WO2023063695A1 - 잔토리졸 또는 이의 염을 포함하는 항-코로나바이러스용 조성물 - Google Patents

잔토리졸 또는 이의 염을 포함하는 항-코로나바이러스용 조성물 Download PDF

Info

Publication number
WO2023063695A1
WO2023063695A1 PCT/KR2022/015329 KR2022015329W WO2023063695A1 WO 2023063695 A1 WO2023063695 A1 WO 2023063695A1 KR 2022015329 W KR2022015329 W KR 2022015329W WO 2023063695 A1 WO2023063695 A1 WO 2023063695A1
Authority
WO
WIPO (PCT)
Prior art keywords
coronavirus
protein
scov2
amino acids
composition
Prior art date
Application number
PCT/KR2022/015329
Other languages
English (en)
French (fr)
Inventor
오종원
김민우
조희
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from KR1020220123702A external-priority patent/KR20230054269A/ko
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2023063695A1 publication Critical patent/WO2023063695A1/ko

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/045—Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
    • A61K31/05—Phenols
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K9/00—Medicinal preparations characterised by special physical form
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12—Antivirals
    • A61P31/14—Antivirals for RNA viruses

Definitions

  • composition comprising zantorizol or a salt thereof.
  • SCoV2 Severe acute respiratory syndrome coronavirus 2
  • WHO World Health Organization
  • SCoV2 which belongs to the Coronaviridae family, has a positive-stranded RNA genome of ⁇ 31 kb.
  • the RNA genome is replicated by a replication polyprotein (pp) encoded by ORF1a and ORF1b.
  • pp1ab which contains a nonstructural protein (Nsp) produced by -1 programmed ribosomal frameshifting, is a nonstructural protein with papain-like protease (PLpro) activity. It is cleaved by the 3 (Nsp3) and 3C-like (3CL: 3C-like) proteases Nsp5 to generate a total of 16 viral Nsp.
  • SCoV2 replication is used to express viral structural proteins (spike (S), envelope (E), membrane (M) and nucleocapsid (N) proteins) and accessory proteins. Generate a set of subgenomic (sg) mRNAs. Some of the non-structural proteins are known to have a function of blocking the host's innate antiviral immune response.
  • IFNs interferon
  • ribavirin ribavirin
  • lopinavir/ritonavir a viral RNA polymerase inhibitor currently approved by the U.S. Food and Drug Administration (FDA)
  • FDA U.S. Food and Drug Administration
  • Medicinal plants have been used for thousands of years to treat a variety of diseases, including microbial infections, metabolic disorders and cancer. Recent studies have also highlighted the potential usefulness of medicinal plants traditionally used in the treatment of the 2019 coronavirus (COVID-19).
  • Turmeric extract has been successfully used as a prophylactic for the treatment of various diseases.
  • Xanthorrhizol (XNT: C 15 H 22 O, 2-methyl-5-[(2R)-6-methyl-5-hepten-2-yl]phenol), also known as Java turmeric, is a It is a major component of the turmeric rhizome of Curcuma xanthorrhizza Roxb., a plant of the ginger family of the family Zingiberaceae .
  • Xanthorisole is known to have various biological activities such as anticancer, antibacterial, anti-inflammatory, antioxidant, antihyperglycemic, antihypertensive, antiplatelet, renoprotective, hepatoprotective, estrogenic and antiestrogenic effects.
  • anticancer antibacterial, anti-inflammatory, antioxidant, antihyperglycemic, antihypertensive, antiplatelet, renoprotective, hepatoprotective, estrogenic and antiestrogenic effects.
  • SCoV2 and other CoVs the antiviral activity in cells infected with SCoV2 and other CoVs has not yet been evaluated.
  • Xanthoizole has the ability to inhibit viral replication of SCoV2, and furthermore, against several CoVs, including SCoV1 and human coronavirus 229E (HCoV-229E) that causes colds. It has been demonstrated to exhibit broad-spectrum antiviral activity.
  • the present invention was completed by demonstrating high antiviral efficacy against several variants of concern of SCoV2.
  • One aspect is to provide an anti-coronavirus composition
  • an anti-coronavirus composition comprising Xanthorrhizol (XNT) or a salt thereof.
  • Another aspect is to provide a pharmaceutical composition for preventing or treating coronavirus infection comprising Xanthorrhizol (XNT) or a pharmaceutically acceptable salt thereof.
  • XNT Xanthorrhizol
  • Another aspect is to provide a method for preventing or treating coronavirus infection comprising administering Xanthorrhizol or a pharmaceutically acceptable salt thereof to a subject in need thereof.
  • Another aspect is to provide the use of Xanthorrhizol or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for preventing or treating coronavirus infection.
  • One aspect provides an anti-coronavirus composition
  • XNT Xanthorrhizol
  • Xanthorrhizol is known as Java turmeric, and is a turmeric root of Curcuma xanthorrhizza Roxb., a plant of the ginger family of the Zingiberaceae family. It is the main component of the stem.
  • the xanthorisol is known to have various biological activities such as anticancer, antibacterial, anti-inflammatory, antioxidant, antihyperglycemic, antihypertensive, antiplatelet, renoprotective, hepatoprotective, estrogenic and antiestrogenic effects.
  • salt refers to a salt prepared using a specific compound according to one aspect and a relatively non-toxic acid or base, and the composition may be used for various purposes such as a control composition in addition to a pharmaceutical composition.
  • prevention means to prevent or rescue cells from viruses
  • the control composition is a hydration agent, a suspension agent, an emulsion, an emulsion agent, an emulsion agent, a liquid agent, a dispersible liquid agent, a granular hydration agent, a granule agent, a powder agent, a liquid hydration agent, It may be formulated in any one form selected from the group consisting of granular hydration agents, water floating granules, and tablets. These preparations can be prepared by known methods, and can be prepared, for example, by mixing the active compound with an extender (liquid solvent or solid carrier), optionally using a surfactant (emulsifier, dispersant or foam former).
  • an extender liquid solvent or solid carrier
  • a surfactant emulsifier, dispersant or foam former
  • virus is an infectious agent that can live only in the living cells of other organisms and an intermediate existence between animate and inanimate objects (non-cellular anti-living).
  • Coronaviridae belongs to the family Coronaviridae and is a single-stranded positive RNA virus with a size of about 100 to 220 nm and having a spherical outer membrane.
  • the composition comprising the zantorizole or a salt thereof is anti-coronavirus by suppressing the spike of coronavirus or the expression of N protein, or inhibiting the proliferation of the virus in such a way as to inhibit the replication of coronavirus. show effect.
  • the zantorizol may inhibit the replication of the coronavirus.
  • xanthorisole inhibits SCoV1 replication, thereby actually reducing the expression of capsid N protein, a viral structural protein.
  • N gene-specific sg-mRNA produced by transcription-regulating sequence 9 (TRS9) when the SCoV1 subgenomic leprechaun is cloned by xantholyzol treatment It was confirmed that the number of copies of was reduced, and it was also confirmed that the N protein expression was significantly decreased (see Example 2(3)).
  • the treatment of HCV and human norovirus was performed to determine whether xanthorizole (XNT) acts as a broad-spectrum antiviral agent that can be used in the treatment of a wide range of pathogenic RNA viruses.
  • XNT xanthorizole
  • the effect of inhibiting viral replication was analyzed in Huh7-derived cell lines in which replication of the self-replicating viral subgenome was occurring. As a result, it was confirmed that none of the replicons were inhibited by xanthorisole (XNT). Furthermore, it was confirmed that no antiviral activity was observed in RAW264.7 cells infected with mouse norovirus.
  • xanthorizole (XNT) against human coronavirus (HCoV-229E) was evaluated.
  • titer plaque formation titer
  • the zantorizol may inhibit the expression of the spike protein or N protein of the coronavirus.
  • xanthorisole XNT
  • type I IFN-deficient Vero E6 cells infected with SCoV2 KCDC03 isolate
  • SCoV2 susceptible lung adenocarcinoma Calu-3 cells SCoV2 -permissive lung adenocarcinoma Calu-3 cells
  • XNT xantorizole
  • the concentration of zantorizol in the composition is 2 to 50 ⁇ M, 5 to 50 ⁇ M, 10 to 50 ⁇ M, 15 to 50 ⁇ M, 2 to 40 ⁇ M, 5 to 40 ⁇ M, 10 to 40 ⁇ M, 2 to 30 ⁇ M ⁇ M, 5 to 30 ⁇ M or 2 to 20 ⁇ M.
  • cytotoxicity when the concentration of xanthorisol in the composition exceeds 50 ⁇ M, cytotoxicity may begin to appear, and when the concentration of zantorizol in the composition is less than 2 ⁇ M, the active ingredient, xanthorisol, is anti-inflammatory. - May not be enough to show the coronavirus effect.
  • the coronavirus is SARS-CoV-1: Severe Acute Respiratory Syndrome Coronavirus1, SARS-CoV-2: Severe Acute Respiratory Syndrome Coronavirus2, human coronavirus (HCoV -229E: may be one or more coronaviruses selected from the group consisting of human coronavirus 229E) and variants thereof.
  • SARS-CoV-1 Severe acute respiratory syndrome coronavirus 1
  • SARS severe acute respiratory syndrome
  • It is a virus that infects lung epithelial cells of humans, bats, and Asian civets.
  • SARS-CoV-2 Severe acute respiratory syndrome coronavirus 2
  • type 2 severe acute respiratory syndrome coronavirus and positive sense single-stranded RNA It is the causative agent of the genetic zoonotic infection and human-to-human transmission of COVID-19.
  • human coronavirus refers to a species of coronavirus that infects humans and bats, and is an enveloped positive single-stranded RNA virus, which is one of the viruses that cause the common cold.
  • coronavirus variant means that the genome is modified compared to the representative species of the virus, and in one aspect, the coronavirus variant is 90%, 91%, 92%, 93%, 94%, 95% of the coronavirus. , 96%, 97%, 98% or 99% genomic or amino acid homology.
  • the SARS coronavirus 2 variants may be variants of concern, specifically alpha, beta, gamma, delta and omicron variants. It may be one or more selected from the group consisting of.
  • Nsp5 Xanthoizole
  • Nsp12 and Nsp13 were used to identify potential targets, and the Nsp are SCoV1 and SCoV2 It was confirmed that 96.4%, 96.1% and 99.8% amino acid identity were respectively shown between them (see Example 2(6)).
  • mutant amino acids constituting one or more proteins selected from the group consisting of Nsp2, Nsp3, Nsp4, Nsp5, Nsp6, Nsp7, Nsp12, Nsp13, Nsp14 and Nsp16 of the virus may be mutated.
  • Nonstructural protein refers to a nonstructural protein, and in virology, a nonstructural protein does not mean a protein encoded by a virus or a part of a virus particle, and a virus protease (3CL/nsp5 , etc.), It includes various enzymes and transcription factors that viruses use to replicate themselves, such as the RNA replicase complex or other template-directed polymerases and some viral proteins that they use to evade host defense mechanisms. .
  • the variant is amino acids at position 85 of the Nsp2 protein, amino acids at positions 77, 707, 792 and 822 of the Nsp3 protein, amino acids at positions 293 and 446 of the Nsp4 protein, Amino acids at positions 149 and 181 of Nsp6 protein, amino acids at position 25 of Nsp7 protein, amino acids at positions 323 and 671 of Nsp12 protein, amino acids at positions 77 and 210 of Nsp13 protein, and position 394 of Nsp14 protein At least one amino acid selected from the group consisting of the amino acid at position 6 and the amino acid at position 6 of the Nsp16 protein may be mutated.
  • mutation means that the amino acid of the coronavirus is arginine, histidine, lysine, asparaic acid, glutamic acid, serine, threonine, asparagine, glutamine, cysteine, selenocysteine, glycine, proline, alanine, valine, leucine, isoleucine , methionine, phenylalanine, tyrosine, tryptophan, or a modification thereof.
  • the composition containing the zantorizole or a salt thereof exhibits an anti-coronavirus effect by inhibiting viral growth not only for the coronavirus but also for the variant coronavirus.
  • xantorizole xantorizole
  • KCDC03 isolate SARS-CoV-2/human/KOR/KCDC03/2020
  • Nsp2 Nsp2
  • YS006 isolate SARS-CoV-2/human/KOR/YS006/2020
  • delta mutant YS117 SARS-CoV-2/human/ KOR/YS117/2021
  • Omicron mutants BA.1, YS430 isolate
  • the composition inhibits the spike of coronavirus and the expression of N protein, and inhibits the replication of coronavirus, thereby inhibiting SCoV2 coronavirus in which mutations are introduced into the above-mentioned Nsp proteins, resulting in an excellent anti-viral effect.
  • Another aspect provides a pharmaceutical composition for preventing or treating coronavirus infection comprising Xanthorrhizol (XNT) or a pharmaceutically acceptable salt thereof.
  • XNT Xanthorrhizol
  • the “zantorizol”, “coronavirus”, etc. may be within the above-mentioned range.
  • composition exhibits properties that are not toxic to cells or humans exposed to the composition.
  • pharmaceutically acceptable salt refers to a salt prepared using a specific compound according to one aspect and a relatively non-toxic acid or base.
  • base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of base in neat solution or in a suitable inert solvent.
  • Pharmaceutically acceptable base addition salts include salts of sodium, potassium, calcium, ammonium, organic amines, or magnesium or similar salts.
  • acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of an acid in neat solution or in a suitable inert solvent.
  • Pharmaceutically acceptable acid addition salts include salts of inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid, carbonic acid, hydrogen carbonate ion, phosphoric acid, hydrogen phosphate ion, dihydrogen phosphate ion, sulfuric acid, hydrogen sulfate ion, hydroiodic acid or phosphorous acid; and salts of organic acids such as acetic acid, propionic acid, isobutyric acid, maleic acid, malonic acid, benzoic acid, succinic acid, suberic acid, fumaric acid, lactic acid, mandelic acid, phthalic acid, benzenesulfonic acid, p-tolylsulfonic acid, citric acid, tartaric acid, and methanesulfonic acid. and salts of amino acids (eg, arginine) and salts of organic acids such as glucuronic acid.
  • inorganic acids such as hydrochloric acid, hydrobromic acid, nitric acid
  • coronavirus infection is a severe respiratory syndrome caused by a coronavirus
  • the coronavirus is SARS-CoV-1: Severe Acute Respiratory Syndrome Coronavirus1, SARS-CoV-2 -2: Severe Acute Respiratory Syndrome Coronavirus2), human coronavirus (HCoV-229E: human coronavirus 229E), and variants thereof.
  • coronavirus variant means that the genome is modified compared to the representative species of the virus, and in one aspect, the coronavirus variant is 90%, 91%, 92%, 93%, 94%, 95% of the coronavirus. , 96%, 97%, 98% or 99% genomic or amino acid homology.
  • the SARS coronavirus 2 variants may be variants of concern, specifically alpha, beta, gamma, delta and omicron variants. It may be one or more selected from the group consisting of.
  • prevention refers to any action that inhibits infection of a subject with a coronavirus or delays the onset of a coronavirus infection by administering a pharmaceutical composition according to one aspect.
  • treatment refers to all activities that improve or beneficially change symptoms of a coronavirus infection in an individual by administration of a pharmaceutical composition according to one aspect.
  • administration refers to introducing a predetermined substance into an individual by an appropriate method
  • subject refers to all organisms such as rats, mice, livestock, and the like, including humans capable of carrying a coronavirus. As a specific example, it may be mammals including humans.
  • the zantorizol may inhibit the replication of the coronavirus.
  • the zantorizol may inhibit the expression of the spike protein or N protein of the coronavirus.
  • the concentration of zantorizol in the pharmaceutical composition is 2 to 50 ⁇ M, 5 to 50 ⁇ M, 10 to 50 ⁇ M, 15 to 50 ⁇ M, 2 to 40 ⁇ M, 5 to 40 ⁇ M, 10 to 40 ⁇ M, 2 to 30 ⁇ M, 5 to 30 ⁇ M or 2 to 20 ⁇ M.
  • cytotoxicity may begin to appear on cells infected with coronavirus, and the concentration of zantorizol in the pharmaceutical composition is 2 ⁇ M. If less than, the active ingredient, xanthorisol, may not be sufficient to show a preventive or therapeutic effect on coronavirus infection.
  • the pharmaceutical composition can exhibit an excellent preventive or therapeutic effect of coronavirus infection by inhibiting the spike of coronavirus and the expression of N protein and suppressing the replication of coronavirus, and furthermore, the coronavirus It can also exhibit excellent preventive or therapeutic effects against coronavirus infections caused by variants of.
  • the pharmaceutical composition may be provided as a pharmaceutical composition including an active ingredient alone or one or more pharmaceutically acceptable carriers, excipients or diluents.
  • the carrier may be, for example, a colloidal suspension, powder, saline solution, lipid, liposome, microspheres or nano-spherical particles. They may be complexed with or associated with the delivery vehicle and are known in the art such as lipids, liposomes, microparticles, gold, nanoparticles, polymers, condensation reagents, polysaccharides, polyamino acids, dendrimers, saponins, adsorption enhancing substances or fatty acids. It can be delivered in vivo using known delivery systems.
  • compositions When the pharmaceutical composition is formulated, it is prepared using diluents or excipients such as commonly used lubricants, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc.
  • diluents or excipients such as commonly used lubricants, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, fillers, extenders, binders, wetting agents, disintegrants, surfactants, etc.
  • parenteral administration may include sterilized aqueous solutions, non-aqueous solvents, suspensions, emulsions, freeze-dried formulations, and suppositories.
  • Propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used as non-aqueous solvents and suspensions.
  • suppositories As a base for suppositories, witepsol, macrogol, Tween 61, cacao butter, laurin paper, glycero-geratin, etc. may be used, and when preparing in the form of eye drops, known diluents or excipients may be used. there is.
  • the pharmaceutical composition may be administered intranasally.
  • nasal administration means administration of a drug through the nasal mucosa or nasal-brain route, and formulations for nasal administration may be administered utilizing a delivery device, for example, aerosol delivery. Any form of aerosolization known in the art may be used, including spray bottle, spray therapy, atomization or pump aerosolization of liquid formulations and aerosolization of dry powder formulations.
  • Nasal formulations may also be administered using plastic squeeze bottles with holes or openings dimensioned to aerosolize the aerosol formulation, for example by forming a spray upon squeezing.
  • the opening is usually at the top of the bottle, and the top may generally be tapered to fit partially into the nasal passage for efficient administration of the aerosol formulation.
  • the pharmaceutical composition is administered in a pharmaceutically effective amount.
  • pharmaceutically effective amount means an amount sufficient to treat a disease with a reasonable benefit/risk ratio applicable to medical treatment, and the effective dose level depends on the type and severity of the patient's disease, the activity of the drug, and the drug. sensitivity, time of administration, route of administration and excretion rate, duration of treatment, factors including concomitantly used drugs, and other factors well known in the medical field.
  • the administration of the pharmaceutical composition may be administered once a day or divided into several times. For example, it may be administered every other day or one day a week. Specifically, the pharmaceutical composition may be administered at 0.001 to 1000 mg/kg/day, more specifically at 0.1 to 100 mg/kg/day. The administration may be administered once a day or divided into several times.
  • Another aspect provides a method for preventing or treating coronavirus infection comprising administering Xanthorrhizol or a pharmaceutically acceptable salt thereof to a subject in need thereof.
  • the method may be administered in parallel with a known composition or other pharmaceutical composition having a preventive or therapeutic effect on coronavirus infection, may be administered simultaneously, separately, or sequentially, and may be administered single or multiple times. there is. Considering all of the above factors, it is important to administer an amount that can obtain the maximum effect with the minimum amount without side effects, which can be easily determined by those skilled in the art.
  • the spike of the coronavirus and the expression of the N protein are inhibited, and the replication of the coronavirus is inhibited, resulting in an excellent treatment of coronavirus infection. It can exhibit a preventive or therapeutic effect, and furthermore, it can exhibit an excellent preventive or therapeutic effect against coronavirus infections caused by variants of the coronavirus.
  • Another aspect provides the use of Xanthorrhizol or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for preventing or treating coronavirus infection.
  • coronavirus infection means that is within the above-described range.
  • Another aspect provides the use of an anti-coronavirus composition comprising Xanthorrhizol or a pharmaceutically acceptable salt thereof for the manufacture of a medicament for preventing or treating coronavirus infection.
  • coronavirus infection means that, "prevention”, “treatment”, “zantorizol”, “pharmaceutically acceptable salt”, “anti-coronavirus composition” and the like may be within the above-described range.
  • a composition containing Xanthorrhizol or a salt thereof according to one aspect may exhibit excellent effects in anti-coronavirus effect and/or preventive, ameliorative, or therapeutic effect of coronavirus infection through inhibition of coronavirus replication.
  • the composition can be used as a wide range of anti-coronavirus compositions, as it has been confirmed that the composition has excellent anti-viral effects against various coronaviruses, including variants of coronaviruses.
  • FIG. 1 is a diagram showing the results of confirming the antiviral activity of Xanthorrhizol (XNT) against SCoV2
  • FIG. 1A is a diagram showing the chemical structure of Xanthorrhizol
  • FIG. 1B is a diagram showing the cytotoxicity of Xanthorrhizol
  • Figure 1C is a diagram showing the intracellular viral RNA measured 24 hours after treatment of SCoV2 (KCDC03)-infected VeroE6 cells with zantorizole
