, it is purported that the rice genome (rice.plantbiology.msu.edu) has 14 LOX protein genes. Three isozymes of Type III LOXs (LOX1, LOX2, and LOX3) have been identified in developing rice seeds (Ohta et al., 1986).
  • LOX3 is the most abundant enzyme.
  • Examples of LOX3 proteins have an amino acid sequence as set forth in any one of SEQ ID NO’s 23 to 29.
  • a rice LOX3 protein has an amino acid sequence which is at least 95%, at least 97%, at least 99%, or at least 99.5% identical when compared to the sequence of amino acids set forth as SEQ ID NO:23, or is identical thereof.
  • LOX3 protein activity refers to the peroxidation of fatty acids in cereal grain such as rice grain.
  • the term “FatB polypeptide” refers to a protein which hydrolyses palmitoyl-ACP to produce free palmitic acid.
  • FatB activity refers to the hydrolysis of palmitoyl-ACP to produce free palmitic acid.
  • FatB-1 protein refers to an evolutionary conserved subclass of FATB proteins which are typically expressed in seeds.
  • There are four rice OsFATB genes were named FATB1 (LOC_Os06g05130) (SEQ ID NO:19), FATB2 (LOC_Os11g43820) (SEQ ID NO:20), FATB3 (LOC_Os02g43090) (SEQ ID NO:21) and FATB4 (LOC_Os06g39520) (SEQ ID NO:22) (WO 2008/006171).
  • a rice FATB-1 protein has an amino acid sequence which is at least 95%, at least 97%, at least 99%, or at least 99.5% identical when compared to the sequence of amino acids set forth as SEQ ID NO:21, or is identical thereto.
  • the phrase “more stable” is a relative term. Stability refers the oxidative stability of the oil.
  • a “more stable” oil (such as rice oil of the invention) is oxidised to a lesser extent than oil from a wild type plant (lacking the genetic modifications of the invention) when stored under the same conditions for the same length of time.
  • one measure for improved stability is hexanal production (see Example 9).
  • seed and “grain” are used interchangeably herein.
  • “Grain” generally refers to mature, harvested grain but can also refer to grain after imbibition or germination, according to the context. Mature grain commonly has a moisture content of less than about 18-20%.
  • “fertile” grain is able to germinate to produce a fertile plant, whereas a fertile plant is able to produce fertile grain.
  • a plant of the invention is at least able to produce 50% or more, or 75% or more, of the amount of fertile grain when compared to a corresponding wild type plant lacking the genetic modifications.
  • “Wild type”, as used herein, refers to a cell, tissue or plant that has not been modified according to the invention.
  • Wild-type cells, tissue or plants may be used as controls to compare levels of expression of an exogenous nucleic acid or the extent and nature of trait modification with cells, tissue or plants modified as described herein.
  • Wild-type rice varieties that are suitable as a reference standard include Nipponbare.
  • Polypeptides The terms “polypeptide” and “protein” are generally used interchangeably.
  • substantially purified polypeptide or “purified polypeptide” we mean a polypeptide that has generally been separated from the lipids, nucleic acids, other peptides, and other contaminating molecules with which it is associated in its native state.
  • the substantially purified polypeptide is at least 90% free from other components with which it is naturally associated.
  • the polypeptide of the invention has an amino acid sequence which is different to a naturally occurring FAD2-1 and/or LOX3 polypeptide i.e. is an amino acid sequence variant.
  • Genetically modified organisms, such as plants, and host cells of the invention may comprise an exogenous polynucleotide encoding a polypeptide of the invention. In these instances, the plants and cells produce a recombinant polypeptide.
  • recombinant in the context of a polypeptide refers to the polypeptide encoded by an exogenous polynucleotide when produced by a cell, which polynucleotide has been introduced into the cell or a progenitor cell by recombinant DNA or RNA techniques such as, for example, transformation.
  • the cell comprises a non-endogenous gene that causes an altered amount of the polypeptide to be produced.
  • a "recombinant polypeptide” is a polypeptide made by the expression of an exogenous (recombinant) polynucleotide in a plant cell.
  • the query sequence is at least 300 amino acids in length, and the GAP analysis aligns the two sequences over a region of at least 300 amino acids. More preferably, the query sequence is at least 325 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 335 amino acids. Even more preferably, the query sequence is at least 350 amino acids in length and the GAP analysis aligns the two sequences over a region of at least 350 amino acids. Even more preferably, the GAP analysis aligns two sequences over their entire length.
  • the polypeptide comprises an amino acid sequence which is preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%, more preferably at least 99.6%, more preferably at least 99.7%, more preferably at least 99.8%, and even more preferably at least 99.9% identical to the relevant nominated SEQ ID NO.
  • Amino acid sequence mutants/variants of the polypeptides defined herein can be prepared by introducing appropriate nucleotide changes into a nucleic acid, or by in vitro synthesis of the desired polypeptide.
  • Such mutants include, for example, deletions, insertions or substitutions of residues within the amino acid sequence.
  • a combination of deletion, insertion and substitution can be made to arrive at the final construct, provided that the final peptide product possesses the desired characteristics.
  • Preferred amino acid sequence mutants have one, two, three, four or less than 10 amino acid changes relative to the reference polypeptide.
  • the mutant/variant may be N-terminally and/or C- terminally truncated.
  • the FAD2-1 protein with reduced activity has an N-terminal truncation compared to the wild type sequence such as lacking the first three, four, five, or six N-terminal amino acids.
  • the mutant lacks the first six amino acids of the wild type FAD 2-1 protein.
  • the LOX3 protein with reduced, preferably no, activity has an C-terminal truncation compared to the wild type sequence such as lacking at least last 100, 200, 300, 400, 500, 600 or so C-terminal amino acids. In an embodiment, the mutant lacks the last about 500 C-terminal amino acids of the wild type LOX3 protein.
  • the genetically modified LOX3 gene only encodes the first about 91 amino acids of a wild type LOX3 protein.
  • Mutant (altered) polypeptides can be prepared using any technique known in the art, for example, using directed evolution, rational design strategies or mutagenesis (see below). Products derived from mutated/altered DNA can readily be screened using techniques described herein to determine if, when expressed in a plant, such as rice, confer reduced FAD 2-1 protein activity or LOX3 protein activity.
  • the method may comprise producing a plant with a genetic modification expressing the mutated/altered DNA and determining the fertility and fatty acid profile of grain of the plant.
  • amino acid sequence mutants the location of the mutation site and the nature of the mutation will depend on characteristic(s) to be modified.
  • the sites for mutation can be modified individually or in series, e.g., by (1) substituting first with conservative amino acid choices and then with more radical selections depending upon the results achieved, (2) deleting the target residue, or (3) inserting other residues adjacent to the located site.
  • Amino acid sequence deletions generally range from about 1 to 15 residues, more preferably about 1 to 10 residues and typically about 1 to 5 contiguous residues, but may be even larger in the case of knockout mutants such as for LOX3.
  • Substitution mutants have at least one amino acid residue in the polypeptide molecule removed and a different residue inserted in its place.
  • a mutant/variant polypeptide has one or two or three or four conservative amino acid changes when compared to a naturally occurring polypeptide. Details of conservative amino acid changes are provided in Table 2.
  • the primary amino acid sequence of wild-type polypeptides can be used to design variants/mutants thereof based on comparisons with closely related polypeptides (for example, as shown in Figures 11 and 12).
  • the FATB1 with reduced activity has the amino acid sequence LNHVKTAG (SEQ ID NO:41) replaced with LNHVKTCW (SEQ ID NO:42).
  • the FATB1 with reduced activity has the amino acid sequence FLAAEKOW (SEQ ID NO:43) replaced with FLAAENSG (SEQ ID NO:44) or FLAAEKTV (SEQ ID NO:45).
  • the FATB1 with reduced activity has the amino acid sequence FLAAEKOW replaced with FLAAENSG.
  • the FATB2 with reduced activity has the amino acid sequence MIRSYEIGAD (SEQ ID NO:46) replaced with MIRSYEDWC* (SEQ ID NO:47).
  • the FATB3 with reduced activity has the amino acid sequence MIRSYEIGAD (SEQ ID NO:46) replaced with MIRSYEDWC* (SEQ ID NO:47) or MIRSYDWR* (SEQ ID NO:48).
  • the FATB3 with reduced activity has the amino acid sequence MIRSYEIGAD replaced with MIRSYEDWC*.
  • the FATB4 with reduced activity has the amino acid sequence GLLGDGFG (SEQ ID NO:49) replaced with GLLGDFWL (SEQ ID NO:50), GLLGDGFW (SEQ ID NO:51), GLLGDFG (SEQ ID NO:52) or GLLFWLNA (SEQ ID NO:53).
  • the FATB4 with reduced activity has the amino acid sequence GLLGDGFG (SEQ ID NO:49) replaced with GLLGDFWL (SEQ ID NO:50).
  • the FAD2-1 knockdown has the amino acid sequence MGAGGR (SEQ ID NO:54) deleted from the N-terminus.
  • the FAD2-1 knockdown has the amino acid sequence Aa177’PYVYHNPIG’aa185 (SEQ ID NO:55) replaced with Aa177’PYVYHTIG’aa184 (SEQ ID NO:56).
  • the FAD2-1 knockdown has the amino acid sequence MGAGGR deleted from the N-terminus and the amino acid sequence Aa177’PYVYHNPIG’aa185 replaced with Aa177’PYVYHTIG’aa184.
  • the grain, bran and/or plant of the invention is homozygous for i) LOX3 gene which only encodes the first about 91 amino acids of a wild type LOX3 protein, ii) a FAD2-1 gene encoding a FAD2-1 polypeptide lacking MGAGGR at the N- terminus and comprising Aa177’PYVYHTIG’aa184, iii) a FATB2 gene encoding a polypeptide ending in MIRSYEDWC* (SEQ ID NO:47), iv) a FATB3 gene encoding a polypeptide ending in MIRSYEDWC* (SEQ ID NO:47), and v) a FATB4 gene encoding a polypeptide comprising GLLGDFWL.
  • the grain, bran and/or plant of the invention is homozygous for i) LOX3 gene which only encodes the first about 91 amino acids of a wild type LOX3 protein, ii) a FAD2-1 gene encoding a FAD2-1 polypeptide lacking MGAGGR at the N- terminus and comprising Aa177’PYVYHTIG’aa184, iii) a FATB1 gene encoding a polypeptide comprising FLAAENSG, and iv) a FATB4 gene encoding a polypeptide comprising GLLGDFWL.
  • the grain, bran or plant has wild type phospholipase D (PLD) activity.
  • Directed Evolution In directed evolution, random mutagenesis is applied to a protein, and a selection regime is used to pick out variants that have the desired qualities, for example, decreased activity. Further rounds of mutation and selection are then applied.
  • a typical directed evolution strategy involves three steps: 1) Diversification: The gene encoding the protein of interest is mutated and/or recombined at random to create a large library of gene variants.
  • Variant gene libraries can be constructed through error prone PCR (see, for example, Leung, 1989; Cadwell and Joyce, 1992), from pools of DNaseI digested fragments prepared from parental templates (Stemmer, 1994a; Stemmer, 1994b; Crameri et al., 1998; Coco et al., 2001) from degenerate oligonucleotides (Ness et al., 2002, Coco, 2002) or from mixtures of both, or even from undigested parental templates (Zhao et al., 1998; Eggert et al., 2005; Jézéquek et al., 2008) and are usually assembled through PCR.
  • Libraries can also be made from parental sequences recombined in vivo or in vitro by either homologous or non-homologous recombination (Ostermeier et al., 1999; Volkov et al., 1999; Sieber et al., 2001).
  • Variant gene libraries can also be constructed by sub-cloning a gene of interest into a suitable vector, transforming the vector into a "mutator" strain such as the E. coli XL-1 red (Stratagene) and propagating the transformed bacteria for a suitable number of generations.
  • Variant gene libraries can also be constructed by subjecting the gene of interest to DNA shuffling (i.e., in vitro homologous recombination of pools of selected mutant genes by random fragmentation and reassembly) as broadly described by Harayama (1998). 2) Selection: The library is tested for the presence of mutants (variants) possessing the desired property using a screen or selection. Screens enable the identification and isolation of high-performing mutants by hand, while selections automatically eliminate all nonfunctional mutants. A screen may involve screening for the presence of known conserved amino acid motifs. Alternatively, or in addition, a screen may involve expressing the mutated polynucleotide in a host organism or part thereof and assaying the level of activity.
  • Amplification The variants identified in the selection or screen are replicated many fold, enabling researchers to sequence their DNA in order to understand what mutations have occurred. Together, these three steps are termed a "round" of directed evolution. Most experiments will entail more than one round. In these experiments, the "winners” of the previous round are diversified in the next round to create a new library. At the end of the experiment, all evolved protein or polynucleotide mutants are characterized using biochemical methods. Rational Design A protein can be designed rationally, on the basis of known information about protein structure and folding.
  • Protein design typically involves identifying sequences that fold into a given or target structure and can be accomplished using computer models.
  • Computational protein design algorithms search the sequence-conformation space for sequences that are low in energy when folded to the target structure.
  • Computational protein design algorithms use models of protein energetics to evaluate how mutations would affect a protein's structure and function. These energy functions typically include a combination of molecular mechanics, statistical (i.e. knowledge- based), and other empirical terms.
  • Suitable available software includes IPRO (Interative Protein Redesign and Optimization), EGAD (A Genetic Algorithm for Protein Design), Rosetta Design, Sharpen, and Abalone.
  • Polynucleotides and Genes The present invention refers to various polynucleotides.
  • a "polynucleotide” or “nucleic acid” or “nucleic acid molecule” means a polymer of nucleotides, which may be DNA or RNA or a combination thereof, and includes genomic DNA, mRNA, cRNA, and cDNA. Less preferred polynucleotides include tRNA, siRNA, shRNA and hpRNA.
  • RNA may be DNA or RNA of cellular, genomic or synthetic origin, for example made on an automated synthesizer, and may be combined with carbohydrate, lipids, protein or other materials, labelled with fluorescent or other groups, or attached to a solid support to perform a particular activity defined herein, or comprise one or more modified nucleotides not found in nature, well known to those skilled in the art.
  • the polymer may be single-stranded, essentially double-stranded or partly double-stranded.
  • Basepairing as used herein refers to standard basepairing between nucleotides, including G:U basepairs.
  • “Complementary” means two polynucleotides are capable of basepairing (hybridizing) along part of their lengths, or along the full length of one or both.
  • polynucleotide is used interchangeably herein with the term “nucleic acid”.
  • Preferred polynucleotides of the invention encode a polypeptide of the invention.
  • isolated polynucleotide we mean a polynucleotide which has generally been separated from the polynucleotide sequences with which it is associated or linked in its native state, if the polynucleotide is found in nature.
  • the isolated polynucleotide is at least 90% free from other components with which it is naturally associated, if it is found in nature.
  • the polynucleotide is not naturally occurring, for example by covalently joining two shorter polynucleotide sequences in a manner not found in nature (chimeric polynucleotide).
  • the present invention may involve the modification of gene activity and the construction and use of chimeric genes.
  • the term "gene" includes any deoxyribonucleotide sequence which includes a protein coding region or which is transcribed in a cell but not translated, as well as associated non-coding and regulatory regions.
