WO2023069480A1

WO2023069480A1 - Hypoimmune vasculogenic cells

Info

Publication number: WO2023069480A1
Application number: PCT/US2022/047081
Authority: WO
Inventors: James Farmer; Mervin C. Yoder; Carter CLIFF; Matt GEORGE
Original assignee: Vascugen, Inc.
Priority date: 2021-10-20
Filing date: 2022-10-19
Publication date: 2023-04-27

Abstract

This present invention is directed in part to hypoimmune KDR+NMAR+APLNR+ (KNA+) vasculogenic mesodermal cells, methods for producing and using these cells to treat vascular diseases and/or diseases related to endothelial dysfunction.

Description

HYPOIMMUNE VASCULOGENIC CELLS

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001 ] This application claims priority under 35 U.S.C. § 119 to U.S. provisional application 63/257713 filed October 20, 2021, the entire contents of which are incorporated herein by reference.

REFERENCE TO SEQUENCE LISTING

[0002] This application includes one or more Sequence Listings pursuant to 37 C.F.R. 1.821 et seq., which are disclosed herein.

FIELD OF INVENTION

10003] This present invention is directed in part to hypoimmune KDR+NMAR+APLNR+ (KNA+) vasculogenic mesodermal cells, methods for producing and using these cells to treat vascular diseases and/or diseases related to endothelial dysfunction.

BACKGROUND

[0004] Vascular disease is a disease of the blood vessels that often involves endothelial cell dysfunction that can lead to a reduction or restriction of blood flow to a tissue, organ or extremity. This condition can lead to severe health problems or even death. Common vascular diseases include peripheral arterial disease (PAD), critical limb-threatening ischemia (CLTI), pulmonary arterial hypertension, ischemic heart disease, retinopathies and acute kidney injury. PAD alone affects approximately 6.5 million people in the United States. Over the last few years there has been encouraging results in the use of stem cell-derived therapies to treat vascular diseases. However, the human leukocyte antigens (HLA) encoded by the major histocompatibility complex (MHC) represent a barrier in the widespread use of allogeneic cells as patient therapies. It is often challenging to find a stem cell donor that matches a patient’s specific HLA phenotype thus necessitating the transplantation of HLA- mismatched cells into patients treated with immunosuppressive agents. However, the prolonged use of these suppressive agents can have dangerous side effects. There is an unmet need for the generation of hypoimmune or hypoimmune cells that can be used to treat vascular disease in patients with different HLA phenotypes.

SUMMARY OF THE INVENTION

|0005| The present disclosure describes hypoimmune KDR+NMAR+APLNR+ (KNA+) vasculogenic mesodermal cells, methods for producing and using these cells to treat vascular diseases and/or diseases related to endothelial dysfunction. As used herein, “hypoimmune” cells are cells wherein beta-2 microglobulin (B2M) and/or HLA expression has been altered to enable the cells to at least partly evade the host’s immune response after allogeneic transplantation. The hypoimmune mesodermal cells can be derived from pluripotent stem cells (PSCs), including induced pluripotent stem cells (iPSCs). In some instances, the KNA+ mesodermal cells are referred to as KNA+ mesodermal cells, mesodermal cells or KNA+ cells. Mesodermal KNA+ cells can differentiate into cells of the endothelial lineage, including vasculogenic cells. As used herein, “vasculogenic cells” are any cells capable of repairing or forming blood vessels when introduced into a patient in need of thereof (e.g., suffering from an ischemic disorder such as peripheral arterial disease). Vasculogenic cells include endothelial colony-forming cells (ECFCs).

[0006] In an aspect, provided herein is a population of cells comprising KDR+NCAM+APLNR+ (KNA+) mesodermal cells generated from human pluripotent stem cells (PSCs) cultured in vitro in a medium comprising Activin A. The beta-2 microglobulin (B2M) expression has been altered, thereby reducing the surface expression of MHC Class I molecules in the cells.

[0007] In some embodiments, the cells are vasculogenic.

[0008] In some embodiments, the pluripotent stem cells are induced pluripotent stem cells (iPSCs).

[0009] In some embodiments, the B2M expression has been reduced compared to wild-type expression. [0010] In some embodiments, B2M expression is reduced using genetic modification utilizing zinc-finger nucleases (ZFN), transcription activator-like effector nuclease (TALEN), a CRISPR/Cas system or homologous recombination techniques.

[0011] In some embodiments, the B2M expression has been altered with the use of a regulator.

|0012| The cells of claim 6, wherein the regulator is a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a single-stranded RNA (ssRNA), a double-stranded RNA (dsDNA), an mRNA, a micro-RNA (miRNA), a miRNA mimic, an antisense RNA, a ribozyme, an antisense oligonucleotide, a bifunctional antisense oligonucleotide, a short hairpin RNA (shRNA), an antagomir, an aptamer, a small interfering RNA (siRNA), a dsDNA, a DNAzyme, a ssDNA, polypeptide or active fragment thereof, an antibody, an intrabody, a transbody, a protein, an enzyme, a peptidomimetic, a peptoid, a transcriptional factor, or a small organic molecule, and the like.

[0013] In some embodiments, the regulator is introduced by nucleofection or lipofection.

[0014] In some embodiments, the vasculogenic KNA+ mesodermal cells are produced by a method comprising; culturing the pluripotent stem cells for about 24 hours in a mesoderm differentiation medium comprising Activin A, Bone Morphogenic Protein 4 (BMP4), Vascular endothelial growth factor (VEGF), and Fibroblast Growth Factor 2 (FGF2); and culturing on a mesoderm differentiation medium comprising BMP -4, VEGF and FGF-2 about every 24-48 hours thereafter for about 72 hours.

10015] In some embodiments, the method further comprises the isolation of KNA+ mesodermal cells from a heterogenous population based on the expression of KDR, NCAM, APLNR or any combination thereof.

[0016] In some embodiments, the isolation of KNA+ mesodermal cells is carried out via fluorescent- or magnetic-activated cell sorting. [0017] In some embodiments, the vasculogenic KNA+ mesodermal cells are produced by a method comprising contacting the cells undergoing mesodermal induction with one or more miRNA inhibitor, wherein the one or more miRNA inhibitor inhibits an miRNA that exhibits decreased expression in KDR+NCAM+APLNR+ mesoderm cells relative to PSCs.

[0018 J In some embodiments, the miRNA inhibitor inhibits an miRNA selected from the group consisting of: miR-221-3p, miR-1271-5p, miR-559, miR543, miR-361-3p, miR- 30d-5p, miR-124-3p and miR-185-5p.

[0019] In some embodiments, the cells undergoing mesodermal induction are contacting with one or more of an miRNA inhibitor of miR-221-3p, miR-1271-5p and miR- 559, preferably miR-221-3p.

[0020] In some embodiments, the vasculogenic KNA+ mesodermal cells are produced by a method comprising contacting the cells undergoing mesodermal induction with one or more miRNA mimic, wherein the one or more miRNA mimic mimics an miRNA that exhibits increased expression KDR+NCAM+APLNR+ mesoderm cells relative to PSCs.

[0021] In some embodiments, the miRNA mimic mimics an miRNA selected from the group consisting of: miR-330-5p, miR-145-5p, miR-214-3p and miR-497-5p.

[0022] In some embodiments, the cells undergoing mesodermal induction are cultured with one or more of an miRNA mimic of miR-330-5p, miR-145-5p and miT-214-3p, preferably miR-330-5p.

[0023] In some embodiments, the mesodermal induction further comprises contacting the cells undergoing mesodermal induction with a miR-214 mimic.

[0024] In some embodiments, the KNA+ cells can differentiate into vasculogenic endothelial progenitor cells.

[0025] In some embodiments, the vasculogenic endothelial progenitor cells comprise endothelial colony forming cells (ECFCs). [0026] In some embodiments, the ECFCs are produced by a method comprising culturing a pluripotent stem cell in a first medium without BMP on a first matrix comprising laminin 411 and laminin 511 to produce an intermediate cell.

[0027] In some embodiments, the method further comprises culturing the intermediate cell in a second medium on a matrix comprising laminin 411 and laminin 511 to produce a mesodermal cell.

[0028] In some embodiments, the method further comprises culturing the mesodermal cell in a third medium on a second matrix comprising laminin 411 to produce an ECFC.

[0029] In some embodiments, the first matrix comprises about 75% laminin 411 and about 25% laminin 511.

[0030] In some embodiments, the second matrix comprises laminin 411.

[0031] In some embodiments, the first medium is a conditioned medium without

BMP.

[0032] The method of the previous claims, wherein the second and third media comprises BMP4, VEGF, and FGF2.

[0033] In some embodiments, the ECFCs are produced by a method comprising contacting the iPSC or a progeny thereof with a forward programming factor.

[0034] In some embodiments, the forward programming factor is ETV2.

[0035] In some embodiments, the ETV2 is isoform 2 or a variant thereof.

[0036] In some embodiments, the forward programming factor is selected from the group consisting of miR-200b, miR-93, miRNA-330-5p, miRNA-145-5p, miRNA-214-3p, miRNA-221-3p, miRNA-1271-5p, miRNA-559, and combinations thereof.

[0037] The method of Claim 28, wherein the forward programming factor is a mimic of a native miRNA. [0038] In some embodiments, the miRNA mimic is miRNA-93, miRNA-330-5p, miRNA-145-5p, or miRNA-214-3p.

[0039] In some embodiments, the forward programming factor is a miRNA inhibitor.

[0040] In some embodiments, the miRNA inhibitor is miRNA-221-3p, miRNA-1271-

5p, miRNA-559, or miRNA-200b.

[0041] A composition used for the treatment of a disease or disorder comprising a therapeutically effective number of the KNA+ mesodermal cells, wherein the beta-2 microglobulin (B2M) expression has been altered, thereby reducing the surface expression of MHC Class I molecules in the cells.

[0042] In some embodiments, the composition further comprises an agent wherein the agent enhances proliferation and/or survival of the KNA+ mesodermal cells.

[0043] In some embodiments, the composition further comprises an agent wherein the agent promotes migration of the KNA+ mesodermal cells towards areas of injury and/or cellular dysfunction.