  • Figure 1D is a diagram showing SCoV2 (KCDC03)-infected VeroE6 cells.
  • Figure 1E is a diagram showing the extracellular viral RNA measured 24 hours after treating cells with xanthorisole
  • FIGS. 1G and 1H show the results confirming the antiviral activity of xantorizole in Calu-3 cells. It is a diagram showing (*P ⁇ 0.05; **P ⁇ 0.01; ***P ⁇ 0.001; ****P ⁇ 0.0001; n.s., not significant).
  • Figure 2 is a diagram showing the results of confirming the SCoV2 inhibitory activity of xanthorisole in Calu-3 cells
  • Figure 2A is a diagram showing the cytotoxicity of zantorizol after treatment with zantorizol in Calu-3 cells
  • Figure 3 is a diagram showing the antiviral activity of remdesivir (RDV) against SCoV2
  • Figure 3A is a diagram showing the results of confirming the cytotoxicity of remdesivir in Vero E6 cells
  • Figure 4 is a diagram showing the results of analyzing the effect of xantorizole on SCoV2 cell entry
  • Figure 4A is a plasmid used for the generation of pseudotype (pseudotype) MLV (MLV: murine leukemia virus) loaded with SCoV2 spike protein A schematic diagram of them
  • Figure 4B is a diagram showing the results of analyzing whether the E-64d drug inhibits the entry process of the generated pseudotype virus through the endosome
  • Figures 4C and 4D are the pseudotype virus described above.
  • FIG. 5 is a diagram showing the results of analyzing the effect of suppressing the replication of SCoV1 subgenomic replicon by xanthorisole, and showing the results of SCoV1 by xantorizole in HEK293 cells transfected with a subgenomic replicon expression vector. It is a diagram showing the results of analyzing the effect of suppressing subgenomic replication and thereby reducing the expression level of the viral capsid protein (N).
  • FIG. 6 is a diagram showing the results of analyzing the ability of zantorizol to induce interferon (IFN) expression.
  • 7A and 7B are evaluations of the antiviral activity of xantorizole in R-1 and HG23 cell lines containing self-replicating HCV subgenomic leprechauns (a) and human norovirus subgenomic leprechauns (b), respectively. It is a diagram showing the result.
  • 7c and 7d are diagrams showing intracellular MNV-1 genome copy number (c) and infectious virus titer (plaque titer) (d), after infection of RAW264.7 cells with MNV-1, It is a diagram showing the result of analyzing the virus growth inhibitory effect (n.s., not significant).
  • FIG. 8 is a diagram showing the results of comparing the cytotoxicity and antiviral activity of zantorizole and remdesivir (RDV) on HCoV-229E and Huh7 cells
  • FIGS. 8B and 8D are diagrams showing the results of evaluating the cytotoxicity of sol (A) and remdesivir (C) by the MTS method
  • FIG. 8B and FIG. It is a figure showing the result of comparing viral activity (ND, not detected).
  • Figure 9 is a diagram showing the results of analyzing the antiviral titer of SCoV2 mutants of zantorizole (**P ⁇ 0.01; ***P ⁇ 0.001; ****P ⁇ 0.0001, YS430 (Omicron) BA.1 Omicron Mutant).
  • FIG. 10 is a diagram showing the expression and purification results of SCoV2 Nsp12 protein
  • FIG. 10A is a schematic diagram of recombinant N-terminal (His) 6 -tagged Nsp12 protein
  • FIG. 10B is a purified wild-type Nsp12 and its inactive derivative Nsp12 ( SAA) is a diagram showing the results of staining with Coomassie blue after SDS-PAGE
  • FIG. It is a diagram showing the result of image analysis of RNA by autoradiography.
  • 11a is a diagram showing the results of analyzing the SCoV2 Nsp12 (RdRp) inhibitory activity of zantorizole.
  • Figure 11b is a schematic diagram (top) of an in vitro FRET-based SCoV2 Nsp5 protease activity assay experiment and a diagram showing the results of analyzing the activity inhibitory ability of xantorizole and ebselen, a known Nsp5 activity inhibitor.
  • 11c is a schematic diagram (top) of FRET-based SCoV2 Nsp13 helicase activity analysis and a diagram showing the results of analyzing the activity inhibitory ability of xantorizole and bismuth, a known Nsp13 activity inhibitor.
  • Figure 12 is a diagram showing the results of in vitro SCoV2 Nsp5 protease activity analysis using purified Nsp5 protein
  • Figure 12A is a schematic diagram of the N-terminal (His) 6 -tagged recombinant Nsp5 protein used in the experiment
  • Figure 12B is a diagram showing the results of evaluating the difference in Nsp5 activity change with and without Factor X protease treatment using a FRET-based Nsp5 protease activity assay (****P ⁇ 0.0001)
  • FIG. 12C is N-terminus with Factor X treatment.
  • His It is a diagram showing the result of determining the Km value of the purified active Nsp5 protein from which the 6 -tag was excised.
  • Figure 13 is a diagram showing the results of in vitro SCoV2 Nsp13 helicase activity assay using purified Nsp13 protein
  • Figure 13A is a schematic diagram of the recombinant N-terminal (His) 6 -tagged Nsp13 protein
  • Figure 13B is an analysis
  • Fig. 13C is a diagram showing the result of determining the Km value of the SCoV2 Nsp13 protein.
  • Xanthorrhizol and ebselen with a purity of 97% or more were purchased from Cayman Chemical (Ann Arbor, MI, USA).
  • Xanthorizole (XNT) was dissolved in 100% DMSO, and culture medium or each enzymatic reaction or SCoV2 (SARS-CoV-2: severe acute respiratory syndrome coronavirus 2) spike at a final concentration of 0.1% or 1% to 4%. It was used in a virus cell entry experiment using a murine leukemia virus (MLV) pseudovirus loaded on the surface.
  • Remdesivir was obtained from MedChemExpress (MCE: Monmouth Junction, NJ, USA).
  • the pSARS-REP-Feo plasmid is a vector capable of expressing the SCoV1 (SARS-CoV-1: Severe Acute Respiratory Syndrome Coronavirus1) subgenome expressing a firefly luciferase (Fluc) reporter.
  • Antibodies were purchased and used from the following manufacturers: mouse monoclonal anti- ⁇ tubulin antibody (clone DM1A) from Calbiochem (La Jolla, CA, USA), rabbit polyclonal antibody from Cell Signaling (Beverly, MA, USA). - ⁇ -actin antibody (#4967), mouse monoclonal from SinoBiological (Beijing, China) anti-SCoV2 nucleocapsid (N) antibody (40143-MM08) and mouse monoclonal from GeneTex (Irvine, CA, USA) Anti-SCoV1/SCoV2 anti-S antibody (clone 1A9).
  • African green monkey kidney cell line Vero E6, human lung adenocarcinoma cell line Calu-3, human embryonic kidney 293 (HEK293), human embryonic kidney derived HEK293T cells, human fetal lung fibroblast MRC-5 and murine macrophage cell line RAW2647 were 10% fetal bovine It was cultured in DMEM (Dulbecco's modified Eagle's medium) supplemented with serum (FBS: fetal bovine serum), 100 U/ml of penicillin, and 100 ⁇ g/ml of streptomycin.
  • DMEM Dulbecco's modified Eagle's medium
  • FBS fetal bovine serum
  • the human hepatocellular carcinoma cell line Huh7 was cultured in DMEM supplemented with 10% FBS, 2 mM L-glutamine, 100 U/ml penicillin, 100 ⁇ g/ml streptomycin and 0.1 mM nonessential amino acids.
  • the SCoV2 strain KCDC03 (SARS-CoV-2/human/KOR/KCDC03/2020; GenBank accession number: MT020782 and GISAID accession number: EPI_ISL_407193) was obtained from the National Culture Collection for Pathogens (NCCP) of the Korea Centers for Disease Control and Prevention.
  • the GH strain SCoV2 YS006 (SARS-CoV-2/human/KOR/YS006/2020; GenBank accession number: MW345824 and GISAID accession number: EPI_ISL_660109) used in the infection experiment was a sample collected with a swab from the nasopharynx of a domestic COVID-19 patient.
  • Infectious virus titers were determined by plaque assay. To briefly summarize the method, Vero cells previously seeded and cultured in a 6-well plate were incubated with 10-fold serially diluted virus samples in serum-free medium for 1 hour to conduct infection experiments. Then, the infected cells were washed with PBS, and SeaPlaque agarose (1% w/v; Lonza, Rockland, Me., USA) was added to the solid medium. When plaque formation was seen after 3 to 4 days, the cells were fixed with 10% formaldehyde, stained with 1% crystal violet, and the number of plaques was measured.
  • SeaPlaque agarose 1% w/v; Lonza, Rockland, Me., USA
  • HCV-229E Human coronavirus 229E (HCoV-229E; ATCC VR-740) was grown and used in MRC-5 cells, and related experiments were conducted with institutional approval (IBC-A-202108-285-01, Yonsei University IBC approval). Plaque assay was performed according to the method described below. Ten-fold serially diluted virus samples were inoculated into Huh7 cells, and after incubation for 1 hour, the cells were incubated in 0.6% SeaPlaque agarose in DMEM supplemented with 2% FBS, 100 U/ml penicillin and 100 ⁇ g/ml streptomycin. It was quantified by staining when a plaque was formed by covering it with a solid medium to which furnace was added.
  • Murine norovirus [MNV-1.CW1 strain, a gift from Herbert W. Virgin (Washington University School of Medicine, St. Louis, MO, USA)] was propagated in RAW264.7 cells. Viral titers were determined via plaque assay according to previously described methods.
  • SCoV2 genomic RNA (gRNA), SCoV1 N-coding subgenomic (sg) mRNA, and HCV subgenomic RNA copy numbers were determined using Realtime PCR Master Mix (Toyobo, Osaka, Japan).
  • MNV-1 gRNA and Norwalk virus replicon RNA (HG23) copy numbers were determined using TOPreal qPCR 2X PreMIX (Enzynomics, Daejeon, South Korea). Primers used for RT-qPCR are shown in Table 1.
  • Standard RNAs for SCoV2 gRNA and SCoV1 sgRNA were prepared after in vitro transcription using the T7 MEGAscript kit (Ambion, TX, USA) and PCR-amplified cDNA templates.
  • a cDNA template covering a specific region of ORF1ab was mixed with a forward primer (SEQ ID NO: 1: 5'- TAATACGACTCACTATAG ATCATCCAAATCCTAAAGGATTTTG -3'; the underlined sequence is the T7 promoter) and a reverse primer.
  • SEQ ID NO: 2 5'-CGACATCAGTACTAGTGCCTGT-3'.
  • a Mixed bases are as follows: Y, C or T; N, any. NoV-GI, human norovirus genotype I.
  • a murine leukemia virus (MLV)-based SCoV2 spike protein (S)-like retrovirus (SARS2pp) was used for the SCoV2 entry assay.
  • MLV leukemia virus
  • S SCoV2 spike protein
  • SARS2pp bovine serum-derived retrovirus
  • pcDNA3.1_SCoV2-S ⁇ C19 was constructed by inserting a human codon-optimized cDNA encoding the SCoV2 S protein in which the C-terminal 19 amino acid ER-retaining signal was deleted.
  • HEK293T cells After transfecting HEK293T cells with pcDNA3.1_SCoV2-S ⁇ C19, such as the packaging vector and the vector containing the MLV gene reporter, the medium was changed after 12 hours, and the culture medium containing the pseudovirus was maintained for 2 days. obtained later. Then, the pseudovirus obtained through centrifugation was passed through a 0.22 ⁇ m syringe filter.
  • SARS2pp obtained by the above method was infected with HEK293T cells transiently expressing human ACE2 (hACE2) necessary for SCoV to enter host cells, and then performed Nano-Glo luciferase assay to detect pseudovirus through SCoV2 spike protein (S). The intracellular entry ability of was evaluated.
  • hACE2 human ACE2
  • the medium was replaced after 12 hours and further cultured for 48 hours. Then, the recovered cells were lysed in Glolysis buffer (Promega), and luciferase activity was quantitatively analyzed using the Nano-Glo luciferase assay system (Promega).
  • pSARS-REP-Feo and pRL-TK (Promega) expressing Renilla luciferase (Rluc) [used as internal controls to normalize transfection efficiency]] were subjected to calcium phosphate-mediated transfection ( calcium phosphate-mediated transfection) was introduced into HEK293 or HEK293T cells. After 6 hours, cells were washed and treated with specific concentrations of Xanthorisole (XNT) or DMSO vehicle. After further culturing for 24 hours, Rluc and Fluc activities were measured using the Dual-Glo luciferase assay system (Promega).
  • E. coli codon-optimized cDNAs for SCoV2 (Wuhan strain, NC_045512.2) Nsp5, Nsp12 and Nsp13 were chemically synthesized, PCR amplified using specific primer sets, and cloned into the expression vector pTrcHisB (Invitrogen).
  • pTrcHisB Invitrogen
  • a Factor-Xa cleavage site was inserted to obtain Nsp5 from which the (His) 6 -tag attached to the N-terminus for purification was removed.
  • Expression and purification of the recombinant SCoV2 enzyme were performed in the following manner. In summary, all of these enzymes are compatible with E.
  • Fractions containing the recombinant protein were pooled and dialyzed against buffer A (50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 1 mM DTT and 10% glycerol). If necessary, the protein was further purified using a Q-Sepharose column (Amersham Biosciences, Piscataway, NJ, USA). For Nsp5, the purified protein was treated with Factor-Xa (New England Biolabs, Ipswich, MA, USA) overnight at 20° C. in buffer A, and the mixture was loaded onto Ni-NTA agarose resin again, ( His) 6 -tagged Nsp5 protein-containing flow-through fractions were collected. All purified proteins were used after dialysis against buffer A and stored in aliquots at -80°C.
  • buffer A 50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 1 mM DTT and 10% glycerol.
  • buffer A 50 mM
  • RNA-dependent RNA polymerase (RdRp: RNA-dependent RNA polymerase) assay was performed using 3 pmol of purified recombinant SCoV2 Nsp12, 1 ⁇ g of poly(C) substrate, 10 pmol of oligo(G) 20 primer, 5 ⁇ M of GTP and 5 ⁇ Ci [ ⁇ 32 P]-GTP (Amersham Pharmacia Biotech, Uppsala, Sweden) was added in a total volume of 25 ⁇ l RdRp reaction buffer (50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 2 mM MnCl 2 , 1 mM DTT, 10% glycerol and 20 U of RNase inhibitor) and reacted at 32°C for 1 to 2 hours.
  • RdRp reaction buffer 50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 2 mM MnCl 2 , 1 mM DTT, 10% gly
  • the reaction product of the RdRp assay was electrophoresed on a denatured 7.5% polyacrylamide gel containing 8 M urea, and then the gel was exposed to a phosphorimaging plate.
  • the reaction product was Amersham Typhoon 5 Biomolecular It was detected using an Imager (GE Healthcare Life Sciences, Piscataway, NJ, USA).
  • the enzyme reaction for fluorescence resonance energy transfer (FRET)-based protease activity assay was performed in a black 96-well microtiter plate with a flat bottom.
  • Various concentrations of inhibitors were added to a total volume of 100 ⁇ l of reaction buffer (50 mM Tris buffer, pH 7.5) containing 100 nM purified recombinant SCoV2 Nsp5, pre-incubated for 10 min at room temperature, followed by FRET substrate peptide (DABCYL- KTSAVLQ SGFRKME-EDANS) was added at a final concentration of 10 ⁇ M to proceed with the enzymatic reaction.
  • the reaction proceeded at 25 °C for a certain period of time.
  • a helicase unwinding assay of double-stranded DNA by FRET-based helicase activity by Nsp13 was performed by the method described below.
  • FL-BHQ oligo SEQ ID NO: 18: 5'-TTTTTTTTTTTTTTTTTTTCGAGCACCGCCTGCGGCTGCACC-BHQ1-3'
  • RL-FAM oligo SEQ ID NO: 19: 5'-FAM-GGTGCAGCCGCAGCGGTGCTCG-3'
  • HEK293T or VeroE6 cells cultured in a 24-well plate were co-transfected with pGL3-IFN- ⁇ (500 ng) [provided by John Hiscott (McGill University, Montreal, Quebec, Canada)] and pRL-TK (50 ng). After 6 hours, fresh medium was added to the transfected cells, and after further culture for 24 hours, Fluc and Rluc activities were measured using Promega's Dual-Glo luciferase assay. Xanthorizol (XNT) or DMSO vehicle (0.1% final concentration) was added to the transfected cells in a fresh medium to analyze the interferon induction effect.
  • XNT Xanthorizol
  • DMSO vehicle 0.1% final concentration
  • the 50% effective concentration (EC 50 ) values for inhibition of CoV replication by antiviral compounds were determined using GraphPad Prism 6.01 (GraphPad Prism Software Inc., La Jolla, CA, USA). Data in the inventive examples are expressed as mean ⁇ standard deviation (SD) from at least three independent experiments unless otherwise specified. Statistical analysis was performed using GraphPad Prism 6.01. P-value was calculated using unpaired Student's t-test, and a value with P ⁇ 0.05 was considered statistically significant.
  • Antiviral activity was evaluated by treating type I IFN-deficient Vero E6 cells infected with SCoV2 (KCDC03) with xanthoizole (XNT) in a concentration range that exhibited minimal cytotoxicity ( ⁇ 20% cell viability reduction) (Fig. 1A and Figure 1B). It was confirmed that Xanthoizole (XNT) treatment resulted in a significant decrease in intracellular and extracellular viral RNA titers 24 hours after infection (hpi), with average EC 50 of 8.26 ⁇ M and 5.76 ⁇ M, respectively (FIG. 1C and FIG. 1D). ).
  • Xanthorizole decreased the infectious virus titer in a dose-dependent manner, and at a concentration of 20 ⁇ M, it was confirmed that the infectious virus titer was reduced by ⁇ 3-log 10 compared to the untreated group (FIG. 1E). Along with this, it was confirmed that the expression level of viral proteins (Spike and N protein) was also significantly reduced (FIG. 1F). Even in SCoV2-permissive lung adenocarcinoma Calu-3 cells (SCoV2-permissive lung adenocarcinoma Calu-3 cells), the cell viability was not affected (Fig. 2A), by treatment with 20 ⁇ M concentration xanthorizol (XNT) to induce intracellular and extracellular viruses.
  • Fig. 2A SCoV2-permissive lung adenocarcinoma Calu-3 cells
  • xantorizole 10 times greater than that of remdesivir (RDV), an FDA-approved phosphoramidite nucleoside prodrug known to inhibit RNA synthesis by SCoV2 RNA polymerase. more than twice as low. It was confirmed that remdesivir (RDV) did not affect cell viability at 20 ⁇ M, as did xantorizole (XNT) (FIG. 3A). It was confirmed that remderivir (RDV) inhibited viral replication in a dose-dependent manner, reducing viral protein expression and reducing extracellular viral RNA titer (FIGS. 3B and 3C). The EC 50 value was determined to be 0.33 ⁇ M.
  • xanthorizole XNT interferes with viral infectivity or entry by acting on viral particles or disrupting cell signaling pathways.
  • An MLV packaging vector a vector expressing the SCoV2 spike protein with the C-terminal 19 amino acids deleted, and an MLV gene expression vector modified to express the reporter were used to infect HEK293T cells, and the SCoV2 spike protein (S)-loading MLV-derived pseudovirus was used.
  • S SCoV2 spike protein
  • the assay constructed as described above was used to test the effect of pre-treatment or simultaneous treatment with infection of xanthorisole (XNT) on pseudovirus entry. As a result, it was confirmed that the entry of SCoV2-pseudotyped virus into cells was not affected (FIG. 4C).
  • pre-treatment with HCQ (2 ⁇ M) a lysosomotropic agent that has been shown to exhibit antiviral activity against SCoV2, inhibits the entry of pseudovirus and lowers the measured luciferase activity, unlike simultaneous treatment. confirmed (Fig. 4D).
  • the pre-treatment (20 ⁇ M) of xanthorizole (XNT) did not affect virus entry. Taken together, these results show that the antiviral activity of xanthorisole (XNT) is not caused by interfering with the viral entry process.
  • Xanthorizole is based on the fact that the amino acid sequence of SCoV2 ORF1a/b, which produces 16 non-structural proteins (Nsp) involved in viral replication and evasion of the cellular antiviral defense system, is very similar to the corresponding proteins in SCoV1.
  • Nsp non-structural proteins
  • Xanthorizole is a copy of N gene-specific sg-mRNA (N sg-mRNA) synthesized via transcription-regulating sequence 9 (TRS9) during subgenomic replicon replication at a concentration of 50 ⁇ M. showed the effect of lowering the number of As a result, it could be seen that the expression level of N protein was also significantly reduced. In conclusion, it was confirmed that zantorizol has the function of inhibiting the replication of SARS corona virus (FIG. 5).
  • Xanthorizole acts as a broad-spectrum antiviral agent that can be used for the treatment of various pathogenic RNA viruses other than SARS coronavirus. It was confirmed that xanthorizole (XNT) did not inhibit the replication of these viral genes when treated in Huh7-derived cell lines in which the self-replicating viral subgenomes of HCV and human norovirus (HuNoV) are replicating (FIGS. 7a and 7b). .
  • SCoV1, MERS-CoV and SCoV2 belong to betacoronavirus ( Betacoronavirus ) Evolutionarily diverged alphacoronavirus ( Alphacoronavirus )
  • XNT xantorizole
  • HoV human coronavirus
  • HCoV-229E human coronavirus
  • XNT Xanthorisole
  • XNT dose-dependently reduced the infectious viral titer in Huh7 cells infected with an MOI (Multiplicity of infection) of 0.0001, and reduced plaque formation by about 50% at a concentration of 10 ⁇ M.
  • MOI Multiplicity of infection
  • xanthorisole exhibits selective antiviral activity against SCoV and HCoV.
  • XNT xanthorisole
  • the GH strain YS006 (SARS-CoV-2/human/KOR/YS006/2020) evolved from them has a total of 5 amino acid mutations in Nsp proteins compared to the KCDC003 isolate, and the delta strain YS117 (SARS-CoV-2 /human/KOR/YS117/2021) has more mutations than this.
  • XNT xanthorisole
  • Nsp5 As essential viral enzymes for CoV replication, Nsp5, Nsp12, and Nsp13, which have very high amino acid sequence conservation, are known. Nsp5, also called main protease (Mpro) or 3CL protease, is an enzyme involved in generating Nsp12 RdRp and Nsp13 helicase by cleaving SCoV2 polyprotein at at least 11 sites.
  • Mpro main protease
  • 3CL protease is an enzyme involved in generating Nsp12 RdRp and Nsp13 helicase by cleaving SCoV2 polyprotein at at least 11 sites.
  • xanthorisole inhibited SCoV1 subgenomic replication
  • the three Nsp showed 96.4%, 96.1% and 99.8% amino acid identity between SCoV1 and SCoV2, respectively.
  • SCoV2 Nsp12 was expressed as an N-terminal (His) 6 -tagged fusion protein in E. coli and purified by affinity chromatography using a Ni-NTA column (FIGS. 10a and 10b). Purified Nsp12 showed activity capable of replicating poly(C) substrate under the condition that rG 20 primer was added. On the other hand, it was confirmed that the Nsp12(SAA) recombinant protein in which SDD, a catalytic triad residue in the RdRp active site, was substituted with SAA lost activity as expected (FIGS. 10b and 10c). As a result of analyzing the ability of xantorizole to inhibit replication enzyme activity using the assay established as described above, it was confirmed that the activity was not inhibited by directly acting on the replication enzyme (FIG. 11a).
  • xanthorisole exhibits CoV-selective antiviral efficacy, and that the antiviral activity of this compound is associated with inhibition of CoV viral gene replication.
  • results of Example 2.(6) above indicate that the SCoV replication inhibitory activity of xanthorizole (XNT) is not caused by direct inhibition of Nsp5, Nsp12 and Nsp13 enzymes whose amino acid sequences are conserved in CoV.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Virology (AREA)
  • Epidemiology (AREA)
  • Molecular Biology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

