WO2023069950A1 - Recombinant rotavirus expressing exogenous protein and uses thereof - Google Patents
Recombinant rotavirus expressing exogenous protein and uses thereof Download PDFInfo
- Publication number
- WO2023069950A1 WO2023069950A1 PCT/US2022/078305 US2022078305W WO2023069950A1 WO 2023069950 A1 WO2023069950 A1 WO 2023069950A1 US 2022078305 W US2022078305 W US 2022078305W WO 2023069950 A1 WO2023069950 A1 WO 2023069950A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- polynucleotide
- peptide
- nsp3
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/15—Reoviridae, e.g. calf diarrhea virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/525—Virus
- A61K2039/5254—Virus avirulent or attenuated
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
- C12N2720/00011—Details
- C12N2720/12011—Reoviridae
- C12N2720/12311—Rotavirus, e.g. rotavirus A
- C12N2720/12322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
- C12N2720/00011—Details
- C12N2720/12011—Reoviridae
- C12N2720/12311—Rotavirus, e.g. rotavirus A
- C12N2720/12334—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2720/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsRNA viruses
- C12N2720/00011—Details
- C12N2720/12011—Reoviridae
- C12N2720/12311—Rotavirus, e.g. rotavirus A
- C12N2720/12341—Use of virus, viral particle or viral elements as a vector
- C12N2720/12343—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/16011—Caliciviridae
- C12N2770/16022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/16011—Caliciviridae
- C12N2770/16034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/20011—Coronaviridae
- C12N2770/20022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
- C12N2770/00011—Details
- C12N2770/20011—Coronaviridae
- C12N2770/20034—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
Definitions
- Rotavirus (RV) and norovirus (NoV) are the leading cause of acute gastroenteritis (AGE) and acute diarrheal episodes in young children and the elderly (1, 2).
- RV vaccines a monovalent vaccine (RV1), Rotarix (GSK Biologicals) and a pentavalent vaccine (RV5), RotaTeq (Merck and Company), in the childhood immunization programs in the US and many other countries resulted in reducing the incidence of RV hospitalizations and mortality, and these vaccines are quite successful in generating neutralizing antibodies in vaccinated children (3, 4).
- NoV disease In countries where RV vaccines are largely used, an increase of NoV mediated diarrheal diseases and hospitalizations in children during the first 5 years of life became more evident (5, 6). The incidence of NoV disease is higher in young children, in the elderly population, and in subjects with lower immune defenses, for whom effective preventive measures are needed urgently (7). NoV disease is extremely contagious, only 10 infectious particles are required to cause AGE, and they have high environmental stability, and shedding after infection lasts for weeks (8). However, it has been very difficult to develop effective anti-NoV drugs or vaccines for many years due to the lack of adequate cell lines for viral culture and successful animal models for drug and vaccine evaluation (9, 10). Therefore, there is a need in the art for novel compositions and methods to elicit immunity to NoV.
- polynucleotides are provided.
- the polynucleotides comprise: a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide.
- the polynucleotide is operably linked to a promoter.
- the promoter is a T7 promoter or a T3 promoter.
- the promoter is a T7 promoter.
- the polynucleotide encodes a positive sense viral transcript.
- the sequence encoding an RV NSP3 is a sequence encoding SEQ ID NO: 1, or a sequence with at least about 90% identity to SEQ ID NO: 1.
- the heterologous polynucleotide encodes a peptide or protein.
- the heterologous polynucleotide encodes a peptide or protein and is in frame with the NSP3.
- the peptide or protein comprises an antigenic peptide or protein.
- the peptide or protein comprises a microorganismal peptide or protein.
- the peptide or protein comprises a bacterial peptide or protein.
- the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide. In some embodiments, the SARS-CoV-2 protein or peptide is selected from an N protein, an S protein, or fragment of either an N protein or an S protein. In some embodiments, the SARS-CoV-2 protein is an SI protein or a fragment thereof.
- the peptide or protein comprises a cleavage site.
- the cleavage site is a protease cleavage site.
- the cleavage site is a thrombin cleavage site (SEQ ID NO: 28).
- the cleavage site is a self-cleaving peptide sequence.
- the self-cleaving peptide sequence is porcine teschovirus 2 A element (SEQ ID NO: 29).
- the peptide or protein comprises a linker.
- the linker is a GAG flexible linker or a GSG flexible linker.
- the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length.
- the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation site.
- the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag.
- the reporter is fused in-frame 3 ’ to the sequence encoding the RV protein.
- the polynucleotides comprise any one of SEQ ID NOs: 13-22 or a sequence with at least about 90% identity to any one of SEQ ID NOs: 13-22.
- infectious particles comprise a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide.
- the polynucleotide is operably linked to a promoter.
- the promoter is a T7 promoter or a T3 promoter.
- the promoter is a T7 promoter.
- the polynucleotide encodes a positive sense viral transcript.
- the sequence encoding an RV NSP3 is a sequence encoding SEQ ID NO: 1, or a sequence with at least about 90% identity to SEQ ID NO: 1.
- the heterologous polynucleotide encodes a peptide or protein.
- the heterologous polynucleotide encodes a peptide or protein and is in frame with the NSP3.
- the peptide or protein comprises an antigenic peptide or protein.
- the peptide or protein comprises a microorganismal peptide or protein.
- the peptide or protein comprises a bacterial peptide or protein.
- the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide. In some embodiments, the SARS-CoV-2 protein or peptide is selected from an N protein, an S protein, or fragment of either an N protein or an S protein. In some embodiments, the SARS-CoV-2 protein is an SI protein or a fragment thereof.
- the peptide or protein comprises a cleavage site.
- the cleavage site is a protease cleavage site.
- the cleavage site is a thrombin cleavage site (SEQ ID NO: 28).
- the cleavage site is a self-cleaving peptide sequence.
- the selfcleaving peptide sequence is porcine teschovirus 2A element (SEQ ID NO: 29).
- the peptide or protein comprises a linker.
- the linker is a GAG flexible linker or a GSG flexible linker.
- the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length.
- the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation site.
- the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag.
- the reporter is fused in-frame 3’ to the sequence encoding the RV protein.
- the polynucleotides comprise any one of SEQ ID NOs: 13-22 or a sequence with at least about 90% identity to any one of SEQ ID NOs: 13-22.
- the infectious particles are made by introducing a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide into a cell.
- the polynucleotide is operably linked to a promoter.
- the promoter is a T7 promoter or a T3 promoter.
- the promoter is a T7 promoter.
- the polynucleotide encodes a positive sense viral transcript.
- the sequence encoding an RV NSP3 is a sequence encoding SEQ ID NO: 1, or a sequence with at least about 90% identity to SEQ ID NO: 1.
- the heterologous polynucleotide encodes a peptide or protein.
- the heterologous polynucleotide encodes a peptide or protein and is in frame with the NSP3.
- the peptide or protein comprises an antigenic peptide or protein.
- the peptide or protein comprises a microorganismal peptide or protein.
- the peptide or protein comprises a bacterial peptide or protein.
- the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide. In some embodiments, the SARS-CoV-2 protein or peptide is selected from an N protein, an S protein, or fragment of either an N protein or an S protein. In some embodiments, the SARS-CoV-2 protein is an SI protein or a fragment thereof.
- the peptide or protein comprises a cleavage site.
- the cleavage site is a protease cleavage site.
- the cleavage site is a thrombin cleavage site (SEQ ID NO: 28).
- the cleavage site is a self-cleaving peptide sequence.
- the self-cleaving peptide sequence is porcine teschovirus 2 A element (SEQ ID NO: 29).
- the peptide or protein comprises a linker.
- the linker is a GAG flexible linker or a GSG flexible linker.
- the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length.
- the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation site.
- the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag.
- the reporter is fused in-frame 3 ’ to the sequence encoding the RV protein.
- the polynucleotides comprise any one of SEQ ID NOs: 13-22 or a sequence with at least about 90% identity to any one of SEQ ID NOs: 13-22.
- composition comprising an infectious particle comprising a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide, optionally, further comprising a pharmaceutically acceptable carrier or excipient.
- the polynucleotide is operably linked to a promoter.
- the promoter is a T7 promoter or a T3 promoter.
- the promoter is a T7 promoter.
- the polynucleotide encodes a positive sense viral transcript.
- the sequence encoding an RV NSP3 is a sequence encoding SEQ ID NO: 1, or a sequence with at least about 90% identity to SEQ ID NO: 1.
- the heterologous polynucleotide encodes a peptide or protein.
- the heterologous polynucleotide encodes a peptide or protein and is in frame with the NSP3.
- the peptide or protein comprises an antigenic peptide or protein.
- the peptide or protein comprises a microorganismal peptide or protein.
- the peptide or protein comprises a bacterial peptide or protein.
- the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide. In some embodiments, the SARS-CoV-2 protein or peptide is selected from an N protein, an S protein, or fragment of either an N protein or an S protein. In some embodiments, the SARS-CoV-2 protein is an SI protein or a fragment thereof.
- the peptide or protein comprises a cleavage site.
- the cleavage site is a protease cleavage site.
- the cleavage site is a thrombin cleavage site (SEQ ID NO: 28).
- the cleavage site is a self-cleaving peptide sequence.
- the selfcleaving peptide sequence is porcine teschovirus 2A element (SEQ ID NO: 29).
- the peptide or protein comprises a linker.
- the linker is a GAG flexible linker or a GSG flexible linker.
- the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length.
- the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation site.
- the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag.
- the reporter is fused in-frame 3’ to the sequence encoding the RV protein.
- the polynucleotides comprise any one of SEQ ID NOs: 13-22 or a sequence with at least about 90% identity to any one of SEQ ID NOs: 13-22.
- the pharmaceutical compositions comprise an infectious particle made by introducing a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide into a cell.
- the polynucleotide is operably linked to a promoter.
- the promoter is a T7 promoter or a T3 promoter.
- the promoter is a T7 promoter.
- the polynucleotide encodes a positive sense viral transcript.
- the sequence encoding an RV NSP3 is a sequence encoding SEQ ID NO: 1, or a sequence with at least about 90% identity to SEQ ID NO: 1.
- the heterologous polynucleotide encodes a peptide or protein.
- the heterologous polynucleotide encodes a peptide or protein and is in frame with the NSP3.
- the peptide or protein comprises an antigenic peptide or protein.
- the peptide or protein comprises a microorganismal peptide or protein.
- the peptide or protein comprises a bacterial peptide or protein.
- the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide. In some embodiments, the SARS-CoV-2 protein or peptide is selected from an N protein, an S protein, or fragment of either an N protein or an S protein. In some embodiments, the SARS-CoV-2 protein is an SI protein or a fragment thereof.
- the peptide or protein comprises a cleavage site.
- the cleavage site is a protease cleavage site.
- the cleavage site is a thrombin cleavage site (SEQ ID NO: 28).
- the cleavage site is a self-cleaving peptide sequence.
- the selfcleaving peptide sequence is porcine teschovirus 2A element (SEQ ID NO: 29).
- the peptide or protein comprises a linker.
- the linker is a GAG flexible linker or a GSG flexible linker.
- the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length.
- the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation site.
- the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag.
- the reporter is fused in-frame 3’ to the sequence encoding the RV protein.
- the polynucleotides comprise any one of SEQ ID NOs: 13-22 or a sequence with at least about 90% identity to any one of SEQ ID NOs: 13-22.
- the pharmaceutical compositions further comprise a pharmaceutically acceptable carrier.
- methods of eliciting an immune response to one or more microorganism in a subject comprise: administering an effective amount of a pharmaceutical composition comprising an infectious particle comprising a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide, optionally, further comprising a pharmaceutically acceptable carrier or excipient; to a subject to elicit an immune response to the one or more microorganism.
- a pharmaceutical composition comprising an infectious particle comprising a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein
- a heterologous polynucleotide optionally, further comprising a pharmaceutically acceptable carrier or excipient
- the pharmaceutical compositions comprise an infectious particle made by introducing a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide into a cell.
- the polynucleotide is operably linked to a promoter.
- the promoter is a T7 promoter or a T3 promoter.
- the promoter is a T7 promoter.
- the polynucleotide encodes a positive sense viral transcript.
- the sequence encoding an RV NSP3 is a sequence encoding SEQ ID NO: 1, or a sequence with at least about 90% identity to SEQ ID NO: 1.
- the heterologous polynucleotide encodes a peptide or protein.
- the heterologous polynucleotide encodes a peptide or protein and is in frame with the NSP3.
- the peptide or protein comprises an antigenic peptide or protein.
- the peptide or protein comprises a microorganismal peptide or protein.
- the peptide or protein comprises a bacterial peptide or protein.
- the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide. In some embodiments, the SARS-CoV-2 protein or peptide is selected from an N protein, an S protein, or fragment of either an N protein or an S protein. In some embodiments, the SARS-CoV-2 protein is an SI protein or a fragment thereof.