[0044] In some embodiments, the composition further comprises an agent wherein the agent promotes engraftment of the KNA+ mesodermal cells in areas of injury and/or cellular dysfunction.

[0045] In another aspect, provided herein is a kit comprising the cryopreserved, KNA+ mesodermal cells, wherein the beta-2 microglobulin (B2M) expression has been altered, thereby reducing the surface expression of MHC Class I molecules in the cells.

[0046] In another aspect, provided herein is a method of treating a disease or disorder characterized by cellular dysfunction comprising administering to a subject in need thereof a population of vasculogenic KDR+NCAM+APLNR+ (KNA+) mesodermal cells, wherein the beta-2 microglobulin (B2M) expression has been altered, thereby reducing the surface expression of MHC Class I molecules in the cells. [0047] In some embodiments, the cellular dysfunction comprises endothelial cell dysfunction.

[0048] In some embodiments, the method comprises administering the cells directly to the subject's organ, tissue or extremity in vivo.

10049] In some embodiments, the method comprises promoting neovascularization in the subject's organ, tissue or extremity.

[0050] In some embodiments, the disease or disorder is a vascular and/or cardiac disease such as critical limb ischemia, diabetic retinopathy, arterial hypertension, pulmonary hypertension, traumatic vascular injuries, transplant vasculopathies, microvascular injuries, myocardial remodeling and vascular remodeling, ischemia-reperfusion injuries and/or vasospastic diseases.

[0051] In some embodiments, provided herein is a method of preparing hypoimmunie KDR+NCAM+APLNR+ (KNA+) mesodermal cells comprising culturing human pluripotent stem cells (PSCs) in vitro in a medium comprising Activin A, and altering the expression of beta-2 microglobulin (B2M) in the PSCs, thereby reducing the surface expression of MHC Class I molecules in the KNA+ mesodermal cells generated from the PSCs to prepare hypoimmune KNA+ mesodermal cells. In some embodiments, the method of preparing hypoimmune KNA+ mesodermal cells further comprises comprising culturing the pluripotent stem cells for about 24 hours in a mesoderm differentiation medium comprising Activin A, BMP -4, VEGF and FGF-2; and culturing on a mesoderm differentiation medium comprising BMP -4, VEGF and FGF-2 about every 24-48 hours thereafter for about 72 hours.

[0052] In some embodiments, the hypoimmune KNA+ mesodermal cells exhibits at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in B2M expression compared to KNA+ mesodermal cells generated from wild type PSCs. In some embodiments, the hypoimmune KNA+ mesodermal cells do not express B2M.

[0053] In some embodiments, the hypoimmune KNA+ mesodermal cells exhibits at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in surface expression of MHC class I molecules compared to KNA+ mesodermal cells generated from wild type PSCs.

[0054] In some embodiments, the disclosure herein provides a hypoimmune KNA+ mesodermal cell obtained by any one of the methods disclosed herein.

[0055] In some embodiments, the disclosure herein provides a population of hypoimmune KNA+ mesodermal cells obtained by any one of the methods disclosed herein. In some embodiments, at least 50%, 60%, 80%, 90%, 95%, 99%, or 100% of the population of hypoimmune KNA+ mesodermal cells have at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in B2M expression compared to KNA+ mesodermal cells generated from wild type PSCs.

[0056] Both the foregoing summary and the following detailed description are exemplary and explanatory. They are intended to provide further details of the invention, but are not to be construed as limiting. Other objects, advantages, and novel features will be readily apparent to those skilled in the art from the following detailed description of the invention.

[0057] In another aspect, the present disclosure provides a population of hypoimmune endothelial colony forming cells (ECFCs), wherein the ECFCs have altered beta-2 microglobulin (B2M) expression, thereby reducing the surface expression of MHC Class I molecules in the cells. In some embodiments, at least 50%, 60%, 80%, 90%, 95%, 99%, or 100% of the population of hypoimmune ECFCs have at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in B2M expression compared to wild type ECFCs. In some embodiments, the ECFCs exhibit at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in surface expression of MHC class I molecules compared to wild type ECFCs, or wherein the hypoimmune ECFCs do not have surface expression of MHC class I molecules. In some embodiments, the hypoimmune ECFCs do not express B2M. In some embodiments, the B2M expression in the ECFCs has been altered to be reduced compared to wild-type expression. In some embodiments, B2M expression in the ECFCs is reduced using genetic modification utilizing zinc-finger nucleases (ZFN), transcription activator-like effector nuclease (TALEN), a CRISPR/Cas system or homologous recombination techniques. [0058] In some embodiments, the B2M expression in the ECFCs has been altered with the use of a regulator. In some embodiments, the regulator is a PNA, an LNA, a ssRNA, a dsRNA, an mRNA, a micro-RNA, a miRNA mimic, an antisense RNA, a ribozyme, an antisense oligonucleotide, a bifunctional antisense oligonucleotide, an shRNA, an antagomir, an aptamer, an siRNA, a dsDNA, a DNAzyme, a ssDNA, polypeptide or active fragment thereof, an antibody, an intrabody, a transbody, a protein, an enzyme, a peptidomimetic, a peptoid, a transcriptional factor, or a small organic molecule, and the like. In some embodiments, the regulator is introduced by nucleofection or lipofection.

100591 In another aspect, the present disclosure provides a hypoimmune endothelial colony forming cell (ECFC), wherein the ECFC has altered beta-2 microglobulin (B2M) expression, thereby reducing the surface expression of MHC Class I molecules in the ECFC. In some embodiments, the hypoimmune ECFC has at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in B2M expression compared to wild type ECFCs. In some embodiments, the ECFC exhibits at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in surface expression of MHC class I molecules compared to wild type ECFCs, or in some embodiment, the hypoimmune ECFC does not have surface expression of MHC class I molecules. In some embodiments, the hypoimmune ECFC does not express B2M. In some embodiments, the B2M expression of the hypoimmune ECFC has been altered to be reduced compared to wild-type expression. In some embodiments, B2M expression in the ECFC is reduced using genetic modification utilizing zinc-finger nucleases (ZFN), transcription activator-like effector nuclease (TALEN), a CRISPR/Cas system or homologous recombination techniques.

[0060] In some embodiments, the B2M expression in the ECFC has been altered with the use of a regulator. In some embodiments, the regulator is a PNA, an LNA, a ssRNA, a dsRNA, an mRNA, a micro-RNA, a miRNA mimic, an antisense RNA, a ribozyme, an antisense oligonucleotide, a bifunctional antisense oligonucleotide, an shRNA, an antagomir, an aptamer, an siRNA, a dsDNA, a DNAzyme, a ssDNA, polypeptide or active fragment thereof, an antibody, an intrabody, a transbody, a protein, an enzyme, a peptidomimetic, a peptoid, a transcriptional factor, or a small organic molecule, and the like. In some embodiments, the regulator is introduced by nucleofection or lipofection. [0061 ] In another aspect, the present disclosure provides a method of treating a disease or disorder characterized by cellular dysfunction comprising administering to a subject in need thereof the population of hypoimmune ECFCs or the ECFCs disclosed herein. In some embodiments, the cellular dysfunction comprises endothelial cell dysfunction. In some embodiments, the method comprises administering the population of hypoimmune ECFCs or the ECFCs directly to the subject's organ, tissue or extremity in vivo. In some embodiments, the method comprises promoting neovascularization in the subject's organ, tissue or extremity. In some embodiments, the disease or disorder is a vascular and/or cardiac disease such as critical limb ischemia, diabetic retinopathy, arterial hypertension, pulmonary hypertension, traumatic vascular injuries, transplant vasculopathies, microvascular injuries, myocardial remodeling and vascular remodeling, ischemia-reperfusion injuries and/or vasospastic diseases.

BRIEF DESCRIPTION OF THE DRAWINGS

[0062] Figure 1 depicts population of KDR+(CD309), NCAM+(CD56), and APLNR+(APJ) (KNA) mesodermal cells derived from wild-type (WT) and B2M-K0 iPSCs.

[0063] Figure 2 depicts mixed leukocyte reaction data showing (A) CD4+ and (B) CD8+ T cell proliferation after incubation with vasculogenic endothelial progenitor cells (VPC) derived from wild-type (WT VPC) and B2M-K0 (KO VPC) iPSCs. * represents a p value < 0.05, and *** represents a p value <0.001. Unstimulated PBMCs were used as a negative control and are represented by triangles , stimulated PBMCs were used a positive control and are represented by circles, WT VPCs are represented by squares, and KO VPCs are represented by diamonds.

{0064] Figure 3 depicts MHC Class I HLA ABC expression in wild type (WT) and B2M-K0 (KO) vasculogenic endothelial progenitor cells in the presence and absence of IFN-gamma treatment as indicated under the graphs. Figure 3 (A) show percent cells expressing MHC Class I HLA ABC. Figure 3 (B) shows MHC Class I HLA ABC expression as mean fluorescence intensity of MHC Class I expression in each cell population. M.F.I. = Mean Fluorescence Intensity. DETAILED DESCRIPTION

[0065] Cellular therapy has shown promise for the treatment of many ailments in the past few years. A key challenge for cell therapy in general is the need to generate a large number of cells for each patient. The use of PSCs or the differentiated cell lineages derived therefrom addresses the challenge of manufacturing human cells at a large scale. As used herein, “pluripotent stem cells” are cells with the capacity for self-renewal and differentiation into the primary germ cell layers (i.e. have the potential to develop into any cell type). In some instances, the PSC is an “induced PSC” (iPSC), a somatic cell (e.g. a skin or blood cell) that has been reprogrammed back into a pluripotent state.

|0066[ Given the resources needed for the manufacture of human cells for therapy, the development of cells that can be taken off-the-shelf for allogeneic transplantation into a genetically diverse patient population would be beneficial. One way to achieve this goal is to use a “hypoimmune” cell, defined herein as a cell that has reduced immunogenicity, to produce the cells for allogeneic cell therapy. The use of hypoimmune cells thus mitigates the risk of graft rejection or graft-vs-host disease after administration of the cells to a subject in need thereof. The cells described here are hypoimmune KDR+NMAR+APLNR+ (KNA+) mesodermal cells that can be used in allogeneic cell therapy, for instance in the treatment of vascular diseases.