본 발명은 잔토리졸 또는 이의 염을 포함하는 항-코로나바이러스용 조성물에 관한 것이다. 본 발명에 따른 잔토리졸(Xanthorrhizol) 또는 이의 염을 포함하는 조성물은 코로나바이러스 복제 억제를 통해 항-코로나바이러스 효과 및/또는 코로나바이러스 감염증의 예방, 개선 또는 치료 효과에 있어서 우수한 효과를 나타낼 수 있다. 또한, 상기 조성물이 코로나바이러스들의 변이체들을 포함하여 다양한 코로나바이러스에 대해서도 우수한 항-바이러스 효과를 확인하였는 바, 광범위한 항-코로나바이러스 조성물로 사용될 수 있다.

Description

잔토리졸 또는 이의 염을 포함하는 항-코로나바이러스용 조성물
잔토리졸 또는 이의 염을 포함하는 항-코로나바이러스용 조성물에 관한 것이다.
2002년 11월 SARS(중증급성호흡기증후군; severe acute respiratory syndrome)가 발생한 후, 두 번째 SARS 코로나바이러스(CoV: coronavirus)인 SCoV2(Severe acute respiratory syndrome coronavirus 2)는 2019년 12월 중국 후베이성에서 발생하였다. SCoV2는 박쥐 유래 SARS 관련 코로나바이러스에서 유래한 것으로 추정되며, 천산갑과 같은 중간 숙주를 통해 인간 네트워크로 전파된 것으로 알려지고 있다. 사회적 거리두기, 대규모 진단, 자가 또는 강제 검역에도 불구하고 전례 없는 속도로 이 인수공통 바이러스가 급속히 확산됨에 따라 세계보건기구(WHO: World Health Organization)는 2020년 4월에 SCoV2 대유행을 선언하였다. 인간 네트워크로의 SCoV2 확산은 SCoV2에 감염된 환자의 사망 위험이 현재 퍼져 있는 기존 CoV 또는 인플루엔자 바이러스의 사망률보다 훨씬 높기 때문에(~2%) 의료시스템 및 공중보건에 큰 부담이 되고 있다.
코로나비리데(Coronaviridae)과에 속하는 SCoV2는 ~31 kb의 양성 가닥 RNA 게놈을 가지고 있다. RNA 게놈은 ORF1a 및 ORF1b에 의해 암호화된 복제 폴리단백질(pp: polyprotein)에 의해 복제된다. -1로 프로그래밍된 리보솜 프레임 이동(-1 programmed ribosomal frameshifting)에 의해 생성되는 비구조단백질(Nsp: nonstructural protein)을 포함하고 있는 pp1ab는 파파인 유사 프로테아제(PLpro: papain-like protease) 활성을 갖는 비구조 단백질 3(Nsp3) 및 3C 유사(3CL: 3C-like) 프로테아제 Nsp5에 의해 절단되어 총 16개의 바이러스 Nsp를 생성한다. 다른 CoV와 마찬가지로 SCoV2 복제는 바이러스 구조 단백질[스파이크(S: spike), 엔벨로프(E: envelope), 멤브레인(M: membrane) 및 뉴클레오캡시드(N: nucleocapsid) 단백질] 및 액세서리 단백질들을 발현하는데 사용되는 subgenomic(sg) mRNA 세트를 생성한다. 비구조단백질 중 일부는 숙주의 선천적 항바이러스 면역 반응을 차단하는 기능이 있는 것으로 알려지고 있다.
2003년 SCoV1 유행 당시 SARS 치료를 위해 인터페론(IFNs: interferon), 리바비린(ribavirin), 로피나비르/리토나비르(lopinavir/ritonavir) 등 다양한 항바이러스제가 사용되었다. 그러나 현재 미국 식품의약국(FDA: Food and Drug Administration)에서 승인한 바이러스 RNA 중합효소 억제제인 렘데시비르(RDV: remdesivir)를 제외하고 SCoV1 및 새로 등장한 SCoV2에 대한 임상 환경에서 사용하기 위해 아직 효과적이고 특정한 항바이러스 치료제가 개발 및 공식 승인되지 않았다.
약용식물은 미생물 감염, 대사 질환 및 암을 포함한 다양한 질병을 치료하기 위해 수천 년 동안 사용되어 왔다. 최근 연구에서는 2019년 코로나바이러스(COVID-19) 치료에 전통적으로 사용되어온 약용식물의 잠재적 유용성이 강조되기도 한 바 있다. 강황 추출물은 다양한 질병의 치료를 위한 예방약으로 성공적으로 사용되었다. 자바 심황(Java turmeric)으로도 알려진 잔토리졸(XNT: Xanthorrhizol, C15H22O, 2-methyl-5-[(2R)-6-methyl-5-hepten-2-yl]phenol)은 진기베라케애(Zingiberaceae) 계통의 생강 계통 식물인, 커큐마 잔토리지아 락스브(Curcuma xanthorrhizza Roxb.)의 강황 뿌리줄기의 주요 구성 성분이다. 잔토리졸은 항암, 항균, 항염, 항산화, 항고혈당, 항고혈압, 항혈소판, 신장보호, 간보호, 에스트로겐 및 항에스트로겐 효과와 같은 다양한 생물학적 활성을 갖는 것으로 알려져 있다. 그러나, 복합성분을 지닌 추출물이 아닌 잔토리졸 단일 화합물의 항바이러스 효과에 대한 보고는 없으며, 나아가 SCoV2 및 다른 CoV에 감염된 세포에서 항바이러스 활성은 아직 평가된 바가 없다.
현재 COVID-19 질환에 대한 저비용 고효용 치료법은 제공되지 못하고 있다. 람데시비르(RDV)를 비롯한 승인된 의약품의 높은 비용을 고려해, 항바이러스제를 구하기 어려운 지역에서도 사용될 수 있는 코로나19 중증 증상 환자의 치료에 효과적인 예방 및/또는 치료 대체의약품 개발이 시급한 실정이다. 본 발명에서는 잔토리졸(XNT)의 SCoV2 및 유사 코로나바이러스에 대한 항바이러스 효능을 입증하였다. 본 발명의 실시예들에서는 잔토리졸(XNT)이 SCoV2의 바이러스 복제를 억제하는 기능이 있음을 확인하였고, 나아가 SCoV1과 감기를 유발하는 인간 코로나바이러스 229E(HCoV-229E)를 포함한 여러 CoV에 대해 광범위한 항바이러스 활성을 나타냄을 입증하였다. 또한, SCoV2의 여러 우려변이주(variants of concern)에 대해서도 높은 항바이러스 효능을 보임을 입증함으로써 본 발명을 완성하였다.
일 양상은 잔토리졸(XNT: Xanthorrhizol) 또는 이의 염을 포함하는 항-코로나바이러스용 조성물을 제공하는 것이다.
다른 양상은 잔토리졸(XNT: Xanthorrhizol) 또는 이의 약학적으로 허용되는 염을 포함하는 코로나바이러스 감염증의 예방 또는 치료용 약학적 조성물을 제공하는 것이다.
또 다른 양상은 잔토리졸(Xanthorrhizol) 또는 이의 약학적으로 허용가능한 염을 이를 필요로 하는 개체에 투여하는 단계를 포함하는 코로나바이러스 감염증의 예방 또는 치료 방법을 제공하는 것이다.
또 다른 양상은 코로나바이러스 감염증의 예방 또는 치료용 약제의 제조를 위한 잔토리졸(Xanthorrhizol) 또는 이의 약학적으로 허용가능한 염의 용도를 제공하는 것이다.
일 양상은 잔토리졸(XNT: Xanthorrhizol) 또는 이의 염을 포함하는 항-코로나바이러스용 조성물을 제공한다.
상기 용어 잔토리졸(XNT: Xanthorrhizol)은 자바 심황(Java turmeric)으로 알려져 있고, 진기베라케애(Zingiberaceae) 계통의 생강 계통 식물인, 커큐마 잔토리지아 락스브(Curcuma xanthorrhizza Roxb.)의 강황 뿌리줄기의 주요 구성 성분이다. 상기 잔토리졸은 항암, 항균, 항염, 항산화, 항고혈당, 항고혈압, 항혈소판, 신장보호, 간보호, 에스트로겐 및 항에스트로겐 효과와 같은 다양한 생물학적 활성을 갖는 것으로 알려져 있다.
상기 용어 "염"은 일 양상에 따른 특정 화합물과 비교적 무독성인 산 또는 염기를 이용해서 조제되는 염을 의미하며, 상기 조성물은 약학적 조성물 이외에도 방제용 조성물 등 여러 용도로 사용될 수 있다.
용어 "방제"는 세포를 바이러스로부터 예방하거나 구제하는 것을 의미하고, 상기 방제용 조성물은 수화제, 현탁제, 유제, 유탁제, 미탁제, 액제, 분산성 액제, 입상수화제, 입제, 분제, 액상수화제, 입상수화제, 수면부상성입제 및 정제로 이루어진 군으로 선택되는 어느 하나의 형태로 제제화된 것일 수 있다. 이들 제제는 공지된 방법으로 제조될 수 있고, 예를 들어, 임의로 계면활성제(유화제, 분산제 또는 포움 형성제)를 사용하여 활성 화합물을 증량제(액체 용매 또는 고형 담체)와 혼합하여 제조될 수 있다.
상기 용어 "바이러스"는 다른 유기체의 살아 있는 세포 안에서만 살 수 있는 전염성 감염원이자 생물과 무생물의 중간적 존재(비세포성 반생물)이다.
상기 용어 "코로나바이러스는(Corona virus)" 코로나바이러스과(Coronaviridae)에 속하며 구형의 외막을 가지는 약 100 내지 220 nm 크기의 단일 가닥 양성 RNA 바이러스이다.
일 양상에 있어서, 상기 잔토리졸 또는 이의 염을 포함하는 조성물은 코로나바이러스의 스파이크 또는 N 단백질의 발현을 억제하거나, 코로나바이러스의 복제를 억제하는 방식 등으로 바이러스의 증식을 억제함으로써 항-코로나바이러스 효과를 나타낸다.
일 양상에 있어서, 상기 잔토리졸은 상기 코로나바이러스의 복제를 억제하는 것일 수 있다.
일 실시예에서는 잔토리졸(XNT)이 SCoV1 복제를 억제하여 실제로 바이러스 구조단백질인 캡시드(capsid) N 단백질의 발현이 감소됨을 확인하였다. 구체적으로, 잔토리졸 처리에 의해 SCoV1 서브게놈 레프리콘이 복제될 때 전사 조절 서열 9(TRS9: transcription-regulating sequence 9)에 의해 지시되어 생성되는 N 유전자 특이적 sg-mRNA(N sg-mRNA)의 카피 수가 감소됨을 확인하였으며, 이와 동반해 N 단백질 발현도 현저히 감소함을 확인하였다(실시예 2(3) 참조).
다른 실시예에서는 잔토리졸(XNT)이 광범위한 병원성 RNA 바이러스의 치료에 이용될 수 있는 광범위-항바이러스제(broad-spectrum antiviral agent)로 작용하는지 여부를 확인하기 위해 HCV 및 인간 노로바이러스(HuNoV)의 자가 복제 바이러스 서브게놈의 복제가 일어나고 있는 Huh7 유래 세포주들에서 이들 바이러스 복제 억제 효과를 분석하였다. 그 결과, 상기 레플리콘 중 어느 것도 잔토리졸(XNT)에 의해 억제되지 않음을 확인하였다. 나아가 쥐의 노로바이러스에 감염된 RAW264.7 세포에서도 항바이러스 활성이 나타나지 않음을 확인하였다.
또한, 잔토리졸(XNT)이 인간코로나바이러스(HCoV-229E)에 대해 항바이러스 활성을 나타내는지 평가하였다. 그 결과, HCoV-229E에 감염된 Huh7 세포(간암세포)에서 감염성 바이러스의 역가(플라크 형성 타이터)를 용량 의존적으로 감소시킴을 확인하였다(실시예 2(4) 참조).
일 양상에 있어서, 상기 잔토리졸은 상기 코로나바이러스의 스파이크 단백질 또는 N 단백질의 발현을 억제하는 것일 수 있다.
일 실시예에서는 SCoV2에 대한 항바이러스제로서 잔토리졸(XNT)이 이용될 수 있는지 확인하기 위해 SCoV2 (KCDC03 분리주)에 감염된 I형 IFN-결핍 Vero E6 세포 및 SCoV2 감수성 폐 선암종 Calu-3 세포(SCoV2-permissive lung adenocarcinoma Calu-3 cells)에 대한 잔토리졸(XNT)의 항바이러스 활성을 평가하였다. 그 결과, 상기 Vero E6 세포에서는 세포내 및 세포외 바이러스 RNA 역가가 감소하였고, 감염성 바이러스 역가도 용량 의존적으로 감소시켰으며, 바이러스 단백질(스파이크 및 N 단백질) 발현 역시 현저히 감소시킬 수 있음을 확인하였다. 또한, 상기 Calu-3 세포에서도 역시 세포내 및 세포외 바이러스 RNA 카피수가 감소됨을 확인하였다(실시예 2(1) 참조).
일 양상에 있어서, 상기 조성물 내 잔토리졸의 농도는 2 내지 50 μM, 5 내지 50 μM, 10 내지 50μM, 15 내지 50μM, 2 내지 40 μM, 5 내지 40 μM, 10 내지 40 μM, 2 내지 30 μM, 5 내지 30 μM 또는 2 내지 20 μM일 수 있다.
일 양상에 있어서, 상기 조성물 내 잔토리졸의 농도가 50 μM 초과인 경우, 세포 독성이 나타나기 시작할 수 있고, 상기 조성물 내 잔토리졸의 농도가 2 μM 미만인 경우, 유효성분인 잔토리졸이 항-코로나바이러스 효과를 나타낼 만큼 충분하지 않을 수 있다.
일 양상에 있어서, 상기 코로나바이러스는 사스코로나바이러스1(SARS-CoV-1: Severe Acute Respiratory Syndrome Coronavirus1), 사스코로나바이러스2(SARS-CoV-2: Severe Acute Respiratory Syndrome Coronavirus2), 인간코로나바이러스(HCoV-229E: human coronavirus 229E) 및 이들의 변이체(variant)로 이루어진 군에서 선택되는 하나 이상의 코로나바이러스일 수 있다.
상기 용어 “사스코로나바이러스1(SARS-CoV-1: Severe acute respiratory syndrome coronavirus 1)”은 중증급성호흡기증후군(SARS)을 일으키는 바이러스주(strain)를 의미하고, 외피를 보유하는, 양성 단일가닥 RNA 바이러스로, 사람, 박쥐, 아시아 사향고양이 등의 허파 상피세포를 감염시킨다.
상기 용어 "사스코로나바이러스2(SARS-CoV-2: Severe acute respiratory syndrome coronavirus 2)"는 제2형 중증급성호흡기증후군 코로나바이러스를 의미하고, 양성(positive sense) 단일 가닥 RNA(single-stranded RNA) 유전자를 지닌 인수공통 감염 및 인간간 전염성이 있는 코로나바이러스감염증-19의 원인 병원체이다.
상기 용어 "인간코로나바이러스(HCoV-229E)"는 인간과 박쥐를 감염시키는　코로나바이러스의 종을 의미하고, 외피를 보유하는 양성 단일 가닥 RNA 바이러스로, 일반적인 감기를 일으키는 바이러스 중 하나이다.
상기 용어 "변이체"는 바이러스의 대표종 대비 유전체가 변형된 것을 의미하며, 일 양상에 있어서, 상기 코로나바이러스 변이체는 상기 코로나바이러스와 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 또는 99%의 유전체 또는 아미노산 상동성을 갖는 것일 수 있다.
예를 들어, 상기 사스코로나바이러스2의 변이체는 우려변이주(variants of concern)일 수 있고, 구체적으로는 알파(alpha), 베타(beta), 감마(gamma), 델타 및 오미크론(omicron) 변이주로 이루어진 군에서 선택되는 하나 이상일 수 있다.
일 실시예에서는 잔토리졸(XNT)이 SCoV1 서브게놈 복제를 억제함을 확인한 후, Nsp5, Nsp12 및 Nsp13에 대한 시험관내 효소 분석을 이용하여 잠재적인 표적을 확인하고자 하였고, 상기 Nsp는 SCoV1 및 SCoV2 사이에서 각각 96.4%, 96.1% 및 99.8% 아미노산 동일성을 나타냄을 확인하였다(실시예 2(6) 참조).