  • Such associated regions are typically located adjacent to the coding region or the transcribed region on both the 5’ and 3’ ends for a distance of about 2 kb on either side.
  • the gene may include control signals such as promoters, enhancers, termination and/or polyadenylation signals that are naturally associated with a given gene, or heterologous control signals in which case the gene is referred to as a "chimeric gene".
  • the sequences which are located 5’ of the coding region and which are present on the mRNA are referred to as 5’ non-translated sequences.
  • the sequences which are located 3’ or downstream of the coding region and which are present on the mRNA are referred to as 3’ non-translated sequences.
  • genomic form or clone of a gene containing the transcribed region may be interrupted with non-coding sequences termed “introns” or “intervening regions” or “intervening sequences”, which may be either homologous or heterologous with respect to the “exons” of the gene.
  • An "intron” as used herein is a segment of a gene which is transcribed as part of a primary RNA transcript but is not present in the mature mRNA molecule. Introns are removed or "spliced out” from the nuclear or primary transcript; introns therefore are absent in the messenger RNA (mRNA). Introns may contain regulatory elements such as enhancers.
  • Exons refer to the DNA regions corresponding to the RNA sequences which are present in the mature mRNA or the mature RNA molecule in cases where the RNA molecule is not translated.
  • An mRNA functions during translation to specify the sequence or order of amino acids in a nascent polypeptide.
  • the term "gene” includes a synthetic or fusion molecule encoding all or part of the proteins of the invention described herein and a complementary nucleotide sequence to any one of the above.
  • a gene may be introduced into an appropriate vector for extrachromosomal maintenance in a cell or, preferably, for integration into the host genome.
  • a "chimeric gene” refers to any gene that comprises covalently joined sequences that are not found joined in nature.
  • a chimeric gene comprises regulatory and transcribed or protein coding sequences that are not found together in nature. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that found in nature.
  • the protein coding region is operably linked to a promoter or polyadenylation/terminator region which is heterologous to the gene, thereby forming a chimeric gene.
  • endogenous is used herein to refer to a substance that is normally present or produced in an unmodified plant at the same developmental stage as the plant under investigation.
  • an “endogenous gene” refers to a native gene in its natural location in the genome of an organism.
  • recombinant nucleic acid molecule refers to a nucleic acid molecule which has been constructed or modified by recombinant DNA/RNA technology.
  • foreign polynucleotide or “exogenous polynucleotide” or “heterologous polynucleotide” and the like refer to any nucleic acid which is introduced into the genome of a cell by experimental manipulations.
  • Foreign or exogenous genes may be genes that are inserted into a non-native organism or cell, native genes introduced into a new location within the native host, or chimeric genes. Alternatively, foreign or exogenous genes may be the result of editing the genome of the organism or cell, or progeny derived therefrom.
  • a "transgene” is a gene that has been introduced into the genome by a transformation procedure.
  • exogenous in the context of a polynucleotide (nucleic acid) refers to the polynucleotide when present in a cell that does not naturally comprise the polynucleotide.
  • the query sequence is at least 900 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 900 nucleotides.
  • the query sequence is at least 975 nucleotides in length, and the GAP analysis aligns the two sequences over a region of at least 975 nucleotides.
  • the query sequence is at least 1,050 nucleotides in length and the GAP analysis aligns the two sequences over a region of at least 1,050 nucleotides.
  • the GAP analysis aligns two sequences over their entire length.
  • the polynucleotide comprises a polynucleotide sequence which is at least 50%, at least 60%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, more preferably at least 99%, more preferably at least 99.1%, more preferably at least 99.2%, more preferably at least 99.3%, more preferably at least 99.4%, more preferably at least 99.5%,
  • oligonucleotides are polynucleotides up to 50 nucleotides in length. The minimum size of such oligonucleotides is the size required for the formation of a stable hybrid between an oligonucleotide and a complementary sequence on a nucleic acid molecule of the present invention. They can be RNA, DNA, or combinations or derivatives of either. Oligonucleotides are typically relatively short single stranded molecules of 10 to 30 nucleotides, commonly 15-25 nucleotides in length.
  • the minimum size of such an oligonucleotide is the size required for the formation of a stable hybrid between the oligonucleotide and a complementary sequence on a target nucleic acid molecule.
  • the oligonucleotides are at least 15 nucleotides, more preferably at least 18 nucleotides, more preferably at least 19 nucleotides, more preferably at least 20 nucleotides, more preferably at least 22 nucleotides, even more preferably at least 25 nucleotides in length.
  • Oligonucleotides of the present invention used as a probe are typically conjugated with a label such as a radioisotope, an enzyme, biotin, a fluorescent molecule or a chemiluminescent molecule.
  • a label such as a radioisotope, an enzyme, biotin, a fluorescent molecule or a chemiluminescent molecule.
  • sequence of the oligonucleotide primers described herein can be varied to some degree without effecting their usefulness for the methods of the invention.
  • a "variant" of an oligonucleotide disclosed herein also referred to herein as a "primer” or “probe” depending on its use
  • useful for the methods of the invention includes molecules of varying sizes of, and/or are capable of hybridising to the genome close to that of, the specific oligonucleotide molecules defined herein.
  • variants may comprise additional nucleotides (such as 1, 2, 3, 4, or more), or less nucleotides as long as they still hybridise to the target region.
  • additional nucleotides such as 1, 2, 3, 4, or more
  • a few nucleotides may be substituted without influencing the ability of the oligonucleotide to hybridise the target region.
  • variants may readily be designed which hybridise close (for example, but not limited to, within 50 nucleotides or within 100 nucleotides) to the region of the genome where the specific oligonucleotides defined herein hybridise.
  • the present invention includes oligonucleotides that can be used as, for example, guides for RNA-guided endonucleases (see, for examples SEQ ID NO’s 30 to 37), probes to identify nucleic acid molecules, or primers to produce nucleic acid molecules. Probes and/or primers can be used to clone homologues of the polynucleotides of the invention from other species. Furthermore, hybridization techniques known in the art can also be used to screen genomic or cDNA libraries for such homologues. Polynucleotides of the present invention possess, when compared to naturally occurring molecules, one or more genetic modifications which are deletions, insertions, or substitutions of nucleotide residues.
  • a variant of a polynucleotide or an oligonucleotide of the invention includes molecules of varying sizes of, and/or are capable of hybridising to, the rice (for example) genome close to that of the reference polynucleotide or oligonucleotide molecules defined herein.
  • variants may comprise additional nucleotides (such as 1, 2, 3, 4, or more), or less nucleotides as long as they still hybridise to the target region.
  • a few nucleotides may be substituted without influencing the ability of the oligonucleotide to hybridise to the target region.
  • variants may readily be designed which hybridise close to, for example to within 50 nucleotides, the region of the plant genome where the specific oligonucleotides defined herein hybridise.
  • this includes polynucleotides which encode the same polypeptide or amino acid sequence but which vary in nucleotide sequence by redundancy of the genetic code.
  • polynucleotide variant and “variant” also include naturally occurring allelic variants.
  • Nucleic Acid Constructs The present invention includes nucleic acid constructs comprising the polynucleotides of the invention, and vectors and host cells containing these, methods of their production and use, and uses thereof. The present invention refers to elements which are operably connected or linked.
  • operably connected or “operably linked” and the like refer to a linkage of polynucleotide elements in a functional relationship.
  • operably connected nucleic acid sequences are contiguously linked and, where necessary to join two protein coding regions, contiguous and in reading frame.
  • a coding sequence is "operably connected to" another coding sequence when RNA polymerase will transcribe the two coding sequences into a single RNA, which if translated is then translated into a single polypeptide having amino acids derived from both coding sequences.
  • the coding sequences need not be contiguous to one another so long as the expressed sequences are ultimately processed to produce the desired protein.
  • cis-acting sequence As used herein, the term "cis-acting sequence", “cis-acting element” or “cis- regulatory region” or “regulatory region” or similar term shall be taken to mean any sequence of nucleotides, which when positioned appropriately and connected relative to an expressible genetic sequence, is capable of regulating, at least in part, the expression of the genetic sequence.
  • a cis-regulatory region may be capable of activating, silencing, enhancing, repressing or otherwise altering the level of expression and/or cell-type-specificity and/or developmental specificity of a gene sequence at the transcriptional or post-transcriptional level.
  • the cis-acting sequence is an activator sequence that enhances or stimulates the expression of an expressible genetic sequence.
  • "Operably connecting" a promoter or enhancer element to a transcribable polynucleotide means placing the transcribable polynucleotide (e.g., protein-encoding polynucleotide or other transcript) under the regulatory control of a promoter, which then controls the transcription of that polynucleotide.
  • a promoter or variant thereof In the construction of heterologous promoter/structural gene combinations, it is generally preferred to position a promoter or variant thereof at a distance from the transcription start site of the transcribable polynucleotide which is approximately the same as the distance between that promoter and the protein coding region it controls in its natural setting; i.e., the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of function.
  • the preferred positioning of a regulatory sequence element e.g., an operator, enhancer etc
  • the preferred positioning of a transcribable polynucleotide to be placed under its control is defined by the positioning of the element in its natural setting; i.e., the genes from which it is derived.
  • Promoter refers to a region of a gene, generally upstream (5') of the RNA encoding region, which controls the initiation and level of transcription in the cell of interest.
  • a “promoter” includes the transcriptional regulatory sequences of a classical genomic gene, such as a TATA box and CCAAT box sequences, as well as additional regulatory elements (i.e., upstream activating sequences, enhancers and silencers) that alter gene expression in response to developmental and/or environmental stimuli, or in a tissue-specific or cell-type-specific manner.
  • a promoter is usually, but not necessarily (for example, some PolIII promoters), positioned upstream of a structural gene, the expression of which it regulates.
  • the regulatory elements comprising a promoter are usually positioned within 2 kb of the start site of transcription of the gene. Promoters may contain additional specific regulatory elements, located more distal to the start site to further enhance expression in a cell, and/or to alter the timing or inducibility of expression of a structural gene to which it is operably connected.
  • Constutive promoter refers to a promoter that directs expression of an operably linked transcribed sequence in many or all tissues of an organism such as a plant. The term constitutive as used herein does not necessarily indicate that a gene is expressed at the same level in all cell types, but that the gene is expressed in a wide range of cell types, although some variation in level is often detectable.
  • Selective expression refers to expression almost exclusively in specific organs of, for example, the plant, such as, for example, endosperm, embryo, leaves, fruit, tubers or root.
  • a promoter is expressed selectively or preferentially in leaves and/or stems of a plant, preferably a cereal plant. Selective expression may therefore be contrasted with constitutive expression, which refers to expression in many or all tissues of a plant under most or all of the conditions experienced by the plant. Selective expression may also result in compartmentation of the products of gene expression in specific plant tissues, organs or developmental stages such as adults or seedlings.
  • Compartmentation in specific subcellular locations such as the plastid, cytosol, vacuole, or apoplastic space may be achieved by the inclusion in the structure of the gene product of appropriate signals, eg. a signal peptide, for transport to the required cellular compartment, or in the case of the semi-autonomous organelles (plastids and mitochondria) by integration of a transgene with appropriate regulatory sequences directly into the organelle genome.
  • appropriate signals eg. a signal peptide
  • organ-specific promoter is a promoter that is preferentially expressed in one tissue or organ relative to many other tissues or organs, preferably most if not all other tissues or organs in, for example, a plant.
  • the promoter is expressed at a level 10-fold higher in the specific tissue or organ than in other tissues or organs.
  • the promoters contemplated by the present invention may be native to the host plant to be transformed or may be derived from an alternative source, where the region is functional in the host plant.
  • Other sources include the Agrobacterium T-DNA genes, such as the promoters of genes for the biosynthesis of nopaline, octapine, mannopine, or other opine promoters, tissue specific promoters (see, e.g., US 5,459,252 and WO 91/13992); promoters from viruses (including host specific viruses), or partially or wholly synthetic promoters.
  • promoters that are functional in mono- and dicotyledonous plants are well known in the art (see, for example, Greve, 1983; Salomon et al., 1984; Garfinkel et al., 1983; Barker et al., 1983); including various promoters isolated from plants and viruses such as the cauliflower mosaic virus promoter (CaMV 35S, 19S).
  • Non-limiting methods for assessing promoter activity are disclosed by Medberry et al. (1992, 1993), Sambrook et al. (1989, supra) and US 5,164,316.
  • the promoter may be an inducible promoter or a developmentally regulated promoter which is capable of driving expression of the introduced polynucleotide at an appropriate developmental stage of the, for example, plant.
  • Other cis-acting sequences which may be employed include transcriptional and/or translational enhancers. Enhancer regions are well known to persons skilled in the art, and can include an ATG translational initiation codon and adjacent sequences. When included, the initiation codon should be in phase with the reading frame of the coding sequence relating to the foreign or exogenous polynucleotide to ensure translation of the entire sequence if it is to be translated.
  • Translational initiation regions may be provided from the source of the transcriptional initiation region, or from a foreign or exogenous polynucleotide.
  • the sequence can also be derived from the source of the promoter selected to drive transcription, and can be specifically modified so as to increase translation of the mRNA.
  • the nucleic acid construct of the present invention may comprise a 3' non- translated sequence from about 50 to 1,000 nucleotide base pairs which may include a transcription termination sequence.