[0067] The hypoimmune KNA+ mesodermal cells disclosed here have been modified such that B2M expression has been altered, reducing the cell surface expression of MHC Class I molecules and, thereby reducing immunogenicity, in the cells. In some embodiments, the B2M gene expression can be altered using zinc-finger nucleases (ZFN), transcription activator-like effector nuclease (TALEN), a CRISPR/Cas system or traditional homologous recombination techniques. In other instances, the B2M expression can be altered using a regulator such as a peptide nucleic acid (PNA), a locked nucleic acid (LNA), a singlestranded RNA (ssRNA), a double-stranded RNA (dsRNA), an mRNA, a micro-RNA (miRNA), an miRNA mimic, an antisense RNA, a ribozyme, an antisense oligonucleotide, a bifunctional antisense oligonucleotide, a short hairpin RNA (shRNA), an antagomir, an aptamer, a small interfering RNA (siRNA), a dsDNA, a DNAzyme, a ssDNA, polypeptide or active fragment thereof, an antibody, an intrabody, a transbody, a protein, an enzyme, a peptidomimetic, a peptoid, a transcriptional factor, or a small organic molecule. In some cases, the regulator can be introduced into the cell via nucleofection or transfection.

[0068] In some embodiments, the B2M expression is reduced in pluripotent stem cells (PSCs) followed by generation of KNA+ mesodermal cells from the PSC with reduced B2M expression to prepare hypoimmune KNA+ mesodermal cells. In some embodiments, B2M expression is reduced in the KNA+ mesodermal cells or a population of KNA+ mesodermal cells. In some embodiments, the B2M expression is reduced in the ECFCs.

[0069] In some embodiments, the hypoimmune KNA+ mesodermal cells exhibit at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in B2M expression compared to KNA+ mesodermal cells generated from wild type PSCs. In some embodiments, the hypoimmune KNA+ mesodermal cells do not express B2M. In some embodiments, the hypoimmune KNA+ mesodermal cells exhibit at least about 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold or 20 fold reduction in B2M expression compared to KNA+ mesodermal cells generated from wild type PSCs. In some embodiments, the hypoimmune KNA+ mesodermal cells exhibit at least about 2 fold to 20 fold, 2 fold to 10 fold, or 2 fold to 5 fold reduction in B2M expression compared to KNA+ mesodermal cells generated from wild type PSCs. In some embodiments, the hypoimmune KNA+ mesodermal cells do not express B2M.

[0070] In some embodiments, the hypoimmune KNA+ mesodermal cells exhibit at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in surface expression of MHC class I molecules compared to KNA+ mesodermal cells generated from wild type PSCs. In some embodiments, the hypoimmune KNA+ mesodermal cells exhibit at least about 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold or 20 fold reduction in surface expression of MHC class I molecules compared to KNA+ mesodermal cells generated from wild type PSCs. In some embodiments, the hypoimmune KNA+ mesodermal cells exhibit at least about 2 fold to 20 fold, 2 fold to 10 fold, or 2 fold to 5 fold reduction in surface expression of MHC class I molecules compared to KNA+ mesodermal cells generated from wild type PSCs. In some embodiments, the hypoimmune KNA+ mesodermal cells do not have surface expression of MHC class I molecules.

[0071] In some embodiments, the disclosure herein provides a population of hypoimmune KNA+ mesodermal cells obtained by any one of the methods disclosed herein. In some embodiments, at least 50%, 60%, 80%, 90%, 95%, 99%, 100%, 50% to 100%, 50% to 75%, or 75% to 99% of the population of hypoimmune KNA+ mesodermal cells have at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in B2M expression compared to KNA+ mesodermal cells generated from wild type PSCs.

[0072] In some embodiments, at least 50%, 60%, 80%, 90%, 95%, 99%, 100%, 50% to 100%, 50% to 75%, or 75% to 99% of the population of hypoimmune KNA+ mesodermal cells have at least about 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold or 20 fold reduction in B2M expression compared to KNA+ mesodermal cells generated from wild type PSCs. In some embodiments, at least 50%, 60%, 80%, 90%, 95%, 99%, 100%, 50% to 100%, 50% to 75%, or 75% to 99% of the population of hypoimmune KNA+ mesodermal cells have at least about 2 fold to 20 fold, 2 fold to 10 fold, or 2 fold to 5 fold reduction in surface expression of MHC class I molecules compared to KNA+ mesodermal cells generated from wild type PSCs. In some embodiments, 100% of cells of the population of the hypoimmune KNA+ mesodermal cells do not have surface expression of MHC class I molecules.

[0073] In another aspect, the present disclosure provides a population of hypoimmune endothelial colony forming cells (ECFCs), wherein the ECFCs have altered beta-2 microglobulin (B2M) expression, thereby reducing the surface expression of MHC Class I molecules in the cells. In some embodiments, at least 50%, 60%, 80%, 90%, 95%, 99%, or 100% of the population of hypoimmune ECFCs have at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in B2M expression compared to wild type ECFCs.

[0074] In some embodiments, at least 50%, 60%, 80%, 90%, 95%, 99%, 100%, 50% to 100%, 50% to 75%, or 75% to 99% of the population of hypoimmune ECFCs has at least about 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold or 20 fold reduction in B2M expression compared to a population of wild type ECFCs. In some embodiments, at least 50%, 60%, 80%, 90%, 95%, 99%, 100%, 50% to 100%, 50% to 75%, or 75% to 99% of the population of hypoimmune ECFCs have at least about 2 fold to 20 fold, 2 fold to 10 fold, or 2 fold to 5 fold reduction in surface expression of MHC class I molecules compared to a population of wild type ECFCs. In some embodiments, 100% of cells of the population of the hypoimmune KNA+ mesodermal cells do not have surface expression of MHC class I molecules.

In some embodiments, the ECFCs exhibit at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in surface expression of MHC class I molecules compared to wild type ECFCs, or wherein the hypoimmune ECFCs do not have surface expression of MHC class I molecules. In some embodiments, the hypoimmune ECFCs do not express B2M. In some embodiments, the B2M expression in the ECFCs has been altered to be reduced compared to wild-type expression.

[0075] In another aspect, the present disclosure provides a hypoimmune endothelial colony forming cell (ECFC), wherein the ECFC has altered beta-2 microglobulin (B2M) expression, thereby reducing the surface expression of MHC Class I molecules in the ECFC. In some embodiments, the hypoimmune ECFC has at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in B2M expression compared to wild type ECFCs. In some embodiments, the hypoimmune ECFC exhibits at least about 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold or 20 fold reduction in surface expression of B2M compared to wild type ECFCs. In some embodiments, the hypoimmune ECFC exhibits at least about 2 fold to 20 fold, 2 fold to 10 fold, or 2 fold to 5 fold reduction in surface expression of B2M compared to wild type ECFCs.

[0076] In some embodiments, the hypoimmune ECFC exhibits at least about 2 fold, 3 fold, 4 fold, 5 fold, 6 fold, 7 fold, 8 fold, 9 fold, 10 fold, 15 fold or 20 fold reduction in surface expression of MHC class I molecules compared to wild type ECFCs. In some embodiments, the hypoimmune ECFC exhibits at least about 2 fold to 20 fold, 2 fold to 10 fold, or 2 fold to 5 fold reduction in surface expression of MHC class I molecules compared to wild type ECFCs.

[0077] In some embodiments, the hypoimmune ECFC does not express B2M. In some embodiments, wherein the B2M expression of the hypoimmune ECFC has been altered to be reduced compared to wild-type expression. In some embodiments, B2M expression in the ECFC is reduced using genetic modification utilizing zinc-finger nucleases (ZFN), transcription activator-like effector nuclease (TALEN), a CRISPR/Cas system or homologous recombination techniques.

[0078] In some embodiments, the B2M expression in the ECFC has been altered with the use of a regulator. In some embodiments, the regulator is a PNA, an LNA, a ssRNA, a dsRNA, an mRNA, a micro-RNA, a miRNA mimic, an antisense RNA, a ribozyme, an antisense oligonucleotide, a bifunctional antisense oligonucleotide, an shRNA, an antagomir, an aptamer, an siRNA, a dsDNA, a DNAzyme, a ssDNA, polypeptide or active fragment thereof, an antibody, an intrabody, a transbody, a protein, an enzyme, a peptidomimetic, a peptoid, a transcriptional factor, or a small organic molecule, and the like. In some embodiments, the regulator is introduced by nucleofection or lipofection.

[0079] In another aspect, the present disclosure provides a method of treating a disease or disorder characterized by cellular dysfunction comprising administering to a subject in need thereof the population of hypoimmune ECFCs or the ECFCs disclosed herein. In some embodiments, the cellular dysfunction comprises endothelial cell dysfunction. In some embodiments, the method comprises administering the cells directly to the subject's organ, tissue or extremity in vivo. In some embodiments, the method comprises promoting neovascularization in the subject's organ, tissue or extremity. In some embodiments, the disease or disorder is a vascular and/or cardiac disease such as critical limb ischemia, diabetic retinopathy, arterial hypertension, pulmonary hypertension, traumatic vascular injuries, transplant vasculopathies, microvascular injuries, myocardial remodeling and vascular remodeling, ischemia-reperfusion injuries and/or vasospastic diseases. [0080] In some embodiments, the present disclosure provides a method for generating a population of human KNA+ mesodermal cells from human PSCs. The method comprises inducing the pluripotent stem cells to undergo mesodermal differentiation, wherein the mesodermal induction comprises culturing the pluripotent stem cells for about 24 hours in a mesoderm differentiation medium comprising Activin A, Bone Morphogenic Protein 4 (BMP4), Vascular endothelial growth factor (VEGF), and Fibroblast Growth Factor 2 (FGF2). This can be followed by replacing the medium with a mesoderm differentiation medium comprising BMP-4, VEGF and FGF-2 about every 24-48 hours thereafter for about 72 hours. In some instances, the KNA+ mesodermal cells can be separated from a heterogenous population based on the cell membrane protein expression of KDR, NCAM, APLNR or any combination thereof. In some cases, the process of sorting a heterogeneous population into a homogenous population of KNA+ cells can be carried out with the use of fluorescent- or magnetic-activated cell sorting (FACS or MACS). This sorting is based on using antibodies specific for each cell surface marker to separate the differing populations. In some cases, the mesoderm differentiation medium may be a commercially available basal medium such as mTeSRl or Stemline II.