일 양상에 있어서, 상기 변이체는 상기 바이러스의 Nsp2, Nsp3, Nsp4, Nsp5, Nsp6, Nsp7, Nsp12, Nsp13, Nsp14 및 Nsp16으로 이루어진 군에서 선택되는 하나 이상의 단백질을 구성하는 아미노산이 변이된 것일 수 있다.
상기 용어 "Nsp(nonstructural protein)"는 비구조 단백질을 의미하고, 바이러스학에 있어서 비구조 단백질은 바이러스에 의해 코딩되는 단백질이나 바이러스 입자의 일부를 의미하는 것은 아니며, 바이러스　프로테아제 (3CL/nsp5　등), RNA 복제효소 복합체(RNA replicase complex) 또는 다른 주형-지시된 폴리머라제 및 숙주 방어기전을 회피하기 위해 사용하는 몇몇 바이러스 단백질과 같이 바이러스가 스스로를　복제하기 위해 사용하는 다양한　효소　및　전사 인자 등을 포함한다.
또한, 일 양상에 있어서, 상기 변이체는 상기 바이러스로부터 Nsp2 단백질의 85번 위치의 아미노산, Nsp3 단백질의 77, 707, 792 및 822번 위치의 아미노산들, Nsp4 단백질의 293 및 446번 위치의 아미노산들, Nsp6 단백질의 149 및 181번 위치의 아미노산들, Nsp7 단백질의 25번 위치의 아미노산, Nsp12 단백질의 323 및 671번 위치의 아미노산들, Nsp13 단백질의 77 및 210번 위치의 아미노산들, Nsp14 단백질의 394번 위치의 아미노산 및 Nsp16 단백질의 6번 위치의 아미노산으로 이루어진 군에서 선택되는 하나 이상의 아미노산이 변이된 것일 수 있다.
또한, 상기 용어 "변이"는 상기 코로나바이러스의 아미노산이 알기닌, 히스티딘, 라이신, 아스파라산, 글루탐산, 세린, 트레오닌, 아스파라긴, 글루타민, 시스테인, 셀레노시스테인, 글리신, 프롤린, 알라닌, 발린, 류신, 이소류신, 메티오닌, 페닐알라닌, 티로신, 트립토판 또는 이들의 변형물로 치환된 것을 의미한다.
일 양상에 있어서, 상기 잔토리졸 또는 이의 염을 포함하는 조성물은 상기 코로나바이러스 뿐만 아니라, 상기 코로나바이러스 변이체에 대해서도 바이러스 증식을 억제함으로써 항-코로나바이러스 효과를 나타낸다.
일 실시예에서는 SCoV2 변이체에 대한 잔토리졸(XNT)의 항바이러스 효능을 확인하기 위해, 우한/Hu-1/2019, KCDC03 분리주(SARS-CoV-2/human/KOR/KCDC03/2020), Nsp2, Nsp3, Nsp7, Nsp12 및 Nsp16에 상기한 초기 분리주와 대비해 돌연변이가 도입된 YS006 분리주(SARS-CoV-2/human/KOR/YS006/2020)와 델타 변이주인 YS117 (SARS-CoV-2/human/KOR/YS117/2021)과 최근 출연한 오미크론 변이주(BA.1, YS430 분리주)를 사용하였다. 이들 변이주들은 Nsp3, Nsp4, Nsp6, Nsp12, Nsp13, Nsp14 등에서 초기분리주 대비 아미노산 서열차이가 있어, 잔토리졸(XNT)이 이들 변이주에 대해 항바이러스 효능을 다르게 보이거나 상실하게 되면, 이들 Nsp들 중 하나가 잔토리졸이 결합하는 직접적인 표적이 될 수 있는 가능성이 있는 바, 이들에 대한 잔토리졸 민감성을 비교평가 하였다. 그 결과 이들 변이주에 대해 모두 유사한 정도(세포내 바이러스 유전자 카피수를 2log10배 이상 감소시킴)의 항바이러스 효능을 보임을 확인하였다(실시예 2(5) 참조).
다른 실시예에서는 잔토리졸(XNT)의 Nsp5, Nsp12 및 Nsp13에 대한 활성 억제능이 있는지를 평가하였다. 그 결과, 잔토리졸(XNT)이 Nsp12 RdRp 활성에 대한 억제 효과가 거의 또는 전혀 없음을 확인하였고, SCoV2 Nsp5 프로테아제 및 Nsp13 RNA 헬리카제에 대한 FRET 기반 효소 분석 에세이를 활용한 실험을 통해, 상기 두 효소가 잔토리졸(XNT)의 직접적인 표적이 아님을 확인하였다(실시예 2(6) 참조).
일 양상에 있어서, 상기 조성물은 코로나바이러스의 스파이크 및 N 단백질의 발현을 억제하고, 코로나바이러스의 복제를 억제함으로써, 상기한 Nsp 단백질들에 변이가 도입된 SCoV2 코로나바이러스를 억제하여 우수한 항-바이러스 효과를 나타낸다.
다른 양상은 잔토리졸(XNT: Xanthorrhizol) 또는 이의 약학적으로 허용되는 염을 포함하는 코로나바이러스 감염증의 예방 또는 치료용 약학적 조성물을 제공한다.
상기 "잔토리졸", "코로나바이러스" 등은 전술한 범위 내일 수 있다.
상기 용어 "약학적으로 허용 가능한"은 상기 조성물에 노출되는 세포나 인간에게 독성이 없는 특성을 나타내는 것을 의미한다.
용어 "약학적으로 허용 가능한 염"이란 일 양상에 따른 특정 화합물과 비교적 무독성인 산 또는 염기를 이용해서 조제되는 염을 의미한다. 상기 화합물이 상대적으로 산성 관능기를 포함할 때, 순수 용액 또는 적합한 불활성 용매 중에서 충분한 양의 염기를 이러한 화합물의 중성 형태와 접촉시킴으로써 염기 부가염을 얻을 수 있다. 약학적으로 허용 가능한 염기 부가염은 나트륨, 칼륨, 칼슘, 암모늄, 유기 아민, 혹은 마그네슘의 염 또는 유사한 염이 포함된다. 상기 화합물이 상대적으로 염기성 관능기를 포함할 때, 순수 용액 또는 적합한 불활성 용매 중에서 충분한 양의 산을 이러한 화합물의 중성 형태와 접촉시킴으로써 산 부가염을 얻을 수 있다. 약학적으로 허용 가능한 산 부가염은 염산, 브롬화 수소산, 질산, 탄산, 탄산 수소 이온, 인산, 인산 1수소 이온, 인산 2수소 이온, 황산, 황산 수소 이온, 요오드화 수소산 또는 아인산 등의 무기산의 염, 그리고 아세트산, 프로피온산, 이소부티르산, 말레산, 말론산, 안식향산, 숙신산, 수베르산, 푸마르산, 락트산, 만델산, 프탈산, 벤젠술폰산, p-톨릴술폰산, 구연산, 주석산, 메탄술폰산 등의 유기산의 염을 들 수 있고, 나아가 아미노산(예를 들면 아르기닌 등)의 염 및 글루쿠론산 등의 유기산의 염도 포함된다.
상기 용어 "코로나바이러스 감염증"은 코로나바이러스가 일으키는 중증 호흡기 증후군으로, 일 양상에 있어서 코로나바이러스는 사스코로나바이러스1(SARS-CoV-1: Severe Acute Respiratory Syndrome Coronavirus1), 사스코로나바이러스2(SARS-CoV-2: Severe Acute Respiratory Syndrome Coronavirus2), 인간코로나바이러스(HCoV-229E: human coronavirus 229E) 및 이들의 변이체(variant)일 수 있다.
상기 용어 "변이체"는 바이러스의 대표종 대비 유전체가 변형된 것을 의미하며, 일 양상에 있어서, 상기 코로나바이러스 변이체는 상기 코로나바이러스와 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% 또는 99%의 유전체 또는 아미노산 상동성을 갖는 것일 수 있다.
예를 들어, 상기 사스코로나바이러스2의 변이체는 우려변이주(variants of concern)일 수 있고, 구체적으로는 알파(alpha), 베타(beta), 감마(gamma), 델타 및 오미크론(omicron) 변이주로 이루어진 군에서 선택되는 하나 이상일 수 있다.
상기 용어 "예방"은 일 양상에 따른 약학적 조성물의 투여에 의해 개체의 코로나바이러스의 감염을 억제시키거나 코로나바이러스 감염증의 발병을 지연시키는 모든 행위를 의미한다.
상기 용어 "치료"는 일 양상에 따른 약학적 조성물의 투여에 의해 개체의 코로나바이러스 감염증에 대한 증세가 호전되거나 이롭게 변경되는 모든 행위를 의미한다.
용어 "투여"는 적절한 방법으로 개체에게 소정의 물질을 도입하는 것을 의미하며, "개체"는 코로나바이러스를 보유할 수 있는 인간을 포함한 쥐, 생쥐, 가축 등의 모든 생물을 의미한다. 구체적인 예로, 인간을 포함한 포유동물일 수 있다.
일 양상에 있어서, 상기 잔토리졸은 상기 코로나바이러스의 복제를 억제하는 것일 수 있다.
일 양상에 있어서, 상기 잔토리졸은 상기 코로나바이러스의 스파이크 단백질 또는 N 단백질의 발현을 억제하는 것일 수 있다.
일 양상에 있어서, 상기 약학적 조성물 내 잔토리졸의 농도는 2 내지 50 μM, 5 내지 50 μM, 10 내지 50μM, 15 내지 50μM, 2 내지 40 μM, 5 내지 40 μM, 10 내지 40 μM, 2 내지 30 μM, 5 내지 30 μM 또는 2 내지 20 μM일 수 있다.
일 양상에 있어서, 상기 약학적 조성물 내 잔토리졸의 농도가 50 μM 초과인 경우, 코로나바이러스에 감염된 세포에 대해 세포 독성이 나타나기 시작할 수 있고, 상기 약학적 조성물 내 잔토리졸의 농도가 2 μM 미만인 경우, 유효성분인 잔토리졸이 코로나바이러스 감염증에 대한 예방 또는 치료 효과를 나타낼 만큼 충분하지 않을 수 있다.
일 양상에 있어서, 상기 약학적 조성물은 코로나바이러스의 스파이크 및 N 단백질의 발현을 억제하고, 코로나바이러스의 복제를 억제함으로써, 우수한 코로나바이러스 감염증의 예방 또는 치료 효과를 나타낼 수 있고, 나아가, 상기 코로나바이러스의 변이체들에 의한 코로나바이러스 감염증에 대해서도 우수한 예방 또는 치료 효과를 나타낼 수 있다.
또한, 상기 약학적 조성물은 유효성분을 단독으로 포함하거나, 하나 이상의 약학적으로 허용 가능한 담체, 부형제 또는 희석제를 포함하여 약학적 조성물로 제공될 수 있다.
구체적으로, 상기 담체는 예를 들어, 콜로이드 현탁액, 분말, 식염수, 지질, 리포좀, 미소구체(microspheres) 또는 나노 구형입자일 수 있다. 이들은 운반 수단과 복합체를 형성하거나 관련될 수 있고, 지질, 리포좀, 미세입자, 금, 나노입자, 폴리머, 축합 반응제, 다당류, 폴리아미노산, 덴드리머, 사포닌, 흡착 증진 물질 또는 지방산과 같은 당업계에 공지된 운반 시스템을 사용하여 생체 내 운반될 수 있다.
상기 약학적 조성물이 제제화될 경우에는 통상적으로 사용하는 윤활제, 감미제, 향미제, 유화제, 현탁제, 보존제, 충진제, 증량제, 결합제, 습윤제, 붕해제, 계면활성제 등의 희석제 또는 부형제를 사용하여 조제될 수 있다. 비경구 투여를 위한 제제에는 멸균된 수용액, 비수성용제, 현탁제, 유제, 동결건조 제제, 좌제가 포함될 수 있다. 비수성용제, 현탁제로는 프로필렌글리콜(propyleneglycol), 폴리에틸렌글리콜, 올리브 오일과 같은 식물성 기름, 에틸올레이트와 같은 주사 가능한 에스테르 등이 사용될 수 있다. 좌제의 기제로는 위텝솔(witepsol), 마크로골, 트윈(Tween) 61, 카카오지, 라우린지, 글리세로 제라틴 등이 사용될 수 있고, 점안제 형태로 제조 시 공지의 희석제 또는 부형제 등이 사용될 수 있다.
일 양상에 있어서, 상기 약학적 조성물은 비강 투여되는 것일 수 있다.
상기 용어 "비강 투여"는 코 점막 또는 코-뇌 경로를 통해 약물을 투여하는 것을 의미하고, 비강 투여를 위한 제제는 전달 장치, 예를 들어 에어로졸 전달을 활용하여 투여될 수 있다. 액체 제제의 스프레이병, 분무치료, 분무화 또는 펌프 에어로졸화 및 건조 분말 제제의 에어로졸화를 포함하나 관련 기술분야에 공지된 임의의 형태의 에어로졸화를 사용할 수 있다.
또한, 비강 제제는 예를 들어 스퀴징시 스프레이를 형성함으로써 에어로졸 제제를 에어로졸화하도록 치수화된 구멍 또는 개구부를 갖춘 플라스틱 스퀴즈병을 사용하여 투여될 수 있다. 개구부는 대개 병의 최상부에 있으며, 최상부는 일반적으로 에어로졸 제제의 효율적 투여를 위해 비도에 부분적으로 끼워 맞춰지도록 점점 가늘어져 있는 것을 사용할 수 있다.
상기 약학적 조성물은 약학적으로 유효한 양으로 투여한다. 용어, "약학적으로 유효한 양"은 의학적 치료에 적용 가능한 합리적인 수혜/위험 비율로 질환을 치료하기에 충분한 양을 의미하며, 유효 용량 수준은 환자의 질환의 종류, 중증도, 약물의 활성, 약물에 대한 민감도, 투여 시간, 투여 경로 및 배출 비율, 치료기간, 동시 사용되는 약물을 포함한 요소 및 기타 의학 분야에 잘 알려진 요소에 따라 결정될 수 있다.
일 양상에 있어서, 상기 약학적 조성물의 투여는 하루에 한 번 투여되는 것일 수도 있고, 수 회 나누어 투여되는 것일 수도 있다. 예를 들어, 격일로 투여되는 것일 수도 있으며, 일주일에 하루 투여되는 것일 수도 있다. 구체적으로, 상기 약학적 조성물은 0.001 내지 1000 mg/kg/day로, 보다 구체적으로 0.1 내지 100 ㎎/kg/day로 투여될 수 있다. 상기 투여는 하루에 한 번 투여되는 것일 수도 있고, 수 회 나누어 투여되는 것일 수도 있다.
또 다른 양상은 잔토리졸(Xanthorrhizol) 또는 이의 약학적으로 허용가능한 염을 이를 필요로 하는 개체에 투여하는 단계를 포함하는 코로나바이러스 감염증의 예방 또는 치료 방법을 제공한다.
상기 "잔토리졸", "약학적으로 허용가능한 염", "개체", "투여", "코로나바이러스감염증", "예방", "치료" 등은 전술한 범위 내일 수 있다.
상기 방법은 코로나바이러스 감염증의 예방 또는 치료 효과를 가지는 공지의 조성물 또는 다른 약학적 조성물과 병행하여 투여하는 것일 수 있고, 동시에, 별도로, 또는 순차적으로 투여하는 것일 수 있으며, 단일 또는 다중 투여하는 것일 수 있다. 상기 요소들을 모두 고려하여 부작용 없이 최소한의 양으로 최대 효과를 얻을 수 있는 양을 투여하는 것이 중요하며, 이는 당업자에 의해 용이하게 결정될 수 있다.
일 양상에 따르면, 상기 잔토리졸(Xanthorrhizol) 또는 이의 약학적으로 허용가능한 염을 투여함으로써, 코로나바이러스의 스파이크 및 N 단백질의 발현을 억제하고, 코로나바이러스의 복제를 억제하여, 우수한 코로나바이러스 감염증의 예방 또는 치료 효과를 나타낼 수 있고, 나아가, 상기 코로나바이러스의 변이체들에 의한 코로나바이러스 감염증에 대해서도 우수한 예방 또는 치료 효과를 나타낼 수 있다.
또 다른 양상은 코로나바이러스 감염증의 예방 또는 치료용 약제의 제조를 위한 잔토리졸(Xanthorrhizol) 또는 이의 약학적으로 허용가능한 염의 용도를 제공한다.
상기 "코로나바이러스 감염증", "예방", "치료", "잔토리졸", "약학적으로 허용가능한 염" 등은 전술한 범위 내일 수 있다.
또 다른 양상은 코로나바이러스 감염증의 예방 또는 치료용 약제의 제조를 위한 잔토리졸(Xanthorrhizol) 또는 이의 약학적으로 허용가능한 염을 포함하는 항-코로나바이러스용 조성물의 용도를 제공한다.
상기 "코로나바이러스 감염증", "예방", "치료", "잔토리졸", "약학적으로 허용가능한 염", "항-코로나바이러스용 조성물" 등은 전술한 범위 내일 수 있다.