- the peptide or protein comprises a cleavage site.
- the cleavage site is a protease cleavage site.
- the cleavage site is a thrombin cleavage site (SEQ ID NO: 28).
- the cleavage site is a self-cleaving peptide sequence.
- the selfcleaving peptide sequence is porcine teschovirus 2A element (SEQ ID NO: 29).
- the peptide or protein comprises a linker.
- the linker is a GAG flexible linker or a GSG flexible linker.
- the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length.
- the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation site.
- the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag.
- the reporter is fused in-frame 3’ to the sequence encoding the RV protein.
- the polynucleotides comprise any one of SEQ ID NOs: 13-22 or a sequence with at least about 90% identity to any one of SEQ ID NOs: 13-22.
- the pharmaceutical compositions further comprise a pharmaceutically acceptable carrier.
- the one or more pathogens comprises NoV.
- the one or more pathogens comprises RV and NoV.
- the one or more pathogens comprises SARS-CoV- 2.
- the one or more pathogens comprises RV and SARS-CoV-2.
- methods of vaccinating a subject against one or more pathogens comprise: administering an effective amount of a pharmaceutical composition comprising an infectious particle comprising a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide, optionally, further comprising a pharmaceutically acceptable carrier or excipient to a subject to vaccinate a subject against the one or more pathogens.
- a pharmaceutical composition comprising an infectious particle comprising a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein
- a heterologous polynucleotide optionally, further comprising a pharmaceutically acceptable carrier or excipient to a subject to vaccinate a subject against the one or more pathogens.
- the pharmaceutical compositions comprise an infectious particle made by introducing a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide into a cell.
- the polynucleotide is operably linked to a promoter.
- the promoter is a T7 promoter or a T3 promoter.
- the promoter is a T7 promoter.
- the polynucleotide encodes a positive sense viral transcript.
- the sequence encoding an RV NSP3 is a sequence encoding SEQ ID NO: 1, or a sequence with at least about 90% identity to SEQ ID NO: 1.
- the heterologous polynucleotide encodes a peptide or protein.
- the heterologous polynucleotide encodes a peptide or protein and is in frame with the NSP3.
- the peptide or protein comprises an antigenic peptide or protein.
- the peptide or protein comprises a microorganismal peptide or protein.
- the peptide or protein comprises a bacterial peptide or protein.
- the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide. In some embodiments, the SARS- CoV-2 protein or peptide is selected from an N protein, an S protein, or fragment of either an N protein or an S protein. In some embodiments, the SARS-CoV-2 protein is an SI protein or a fragment thereof.
- the peptide or protein comprises a cleavage site.
- the cleavage site is a protease cleavage site.
- the cleavage site is a thrombin cleavage site (SEQ ID NO: 28).
- the cleavage site is a self-cleaving peptide sequence.
- the self-cleaving peptide sequence is porcine teschovirus 2 A element (SEQ ID NO: 29).
- the peptide or protein comprises a linker.
- the linker is a GAG flexible linker or a GSG flexible linker.
- the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length.
- the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation site.
- the heterologous polynucleotide encodes a reporter. In some embodiments, the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag.
- the reporter is fused in-frame 3 ’ to the sequence encoding the RV protein.
- the polynucleotides comprise any one of SEQ ID NOs: 13-22 or a sequence with at least about 90% identity to any one of SEQ ID NOs: 13-22.
- the pharmaceutical compositions further comprise a pharmaceutically acceptable carrier.
- the one or more pathogens comprises NoV. In some embodiments, the one or more pathogens comprises RV and NoV.
- the one or more pathogens comprises SARS-CoV-2. In some embodiments, the one or more pathogens comprises RV and SARS-CoV-2. In some embodiments, the one or more pathogens comprises NoV. In some embodiments, the one or more pathogens comprises RV and NoV. In some embodiments, the one or more pathogens comprises SARS-CoV-2. In some embodiments, the one or more pathogens comprises RV and SARS-CoV-2.
- methods of generating recombinant rotavirus (RV) in vitro comprise: introducing a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide into a cell; allowing the cell to express the polynucleotide; incubating the cells for a sufficient time to produce RV; and harvesting virus produced by the cells to generate RV in vitro.
- the polynucleotide is operably linked to a promoter.
- the promoter is a T7 promoter or a T3 promoter.
- the promoter is a T7 promoter.
- the polynucleotide encodes a positive sense viral transcript.
- the sequence encoding an RVNSP3 is a sequence encoding SEQ ID NO: 1, or a sequence with at least about 90% identity to SEQ ID NO: 1.
- the heterologous polynucleotide encodes a peptide or protein.
- the heterologous polynucleotide encodes a peptide or protein and is in frame with the NSP3.
- the peptide or protein comprises an antigenic peptide or protein.
- the peptide or protein comprises a microorganismal peptide or protein.
- the peptide or protein comprises a bacterial peptide or protein. In some embodiments, the peptide or protein comprises a viral peptide or protein. In some embodiments, the peptide or protein comprises a norovirus (NoV) peptide or protein. In some embodiments, the NoV peptide or protein comprises NoV VP1 protein. In some embodiments, the NoV peptide or protein is selected from SEQ ID NOs: 24, 26, or 80-84. In some embodiments, the peptide or protein comprises a SARS-CoV-2 protein or peptide. In some embodiments, the SARS-CoV-2 protein or peptide is selected from an N protein, an S protein, or fragment of either an N protein or an S protein.
- the SARS-CoV-2 protein is an SI protein or a fragment thereof.
- the peptide or protein comprises a cleavage site.
- the cleavage site is a protease cleavage site.
- the cleavage site is a thrombin cleavage site (SEQ ID NO: 28).
- the cleavage site is a self-cleaving peptide sequence.
- the self-cleaving peptide sequence is porcine teschovirus 2 A element (SEQ ID NO: 29).
- the peptide or protein comprises a linker.
- the linker is a GAG flexible linker or a GSG flexible linker.
- the heterologous polynucleotide is about 2.6 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.55 kb or less in length. In some embodiments, the heterologous polynucleotide is about 1.3 kb or less in length.
- the peptide or protein is a glycoprotein. In some embodiments, the peptide or protein comprises one or more glycosylation site. In some embodiments, the heterologous polynucleotide encodes a reporter.
- the reporter is selected from a fluorescent reporter, an enzyme, and an antigen tag. In some embodiments, the reporter is fused in-frame 3 ’ to the sequence encoding the RV protein.
- the method further comprises introducing one or more additional polynucleotides into the cell before the allowing step, wherein the one or more additional polynucleotides comprise a sequence encoding an RV protein selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP3, NSP4, and NSP5, wherein each sequence encoding an RV protein is operably linked to a promoter.
- the one or more additional polynucleotides comprise a sequence encoding an RV protein selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP4, andNSP5.
- the one or more additional polynucleotides comprise a sequence encoding a capping enzyme operably linked to a promoter.
- the capping enzyme is African swine fever virus capping enzyme.
- the cell is selected from an MA-104 cell, a Vero cell, and a BHK-1 cell.
- the cell expresses a heterologous RNA polymerase.
- the heterologous RNA polymerase is selected from T7 RNA polymerase and T3 RNA polymerase.
- the cell is a BHK-1 cell comprising T7 RNA polymerase.
- the method produces an RV protein fused to a glycoprotein when expressed in the cell.
- cells are provided.
- the cells comprise a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide.
- the cells comprise a infectious particle comprising a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide.
- the cells comprise an infectious particle made by introducing a polynucleotide comprising a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide into a cell.
- the cell is an MA-104 cell, a Vero cell or a BHK-1 cell.
- the cell expresses a heterologous RNA polymerase.
- the heterologous RNA polymerase is selected from T7 RNA polymerase and T3 RNA polymerase.
- systems, platforms, or kits for generating recombinant rotavirus comprise: (a) a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide; and (b) cells capable of expressing the polynucleotides of (a).
- the systems, platforms, or kits further comprise one or more additional polynucleotides comprising a sequence encoding an RV protein selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP3, NSP4, and NSP5, wherein each sequence encoding an RV protein is operably linked to a promoter.
- the one or more additional polynucleotides comprise at least one sequence encoding an RV protein selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP4, and NSP5.
- the cells comprise a heterologous RNA polymerase and, optionally, comprising African swine fever virus capping enzyme.
- the cells comprise a cells from a cell line selected from MA-104 cells, Vero cells, and BHK-1 cells.
- the cells comprise BHK-1 cells comprising T7 RNA polymerase.
- the cells comprise BHK-1 cells comprising T7 RNA polymerase, Vero cells, and MA-104 cells.
- FIG. 1A Domains of the human NoV VP1 capsid protein. VP1 can be subdivided into shell (S) and protruding (P) domains. The P domain is further resolved into Pl and P2 subdomains.
- FIG. IB Surface representation of NoV capsid with the S domain (green) and Pl (cyan) and P2 (blue) subdomains of VP1 distinguished by color.
- FIG. 1C Ribbon representation of a NoV VP1 dimer: S (green), Pl (cyan) and P2 (blue).
- FIG. 2. Plasmids with modified segment 7 (NSP3) cDNAs used to generate recombinant (r)SAl l viruses expressing portions of the human NoV VP1 protein. Illustration indicates nucleotide positions of the coding sequences for NSP3 (non-structural protein 3), porcine teschovirus 2A element (2A), 3xFLAG (3FL), IxFLAG (1FL), or 6xhistidine (6xHis) tag, and/or thrombin cleavage site (Th) and complete VP1, or subdomains of P2 and P.
- NSP3 non-structural protein 3
- porcine teschovirus 2A element (2A
- 3xFLAG (3FL) IxFLAG (1FL)
- 6xHis 6xhistidine
- Th thrombin cleavage site
- the red arrow notes the position of the 2A translational stop-restart site, and the asterisk notes the end of the ORF (open reading frame). Sizes (expressed as the number of amino acids encoded (aa) of encoded NSP3 and VP1 products are given in parenthesis. T7 (T7 RNA polymerase promoter sequence), Rz (hepatitis D virus ribozyme), UTR (untranslated region).
- FIG. 3A Properties of rSAl 1 viruses expressing FLAG-tagged regions of the NoV VP1 protein. Double-stranded RNA was recovered from rS Al 1 -infected MAI 04 cells, resolved by gel electrophoresis, and detected by ethidium-bromide staining. The genome segments of rSAl 1/wt (wt, wildtype) are labeled 1 to 11. Sizes (kilobasepair, kbp) of modified segment 7 RNAs (black arrows) are indicated.
- FIG. 3B Plaque assays were performed using MAI 04 cells and detected by crystal-violet staining.
- FIG. 3C Mean diameter values of rSAl 1 plaques are shown along with 95% confidence intervals (black lines).
- FIG. 3D Titers reached by rSAl 1 isolates were determined by plaque assay (plaqueforming units, PFU).
- FIG. 3E Whole cell lysates (WCL) were prepared from MAI 04 cells infected with rSAl 1 viruses and examined by immunoblot assay using FLAG antibody to detect VP1 protein products (P2, P, VP1 and 2A read-through products [red asterisk] and antibodies specific for RVNSP3 and VP6, porcine teschovirus 2A element, and b-actin. Sizes (kDa) of protein molecular weight markers (MWM) are indicated.
- FIG. 4A Properties of rSAl l viruses expressing His-tagged NoV capsid proteins.
- dsRNAs were recovered from MA104 cells infected with plaque-purified rSAl l isolates expressing His-tagged proteins, resolved by gel electrophoresis, and detected by ethidium-bromide staining. RNA segments of rSAl 1/wt are labeled 1 to 11. Sizes (kbp) of modified segment 7 RNAs (black arrows) of rSAl 1 isolates are indicated.
- FIG. 4B Plaque assays were performed using MAI 04 cells and detected by crystal -violet staining.
- FIG. 4C Mean diameter values of plaques, noting 95% confidence intervals (black lines).
- FIG. 4D Titers reached by rSAl 1 isolates were determined by plaque assay.
- FIG. 4E Whole cell lysates (WCL) were prepared from MAI 04 cells infected with rSAl 1 viruses and examined by immunoblot assay using anti-6xHis antibody to detect VP1 protein products (P and VP1) and antibodies specific for RV NSP3, VP6, porcine teschovirus 2 A element (2A), and cellular beta actin. Sizes (kilodaltons) of protein markers (MWM) are indicated.
- FIG. 5A Properties of rSAl l/RIX NSP3 virus expressing NoV P protein dsRNA was recovered from MA104 cells infected with plaque-purified rSAl land rSAl 1/RIX NSP3-2A-P His isolates (plaques 1-3), resolved by gel electrophoresis, and detected by ethidium-bromide staining.
- RNA segments of rSAl 1/wt. are labeled 1 to 11. Sizes (kbp) of modified segment 7 RNAs (black arrows) of rSAl 1 isolates are indicated.