[0081] Cellular differentiation can be controlled by many biological macromolecules such as DNA, RNA and polypeptides having various effects in the cell. Some can include transcription factors having either broad or targeted effects on the cell. MicroRNA (often abbreviated miRNA or miR) are small single-stranded non-coding RNA molecules that can function in RNA silencing or post-transcriptional regulation of gene expression. Another biomolecule used in RNA silencing is the miRNA mimic. A miRNA mimic is a chemically synthesized, double stranded miRNA-like RNA fragment that is designed to copy the functionality of a mature endogenous miRNA upon transfection. MicroRNA or miRNA mimics can have either broad or narrow effect on differentiation of precursor cells (e.g., PSCs) into lineage-specific cells.

[0082] In some embodiments, the mesodermal induction further comprises contacting the cells undergoing mesodermal induction with one or more miRNA inhibitor, wherein the one or more miRNA inhibitor inhibits an miRNA that exhibits decreased expression in KNA+ mesodermal cells relative to PSCs. In one aspect, the miRNA inhibitor inhibits an miRNA selected from the group consisting of miR-221-3p, miR-1271-5p, miR-559, miR543, miR- 361-3p, miR-30d-5p, miR-124-3p and miR-185-5p. In some instances, the cells undergoing mesodermal induction are contacting with one or more of an miRNA inhibitor of miR-221- 3p, miR-1271-5p and miR-559, preferably miR-221-3p.

[0083] In some embodiments, the mesodermal induction further comprises contacting the cells undergoing mesodermal induction with one or more miRNA mimic, wherein the one or more miRNA mimic mimics an miRNA that exhibits increased expression in KNA+ mesodermal cells relative to PSCs. In some instances, the miRNA mimic mimics an miRNA selected from the group consisting of miR-330-5p, miR-145-5p, miT-214-3p and miR-497- 5p. In some cases, the cells undergoing mesodermal induction are cultured with one or more of an miRNA mimic of miR-330-5p, miR-145-5p and miT-214-3p, preferably miR-330-5p. In an embodiment, the mesodermal induction further comprises contacting the cells undergoing mesodermal induction with a miR-214 mimic.

[0084] In some embodiments, the hypoimmune KNA+ mesodermal cells can differentiate into hypoimmune vasculogenic endothelial progenitor cells. In some instances, the hypoimmune vasculogenic endothelial progenitor cells comprise hypoimmune endothelial colony-forming cells (ECFCs) or similar (i.e., ECFC-like cells) generated by a method that can include culturing a pluripotent stem cell in a medium without BMP on a first matrix to produce an intermediate cell. The first matrix can include laminin 411 and laminin 511. The ratio of laminin 411 to laminin 511 can be any suitable ratio. In some cases, the proportion of laminin that is laminin 411 is about 75%. In some embodiments, about 95%, about 90%, about 85%, about 80%, about 75%, about 70%, about 65%, about 60%, about 55%, about 50%, about 45%, about 40%, about 35%, about 30%, or about 25% of the laminin is laminin 411. In some instances, at least about 95%, at least about 90%, at least about 85%, at least about 80%, at least about 75%, at least about 70%, at least about 65%, at least about 60%, at least about 55%, at least about 50%, at least about 45%, at least about 40%, at least about 35%, at least about 30%, or at least about 25% of the laminin is laminin 411. The laminin can be full-length, optionally recombinant, optionally human. In some cases, the laminins are truncated laminins. [0085] The intermediate cell can be cultured in a second medium that may be a commercially available basal medium such as Stemline II. In some cases, the basal medium may be supplemented with certain growth factors. In some cases, these factors can include Activin A, BMP4, VEGF165, FGF2, or any combination thereof. Culturing the intermediate cell in the second medium on the first matrix can result in a mesodermal cell. The mesodermal cell can be cultured in a third medium that can be a commercially available basal medium such as EC- Cult XF. In some cases, the basal medium may be supplemented with certain growth factors. In some cases, these factors can include BMP4, VEGF165, FGF2, or any combination thereof. The mesodermal cell can be cultured on a second matrix that includes laminin 411 to produce an ECFC.

[0086] In some embodiments, the method of producing an ECFC from a PSC involves the use of a forward programming factor. In some cases, the forward programming factor is a nucleic acid or nucleic acid derivative, including either RNA or DNA. In some cases, the nucleic acid is chemically protected from degradation (e.g., by replacement of uridine with pseudo-uridine and/or cytosine with 5-methyl-cytosine). In some cases, the nucleic acid can be a transgene, capable of expressing the forward programming factor (i.e., mimicking the native factor). In some cases, the nucleic acid can interfere with native expression of the factor in the cell (e.g., by being a reverse compliment antisense sequence). In some instances, the forward programming factor is a polypeptide or an active fragment thereof (e.g., a transcription factor).

[0087] In some embodiments, the forward programming factor is ETV2. The ETV2 factor can be expressed from mRNA, DNA, or used as a polypeptide. There are at least four splice isoforms of ETV2 (i.e., SEQ ID 1, SEQ ID 2, SEQ ID 3, and SEQ ID 4). In some embodiments, the ETV2 is isoform 2 or a variant thereof.

|0088[ The forward programming factor can be contacted with the intermediate cell (e.g., KNA+ cell) at any suitable concentration. In some instances, the concentration is about 0.05, about 0.1, about 0.5, about 1.0, about 3, about 5, or about 10 micrograms per million cells. In some instances, the concentration is at least about 0.05, at least about 0.1, at least about 0.5, at least about 1.0, at least about 3, at least about 5, or at least about 10 micrograms per million cells. In some instances, the concentration is at most about 0.05, at most about 0.1, at most about 0.5, at most about 1.0, at most about 3, at most about 5, or at most about 10 micrograms per million cells. In some cases, the concentration of the forward programming factor is between about 0.5 and about 1 microgram per million cells.

[0089] In some embodiments, the forward programming factor is a miRNA or mimic selected from the group consisting of miR-200b, miR-93, miRNA-330-5p, miRNA-145-5p, miRNA-214-3p, miRNA-221-3p, miRNA- 1271 -5p, miRNA-559, and combinations thereof. In some embodiments, the forward programming factor is a miRNA mimic such as miRNA- 93, miRNA-330-5p, miRNA-145-5p, or miRNA-214-3p. In some embodiments, the forward programming factor is a miRNA inhibitor such as miRNA-221-3p, miRNA- 1271 -5p, miRNA-559, or miRNA-200b.

[0090] In some embodiments, PSC-derived hypoimmune vasculogenic cells can be used for the treatment of diseases of the vasculature such as PAD.

(0091 ] In some embodiments, the hypoimmune KNA+ mesodermal cells described herein can be used as a cellular therapy to treat diseases of the vasculature or disorders characterized by endothelial dysfunction when formulated as a pharmaceutical composition. In some cases, the composition can include a pharmaceutically inert vehicle or agent that enhances proliferation and/or survival of the mesodermal cells. In some instances, the composition includes an agent that promotes migration of the mesodermal cells to areas of endothelial dysfunction. In some cases, the composition is formulated with an agent that promotes the engraftment of the mesodermal cells into areas of endothelial dysfunction. In one embodiment, the composition may be formulated such that the hypoimmune KNA+ mesodermal cells are cryogenically preserved.

(0092] Definitions and Terminology

[0093] As used herein, “about” will be understood by persons of ordinary skill in the art and will vary to some extent depending upon the context in which it is used. If there are uses of the term which are not clear to persons of ordinary skill in the art, given the context in which it is used, “about” will mean up to plus or minus 10% of the particular term. [0094] As used herein, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to “a” component includes aspects having two or more such components, unless the context clearly indicates otherwise. Also, the word “or” when used without a preceding “either” (or other similar language indicating that “or” is unequivocally meant to be exclusive - e.g., only one of x or y, etc.) shall be interpreted to be inclusive (e.g., “x or y” means one or both x or y).

[0095] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

10096 [ Definitions that are contained in text incorporated by reference are excluded to the extent that they contradict definitions in this disclosure.

[0097] While certain embodiments have been illustrated and described, it should be understood that changes and modifications may be made therein in accordance with ordinary skill in the art without departing from the technology in its broader aspects as defined in the following claims.

[0098] The embodiments, illustratively described herein may suitably be practiced in the absence of any element or elements, limitation or limitations, not specifically disclosed herein. Thus, for example, the terms “comprising,” “including,” “containing,” etc. shall be read expansively and without limitation. Additionally, the terms and expressions employed herein have been used as terms of description and not of limitation, and there is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof, but it is recognized that various modifications are possible within the scope of the claimed technology. Additionally, the phrase “consisting essentially of’ will be understood to include those elements specifically recited and those additional elements that do not materially affect the basic and novel characteristics of the claimed technology. The phrase “consisting of’ excludes any element not specified.

[0099] The present disclosure is not to be limited in terms of the particular embodiments described in this application. Many modifications and variations may be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and compositions within the scope of the disclosure, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the appended claims. The present disclosure is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled. It is to be understood that this disclosure is not limited to particular methods, compounds, or compositions, which may of course vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[0100] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof, inclusive of the endpoints. As such, all disclosed ranges are to be understood to encompass and provide support for claims that recite any and all subranges or any and all individual values subsumed by each range. For example, a stated range of 1 to 10 should be considered to include and provide support for claims that recite any and all subranges or individual values that are between and/or inclusive of the minimum value of 1 and the maximum value of 10; that is, all subranges beginning with a minimum value of 1 or more and ending with a maximum value of 10 or less (e.g., 5.5 to 10, 2.34 to 3.56, and so forth) or any values from 1 to 10 (e.g., 3, 5.8, 9.9994, and so forth).