일 양상에 따른 잔토리졸(Xanthorrhizol) 또는 이의 염을 포함하는 조성물은 코로나바이러스 복제 억제를 통해 항-코로나바이러스 효과 및/또는 코로나바이러스 감염증의 예방, 개선 또는 치료 효과에 있어서 우수한 효과를 나타낼 수 있다. 또한, 일 양상에 의하면, 상기 조성물이 코로나바이러스들의 변이체들을 포함하여 다양한 코로나바이러스에 대해서도 우수한 항-바이러스 효과를 확인하였는 바, 광범위한 항-코로나바이러스 조성물로 사용될 수 있다.
도 1은 SCoV2에 대한 잔토리졸(XNT: Xanthorrhizol)의 항바이러스 활성을 확인한 결과를 나타내는 도이고, 도 1A는 잔토리졸의 화학 구조를 나타내는 도이고, 도 1B는 잔토리졸의 세포독성을 확인한 결과를 나타내는 도이고, 도 1C는 SCoV2(KCDC03)에 감염된 VeroE6 세포에 잔토리졸을 처리한 후 24시간 뒤 측정된 세포내 바이러스 RNA를 나타내는 도이고, 도 1D는 SCoV2(KCDC03)에 감염된 VeroE6 세포에 잔토리졸을 처리한 후 24시간 뒤 측정된 세포외 바이러스 RNA를 나타내는 도이고, 도 1E는 SCoV2(KCDC03)에 감염된 VeroE6 세포에 잔토리졸를 처리한 후 24시간 뒤 측정된 감염성 바이러스 역가를 나타내는 도이고, 도 1F는 잔토리졸이 처리된 세포에서 표시된 바이러스 단백질에 대한 면역블롯 결과를 나타내는 도이고, 도 1G 및 도 1H는 Calu-3 세포에서 잔토리졸의 항바이러스 활성을 확인한 결과를 나타내는 도이다(*P<0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; n.s., not significant).
도 2는 Calu-3 세포에서 잔토리졸의 SCoV2 억제 활성을 확인한 결과를 나타내는 도이고, 도 2A는 잔토리졸을 Calu-3 세포에 처리 후 잔토리졸의 세포독성을 나타내는 도이고, 도 2B는 SCoV2에 감염된 Calu-3 세포(MOI-=0.01)를 잔토리졸 처리 후 세포외 바이러스 RNA의 역가를 분석한 결과를 나타내는 도이다(막대는 평균값 ± SD를 나타내고 점은 3개의 생물학적 반복 실험 결과를 나타냄).
도 3은 SCoV2에 대한 렘데시비르(RDV: remdesivir)의 항바이러스 활성을 나타내는 도이고, 도 3A는 Vero E6 세포의 렘데시비르에 대한 세포독성을 확인한 결과를 나타내는 도이고, 도 3B 및 도3c는 SARS-CoV2에 감염된 Vero E6 세포(MOI=0.01)를 렘데시비르 처리 후 세포외 바이러스 RNA의 역가를 분석한 결과를 나타내는 도이다(막대는 평균 값을 나타내고 점은 기술 복제로 수행된 두 개의 생물학적 반복 실험 결과를 나타냄).
도 4는 잔토리졸의 SCoV2 세포 진입에 미치는 영향을 분석한 결과를 나타내는 도이고, 도 4A는 SCoV2 스파이크 단백질를 로딩한 유사형(슈도타입) MLV(MLV: murine leukemia virus)의 생성에 사용되는 플라스미드들의 개략도이고, 도 4B는 생성된 슈도타입 바이러스의 엔도좀(endosome)을 통한 진입과정을 E-64d 약물이 억제하는지를 분석한 결과를 나타내는 도이고, 도 4C 및 도 4D는 상기한 슈도타입 바이러스로 형질 도입(transduction) 시킨 HEK293T 세포를 잔토리졸 또는 리소소모트로픽 제제 히드록시클로로퀸(HCQ: Hydroxychloroquine, S4430)으로 처리 시 바이러스 진입이 영향을 받는지를 분석한 결과를 나타내는 도이다(**P < 0.01; ****P < 0.0001; n.s., not significant).
도 5는 잔토리졸에 의한 SCoV1 서브게놈 레플리콘의 복제 억제 효과를 분석한 결과를 나타내는 도로서, 서브게놈 레플리콘 발현 벡터를 형질 감염(transfection)한 HEK293 세포에서 잔토리졸에 의한 SCoV1 서브게놈 복제 억제와 이로 인한 바이러스 캡시드 단백질(N)의 발현량 감소 효과를 분석한 결과를 나타내는 도이다.
도 6은 잔토리졸의 인터페론(IFN: Interferon) 발현 유도능을 분석한 결과를 나타내는 도이다.
도 7a 및 도 7b는 자가 복제 HCV 서브지노믹 레프리콘(a) 및 인간 노로바이러스 서브게놈 레프리콘(b)을 각각 함유하고 있는 R-1 및 HG23 세포주에서 잔토리졸의 항바이러스 활성을 평가한 결과를 나타내는 도이다.
도 7c 및 도 7d는 세포내 MNV-1 게놈 카피 수(c) 및 감염성 바이러스 역가(플라크 타이터)(d)를 나타내는 도로써, RAW264.7 세포에 MNV-1로 감염 후 잔토리졸에 의한 바이러스 증식 억제효과를 분석한 결과를 나타내는 도이다(n.s., not significant).
도 8은 HCoV-229E 및 Huh7 세포에 대한 잔토리졸 및 렘데시비르(RDV: remdesivir)의 세포독성 및 항바이러스 활성을 비교한 결과를 나타내는 도이고, 도 8A 및 도 8C는 Huh7 세포에서 잔토리졸(A) 및 렘데시비르(C)의 세포독성을 MTS 방법으로서 평가한 결과를 나타내는 도이고, 도 8B 및 도 8D는 HCoV-229E에 대한 잔토리졸 및 주사제로 사용되는 렘데시비르의 항바이러스 활성을 비교한 결과를 나타내는 도이이다(ND, not detected).
도 9는 잔토리졸의 SCoV2 변이주에 대한 항바이러스 역가를 분석한 결과를 나타내는 도이다(**P < 0.01; ***P < 0.001; ****P < 0.0001, YS430(오미크론)은 BA.1 오미크론 변이주임).
도 10은 SCoV2 Nsp12 단백질의 발현 및 정제 결과를 나타내는 도이고, 도 10A는 재조합 N-말단(His)6-태그가 붙은 Nsp12 단백질의 개략도이고, 도 10B는 정제된 야생형 Nsp12 및 그 비활성 유도체 Nsp12(SAA)를 SDS-PAGE 후 쿠마시브릴리언트 블루(Coomassie blue)로 염색한 결과를 나타내는 도이고, 도 10C는 폴리(C) RNA [poly(C)] 주형을 카피하여 생성된 방사성 동위원소로 표지된 RNA를 자동방사선촬영(autoradiography)법으로 이미지 분석한 결과를 나타내는 도이다.
도 11a는 잔토리졸의 SCoV2 Nsp12(RdRp) 억제 활성을 분석한 결과를 나타내는 도이다.
도 11b는 시험관 내 FRET 기반 SCoV2 Nsp5 프로테아제 활성 분석 실험의 개략도(상단)와 잔토리졸 및 알려진 Nsp5 활성억제제인 엡셀렌(ebselen)의 활성억제능을 분석한 결과를 나타내는 도이다.
도 11c는 FRET 기반 SCoV2 Nsp13 헬리카제 활성 분석 개략도(상단)와 잔토리졸 및 알려진 Nsp13 활성억제제인 비스무스(bismuth)의 활성억제능을 분석한 결과를 나타내는 도이다.
도 12는 정제된 Nsp5 단백질을 사용한 시험관 내 SCoV2 Nsp5 프로테아제 활성을 분석한 결과를 나타내는 도이고, 도 12A는 실험에 사용한 N-말단(His)6-태그가 붙은 재조합 Nsp5 단백질의 개략도이고, 도 12B는 FRET 기반 Nsp5 프로테아제 활성 에세이를 사용하여, Factor X 프로테아제 처리 유무에 따른 Nsp5 활성 변화 차이를 평가한 결과를 나타내는 도이고(****P < 0.0001), 도 12C는 Factor X 처리로 N-말단(His)6-태그를 잘라낸 정제된 활성형 Nsp5 단백질의 Km 값을 결정한 결과를 나타내는 도이다.
도 13은 정제된 Nsp13 단백질을 사용한 시험관 내 SCoV2 Nsp13 헬리카제 활성을 분석한 결과를 나타내는 도로서, 도 13A는 재조합 N-말단(His)6-태그가 붙은 Nsp13 단백질의 개략도이고, 도 13B는 분석에 사용된 정제된 Nsp13 재조합 단백질을 나타내는 도이고, 도 13C는 SCoV2 Nsp13 단백질의 Km 값을 결정한 결과를 나타내는 도이다.
이하 본 발명을 실시예를 통하여 보다 상세하게 설명한다. 그러나, 이들 실시예는 본 발명을 예시적으로 설명하기 위한 것으로 본 발명의 범위가 이들 실시예에 한정되는 것은 아니다.
실시예
1. 실험 방법 및 재료
(1) 시약, 플라스미드 및 항체의 확보
순도 97% 이상의 잔토리졸(XNT: xanthorrhizol)과 엡셀렌(ebselen)은 Cayman Chemical (Ann Arbor, MI, USA)에서 구입하였다. 잔토리졸(XNT)은 100% DMSO에 용해하였고, 0.1% 또는 1% 내지 4%의 최종 농도로 배양 배지 또는 각 효소 반응 또는 SCoV2 (SARS-CoV-2: severe acute respiratory syndrome coronavirus 2) 스파이크를 표면에 로딩(loading)하고 있는 MLV (MLV: murine leukemia virus) 슈도바이러스를 사용한 바이러스 세포 진입 실험에 사용하였다. 렘데시비르(RDV: remdesivir)는 MedChemExpress (MCE: Monmouth Junction, NJ, USA)에서 얻었다. Bismuth citrate(구연산 비스무트) 및 E-64d (cysteine protease inhibitor, E8640)는 Sigma-Aldrich (Saint Louis, MO, USA)에서 구입하였다. 하이드록시클로로퀸(HCQ: Hydroxychloroquine, S4430)은 Selleckchem(Houston, TX, USA)에서 구입하였다. pSARS-REP-Feo 플라스미드는 반딧불이 루시퍼라제(Fluc: firefly luciferase) 리포터를 발현하는 SCoV1 (SARS-CoV-1: Severe Acute Respiratory Syndrome Coronavirus1) 서브게놈을 발현할 수 있는 벡터이다. 항체는 다음과 같은 제조사로부터 구입하여 사용하였다: Calbiochem (La Jolla, CA, USA)의 마우스 단일클론 항-α튜불린 항체(clone DM1A), Cell Signaling (Beverly, MA, USA)의 토끼 다클론 항-β-액틴 항체(#4967), SinoBiological (Beijing, China)의 마우스 모노클로날 항-SCoV2 뉴클레오캡시드(N) 항체(40143-MM08) 및 GeneTex (Irvine, CA, USA)의 마우스 모노클로날 항-SCoV1/SCoV2 항-S 항체(clone 1A9).
(2) 세포 배양
아프리카 녹색 원숭이 신장 세포주 Vero E6, 인간 폐 선암종 세포주 Calu-3, 인간 배아 신장 293(HEK293), 인간 배아 신장 유래 HEK293T 세포, 인간 태아 폐 섬유아세포 MRC-5 및 쥐 대식세포 세포주 RAW2647는 10% 소태아혈청(FBS: fetal bovine serum), 100 U/ml의 페니실린(penicillin) 및 100 ㎍/ml의 스트렙토마이신(streptomycin)이 보충된 DMEM (Dulbecco's modified Eagle's medium)에서 배양하였다. 인간 간세포 암종 세포주 Huh7은 10% FBS, 2 mM L-글루타민(L-glutamine), 100 U/ml 페니실린, 100 ㎍/ml 스트렙토마이신 및 0.1 mM 비필수 아미노산이 보충된 DMEM에서 배양하였다. 자가복제 C형간염바이러스(HCV: hepatitis C virus) 서브게놈 레플리콘 및 Norwalk 바이러스 서브게놈 레플리콘을 각각 보유하고 있는 Huh7 유래 세포주 R-1 및 HG23 세포주는 G418이 보충된 동일한 배지에서 배양하였다. 모든 세포배양은 표준 배양 조건(5% CO2, 37℃)에서 진행하였다.
(3) 바이러스 및 플라크 분석
SCoV2 균주 KCDC03 (SARS-CoV-2/human/KOR/KCDC03/2020; GenBank accession number: MT020782 및 GISAID accession number: EPI_ISL_407193)은 질병관리청 국가병원체자원은행(NCCP: National Culture Collection for Pathogens)에서 얻었다. 감염실험에 사용한 GH 계통 SCoV2 YS006 (SARS-CoV-2/human/KOR/YS006/2020; GenBank accession number: MW345824 및 GISAID accession number: EPI_ISL_660109)은 국내 COVID-19 환자의 비인두로부터 면봉으로 채취한 검체에서 분리된 바이러스이다. SCoV2 델타 균주 YS117 (GenBank accession number: MZ798798 및 GISAID accession number: EPI_ISL_3411836)은 유사한 방법으로 임상 검체로부터 분리하였다. 마찬가지로 오미크론(BA.1) 변이주 YS430 (SARS-CoV-2/human/KOR/YS430/2022)도 환자 검체로부터 분리해 사용하였다. 관련 연구는 환자의 서면 동의(IRB 프로토콜 번호: 4-2020-0076) 하에 연세대학교 의료시스템 세브란스병원의 기관심사위원회(IRB: institutional review board)의 승인을 받았다. CoV (corona virus) 스톡은 2% FBS가 보충된 DMEM에서 성장한 Vero E6 세포에서 증식시켰다. 감염성 바이러스 역가는 플라크 분석에 의해 결정되었다. 방법을 간단히 요약하면, 6-well plate에 미리 시딩(seeding)하여 배양한 Vero 세포에 무혈청 배지에서 10배 연속 희석된 바이러스 샘플을 1시간 동안 인큐베이션하여 감염 실험을 진행하였다. 그 후, 감염된 세포를 PBS로 세척한 후, 2% FBS, 100 U/ml의 페니실린 및 100 ㎍/ml의 스트렙토마이신이 보충된 DMEM에 SeaPlaque agarose(1% w/v; Lonza, Rockland, ME, USA)가 추가된 고체 배지로 덮었다. 3 내지 4일 후 플라크 형성이 보일 때 세포를 10% 포름알데히드(formaldehyde)로 고정하고, 1% 크리스탈 바이올렛(crystal violet)으로 염색하여 플라크수를 측정하였다. 살아있는 SCoV2를 사용한 모든 실험은 Avison Biomedical Research Center (ABMRC, Yonsei University College of Medicine)의 BL3 (biosafety level 3) 시설에서[Institutional Biosafety Committee (IBC) 허가 번호: A-202009 -260-01] 수행하였다. SCoV2 유전자를 이용한 다른 연구는 연세대 의과대학 IBC 승인(IBC-2020-008)을 받아 진행하였다.
인간 코로나바이러스 229E (HCoV-229E; ATCC VR-740)는 MRC-5 세포에서 증식시켜 사용하였으며, 관련 실험은 기관 승인을 받아 진행하였다(IBC-A-202108-285-01, 연세대 IBC 승인). 플라크 에세이는 아래 기술한 방법에 따라 수행하였다. 10배 연속 희석된 바이러스 샘플을 Huh7 세포에 접종하고, 1시간 동안 인큐베이션 후, 세포를 2% FBS, 100 U/ml의 페니실린 및 100 ㎍/ml의 스트렙토마이신이 보충된 DMEM에 0.6% SeaPlaque 아가로스로가 첨가된 고체 배지로 덮어 플라크가 형성될 때 염색을 하여 정량 하였다.
