WO2023057777A1 - Synthetic genome editing system - Google Patents
Synthetic genome editing system Download PDFInfo
- Publication number
- WO2023057777A1 WO2023057777A1 PCT/GB2022/052555 GB2022052555W WO2023057777A1 WO 2023057777 A1 WO2023057777 A1 WO 2023057777A1 GB 2022052555 W GB2022052555 W GB 2022052555W WO 2023057777 A1 WO2023057777 A1 WO 2023057777A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- nucleic acid
- target
- dbd
- component
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases [RNase]; Deoxyribonucleases [DNase]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
- C07K2319/735—Fusion polypeptide containing domain for protein-protein interaction containing a domain for self-assembly, e.g. a viral coat protein (includes phage display)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/85—Fusion polypeptide containing an RNA binding domain
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/20—Type of nucleic acid involving clustered regularly interspaced short palindromic repeats [CRISPR]
Definitions
- the present invention provides a synthetic, modular system for DNA modification as may be employed for genome editing comprising a targeting nucleic acid possessing both DNA targeting ability and ability to bind a recognition module of a modular polypeptide where the modular polypeptide also includes as a separate module an effector component.
- the effector component may be a protein component for modifying structure or regulation of a gene, either alone or for example after dimerization. Desirably it may be an artificial nickase comprising a multimer of linked, self-assembling short peptides as also now taught herein.
- a totally synthetic gene modifying tool has been attained which is far smaller than a CRISPR-Cas9 single guide RNA (sgRNA) gene modifying system thereby easing delivery to cells.
- the polypeptide component may be delivered with the targeting nucleic acid(s) in a single AAV vector.
- RNA-guided CRISPR-Cas9 systems and other RNA-guided CRISPR-Cas systems have revolutionised the field of gene editing since the initial studies showing the ability of a sgRNA to direct CRISPR-Cas9 double-strand DNA breaks upon protospacer adjacent motif (PAM) recognition in the target DNA.
- PAM protospacer adjacent motif
- the Streptococcus pyogenes Cas9 (SpCas9) with sgRNA is 4.1 kbp (1368 aa) in size and more recently identified smaller cas enzymes are still nucleases of substantial size and less than optimal for desired vector delivery.
- the overall size of AAV only allows up to 5kb of heterologous sequence to be packaged.
- immunogenicity is a consideration for in vivo therapeutic application in humans. Streptococcus pyogenes Cas9 reactive T cells have been reported in the adult human population.
- SCNA specificity conferring nucleic acid
- the SCNA comprises a nucleotide sequence complementary to a sequence of the target nucleic acid and a recognition component capable of specifically linking the SCNA to the linking domain, e.g. the recognition component of the SCNA may be one of a specific binding partner pair or a naturally-occurring RNA aptamer which recognises its cognate polypeptide binding component.
- a pairing of such artificial nucleoprotein complexes on the target DNA is required to enable dimerization of Fok1 nuclease domains.
- Fok1 nuclease thus provided must be capable of effective interaction with the DNA to make a double stranded DNA break at the target site.
- WO2013/088446 provides only prophetic exemplification for any therapeutic utility and doubts remain over the efficiency of such a system.
- the inventors in this instance have set out to provide a totally synthetic modular system for gene modification as an alternative to use of a CRISPR-Cas/sgRNA system which in the nuclease mode provides good efficiency for DNA target double-strand or single-strand cutting at a predetermined target site and can be designed to provide a gene editing system of far smaller size.
- the small size achievable with use of an artificial nickase as now taught offers the opportunity to choose a wide variety of delivery means including single AAV vector delivery with one, or more than one, targeting RNA.
- the present invention provides a nucleoprotein complex for use in modifying a target nucleic acid, e.g. target DNA, comprising (A) a targeting nucleic acid and (B) a modular polypeptide component, wherein said targeting nucleic acid comprises:
- a targeting nucleic acid element also referred to herein as a targeting element, TE
- TE targeting element
- a recognition element e.g. RNA scaffold, RS
- a nucleic acid recognition module e.g. RNA scaffold binding domain, RSBD
- a connecting sequence which links said targeting element and said recognition element and said modular polypeptide component comprises as linked, separate functional modules:
- nucleic acid recognition module which is devoid of enzymic activity
- a DNA-binding domain which recognises a predetermined sequence in the target, module (a) and said DBD not being naturally found in linkage, and
- the intended purpose of the DBD is to destabilize the structure of a targeted dsDNA upon binding to the predetermined sequence (PDS) in a manner so as to facilitate accessibility of the targeting nucleic acid sequence to the dsDNA structure for hybridization.