[0101] Any listed range may be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein may be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as “up to,” “at least,” “greater than,” “less than,” and the like, include the number recited and refer to ranges which may be subsequently broken down into subranges as discussed above. Further, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 layers refers to groups having 1, 2, or 3 layers. Similarly, a group having 1-5 layers refers to groups having 1, 2, 3, 4, or 5 layers, and so forth.

WORKING EXAMPLES

[0102] The following examples are provided to illustrate the invention, but it should be understood that the invention is not limited to the specific conditions or details of these examples.

[0.103] Working Example 1: Material and Methods

101041 The source of the iPSCs used herein is a Master Cell Bank (MCB) of iPSCs generated by Lonza and licensed through Helios. Briefly, the iPSCs were derived from donor human CD34+ umbilical cord blood cells using non-integrating or episomal lentiviral vectors for reprogramming as described in Broxmeyer, et al., Blood 117, 4773-4777 (2011). The reprogramming factors used were Oct4, KLF-4, Sox2, and c-Myc. Donor eligibility, screening, and testing were done in accordance with 21 CFR 1271 Subpart C.

Reprogramming and generation of the iPSC MCB was conducted under current Good Manufacturing Practice- (cGMP-) compliant conditions.

[0105] The beta-2 microglobulin knock-out (B2M KO) iPSCs were derived by using CRISPR with a guide RNA targeting B2M designed and sourced from Synthego and the Cas9 from Aldevron (SpyFi® CAS9). Nucleofection was used to deliver CRISPR Cas9 to the iPSCs.

[0106] Culturing of hPSCs: Culturing of hPSCs: hiPSCs were maintained in mTeSRl complete media (STEMCELL Technologies) on laminin-521 (BioLamina) in T75 tissue culture flasks at 37°C and 5% CO2. After the plating of cells, media was changed on days 3, and 4. Cells were passaged on Day 5. Media was aspirated and cells washed twice with DPBS (Gibco). hiPSCs were dissociated by adding 7.5mL versene (Gibco) to the flask and incubating at room temperature for 5-7minutes. Fresh media was then added to the flask, the cell suspension collected and centrifuged at 200 x g for 3 minutes. After the supernatant was aspirated, the cell pellet was resuspended in mTeSRl complete media and evenly distributed into a laminin-521 -coated flask. [01 7] Directed differentiation of hPSCs into mesoderm cells: 2 days (D7) after passage, iPSCs were directed toward the mesodermal lineage by incubating in Stemline II complete media (Sigma) containing activin A , fibroblast growth factor 2 (FGF-2), vascular endothelial growth factor (VEGF165), and Bone Morphogenic Protein (BMP4) for 24 hrs. The following day (D8), activin-A containing media was removed and replaced with 8 mL of Stemline II complete media (Sigma) containing FGF-2 (Proteintech), VEGF165 (Proteintech) and BMP4 Proteintech). Media was replaced with 8 ml of fresh Stemline II containing FGF-2 (Proteintech), VEGF165 (Proteintech) and BMP4 (Proteintech) for each of the next two days. On day 1 Ithe cells were collected for sorting by flow cytometry for KNA+ mesoderm cells or SSEA5-KNA+ mesoderm cells.

[0108] Directed differentiation of KNA+ mesoderm cells or SSEA5-KNA+ mesoderm cells into the EC lineage, including ECFC-like cells: Day 11 sorted mesoderm cells (KDR+NCAM+APLNR+ or SSEA5-KDR+NCAM+APLNR+) were further cultured in Stemline II complete media (Sigma) containing FGF-2 (Proteintech), VEGF165 (Proteintech) and BMP4 (Proteintech), which was replaced on days 13, 14, 15, and 16. On day 13 and thereafter Stemline II differentiation media was mixed with EC-Cult-XF media (STEMCELL Technologies) at ratios of 80:20, 60:40, 40:60 and 20:80 respectively.

[0109] Flow cytometry: Adherent cells were harvested using TrypleE and made into a single cell suspension in DPBS containing human serum albumin (HSA), for example at day 11. Cells were counted and aliquots of the cell suspension were prepared for antibody staining. FcR blocking reagent (Miltyni Biotech) may be added to prevent the non-specific binding of antibodies. Cells were labelled using antibodies recognizing KDR (CD309), NCAM (CD56), and/or APLNR (APJ) to identify mesodermal cells. Other antibodies used for characterizing cells may include anti-human CD31 (CD31-FITC, clone WM59 from BD Pharmingen), CD144 (CD144-PE, clone 16B1 from ebioscience) and NRP-1 (NRP-l-APC, clone AD5-176 from Miltenyi Biotech). Anti-CD4 and anti-CD8 antibodies may be used to identify CD4⁺ and CD8⁺ T cells. Anti-HLA or anti -b2m antibodies may be used to measure MHC class I expression. Antibodies were used at concentrations that were titrated prior to use. Propidium Iodide (PI, Sigma) may be added to the cell suspension for dead cell staining. Flow cytometric detection of the cell surface antigens and cells sorting were performed on an MACSQuant Tyto (Miltenyi Biotech) . Compensation may be set by single positive controls using cord blood derived ECFCs. A gating of targeted cell population was determined based on fluorescent minus one (FMO) controls for each fluorescent color.

[0110] T cell proliferation assay: Peripheral blood mononuclear cells were incubated with the vasculogenic progenitor cells, and then the proliferation of CD4⁺ and CD8⁺ T cells resulting from an immune response to the vasculogenic progenitors was measured. Proliferation of T cells may be measured by pre-labeling the cells with 5(6)-Carboxyfluorescein diacetate N- succinimidyl ester (CFSE, Sigma). FACS measurements can be used to determine proliferation of CD4⁺ and CD8⁺ T cells by measuring dilution of CFSE in these cell populations. Other methods include counting numbers of CD4⁺ and CD8⁺ T cells before and after incubation. Alternatively, proliferation may be determined by measure incorporation of Bromodeoxyuridine (BrdU). The amount of incorporated BrdU may be measured by using antibodies recognizing BrdU.

[0111] Working Example 2: Vasculogenic progenitors derived from pi microglobulin (B2M)-KO iPSCs have reduced immunogenicity

[0112] KDR+(CD309), NCAM+(CD56), and APLNR+(APJ) (KNA) mesodermal cells derived from wild-type and B2M-K0 iPSCs according to methods described in working example 1. Figure 1 showed the FACS profile of the resulting cell populations, and confirmed derivation of KDR+(CD309), NCAM+(CD56), and APLNR+(APJ) (KNA) mesodermal cells derived from wild-type (WT) and B2M-K0 iPSCs. Figure 3 (A) showed insignificant expression of MHC class I in B2M-K0 (KO) vasculogenic endothelial progenitor cells (VPCs) in both the presence and absence of interferon (IFN) gamma compared to wild type (WT) VPCs.

(0113] The vasculogenic progenitors derived from wild-type (WT VPC) and B2M-K0 (KO VPC) were mixed with Peripheral Blood Mononuclear cells (PBMCs) to determine immunogenicity by measuring proliferation of CD4⁺ and CD8⁺ T cells resulting from an immune response to the vasculogenic progenitors. On the day before the experiment (Day -1) wild-type (WT VPC) or B2M-K0 (KO VPC) vasculogenic endothelial progenitor cells were plated on extracellular matrix in endothelial medium. The following day (Day 0) CFSE- pretreated PBMCs were cocultured with WT VPCs or KO VPs in a ratio of 10: 1 or 15: 1 as shown in Figure 2. On Day 6, the percentage of proliferating CD4⁺ and CD8⁺ T cells was measured via flow cytometric analysis of CFSE dilution. The results depicted in Figure 2 show that the KO VPCs induced insignificant CD8⁺ T cell proliferation compared to the WT VPCs.

[0114] Hence, the data in Figures 1-3 demonstrate generation of hypoimmune vascular progenitor cells (KNA+ mesoderm cells) from B2M-K0 iPSCs.

[0115] ETV2 SEQUENCES

SEQ ID. 1 - Isoform 1 :

>ETV2-202 cds:protein_coding

ATGGACCTGTGGAACTGGGATGAGGCATCCCCACAGGAAGTGCCTCCAGGGAACAAGCTG

GCAGGGCTTGGTAGGCTGCCGAGGCTGCCACAACGTGTGTGGGGAGGGTGTCCAGGTGGG

GCCTCTGCTGACCCTAACCCCTTATCGCCTGCAGAAGGAGCCAAATTAGGCTTCTGTTTC

CCTGATCTGGCACTCCAAGGGGACACGCCGACAGCGACAGCAGAGACATGCTGGAAAGGT

ACAAGCTCATCCCTGGCAAGCTTCCCACAGCTGGACTGGGGCTCCGCGTTACTGCACCCA

GAAGTTCCATGGGGGGCGGAGCCCGACTCTCAGGCTCTTCCGTGGTCCGGGGACTGGACA

GACATGGCGTGCACAGCCTGGGACTCTTGGAGCGGCGCCTCGCAGACCCTGGGCCCCGCC

CCTCTCGGCCCGGGCCCCATCCCCGCCGCCGGCTCCGAAGGCGCCGCGGGCCAGAACTGC

GTCCCCGTGGCGGGAGAGGCCACCTCGTGGTCGCGCGCCCAGGCCGCCGGGAGCAACACC

AGCTGGGACTGTTCTGTGGGGCCCGACGGCGATACCTACTGGGGCAGTGGCCTGGGCGGG

GAGCCGCGCACGGACTGTACCATTTCGTGGGGCGGGCCCGCGGGCCCGGACTGTACCACC

TCCTGGAACCCGGGGCTGCATGCGGGTGGCACCACCTCTTTGAAGCGGTACCAGAGCTCA

GCTCTCACCGTTTGCTCCGAACCGAGCCCGCAGTCGGACCGTGCCAGTTTGGCTCGATGC

CCCAAAACTAACCACCGAGGTCCCATTCAGCTGTGGCAGTTCCTCCTGGAGCTGCTCCAC

GACGGGGCGCGTAGCAGCTGCATCCGTTGGACTGGCAACAGCCGCGAGTTCCAGCTGTGC

GACCCCAAAGAGGTGGCTCGGCTGTGGGGCGAGCGCAAGAGAAAGCCGGGCATGAATTAC

GAGAAGCTGAGCCGGGGCCTTCGCTACTACTATCGCCGCGACATCGTGCGCAAGAGCGGG

GGGCGAAAGTACACGTACCGCTTCGGGGGCCGCGTGCCCAGCCTAGCCTATCCGGACTGT GCGGGAGGCGGACGGGGAGCAGAGACACAATAA

SEQ ID. 2 - Isoform 2:

>ETV2-203 cds:protein_coding

ATGGACCTGTGGAACTGGGATGAGGCATCCCCACAGGAAGTGCCTCCAGGGAACAAGCTG

GCAGGGCTTGAAGGAGCCAAATTAGGCTTCTGTTTCCCTGATCTGGCACTCCAAGGGGAC

ACGCCGACAGCGACAGCAGAGACATGCTGGAAAGGTACAAGCTCATCCCTGGCAAGCTTC

CCACAGCTGGACTGGGGCTCCGCGTTACTGCACCCAGAAGTTCCATGGGGGGCGGAGCCC

GACTCTCAGGCTCTTCCGTGGTCCGGGGACTGGACAGACATGGCGTGCACAGCCTGGGAC

TCTTGGAGCGGCGCCTCGCAGACCCTGGGCCCCGCCCCTCTCGGCCCGGGCCCCATCCCC

GCCGCCGGCTCCGAAGGCGCCGCGGGCCAGAACTGCGTCCCCGTGGCGGGAGAGGCCACC

TCGTGGTCGCGCGCCCAGGCCGCCGGGAGCAACACCAGCTGGGACTGTTCTGTGGGGCCC

GACGGCGATACCTACTGGGGCAGTGGCCTGGGCGGGGAGCCGCGCACGGACTGTACCATT

TCGTGGGGCGGGCCCGCGGGCCCGGACTGTACCACCTCCTGGAACCCGGGGCTGCATGCG

GGTGGCACCACCTCTTTGAAGCGGTACCAGAGCTCAGCTCTCACCGTTTGCTCCGAACCG

AGCCCGCAGTCGGACCGTGCCAGTTTGGCTCGATGCCCCAAAACTAACCACCGAGGTCCC

ATTCAGCTGTGGCAGTTCCTCCTGGAGCTGCTCCACGACGGGGCGCGTAGCAGCTGCATC CGTTGGACTGGCAACAGCCGCGAGTTCCAGCTGTGCGACCCCAAAGAGGTGGCTCGGCTG TGGGGCGAGCGCAAGAGAAAGCCGGGCATGAATTACGAGAAGCTGAGCCGGGGCCTTCGC TACTACTATCGCCGCGACATCGTGCGCAAGAGCGGGGGGCGAAAGTACACGTACCGCTTC GGGGGCCGCGTGCCCAGCCTAGCCTATCCGGACTGTGCGGGAGGCGGACGGGGAGCAGAG

ACACAATAA

SEQ ID. 3 - Isoform 3 :

>ETV2-205 cds:protein_coding

ATGGCGTGCACAGCCTGGGACTCTTGGAGCGGCGCCTCGCAGACCCTGGGCCCCGCCCCT

CTCGGCCCGGGCCCCATCCCCGCCGCCGGCTCCGAAGGCGCCGCGGGCCAGAACTGCGTC

CCCGTGGCGGGAGAGGCCACCTCGTGGTCGCGCGCCCAGGCCGCCGGGAGCAACACCAGC

TGGGACTGTTCTGTGGGGCCCGACGGCGATACCTACTGGGGCAGTGGCCTGGGCGGGGAG

CCGCGCACGGACTGTACCATTTCGTGGGGCGGGCCCGCGGGCCCGGACTGTACCACCTCC

TGGAACCCGGGGCTGCATGCGGGTGGCACCACCTCTTTGAAGCGGTACCAGAGCTCAGCT

CTCACCGTTTGCTCCGAACCGAGCCCGCAGTCGGACCGTGCCAGTTTGGCTCGATGCCCC

AAAACTAACCACCGAGGTCCCATTCAGCTGTGGCAGTTCCTCCTGGAGCTGCTCCACGAC

GGGGCGCGTAGCAGCTGCATCCGTTGGACTGGCAACAGCCGCGAGTTCCAGCTGTGCGAC

CCCAAAGAGGTGGCTCGGCTGTGGGGCGAGCGCAAGAGAAAGCCGGGCATGAATTACGAG

AAGCTGAGCCGGGGCCTTCGCTACTACTATCGCCGCGACATCGTGCGCAAGAGCGGGGGG CGAAAGTACACGTACCGCTTCGGGGGCCGCGTGCCCAGCCTAGCCTATCCGGACTGTGCG GGAGGCGGACGGGGAGCAGAGACACAATAA

SEQ ID. 4 - Isoform 4:

>ETV2-201 cds:protein_coding

ATGGACCTGTGGAACTGGGATGAGGCATCCCCACAGGAAGTGCCTCCAGGGAACAAGCTG

GCAGGGCTTGAAGGAGCCAAATTAGGCTTCTGTTTCCCTGATCTGGCACTCCAAGGGGAC

ACGCCGACAGCGACAGCAGAGACATGCTGGAAAGGTCCCATTCAGCTGTGGCAGTTCCTC

CTGGAGCTGCTCCACGACGGGGCGCGTAGCAGCTGCATCCGTTGGACTGGCAACAGCCGC

GAGTTCCAGCTGTGCGACCCCAAAGAGGTGGCTCGGCTGTGGGGCGAGCGCAAGAGAAAG

CCGGGCATGAATTACGAGAAGCTGAGCCGGGGCCTTCGCTACTACTATCGCCGCGACATC

GTGCGCAAGAGCGGGGGGCGAAAGTACACGTACCGCTTCGGGGGCCGCGTGCCCAGCCTA GCCTATCCGGACTGTGCGGGAGGCGGACGGGGAGCAGAGACACAATAA

Claims

WHAT IS CLAIMED IS:

1. A population of cells comprising KDR+NCAM+APLNR+ (KNA+) mesodermal cells generated from human pluripotent stem cells (PSCs) cultured in vitro in a medium comprising Activin A, wherein the beta-2 microglobulin (B2M) expression has been altered, thereby reducing the surface expression of MHC Class I molecules in the cells.

2. The population of cells of claim 1, wherein the cells are vasculogenic.

3. The population of cells of claim 1, wherein the pluripotent stem cells are induced pluripotent stem cells (iPSCs).

4. The population of cells of claim 1, wherein the B2M expression has been reduced compared to wild-type expression.

5. The population of cells of claim 4, wherein B2M expression is reduced using genetic modification utilizing zinc-finger nucleases (ZFN), transcription activator-like effector nuclease (TALEN), a CRISPR/Cas system or homologous recombination techniques.

6. The population of cells of claim 1, wherein the B2M expression has been altered with the use of a regulator.

7. The population of cells of claim 6, wherein the regulator is a PNA, an LNA, a ssRNA, a dsRNA, an mRNA, a micro-RNA, a miRNA mimic, an antisense RNA, a ribozyme, an antisense oligonucleotide, a bifunctional antisense oligonucleotide, an shRNA, an antagomir, an aptamer, an siRNA, a dsDNA, a DNAzyme, a ssDNA, polypeptide or active fragment thereof, an antibody, an intrabody, a transbody, a protein, an enzyme, a peptidomimetic, a peptoid, a transcriptional factor, or a small organic molecule, and the like.

8. The population of cells of claim 6, wherein the regulator is introduced by nucleofection or lipofection.

9. A method of preparing KDR+NCAM+APLNR+ (KNA+) mesodermal cells comprising

-27- culturing the pluripotent stem cells for about 24 hours in a mesoderm differentiation medium comprising Activin A, BMP-4, VEGF and FGF-2; and culturing on a mesoderm differentiation medium comprising BMP -4, VEGF and FGF-2 about every 24-48 hours thereafter for about 72 hours.

10. The method of claim 9, further comprising the isolation of KNA+ mesodermal cells from a heterogenous population based on the expression of KDR, NCAM, APLNR or any combination thereof.

11. The method of claim 10, wherein the isolation of KNA+ mesodermal cells is carried out via fluorescent- or magnetic-activated cell sorting.

12. The population of cells of claim 1, wherein the vasculogenic KNA+ mesodermal cells are produced by a method comprising contacting the cells undergoing mesodermal induction with one or more miRNA inhibitor, wherein the one or more miRNA inhibitor inhibits an miRNA that exhibits decreased expression in KDR⁺NCAM⁺APLNR⁺ mesoderm cells relative to PSCs.

13. The population of cells of claim 12, wherein the miRNA inhibitor inhibits an miRNA selected from the group consisting of: miR-221-3p, miR-1271-5p, miR-559, miR543, miR- 361-3p, miR-30d-5p, miR-124-3p and miR-185-5p.

14. The population of cells of claim 12, wherein the cells undergoing mesodermal induction are contacting with one or more of an miRNA inhibitor of miR-221-3p, miR-1271- 5p and miR-559, preferably miR-221-3p.

15. The population of cells of claim 1, wherein the vasculogenic KNA+ mesodermal cells are produced by a method comprising contacting the cells undergoing mesodermal induction with one or more miRNA mimic, wherein the one or more miRNA mimic mimics an miRNA that exhibits increased expression KDR⁺NCAM⁺APLNR⁺ mesoderm cells relative to PSCs.

16. The population of cells of claim 15, wherein the miRNA mimic mimics an miRNA selected from the group consisting of: miR-330-5p, miR-145-5p, miR-214-3p and miR-497- 5p.

17. The population of cells of claim 15, wherein the cells undergoing mesodermal induction are cultured with one or more of an miRNA mimic of miR-330-5p, miR-145-5p and miT-214-3p, preferably miR-330-5p.

18. The population of cells of claim 1, wherein the mesodermal induction further comprises contacting the cells undergoing mesodermal induction with a miR-214 mimic.

19. The population of cells of claim 1, wherein the KNA+ cells can differentiate into vasculogenic endothelial progenitor cells.