- FIG. 5B Plaque assays were performed using MAI 04 cells and detected by crystal -violet staining.
- FIG. 5C Titers reached by rSAl 1 isolates were determined by plaque assay.
- FIG. 5D Whole cell lysates (WCL) were prepared from MAI 04 cells infected with rSAl land rSAl 1/RIX NSP3-2A-P His isolates and examined by immunoblot assay using anti- 6xHis antibody to detect the P protein and 2A read-through products, and antibodies specific for RV SAI 1 NSP3, VP6, porcine teschovirus 2A element (2A), and cellular beta actin.
- FIG. 6A Dimerization of NoV capsid proteins expressed by rSAl 1.
- MAI 04 cells were mock infected or infected with rSAl l/wt or rSAl l/NSP3-2A-fP2, rSAl l/NSP3-2A-fP, rSAl l/NSP3-2A-fVPl and rSAl l/NSP3-2A-VPlf, incubated until 9 h. p, i, when cells were harvested.
- Cell lysates were mixed with sample buffer containing sodium dodecyl sulfate and P- mercaptoethanol, incubated for 10 min at either 25°C or 95°C, resolved by electrophoresis on a Biorad 4 to 20% polyacrylamide gel, and blotted onto a nitrocellulose membrane. Blots were probed with M2 FLAG antibody, guinea pig polyclonal anti-NSP3 or anti-VP6 antibodies or with a rabbit anti-B actin monoclonal antibody. Primary antibodies were detected using HRP- conjugated secondary antibodies. Sizes (kilodaltons, kDa or kD) of molecular weight protein markers (MWM) are indicated.
- M2 FLAG antibody guinea pig polyclonal anti-NSP3 or anti-VP6 antibodies
- Primary antibodies were detected using HRP- conjugated secondary antibodies. Sizes (kilodaltons, kDa or kD) of molecular weight protein markers (MWM) are indicated.
- FIG. 6B MA 104 cells were mock infected or infected with rSAl 1/wt or rSAl 1/NSP3-2A- PHis, rSAl l/NSP3-2A-VPlHis, rSAl l/NSP3-2A-VPlThHis for 9 hpi, and cells were harvested.
- Cell lysates were prepared as above, resolved by electrophoresis on a Biorad 4 to 20% polyacrylamide gel, and blotted onto a nitrocellulose membrane. Blots were probed with mouse anti-6xHis antibody, guinea pig polyclonal anti-NSP3 or anti-VP6 antibodies or with a rabbit anti- B actin monoclonal antibody.
- Primary antibodies were detected using HRP-conjugated secondary antibodies. Sizes (kilodaltons) of protein markers (MWM) are indicated.
- FIG. 7A NoV VP1 capsid proteins expressed from rSAl l strains folded properly.
- A Lysates prepared from MA104 cells infected with rSAl l/wt, rSAl l/NSP3-2A-fVPl, rSAl l/NSP3-2A-VPlf, and rSAl l/NSP3-2A-VPlHis viruses were analyzed by immunoprecipitation (IP) assays using a NoV VP 1 specific monoclonal antibody (anti-NoV GII.4 NVB43.9, Absolute antibody) recognizing a conformational dependent epitope of the folded VP1 proteins.
- IP immunoprecipitation
- Antigen-antibody complexes were recovered using magnetic IgA/G beads, resolved by gel electrophoresis, and blotted onto nitrocellulose membranes. Blots were probed with anti-FLAG and anti-6xHis antibodies to detect immunoprecipitated VP1 proteins, and guinea pig polyclonal anti-NSP3 or anti-VP6 antibodies or with a rabbit anti-B actin monoclonal antibody. Blue arrows indicate immunoprecipitated VP1 proteins. Ig light chain, (Ig/L) and Ig heavy chain, Ig/H.
- FIG. 7B Lysates were similarly analyzed with a NSP2-specific mouse monoclonal antibody (#171), and blots were probed with mouse anti-NSP2 antibody (#516) to detect immunoprecipitated NSP2 proteins, and guinea pig polyclonal anti-NSP3 or anti-VP6 antibodies or with a rabbit anti-B actin monoclonal antibody. Positions of molecular weight markers (MWM) in kDa are indicated.
- MMWM molecular weight markers
- FIG. 8A Genetic stability of rSAl l strains expressing NoV proteins. rSAl l strains were serially passaged 5 times (Pl to P5) in MA104 cells.
- FIG. 8B and 8C Genomic RNAs were recovered from cells infected with lysates at three dilutions (1 : 10, 1 : 100 and 1 : 1000) and analyzed by gel electrophoresis.
- FIG. 8D. and 8E Genomic RNAs prepared from large (L) and small (S) plaques isolated from P5 lysates of rSAl l/NSP3-2A-fVPl and rSAl l/NSP3-2A-VPlHis viruses.
- the re-arranged segment 7 RNAs are denoted as fVPl/Rl, fVPl/R2 and VP1 His/R (red arrows).
- FIG. 8F Organization of re-arranged segment 7 RNA (R) sequences determined by sequencing the cDNAs prepared from re-arranged RNAs. Sequence deletions are indicated with dashed lines.
- FIG. 9A Characterization of rSAl 1 variants generated from rSAl 1 viruses modified to express NoV VP1.
- Genomic RNAs were recovered from rSAl l/NSP3-2A-fVPl and rSAl l/NSP3-2A-VPlHis infected cell lysates and analyzed by gel electrophoresis. Positions of viral genome segments are labeled. Position of modified segment 7 (NSP3) dsRNAs introduced into rSAl 1 strains are denoted with black arrows and generation of random variants are shown with red arrows.
- NSP3 modified segment 7
- FIG. 9B Whole cell lysates (WCL) were prepared from MA104 cells infected with variant rSAl 1 viruses and examined by immunoblot assay using antibodies specific for RV NSP3, VP6, and cellular beta actin. Probing with NSP3 antisera shows multiple NSP3 protein bands.
- FIG. 9C., 9D., 9E., 9F., 9G., and 9H Genomic RNAs were recovered from cells infected with large (L) and small (S) plaque isolates from fVPl variant pools (VI -V4) and VPIHis variant pools (V5-V6) and analyzed by gel electrophoresis (V: Variant).
- FIG. 91 The organization of re-arranged segment 7 RNA (denoted as R) sequences determined by sequencing of cDNAs made from variant segment 7 RNAs. Sequence deletions are indicated with dashed lines. The sizes of re-arranged variant segments are shown in parenthesis.
- FIG. 10A., 10B Impact of genome size on RV particle density.
- A-B MAI 04 cells were infected with rSAl l/wt, rSAl l/NSP3-fP2, rSAl l/NSP3-fP, rSAl l/NSP3-fVPl, rSAl l/NSP3- PHis, rSAl l/NSP3-VPlHis viruses at an MOI of 5.
- the cells were recovered, lysed by treatment with non-ionic detergent, and treated with EDTA to convert RV virions into DLPs.
- DLPs were banded by centrifugation in CsCl gradients and their densities (g/cm 3 ) determined using a refractometer. The particle densities are shown in the Tables embedded in FIG. 10A., 10B
- FIG. IOC. and FIG. 10D Electrophoretic profile of the dsRNA genomes of DLPs recovered from CsCl gradients.
- Panel C RNAs derive from DLPs in panel A (FIG. 10A) and panel D (FIG. 10C) RNAs derive from DLPs in panel B.
- RNA segments of rSAl 1/wt. are labeled, 1 to 11. Positions of modified segment 7 RNAs are indicated with black arrows and red arrow indicated variants generated in the sample.
- FIG. 11 Plasmids with modified segment 7 (NSP3) cDNAs used to generate rSAl 1 s encoding the SARS-CoV-2 SI protein.
- NSP3 modified segment 7
- Schematic indicates nucleotide positions of the coding sequences for NSP3, porcine teschovirus 2A element, 3x or IxFLAG (FL), 6xHis (His) and the complete SI.
- the red arrow notes the position of the 2A translational stop-restart site, and the asterisk notes the end of the ORF. Sizes (in terms of the number of amino acids encoded the sequence (aa)) of encoded NSP3 and SI proteins are shown in parenthesis.
- T7 T7 RNA polymerase promoter sequence
- Rz Hepatitis D virus ribozyme
- UTR untranslated region
- FIG. 12A Properties of rSAl l viruses expressing SARS CoV-2 SI protein.
- dsRNA was recovered from MA104 cells infected with plaque-purified rSAl l isolates, resolved by gel electrophoresis, and detected by ethidium-bromide staining.
- RNA segments of rSAl 1/weight (wt.) are labelled 1 to 11. Sizes (Kbp) of segment 7 RNAs (black arrows) of rSAl 1 isolates are indicated.
- FIG. 12B Properties of rSAl l viruses expressing SARS CoV-2 SI protein. dsRNA was recovered from MA104 cells infected with plaque-purified rSAl l isolates, resolved by gel electrophoresis, and detected by ethidium-bromide staining. RNA segments of rSAl 1/weight (wt.) are labelled 1 to 11. Sizes (Kbp) of segment 7 RNAs (black arrows) of rSAl 1 isolate
- Cell lysates were prepared from cells infected with rSAl 1 viruses 9, hours post infection (h p.i.), and examined by immunoblot assay using anti-FLAG and anti-6xHis antibodies to detect S protein and the same blot re-probed with antibodies specific for SARS CoV-2 SI protein, RV NSP3 and VP6, and cellular beta actin.
- FIG. 12C Plaque assays were performed using MAI 04 cells and detected by crystal -violet staining.
- FIG. 12D Titers reached by rSAl 1 isolates were determined by plaque assay.
- FIG. 13 SARS CoV-2 SI proteins expressed from rSAl 1 viruses are glycosylated.
- Whole cell lysates were prepared from cells infected with rSAl 1 viruses 9 h.p.i are treated with or without Endo H reagent and examined by immunoblot assay using anti-FLAG and anti-6xHis antibodies to detect SI protein, and the same blot is re-probed for an antibody specific for SARS CoV-2 SI. Immunoblot was also probed with antibodies specific for RV NSP3 and VP6, and the same blot is re-probed with antibodies specific for cellular beta actin.
- FIG. 14A. and FIG. 14B SARS CoV-2 SI proteins expressed from rSAl 1 viruses are glycosylated.
- Whole cell lysates were prepared from cells infected with rSAl 1 viruses 9 h.p.i are treated with or without Endo H reagent and examined by immunoblot assay using anti-FLAG and anti-6xHis antibodies to detect SI protein
- SARS CoV-2 SI proteins expressed from rSAl 1 viruses are able to bind to human ACE-2 receptor.
- Lysates prepared from MA104 cells infected with rSAl l/wt. and rSAl l/NSP3-2A-Sl viruses were examined by co-immunoprecipitation assay using a recombinant ACE-2-human IgG protein.
- the protein-antibody complexes were recovered using protein IgA/G beads, resolved by gel electrophoresis, blotted onto nitrocellulose membranes, and probed with anti -FLAG and anti-6xHis antibodies, SARS CoV-2 SI antibody, antibodies specific for RV NSP3 and VP6, and cellular beta actin.
- FIG. 15 Localization of SARS CoV-2 Siprotein in RV-infected cells.
- MA104 cells were mock infected or infected with recombinant SA11 viruses: wt, NSP3-2A-Slf. At 9 h p.i., cells were fixed with 3.7 % formaldehyde. Afterwards, all cells were incubated with Rabbit S 1 antibody, mouse NSP2 antibody, followed by Alexa 488 anti-rabbit IgG (green) and TRITC anti-mouse IgG (red) and to detect locations of SI protein and NSP2 proteins in the infected cells. Nuclei were detected by staining with DAPI. Cells were analyzed with an Echo Revolve fluorescence microscope (20 X objective) using fluorescein isothiocyanate and tetramethyl rhodium isothiocyanate windows.
- FIG. 16A Genetic stability of rSAl 1 strains expressing SARS CoV-2 SI f protein.
- rSAl 1 strain expressing SI protein was serially passaged 5 times (Pl to P5) in MAI 04 cells.
- Genomic RNAs were recovered from infected cell lysates and analysed by gel electrophoresis. Positions of viral genome segments are labelled. Positions of modified segment 7 (NSP3) dsRNAs introduced into rSAl 1 strain are denoted with black arrows.
- FIG. 16B Lysates prepared from MAI 04 cells infected with rSAl 1/wt and serially passed SAl l/NSP3-2A-Slf viruses (Pl to P5) were examined by immunoblot assay and probed with FLAG antibody, SARS CoV-2 SI antibody, antibodies specific for RV NSP3 and VP6, and cellular beta actin.
- the NoV genome is approximately 7.6 kbp, contains three open reading frames (ORF 1-3), and ORF-3 encodes the major structural protein, VP1.
- the viral capsid is comprised of 90 dimers of VP1, which is comprised of a shell (S) domain and a protruding (P) domain (16).