  • a 3' non-translated sequence may contain a transcription termination signal which may or may not include a polyadenylation signal and any other regulatory signals capable of effecting mRNA processing.
  • a polyadenylation signal functions for addition of polyadenylic acid tracts to the 3' end of a mRNA precursor.
  • Polyadenylation signals are commonly recognized by the presence of homology to the canonical form 5' AATAAA-3' although variations are not uncommon. Transcription termination sequences which do not include a polyadenylation signal include terminators for PolI or PolIII RNA polymerase which comprise a run of four or more thymidines. Examples of suitable 3' non-translated sequences are the 3' transcribed non-translated regions containing a polyadenylation signal from an octopine synthase (ocs) gene or nopaline synthase (nos) gene of Agrobacterium tumefaciens (Bevan et al., 1983).
  • ocs octopine synthase
  • nos nopaline synthase
  • Suitable 3' non-translated sequences may also be derived from plant genes such as the ribulose-1,5-bisphosphate carboxylase (ssRUBISCO) gene, although other 3' elements known to those of skill in the art can also be employed.
  • ssRUBISCO ribulose-1,5-bisphosphate carboxylase
  • Suitable leader sequences include those that comprise sequences selected to direct optimum expression of the foreign or endogenous DNA sequence.
  • leader sequences include a preferred consensus sequence which can increase or maintain mRNA stability and prevent inappropriate initiation of translation as for example described by Joshi (1987).
  • Vectors The present invention includes use of vectors for manipulation or transfer of genetic constructs.
  • vector or “chimeric vector” is meant a nucleic acid molecule, preferably a DNA molecule derived, for example, from a plasmid, bacteriophage, or plant virus, into which a nucleic acid sequence may be inserted or cloned.
  • a vector preferably is double-stranded DNA and contains one or more unique restriction sites and may be capable of autonomous replication in a defined host cell including a target cell or tissue or a progenitor cell or tissue thereof, or capable of integration into the genome of the defined host such that the cloned sequence is reproducible.
  • the vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a linear or closed circular plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome.
  • the vector may contain any means for assuring self-replication.
  • the vector may be one which, when introduced into a cell, is integrated into the genome of the recipient cell and replicated together with the chromosome(s) into which it has been integrated.
  • a vector system may comprise a single vector or plasmid, two or more vectors or plasmids, which together contain the total DNA to be introduced into the genome of the host cell, or a transposon. The choice of the vector will typically depend on the compatibility of the vector with the cell into which the vector is to be introduced.
  • the vector may also include a selection marker such as an antibiotic resistance gene, a herbicide resistance gene or other gene that can be used for selection of suitable transformants. Examples of such genes are well known to those of skill in the art.
  • the nucleic acid construct of the invention can be introduced into a vector, such as a plasmid.
  • Plasmid vectors typically include additional nucleic acid sequences that provide for easy selection, amplification, and transformation of the expression cassette in prokaryotic and eukaryotic cells, e.g., pUC-derived vectors, pSK-derived vectors, pGEM-derived vectors, pSP-derived vectors, pBS-derived vectors, or binary vectors containing one or more T-DNA regions.
  • Additional nucleic acid sequences include origins of replication to provide for autonomous replication of the vector, selectable marker genes, preferably encoding antibiotic or herbicide resistance, unique multiple cloning sites providing for multiple sites to insert nucleic acid sequences or genes encoded in the nucleic acid construct, and sequences that enhance transformation of prokaryotic and eukaryotic (especially plant) cells.
  • marker gene is meant a gene that imparts a distinct phenotype to cells expressing the marker gene and thus allows such transformed cells to be distinguished from cells that do not have the marker.
  • a selectable marker gene confers a trait for which one can "select” based on resistance to a selective agent (e.g., a herbicide, antibiotic, radiation, heat, or other treatment damaging to untransformed cells).
  • a screenable marker gene confers a trait that one can identify through observation or testing, i.e., by "screening” (e.g., ⁇ -glucuronidase, luciferase, GFP or other enzyme activity not present in untransformed cells).
  • the marker gene and the nucleotide sequence of interest do not have to be linked.
  • the nucleic acid construct desirably comprises a selectable or screenable marker gene as, or in addition to, the foreign or exogenous polynucleotide.
  • the actual choice of a marker is not crucial as long as it is functional (i.e., selective) in combination with the plant cells of choice.
  • the marker gene and the foreign or exogenous polynucleotide of interest do not have to be linked, since co-transformation of unlinked genes as, for example, described in US 4,399,216 is also an efficient process in plant transformation.
  • bacterial selectable markers are markers that confer antibiotic resistance such as ampicillin, erythromycin, chloramphenicol or tetracycline resistance, preferably kanamycin resistance.
  • Exemplary selectable markers for selection of plant transformants include, but are not limited to, a hyg gene which encodes hygromycin B resistance; a neomycin phosphotransferase (nptII) gene conferring resistance to kanamycin, paromomycin, G418; a glutathione-S-transferase gene from rat liver conferring resistance to glutathione derived herbicides as, for example, described in EP 256223; a glutamine synthetase gene conferring, upon overexpression, resistance to glutamine synthetase inhibitors such as phosphinothricin as, for example, described in WO 87/05327, an acetyltransferase gene from Streptomyces viridochromogenes conferring resistance to the selective agent phosphinothricin as, for example, described in EP 275957, a gene encoding a 5-enolshikimate-3-phosphate synthase
  • a bar gene conferring resistance against bialaphos as, for example, described in WO91/02071; a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalker et al., 1988); a dihydrofolate reductase (DHFR) gene conferring resistance to methotrexate (Thillet et al., 1988); a mutant acetolactate synthase gene (ALS), which confers resistance to imidazolinone, sulfonylurea or other ALS-inhibiting chemicals (EP 154,204); a mutated anthranilate synthase gene that confers resistance to 5-methyl tryptophan; or a dalapon dehalogenase gene that confers resistance to the herbicide.
  • a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalk
  • Preferred screenable markers include, but are not limited to, a uidA gene encoding a ⁇ -glucuronidase (GUS) enzyme for which various chromogenic substrates are known, a ⁇ -galactosidase gene encoding an enzyme for which chromogenic substrates are known, an aequorin gene (Prasher et al., 1985), which may be employed in calcium-sensitive bioluminescence detection; a green fluorescent protein gene or derivatives thereof; a luciferase (luc) gene (Ow et al., 1986), which allows for bioluminescence detection, and others known in the art.
  • GUS ⁇ -glucuronidase
  • luc luciferase
  • reporter molecule as used in the present specification is meant a molecule that, by its chemical nature, provides an analytically identifiable signal that facilitates determination of promoter activity by reference to protein product.
  • the nucleic acid construct is stably incorporated into the genome of, for example, the plant.
  • the nucleic acid comprises appropriate elements which allow the molecule to be incorporated into the genome, or the construct is placed in an appropriate vector which can be incorporated into a chromosome of a plant cell.
  • One embodiment of the present invention includes a recombinant vector, which includes at least one polynucleotide molecule of the present invention, inserted into any vector capable of delivering the nucleic acid molecule into a host cell.
  • Such a vector contains heterologous nucleic acid sequences, that is nucleic acid sequences that are not naturally found adjacent to nucleic acid molecules of the present invention and that preferably are derived from a species other than the species from which the nucleic acid molecule(s) are derived.
  • the vector can be either RNA or DNA, either prokaryotic or eukaryotic, and typically is a virus or a plasmid.
  • a number of vectors suitable for stable transfection of plant cells or for the establishment of genetically modified plants have been described in, e.g., Pouwels et al., Cloning Vectors: A Laboratory Manual, 1985, supp.
  • plant expression vectors include, for example, one or more cloned plant genes under the transcriptional control of 5’ and 3’ regulatory sequences and a dominant selectable marker.
  • plant expression vectors also can contain a promoter regulatory region (e.g., a regulatory region controlling inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
  • Recombinant Cells Another embodiment of the present invention includes a recombinant cell comprising a host cell transformed with one or more recombinant molecules of the present invention, or progeny cells thereof. Transformation of a nucleic acid molecule into a cell can be accomplished by any method by which a nucleic acid molecule can be inserted into the cell. Transformation techniques include, but are not limited to, transfection, particle bombardment/biolistics, electroporation, microinjection, lipofection, adsorption, and protoplast fusion. In an embodiment, gene editing is used to transform the target cell using, for example, targeting nucleases such as TALEN, Cpf1, MAD7 and Cas9-CRISPR or engineered nucleases derived therefrom.
  • targeting nucleases such as TALEN, Cpf1, MAD7 and Cas9-CRISPR or engineered nucleases derived therefrom.
  • a recombinant cell may remain unicellular or may grow into a tissue, organ or a multicellular organism.
  • Transformed nucleic acid molecules of the present invention can remain extrachromosomal or can integrate into one or more sites within a chromosome of the transformed (i.e., recombinant) cell in such a manner that their ability to be expressed is retained.
  • Preferred host cells are plant cells, more preferably cells of a cereal plant, more preferably rice or sorghum cells, and even more preferably a rice cell.
  • Genome Editing Endonucleases can be used to generate single strand or double strand breaks in genomic DNA.
  • the genomic DNA breaks in eukaryotic cells are repaired using non- homologous end joining (NHEJ) or homology directed repair (HDR) pathways.
  • NHEJ may result in imperfect repair resulting in unwanted mutations and HDR can enable precise gene insertion by using an exogenous supplied repair DNA template.
  • CRISPR-associated (Cas) proteins have received significant interest although transcription activator-like effector nucleases (TALENs) and zinc-finger nucleases are still useful, the CRISPR-Cas system offers a simpler, versatile and cheaper tool for genome modification (Doudna and Charpentier, 2014).
  • the CRISPR-Cas systems are classed into three major groups using various nucleases or combinations on nuclease.
  • the effector module consists of a multi-protein complex whereas class 2 systems (types II, V and VI) use only one effector protein (Makarova et al., 2015).
  • Cas includes a gene that is coupled or close to or localised near the flanking CRISPR loci. Haft et al. (2005) provides a review of the Cas protein family. The nuclease is guided by the synthetic small guide RNA (sgRNAs or gRNAs) that may or may not include the tracRNA resulting in a simplification of the CRISPR- Cas system to two genes; the endonuclease and the sgRNA (Jinek et al.
  • sgRNAs or gRNAs synthetic small guide RNA
  • the sgRNA is typically under the regulatory control of a U3 or U6 small nuclear RNA promoter.
  • the sgRNA recognises the specific gene and part of the gene for targeting.
  • the protospacer adjacent motif (PAM) is adjacent to the target site constraining the number of potential CRISPR-Cas targets in a genome although the expansion of nucleases also increases the number of PAM’s available.
  • CRISPR-Cas systems are the most frequently adopted in eukaryotic work to date using a Cas9 effector protein typically using the RNA-guided Streptococcus pyogenes Cas9 or an optimised sequence variant in multiple plant species (Luo et al., 2016). Luo et al.
  • CRISPR-Cas systems refer to effector enzymes that contain the nuclease RuvC domain but do not contain the HNH domain including Cas12 enzymes including Cas12a, Cas12b, Cas12f, Cpf1, C2c1, C2c3, and engineered derivatives.
  • Cpf1 creates double-stranded breaks in a staggered manner at the PAM-distal position and being a smaller endonuclease may provide advantages for certain species (Begemann et al., 2017).
  • Other CRISPR-Cas systems include RNA-guided RNAses including Cas13, Cas13a (C2c2), Cas13b, Cas13c.
  • the CRISPR-Cas system can be combined with the provision of a nucleic acid sequence to direct homologous repair for the insertion of a sequence into a genome.
  • Targeted genome integration of plant transgenes enables the sequential addition of transgenes at the same locus. This “cis gene stacking” would greatly simplify subsequent breeding efforts with all transgenes inherited as a single locus.
  • the transgene can be incorporated into this locus by homology-directed repair that is facilitated by flanking sequence homology. This approach can be used to rapidly introduce new alleles without linkage drag or to introduce allelic variants that do not exist naturally.
  • the CRISPR-Cas II systems use a Cas9 nuclease with two enzymatic cleavage domains a RuvC and HNH domain. Mutations have been shown to alter the double strand cutting to single strand cutting and resulting in a technology variant referred to as a nickase or a nuclease-inactivated Cas9.
  • the RuvC subdomain cleaves the non- complementary DNA strand and the HNH subdomain cleaves that DNA strand complementary to the gRNA.
  • the nickase or nuclease-inactivated Cas9 retains DNA binding ability directed by the gRNA.
  • Mutations in the subdomains are known in the art for example S.pyogenes Cas9 nuclease with a D10A mutation or H840A mutation.
  • Genome Base Editing or Modification Base editors have been created by fusing a deaminase with a Cas9 domain (WO 2018/086623).
  • fusing the deaminase can take advantage of the sequence targeting directed by the gRNA to make targeted cytidine (C) to uracil (U) conversion by deamination of the cytidine in the DNA.
  • C cytidine
  • U uracil
  • Suitable cytidine deaminases may include APOBEC1 deaminase, activation-induced cytidine deaminase (AID), APOBEC3G and CDA1.
  • the Cas9-deaminase fusion may be a mutated Cas9 with nickase activity to generate a single strand break. It has been suggested that the nickase protein was potentially more efficient in promoting homology-directed repair (Luo et al., 2016).
  • Vector Free Genome Editing or Genome Modification More recently methods to use vector free approaches using Cas9/sgRNA ribonucleoproteins have been described with successful reduction of off-target events.
  • the method requires in vitro expression of Cas9 ribonucleoproteins (RNPs) which are transformed into the cell or protoplast and does not rely on the Cas9 being integrated into the host genome, thereby reducing the undesirable side cuts that has been linked with the random integration of the Cas9 gene. Only short flanking sequences are required to form a stable Cas9 and sgRNA stable ribonucleoprotein in vitro.
  • Woo et al. (2015) produced pre-assembled Cas9/sgRNA protein/RNA complexes and introduced them into protoplasts of Arabidopsis, rice, lettuce and tobacco and targeted mutagenesis frequencies of up to 45% observed in regenerated plants.
  • DNA repair templates are may be synthesised DNA fragment or a 127-mer oligonucleotide, with each encoding the cDNA or the gene of interest. Bombarded cells are grown on tissue culture medium. DNA extracted from callus or T0 plants leaf tissue using CTAB DNA extraction method can be analysed by PCR to confirm gene integration. T1 plants selected if pcr confirms presence of the gene of interest.