- PDS predetermined sequence
- Such functional ability may be assessed as exemplified in Example 1 , e.g. using a dsDNA including the chosen PDS and T7 Endonuclease 1 (T7E1) to evaluate DNA structure.
- T7E1 is well-known as a structure selective enzyme that will detect structural deformities in dsDNA. Other methods of detecting the desired structural deformation upon binding of the DBD polypeptide to a PDS will be recognised.
- the DBD may have binding affinity for a single predetermined sequence but may have ability to bind more than one predetermined sequence.
- the requirement is that the DBD in concert with the targeting element of the targeting nucleic acid directs site-specific modification.
- the DBD is viewed as more than just a secondary tool for positioning at the required target site; it is viewed as having a structural role in facilitating hybridization of the targeting element and thereby facilitating the overall desired target modification. It will thus be recognised that provision of a short DBD polypeptide sequence in this instance is not comparable with use of for example a zinc finger protein or TALE array to merely position an effector or portion of an effector at a specific DNA sequence.
- the effector component of a modular polypeptide of the invention will be an end module.
- the nucleic acid recognition module e.g. RSBD
- the modular polypeptide component will comprise:
- modules (d) optionally, or if required, a first linker and/ or a second linker providing direct linkage of said DBD to said effector component and said nucleic acid recognition module respectively.
- the modules of the modular polypeptide component will generally be linearly linked.
- modules (a), (b) and (c) may, for example, be linearly joined with (a) at the N-terminal and the effector component at the C-terminal or vice versa. In this way, interaction of the targeting nucleic acid with the recognition module of the modular polypeptide component is distanced from the effector component.
- the targeting nucleic acid may be an RNA, preferably wholly an RNA. It will be appreciated that the nucleic acid targeting element is comparable in functional purpose to a CRISPR- Cas9 gRNA. As indicated above, conveniently and preferably, this targeting element may be joined, via a connector, with an RNA motif providing an RNA scaffold (possibly alternatively referred to as an RNA aptamer) which binds a cognate protein or peptide module in the modular polypeptide.
- the RNA scaffold recognizing module of the modular polypeptide component in this case may be referred to as the RNA scaffold binding domain (RSBD).
- the nucleoprotein complex may advantageously comprise (i) a nucleic acid component (NAC) capable of expression as an RNA from an encoding nucleic acid sequence and (ii) a modular polypeptide component, also expressible from a single encoding nucleic acid sequence.
- NAC nucleic acid component
- a modular polypeptide component also expressible from a single encoding nucleic acid sequence.
- a nucleoprotein complex of the invention for use in modifying a target nucleic acid comprises (A) a wholly nucleic acid component (NAC) and (B) a modular polypeptide component, wherein the NAC comprises:
- a targeting element (TE) complementary to a region of the target
- RNA scaffold which specifically binds to an RNA scaffold binding domain (RSBD) of said modular polypeptide component
- a DNA-binding domain linked to (a) which recognises a pre-determined sequence in the target, module (a) and said DBD not being naturally found in linkage;
- DBD is a polypeptide sequence of no more than 70-75 amino acid residues, e.g. no more than a 30 mer, no more than a 25 mer, no more than a 20mer, preferably no more than a 15mer as discussed above. See Figure 1. It will be understood that the separate functional modules of the modular polypeptide component can be advantageously independently substituted and encoded by a single nucleic acid such that they are joined in defined linear succession.
- the target may be any target nucleic acid, RNA or DNA, including a viral nucleic acid.
- the target may be a single-stranded DNA or more commonly a double-stranded DNA (dsDNA).
- dsDNA double-stranded DNA
- a nucleoprotein complex of the invention as indicated above may be particularly favoured as an alternative to a CRISPR-Cas system for delivery to cells to achieve genomic DNA modification, especially in eukaryotic cells including plant cells and human cells.
- the DBD by its specific recognition of a predetermined sequence in a double-stranded DNA assists in melting and/or unwinding of the double helix and thereby assists in targeting by the target nucleic acid and operation of the effector component at the desired site.
- a nuclear localization signal (NLS) and/or organelle localization signal may also be provided as part of the modular polypeptide component for efficient transportation into the nucleus of a eukaryotic cell or efficient transportation into a desired cellular organelle e.g. a mitochondrial or chloroplast localization signal.
- a signal sequence will generally be provided at the N- or C-terminus. It may be connected to one or more additional sequences, e.g. a detection tag to aid detection such as an epitope tag, provided the required function of the modular polypeptide component is maintained; see Figure 25.