- S domain is the most highly conserved VP1 domain
- P domain is more variable and includes a Pl and a P2 subdomain that are discontinuous in their primary amino acid sequence.
- the highly variable P2 subdomain represents the immunodominant region of the protein, a target for neutralizing antibodies, and contains the defined receptor binding site for NoV (17, 18).
- the immunological response following NoV infection can be identified by measuring the serum human histo-blood group antigens (19, 20).
- NoV vaccines Three types have been developed; non-replicating virus-like particles (VLPs), P particles, and recombinant adenovirus vectored vaccines (21-23). Most vaccine studies were performed in adults (24-26), while a phase II trial of a GI.1 and GII.4 bivalent vaccine trial carried out in children and infants for testing the immunogenicity and safety showed that the preparation has evoked a robust immune response (27).
- a trivalent vaccine containing two NoV VLPs GII.4 and GI.3 and the oligomeric RV VP6 was tested in animal models (28, 29).
- RV VP6 is a highly conserved protein, capable of evoking a significant immune response that protects from RV infection, and it can act as an adjuvant increasing the immune response against NoV antigen (30).
- RV reverse genetics systems has resulted in the generation of recombinant RVs as expression vectors of foreign proteins (31-36).
- the RV genome consists of 11 segments of dsRNA, with a total size of 18.5 kbp. All the segments contain a single ORF except for segment 11. These encode the six structural (VP) or six non-structural (NSP) viral proteins (37).
- Genome segment 7 of group A RV (RVA) encodes 36 kDa protein, NSP3, an RNA binding protein that acts as a translation enhancer of viral (+) mRNAs in infected cells (38, 39).
- RV a vaccine expression vector
- the inventors explored the possibility of making an RV-SARS-CoV-2 vaccine, by modifying the NSP3 ORF using a 2A translation element to express regions of SARS-CoV-2 spike proteins (31).
- Well growing, genetically stable recombinant RVs that express domains of SARS CoV-2 S protein were made, and the NSP3 product of these viruses was functional, capable of dimerization and inducing nuclear localization of the cellular poly(A)-binding protein (31, 32, 40). Therefore, the inventor’s developed RV as an effective vector system for making a combined RV-NoV vaccine that can induce immunological protection against both RV and NoV infection.
- polynucleotides comprising: a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide are provided.
- the inventors disclose herein that the polynucleotides, in some embodiments, encode a positive sense viral transcript and may be expressed in a cell to generate functional gene products. Therefore, in some embodiments, the polynucleotides are operably linked to a promoter, e.g., a T3 promoter (SEQ ID NO: 31) or a T7 promoter (SEQ ID NO: 30).
- operably linked refers to a functional relationship between two or more nucleic acid (e.g., DNA) segments. Typically, it refers to the functional relationship of transcriptional regulatory element (promoter) to a transcribed sequence.
- a promoter is operably linked to a coding sequence if it stimulates or modulates the transcription of the coding sequence in an appropriate cell.
- promoter transcriptional regulatory elements that are operably linked to a sequence are physically contiguous to the transcribed sequence, i.e., they are cis acting.
- some transcriptional regulatory elements, such as enhancers need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
- Exemplary promoters include a T7 bacteriophage promoter (SEQ ID NO: 14) and a T3 bacteriophage promoter (SEQ ID NO: 15).
- a suitable promoter may be chosen by from promoters known in the art.
- the cells are mammalian cells and are selected from MA- 104 cells, Vero cells and BHK-1 cells.
- the RV NSP3 protein is SEQ ID NO: 1, or a sequence with at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or at least about 99% identity to SEQ ID NO: 1.
- the sequence encoding NSP3, e.g., SEQ ID NO: 9, further comprises the heterologous polynucleotide fused to the 3’ end of the sequence such that the heterologous polynucleotide encodes a protein or peptide in frame with the NSP3 sequence, thereby allowing transcription of a single mRNA that encodes both NSP3 and the heterologous polynucleotide.
- the polynucleotide comprising a sequence encoding NSP3 and a heterologous polynucleotide comprise a sequence encoding a cleavage site.
- the cleavage site is a self-cleaving peptide, e.g., porcine teschovirus P2A element (SEQ ID NO: 13).
- the disclosed compositions comprise, from 5’ to 3’, a polynucleotide encoding NSP3, fused in-frame to a sequence encoding a self-cleaving peptide which is fused in-frame to a heterologous polynucleotide sequence encoding a peptide or protein.
- a fusion protein comprising, from N- to C-terminus, an RV NSP3 protein fused to a self-cleaving peptide, e.g., SEQ ID NO: 13, which is fused to a peptide or protein encoded by the heterologous polynucleotide, in a cell; following translation, the fusion protein self-cleaves resulting in two separate proteins (1) a functional RV NSP3 protein and (2) the protein or peptide encoded by the heterologous polynucleotide.
- a self-cleaving peptide e.g., SEQ ID NO: 13
- compositions further comprise a sequence encoding a sequence encoding a linker, e.g., a flexible linker located 3’ to, and in frame with, the sequence encoding NSP3 protein and 5’ to a cleavage site.
- a linker e.g., a flexible linker located 3’ to, and in frame with, the sequence encoding NSP3 protein and 5’ to a cleavage site.
- GAG GAGn linker
- GSG linker a GSG linker
- sequence encoding a cleavage site encodes a protease cleavage site, e.g., a thrombin cleavage site, e.g., SEQ ID NO: 12.
- the heterologous polynucleotide comprises a sequence encoding at least one carrier moiety.
- the carrier moiety is a secretion peptide, e.g., interleukin-2-secretion protein, SARS CoV-2 SI secretion peptide, or a ligand for cell surface receptor, e.g., immunoglobulin IgG, fetal receptor FcRn.
- the heterologous polynucleotide sequence described above comprise sequences encoding proteins or peptides derived from infectious organisms, e.g., NoV or SARS-CoV-2. Therefore, in some embodiments, the disclosed compositions comprise sequences encoding RV NSP3 fused, in-frame, to a heterologous polynucleotide encoding a NoV protein or peptide, e.g., NoV.
- the NoV VP1 protein has an amino acid sequence selected from SEQ ID NOs: 24 or 26.
- the heterologous polynucleotide encodes NoV VP1 and comprises SEQ ID NO: 25.
- the norovirus protein is selected from SEQ ID NOs: 24 or 26 and 80-84.
- polynucleotides encode a protein selected from SEQ ID NOs: 2-11, or a sequence with at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or at least about 99% identity to to a sequence selected from SEQ ID NOs: 2-11.
- the polynucleotides comprise SEQ ID NOs: 13-22 or a sequence with at least about 90% identity, at least about 91% identity, at least about 92% identity, at least about 93% identity, at least about 94% identity, at least about 95% identity, at least about 96% identity, at least about 97% identity, at least about 98% identity, or at least about 99% identity to any one of SEQ ID NOs: 13-22.
- infectious particles comprise a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide.
- the infectious particles are made by introducing a polynucleotide comprising a sequence encoding an RV NSP3 protein; and a heterologous polynucleotide into a cell.
- infectious particles refers to any particle capable of causing an infection of an organism or cell.
- infectious particles include, but are not limited to, viral particles, virions, and the like.
- virus refers to any virus capable of causing an infection of an organism or cell.
- viral particle refers to any virus capable of causing an infection of an organism or cell.
- infectious particles include, but are not limited to, viral particles, virions, and the like.
- infectious particles include, but are not limited to, viral particles, virions, and the like.
- virus viral particle
- virion may be used interchangeably herein.
- the infectious particles are an RV, e.g., RV strain SAI 1.
- RV e.g., RV strain SAI 1.
- the instant disclosure provides compositions comprising polynucleotides encoding RV proteins operably linked to a promoter, e.g., a T7 promoter (SEQ ID NO: 30).
- the compositions may be used in a reverse genetics approach to generate recombinant RV, e.g., recombinant RV strain RIX4414.
- the recombinant RV may comprise the disclosed compositions.
- the cells are selected from BHK-1 cells, MA- 104 cells, and Vero cells.
- the cells are BHK-1 cells expressing T7 polymerase, also known as BHK-T7 cells.
- compositions comprising a polynucleotide comprising a sequence encoding an RV NSP3 protein; and a heterologous polynucleotide.
- pharmaceutical compositions comprise an infectious particle made by transfecting a cell with a polynucleotide comprising a sequence encoding a recombinant RV NSP3 protein and a heterologous polynucleotide.
- compositions and methods disclosed herein may be administered as pharmaceutical compositions and, therefore, pharmaceutical compositions incorporating the compounds are considered to be embodiments of the compositions disclosed herein.
- Such compositions may take any physical form which is pharmaceutically acceptable; illustratively, they can be orally administered pharmaceutical compositions.
- Such pharmaceutical compositions contain an effective amount of a disclosed composition, which effective amount is related to the daily dose of the composition to be administered.
- Each dosage unit may contain the daily dose of a given composition or each dosage unit may contain a fraction of the daily dose, such as one-half or one- third of the dose.
- the amount of each composition to be contained in each dosage unit can depend, in part, on the identity of the particular composition chosen for the therapy and other factors, such as the indication for which it is given.
- the pharmaceutical compositions disclosed herein may be formulated so as to provide quick, sustained, or delayed release of the active ingredient after administration to the patient by employing well known procedures.
- the pharmaceutical compositions may be utilized in methods of eliciting an immune response or vaccinating against a pathogen, e.g., RV, NoV, SARS-CoV-2.
- a pathogen e.g., RV, NoV, SARS-CoV-2.
- the terms “treating” or “to treat” each mean to alleviate symptoms, eliminate the causation of resultant symptoms either on a temporary or permanent basis, and/or to prevent or slow the appearance or to reverse the progression or severity of resultant symptoms of the named disease or disorder.
- the methods disclosed herein encompass both therapeutic and prophylactic administration.
- a subject may be at risk for infection by a pathogen, e.g., RV, NoV, and administration of the disclosed pharmaceutical compositions elicits a protective immune response or vaccinates against the pathogen.
- the term “effective amount” refers to the amount or dose of the compositions, upon single or multiple dose administration to the subject, which provides the desired effect in the subject under diagnosis or treatment.
- the disclosed methods may include administering an effective amount of the disclosed compositions e.g., as present in a pharmaceutical composition) for eliciting an immune response to a pathogen, e.g., RV, NoV, SARS-CoV-2, or vaccinating against the pathogen.
- a pathogen e.g., RV, NoV, SARS-CoV-2
- an effective amount can be readily determined by the attending diagnostician, as one skilled in the art, by the use of known techniques and by observing results obtained under analogous circumstances.
- determining the effective amount or dose of composition administered a number of factors can be considered by the attending diagnostician, such as: the species of the subject; its size, age, and general health; the degree of involvement or the severity of the disease or disorder involved; the response of the individual subject; the particular composition administered; the mode of administration; the bioavailability characteristics of the preparation administered; the dose regimen selected; the use of concomitant medication; and other relevant circumstances.
- Oral administration is an illustrative route of administering the compositions and methods disclosed herein.
- Other illustrative routes of administration include transdermal, percutaneous, intravenous, intramuscular, intranasal, buccal, intrathecal, intracerebral, or intrarectal routes.
- the route of administration may be varied in any way, limited by the physical properties of the compounds being employed and the convenience of the subject and the caregiver.
- suitable formulations include those that are suitable for more than one route of administration.
- the formulation can be one that is suitable for both intrathecal and intracerebral administration.
- suitable formulations include those that are suitable for only one route of administration as well as those that are suitable for one or more routes of administration, but not suitable for one or more other routes of administration.
- the formulation can be one that is suitable for oral, transdermal, percutaneous, intravenous, intramuscular, intranasal, buccal, and/or intrathecal administration but not suitable for intracerebral administration.
- compositions contain from about 0.5% to about 50% of the compound in total, depending on the desired doses and the type of composition to be used.
- amount of the compound is best defined as the “effective amount”, that is, the amount of the compound which provides the desired dose to the patient in need of such treatment.
- the activity of the compounds employed in the compositions and methods disclosed herein are not believed to depend greatly on the nature of the composition, and, therefore, the compositions can be chosen and formulated primarily or solely for convenience and economy.
- Capsules are prepared by mixing the compound with a suitable diluent and filling the proper amount of the mixture in capsules.
- suitable diluents include inert powdered substances (such as starches), powdered cellulose (especially crystalline and microcrystalline cellulose), sugars (such as fructose, mannitol and sucrose), grain flours, and similar edible powders.
- Tablets are prepared by direct compression, by wet granulation, or by dry granulation. Their formulations usually incorporate diluents, binders, lubricants, and disintegrators (in addition to the compounds). Typical diluents include, for example, various types of starch, lactose, mannitol, kaolin, calcium phosphate or sulfate, inorganic salts (such as sodium chloride), and powdered sugar. Powdered cellulose derivatives can also be used. Typical tablet binders include substances such as starch, gelatin, and sugars (e.g., lactose, fructose, glucose, and the like).