  • the method comprises introducing into a plant cell the DNA sequence of interest referred to as the donor DNA and the endonuclease. The endonuclease generates a break in the target site allowing the first and second regions of homology of the donor DNA to undergo homologous recombination with their corresponding genomic regions of homology.
  • the cut genomic DNA acts as an acceptor of the DNA sequence.
  • the resulting exchange of DNA between the donor and the genome results in the integration of the polynucleotide of interest of the donor DNA into the strand break in the target site in the plant genome, thereby altering the original target site and producing an altered genomic sequence.
  • the donor DNA may be introduced by any means known in the art. For example, a plant having a target site is provided.
  • the donor DNA may be provided to the plant by known transformation methods including, Agrobacterium-mediated transformation or biolistic particle bombardment.
  • the RNA guided Cas or Cpf1 endonuclease cleaves at the target site, the donor DNA is inserted into the transformed plant's genome.
  • plant as used herein as a noun refers to whole plants and refers to any member of the Kingdom Plantae, but as used as an adjective refers to any substance which is present in, obtained from, derived from, or related to a plant, such as for example, plant organs (e.g. leaves, stems, roots, flowers), single cells (e.g.
  • plant parts refers to one or more plant tissues or organs which are obtained from a plant and which comprises genomic DNA of the plant. Plant parts include vegetative structures (for example, leaves, stems), roots, floral organs/structures, seed (including embryo, cotyledons, and seed coat), plant tissue (for example, vascular tissue, ground tissue, and the like), cells and progeny of the same.
  • plant cell refers to a cell obtained from a plant or in a plant and includes protoplasts or other cells derived from plants, gamete-producing cells, and cells which regenerate into whole plants. Plant cells may be cells in culture.
  • plant tissue is meant differentiated tissue in a plant or obtained from a plant ("explant") or undifferentiated tissue derived from immature or mature embryos, seeds, roots, shoots, fruits, tubers, pollen, tumor tissue, such as crown galls, and various forms of aggregations of plant cells in culture, such as calli.
  • Exemplary plant tissues in or from seeds are cotyledon, embryo and embryo axis. The invention accordingly includes plants and plant parts and products comprising these.
  • seed refers to "mature seed” of a plant, which is either ready for harvesting or has been harvested from the plant, such as is typically harvested commercially in the field, or as “developing seed” which occurs in a plant after fertilisation and prior to seed dormancy being established and before harvest.
  • a “genetically modified plant”, or variations thereof, as used herein, refers to a plant that contains one or more genetic variations, such as introduced by gene editing, not found in a wild-type plant of the same species, variety or cultivar. Plants contemplated for use in the practice of the present invention include both monocotyledons and dicotyledons.
  • Target plants include, but are not limited to, the following: cereals (for example, wheat, barley, rye, oats, rice, maize, sorghum and related crops); grapes; beet (sugar beet and fodder beet); pomes, stone fruit and soft fruit (apples, pears, plums, peaches, almonds, cherries, strawberries, raspberries and black-berries); leguminous plants (beans, lentils, peas, soybeans); oil plants (rape or other Brassicas, mustard, poppy, olives, sunflowers, safflower, flax, coconut, castor oil plants, cocoa beans, groundnuts); cucumber plants (marrows, cucumbers, melons); fibre plants (cotton, flax, hemp, jute); citrus fruit (oranges, lemons, grapefruit, mandarins); vegetables (spinach, lettuce, asparagus, cabbages, carrots, onions, tomatoes, potatoes, paprika); lauraceae (avocados, cinnamon, camphor);
  • the plant is a cereal plant.
  • the cereal plant is a rice plant or sorghum plant.
  • the cereal plant is rice.
  • the cereal plant is maize.
  • the cereal plant is triticale.
  • the cereal plant is oats.
  • the cereal plant is barley.
  • the term "rice" refers to any species of the Genus Oryza, including progenitors thereof, as well as progeny thereof produced by crosses with other species.
  • the plant is of a Oryza species which is commercially cultivated such as, for example, a strain or cultivar or variety of Oryza sativa or suitable for commercial production of grain.
  • the genetically modified plants are homozygous for each and every genetic variation that has been introduced so that their progeny do not segregate for the desired phenotype.
  • the term "compared to an isogenic plant”, or similar phrases refers to a plant which is isogenic, or is substantially isogenic relative to the genetically modified plant but without the genetic variations.
  • the corresponding isogenic plant is of the same cultivar or variety as the progenitor of the genetically modified plant of interest.
  • Wild type or “corresponding”, as used herein, refers to a cell, tissue or plant that has not been modified according to the invention. Wild-type or corresponding cells, tissue or plants may be used as controls to compare levels of expression of mutant/variant proteins or the extent and nature of trait modification with cells, tissue or plants modified as described herein.
  • Genetically modified plants as defined in the context of the present invention include progeny of the plants which have been genetically modified using recombinant techniques, wherein the progeny comprise the genetic variation of interest. Such progeny may be obtained by self-fertilisation of the primary genetically modified plant or by crossing such plants with another plant of the same species. This would generally be to modulate the production of at least one protein defined herein in the desired plant or plant organ.
  • Genetically modified plant parts include all parts and cells of said plants comprising the genetic variations such as, for example, cultured tissues, callus and protoplasts.
  • Genetically modified plants as defined in the context of the present invention include plants (as well as parts and cells of said plants) and their progeny which have been genetically modified using recombinant techniques to cause production of at least one polypeptide as defined herein in the desired plant or plant organ.
  • Genetically modified plants can be produced using techniques known in the art, such as those generally described in A. Slater et al., Plant Biotechnology - The Genetic Manipulation of Plants, Oxford University Press (2003), N. G. Halford, Crop Technology: Genetic Modification and genome editing, World Scientific Publ Co Pte Ltd (2016), and P. Christou and H.
  • the genetically modified plants are homozygous for each and every genetic modification that has been introduced so that their progeny do not segregate for the desired phenotype.
  • the genetically modified plants may also be heterozygous for the introduced genetic modification(s), such as, for example, in F1 progeny which have been grown from hybrid seed. Such plants may provide advantages such as hybrid vigour, well known in the art.
  • Acceleration methods include, for example, microprojectile bombardment and the like.
  • microprojectile bombardment One example of a method for delivering transforming nucleic acid molecules to plant cells is microprojectile bombardment. This method has been reviewed by Yang et al., Particle Bombardment Technology for Gene Transfer, Oxford Press, Oxford, England (1994).
  • Non-biological particles that may be coated with nucleic acids and delivered into cells by a propelling force.
  • Exemplary particles include those comprised of tungsten, gold, platinum, and the like.
  • a particle delivery system suitable for use with the present invention is the helium acceleration PDS-1000/He gun is available from Bio-Rad Laboratories.
  • immature embryos or derived target cells such as scutella or calli from immature embryos may be arranged on solid culture medium.
  • plastids can be stably transformed. Method disclosed for plastid transformation in higher plants include particle gun delivery of DNA containing a selectable marker and targeting of the DNA to the plastid genome through homologous recombination (US 5, 451,513, US 5,545,818, US 5,877,402, US 5,932479, and WO 99/05265).
  • Agrobacterium-mediated transfer is a widely applicable system for introducing genes into plant cells because the DNA can be introduced into whole plant tissues, thereby bypassing the need for regeneration of an intact plant from a protoplast.
  • the use of Agrobacterium-mediated plant integrating vectors to introduce DNA into plant cells is well known in the art (see, for example, US 5,177,010, US 5,104,310, US 5,004,863, US 5,159,135). Further, the integration of the T-DNA is a relatively precise process resulting in few rearrangements.
  • the region of DNA to be transferred is defined by the border sequences, and intervening DNA is usually inserted into the plant genome.
  • Agrobacterium transformation vectors are capable of replication in E.
  • a genetically modified plant formed using Agrobacterium transformation methods typically contains a single genetic locus on one chromosome. Such genetically modified plants can be referred to as being hemizygous for the added gene. More preferred is a genetically modified plant that is homozygous for the added structural gene; i.e., a genetically modified plant that contains two added genes, one gene at the same locus on each chromosome of a chromosome pair.
  • a homozygous genetically modified plant can be obtained by sexually mating (selfing) an independent segregant genetically modified plant that contains a single added gene, germinating some of the seed produced and analyzing the resulting plants for the gene of interest. It is also to be understood that two different genetically modified plants can also be mated/crossed to produce offspring that contain two independently segregating exogenous genes. Selfing of appropriate progeny can produce plants that are homozygous for both exogenous genes. Back-crossing to a parental plant and out- crossing with a non-genetically modified plant are also contemplated, as is vegetative propagation. Descriptions of other breeding methods that are commonly used for different traits and crops can be found in Fehr, Breeding Methods for Cultivar Development, J.
  • Transformation of plant protoplasts can be achieved using methods based on calcium phosphate precipitation, polyethylene glycol treatment, electroporation, and combinations of these treatments.
  • Application of these systems to different plant varieties depends upon the ability to regenerate that particular plant strain from protoplasts. Illustrative methods for the regeneration of cereals from protoplasts are described (Fujimura et al., 1985; Toriyama et al., 1986; Abdullah et al., 1986).
  • Other methods of cell transformation can also be used and include but are not limited to introduction of polynucleotides such as DNA into plants by direct transfer into pollen, by direct injection of polynucleotides such as DNA into reproductive organs of a plant, or by direct injection of polynucleotides such as DNA into the cells of immature embryos followed by the rehydration of desiccated embryos.
  • introduction of polynucleotides such as DNA into plants by direct transfer into pollen by direct injection of polynucleotides such as DNA into reproductive organs of a plant, or by direct injection of polynucleotides such as DNA into the cells of immature embryos followed by the rehydration of desiccated embryos.
  • the regeneration, development, and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art (Weissbach et al., Methods for Plant Molecular Biology, Academic Press, San Diego, (1988)).
  • This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Genetically modified embryos and seeds are similarly regenerated. The resulting genetically modified rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.
  • the development or regeneration of plants containing the foreign, exogenous gene is well known in the art.
  • the regenerated plants are self-pollinated to provide homozygous genetically modified plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants.
  • a genetically modified plant of the present invention containing a desired genetic modification is cultivated using methods well known to one skilled in the art. Methods for transforming dicots, primarily by use of Agrobacterium tumefaciens, and obtaining genetically modified plants have been published for cotton (US 5,004,863, US 5,159,135, US 5,518,908); soybean (US 5,569,834, US 5,416,011); Brassica (US 5,463,174); peanut (Cheng et al., 1996); and pea (Grant et al., 1995).
  • Methods for transformation of cereal plants such as wheat and barley for introducing genetic variation into the plant by introduction of an exogenous nucleic acid and for regeneration of plants from protoplasts or immature plant embryos are well known in the art, see for example, CA 2,092,588, AU 61781/94, AU 667939, US 6,100,447, WO 97/048814, US 5,589,617, US 6,541,257, and other methods are set out in WO 99/14314.
  • genetically modified wheat or barley plants are produced by Agrobacterium tumefaciens mediated transformation procedures.
  • Vectors carrying the desired nucleic acid construct may be introduced into regenerable wheat cells of tissue cultured plants or explants, or suitable plant systems such as protoplasts.
  • the regenerable wheat cells are preferably from the scutellum of immature embryos, mature embryos, callus derived from these, or the meristematic tissue.
  • PCR polymerase chain reaction
  • Southern blot analysis can be performed using methods known to those skilled in the art.
  • Expression products of the genetically modified gene(s) can be detected in any of a variety of ways, depending upon the nature of the product, and include Western blot and enzyme assay.
  • One particularly useful way to quantitate protein expression and to detect replication in different plant tissues is to use a reporter gene, such as GUS.
  • a reporter gene such as GUS.
  • Marker Assisted Selection is a well recognised method of selecting for heterozygous plants required when backcrossing with a recurrent parent in a classical breeding program.
  • the population of plants in each backcross generation will be heterozygous for the gene(s) of interest normally present in a 1:1 ratio in a backcross population, and the molecular marker can be used to distinguish the two alleles of the gene.
  • the molecular marker can be used to distinguish the two alleles of the gene.
  • Such methods include, but are not limited to, the use of nucleic acid amplification, nucleic acid sequencing, nucleic acid hybridization with suitably labelled probes, single-strand conformational analysis (SSCA), denaturing gradient gel electrophoresis (DGGE), heteroduplex analysis (HET), chemical cleavage analysis (CCM), catalytic nucleic acid cleavage or a combination thereof (see, for example, Lemieux, 2000; Langridge et al., 2001).
  • the invention also includes the use of molecular marker techniques to detect polymorphisms linked to alleles of the (for example) FAD 2-1 gene or LOX3 gene conferring reduced activity.
  • RFLP restriction fragment length polymorphisms
  • RAPD RAPD
  • microsatellite simple sequence repeat, SSR
  • the closely linked markers can be obtained readily by methods well known in the art, such as Bulked Segregant Analysis, as reviewed by Langridge et al. (2001).
  • a linked loci for marker assisted selection is at least within 1cM, or 0.5cM, or 0.1cM, or 0.01cM from a gene encoding a polypeptide of the invention.
  • PCR polymerase chain reaction
  • PCR can be performed on cDNA obtained from reverse transcribing mRNA isolated from plant cells expressing a FAD 2-1 gene and/or LOX3 gene which confers upon the plant an altered grain fatty acid content. However, it will generally be easier if PCR is performed on genomic DNA isolated from a plant.
  • a primer is an oligonucleotide sequence that is capable of hybridising in a sequence specific fashion to the target sequence and being extended during the PCR. Amplicons or PCR products or PCR fragments or amplification products are extension products that comprise the primer and the newly synthesized copies of the target sequences.
  • Multiplex PCR systems contain multiple sets of primers that result in simultaneous production of more than one amplicon.