쥐 노로바이러스[MNV-1.CW1 strain, a gift from Herbert W. Virgin (Washington University School of Medicine, St. Louis, MO, USA)]는 RAW264.7 세포에서 증식되었다. 바이러스 역가는 이전에 설명된 방법에 따라 플라크 에세이를 통해 결정되었다.
(4) 세포 생존력 분석
잔토리졸(XNT) 및 기타 항바이러스 화합물의 세포독성은 MTS [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenly)-2H-tetraxolium] reagent (Promega, Madison, WI, USA)를 이용하여 측정하였다. 방법을 간단히 요약하면, 96-well plate (2 x 104 cells/well)에서 성장한 세포를 24시간 또는 48시간 동안 다양한 농도의 화합물로 처리하였다. 그 후, MTS를 첨가하고, 37℃에서 1시간 동안 인큐베이션한 후, 96-well microplate 판독기(GloMax-Multi Detection System, Promega)에서 흡광도를 측정하였다.
(5) 실시간 역전사 정략(RT-qPCR)
총 RNA는 Trizol 시약(Invitrogen, Carlsbad, CA, USA)을 사용하여 분리하였다. SCoV2 genomic RNA (gRNA), SCoV1 N-coding subgenomic (sg) mRNA 및 HCV subgenomic RNA 카피수(copy number)는 Realtime PCR Master Mix (Toyobo, Osaka, Japan)를 이용하여 결정하였다. MNV-1 gRNA 및 Norwalk 바이러스 레플리콘 RNA (HG23) 카피 수는 TOPreal qPCR 2X PreMIX (Enzynomics, Daejeon, South Korea)를 이용하여 결정하였다. RT-qPCR에 사용된 프라이머는 표 1에 제시하였다.
SCoV2 gRNA 및 SCoV1 sgRNA에 대한 표준 RNA는 T7 MEGAscript 키트(Ambion, TX, USA) 및 PCR-증폭된 cDNA 템플릿을 이용하여 시험관내 전사 후 제조하였다. SCoV2 gRNA 카피 수를 결정하기 하기 위한 RNA를 얻기 위해, ORF1ab의 특정 영역을 커버하는 cDNA 주형을 정방향 프라이머(서열번호 1: 5'- TAATACGACTCACTATAGATCATCCAAATCCTAAAGGATTTTG -3'; 밑줄 친 서열은 T7 프로모터)와 역방향 프라이머(서열번호 2: 5'- CGACATCAGTACTAGTGCCTGT-3')를 이용하여 RT-PCR로 제조하였다. SCoV1 레플리콘 RNA 및 SCoV1 레플리콘 유래 N-특이 sgRNA의 RT-qPCR 정량화는 이전에 발표한 논문에 기술한 방법에 따라 진행하였다.
Gene Primer set Sequence (5'-3')a 서열번호
SARS-CoV-2 Forward CCCTGTGGGTTTTACACTTAA 서열번호 3
Reverse ACGATTGTGCATCAGCTGA 서열번호 4
Probe FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1 서열번호 5
SARS-CoV N Forward ATATTAGGTTTTTACCTACCCAGG 서열번호 6
Reverse CGTCGGGTAGCTCTTCGGTAG 서열번호 7
Probe FAM-TCCTCCTTGCCATGCTGAGTGAGA-BHQ1 서열번호 8
HCV replicon Forward GCGTCTAGCCATGGCCTTAGTATGAGTGTC 서열번호 9
Reverse ACCACAAGGCCTTTCGCGACCCAACACTAC 서열번호 10
Probe FAM-CTGCGGAACCGGTGAGTACAC-TAMRA 서열번호 11
MNV-1 Forward CACGCCACCGATCTGTTCTG 서열번호 12
Reverse GCGCTGCGCCATCACTC 서열번호 13
NoV-GI Forward CGYTGGATGCGNTTYCATGAa 서열번호 14
Reverse CTTAGACGCCATCATCATTYACa 서열번호 15
hGAPDH Forward GAAGGTGAAGGTCGGAGTC 서열번호 16
Reverse GAAGATGGTGATGGGATTTC 서열번호 17
a Mixed bases are as follows: Y, C or T; N, any. NoV-GI, human norovirus genotype I.
(6) SCoV2 S 단백질을 지닌 슈도바이러스(pseudovirus)를 사용한 세포진입 분석
쥐 백혈병 바이러스(MLV: murine leukemia virus) 기반 SCoV2 스파이크 단백질(S)-유사형 레트로바이러스(SARS2pp)를 SCoV2 진입 분석에 이용하였다. 슈도바이러스(pseudovirus)에 SCoV2 스파이크 단백질이 로딩되게 하기 위해서 C-말단 19개 아미노산 ER-보유 신호가 결실된 SCoV2 S 단백질을 인코딩하는 인간 코돈 최적화 cDNA가 삽입된 pcDNA3.1_SCoV2-S△C19를 제작하여 사용하였다.
패키징 벡터와 MLV 유전자에 리포터가 들어 있는 벡터와 같이 pcDNA3.1_SCoV2-S△C19를 HEK293T 세포에 형질 감염(transfection)한 뒤, 12시간 후 배지를 교체하고, 슈도바이러스를 함유하는 배양 배지를 2일 후에 획득하였다. 그 후, 원심분리를 통해 얻은 슈도바이러스를 0.22 μm 시린지 필터에 통과시켰다. 상기 방법으로 얻은 SARS2pp는 SCoV가 숙주세포에 진입하는데 필요한 인간 ACE2 (hACE2)를 일시적으로 발현시킨 HEK293T 세포에 감염시킨 후 Nano-Glo 루시퍼라제 에세이를 수행함으로써, SCoV2 스파이크 단백질(S)를 통한 슈도바이러스의 세포내 진입능을 평가하였다. 상기 세포주에 슈도타입바이러스를 감염시킨 다음 배지를 12시간 후 교체하고 48시간 동안 추가 배양하였다. 이후 회수한 세포를 Glolysis 버퍼(Promega)에서 용해한 후 Nano-Glo 루시퍼라제 분석 시스템(Promega)을 이용하여 루시퍼라제 활성을 정량분석 하였다.
(7) SCoV1 서브게놈 레플리콘 복제 분석
Renilla luciferase (Rluc)를 발현하는 pSARS-REP-Feo 및 pRL-TK (Promega) [형질 감염 효율을 노말라이제이션(normalization) 하기 위해 내부 대조군(internal control)으로 사용)]를 인산칼슘 매개 형질 감염(calcium phosphate-mediated transfection)법으로 HEK293 또는 HEK293T 세포에 도입하였다. 6시간 후, 세포를 세척하고 특정 농도의 잔토리졸(XNT) 또는 DMSO 비히클(vehicle)로 처리하였다. 24시간 추가로 배양한 후, Rluc와 Fluc 활성은 Dual-Glo luciferase assay system (Promega)을 사용하여 측정하였다.
(8) 면역블로팅 분석
세포를 EDTA가 없는 프로테아제 억제제 칵테일(Roche Diagnostics, Mannheim, Germany)이 보충된 용해 완충액(50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM EDTA 및 1% Triton X-100)에 현탁시키고, 얼음 위에서 20분간 배양하여 세포를 용해시켰다. 원심분리 후 얻어진 세포 용해물을 나트륨 도데실 설페이트-폴리아크릴아미드 겔 전기영동(SDS-PAGE: sodium dodecyl sulfate-polyacrylamide gel electrophoresis)한 후, 니트로셀룰로오스(nitrocellulose) Hybond ECL 멤브레인(GE Healthcare Life Sciences, Piscataway, NJ, USA)으로 블로팅하고, 적절한 항체 세트를 이용하여 단백질을 검출하였다.
(9) 재조합 SCoV2 효소의 발현 및 정제
SCoV2 (Wuhan strain, NC_045512.2) Nsp5, Nsp12 및 Nsp13에 대한 E. coli codon-optimized cDNA를 화학적으로 합성하고, 특정 프라이머 세트를 이용하여 PCR 증폭하고, 발현 벡터 pTrcHisB (Invitrogen)에 클로닝하였다. Nsp5 활성형 단백질을 얻고자 하였고, N-말단에 정제를 위해 붙인 (His)6-태그를 제거한 Nsp5를 얻기 위해 Factor-Xa 절단 부위를 삽입하였다. 재조합 SCoV2 효소의 발현 및 정제는 아래와 같은 방법으로 진행하였다. 요약해서, 이들 효소 모두는 E. coli (Escherichia coli: 대장균) 로제타(Rosetta) 균주(Sigma-Aldrich)에서 발현하였다. 각각의 발현 벡터로 형질 전환된 세포를 37℃에서 배양하고, 0.5 mM IPTG (isopropyl-β-D-thiogalactopyranoside)를 첨가하여, 16℃에서 20시간 동안 단백질 발현을 유도하였다. 세포를 수집하고, 결합 완충액에 재현탁하고, 초음파 처리하여 수상을 수집한 후, 이를 Ni-NTA (Ni-nitrilotriacetic acid) 아가로스 수지(Qiagen, Hilden, Germany)를 사용한 금속 친화성 크로마토그래피로 재조합단백질을 정제하였다. 재조합단백질을 함유한 분획은 모아서 완충액 A (50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 1 mM DTT 및 10% 글리세롤)에 투석하였다. 필요한 경우 추가로 Q-Sepharose 컬럼(Amersham Biosciences, Piscataway, NJ, USA)을 사용하여 단백질을 정제하였다. Nsp5의 경우, 정제된 단백질을 완충액 A에서 20℃에서 밤새(overnight) Factor-Xa (New England Biolabs, Ipswich, MA, USA)로 처리하고, 혼합물을 Ni-NTA 아가로스 수지에 다시 로딩하여, (His)6-태그가 제거된 Nsp5 단백질 함유통과 분획을 수집하였다. 모든 정제된 단백질은 완충액 A에 투석 후, 분취량을 -80℃에 보관하며 사용하였다.
(10) Nsp 12 RdRp (RNA-dependent RNA polymerase) 효소 활성 분석
시험관 내 RNA 의존성 RNA 중합효소(RdRp: RNA-dependent RNA polymerase) 분석은 정제된 재조합 SCoV2 Nsp12 3 pmol, poly(C) 기질 1 μg, oligo(G)20 프라이머 10 pmol, GTP 5 μM 및 5 μCi [α32P]-GTP (Amersham Pharmacia Biotech, Uppsala, Sweden)을 총 부피 25 μl RdRp 반응 완충액(50 mM Tris-HCl, pH 8.0, 50 mM NaCl, 2 mM MnCl2, 1 mM DTT, 10% 글리세롤 및 20 U of RNase inhibitor)에 넣고, 1 내지 2시간 동안 32℃에서 반응시켰다. RdRp 분석의 반응 생성물은 8 M 유레아(urea)를 함유하는 변성 7.5% 폴리아크릴아미드 겔(polyacrylamide gel)에서 전기영동 후 겔을 인광 이미징 플레이트(Phosphorimaging plate)에 노출하였으며, 반응 생성물은 Amersham Typhoon 5 Biomolecular Imager (GE Healthcare Life Sciences, Piscataway, NJ, USA)를 이용하여 검출하였다.
(11) Nsp5 프로테아제 효소 활성 분석
형광공명 에너지전달(FRET: fluorescence resonance energy transfer) 기반 프로테아제 활성 분석을 위한 효소 반응은 바닥이 평평한 검은색 96-well microtiter plate에서 진행하였다. 100 nM 정제된 재조합 SCoV2 Nsp5를 포함한 총 100 μl 부피의 반응 완충액(50 mM Tris 완충액, pH 7.5)에 다양한 농도의 억제제를 첨가하고, 실온에서 10분 동안 사전 인큐베이션한 후, FRET 기질 펩티드(DABCYL-KTSAVLQ SGFRKME-EDANS)를 최종 농도 10 μM로 첨가해 효소반응을 진행하였다. 반응은 25℃에서 일정 시간 동안 진행하였다. Nsp5가 없는 동일한 반응의 판독 값을 측정해 공백값으로 설정하였다. 340 nm에서 자극 후 EDANS에서 방출된 형광 강도는 535 nm에서 형광계(Victor 5; PerkinElmer Biosciences, Boston, MA, USA)를 사용하여 측정하였다.
(12) Nsp13 헬리카제 효소 활성 분석
Nsp13에 의한 FRET 기반 헬리카제 활성에 의한 이중 가닥 DNA의 풀림 분석 에세이(helicase unwinding assay)는 아래 기술한 방법으로 수행하였다. FL-BHQ 올리고(서열번호 18: 5'-TTTTTTTTTTTTTTTTTTCGAGCACCGCCTGCGGCTGCACC-BHQ1-3') 및 RL-FAM 올리고(서열번호 19: 5'-FAM-GGTGCAGCCGCAGCGGTGCTCG-3')(Macrogen, Seoul, South Korea)를 어닐링하여 얻은 100 nM 이중 나선 DNA 기질과 125 nM 포획 단일가닥(서열번호 20: 5'-GGTGCAGCCGCAGCGGTGCTCG-3') 및 80nM의 정제된 SCoV2 Nsp13를 포함한 총 100 μl 반응 완충액(50mM Tris-HCl, pH7.5, 0.075% Triton X-100 및 1 mM ATP)을 96-well black polystyrene plate 안에서 60분 동안 25℃에서 반응시켰다. 이후 이중 나선 DNA 기질의 풀림으로 인해 증가하는 형광 신호를 535 nm에서 형광계(Victo 5; PerkinElmer Biosciences)를 사용하여 측정하였다.
(13) 인터페론 β 리포터 분석
24-well plate에서 배양한 HEK293T 또는 VeroE6 세포에 pGL3-IFN-β(500 ng)[John Hiscott(McGill University, Montreal, Quebec, Canada) 제공] 및 pRL-TK(50 ng)를 같이 형질 감염하였다. 6시간 후 새로운 배지를 형질 감염된 세포에 첨가하고 24 시간 추가 배양한 뒤 Promega사의 Dual-Glo 루시페라제 분석 시스템(Dual-Glo luciferase assay)을 사용하여, Fluc 및 Rluc 활성을 측정하였다. 형질 감염된 세포에 잔토리졸(XNT) 또는 DMSO 비히클(0.1% 최종 농도)를 새로운 배지에 첨가하여 인터페론(interferon) 유도효과를 분석하였다.
(14) 데이터 분석 및 통계 분석