- Natural and synthetic gums can also be used, including acacia, alginates, methylcellulose, polyvinylpyrrolidine, and the like. Polyethylene glycol, ethylcellulose, and waxes can also serve as binders.
- Tablets can be coated with sugar, e.g., as a flavor enhancer and sealant.
- the compounds also may be formulated as chewable tablets, by using large amounts of pleasant-tasting substances, such as mannitol, in the formulation.
- Instantly dissolving tablet-like formulations can also be employed, for example, to assure that the patient consumes the dosage form and to avoid the difficulty that some patients experience in swallowing solid objects.
- a lubricant can be used in the tablet formulation to prevent the tablet and punches from sticking in the die.
- the lubricant can be chosen from such slippery solids as talc, magnesium and calcium stearate, stearic acid, and hydrogenated vegetable oils.
- Tablets can also contain disintegrators.
- Disintegrators are substances that swell when wetted to break up the tablet and release the compound. They include starches, clays, celluloses, algins, and gums. As further illustration, com and potato starches, methylcellulose, agar, bentonite, wood cellulose, powdered natural sponge, cation-exchange resins, alginic acid, guar gum, citrus pulp, sodium lauryl sulfate, and carboxymethylcellulose can be used.
- compositions can be formulated as enteric formulations, for example, to protect the active ingredient from the strongly acid contents of the stomach.
- Such formulations can be created by coating a solid dosage form with a film of a polymer which is insoluble in acid environments and soluble in basic environments.
- Illustrative films include cellulose acetate phthalate, polyvinyl acetate phthalate, hydroxypropyl methylcellulose phthalate, and hydroxypropyl methylcellulose acetate succinate.
- Transdermal patches can also be used to deliver the compounds.
- Transdermal patches can include a resinous composition in which the compound will dissolve or partially dissolve; and a film which protects the composition, and which holds the resinous composition in contact with the skin.
- Other, more complicated patch compositions can also be used, such as those having a membrane pierced with a plurality of pores through which the drugs are pumped by osmotic action.
- the formulation can be prepared with materials (e.g., actives excipients, carriers (such as cyclodextrins), diluents, etc.) having properties (e.g., purity) that render the formulation suitable for administration to humans.
- the formulation can be prepared with materials having purity and/or other properties that render the formulation suitable for administration to non-human subjects, but not suitable for administration to humans.
- RV recombinant rotavirus
- the methods comprise: introducing a polynucleotide comprising a sequence encoding an RV NSP3 protein; and a heterologous polynucleotide into a cell; allowing the cell to express the polynucleotide; incubating the cells for a sufficient time to produce RV; and harvesting virus produced by the cells to generate RV in vitro.
- a polynucleotide comprising a sequence encoding an RV NSP3 protein
- a heterologous polynucleotide into a cell
- allowing the cell to express the polynucleotide incubating the cells for a sufficient time to produce RV; and harvesting virus produced by the cells to generate RV in vitro.
- each of the 11 RV genome segments must be expressed in a cell.
- the methods further comprise introducing one or more additional polynucleotides into the cell before the allowing step, wherein the one or more additional polynucleotides comprise a sequence encoding an RV protein selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP3, NSP4, and NSP5, wherein each sequence encoding an RV protein is operably linked to a promoter.
- the one or more additional polynucleotides comprise a sequence encoding an RV protein selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP4, and NSP5.
- the one or more additional polynucleotides are 10 separate polynucleotides which comprise a sequence encoding an RV protein selected from VP1, VP2, VP3, VP4, VP6, VP7, NSP1, NSP2, NSP4, and NSP5, respectively.
- the methods comprise introducing a polynucleotide comprising sequences encoding each of the 11 rotaviral proteins, which, in some embodiments, are each encoded on separate polynucleotides.
- the one or more additional polynucleotides comprise a sequence encoding a capping enzyme operably linked to a promoter.
- the capping enzyme is African swine fever virus capping enzyme (encoded by SEQ ID NO: 27).
- cells comprising the disclosed polynucleotides, which may also be used in the disclosed methods and systems. Accordingly, in another aspect of the current disclosure, cells are provided.
- the cells comprise a polynucleotide comprising a sequence encoding a recombinant RV NSP3 protein; and a heterologous polynucleotide.
- the cells are selected from MA-104 cells, Vero cells, and BHK-1 cells.
- RV vaccine strains have been traditionally grown using Vero cells. This method of producing RV has been found to be suitable for generation of RV for administration to subjects. Therefore, in some embodiments, the cells are Vero cells.
- the cells disclosed herein further comprise a heterologous RNA polymerase, wherein the heterologous RNA polymerase binds to the promoter in the disclosed compositions and catalyzes sequence-dependent RNA polymerization based on the polynucleotides when the polynucleotides are introduced into the cell.
- heterologous RNA polymerase refers to an RNA polymerase introduced into a cell through molecular biological techniques, e.g., transduction, transfection, lipofection, etc.
- the heterologous RNA polymerase comprises T7 bacteriophage RNA polymerase or T3 bacteriophage RNA polymerase, more commonly known as simply T7 polymerase and T3 polymerase, respectively.
- the cells further comprise T7 RNA polymerase or T3 RNA polymerase.
- T7 RNA polymerase or T3 RNA polymerase such cells are referred to as, e.g., BHK-T7 cells, because they are derived from BHK-1 cells, but express the heterologous RNA polymerase T7 bacteriophage RNA polymerase.
- BHK-T7 cells are BHK-1 cells that express the heterologous RNA polymerase T7 bacteriophage RNA polymerase.
- the instant disclosure provides pharmaceutical compositions comprising infectious particles which may comprise heterologous antigens that, when administered to a subject, may be protective against natural infection with the pathogen from which the antigens are derived. Therefore, in another aspect of the current disclosure, methods of eliciting an immune response to one or more pathogens are provided.
- the methods comprise administering a pharmaceutical composition comprising an infectious particle comprising a polynucleotide comprising a sequence encoding an RV NSP3 protein; and a heterologous polynucleotide to a subject to elicit an immune response to one or more pathogens.
- the methods comprise administering a pharmaceutical composition comprising an infectious particle made by transfecting cells with a polynucleotide comprising a sequence encoding an RV NSP3 protein; and a heterologous polynucleotide to a subject to elicit an immune response to one or more pathogens.
- eliciting an immune response refers to generation of an inflammatory reaction, increase in activation level or number of innate or adaptive immune cells in response to administration. Eliciting an immune response may also be measured as increased humoral immunity against an administered antigen in a subject. Suitable assays to measure both increased innate/ adaptive cell activation and number and/or humoral immunity against an antigen are known in the art.
- cellular immunity may be measured by increased numbers of activated T cells in the subject by, e.g., flow cytometry.
- Elicitation of a humoral immune response may be measured by antibody binding to the antigen administered to the subject, for which numerous methods are known in the art.
- methods of vaccinating a subject against one or more pathogens comprise administering a pharmaceutical composition comprising an infectious particle comprising a polynucleotide comprising a sequence encoding a rotavirus (RV) NSP3 protein; and a heterologous polynucleotide.
- the methods comprise administering a pharmaceutical composition comprising an infectious particle made by transfecting cells with a polynucleotide comprising a sequence encoding an RV NSP3 protein; and a heterologous polynucleotide.
- vaccinating refers to administering to a subject an antigen derived from a pathogen to stimulate an immune response in the subject to the antigen, thereby providing some level of immunity to the pathogen, should the subject become infected with the pathogen.
- vaccination may reduce the signs or symptoms of infection by a pathogen in a vaccinated subject or may provide neutralizing immunity and prevent infection by the pathogen in a subject.
- kits for generating recombinant RV comprise: a polynucleotide comprising a sequence encoding an RV NSP3 protein; and a heterologous polynucleotide; and cells capable of expressing the polynucleotides.
- the kits of the current disclosure comprise a polynucleotide comprising a sequence encoding an RV NSP3 protein; and a heterologous polynucleotide; and cells capable of expressing the polynucleotides.
- kits may contain, in some embodiments, additional reagents necessary to introduce the polynucleotides of the instant disclosure into the cells, e.g., reagents for transfection, lipofection, electroporation, transduction, etc. Therefore, in some embodiments, the disclosed kits comprise reagents for, e.g., generating recombinant rotaviruses in vitro according to the disclosed methods.
- a recombinant RV comprising: an RV; and an insertion of up to 1.3 kbp of foreign sequence of, wherein the RV bearing the 1.3 bp insertion is genetically stable.
- a non-RV virus selected from the group consisting of: NoV, SARS-CoV-2, astrovirus, enterovirus, and hepatitis E.
- the recombinant RV wherein the at least one carrier moiety, is a secretion peptide (e.g:interleukin-2-secretion protein, SARS CoV-2 SI secretion peptide) or ligands for cell surface receptor, immunoglobulin IgG, fetal receptor FcRn).
- a secretion peptide e.g:interleukin-2-secretion protein, SARS CoV-2 SI secretion peptide
- ligands for cell surface receptor e.g:interleukin-2-secretion protein, SARS CoV-2 SI secretion peptide
- ligands for cell surface receptor e.g:interleukin-2-secretion protein, SARS CoV-2 SI secretion peptide
- ligands for cell surface receptor e.g:interleukin-2-secretion protein, SARS CoV-2 SI secretion peptide
- ligands for cell surface receptor e.g:interleukin-2
- RV The recombinant RV, according to any of embodiments 1 to 5, wherein the insertion encodes SARS-CoV-2 SI protein.
- a vaccine comprising the recombinant RV of any one of embodiments 1 to 7.
- a recombinant RV comprising: an RV; and a sequence encoding a glycosylated exogenous capsid protein, wherein the sequence is inserted into segment 7 RNA.
- the recombinant RV according to the eleventh embodiment, wherein the RV is rSAl 1.
- the recombinant RV of embodiments 11-14 further including at one of the following: a pharmaceutically acceptable excipient, stabilizer, and or carrier.
- a composition comprising the recombinant RV of embodiment 15, further comprising an adjuvant.
- composition of embodiment 16, wherein the adjuvant is an immunostimulatory oligonucleotide such as CpG, a polyacrylic acid polymer, a dimethyl dioctadecyl ammonium bromide, a sterol, saponin, a monophosphoryl lipid A or analog thereof, a quartenary amine, an aluminium hydroxide composition such as an aluminium hydroxide gel, or a combination thereof.
- an immunostimulatory oligonucleotide such as CpG
- a polyacrylic acid polymer such as a polyacrylic acid polymer, a dimethyl dioctadecyl ammonium bromide, a sterol, saponin, a monophosphoryl lipid A or analog thereof, a quartenary amine
- an aluminium hydroxide composition such as an aluminium hydroxide gel, or a combination thereof.
- a method of treating a subject comprising administering any of the composition according to embodiments 15-19.
- a cell comprising the recombinant RV of any one of embodiments 1-14.
- Example 1- Recombinant rotaviruses expressing norovirus protein
- Embryonic monkey kidney (MAI 04) cells were grown in Dulbecco’s Modified Eagle Medium (DMEM) containing 5% fetal bovine serum (FBS) and 1% penicillin-streptomycin (41).
- Baby hamster kidney cells constitutively expressing T7 RNA polymerase (BHK-T7) were provided by Dr. Ulla Buchholz, Laboratory of Infectious Diseases, NIAID, NIH, and were propagated in Glasgow minimum essential media (GMEM) containing 5% heat-inactivated FBS, 10% tryptone-peptide broth, 1% penicillin-streptomycin, 2% non-essential amino acids, and 1% glutamine (42).
- BHK-T7 cells were grown in a medium supplemented with 2% Geneticin (Invitrogen) with every other passage.
- Recombinant rSAl ls were prepared using the plasmids pT7/VPlSAl l, pT7/VP2SAl l, pT7/VP3SAl l, pT7/VP4SAl l, pT7/VP6SAl l, pT7/VP7SAl l, pT7/NSPlSAl 1, pT7/NSP2SAl l, pT7/NSP3SAl l, pT7/NSP4SAl 1, and pT7/NSP5SAl l [https://www.addgene.org/Takeshi_Kobayashi/] (36) and pCMV/NP868R (33).
- the plasmid pT7/NSP3-P2A-fUnaG was produced by fusing a DNA fragment containing the ORF for P2A- 3xFL-UnaG to the 3'-end of the NSP3 ORF of pT7/NSP3SAl 1 using a Takara In-Fusion cloning kit (32).
- a plasmid (pUC57/MDA145_VPl) containing a full-length cDNA of the VP1 genome segment of the NoV GII.4 MD145-12 strain was purchased from Genewiz.
- the plasmids pT7/NSP3-P2A-fP2, pT7/NSP3-P2A-fP, pT7/NSP3-P2A-fVPl were made by replacing the UnaG ORF in pT7/NSP3-P2A-fUnaG with ORFs for the P2, P, and VP1 regions, respectively, of the NoV VP1 capsid protein, by In-Fusion cloning.