20. The population of cells of claim 19, wherein the vasculogenic endothelial progenitor cells comprise endothelial colony forming cells (ECFCs).

21. The population of cells of claim 20, wherein the ECFCs are produced by culturing a pluripotent stem cell in a first medium without BMP on a first matrix comprising laminin 411 and laminin 511 to produce an intermediate cell.

22. The population of cells of claim 21, further comprising culturing the intermediate cell in a second medium on a matrix comprising laminin 411 and laminin 511 to produce a mesodermal cell.

23. The population of cells of claim 22, further comprising culturing the mesodermal cell in a third medium on a second matrix comprising laminin 411 to produce an ECFC.

24. The population of cells of claim 21, wherein the first matrix comprises about 75% laminin 411 and about 25% laminin 511.

25. The population of cells of claim 21, wherein the second matrix comprises laminin 411.

26. The population of cells of claim 21, wherein the first medium is a conditioned medium without BMP.

27. The population of cells of claim 23, wherein the second and third media comprises BMP4, VEGF, and FGF2.

28. The population of cells of claim 20, wherein the ECFCs are produced by a method comprising contacting the iPSC or a progeny thereof with a forward programming factor.

29. The population of cells of claim 28, wherein the forward programming factor is ETV2.

30. The population of cells of claim 29, wherein the ETV2 is isoform 2 or a variant thereof.

31. The population of cells of claim 28, wherein the forward programming factor is selected from the group consisting of miR-200b, miR-93, miRNA-330-5p, miRNA-145-5p, miRNA-214-3p, miRNA-221-3p, miRNA-1271-5p, miRNA-559, and combinations thereof.

32. The population of cells of claim 28, wherein the forward programming factor is a mimic of a native miRNA.

33. The population of cells of claim 32, wherein the miRNA mimic is miRNA-93, miRNA-330-5p, miRNA-145-5p, or miRNA-214-3p.

34. The population of cells of claim 28, wherein the forward programming factor is a miRNA inhibitor.

35. The population of cells of claim 34, wherein the miRNA inhibitor is miRNA-221-3p, miRNA- 127 l-5p, miRNA-559, or miRNA-200b.

36. A composition used for the treatment of a disease or disorder comprising a therapeutically effective number of the KNA+ mesodermal cells, wherein the beta-2 microglobulin (B2M) expression has been altered, thereby reducing the surface expression of MHC Class I molecules in the cells.

37. The composition of claim 36, further comprising an agent wherein the agent enhances proliferation and/or survival of the KNA+ mesodermal cells.

38. The composition of claim 36, further comprising an agent wherein the agent promotes migration of the KNA+ mesodermal cells towards areas of injury and/or cellular dysfunction.

39. The composition of claim 36, further comprising an agent wherein the agent promotes engraftment of the KNA+ mesodermal cells in areas of injury and/or cellular dysfunction.

40. A kit comprising the cryopreserved, KNA+ mesodermal cells, wherein the beta-2 microglobulin (B2M) expression has been altered, thereby reducing the surface expression of MHC Class I molecules in the cells.

41. A method of treating a disease or disorder characterized by cellular dysfunction comprising administering to a subject in need thereof a population of vasculogenic KDR+NCAM+APLNR+ (KNA+) mesodermal cells, wherein the beta-2 microglobulin (B2M) expression has been altered, thereby reducing the surface expression of MHC Class I molecules in the cells.

42. The method of claim 41, wherein the cellular dysfunction comprises endothelial cell dysfunction.

43. The method of claim 41, wherein the method comprises administering the cells directly to the subject's organ, tissue or extremity in vivo.

44. The method of claim 41, wherein the method comprises promoting neovascularization in the subject's organ, tissue or extremity.

45. The method according to Claim 41, wherein the disease or disorder is a vascular and/or cardiac disease such as critical limb ischemia, diabetic retinopathy, arterial hypertension, pulmonary hypertension, traumatic vascular injuries, transplant vasculopathies, microvascular injuries, myocardial remodeling and vascular remodeling, ischemiareperfusion injuries and/or vasospastic diseases.

46. A method of preparing hypoimmune KDR+NCAM+APLNR+ (KNA+) mesodermal cells comprising culturing human pluripotent stem cells (PSCs) in vitro in a medium comprising Activin A, and altering the expression of beta-2 microglobulin (B2M) in the PSCs or KNA+ mesodermal cells, thereby generating the KNA+ mesodermal cells with reduced B2M expression.

47. The method of claim 46, wherein the cells are vasculogenic.

-31-

48. The method of claim 46, wherein the pluripotent stem cells are induced pluripotent stem cells (iPSCs).

49. The method of claim 46, wherein the B2M expression has been altered to be reduced compared to wild-type expression.

50. The method of claim 49, wherein B2M expression is reduced using genetic modification utilizing zinc-finger nucleases (ZFN), transcription activator-like effector nuclease (TALEN), a CRISPR/Cas system or homologous recombination techniques.

51. The method of claim 46, wherein the B2M expression has been altered with the use of a regulator.

52. The method of claim 51, wherein the regulator is a PNA, an LNA, a ssRNA, a dsRNA, an mRNA, a micro-RNA, a miRNA mimic, an antisense RNA, a ribozyme, an antisense oligonucleotide, a bifunctional antisense oligonucleotide, an shRNA, an antagomir, an aptamer, an siRNA, a dsDNA, a DNAzyme, a ssDNA, polypeptide or active fragment thereof, an antibody, an intrabody, a transbody, a protein, an enzyme, a peptidomimetic, a peptoid, a transcriptional factor, or a small organic molecule, and the like.

53. The method of claim 51, wherein the regulator is introduced by nucleofection or lipofection.

54. The method of any one of claims 46-53, further comprising culturing the pluripotent stem cells for about 24 hours in a mesoderm differentiation medium comprising Activin A, BMP-4, VEGF and FGF-2; and culturing on a mesoderm differentiation medium comprising BMP -4, VEGF and FGF-2 about every 24-48 hours thereafter for about 72 hours.

55. The method of any one of claims 46-54, further comprising the isolation of KNA+ mesodermal cells from a heterogeneous population based on the expression of KDR, NCAM, APLNR or any combination thereof.

-32-

56. The method of claim 55, wherein the isolation of KNA+ mesodermal cells is carried out via fluorescent- or magnetic-activated cell sorting.

57. The method of any one of claims 46-54, further comprising contacting the cells undergoing mesodermal induction with one or more miRNA inhibitor, wherein the one or more miRNA inhibitor inhibits an miRNA that exhibits decreased expression in KDR⁺NCAM⁺APLNR⁺ mesoderm cells relative to PSCs.

58. The method of claim 57, wherein the miRNA inhibitor inhibits an miRNA selected from the group consisting of: miR-221-3p, miR-1271-5p, miR-559, miR543, miR-361-3p, miR-30d-5p, miR-124-3p and miR-185-5p.

59. The method of claim 57, wherein the cells undergoing mesodermal induction are contacted with one or more of an miRNA inhibitor of miR-221-3p, miR-1271-5p and miR- 559, preferably miR-221-3p.

60. The method of any one of claims 46-54, further comprising contacting the cells undergoing mesodermal induction with one or more miRNA mimic, wherein the one or more miRNA mimic mimics an miRNA that exhibits increased expression KDR⁺NCAM⁺APLNR⁺ mesoderm cells relative to PSCs.

61. The method of claim 60, wherein the miRNA mimic mimics an miRNA selected from the group consisting of: miR-330-5p, miR-145-5p, miR-214-3p and miR-497-5p.

62. The method of claim 60, wherein the cells undergoing mesodermal induction are cultured with one or more of an miRNA mimic of miR-330-5p, miR-145-5p and miT-214-3p, preferably miR-330-5p.

63. The method of claim any one of claims 46-54, wherein the mesodermal induction further comprises contacting the cells undergoing mesodermal induction with a miR-214 mimic.

64. The method of claim 46, wherein the KNA+ cells can differentiate into vasculogenic endothelial progenitor cells.

-33-

65. The method of claim 64, wherein the vasculogenic endothelial progenitor cells comprise endothelial colony forming cells (ECFCs).

66. The method of claim 65, wherein the ECFCs are produced by culturing a pluripotent stem cell in a first medium without BMP on a first matrix comprising laminin 411 and laminin 511 to produce an intermediate cell.

67. The method of claim 66, further comprising culturing the intermediate cell in a second medium on a matrix comprising laminin 411 and laminin 511 to produce a mesodermal cell.

68. The method of claim 67, further comprising culturing the mesodermal cell in a third medium on a second matrix comprising laminin 411 to produce an ECFC.

69. The method of claim 68, wherein the first matrix comprises about 75% laminin 411 and about 25% laminin 511.

70. The method of claim 68, wherein the second matrix comprises laminin 411.

71. The method of claim 66, wherein the first medium is a conditioned medium without BMP.

72. The method of claims 67-68, wherein the second and third media comprises BMP4, VEGF, and FGF2.

73. The method of claim 65, wherein the ECFCs are produced by a method comprising contacting the iPSC or a progeny thereof with a forward programming factor.

74. The method of claim 73, wherein the forward programming factor is ETV2.

75. The method of claim 74, wherein the ETV2 is isoform 2 or a variant thereof.

76. The method of claim 73, wherein the forward programming factor is selected from the group consisting of miR-200b, miR-93, miRNA-330-5p, miRNA-145-5p, miRNA-214-3p, miRNA-221-3p, miRNA-1271-5p, miRNA-559, and combinations thereof.

-34-

77. The method of claim 73, wherein the forward programming factor is a mimic of a native miRNA.

78. The method of claim 77, wherein the miRNA mimic is miRNA-93, miRNA-330-5p, miRNA-145-5p, or miRNA-214-3p.

79. The method of claim 73, wherein the forward programming factor is a miRNA inhibitor.

80. The method of claim 79, wherein the miRNA inhibitor is miRNA-221-3p, miRNA- 1271-5p, miRNA-559, or miRNA-200b.

81. The method of claim 46, wherein the hypoimmune KNA+ mesodermal cells exhibit at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in B2M expression compared to KNA+ mesodermal cells generated from wild type PSCs, or wherein the hypoimmune KNA+ mesodermal cells do not express B2M.