항바이러스 화합물에 의한 CoV 복제 억제에 대한 50% 유효 농도(EC50) 값은 GraphPad Prism 6.01 (GraphPad Prism Software Inc., La Jolla, CA, USA)을 이용하여 결정하였다. 본 발명의 실시예의 데이터는 달리 명시되지 않는 한 최소 3개의 독립적인 실험에서 평균 ± 표준 편차(SD)로 표시하였다. 통계 분석은 GraphPad Prism 6.01을 이용하여 수행하였다. P-value는 unpaired Student's t-test를 이용하여 계산하였고, P < 0.05인 값은 통계적으로 유의한 것으로 간주하였다.
2. 실험 결과
(1) SCoV2에 대한 항바이러스제로서의 잔토리졸
SCoV2(KCDC03)에 감염된 I형 IFN-결핍 Vero E6 세포에 최소 세포 독성(< 20% 세포 생존 감소)을 나타내는 농도 범위내의 잔토리졸(XNT)을 처리하여 항바이러스 활성을 평가하였다(도 1A 및 도 1B). 잔토리졸(XNT) 처리는 감염 후 24시간(hpi)뒤 세포내 및 세포외 바이러스 RNA 역가의 상당한 감소를 가져왔고, 평균 EC50은 각각 8.26 μM 및 5.76 μM임을 확인하였다(도 1C 및 도 1D). 잔토리졸(XNT)은 용량 의존적으로 감염성 바이러스 역가를 감소시켰으며, 20 μM 처리 농도에서 비처리군 대비 ~ 3-log10 감염성 바이러스 역가를 감소시킴을 확인하였다(도 1E). 이와 동반하여 바이러스 단백질(스파이크 및 N 단백질) 발현량도 현저히 감소시킴을 확인하였다(도 1F). SCoV2 감수성 폐 선암종 Calu-3 세포(SCoV2-permissive lung adenocarcinoma Calu-3 cells)에서도 세포 생존율에 영향을 주지 않는(도 2A), 20 μM 농도 잔토리졸(XNT) 처리에 의해 세포내 및 세포외 바이러스 RNA 카피 수가 감소됨을 확인하였다(도 1G 및 도 1H). 또한, Calu-3 세포에서 감염 후 48 시간 뒤, 세포외 바이러스 RNA 역가가 > 2-log10배 감소함을 확인하였다(도 2B).
그러나, 잔토리졸(XNT)의 항바이러스 효능은 SCoV2 RNA 중합효소에 의한 RNA 합성을 억제하는 것으로 알려진 FDA 승인 포스포르아미다이트 뉴클레오사이드(phosphoramidite nucleoside) 전구약물 렘데시비르(RDV)보다 10배 이상 낮았다. 렘데시비르(RDV)는 잔토리졸(XNT)과 마찬가지로 20 μM에서 세포 생존력에 영향을 미치지 않음을 확인하였다(도 3A). 렘데리비르(RDV)는 용량 의존적으로 바이러스 복제를 억제하여 바이러스 단백질 발현의 감소와 세포외 바이러스 RNA 역가를 감소시킴을 확인하였다(도 3B 및 도 3C). EC50 값은 0.33 μM로 결정되었다.
(2) SCoV2 세포 진입에 대한 잔토리졸의 영향
잔토리졸(XNT)의 항바이러스 작용 기전을 이해하기 위해, 먼저 잔토리졸(XNT)이 바이러스 입자에 작용하거나 세포 신호 전달 경로를 교란함으로써 바이러스 감염성 또는 진입을 방해하는지 평가하였다. MLV 포장 벡터와 C 말단 19개의 아미노산 결실된 SCoV2 스파이크 단백질을 발현하는 벡터 및 리포터 발현을 하도록 변형된 MLV 유전자 발현 벡터를 HEK293T 세포를 감염시켜 생성시킨 SCoV2 스파이크 단백질(S) 로딩 MLV 유래 슈도바이러스를 이용하였다(도 4A). 생성된 슈도타입의 바이러스(pseudotyped virus)의 세포 진입은 후기 엔도솜(endosome)에서 S-단백질 매개 막 융합을 차단함으로써 SCoV2 진입을 방해하는 것으로 알려진 카텝신 억제제(cathepsin inhibitor)인 E-63d에 의해 억제됨을 확인하였다(도 4B).
상기와 같이 구축된 에세이를 사용하여 잔토리졸(XNT)의 전처리 혹은 감염과 동시 처리가 슈도바이러스 진입에 어떤 영향을 미치는지를 테스트하였다. 그 결과, SCoV2-슈도타입 바이러스(pseudotyped virus)의 세포 진입에 영향을 미치지 않음을 확인하였다(도 4C). 반면, SCoV2에 대한 항바이러스 활성을 나타내는 것으로 밝혀진 라이소소모트로픽(lysosomotropic) 제제인 HCQ(2 μM)를 전처리 시, 동시 처리와는 달리 슈도바이러스의 진입을 억제하여 루시페라제 활성 측정치를 낮추는 것을 확인하였다(도 4D). 또한, 잔토리졸(XNT)의 전처리(20 μM)는 바이러스 진입에 영향을 미치지 않음을 확인하였다. 종합하면, 이러한 결과는 잔토리졸(XNT)의 항바이러스 활성이 바이러스 진입 과정을 방해하여 유발된 것이 아님을 보여주고 있다.
(3) 잔토리졸에 의한 SCoV1 서브게놈 레플리콘 복제 억제
바이러스 복제 및 세포 항바이러스 방어 시스템 회피에 관여하는 16개의 비구조단백질(Nsp)을 생성하는 SCoV2 ORF1a/b의 아미노산 서열이 SCoV1의 해당 단백질들과 매우 유사하다는 사실에 근거하여 잔토리졸(XNT)이 SCoV1 복제를 억제할 수 있는지 평가하고자 하였다. 이를 위해 SCoV1 서브게놈의 복제만 일어나고 감염성 바이러스를 생성하지 못하는 서브게놈 레프리콘을 활용해 실험을 진행하였다. 잔토리졸(XNT)은 50 μM 농도에서 서브게놈 레플리콘 복제 동안 전사 조절 서열 9(TRS9: transcription-regulating sequence 9)를 통해 합성되는 N 유전자 특이적 sg-mRNA(N sg-mRNA)의 카피 수를 낮추는 효과를 보여주었다. 이로 인해 N 단백질의 발현량도 현저히 감소되는 것을 볼 수 있었다. 결론적으로 잔토리졸이 사스코로나바이로스의 복제를 억제하는 기능이 있음을 확인하였다(도 5).
이러한 항바이러스 효능은 I형 인터페론에 의해 유도되는 선천적 항바이러스 반응에 의한 것이 아님을 확인하였다. 또한, HEK293 및 VeroE6 세포에 잔토리졸(XNT) 처리 시, IFN-β 발현을 지시하는 프로모터(promoter)가 활성화되지 않음을 확인하였다(도 6).
(4) 잔토리졸에 의한 HCoV-229E 억제
본 발명자들은 잔토리졸(XNT)이 사스코로나바이러스 외에 다양한 병원성 RNA 바이러스의 치료에 이용될 수 있는 광범위한 항바이러스제로 작용하는지 여부를 분석하고자 아래의 다양한 실험을 수행하였다. 잔토리졸(XNT)은 HCV 및 인간 노로바이러스(HuNoV)의 자가 복제 바이러스 서브게놈이 복제되고 있는 Huh7 유래 세포주에 처리 시 이들 바이러스 유전자의 복제를 억제하지 않음을 확인하였다(도 7a 및 도 7b).
또한, 마우스 노로바이러스에 감염된 RAW264.7 세포에서 노로바이러스의 증식을 억제하는 활성도 관찰되지 않았고, 감염된 마우스 대식세포에 잔토리졸(XNT)을 처리 후 24시간 뒤에 세포 내 바이러스 RNA와 감염성 바이러스 역가 모두 감소하지 않음을 확인하였다(도 7c 및 도7d).
또한, SCoV1, MERS-CoV 및 SCoV2가 속하는 베타코로나바이러스(Betacoronavirus) 속에서 진화적으로 분기된 알파코로나바이러스(Alphacoronavirus) 속에 속해 있는 감기의 원인이 되는 인간 코로나바이러스(HCoV) HCoV-229E에 대해 잔토리졸(XNT)이 항바이러스 활성을 보이는지 평가하였다. 그 결과, 잔토리졸(XNT)은 0.0001의 MOI(Multiplicity of infection)로 감염된 Huh7 세포에서 감염성 바이러스 역가를 용량 의존적으로 감소시켰고, 10 μM 농도에서 플라크 형성을 약 50% 감소시켰으며, 잔토리졸(XNT)은 최대 50 μM 농도에서도 Huh7 세포 생존력에 영향을 미치지 않음을 확인하였다(도 8A 및 도 8B).
그러나, SCoV2에서 관찰된 바와 같이 HCoV에 대한 잔토리졸(XNT)의 항바이러스 효능은 주사제인 렘데시비르(RDV)보다 낮았다. 렘데시비르(RDV)는 Vero E6 세포에서는 세포 독성이 관찰되지 않았으나(도 3A), Huh7 세포에서는 > 1 μM 농도에서 세포 생존력이(> 20%) 감소됨을 확인하였다(도 8C). 그럼에도 불구하고, 렘데시비르(RDV)는 10% 미만의 세포 생존 감소를 나타내는 0.5 μM의 용량에서 HCoV-229E의 증식을 검출할 수 없을 정도로 억제할 수 있음을 확인하였다(도 8D).
종합적으로, 본 발병의 실시예 결과는 잔토리졸(XNT)이 SCoV 및 HCoV에 대해 선택적 항바이러스 활성을 나타냄을 보여주고 있다. 상기 결과들은 약용식물에서 유래한 단일 화합물 잔토리졸(XNT)이 안전한 경구 혹은 비강 투여 범용 코로나바이러스제로 활용될 수 있는 가능성을 제시하고 있다.
(5) SCoV2 변이체에 대한 잔토리졸의 항바이러스 효능
SCoV2는 2019년 말 출현 이후 수많은 변이주를 만들며 인간 숙주에 적응진화하고 있다. 이들 변이바이러스들은 바이러스의 숙주세포 진입에 관여하는 S 단백질뿐만 아니라 ORF1a/1b 코딩 비구조단백질 등에서 다수의 변이를 보이고 있다. SCoV2 초기 원주격인 우한/Hu-1/2019의 서열과 비교 시, 본 발명에서 사용한 KCDC03 (SARS-CoV-2/human/KOR/KCDC03/2020) 분리주는 ORF1a/b에 의해 코딩되는 여러 nsp 들에서 아미노산 서열 차이가 없음을 볼 수 있다(표 2: SCoV2 변이주간 비구조단백질 아미노산 서열 차이). 반면 이들로부터 진화된 GH 계통 분리주 YS006 (SARS-CoV-2/human/KOR/YS006/2020)는 KCDC003 분리주 대비 Nsp 단백질들에서 총5개의 아미노산 변이가 일어나 있으며, 델타 변종 YS117 (SARS-CoV-2/human/KOR/YS117/2021)은 이 보다 더 많은 돌연변이를 지니고 있다.
본 발명에서는 이러한 아미노산 변이를 지닌 상기 Nsp 중 하나에 잔토리졸(XNT)의 표적일 경우, 변이 바이러스에 대한 항바이러스 효과가 달라질 수 있을 것으로 추론하였다. 이 가능성을 평가하기 위해 이들 변이주와 최근에 출현한 오미크론 우려 변이주인 YS430 (SARS-CoV-2/human/KOR/YS430/2022)에 대한 잔토리졸(XNT)의 항바이러스 활성을 비교 평가한 결과, 20 μM 농도의 잔토리졸(XNT)이 테스트한 바이러스 4종에 대해 모두 높은 증식 억제효과를 보임을 확인할 수 있었다. 도 9에서 볼 수 있듯이 세포내 바이러스 유전자 카피수가 비처리군 대비 SCoV2 변이주에 존재하는 다양한 돌연변이에 관계없이 잔토리졸(XNT)이 항바이러스능 활성을 보이는 이상의 결과는 적어도 현재까지 발견된 SCoV2 변이주에 존재하는 돌연변이에 의해 잔토리졸의 항바이러스 기능이 영향을 받지 않음을 알 수 있다.
Gene name a.a. position Wuhan/Hu-1a KCDC03 (S) YS006 (GH) YS117 (Delta)
Nsp2 85 Thr Thr Ile b Thr
Nsp3 77 Leu Phe Leu Leu
707 Ile Ile Ile Leu
792 His His His Leu
822 Pro Pro Pro Leu
Nsp4 293 Val Val Val Ile
446 Ala Ala Ala Val
Nsp6 149 Val Val Val Ala
181 Thr Thr Thr Ile
Nsp7 25 Ser Ser Leu Ser
Nsp12 323 Pro Pro Leu Leu
671 Gly Gly Gly Ser
Nsp13 77 Pro Pro Pro Leu
210 Val Val Val Ile
Nsp14 394 Ala Ala Ala Val
Nsp16 6 Gln Gln Leu Gln
a Wuhan/Hu-1, MN988668; KCDC03, MT020782; YS006, MW345824; YS117, MZ798798
b Amino acid changes in the YS006 and YS117, in comparison to the reference strain KCDC03, are in bold-type(KCDC03 분리주 대비 YS006 및 YS117 분리주에서 발견되는 아미노산 변이는 굵은 글자체로 표시함).
(6) 잔토리졸의 Nsp5, Nsp12 및 Nsp13에 대한 억제 활성
상기 실시예 결과들은 잔토리졸(XNT)이 코로나바이러스들 유전자 복제를 억제할 가능성을 시사하고 있다. 이에 바이러스 복제에 필수적인 역할을 하는 바이러스 효소들을 대상으로 잔토리졸(XNT)이 활성억제 기능이 있는지를 평가하였다. CoV 복제에 필수적인 바이러스 효소로 아미노산 서열 보존성이 매우 높은 Nsp5, Nsp12 및 Nsp13가 알려져 있다. 주요 프로테아제 (main protease; Mpro) 또는 3CL 프로테아제로 불리는 Nsp5는 SCoV2 다단백질(polyprotein)을 최소 11개 부위에서 절단하여, Nsp12 RdRp 및 Nsp13 헬리카제 등을 생성하는데 관여하는 효소이다. 잔토리졸(XNT)이 SCoV1 서브게놈 복제를 억제했기 때문에 본 발명에서는 Nsp5, Nsp12 및 Nsp13에 대한 시험관내 효소 분석을 이용하여 이들 효소가 잔토리졸(XNT)의 표적이 되어 억제될 수 있는지를 평가하였다. 상기 3개 Nsp들은 SCoV1 및 SCoV2 사이에서 각각 96.4%, 96.1% 및 99.8% 아미노산 동일성을 보이고 있다.
SCoV2 Nsp12는 E. coli에서 N-말단 (His)6-태그가 있는 융합 단백질로 발현시킨 후 Ni-NTA 컬럼을 사용하는 친화성 크로마토그래피 방법으로 정제하였다(도 10a 및 도 10b). 정제된 Nsp12는 poly(C) 기질을 rG20 프라이머를 첨가한 조건에서 복제할 수 있는 활성을 보이고 있다. 반면 RdRp 활성 부위 내의 3개 작용기(catalytic triad) 잔기인 SDD를 SAA로 치환시킨 Nsp12(SAA) 재조합단백질은 예상한대로 활성을 소실하는 것을 확인하였다(도 10b 및 도 10c). 이와 같이 확립된 에세이를 사용하여 잔토리졸의 복제효소 활성억제능을 분석한 결과, 복제효소에 직접 작용하여 활성을 억제하지 못함을 확인하였다(도 11a).
또한, SCoV2 Nsp5 프로테아제 및 Nsp13 RNA 헬리카제(도 12 및 도 13)에 대한 FRET 기반 효소 활성 에세이를 활용하여, 잔토리졸의 효소 활성 억제효과를 분석한 결과, 상기 두 효소가 잔토리졸(XNT)의 직접적인 표적이 아님을 확인할 수 있었다. 같은 실험 조건에서 Nsp5의 프로테아제 활성 및 Nsp13의 dsDNA 풀림 활성을 억제하는 물질로 알려진 엡셀렌(ebselen)과 비스무트 시트레이트(bismuth citrate)는 이들 효소의 활성을 억제하는 것을 볼 수 있다(도 11b 및 도 11c).
결론적으로 앞선 실시예들에서 본 발명자들은 잔토리졸이 CoV 선택적 항바이러스 효능을 보이며, 이 화합물의 항바이러스 활성은 CoV 바이러스 유전자 복제 억제와 연관되어 있음을 입증할 수 있다. 또한, 상기 실시예 2.(6)의 결과는 잔토리졸(XNT)의 SCoV 복제 억제 활성이 CoV에서 아미노산 서열이 보존된 Nsp5, Nsp12 및 Nsp13 효소들을 직접 억제하여 유발되는 것이 아님을 나타낸다.