- the backbone of the plasmids was generated through PCR amplification of pT7/NSP3-P2A-fUnaG with the primer pairs: Vector For and Vector Rev (Table 1).
- DNA fragments containing P2, P, and VP1 coding sequences were amplified from pUC57/MDA145_VPl using the primer pairs fP2_For and fP2_Rev, fP For and fP Rev, fVPI For and fVPI Rev respectively (Table 1).
- the plasmids pT7/NSP3-P2A-VPlf, pT7/NSP3-P2A-P-His, pT7/NSP3-P2A-VPl-His, pT7/NSP3-P2A-VPl- Th-His were made similarly.
- the backbone of the plasmids was generated by amplifying pT7/NSP3-P2A-fUnaG with the primer pairs Vector P2A_For and Vector P2A_Rev (Table 1).
- DNA fragments containing VP1 with a C terminal FLAG or P or VP1 with a C terminal His tag were produced through PCR amplification of pUC57/MDA145_VPl with the primer pairs VP1- fFor and VPl-fRev, P-His_For and P-His_Rev, VPl-ThHis_For and VPl-ThHis_Rev, VP1- His For and VPl-His_Rev respectively (Table 1).
- a pucl9 plasmid containing a RIX/NSP3-P2A- P-His insert under the control of a T7 transcription promoter was purchased from Bio Basic Canada Inc. Transfection quality plasmids were prepared commercially (www.plasmid.com) or using Qiagen plasmid purification kits. Primers were provided by and sequences determined by EuroFins Scientific. [00109] Recombinant viruses
- the BHK-T7/MA104 cell mixture was freeze-thawed 3-times and the lysates were clarified by low-speed centrifugation (800 xg, 5 min).
- Recombinant viruses in clarified lysates were amplified by a single round of passage on MAI 04 monolayers and recovered by plaque purification.
- Viral dsRNAs were recovered from infected-cell lysates by TRIzol extraction, resolved by electrophoresis on 10% polyacrylamide gels in Tris-glycine buffer, detected by staining with ethidium bromide, and visualized using a BioRad ChemiDoc MP Imaging System.
- RV plaque assays were performed as described before. To visualize plaques, cell monolayers with agarose overlays were incubated overnight with phosphate-buffered saline (PBS) containing 3.7% formaldehyde. Afterward, agarose overlays were removed, and the monolayers were stained for 3 h with a solution of 1% crystal violet dissolved in 5% ethanol. Monolayers then were rinsed with water and air-dried. Plaque images were captured using a Bio-Rad ChemiDoc imaging system and diameters were measured using ImageJ software and the results were analyzed with GraphPad Prism, version 8. Statistical significance of plaque size differences was determined using an unpaired Student's /-test and included 95% confidence intervals.
- PBS phosphate-buffered saline
- MA 104 cells were mock-infected or infected with 5 plaque-forming units (PFU) per cell of recombinant RV and harvested at 9 h p.i. Cells were washed with cold PBS, pelleted by centrifugation (5000 x g, 10 min), and lysed by incubation for 30 min on ice in non-denaturing lysis buffer (300 mM NaCl, 100 mM Tris-HCl, pH 7.4, 2% Triton X-100, and lx EDTA-free protease inhibitor cocktail [Roche Complete]). For immunoblot assays, lysates were resolved by electrophoresis on 10% polyacrylamide gels and transferred to nitrocellulose membranes.
- PFU plaque-forming units
- mouse monoclonal FLAG M2 F1804, Sigma, 1 :2000
- mouse monoclonal anti-6xHis antibody MCA1396GA, BioRad, 1 :1000
- mouse 2A antibody NBP2-59627, Novus, 1 :1000
- guinea pig polyclonal NSP3 Lit 55068, 1 :2000
- VP6 Lit 53963, 1 :2000 antisera or rabbit monoclonal B-actin (8457S, Cell Signaling Technology (CST), 1 : 1000) antibody.
- HRP horseradish peroxidase
- CST horseradish peroxidase
- KPL goat anti-guinea pig IgG
- CST goat anti-rabbit IgG
- Alexa fluor conjugated antibody goat anti-mouse Alexa 647 antibody (CST) in 2.5% non-fat dry milk.
- HRP signals were developed using Clarity Western ECL Substrate (Bio-Rad) and detected using a Bio-Rad ChemiDoc imaging system, whereas Alexa fluor signals were visualized directly using a Bio-Rad ChemiDoc imaging system.
- WCLs Whole-cell lysates (WCLs) were prepared from MAI monolayers either mock- infected or infected with rSAl l virus at 9 hours p.i., as described above.
- Rabbit anti-NoV GII.4 monoclonal antibody [NVB43.9] (Ab00269-23.0, Absolute antibody, final dilution of 1 : 150) or NSP2 mouse polyclonal antibody (Lot 171, final dilution of 1 :200) were added to cell lysates.
- antigen-antibody complexes were recovered using Pierce magnetic IgA/IgG beads (ThermoScientific), resolved by gel electrophoresis, and blotted onto nitrocellulose membranes. Blots were probed with anti-FLAG antibody (1 :2000) or anti-6xHis antibody (1 : 1000) to detect FLAG tagged or His-tagged VP1 proteins, and NSP2 antibody (Lot #516, 1 :2000) to detect NSP2 proteins.
- Viruses were serially passaged five times on MAI 04-cell monolayers using 1 : 1000,
- dsRNAs double stranded RNAs
- rSAl 1 variants were recovered from pools of the serially passaged virus by plaque isolation (41). The variants were amplified by a single round of passage on MA104 cells and their genomic dsRNA recovered by Trizol extraction. The full-length genome segment 7 RNAs in the samples were amplified with segment-specific primer pairs NSP3_5’UTR 5’GGCATTTAATGCTTTTCAGTG 3’ (SEQ ID NO: 1), and NSP3_3’UTR 5’ GGCCACATAACGCCCCTATAG 3’ (SEQ ID NO: 2), and a shorter fragment from the C terminus of NSP3 ORF to 3'UTR region was amplified with the primer pairs NSP3 C termF 5' CATTGCACGCTTTTGATGACTTAG 3' (SEQ ID NO: 3), and NSP3_3'UTR 5'GGCCACATAACGCCCCTATAG 3’ (SEQ ID NO: 4), similarly using Superscript III One-Step RT-PCR System with Platinum Taq DNA poly
- Amplified PCR products were resolved by electrophoresis on 0.8% agarose gels in Tris-acetate-EDTA buffer, products were gel- purified using Nucleospin gel and PCR Clean-up (Takara), and the sequences were determined by EuroFins Scientific.
- DLPs double-layered particles
- CsCl was added to samples to a density of 1.367 g/cm 3 , and samples were centrifuged at 110,000 x g in a Beckman SW55Ti rotor at 8°C for 22 h. Virus bands were detected in the gradients using an inverted light source. Fractions containing viral bands were recovered with a micropipette and their CsCl densities were determined using a refractometer.
- Segment 7 sequences in rSAl l viruses have been deposited in GenBank: wt. (LC178572), NSP3-P2A-NoVfP2 (MN190002), NSP3-P2A-NoVfP (MN190003), NSP3-P2A- NoVfVPl (MN190004), NSP3-P2A-NoV VPlf (MN201548), NSP3-P2A-NoV P-His (MN201549), NSP3-P2A-NoV VPl-ThHis (MN201547), NSP3-P2A-NoV VPl-His (MZ562305), RIX/NSP3-P2A-NoV P-His (MZ643978). See also Table 2.
- NoV sequences were inserted into the pT7/NSP3 plasmid at the same site as used for the generation of rSAl 1 strains expressing fluorescent proteins and SARS CoV-2 spike proteins.
- pT7 SA11 NSP3 vectors expressing 6xHis-tagged NoV proteins were generated by replacing the FLAG tagged NoV sequences with 6xHis tagged NoV sequences, with or without inserting Th cleavage site (FIG. 2).
- the current neonatal RV vaccine strain Rotarix genome segment 7 (RIX NSP3) was modified to express NoV PHis protein down-stream of2A peptide, pUC 19/RIXNSP3- 2A-P His was synthesized.
- Recombinant SA11 viruses expressing NoV capsid proteins were generated by transfecting BHK-T7 cells with a complete set of eleven pT7 plasmids encoding +mRNA of RV genome segments and a CMV expression vector encoding African swine fever virus capping enzyme (NP8688R), and the pT7/NSP3SAl l was replaced with a pT7/NSP3-2A-NoV vector as described before.
- the transfected BHK-T7 cells were over-seeded with MAI 04 cells 2 days posttransfection and the cell mixture was freeze-thawed three days later, and the recombinant RVs were recovered by growing them on MA104 cells.
- the rSAl l isolates were plaque purified and amplified to larger volumes before characterization. The characteristics of rSAl l viruses are summarized in Table 2.
- rSAl l viruses generated with modified pT7 NSP3-2A-NoV vectors expressing FLAG-tagged NoV proteins contained larger segment 7 dsRNAs than that of wildtype virus (rSAl 1/wt), based on RNA gel electrophoresis (FIG. 3A). Sequence analysis showed that segment 7 of the rSAl 1 viruses matched that of the pT7 NSP3-2A-NoV vectors.
- the introduction of FLAG- tagged NoV P2 and P into the genome segment 7 has increased the size to 1.7 kbp and 2.1 kbp respectively, that migrated on RNA gels between RV genome segments 4 (2.4kbp) and 5 (1.6 kbp), as expected from their sizes (Table 2, FIG.
- segment 7 of virus isolates containing 1.7 kbp NoV VP1 protein sequences had a length of 2.9 kbp, resulting in a slower migratory position near RV genome segment 1.
- the insertion of 2A-fVPl and VPl-f sequences into the segment 7 genome has increased the total genome size to 20.3 kbp, which is 9.5% more than the packaging capacity of the wt. virus.
- the longest foreign sequence introduced into segment 7 RNA of rSAl l previously was 3.3 kbp segment 7 dsRNA of rSAl l/NSP3-fSl, that expressing SARS CoV-2 SI protein.
- Plaque analysis showed that the plaques formed by rSAl 1/wt virus were larger than plaques formed by rSAl l/NSP3-2A-fP2, -fP, -fVPl, and -VPlf viruses (FIG. 3B., FIG. 3C.), consistent with the data reported in a previous study. Quantitation of the viral peak titers demonstrated that rSAl l/NSP3-2A-fP2, -fP, -fVPl, and -VPlf viruses grew to similar titers in MA104 cells, ranging from 0.5 X 10 7 to 2.6 X 10 7 (FIG. 3D).
- the exact reason for the smaller plaque phenotypes and lower titers is unknown but may be possibly due to the longer elongation time required for the viral RNA polymerase to transcribe the modified segment 7 dsRNAs during viral replication or may be the longer time required for translating the segment 7 mRNA containing foreign protein sequences. Alternatively, it may reflect the complexity associated with packaging the largely modified dsRNA containing foreign sequences and assembly of the viral particles.
- recombinant SAI 1 monoreassortant virus containing human vaccine strain Rotarix genome segment 7 (RIX 4414), modified to express NoV P protein was generated using the reverse genetics approach as described previously.
- the rSAl 1 virus containing RIX NSP3-2A-PHis was recovered by growing them on MAI 04 cells (African green monkey kidney cells), isolates were plaque purified and characterized as summarized in Table 2.
- the rSAl 1/ RIX NSP3-2A-PHis contained larger segment 7 dsRNA (2.1 kbp) than that of rSAl l/wt (1.1 kbp) due to the introduction of Ikb of 2A-NoV PHis sequence, based on RNA gel electrophoresis (FIG. 5A), and additional sequence introduction increased the total genome size to 19.6 kbp (Table 2). Plaque analysis showed that rSAl l/RIX NSP3-2A-PHis formed smaller plaques than rSAl 1/wt virus (FIG. 5B) and they grew to a peak titer 1 log lower than rSAl 1/ wt. (Fig. 5C).
- VP1 viruses folded into native structures lysates prepared from MAI 04 cells infected with rSAl l/NSP3-2A-fVPl and -VPlf, -VPIHis viruses were probed by pulldown assay using an anti- NoV VP1 conformation-dependent neutralizing monoclonal antibody (NVB43.9, Absolute antibody). As shown in FIG.
- anti-NoV GII.4 NVB43.9 antibody immunoprecipitated both FLAG and His tagged NoV VP 1 proteins (fVPl and VPIHis), indicating that at least some of the VP1 proteins expressed from rSAl l viruses folded in the correct conformation to include an authentic neutralizing epitope found in the NoV VP1 protein, which is capable of inducing a protective immunological response.
- fVPl and VPIHis anti-NoV GII.4 antibody
- rSAl 1 viruses expressing both FLAG and His tagged proteins were subjected to 5 rounds of serial passage at three dilutions (1 : 10, 1 : 100 or 1 :1000).