  • Primers may be perfectly matched to the target sequence or they may contain internal mismatched bases that can result in the introduction of restriction enzyme or catalytic nucleic acid recognition/cleavage sites in specific target sequences. Primers may also contain additional sequences and/or contain modified or labelled nucleotides to facilitate capture or detection of amplicons. Repeated cycles of heat denaturation of the DNA, annealing of primers to their complementary sequences and extension of the annealed primers with polymerase result in exponential amplification of the target sequence.
  • target or target sequence or template refer to nucleic acid sequences which are amplified.
  • TILLING Plants of the invention can be produced using the process known as TILLING (Targeting Induced Local Lesions IN Genomes).
  • a first step introduced mutations such as novel single base pair changes are induced in a population of plants by treating seeds (or pollen) with a chemical mutagen, and then advancing plants to a generation where mutations will be stably inherited. DNA is extracted, and seeds are stored from all members of the population to create a resource that can be accessed repeatedly over time.
  • PCR primers are designed to specifically amplify a single gene target of interest. Specificity is especially important if a target is a member of a gene family or part of a polyploid genome.
  • dye-labeled primers can be used to amplify PCR products from pooled DNA of multiple individuals.
  • Mismatches or heteroduplexes, represent both naturally occurring single nucleotide polymorphisms (SNPs) (i.e., several plants from the population are likely to carry the same polymorphism) and induced SNPs (i.e., only rare individual plants are likely to display the mutation).
  • SNPs single nucleotide polymorphisms
  • induced SNPs i.e., only rare individual plants are likely to display the mutation.
  • endonuclease such as Cel I, that recognizes and cleaves mismatched DNA is the key to discovering novel SNPs within a TILLING population.
  • Genomic fragments being assayed can range in size anywhere from 0.3 to 1.6 kb.
  • 1.4 kb fragments counting the ends of fragments where SNP detection is problematic due to noise
  • 96 lanes per assay this combination allows up to a million base pairs of genomic DNA to be screened per single assay, making TILLING a high-throughput technique. TILLING is further described in Slade and Knauf (2005), and Henikoff et al. (2004).
  • the left or right sequencing primer for a single reaction is chosen by its proximity to the polymorphism. Sequencher software performs a multiple alignment and discovers the base change, which in each case confirmed the gel band. Ecotilling can be performed more cheaply than full sequencing, the method currently used for most SNP discovery. Plates containing arrayed ecotypic DNA can be screened rather than pools of DNA from mutagenized plants. Because detection is on gels with nearly base pair resolution and background patterns are uniform across lanes, bands that are of identical size can be matched, thus discovering and genotyping SNPs in a single step. In this way, ultimate sequencing of the SNP is simple and efficient, made more so by the fact that the aliquots of the same PCR products used for screening can be subjected to DNA sequencing.
  • Plant/Grain Processing Grain/seed of the invention preferably cereal grain and more preferably rice or sorghum grain, or other plant parts of the invention, can be processed to produce a food ingredient, food or non-food product using any technique known in the art.
  • Techniques that are routinely practiced in the art can be used to extract, process, and analyze the oils produced by cells, plants, seeds, bran etc of the instant invention.
  • plant seeds are cooked, pressed, and extracted to produce crude oil, which is then degummed, refined, bleached, and deodorized.
  • Rice is typically milled to remove the husk and polished to remove the bran layer from the white rice.
  • techniques for crushing seed and bran are known in the art.
  • seeds can be tempered by spraying them with water to raise the moisture content to, e.g., 8.5%, and flaked using a smooth roller with a gap setting of 0.23 to 0.27 mm.
  • water may not be added prior to crushing.
  • Rice bran may be heated by steam at or above 100°C. Application of heat deactivates enzymes, facilitates further cell rupturing, coalesces the oil droplets, and agglomerates protein particles, all of which facilitate the extraction process.
  • Rice bran is separated during rice milling. The bran can be stabilised usually by applying heat or irradiation and then the rice bran oil recovered using chemical and/or physical methods as described.
  • the defatted rice bran provides a nutrient rich meal that is suitable for human food and animal feed. Further processing to isolate valuable fatty acids, starch or phytates from the rice bran oil or meal can be performed. Alternatively, the rice bran may be fermented. In an embodiment, the majority of the oil is released by passage through a screw press. Cakes expelled from the screw press are then solvent extracted, e.g., with hexane, using a heat traced column.
  • crude oil produced by the pressing operation can be passed through a settling tank with a slotted wire drainage top to remove the solids that are expressed with the oil during the pressing operation.
  • the clarified oil can be passed through a plate and frame filter to remove any remaining fine solid particles.
  • the oil recovered from the extraction process can be combined with the clarified oil to produce a blended crude oil.
  • a purification step may comprise one or more or all of the group consisting of: degumming, deodorising, decolourising, drying and/or fractionating the extracted oil.
  • Degumming is an early step in the refining of oils and its primary purpose is the removal of most of the phospholipids from the oil, which may be present as approximately 1-2% of the total extracted lipid. Addition of ⁇ 2% of water, typically containing phosphoric acid, at 70–80°C to the crude oil results in the separation of most of the phospholipids accompanied by trace metals and pigments.
  • the insoluble material that is removed is mainly a mixture of phospholipids and triacylglycerols and is also known as lecithin.
  • Degumming can be performed by addition of concentrated phosphoric acid to the crude seedoil to convert non-hydratable phosphatides to a hydratable form, and to chelate minor metals that are present. Gum is separated from the soil by centrifugation. Alkali refining is one of the refining processes for treating crude oil, sometimes also referred to as neutralization. It usually follows degumming and precedes bleaching. Following degumming, the oil can treated by the addition of a sufficient amount of an alkali solution to titrate all of the fatty acids and phosphoric acids, and removing the soaps thus formed.
  • Suitable alkaline materials include sodium hydroxide, potassium hydroxide, sodium carbonate, lithium hydroxide, calcium hydroxide, calcium carbonate and ammonium hydroxide. This process is typically carried out at room temperature and removes the free fatty acid fraction. Soap is removed by centrifugation or by extraction into a solvent for the soap, and the neutralised oil is washed with water. If required, any excess alkali in the oil may be neutralized with a suitable acid such as hydrochloric acid or sulphuric acid.
  • Bleaching is a refining process in which oils are heated at 90–120°C for 10–30 minutes in the presence of a bleaching earth (0.2–2.0%) and in the absence of oxygen by operating with nitrogen or steam or in a vacuum.
  • This step in oil processing is designed to remove unwanted pigments (carotenoids, chlorophyll, gossypol etc), and the process also removes oxidation products, trace metals, sulphur compounds and traces of soap.
  • Deodorization is a treatment of oils and fats at a high temperature (200–260°C) and low pressure (0.1–1 mm Hg). This is typically achieved by introducing steam into the oil at a rate of about 0.1 ml/minute/100 ml of oil. After about 30 minutes of sparging, the oil is allowed to cool under vacuum. The oil is typically transferred to a glass container and flushed with argon before being stored under refrigeration.
  • This treatment improves the colour of the oil and removes a majority of the volatile substances or odorous compounds including any remaining free fatty acids, monoacylglycerols and oxidation products.
  • Winterization is a process sometimes used in commercial production of oils for the separation of oils and fats into solid (stearin) and liquid (olein) fractions by crystallization at sub-ambient temperatures. It was applied originally to cottonseed oil to produce a solid-free product. It is typically used to decrease the saturated fatty acid content of oils.
  • Transesterification is a process that exchanges the fatty acids within and between TAGs or transfers the fatty acids to another alcohol to form an ester, initially by releasing fatty acids from the TAGs either as free fatty acids or as fatty acid esters, usually fatty acid methyl esters or ethyl esters.
  • transesterification can be used to modify the fatty acid composition of lipids.
  • Transesterification can use either chemical (e.g. strong acid or base catalysed) or enzymatic means, the latter using lipases which may be position-specific (sn-1/3 or sn- 2 specific) for the fatty acid on the TAG, or having a preference for some fatty acids over others.
  • the fatty acid fractionation to increase the concentration of LC-PUFA in an oil can be achieved by any of the methods known in the art, such as, for example, freezing crystallization, complex formation using urea, molecular distillation, supercritical fluid extraction and silver ion complexing.
  • Complex formation with urea is a preferred method for its simplicity and efficiency in reducing the level of saturated and monounsaturated fatty acids in the oil.
  • the TAGs of the oil are split into their constituent fatty acids, often in the form of fatty acid esters, by hydrolysis under either acid or base catalysed reaction conditions, whereby one mol of TAG is reacted with at least 3 mol of alcohol (e.g.
  • the product is whole grain flour such as, for example, an ultrafine-milled whole grain flour, or a flour made from about 100% of the grain.
  • the whole grain flour includes a refined flour constituent (refined flour or refined flour) and a coarse fraction (an ultrafine-milled coarse fraction).
  • Refined flour may be flour which is prepared, for example, by grinding and bolting cleaned grain such as rice or sorghum grain.
  • the particle size of refined flour is described as flour in which not less than 98% passes through a cloth having openings not larger than those of woven wire cloth designated "212 micrometers (U.S. Wire 70)".
  • the coarse fraction includes at least one of: bran and germ.
  • the germ is an embryonic plant found within the grain kernel.
  • the germ includes lipids, fiber, vitamins, protein, minerals and phytonutrients, such as flavonoids.
  • the bran includes several cell layers and has a significant amount of lipids, fiber, vitamins, protein, minerals and phytonutrients, such as flavonoids.
  • the coarse fraction may include an aleurone layer which also includes lipids, fiber, vitamins, protein, minerals and phytonutrients, such as flavonoids.
  • the aleurone layer while technically considered part of the endosperm, exhibits many of the same characteristics as the bran and therefore is typically removed with the bran and germ during the milling process.
  • the aleurone layer contains proteins, vitamins and phytonutrients, such as ferulic acid.
  • the coarse fraction may be blended with the refined flour constituent.
  • the coarse fraction may be mixed with the refined flour constituent to form the whole grain flour, thus providing a whole grain flour with increased nutritional value, fiber content, and antioxidant capacity as compared to refined flour.
  • the coarse fraction or whole grain flour may be used in various amounts to replace refined or whole grain flour in baked goods, snack products, and food products.
  • the whole grain flour of the present invention i.e.-ultrafine-milled whole grain flour
  • a granulation profile of the whole grain flour is such that 98% of particles by weight of the whole grain flour are less than 212 micrometers.
  • enzymes found within the bran and germ of the whole grain flour and/or coarse fraction are inactivated in order to stabilize the whole grain flour and/or coarse fraction. Stabilization is a process that uses steam, heat, radiation, or other treatments to inactivate the enzymes found in the bran and germ layer.
  • the whole grain flour, the coarse fraction, or the refined flour may be a component (ingredient) of a food product and may be used to product a food product.
  • the food product may be a bagel, a biscuit, a bread, a bun, a croissant, a dumpling, an English muffin, a muffin, a pita bread, a quickbread, a refrigerated/frozen dough product, dough, baked beans, a burrito, chili, a taco, a tamale, a tortilla, a pot pie, a ready to eat cereal, a ready to eat meal, stuffing, a microwaveable meal, a brownie, a cake, a cheesecake, a coffee cake, a cookie, a dessert, a pastry, a sweet roll, a candy bar, a pie crust, pie filling, baby food, a baking mix, a batter, a breading, a gravy mix, a meat extender, a meat substitute, a seasoning mix, a soup mix, a gravy, a roux, a salad dressing, a soup, sour cream, a noodle, a pasta, ram
  • the whole grain flour, refined flour, or coarse fraction may be a component of a nutritional supplement.
  • the nutritional supplement may be a product that is added to the diet containing one or more additional ingredients, typically including: vitamins, minerals, herbs, amino acids, enzymes, antioxidants, herbs, spices, probiotics, extracts, prebiotics and fiber.
  • the whole grain flour, refined flour or coarse fraction of the present invention includes vitamins, minerals, amino acids, enzymes, and fiber.
  • the coarse fraction contains a concentrated amount of dietary fiber as well as other essential nutrients, such as B- vitamins, selenium, chromium, manganese, magnesium, and antioxidants, which are essential for a healthy diet.
  • the nutritional supplement may include any known nutritional ingredients that will aid in the overall health of an individual, examples include but are not limited to vitamins, minerals, other fiber components, fatty acids, antioxidants, amino acids, peptides, proteins, lutein, ribose, omega-3 fatty acids, and/or other nutritional ingredients.
  • the supplement may be delivered in, but is not limited to the following forms: instant beverage mixes, ready-to-drink beverages, nutritional bars, wafers, cookies, crackers, gel shots, capsules, chews, chewable tablets, and pills.
  • One embodiment delivers the fiber supplement in the form of a flavored shake or malt type beverage, this embodiment may be particularly attractive as a fiber supplement for children.
  • a milling process may be used to make a multi- grain flour or a multi-grain coarse fraction.
  • bran and germ from one type of grain may be ground and blended with ground endosperm or whole grain cereal flour of another type of cereal.
  • bran and germ of one type of grain may be ground and blended with ground endosperm or whole grain flour of another type of grain. It is contemplated that the present invention encompasses mixing any combination of one or more of bran, germ, endosperm, and whole grain flour of one or more grains.
  • This multi-grain approach may be used to make custom flour and capitalize on the qualities and nutritional contents of multiple types of cereal grains to make one flour.
  • the whole grain flour, coarse fraction and/or grain products of the present invention may be produced by any milling process known in the art.
  • An exemplary embodiment involves grinding grain in a single stream without separating endosperm, bran, and germ of the grain into separate streams. Clean and tempered grain is conveyed to a first passage grinder, such as a hammermill, roller mill, pin mill, impact mill, disc mill, air attrition mill, gap mill, or the like. After grinding, the grain is discharged and conveyed to a sifter.
  • a first passage grinder such as a hammermill, roller mill, pin mill, impact mill, disc mill, air attrition mill, gap mill, or the like.
  • a malt-based beverage provided by the present invention involves alcohol beverages (including distilled beverages) and non-alcohol beverages that are produced by using malt as a part or whole of their starting material. Examples include beer, happoshu (low-malt beer beverage), whisky, low-alcohol malt-based beverages (e.g., malt-based beverages containing less than 1% of alcohols), and non-alcohol beverages.