82. The method of any one of claims 47-80, wherein the hypoimmune KNA+ mesodermal cells exhibit at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in surface expression of MHC class I molecules compared to KNA+ mesodermal cells generated from wild type PSCs, or wherein the hypoimmune KNA+ mesodermal cells do not have surface expression of MHC class I molecules.

83. The method of any one of claims 46-80, wherein the hypoimmune KNA+ mesodermal cells do not express B2M.

84. A hypoimmune KNA+ mesodermal cell obtained by the method according to claim 46.

85. A hypoimmune KNA+ mesodermal cell obtained by the method according to any one of claims 46-83.

86. A population of hypoimmune KNA+ mesodermal cells obtained by the method according to claim 46.

-35-

87. A population of hypoimmune KNA+ mesodermal cells obtained by the method according to any one of claims 46-83.

88. The population of hypoimmune KNA+ mesodermal cells according to claim 86, wherein at least 50%, 60%, 80%, 90%, 95%, 99%, or 100% of the population of hypoimmune KNA+ mesodermal cells have at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in B2M expression compared to KNA+ mesodermal cells generated from wild type PSCs.

89. A method of treating a disease or disorder characterized by cellular dysfunction comprising administering to a subject in need thereof the hypoimmune KNA+ mesodermal cell according to claim 84.

90. A method of treating a disease or disorder characterized by cellular dysfunction comprising administering to a subject in need thereof the population of hypoimmune KNA+ mesodermal cells according to claim 86.

91. A method of treating a disease or disorder characterized by cellular dysfunction comprising administering to a subject in need thereof the hypoimmune KNA+ mesodermal cell according to any one of claims 84-85, or the population of hypoimmune KNA+ mesodermal cells according to any one of claims 86-87.

92. The method of claim 89, wherein the cellular dysfunction comprises endothelial cell dysfunction.

93. The method of claim 90, wherein the cellular dysfunction comprises endothelial cell dysfunction.

94. The method of claim 91, wherein the cellular dysfunction comprises endothelial cell dysfunction.

95. The method of claim 89, wherein the method comprises administering the cells directly to the subject's organ, tissue or extremity in vivo.

-36-

96. The method of claim 90, wherein the method comprises administering the cells directly to the subject's organ, tissue or extremity in vivo.

97. The method of claim 91, wherein the method comprises administering the cells directly to the subject's organ, tissue or extremity in vivo.

98. The method of claim 89, wherein the method comprises promoting neovascularization in the subject's organ, tissue or extremity.

99. The method of claim 90, wherein the method comprises promoting neovascularization in the subject's organ, tissue or extremity.

100. The method of claim 91, wherein the method comprises promoting neovascularization in the subject's organ, tissue or extremity.

101. The method according to claim 89, wherein the disease or disorder is a vascular and/or cardiac disease such as critical limb ischemia, diabetic retinopathy, arterial hypertension, pulmonary hypertension, traumatic vascular injuries, transplant vasculopathies, microvascular injuries, myocardial remodeling and vascular remodeling, ischemiareperfusion injuries and/or vasospastic diseases.

102. The method according to claim 90, wherein the disease or disorder is a vascular and/or cardiac disease such as critical limb ischemia, diabetic retinopathy, arterial hypertension, pulmonary hypertension, traumatic vascular injuries, transplant vasculopathies, microvascular injuries, myocardial remodeling and vascular remodeling, ischemiareperfusion injuries and/or vasospastic diseases.

103. The method according to claim 91, wherein the disease or disorder is a vascular and/or cardiac disease such as critical limb ischemia, diabetic retinopathy, arterial hypertension, pulmonary hypertension, traumatic vascular injuries, transplant vasculopathies, microvascular injuries, myocardial remodeling and vascular remodeling, ischemiareperfusion injuries and/or vasospastic diseases.

-37-

104. A population of hypoimmune endothelial colony forming cells (ECFCs), wherein the ECFCs have altered beta-2 microglobulin (B2M) expression, thereby reducing the surface expression of MHC Class I molecules in the cells.

105. The population of ECFCs according to claim 104, wherein at least 50%, 60%, 80%, 90%, 95%, 99%, or 100% of the population of hypoimmune ECFCs have at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in B2M expression compared to wild type ECFCs.

106. The population of ECFCs according to claim 104, wherein the ECFCs exhibit at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in surface expression of MHC class I molecules compared to wild type ECFCs, or wherein the hypoimmune ECFCs do not have surface expression of MHC class I molecules.

107. The population of ECFCs according to claim 104, wherein the hypoimmune ECFCs do not express B2M.

108. The population of ECFCs according the claim 104, wherein the B2M expression has been altered to be reduced compared to wild-type expression.

109. The population of ECFCs according the claim 104, wherein B2M expression is reduced using genetic modification utilizing zinc-finger nucleases (ZFN), transcription activator-like effector nuclease (TALEN), a CRISPR/Cas system or homologous recombination techniques.

110. The population of ECFCs according the claim 104, wherein the B2M expression has been altered with the use of a regulator.

111. The population of ECFCs according the claim 110, wherein the regulator is a PNA, an LNA, a ssRNA, a dsRNA, an mRNA, a micro-RNA, a miRNA mimic, an antisense RNA, a ribozyme, an antisense oligonucleotide, a bifunctional antisense oligonucleotide, an shRNA, an antagomir, an aptamer, an siRNA, a dsDNA, a DNAzyme, a ssDNA, polypeptide or active fragment thereof, an antibody, an intrabody, a transbody, a protein, an enzyme, a peptidomimetic, a peptoid, a transcriptional factor, or a small organic molecule, and the like.

-38-

112. The population of ECFCs according the claim 110, wherein the regulator is introduced by nucleofection or lipofection.

113. A hypoimmune endothelial colony forming cell (ECFC), wherein the ECFC has altered beta-2 microglobulin (B2M) expression, thereby reducing the surface expression of MHC Class I molecules in the ECFC.

114. The ECFC according to claim 113, wherein the hypoimmune ECFC has at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in B2M expression compared to wild type ECFCs.

115. The ECFC according to claim 113, wherein the ECFC exhibits at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99%, or 100% reduction in surface expression of MHC class I molecules compared to wild type ECFCs, or wherein the hypoimmune ECFC does not have surface expression of MHC class I molecules.

116. The ECFC according to claim 113, wherein the hypoimmune ECFC does not express B2M.

117. The ECFC according to claim 113, wherein the B2M expression has been altered to be reduced compared to wild-type expression.

118. The ECFC according to claim 113, wherein B2M expression is reduced using genetic modification utilizing zinc-finger nucleases (ZFN), transcription activator-like effector nuclease (TALEN), a CRISPR/Cas system or homologous recombination techniques.

119. The ECFC according to claim 113, wherein the B2M expression has been altered with the use of a regulator.

120. The ECFC according to claim 119, wherein the regulator is a PNA, an LNA, a ssRNA, a dsRNA, an mRNA, a micro-RNA, a miRNA mimic, an antisense RNA, a ribozyme, an antisense oligonucleotide, a bifunctional antisense oligonucleotide, an shRNA, an antagomir, an aptamer, an siRNA, a dsDNA, a DNAzyme, a ssDNA, polypeptide or active fragment thereof, an antibody, an intrabody, a transbody, a protein, an enzyme, a peptidomimetic, a peptoid, a transcriptional factor, or a small organic molecule, and the like.

-39-

121. The ECFC according to claim 107, wherein the regulator is introduced by nucleofection or lipofection.

122. A method of treating a disease or disorder characterized by cellular dysfunction comprising administering to a subject in need thereof the population of hypoimmune ECFCs according to claims 104-112 or the ECFCs according to claims 113-121.

123. A method of treating a disease or disorder characterized by cellular dysfunction comprising administering to a subject in need thereof the population of hypoimmune ECFCs according to claim 104.

124. A method of treating a disease or disorder characterized by cellular dysfunction comprising administering to a subject in need thereof the ECFCs according to 113.

125. The method of claim 122, wherein the cellular dysfunction comprises endothelial cell dysfunction.

126. The method of claim 123, wherein the cellular dysfunction comprises endothelial cell dysfunction.

127. The method of claim 124, wherein the cellular dysfunction comprises endothelial cell dysfunction.

128. The method of claim 122, wherein the method comprises administering the cells directly to the subject's organ, tissue or extremity in vivo.

129. The method of claim 123, wherein the method comprises administering the cells directly to the subject's organ, tissue or extremity in vivo.

130. The method of claim 124, wherein the method comprises administering the cells directly to the subject's organ, tissue or extremity in vivo.

131. The method of claim 122, wherein the method comprises promoting neovascularization in the subject's organ, tissue or extremity.

-40-

132. The method of claim 123, wherein the method comprises promoting neovascularization in the subject's organ, tissue or extremity.

133. The method of claim 124, wherein the method comprises promoting neovascularization in the subject's organ, tissue or extremity.

134. The method according to claim 122, wherein the disease or disorder is a vascular and/or cardiac disease such as critical limb ischemia, diabetic retinopathy, arterial hypertension, pulmonary hypertension, traumatic vascular injuries, transplant vasculopathies, microvascular injuries, myocardial remodeling and vascular remodeling, ischemiareperfusion injuries and/or vasospastic diseases.

135. The method according to claim 123, wherein the disease or disorder is a vascular and/or cardiac disease such as critical limb ischemia, diabetic retinopathy, arterial hypertension, pulmonary hypertension, traumatic vascular injuries, transplant vasculopathies, microvascular injuries, myocardial remodeling and vascular remodeling, ischemiareperfusion injuries and/or vasospastic diseases.

136. The method according to claim 124, wherein the disease or disorder is a vascular and/or cardiac disease such as critical limb ischemia, diabetic retinopathy, arterial hypertension, pulmonary hypertension, traumatic vascular injuries, transplant vasculopathies, microvascular injuries, myocardial remodeling and vascular remodeling, ischemiareperfusion injuries and/or vasospastic diseases.

-41-