- New genome segments were appearing by the third round of passage, that were smaller than original modified g7 segments, NSP3-2A-fVPl and -VP1 His of 2.9 kbp size.
- a variant segment of size 1.2 kbp migrating below genome segment 6 became prominent, and 2.9 kbp segment 7 was not detectable by P5 generation, suggesting that high passage virus pools were dominated by variants derived from 2.9 kbp segment 7 RNA through sequence deletion.
- 5 variants were recovered from P5 virus pools by plaque isolation, four with a large (L) plaque phenotype and one with a small (S) plaque phenotype.
- RNA gel electrophoresis on dsRNAs isolated from rSAl l/NSP3-2A-VPlHis P5 pool showed that both the large (LI, L3-5) and small (SI) plaque lysates contained only a single type of small variant segment, -VP1 His/R (FIG. 8E).
- variant segments [00146] Sequence analysis of variant segments revealed that -fVPl/Rl and -fVPl/R2 were originated from 2.9 kbp segment 7 RNA, NSP3-2A-fVPl, and -VP1 His/R was resulting from large NSP3-2A-VP1 His segment (FIG. 8F).
- the -fVPl/Rl (1550 bp) and -fVPl/R2 (1,263 bp) variant segments retained the complete 5’-UTR and NSP3 ORF of segment 7, but contained sequence deletions of 1.6 kbp of NoV VP1 coding sequences and initial 7 bp in the 3’-UTR.
- rSAl l/NSP3-2A-fVPl and -VPIHis viruses were amplified to larger volumes at a low MOI (multiplicity of infection).
- MOI multiplicity of infection.
- Gel electrophoretic analysis of extracted dsRNAs identified diverse variant pools (denoted as V) that contained different types of re-arranged genome segment 7, of varying sizes for rSAl l/NSP3-2A-fVPl virus (fVPl/ V1-V4) and rSAl l/NSP3-2A-VPl His virus (VP1 His/V5-V7) (FIG. 9A, red and blue arrows).
- the Rl, R2, and R3 RNAs generated from fVPl/ VI pool retained the 5'-UTRs and NSP3 ORF, but contained sequence deletions of 1.3 (Rl), 1.6 (R2 and R3) kbp of the VP1 coding sequence, and either a 7 bp deletion or a 9 bp duplication in the 3'-UTRs (FIG. 91).
- the R2 isolate from fVPl/Vl pool showed a 154 bp duplication, identical to the last few amino acids present in NSP3 ORF and few residues of 2 A element, inserted in the middle of 2A peptide (Fig. 9C, FIG. 91 and Table 3).
- Plaque isolates from variant 2 pool showed only one kind of re-arranged genome segment 7 (fVPl/V3/R) (FIG. 9D).
- the fVPl/V3/R segment contained the complete 5'- and 3'- UTRs and NSP3 ORF of segment 7 and lacked the entire 3x FLAG sequence. A portion of the 2A sequence was also missing along with all but the last 40 bases of the VP1 sequence (FIG. 91).
- RNA gel electrophoresis of dsRNAs of plaques isolated from IVP1/V4 pool and VP1 His/V5 pool identified various R segments, one of them (VP1 His/V5/R3) had a smaller genome segment 7 (1038 bp) than rSAl 1/wt (1104 bp) (FIG. 9F, lane 2).
- the smaller size of VP1 His/V5/R3 stemmed from a larger deletion of 1.8 kbp of inserted foreign sequences including 23 bp of NSP3 ORF and 41 bp of 3’-UTR regions (FIG. 91 and Table 3).
- VP1 His/V6/R isolate contained a smaller genome segment 7 (1087 bp) (FIG.
- RNA gel electrophoresis showed that rSAl l/NSP3-2A modified viruses are packaged efficiently and contain a complete constellation of all eleven (11) genome segments (FIGS. 3A, 4A, and 5A); and packaging of additional sequences within the core should change the density of viral particles.
- rSAl l/wt (genome size: 18.6 kbp), rSAl l/NSP3-2A-fP2 (19.1 kbp), rSAl l/NSP3-2A-fP (19.6 kbp), rSAl l/NSP3-2A-fVPl (20.3 kbp), rSAl l/NSP3-2A-PHis (19.6 kbp) and rSAl l/NSP3-2A-VPl His (20.2 kbp) were amplified on MA104 cell monolayers.
- the double-layered particles (DLPs) were prepared from the infected-cell lysates by converting RV triple-layered particles after treating with EDTA.
- the DLPs were centrifuged to equilibrium on CsCl gradients and the density of the DLP bands was determined by refractometry (FIG. 10A, FIG. 10B).
- banded DLPs from rSAl l/NSP3-2A-fVPl showed two bands in CsCl, which is probably due to the fact that the banded DLPs contained diverse virus isolates including some variants (FIG. 10A).
- RV has an extremely high level of antigen expression while using as a vaccine, enabling the generation of a strong immune response, therefore it can act as an adjuvant, increasing the immune response to NoV antigens.
- RV genome can accommodate up to 1.3 kbp of additional sequences without genetic instability, allowing the accommodation of multiple foreign genes, developing as a multivalent vaccine vector.
- VP1 proteins expressed from the modified genome segment 7 forms dimers and are capable of folding in the correct conformation.
- NSP3 protein of recombinant RVs expressing NoV proteins is functional, retaining the ability to form dimers, and is able to express the complete complement of all viral proteins.
- RVs carrying large heterologous sequences e.g., 1.8 kbp NoV VP1 have smaller plaque phenotypes and are genetically unstable resulting in the development of new variants over subsequent amplification.
- the exact reason for the smaller plaque phenotype and genetic instability is unknown, but under investigation (data not shown).
- a proposed hypothesis on sequence rearrangement suggested that the viral RNA polymerase could have interrupted the RNA synthesis, either during transcription or replication, fall back on its-own template to re-initiate RNA synthesis (57, 58).
- RVs carrying up to 1.3 kbp are found genetically stable over 5 rounds of serial passage (43) and, thus, can be developed into vaccine platforms.
- the coding capacity provided by 1.3 kbp of the foreign sequence is sufficient to make RVs expressing NoV P proteins (1.1 kbp) along with some further modification such as fusion of a secretory signal or Fc binding protein.
- This kind of protein modifications such as Fc-immunoglobulin G1 (Fc-IgGl), or ligands for cell surface receptors can specifically target the expressed protein to a specific cell type (antigen-presenting cells or T cells).
- Further modification of the NoV P protein with carrier moieties such as a cell-penetrating peptide or a secretion peptide (e.g., Interleukin-2 secretion peptide), can achieve efficient transport of the expressed protein across the cell membranes.
- Example 2- Recombinant rotaviruses (RVs) expressing functional glycoproteins
- a similar segment 7 modification was used to make a recombinant virus (rSAl l/NSP3-2A-fSl) containing the complete coding sequence of the SARS-CoV-2 SI protein, a cleavage fragment of the S protein that includes both the NTD and RBD and is a primary target of neutralizing antibodies produced during SARS-CoV-2 infection (Brouwer et al., 2020, Liu et al., 2020, Rogers et al., 2020, Zost et al., 2020, Xin et al, 2021).
- the open reading frame (ORF) in the modified segment 7 RNA of the rSAl l/NSP3-2A-fSl virus included the coding cassette NSP3-2A-3xFLAG-Sl.
- NSP3-2A 2 A peptide
- fSl 3xFLAG-tagged SI
- NSP3-2A-3xFLAG-Sl cassette a 3xFLAG tag was positioned immediately upstream of the SI signal peptide, an element critical for synthesis of glycosylated S products (Casalino et al., 2020).
- Embryonic monkey kidney cells (MAI 04) were grown in Dulbecco's modified Eagle's medium (DMEM) containing 4.5 g/L glucose (Lonza 12-640F or Coming 15-107-CV), 1% penicillin-streptomycin [Corning]), and 5% fetal bovine serum (FBS, Gibco) (Arnold et al, 2009).
- Baby hamster kidney cells constitutively expressing T7 RNA polymerase (BHK-T7 cells) were kindly provided by Drs. Ulla Buchholz and Peter Collins, Laboratory of Infectious Diseases, NIAID, NIH.
- BHK-T7 cells were grown in Glasgow complete medium (GMEM, Lonza) supplemented with 10% tryptone-peptide broth (Gibco), 1% penicillin-streptomycin, 2% non- essential amino acids (Gibco), 1% glutamine, and 5% heat-inactivated FBS (Philip et al., 2020).
- GMEM Glasgow complete medium
- Gibco tryptone-peptide broth
- Gibco penicillin-streptomycin
- Gibco non- essential amino acids
- glutamine 1% glutamine
- Plasmids used in generating rSAl l viruses were obtained from Addgene [https://www.addgene.org/Takeshi_Kobayashi/] and included pT7/VPlSAl l, pT7/VP2SAl l, pT7/VP3SAl l, pT7/VP4SAl l, pT7/VP6SAl l, pT7/VP7SAl l, pT7/NSPlSAl 1, pT7/NSP2SAl l, pT7/NSP3SAl l, pT7/NSP4SAl 1, and pT7/NSP5SAl 1.
- the plasmids pCMV- NP868R, pT7/NSP3-P2A-fUnaG, and pTWIST/COVID19spike were derived as described earlier (Philip et al, 2019; Philip and Patton, 2020, 2021).
- the plasmid pT7/NSP3-2A-3fSl was generated as described by Philip and Patton (2021) and contains a full-length cDNA of the SARS-CoV-2 spike SI open reading frame (ORF) (GenBank MN908947.3).
- the plasmids pT7/NSP3-2A-SlF and pT7/NSP3-2A-3fSl-His are the same as pT7/NSP3-2A-3fSl, containing the same SI ORFs, but differ in sequences for peptide tags surrounding their SI ORFs.
- the pT7/NSP3-2A-Slf plasmid was constructed using a Takara In-Fusion cloning kit, which combined the vector backbone (pT7/NSP3-P2A region) of pT7/NSP3-P2A-fUnaG (primer pair for amplification: SEQ ID NO: 72 TGACCATTTTGATACATGTTGAACAATCAAATACAG and SEQ ID NO: 73, AGGACCGGGGTTTTCTTCCAC) with the SI ORF insert of pTWIST/COVID19spike (primer pair: SEQ ID NO: 74.
- the pT7/NSP3-2A-3fSl-His plasmid was produced by inserting a sequence encoding a 6xHis tag at the 3'-end of the SI ORF in pT7/NSP3-2A-3fS using an In-Fusion cloning kit. This was accomplished by amplifying pT7/NSP3-2A-3fS with the primer pair: SEQ ID NO: 76.
- the pT7/NSP3SAl 1 plasmid was replaced with pT7/NSP3-2A-3fS, pT7/NSP3-2A-SlF or pT7/NSP3-2A-3fSl-His.
- the transfected cells BHK-T7 cells were overseeded with MAI 04 cells at 2 days post infection, and the growth medium was adjusted to a final concentration of 0.5 mg/ml trypsin (porcine Type IX pancreatic trypsin, Sigma Aldrich). Once complete cytopathic effects (CPE) was observed, cells in the media overlay were subject to three rounds of free thaw and the lysate clarified by low speed centrifugation.
- CPE cytopathic effects
- Virus in lysates were recovered by plaque isolation and amplified by one round of growth on MAI 04 cells (Philip et al., 2020).
- Viral dsRNAs were recovered by Trizol (Thermo Fisher) extraction (Philip et al, 2020), resolved by polyacrylamide gel electrophoresis, and detected by straining with ethidium bromide.
- cDNAs were generated from dsRNAs using a Superscript III One-Step RT-PCR Platinum Taq kit (Thermo Fisher) and appropriate segment 7 (NSP3) primers and sequenced by Eurofins Genomics.
- Proteins were resolved by electrophoresis on 10% polyacrylamide (SDS) gels and transferred to nitrocellulose membranes using a Bio-Rad Trans-Blot Turbo Transfer System. Membranes were blocked with phosphate- buffered saline containing 5% non-fat dry milk and probed with rabbit polyclonal SARS-CoV-2 SI antibody (A20136, ABclonal, 1 : 1000 dilution), guinea pig polyclonal NSP3 (NIH Lot 55068, 1 :2000 dilution) or VP6 (NIH Lot 53963, 1 :2000) antisera, mouse monoclonal FLAG M2 (Fl 804, Sigma-Aldrich, 1 :2000) or anti-6xHis antibody (MCA1396, Bio-Rad, 1 : 1000), or rabbit monoclonal b-actin antibody (D6A8, Cell Signaling Technology, 1 : 1000).
- SARS-CoV-2 SI antibody A20136, ABclonal, 1
- blots were re-probed with a different antibody following treatment with WestemSure ECL stripping buffer (LLCOR Biosciences).
- Primary antibodies were detected using 1 : 10,000 dilutions of horseradish peroxidase (HRP)-conjugated secondary antibodies: horse anti-mouse IgG (Cell Signal Technology), goat anti-guinea pig IgG [Kirkegaard & Perry Laboratories (KPL)], or goat anti-rabbit IgG (Cell Signaling Technology).