- the effector component will not specifically bind to said predetermined sequence and commonly will be devoid of target binding ability. However, it will be recognised that it is merely essential that the effector component does not prevent site-specific targeting of the desired modification by the nucleic acid targeting element and DBD. This may not preclude the effector component having some target, e.g. DNA, recognition capacity.
- modification of the target may be structural or chemical modification, e.g. a change of nucleotide sequence, or change of regulation, e.g. transcription activation.
- the effector component may be any type of effector known for modifying DNA including, for example, a Fok1 nuclease domain (i.e. a Fok1 nuclease minus its DNA binding domain) which can form a functional nuclease when dimerization occurs, e.g. through appropriate targeting of two nucleoprotein complexes of the invention to a target DNA region.
- the effector component may preferably comprise an artificial nuclease formed from linked, self-assembling short peptides as further discussed below.
- Such an artificial nuclease may act as an artificial nickase in that it cuts just one strand of a double- stranded DNA at a targeted site.
- the effector component may be a fusion protein in which a nickase is linked to or replaced by another functional component, e.g. a base editor or reverse transcriptase.
- the DBD will be a short peptide, generally no more than a 20 mer, e.g. no more than a 16 mer-18 mer, preferably no more than a 15 mer, selected for binding affinity to a pre-determined sequence in the target of, for example 2-7, preferably 3-6 nucleotides, e.g. the 6 nucleotide sequence 5'GAGGTC3' in a dsDNA target as exemplified herein.
- the DBD is expected to aid scanning of a genome and establish initial contact next to the desired modification site, e.g. cleavage site.
- binding of the DBD to the target DNA is expected to trigger structural changes and subsequent melting at the adjacent sites.
- the DBD component of a genome-editing tool of the invention is seen as an important module for improving genome modification efficiency which can be provided without compromising the wish for a short overall polypeptide component length, preferably compatible with expression from an AAV vector also expressing at least one targeting RNA.
- the modular polypeptide component of a genome editing tool of the invention may thus comprise entirely synthetic short peptides with linkers and providing nickase or nuclease activity by means of an artificial nuclease at a target DNA site.
- a genome-editing tool employing a modular polypeptide component has been termed ApGet, standing for 'Artificial peptidic genome editing tool'.
- Such a polypeptide component may be no more than 220 amino acids (minus any cleavable tag, localization signal or any other sequence other than components (a)-(d)) as exemplified by the ApGet polypeptide of SEQ. ID. No. 1 : consisting of the following components fused in the N- terminal to C-terminal direction: an RSBD of 22 amino acids corresponding to the Lambda N22 protein,
- MDAQTRRRERRAEKQAQWKAAN (SEQ. ID. No. 2) - the linker GGGGSGGGGSGGGGSGGGGSGGGGSGGGGSGGGGS (SEQ. ID. No. 3), i.e. (GGGGS) 7
- the linker GGGGSGGGGSGGGGGS (SEQ. ID. No. 5) and the nuclease module IEKDIHINDGGIEIDIHIDSGGIEIDIHISSGSIEIDIHINNGNIEIDIHIGSDGIEIDIHIGNSGIEIDIHID NGGIEIDIHIDSDGIEIDIHISSSGIEIDIHIGSEGIEIDIHIGDSGIEIDKHINQGS (SEQ. ID. No. 6), minus any additional N- or C-terminal sequence which may be provided as indicated above, e.g. to provide a short NLS and possibly a detection tag.
- the nuclease (shown in bold in SEQ. ID. No.1 above) has ten identical 7 mer peptide units (I El DI HI ; SEQ. ID. No. 7) all linked in the same N to C-terminal direction (referred to herein as an example of a non-inverted decamer) with 4 mer linkers providing beta-turns and additional N- and C-terminal flanking sequences.
- This permits folding whereby the decamer of identical peptide units can produce a secondary structure resembling an anti-parallel beta sheet in which consecutive monomer units will appear orientated in opposite directions; see Figure 8b and Figure 9.
- the artificial nuclease module can be viewed as providing the function of a nickase and may thus be referred to as an artificial nickase. It is to be expected that smaller such genome-editing tools can be achieved with, for example, provision of a nuclease with a lower multiplicity of self-assembling peptides and/or variance of other components. This includes any different peptide sequence of same pattern and also combination of different peptide sequences.
- the artificial nuclease of SEQ. ID. No. 1 may be substituted by another effector component, e.g. a transcriptional activator such as VP64 or another effector component as discussed below.