  • malt is a process of controlled steeping and germination followed by drying of the grain such as barley and wheat grain. This sequence of events is important for the synthesis of numerous enzymes that cause grain modification, a process that principally depolymerizes the dead endosperm cell walls and mobilizes the grain nutrients. In the subsequent drying process, flavour and colour are produced due to chemical browning reactions.
  • malt is for beverage production, it can also be utilized in other industrial processes, for example as an enzyme source in the baking industry, or as a flavouring and colouring agent in the food industry, for example as malt or as a malt flour, or indirectly as a malt syrup, etc.
  • the present invention relates to methods of producing a malt composition.
  • the method preferably comprises the steps of: (i) providing grain, such as barley or wheat grain, of the invention, (ii) steeping said grain, (iii) germinating the steeped grains under predetermined conditions and (iv) drying said germinated grains.
  • the malt may be produced by any of the methods described in Hoseney (Principles of Cereal Science and Technology, Second Edition, 1994: American Association of Cereal Chemists, St. Paul, Minn.).
  • any other suitable method for producing malt may also be used with the present invention, such as methods for production of speciality malts, including, but limited to, methods of roasting the malt.
  • Malt is mainly used for brewing beer, but also for the production of distilled spirits.
  • Brewing comprises wort production, main and secondary fermentations and post-treatment.
  • the produced wort is clarified, yeast is added, the mixture is fermented and a post-treatment is performed.
  • EXAMPLES EXAMPLE 1 - MATERIALS AND METHODS Generation of Mutants gRNA design The in silico analysis of DNA sequences of rice FAD2, LOX3 and FATBs, DNA sequence annotation and alignment, vector designs and protein sequence prediction were performed using Geneius Prime 2019.1.1 (www.geneious.com).
  • Rice OsFAD2-1, OsLOX3 and OsFATB1, 2, 3, 4 gene sequences were obtained from Rice Genome Annotation Project (rice.plantbiology.msu.edu/) for designing the gRNAs. All the gRNAs were GC rich, 19 or 20 bp in length, and linked to the canonical PAM (5’- NGG-3’).
  • the gene edit vector V1 targeted OsFAD2-1, OsLOX3 and OsFATB1, while the gene edit vector V2 targeted OsFATB1, 2, 3 and 4.
  • gRNA-1 was targeted for nt 3317 ⁇ 3336 of LOC_OS02g48560 (OsFAD2-1) corresponding to nt 3 ⁇ 22 (20 bp) of CDS, covering the second in-frame ATG (nt 19 ⁇ 21 of CDS).
  • gRNA-2 was targeted for nt 3846 ⁇ 3865 of LOC_OS02g48560, corresponding to nt 532 ⁇ 551 of OsFAD2-1 CDS.
  • the gRNA-3 was designed at the #31 to #50 region in the 1 st exon, and the gRNA-4 at the 20 bp between #467 and #486 crossing 1 st intron and 2 nd exon of OsLOX3.
  • the gRNA-5 was designed at the beginning of 2 nd exon (#523-542) of OsFATB1. In the V2, gRNA-6 targeted #323-342 in the 1 st exon of OsFATB1. gRNA- 7 was designed to the conserved region at #451-470 in the second exon of both OsFATB2 and 3. gRNA-8 targeted 20 bp between #624-643 of the 2 nd exon of OsFATB4.
  • the multi-gRNA expression cassettes consisting of the two OsU3 promoters and three OsU6 promoters (OsU6a, OsU6b, OsU6c) driving gRNA-1 ⁇ 5, respectively, were commercially synthesized at GeneArt (Thermo Fisher Scientific, Regensburg, Germany). Each cassette was cloned into BsaI restriction site of pMA-RQ by GeneArt. The expression cassettes in pMA-RQ were then cloned into pYLCRISPR/Cas9Pubi-H by simultaneous digestion with BsaI and ligating with Golden Gate cloning system following the description by Ma et al. (2015).
  • the molecular sizes of PCR products of V1 and V2 were 3143 bp and 1739 bp, respectively.
  • the V1 and V2 vectors were used to transform rice by Agrobacterium-mediated transformation. Agrobacterium-mediated transformation of rice The vectors V1 or V2 were transformed into Agrobacterium strain AGL1 for rice transformation (Toki et al., 2006) with slight modification. The husk was removed from mature seeds of Nipponbare cv. The seeds were then sterilized with 75% ethanol and 25% bleach consecutively and followed by 8 times of wash in MilliQ water.
  • N6D solid medium pH 5.8 CHU [N6] Basal Medium with vitamins 3.99 g/L, Myoinositol 100 mg/L, Peptone (crude protein) 300 mg/L, Proline 2.9 g/L,Sucrose 30 g/L, and 2ml/L of 2,4-D (1 mg/ml)) to induce callus in a 25 o C growth room under 24 hrs purple and blue light.
  • Regeneration Medium *Adjust pH to 5.8 with 1 M KOH/NaOH. Add phytogel 3 g/L.
  • Leaf tissue was quickly frozen in liquid nitrogen and ground using chopsticks in the 2 mL tubes. About 600 ⁇ L of extraction buffer (100 mM Tris-HCl pH 8.0, 50 mM EDTA, 1.25% SDS) were added for each sample to suspend by shaking. The samples were incubated at 65°C in an oven for at least one hour. After cooled down, 300 ⁇ L of cold 6M ammonium acetate was added to each sample to precipitate at 4 o C. Supernatant was collected by centrifuging and 300 ⁇ L isopropanol was added to precipitate the DNA. Pellet was collected by centrifuging and washed with 250 ⁇ L of 70% ethanol.
  • extraction buffer 100 mM Tris-HCl pH 8.0, 50 mM EDTA, 1.25% SDS
  • PCR primers were designed using Geneius Prime 2019.1.1 to amplify DNA fragments covering the gRNA targeted regions.
  • the PCR mix contained 2 ⁇ L of 5x Taq polymerase buffer, 0.5 ⁇ L of each primer (10 nM), 100 ng template DNA and 0.07 ⁇ L of MyTaq polymerase (Thermo) to a final volume of 10 ⁇ L.
  • the following PCR program was used for the amplification: 2 min at 95 o C, 34 cycles of 15 sec at 95 o C, 15 sec at 58 o C and 32 sec at 72 o C, followed by 5 min at 72 o C and held at 12 o C.
  • the PCR products were diluted 10 times and cleaned up with Shrimp Alkaline Phosphatase (SAP) at ratio of 2.5:1 (v/v) for 15 min at 37 o C and 15 min at 80 o C.
  • SAP Shrimp Alkaline Phosphatase
  • the cleaned DNA product (2.8 ⁇ L) was mixed with 0.3 ⁇ L forward or reverse primer and BigDye buffer to a final volume of 20 ⁇ l.
  • the PCR was carried out under following condition: 5 min at 94 o C, 30 cycles of 10 sec at 96 o C, 5 sec at 50 o C and 4 min at 60 o C and held at 12 o C.
  • the BigDye product was mixed with 2 ⁇ L of 3 M NaOAc (pH 4.8-5) and 50 ⁇ L of ice cold 100% Ethanol to precipitate at -80 o C for 30 min.
  • the precipitate was washed with 200 ⁇ L of 70% ethanol and dried in a vacuum spin dryer before submitting for Sanger sequencing service (Australian National University (ANU) facility, Canberra Australia).
  • the column temperature was programmed as an initial temperature at 150 o C held for 1 min, which was increased to 210°C at 3°C/min, then further increased to 240°C at 50°C/minm which was held for 1.4 min.
  • Helium was the carrier gas with a column head pressure of 17.334 psi and average velocity of 30 cm/sec.
  • the fatty acid profile was analysed by integrating peaks with Agilent Technologies ChemStation software (Rev B.04.03), and the total fatty acid composition was calculated as percentage of whole in each sample.
  • the volatile compounds desorbed from the fibre were analysed by a Shimadzu QP2010 Plus GC-MS equipped with a Shimadzu Stabilwax-DA column (30 m x 0.25 mm x 0.25 ⁇ m).
  • the carrier gas was helium at a constant flow rate of 1 mL/min.
  • Oven ramping program started at 45 °C held for 5.5 min, heated to 170 °C at a rate of 3 °C /min and ramping at 7 °C /min to a final temp of 250 °C, being held for 2 min.
  • Ion fragmentation was acquired under EI mode at 70 eV and scanned in full scan mode from 35 to 350 m/z.
  • OsFAD2-1 LOC_Os02g48560
  • OsFAD2-2 LOC_Os07g23430
  • OsFAD2-3 LOC_Os07g23410
  • OsFAD2-4 LOC_Os07g23390.
  • the genomic sequences for these Oryza sativa FAD2 were retrieved from Genbank.
  • the cDNA sequences were derived and shown in Figure 1 which shows the alignment of Fad2 cDNA sequences.
  • the OsFAD2-1 isoform has an in-frame ATG codon (nt 19 ⁇ 21) after the translation start codon ATG.
  • gRNAs designed for CRISPR editing of OsFAD2-1 included this second ATG ( Figure 1) as outlined below.
  • a schematic of the T-DNA binary vector used for transformation is shown in Figure 2.
  • the location of the stop codon is indicated by an asterisk in the modified FAD2 amino acid sequence for line V1-13 in Table 3.
  • gRNA and Vector Design of V1 and V2 For CRISPR-Cas9 editing the base pairing of the gRNA or single guide RNA controls how specific the cleavage is and the site of the cleavage. Guide RNA design was undertaken as described in Example 1.
  • gRNA-1 (GGGTGCCGGCGGCAGGATGA) (SEQ ID NO:30) targeting position nt3-22 and gRNA-2 (TACGTGTACCACAACCCGAT) (SEQ ID NO:31) targeting position nt 532-551 were designed.
  • FAD2-1 shares low homology with the three other members within the two gRNA regions.
  • the gRNA-1 targeted the 20 bp from the end of start codon covering the second ATG, and the gRNA-2 at 532 bp downstream of the start codon in the FAD2-1 and used in the vector design of V1 in Example 5 and vector design V2 in Example 6.
  • Type I LOXs have a transit peptide, this is absent in Type II and Type III LOXs.
  • LOXs are also classified as either 9-LOXs or 13-LOXs according to the enzymes preference for carbon 9 or carbon 13 in the substrate hydrocarbon backbone, generating 9(S)-hydroperoxy- and 9(S)-hydroperoxy-derivatives (Feussner and Wasternack, 2002). Based on bioinformatic analysis, it is purported that the rice genome (rice.plantbiology.msu.edu) has 14 LOX protein genes. Protein alignment shows that LOX sequences are relatively well conserved (Umate, 2011).
  • Polyunsaturated fatty acids including linoleic and linolenic acids are common substrates in seeds for different LOXs.
  • LOXs present in the rice grain are thought to play important roles in fatty acid peroxidation in membranes or storage lipids.
  • LOX activity in rice seeds is associated with the production of volatile compounds such as n-hexanal, derived from lipid peroxidation, a predominant component of stale or rancid off-flavours in stored rice seed.
  • Three isozymes of Type III LOXs (LOX1, LOX2, and LOX3) have been identified in developing rice seeds (Ohta et al., 1986).
  • LOX3 is the most abundant enzyme (Ida et al., 1983).
  • the LOX3 enzyme was purified and characterized as a 9-LOX (Ohta et al., 1986).
  • the Thai rice variety, DawDam contains a point mutation that causes the premature stop of translation of the LOX3 gene, resulting in a null-mutant rice variety (Suzuki et al., 1993; Suzuki and Matsukura, 1997).
  • the mutation has been associated with reduction in stale flavor development during rice grain storage (Suzuki et al., 1999).
  • Xu et al. (2015) used RNAi silencing to reduce the LOX3 activity in transgenic experimental plants resulted in grain with improved seed storability.
  • LOX3 deficiency is not shown to effect the main agronomic traits in rice (Ma et al., 2015) it is recognised that silencing all of LOX1, LOX2 and LOX3 isoenzymes in the rice would result in plants with unfavourable agronomic behaviours as observed in the DawDam variety (RoyChowdury et al., 2016).
  • inactivation of LOX activity should be achieved without compromising nutritional content and agronomic traits.
  • gRNA-3 GACGAGCTCCGCAACCTGCG
  • gRNA-4 CGTGCGTGCAGATCCGGACT
  • EXAMPLE 4 - IDENTIFICATION AND ISOLATION OF FATB GENES FROM RICE FATB genes encode the enzyme palmitoyl-ACP thioesterases which have the activity preferentially releasing fatty acids that have a length of 16 carbons or less from acyl-acyl carrier protein.
  • Putative rice FATB sequences were identified using homology-based searches with Arabidopsis AtFATB sequence AtACPTE32 (NCBI access number AF213480). The program used was Megablast available with default parameters at NCBI (www.ncbi.nlm.nih.gov/).
  • the most similar sequences from rice identified were four OsFATB genes in the Rice Genome Annotation Project Database (http://rice.plantbiology.msu.edu/) (Ouyang et al. 2007).
  • the four OsFATB genes were named FATB1 (LOC_Os06g05130), FATB2 (LOC_Os11g43820), FATB3 (LOC_Os02g43090) and FATB4 (LOC_Os06g39520).
  • Each rice FATB gene comprises 6 exons.
  • the rice FATB sequences were translated into amino acid sequences from corresponding coding sequences ( Figure 3) and examined for the presence of the conserved motifs.
  • Amino acid residues considered to be essential in the AtFATB sequence are generally known as the catalytic triad are the cysteine 264, asparagine 227 and histidine 229. Consistent with AtFATB1, the catalytic triad (aspartate N-227, histidine H-229 and cysteine C-264) locates at the C terminus of the FATBs shown in Fig. 2 (Yuan et al., 1996; Mayer and Shanklin, 2005).
  • FATB1 and FATB2 contain all three catalytic amino acid residues, and FATB4 contains two of the three catalytic amino acids (N-227 and H-229) in the conserved motif NQHVNN (SEQ ID NO:38) found in FATB1 and FATB2 sequences. However, all three catalytic amino acids residues and NQHVNN (SEQ ID NO:38) are absent in FATB3.
  • the program CLUSTAL with default parameters was used for sequence comparison.
  • the nucleotide sequence identity between FATB1 (LOC_Os06g05130) and FATB4 (LOC_Os06g39520) over the entire coding sequence was 64.6%, and between their deduced amino acid sequences was 54.3%.
  • the proteins deduced from FATB1, FATB2, FATB3 and FATB4 are known to correspond to amino acid sequences of 427, 425, 298 and 357 amino acids respectively.
  • Gene editing of FATB To evaluate the contribution of FATB1 gene to palmitic acid content in the rice grain, gRNA-5 was targeted to the beginning of the second exon of OsFATB1 (CTGAACCATGTGAAAACTGC) (SEQ ID NO:34) and included in the vector V1 (see Example 1). The function of other FATB members is uncharacterised so far. Thus, the contribution of each FATB gene to C16:0 content in the grain was further characterised by gene editing.
  • the gene editing vector V2 contained gRNA-6 ⁇ gRNA-8 (see Example 1).
  • gRNA-6 (TCCTGGCAGCTGAGAAGCAG) (SEQ ID NO:35) and gRNA-8 (GGGCTGCTAGGAGATGGTTT) (SEQ ID NO:36) were designed for editing FATB1 and FATB4 while gRNA-7 (ATGATTCGGTCCTACGAGAT) (SEQ ID NO:37) was targeting both FATB2 and FATB3 simultaneously in a conserved region.
  • EXAMPLE 5 - GENE EDITING OF RICE FAD2-1, LOX3 AND FATB1 WITH VECTOR V1 Multiplex genome editing methods in rice demonstrated by Ma et al. (2016) and reviewed by Zafar et al. (2020) are being rapidly developed because of its potential to offer transgene-free methods of plant improvement by editing several genes simultaneously.
  • gRNA and Vector Design of V1 To construct gene editing vector V1, the inventors designed two gRNAs targeting FAD2-1 (LOC_Os02g48560), two gRNAs targeting LOX3 (LOC_Os03g49350) and one for FATB1 (LOC_Os06g05130) as described in Examples 2, 3 and 4. The vector was generated following the method described by Ma et al. (2015).
  • Each gRNA was under the control of a rice promoter, gRNA targeting FAD2-1 driven by U3 promoter, gRNA targeting LOX3 driven by U6a promoter and gRNA targeting FATB1 driven by U6c promoter.
  • T-DNA binary vector V1 for CRISPR gene editing is shown in Figure 2.
  • the gRNA-1 targeted the 20 bp (nts 3-22) from the end of the start codon covering the second ATG, and the gRNA-2 at nts 532-551 downstream of the start codon in the FAD2-1.
  • the gRNA-3 was designed at the nt 31 to 50 region in the first exon, and the gRNA-4 at the 20 bp (nt 467-486) crossing first intron and second exon of LOX3.
  • the gRNA-5 was designed at the beginning of the second exon (nt 523-542) of FATB1.
  • a schematic of the multiple gRNA expression cassette is shown and detailed plasmid map is shown in Figure 2.
  • Rice Transformation The V1 vector was transformed into Agrobacterium strain AGL1 for rice transformation following the method described by Toki et al. (2006) with modification as per Example 1.
  • a total of 14 T0 transgenic lines carrying the hygromycin resistance gene were obtained after tissue culture of transformed calli generated from Nipponbare cv.
  • Leaf tissue was used to prepare DNA samples from each transgenic line. DNA was subject to PCR amplification as described in Example 1 and PCR products were sequenced.
  • V1-4, V1-7, V1-12 and V1-13 The successfully edited plants are referred to herein as V1-4, V1-7, V1-12 and V1-13 (Table 3).
  • Line V1-4 had one mutated allele of fatb1 edited at gRNA-5 region with one nucleotide inserted leading to frame-shift which introduced a premature stop codon, while FAD2-1 and LOX3 were unchanged.