- HRP horseradish peroxidase
- S1-ACE2 interaction assay [00170] A Takara Capturem IP and Co-IP kit (Cat No: 635721) was used to assess the affinity of SARS-CoV-2 SI expressed by rSAl l viruses for ACE2. Protein A spin columns and all necessary buffers were included in the Capturem kit. MAI 04 cell monolayers were mock- infected or infected with rSAl 1 viruses (5 PFU/cell). At 9 h.p.i., the cells were washed and scraped into PBS, pelleted by low-speed centrifugation, and resuspended in Lysis/Equilibration Buffer containing protease inhibitor cocktail.
- lysate was clarified by centrifugation at 17,000 g for 10 min.
- Soluble hACE2-Fc fchace2, InvivoGen
- a recombinant protein consisting of the extracellular domain of human ACE2 fused to a human IgGl Fc region
- lysate samples were loaded onto pre-equilibrated protein A spin columns, which were then centrifuged at 1000 g for 1 min at room temperature.
- proteins were eluted from columns by adding Elution Buffer and centrifugation at lOOOXg for 1 min at room temperature. The eluted samples were immediately neutralized by adding Neutralization Buffer. Proteins in eluted samples were detected by immunoblot assay, as described above.
- RVs The genetic stability of recombinant RVs was assessed by serial passage on MA104-cell monolayers using 1 :10 dilutions of infected cell lysates prepared in serum-free DMEM and 0.5 pg/ml trypsin (Philip and Patton, 2021). Viral dsRNA was recovered by Trizol extraction from clarified cell lysates treated with RNase T1 to remove single-stranded RNA (Philip et al., 2019). Viral dsRNA was analyzed by electrophoresis on 8% polyacrylamide gels and detected by straining with ethidium bromide.
- accession numbers include the SARS-CoV-2 S sequence in pTWIST/COVID19spike (GenBank MN908947), sequence for the African swine fever virus capping enzyme in pCMV-NP868R, and modified segment 7 RNA of rSAl l-NSP3-P2A-3fUnaG (MK851042).
- rSAl l virus (rSAl l/NSP3-2A-fSl) was generated with a modified segment 7 RNA that encoded the SARS-CoV-2 SI protein with a fused N-terminal 3xFLAG tag (3xFLAG-Sl).
- rSAl l/NSP3-2A-fSl a modified segment 7 RNA that encoded the SARS-CoV-2 SI protein with a fused N-terminal 3xFLAG tag (3xFLAG-Sl).
- 3xFLAG-Sl 3xFLAG-Sl
- rSAl l/NSP3-2A-fSl- His was identical to rSAl l/NSP3-2A-fSl, with the exception that the ORF in its segment 7 RNA was engineered to place a 6xHis tag at the end of the SI product, and thus encode 3xFLAG-Sl- 6xHis.
- the rSAl l/NSP3-2A-fSl-His virus was generated to address the possibility that, due to cleavage of the signal peptide from the SI product, the N-terminal 3xFLAG tag was lost, preventing accurate assessment of fSl synthesis by the rSAl l/NSP3-2A-fSl virus via immunoblot assay with anti -FLAG antibody.
- the production of SI products could be assessed with anti-6xHis antibody.
- SI -IxFLAG N-terminal tag
- T7 transcription vectors for NSP2 and NSP5 +RNAs were used as levels 3-fold greater that the other pT7 vectors.
- the modified segment 7 transcription vectors (FIG. 11) used in generating rSAl l encoding SI products was added to transfection mixtures in place of pT7/NSP3SAl l.
- Recombinant viruses formed in transfected BHK-T7 cells were amplified by overseeding with MA104 cells and then isolated by plaque purification.
- rSAl Is Genomes and growth characteristics of rSAl Is.
- the dsRNA genome segments of recombinant viruses were resolved by gel electrophoresis to verify the presence of modified segment 7 RNAs (FIG. 12). The analysis showed that rSAl l/NSP3-2A-fSl, rSAl l/NSP3-2A-Slf and rSAl l/NSP3-2A-fSl-His all lacked the 1.1-Kbp segment 7 dsRNA typical of rSAl l/wt.
- the Sl-encoding rSAl l viruses all contained segment 7 dsRNAs that migrated on polyacrylamide gels close to the position of the segment 1 dsRNA and had a size of 3.3 Kbp. Sequencing verified that the segment 7 RNA of the recombinant viruses was identical to that of the pT7 transcription vector used in their recovery.
- the total size of genome segments in each rSAl l/NSP3-2A-fSl, rSAl l/NSP3-2A-Slf and rSAl l/NSP3-2A-fSl-His is 20.7-20.8 Kbp, which is the 2.1-2.2 Kbp (or -11%) greater than wildtype virus.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Virology (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Veterinary Medicine (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Gastroenterology & Hepatology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2024523176A JP2024540894A (ja) | 2021-10-18 | 2022-10-18 | 外因性タンパク質を発現する組換えロタウイルス及びその使用 |
| CA3235965A CA3235965A1 (en) | 2021-10-18 | 2022-10-18 | Recombinant rotavirus expressing exogenous protein and uses thereof |
| US18/702,470 US20250263443A1 (en) | 2021-10-18 | 2022-10-18 | Recombinant rotavirus expressing exogenous protein and uses thereof |
| KR1020247016366A KR20240099298A (ko) | 2021-10-18 | 2022-10-18 | 외인성 단백질을 발현하는 재조합 로타바이러스 및 그의 용도 |
| AU2022368902A AU2022368902A1 (en) | 2021-10-18 | 2022-10-18 | Recombinant rotavirus expressing exogenous protein and uses thereof |
| EP22884645.7A EP4419134A4 (en) | 2021-10-18 | 2022-10-18 | Recombinant rotavirus expressing an exogenous protein and its uses |
| CN202280083612.4A CN118555965A (zh) | 2021-10-18 | 2022-10-18 | 表达外源蛋白的重组轮状病毒及其用途 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US202163256960P | 2021-10-18 | 2021-10-18 | |
| US202163256875P | 2021-10-18 | 2021-10-18 | |
| US63/256,960 | 2021-10-18 | ||
| US63/256,875 | 2021-10-18 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023069950A1 true WO2023069950A1 (en) | 2023-04-27 |
Family
ID=86058612
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2022/078305 Ceased WO2023069950A1 (en) | 2021-10-18 | 2022-10-18 | Recombinant rotavirus expressing exogenous protein and uses thereof |
Country Status (7)
| Country | Link |
|---|---|
| US (1) | US20250263443A1 (enExample) |
| EP (1) | EP4419134A4 (enExample) |
| JP (1) | JP2024540894A (enExample) |
| KR (1) | KR20240099298A (enExample) |
| AU (1) | AU2022368902A1 (enExample) |
| CA (1) | CA3235965A1 (enExample) |
| WO (1) | WO2023069950A1 (enExample) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12173032B2 (en) | 2018-07-13 | 2024-12-24 | The Trustees Of Indiana University | Recombinant rotavirus expression system and recombinant rotaviruses |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5952474A (en) * | 1992-08-28 | 1999-09-14 | The Public Health Research Institute Of The City Of New York, Inc. | Fusion glycoproteins |
| WO2008009727A1 (en) * | 2006-07-21 | 2008-01-24 | Centre National De La Recherche Scientifique (Cnrs) | Positive cytomodulines to improve bioreactor productivity. |
| WO2010042490A1 (en) * | 2008-10-06 | 2010-04-15 | Boston Medical Center Corporation | A single lentiviral vector system for induced pluripotent (ips) stem cells derivation |
| US20210269488A1 (en) * | 2018-07-13 | 2021-09-02 | The Trustees Of Indiana University | Recombinant rotavirus expression system and recombinant rotaviruses |
-
2022
- 2022-10-18 CA CA3235965A patent/CA3235965A1/en active Pending
- 2022-10-18 KR KR1020247016366A patent/KR20240099298A/ko active Pending
- 2022-10-18 EP EP22884645.7A patent/EP4419134A4/en active Pending
- 2022-10-18 JP JP2024523176A patent/JP2024540894A/ja active Pending
- 2022-10-18 AU AU2022368902A patent/AU2022368902A1/en active Pending
- 2022-10-18 WO PCT/US2022/078305 patent/WO2023069950A1/en not_active Ceased
- 2022-10-18 US US18/702,470 patent/US20250263443A1/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5952474A (en) * | 1992-08-28 | 1999-09-14 | The Public Health Research Institute Of The City Of New York, Inc. | Fusion glycoproteins |
| WO2008009727A1 (en) * | 2006-07-21 | 2008-01-24 | Centre National De La Recherche Scientifique (Cnrs) | Positive cytomodulines to improve bioreactor productivity. |
| WO2010042490A1 (en) * | 2008-10-06 | 2010-04-15 | Boston Medical Center Corporation | A single lentiviral vector system for induced pluripotent (ips) stem cells derivation |
| US20210269488A1 (en) * | 2018-07-13 | 2021-09-02 | The Trustees Of Indiana University | Recombinant rotavirus expression system and recombinant rotaviruses |
Non-Patent Citations (1)
| Title |
|---|
| See also references of EP4419134A4 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12173032B2 (en) | 2018-07-13 | 2024-12-24 | The Trustees Of Indiana University | Recombinant rotavirus expression system and recombinant rotaviruses |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4419134A4 (en) | 2026-02-11 |
| AU2022368902A1 (en) | 2024-05-16 |
| CA3235965A1 (en) | 2023-04-27 |
| EP4419134A1 (en) | 2024-08-28 |
| KR20240099298A (ko) | 2024-06-28 |
| US20250263443A1 (en) | 2025-08-21 |
| JP2024540894A (ja) | 2024-11-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20250171502A1 (en) | Recombinant rota virus expression system and recombinant rota viruses | |
| WO2021216575A1 (en) | Recombinant rotavirus expression system and recombinant rotaviruses | |
| US11065328B2 (en) | Vaccine against infectious bronchitis virus | |
| US11253587B2 (en) | Vaccine compositions for the treatment of coronavirus | |
| CN108431214B (zh) | 人轮状病毒g9p[6]毒株和作为疫苗的用途 | |
| CN109825517B (zh) | 呼肠弧病毒家族病毒的疫苗病毒株的制造方法 | |
| Philip et al. | Generation of recombinant rotaviruses expressing human norovirus capsid proteins | |
| JP2021152024A (ja) | 多価エンテロウイルス(Enterovirus)ワクチン組成物およびそれに関連する使用 | |
| US20210401983A1 (en) | Arthrogenic alphavirus vaccine | |
| US20230272405A1 (en) | Flavivirus signal peptides, vaccine constructs, and methods therefor | |
| Heng et al. | A novel replication-deficient FCV vaccine provides strong immune protection in cats | |
| US20250263443A1 (en) | Recombinant rotavirus expressing exogenous protein and uses thereof | |
| Kotaki et al. | Generation of single-round infectious rotavirus with a mutation in the intermediate capsid protein VP6 | |
| WO2025137311A1 (en) | Recombinant porcine rotaviruses and methods and systems for producing and using the same | |
| WO2006024542A1 (en) | Nucleic acid sequences encoding proteins capable of associating into a virus-like particle | |
| Kanai et al. | Rapid production of recombinant rotaviruses by overexpression of NSP2 and NSP5 genes with modified nucleotide sequences | |
| CN118555965A (zh) | 表达外源蛋白的重组轮状病毒及其用途 | |
| CN119998309A (zh) | 重组轮状病毒及其生产方法和系统 | |
| Philip et al. | Expression of Separate Foreign Proteins from the Rotavirus NSP3 Genome Segment Using a Translational 2A Stop-Restart Element | |
| CN116457011A (zh) | 用于治疗冠状病毒的疫苗组合物 | |
| Bohmer | Engineering of a chimeric SAT2 foot-and-mouth disease virus for vaccine production | |
| Mitzel | The role of NSP1 in the regulation of rotavirus gene expression | |
| CN100384990C (zh) | 传染性法氏囊病病毒无毒力毒株构建方法 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22884645 Country of ref document: EP Kind code of ref document: A1 |
|
| ENP | Entry into the national phase |
Ref document number: 2024523176 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 3235965 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: AU2022368902 Country of ref document: AU |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112024007611 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 2022368902 Country of ref document: AU Date of ref document: 20221018 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202417038869 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022884645 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11202402678W Country of ref document: SG |
|
| ENP | Entry into the national phase |
Ref document number: 2022884645 Country of ref document: EP Effective date: 20240521 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202280083612.4 Country of ref document: CN |
|
| ENP | Entry into the national phase |
Ref document number: 112024007611 Country of ref document: BR Kind code of ref document: A2 Effective date: 20240418 |
|
| WWP | Wipo information: published in national office |
Ref document number: 18702470 Country of ref document: US |