Claims (10)

  1. 잔토리졸(XNT: Xanthorrhizol) 또는 이의 염을 포함하는 항-코로나바이러스용 조성물.
  2. 청구항 1에 있어서, 상기 잔토리졸은 상기 코로나바이러스의 복제를 억제하는 것인, 조성물.
  3. 청구항 1에 있어서, 상기 잔토리졸은 상기 코로나바이러스의 스파이크 단백질 또는 N 단백질의 발현을 억제하는 것인, 조성물.
  4. 청구항 1에 있어서, 상기 코로나바이러스는 사스코로나바이러스1(SARS-CoV-1: Severe Acute Respiratory Syndrome Coronavirus1), 사스코로나바이러스2(SARS-CoV-2: Severe Acute Respiratory Syndrome Coronavirus2), 인간코로나바이러스(HCoV-229E: human coronavirus 229E) 및 이들의 변이체(variant)로 이루어진 군에서 선택되는 하나 이상의 코로나바이러스인, 조성물.
  5. 청구항 4에 있어서, 상기 변이체는 상기 바이러스의 Nsp2, Nsp3, Nsp4, Nsp5, Nsp6, Nsp7, Nsp12, Nsp13, Nsp14 및 Nsp16으로 이루어진 군에서 선택되는 하나 이상의 단백질을 구성하는 아미노산이 변이된 것인, 조성물.
  6. 청구항 4에 있어서, 상기 변이체는 상기 바이러스로부터 Nsp2 단백질의 85번 위치의 아미노산, Nsp3 단백질의 77, 707, 792 및 822번 위치의 아미노산들, Nsp4 단백질의 293 및 446번 위치의 아미노산들, Nsp6 단백질의 149 및 181번 위치의 아미노산들, Nsp7 단백질의 25번 위치의 아미노산, Nsp12 단백질의 323 및 671번 위치의 아미노산들, Nsp13 단백질의 77 및 210번 위치의 아미노산들, Nsp14 단백질의 394번 위치의 아미노산 및 Nsp16 단백질의 6번 위치의 아미노산으로 이루어진 군에서 선택되는 하나 이상의 아미노산이 변이된 것인, 조성물.
  7. 잔토리졸(XNT: Xanthorrhizol) 또는 이의 약학적으로 허용되는 염을 포함하는 코로나바이러스 감염증의 예방 또는 치료용 약학적 조성물.
  8. 청구항 7에 있어서, 상기 약학적 조성물은 비강 투여되는 것인, 약학적 조성물.
  9. 잔토리졸(Xanthorrhizol) 또는 이의 약학적으로 허용가능한 염을 이를 필요로 하는 개체에 투여하는 단계를 포함하는 코로나바이러스 감염증의 예방 또는 치료 방법.
  10. 코로나바이러스 감염증의 예방 또는 치료용 약제의 제조를 위한 잔토리졸(Xanthorrhizol) 또는 이의 약학적으로 허용가능한 염의 용도.
PCT/KR2022/015329 2021-10-14 2022-10-12 잔토리졸 또는 이의 염을 포함하는 항-코로나바이러스용 조성물 WO2023063695A1 (ko)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
KR20210136860 2021-10-14
KR10-2021-0136860 2021-10-14
KR10-2022-0123702 2022-09-28
KR1020220123702A KR20230054269A (ko) 2021-10-14 2022-09-28 잔토리졸 또는 이의 염을 포함하는 항-코로나바이러스용 조성물

Publications (1)

Publication Number Publication Date
WO2023063695A1 true WO2023063695A1 (ko) 2023-04-20

Family

ID=85988445

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2022/015329 WO2023063695A1 (ko) 2021-10-14 2022-10-12 잔토리졸 또는 이의 염을 포함하는 항-코로나바이러스용 조성물

Country Status (1)

Country Link
WO (1) WO2023063695A1 (ko)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20030014556A (ko) * 2001-08-11 2003-02-19 (주)바이오케어 신규 항바이러스제
KR101267312B1 (ko) * 2011-02-21 2013-05-24 연세대학교 산학협력단 신규 항사스바이러스 치료제

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20030014556A (ko) * 2001-08-11 2003-02-19 (주)바이오케어 신규 항바이러스제
KR101267312B1 (ko) * 2011-02-21 2013-05-24 연세대학교 산학협력단 신규 항사스바이러스 치료제

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
KIM MINWOO, CHO HEE, AHN DAE-GYUN, JUNG HAE-GWANG, SEO HAN YOUNG, KIM JI-SU, LEE YOUN-JUNG, CHOI JUN YONG, PARK IN HO, SHIN JEON-S: "In Vitro Replication Inhibitory Activity of Xanthorrhizol against Severe Acute Respiratory Syndrome Coronavirus 2", BIOMEDICINES, vol. 9, no. 11, 19 November 2021 (2021-11-19), pages 1725, XP093058646, DOI: 10.3390/biomedicines9111725 *
KUSUMAWATI N., BAHAR A., SETIARSO P., MUSLIM S., AULIYA A.R.S.: "GINGER AND TEMULAWAK BASED HERBAL TEA AS POTENTIAL FUNCTIONAL DRINK PRODUCTS IN THE ERA OF COVID-19", RASAYAN JOURNAL OF CHEMISTRY, RASAYAN JOURNAL OF CHEMISTRY, INDIA, vol. 14, no. 03, 1 January 2021 (2021-01-01), India , pages 1920 - 1926, XP093058645, ISSN: 0974-1496, DOI: 10.31788/RJC.2021.1436331 *
M VASAVI, M PUJITHA, G RAAGINI, M RAMAIAH, RAO K RAMALINGESWARA: "NATURAL ANTIVIRALS FOR THE MANAGEMENT OF SARS-COVID-19: A REVIEW", INTERNATIONAL JOURNAL OF RESEARCH IN AYURVEDA AND PHARMACY, vol. 12, no. 3, 6 July 2021 (2021-07-06), pages 113 - 117, XP093058642, ISSN: 2277-4343, DOI: 10.7897/2277-4343.120385 *
NUGRAHA RHEA VEDA, RIDWANSYAH HASTONO, GHOZALI MOHAMMAD, KHAIRANI ASTRID FEINISA, ATIK NUR: "Traditional Herbal Medicine Candidates as Complementary Treatments for COVID-19: A Review of Their Mechanisms, Pros and Cons", EVIDENCE-BASED COMPLEMENTARY AND ALTERNATIVE MEDICINE, OXFORD UNIVERSITY PRESS, US, vol. 2020, 10 October 2020 (2020-10-10), US , pages 1 - 12, XP093058644, ISSN: 1741-427X, DOI: 10.1155/2020/2560645 *

Similar Documents

Publication Publication Date Title
McKee et al. Candidate drugs against SARS-CoV-2 and COVID-19
Yousefi et al. Repurposing existing drugs for the treatment of COVID-19/SARS-CoV-2 infection: A review describing drug mechanisms of action
Gall et al. Emerging alphaviruses are sensitive to cellular states induced by a novel small-molecule agonist of the STING pathway
Feng et al. Enterovirus 2Apro targets MDA5 and MAVS in infected cells
Wen et al. Seneca Valley virus 2C and 3C inhibit type I interferon production by inducing the degradation of RIG-I
Pillaiyar et al. The recent outbreaks of human coronaviruses: A medicinal chemistry perspective
Low et al. Repositioning Ivermectin for Covid-19 treatment: Molecular mechanisms of action against SARS-CoV-2 replication
Sternberg et al. Novel drugs targeting the SARS-CoV-2/COVID-19 machinery
Ashour et al. A systematic review of the global intervention for SARS-CoV-2 combating: from drugs repurposing to molnupiravir approval
Kuo et al. Kinetic characterization and inhibitor screening for the proteases leading to identification of drugs against SARS-CoV-2
Cinatl Jr et al. Development of antiviral therapy for severe acute respiratory syndrome
Wang et al. Porcine IFITM1 is a host restriction factor that inhibits pseudorabies virus infection
CN113289018B (zh) 金诺芬等老药及其组合物在抗单正链rna病毒中的应用
WO2021235616A1 (ko) 제2형 중증급성호흡기증후군 코로나바이러스 감염 질환의 예방 또는 치료용 조성물
Muhammed Molecular targets for COVID-19 drug development: enlightening Nigerians about the pandemic and future treatment
Gómez-Ríos et al. Repurposing antivirals as potential treatments for SARS-CoV-2: From SARS to COVID-19
Prüβ Variants of SARS CoV-2: mutations, transmissibility, virulence, drug resistance, and antibody/vaccine sensitivity
Xu et al. Devil's tools: SARS-CoV-2 antagonists against innate immunity
Han et al. Advances and challenges in the prevention and treatment of COVID-19
Paul et al. Repurposed antiviral drugs for the treatment of COVID-19: syntheses, mechanism of infection and clinical trials
WO2023063695A1 (ko) 잔토리졸 또는 이의 염을 포함하는 항-코로나바이러스용 조성물
WO2021194290A1 (ko) 유행성 rna 바이러스 감염질환의 예방 또는 치료용 약제학적 조성물
Miao et al. Antiviral efficacy of selective estrogen receptor modulators against SARS‐CoV‐2 infection in vitro and in vivo reveals bazedoxifene acetate as an entry inhibitor
KR20230054269A (ko) 잔토리졸 또는 이의 염을 포함하는 항-코로나바이러스용 조성물
Zhu et al. Cholesterol 25-hydroxylase inhibits Senecavirus A replication by enzyme activity-dependent and independent mechanisms

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22881322

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 22881322

Country of ref document: EP

Kind code of ref document: A1