  • the T0 plant grew normally but the fertility was reduced.
  • Line V1-12 is biallelic edited carrying mutations (-7/+1 at gRNA-3, +1/+1 at gRNA-4) in the LOX3 gene, while FAD2-1 and FATB1 genes were unchanged.
  • the lox3 mutations in line V1-12 at the target site of the gRNA-3 all led to downstream premature stop codons.
  • Lines V1-7 and V1-13 are biallelic heterozygous at the FAD2-1 and LOX3 loci meaning both the FAD2-1, and LOX3 were edited, but the FATB1 sequence was confirmed as wild type.
  • the mutations in V1-7 fad2 resulted in an insertion in Allele 1 and a 14-bp deletion in Allele 2 in the gRNA-1 region (+1/-14 at gRNA-1), as well as nucleotide substitution in Allele 1 and a 43-bp deletion in Allele 2 in the gRNA-2 target region (A->C/-43 at gRNA-2).
  • the gene edits resulted in premature stop codon in the downstream of gRNA-1 region in FAD2-1.
  • the resulting fad2-KD encodes a truncated protein with a deletion of the first six amino acid residues from the N terminus (from gRNA1 editing).
  • a mutation of N182/P183 to T182 was generated by the gRNA2 editing.
  • V1-12 and V1-13 were allowed to self pollinate with the aim of segregating the edited alleles of fad2-1 and lox3 in the T 1 progeny. Plants that were homozygous for lox3, for Allele 1 and Allele 2 (Table 3) in single gene KO mutants were obtained from the T 1 and T 2 progenies of V1-12.
  • Allele or ‘Al’ refers to the edited alleles at the same locus.
  • the V2 vector was designed to create a mutation in the corresponding target genes: FATB1 (LOC_Os06g05130), FATB2 (LOC_Os11g43820), FATB3 (LOC_Os02g43090) and FATB4 (LOC_Os06g39520).
  • the V2 vector comprised the gRNA6, gRNA7 and gRNA8; with gRNA7 targeting both FATB2 and FATB3 simultaneously in a conserved common regions as described in Examples 1 and 4.
  • the experiment was undertaken to attempt to knockout the respective FATB enzyme activity in the resulting plant.
  • the method as described in Ma et al. (2015) was followed to generate the vector and modified as described in Example 1.
  • Each gRNA was placed under control of a rice promoter; the U3 promoter was used to drive gRNA6 expression, the U6a promoter was used to drive gRNA7 expression and the U6b promoter was used for gRNA8.
  • a schematic of the T-DNA binary vector and plasmid map for transformation is shown in Figure 4.
  • Rice Transformation The V2 vector was transformed into Agrobacterium strain AGL1 for rice transformation following the method described by Toki et al. (2006) with modifications as per Example 1.
  • Gene edited T 0 V2 lines were identified in the V2 mutant population by Sanger sequencing as described in Example 1 and 5. Multiple fertile plants were observed and four lines V2-2, V2-8, V2-12 and V2-26 were selected for analysis.
  • the T0 V2 lines were grown in a glasshouse and allowed to self-pollinate until T3 generation (Table 4). Progeny of four lines were identified as carrying 6 different combinations of the 4 OsFATB KO alleles as shown in (Table 6). All of the FATB isoforms were successfully edited. Table 6. Combinations of fatb knockout (KO) mutants carried by the selected T2 V2 lines. Note: the genotype column indicates the FATB gene modified by the gene editing. WT, HE and Neg are wild type, heterozygous and negative control respectively. Discussion Generally, it was observed that the mutations were 1 or 2 base pair insertion or deletion which resulted in a frameshift mutation.
  • EXAMPLE 7 FATTY ACID PROFILE OF GENE EDITED RICE PLANTS
  • total lipid was isolated from grain, anther, leaf and root samples of the V1 transformed rice plants and a negative segregated control line V2-8-4.1-3 (‘Neg’).
  • Fatty acid composition was determined for each lipid extract by GC-FID as described in Example 1. The results are presented in Table 6 and some of that data is presented graphically in Figure 5. The proportion of each fatty acid was expressed as a percentage of the total fatty acid in the seed oil of the grain as determined by GC as described in Example 1. Table 6.
  • the C18:2 decreased to under 1% in fad2-1KO/lox3-KO and a 4-fold reduction in the fad2-1 KD/KO line was observed.
  • the proportion of the C18:3n3 in the fad2 mutated lines was reduced to below 1% of total FFA in the fad2-1KO and fad2-1 KO/KD lines but was relatively unchanged in the fad2-1 KD homozygous line when compared to the control.
  • Anthers of the control Nipponbare cv. were found to contain approximately 50% C18:3n3, 26% C16:0, 9% C18:2 and 11% C18:0.
  • the anthers and leaf oil content from plants containing higher C18:1 had a major trade-off in C18:3n3 and C18:2 in the fad2-1 mutants.
  • the fatty acid composition from the anthers of fad2-1 KO lines was approximately 62% C18:1 and exhibited a dramatic reduction in C18:2 and C18:3n3.
  • the variation in C18:1 was less pronounced but with still 18% increase in the anther and 6% increase in the leaf at the expense of C18:3n3 and C18:2, respectively.
  • fad2-1 KD showed only marginal difference in the fatty acid composition compared to the control.
  • fad2-1 KO/KD line oil contained remarkably higher level of C18:1, 5-fold higher than the control, and a reduction in both C16:0 and C18:2 (7% and 21%).
  • the changes in oil composition derived from the fad2-1 KD was less pronounced with a smaller increase in C18:1 at the expense of C18:2.
  • the fatty acid composition of FAD2 WT/lox3KO was found to be comparable to the negative control.
  • the C18:2 level was reduced from 35% to nearly null, along with C18:1 content increased from about 30% to 70%.
  • This observation was reported in FAD2 RNAi transgenic plants of cotton, Arabidopsis and rice previously (Chapman et al., 2001; Zaplin et al., 2013; Stoutjesdijk et al., 2002) and regarded as a variability in the extent of suppression. Without manipulation of the FAD2-1 gene expression in the CRISPR mutant, our results suggest the FAD2 enzyme activity may be unstable to some extent in the heterozygote during seed development for some reason.
  • the plant height of the fad2-1 KD/KO was slightly shorter comparing with other mutants and negative control.
  • the membrane lipids of the cells in various tissues require unsaturated fatty acids (UFAs) to meet the fatty acid balance for maintenance of cell functions allowing the plant to cope with environmental stress (He and Ding, 2020).
  • UFAs unsaturated fatty acids
  • Lipids and their derivatives are crucial for pollen wall maturation and viability (Shi et al., 2015).
  • a recent study reported down-regulation of GhFAD2-3 can result in male sterility of cotton because of remarkably reduced linoleic acids in the anther wax and cutin (Liu et al., 2019).
  • the sterility rate in a single panicle varied in the progenies of the mutant lines, some of which were more than double the rate of the negative controls.
  • the seed set also varied with some lines producing more seeds and others producing less seeds than the negative controls.
  • EXAMPLE 8 Total fatty acid composition of T 3 single seeds of the V2 mutants Previously analysis of genes encoding the FATB isoforms in rice showed that FATB1 (LOC_Os06g05130) and FATB2 (LOC_Os11g43820) were more highly expressed in the grain than the other two genes. To analyse the effect of the gene editing on fatty acid composition, the healthy recovered V2 lines were propagated to T3 population. Total lipid was isolated from grain of the V2 transformed rice plants and a negative control line V2-8-2.2. Fatty acid composition was determined for each lipid extract by GC-FID as described in Example 1. The data are presented in Table 8 and some of that data is presented graphically in Figures 7. The relative proportion of each fatty acid was expressed as a percentage of the total fatty acid in the seed oil of the grain as determined by GC as described in Example 1.
  • Lines ae1.5-1 and ae1.5-2 were found to comprise C18:1 content of 74.6% and 72.8% and dramatically reduced C18:2 content of 1.6% and 1.8% respectively.
  • the palmitic content was reduced from 21.1% in the negative control compared to 16.5% and 17.4% respectively in the experimental lines ae1.5-1 and ae1.5- 2. Further work is underway to examine if Indica rice is a desirable background for the super high oleic acid mutated rice.
  • V1-13 and V2-12 Crosses A cross was performed between V1-13 and V2-12 T0 plants to combine the edited alleles of OsFAD2-1, OsLOX3 and OsFatB in the progeny.
  • V1-13 contained both a OsFad2-KO/KD and OsLox3-KO mutation genotype, and V2-12 which comprises a mutated FatB2/3/4 genotype.
  • a panicle of V1-13 was randomly chosen for cross one day before anthesis. The florets were cut open by removing top 1/3 of the petals using scissors. The anthers of each floret were removed using forceps without damaging the stigma. The panicle was then contained in an envelope on the plant to avoid contamination. On the next day, the 2-5 anthers of V2-12 were collected with forceps when the anthers extended out of petals to shad pollens. The anthers were then put into the V1-13 florets with gentle shaking.
  • the F1 plants, named LFF were confirmed by sanger sequencing as carrying OsFAD2-1-KD, OsLOX3-KO, OsFatB1-KO, OsFatB2-KO, OsFatB4-KO from V2-12 T 0 plant.
  • a new type of OsFAD2-1-KO (Table 9) was identified in the progeny of the cross.
  • the new OsFAD2-1-KO contained 22 bp deletion at gRNA1 and 17 bp deletion at gRNA2.
  • the half seed fatty acid composition analysis of F2 seeds from LFF presented different profiles of seed lipids from V1 and V2 populations ( Figure 8).
  • the OsFAD2-KD/KO+OsFatB2- KO and OsFAD2-KD+OsFatB2-KO showed about further 5-10% reduction in C16:0, 8-13% increase in C18:1, and 4-5% decrease in C18:2 from OsFAD2-KD/KO and OsFAD2-KD.
  • Progenies with OsFAD2-1-KD but new OsFAD2-1-KO segregated out, with either OsLOX3-KO, OsFatB1-KO, OsFatB2-KO, OsFatB4-KO were selected, designated as LEF-KD1, LEF-KD3 and LEF-KD5 for further analysis in F3 seeds.
  • Genotype for KD1 and KD3 was OsFAD2-1-KD, OsLOX3-KO, FatB1-KO, FatB4-KO, KD5 was OsFAD2-1-KD, OsLOX3-KO, FatB2-KO, FatB3-KO, FatB4-KO. F3 plants were again grown to analyse F4 seeds.
  • EXAMPLE 9 OXIDATIVE STABILITY OF RICE BRAN AND RICE BRAN OIL
  • the accelerated rancidity testing involves GC using a sampler to detect the volatiles in the headspace of grain stored at high temperature (40°C).
  • the rice bran isolated from brown rice was passed through 0.5mm sieve, then used for headspace analysis following an accelerated storage simulation.
  • the vials containing 300mg rice bran were incubated in a 37°C oven with cap closed.
  • the vials were removed from the oven at different time points (at day 0, 2, 4 and 8), and stored at -80°C before HS-SPME analysis.
  • the gas sample released from bran can be obtained in the headspace of a vial by either heating at 80oC or by natural diffusion.
  • the volatile components in the headspace were analysed by direct injection into a GC-MS machine (Suzuki et al., 1999).
  • the desorption of the aroma compounds is then done thermally and the trapped molecules are analysed by GC and identified using standards.
  • the production of hexanal from linoleic acid in vitro has been demonstrated by Nielsen et al. (2004).
  • the Rancimat is a standardized test to measure the oxidation stability of fats and oils by an accelerated aging process created by exposing the sample to heat and increased air volume. The time that passes until oxidation takes place is the oxidation stability index.
  • Samples of rice were provided to the Department of Primary Industries New South Wales (DPI NSW).
  • Rice bran oil was extracted by DPI NSW ISO659 method. About 1.8 g of rice bran oil was used for the Rancimat test. Variation in the total fatty acid composition was determined in the rice bran extracts from the gene edited mutants and stored RNAi lines (Table 11) (WO 2008/006171).
  • the Rancimat test by DPI NSW service lab was carried out according to the standard ISO method 110°C airflow 20L/hr. Table 11.
  • Total fatty acid composition of rice bran oil extract from CRISPR mutants and RNAi lines *NEG is negative control from control line stored from prior FAD2-RNAi experiments (WO 2008/006171).
  • the induction time of oil is used by the edible oil industry to indicate the oxidative stability quality.
  • the oxidative stability of rice bran oil from the fad2-1 KD+ lox3 KO line was measured as 39.86 hr which was more than double induction time for the negative control at 18.00 hr.
  • the FAD2-1 WT+lox3 KO mutant line showed a slight increase of 19.09 hrs, about 1 hr greater when compared with the negative control.
  • Hexanal Head space result indicated the increasing of hexanal compound accumulation in each sample during a stimulated storage treatment of 3 days at 40 o C.
  • the overall amount of hexanal increased in all the samples but at a different pace and from different starting concentrations (Figure 10).
  • the amount of hexanal was comparable between the mutant lines with fad2-1 KO/KD+lox3KO, fad2-1KD/KD+lox3KO or FAD2WT+lox3KO at about 100-200 ng/g, while the hexanal level measured was over 700 ng/g in the Negative control. This indicated the peroxidation of linoleic acid may have already started either during and or just after milling process.
  • fad2-1 KO/KD+lox3KO and fad2- 1KD/KD+lox3KO, and FAD2WT+lox3KO were 29%, 25%, and 37% of their negative control.
  • the fact that the hexanal produced by the fad2-1 KO/KD+lox3KO and fad2- 1KD/KD+lox3KO was lower than FAD2WT+lox3KO indicates that knocking out LOX3 in the high oleic acid background can further reduce the C18:2 peroxidation and the rate of peroxidation as measured by capability to produce hexanal.
  • the lox3 mutant also possessed a lower hexanal production level on day 0.
  • At least three positive single colonies of each transformant were then selected for overnight cell culture in 3 mL of the SD-Ura (glu) at 30 o C.
  • the cells were collected by centrifuging, then washed with sterile H2O and resuspended in 3 mL of SD-Ura (gal) to OD 0.1, than inoculated to 5 mL yeast minimal media SD-Ura (gal).
  • the cells were harvested, washed with H2O and freeze-dried for FAME preparation followed by GC analysis of total fatty acid composition. The conversion rate as measured by the ratio between C18:2/(C18:1+C18:2), was used to evaluate the FAD2-1 enzymatic activity in the yeast transformants.
  • FAD2 functions as a homodimeric enzyme
  • expression of nonfunctional mutants of FAD2 may cause inhibition of its activity through formation of nonfunctional heterodimers.
  • the Cas9/sgRNA constructs used in the present studies targeted the start codon and caused frame ⁇ shift mutations in the 5′ region of the targeted FAD2 genes, disrupting the N ⁇ terminal FAD2 domains.
  • the inventors showed the reduction of activity resulting from the frame-shift mutations in the yeast model. Table 13.
  • the corresponding proteins were miscoded due to the mutation and resulted in premature stop codons, aborting the translation. It is predicted that the ORF6 was not interrupted because the 4 bp deletion occurred just before the 3 rd ATG.
  • the predicted ORF6 encoded a truncated enzyme, FAD2-KD, with the 6 amino acid residues removed from the N terminus.
  • the enzyme activity of the FAD2-KD protein was reduced to about 2/3 of the wildtype enzyme FAD2-1, as shown in this Example. Therefore, the higher C18:1 content in the mutated rice lines carrying a KD mutation could be attributed to the knockout of the wildtype ORF and/or all 5 alternative ORFs, and retention of ORF6 contributed to the residue enzyme activity.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Botany (AREA)
  • Biophysics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Developmental Biology & Embryology (AREA)
  • Environmental Sciences (AREA)
  • Nutrition Science (AREA)
  • Oil, Petroleum & Natural Gas (AREA)
  • Physics & Mathematics (AREA)
  • Physiology (AREA)
  • Analytical Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Mycology (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Fodder In General (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
  • Cereal-Derived Products (AREA)
PCT/AU2022/051328 2021-05-11 2022-11-04 Modified cereal grain Ceased WO2023077199A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
US18/707,501 US20250304986A1 (en) 2021-05-11 2022-11-04 Modified cereal grain
CN202280087136.3A CN118488780A (zh) 2021-11-05 2022-11-04 改良谷粒
EP22888658.6A EP4426104A4 (en) 2021-11-05 2022-11-04 MODIFIED CEREAL GRAIN
AU2022379910A AU2022379910A1 (en) 2021-11-05 2022-11-04 Modified cereal grain
JP2024526925A JP2024541073A (ja) 2021-11-05 2022-11-04 改変された穀類粒

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2021903546A AU2021903546A0 (en) 2021-11-05 Modified cereal grain
AU2021903546 2021-11-05

Publications (1)

Publication Number Publication Date
WO2023077199A1 true WO2023077199A1 (en) 2023-05-11

Family

ID=86240332

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2022/051328 Ceased WO2023077199A1 (en) 2021-05-11 2022-11-04 Modified cereal grain

Country Status (6)

Country Link
US (1) US20250304986A1 (https=)
EP (1) EP4426104A4 (https=)
JP (1) JP2024541073A (https=)
CN (1) CN118488780A (https=)
AU (1) AU2022379910A1 (https=)
WO (1) WO2023077199A1 (https=)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118703519A (zh) * 2024-06-13 2024-09-27 广西大学 一种水稻雄性半不育突变体

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060005276A1 (en) * 2004-03-12 2006-01-05 Falco Saverio C Transgenic soybean seeds having reduced activity of lipoxygenases
WO2006073787A2 (en) * 2004-12-20 2006-07-13 Basf Plant Science Gmbh Nucleic acid molecules encoding fatty acid desaturase genes from plants and methods of use
WO2008006171A1 (en) * 2006-07-14 2008-01-17 Commonwealth Scientific And Industrial Research Organisation Altering the fatty acid composition of rice

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
UA129286C2 (uk) * 2018-04-04 2025-03-12 Сайбас Юес Ллс Гени fad2 і мутації
CA3233104A1 (en) * 2021-09-21 2023-03-30 Benson Hill, Inc. Compositions and methods comprising plants with reduced lipoxygenase and/or desaturase activities

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060005276A1 (en) * 2004-03-12 2006-01-05 Falco Saverio C Transgenic soybean seeds having reduced activity of lipoxygenases
WO2006073787A2 (en) * 2004-12-20 2006-07-13 Basf Plant Science Gmbh Nucleic acid molecules encoding fatty acid desaturase genes from plants and methods of use
WO2008006171A1 (en) * 2006-07-14 2008-01-17 Commonwealth Scientific And Industrial Research Organisation Altering the fatty acid composition of rice

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
ABE, K ET AL.: "Production of high oleic/low linoleic rice by genome editing", PLANT PHYSIOLOGY AND BIOCHEMISTRY, vol. 131, 2018, pages 58 - 62, XP085456982, DOI: 10.1016/j.plaphy.2018.04.033 *
BAI, S ET AL.: "Knock-down of OsLOX by RNA interference leads to improved seed viability in rice", JOURNAL OF PLANT BIOLOGY, vol. 58, no. 5, 2015, pages 293 - 302, XP035551769, DOI: 10.1007/s12374-015-0133-6 *
BHUNIA RUPAM KUMAR, SINHA KSHITIJA, KAUR RANJEET, KAUR SUMANDEEP, CHAWLA KIRTI: "A Holistic View of the Genetic Factors Involved in Triggering Hydrolytic and Oxidative Rancidity of Rice Bran Lipids", FOOD REVIEWS INTERNATIONAL, TAYLOR & FRANCIS, PHILADELPHIA, USA, vol. 39, no. 1, 2 January 2023 (2023-01-02), Philadelphia, USA , pages 441 - 466, XP093065171, ISSN: 8755-9129, DOI: 10.1080/87559129.2021.1915328 *
BOLLINEDI HARITHA, SINGH A. K., SINGH NEHA, S GOPALA KRISHNAN, BHOWMICK PROLAY K., K. K VINOD, M NAGARAJAN, R. K ELLUR: "Genetic and genomic approaches to address rapid rancidity of rice bran", CRITICAL REVIEWS IN FOOD SCIENCE AND NUTRITION, TAYLOR & FRANCIS, USA, vol. 61, no. 1, 2 January 2021 (2021-01-02), USA , pages 75 - 84, XP093065173, ISSN: 1040-8398, DOI: 10.1080/10408398.2020.1718598 *
MA LEI, ZHU FUGUI, LI ZHENWEI, ZHANG JIANFU, LI XIN, DONG JIANGLI, WANG TAO: "TALEN-Based Mutagenesis of Lipoxygenase LOX3 Enhances the Storage Tolerance of Rice (Oryza sativa) Seeds", PLOS ONE, vol. 10, no. 12, pages e0143877, XP055939314, DOI: 10.1371/journal.pone.0143877 *
See also references of EP4426104A4 *
SUZUKI YASUHIRO, YASUI TAKESHI, MATSUKURA USHIO, TERAO JUNJI: "Oxidative Stability of Bran Lipids from Rice Variety [ Oryza sativa (L.)] Lacking Lipoxygenase-3 in Seeds", JOURNAL OF AGRICULTURAL AND FOOD CHEMISTRY, AMERICAN CHEMICAL SOCIETY, US, vol. 44, no. 11, 1 January 1996 (1996-01-01), US , pages 3479 - 3483, XP093065167, ISSN: 0021-8561, DOI: 10.1021/jf9600465 *
TIWARI GOPAL JI, LIU QING, SHRESHTHA PUSHKAR, LI ZHONGYI, RAHMAN SADEQUR: "RNAi-mediated down-regulation of the expression of OsFAD2-1: effect on lipid accumulation and expression of lipid biosynthetic genes in the rice grain", BMC PLANT BIOLOGY, vol. 16, no. 1, 1 December 2016 (2016-12-01), XP093065168, DOI: 10.1186/s12870-016-0881-6 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN118703519A (zh) * 2024-06-13 2024-09-27 广西大学 一种水稻雄性半不育突变体
CN118703519B (zh) * 2024-06-13 2026-02-27 广西大学 一种水稻雄性半不育突变体

Also Published As

Publication number Publication date
CN118488780A (zh) 2024-08-13
AU2022379910A1 (en) 2024-05-23
EP4426104A1 (en) 2024-09-11
US20250304986A1 (en) 2025-10-02
JP2024541073A (ja) 2024-11-06
EP4426104A4 (en) 2025-09-24

Similar Documents

Publication Publication Date Title
US10260021B2 (en) Rice plants and methods of producing rice grain
US8921652B2 (en) Vegetable oils and uses therefor
UA116538C2 (uk) Насінина сафлору з високим вмістом олеїнової кислоти
WO2018039740A1 (en) Plants with modified traits
CN102202498A (zh) 改良的棉籽油及应用
US12178174B2 (en) Rice grain with reduced ROS1a activity
US20250324933A1 (en) Crown Rot Resistance
WO2017218883A1 (en) Plants with reduced lipase 1 activity
US20250304986A1 (en) Modified cereal grain
CA3121327A1 (en) Rust resistance gene
US20240349763A1 (en) Millet and food products with reduced lipase activity, genes and implementation thereof
US20240040982A1 (en) Cereal grain with thickened aleurone
CA3201857A1 (en) Plants with stem rust resistance
US20150044349A1 (en) Methods of controlling fructan synthesis in plants
WO2025111662A1 (en) Plant transformation

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22888658

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2024526925

Country of ref document: JP

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2022379910

Country of ref document: AU

Date of ref document: 20221104

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 202447042417

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2022888658

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022888658

Country of ref document: EP

Effective date: 20240605

WWE Wipo information: entry into national phase

Ref document number: 202280087136.3

Country of ref document: CN

WWP Wipo information: published in national office

Ref document number: 18707501

Country of ref document: US