- another effector component e.g. a transcriptional activator such as VP64 or another effector component as discussed below.
- linker 1 between the artificial nuclease (or a substitute effector component) and DBD may be substituted by the linker specified as linker L1a (SEQ. ID. No. 69).
- Linker 2 between the RSBD and DBD may be substituted, e.g. by a shorter linker as exemplified by linker 2b (SEQ. ID. No. 70).
- the linkers in a modular polypeptide component of the invention may be varied and optimised for any pair of DBD binding and target cutting sites. Such variation will be recognised to be a matter of length requirement calculation based on known target sequence information and appropriate testing. Such linkers may also be designed to increase the protein stability and or solubility. While the Lambda N22 protein was chosen as the RSBD for the illustrative ApGet as set out as SEQ. ID. No. 1 above on the basis that this is only a short 22 amino acid sequence with well-known ability to recognise the 19 nucleotide box B lambda phage sequence (Baron- Benhamou et al. (2004) Methods Mol. Biol.
- RNA scaffold e.g. the same box B sequence.
- an RS can be used in tandem to facilitate the binding of multiple RSBDs.
- a Lambda N22 protein RSBD paired with a Box B sequence provided as the RS of a targeting nucleic acid may be substituted by any of a number of other well- known RNA aptamer- polypeptide binding domain pairings as discussed further herein below.
- an ApGet's polypeptide component is expected to improve the DNA scanning and recognition efficiency of the system compared with known gene-editing systems for producing targeted DNA strand breaks and employing larger molecular weight proteins such as ZFNs, TALENs, meganucleases and CRISPR-Cas entities. Such larger prior art systems will have lower diffusion rates.
- an ApGet minus any nuclease or other effector component i.e. just comprising the nucleic acid recognition module, e.g. an. RSBD, linked to a DBD and coupled with an appropriate targeting nucleic acid may have utility in inhibiting transcription at a target site.
- a system is referred to herein as an ApGet-i system.
- it may be chosen to express an ApGet-i polypeptide with addition of a final C-terminal linker sequence, e.g. the linker of SEQ. ID. No. 5 above.
- an ApGet-i polypeptide minus such a linker will be preferred.
- a modular polypeptide component for a nucleoprotein complex of the invention may be initially expressed as part of a longer polypeptide with an N-terminal and /or C-terminal extension to aid for example solubility in an expression system, e.g. a host cell such as E. coli or an in vitro expression system and /or purification and /or detection.
- an extension may include a protease cleavage site, e.g. a TEV protease cleavage site whereby protease cleavage removes unwanted sequence in the final modular polypeptide for target modification; see Figures 10 and 31.
- the modular polypeptide component may be chosen to express the modular polypeptide component with inclusion of a protein transduction domain (PTD), also sometimes referred to as a cell- penetrating peptide (CPP) or domain to facilitate delivery across a membrane, e.g. into a target cell.
- PTD protein transduction domain
- CPP cell- penetrating peptide
- a linker providing a protease cleavage site.
- PTD protein transduction domain
- Such a PTD may be positioned at the N-terminus or C-terminus.
- PTDs can be classified into 3 types: cationic peptides of for example 6-12 amino acids in length, comprised predominately of arginine, ornithine and /or lysine residues, hydrophobic peptides such as leader sequences of secreted growth factors and cytokines and cell specific peptides.
- Exemplary PTDs include but are not limited to that of the HIV TAT protein, a polyarginine peptide sequence, a VP22 domain (Zender et al. (2002) Cancer Gene Ther. 9, , 486-96), a PDX1 protein transduction domain (Noguchi et al.
- An activatable CPP may be provided comprising a polycationic CPP (e.g. Arg9 or R9) connected via a cleavable linker to a matching polyanion (e.g. Glu9 or E9) which reduces the net charge to nearly zero and thereby inhibits adhesion and uptake into cells (Aguilera et al. (2009) Integr. Biol. (Camb) 1, 371-381) Upon cleavage of the linker, the polyanion is released thus locally unmasking the polyarginine and activating its inherent adhesiveness to facilitate membrane transport.
- a polycationic CPP e.g. Arg9 or R9
- a matching polyanion e.g. Glu9 or E9
- a nucleoprotein complex of the invention may be delivered to host cells either as an active complex, e.g. by electroporation, or with one or both of the polypeptide component and targeting nucleic acid expressed by a polynucleotide.
- nucleic acid or combination of nucleic acids for provision of one or more nucleoprotein complexes of the invention in a host cell.
- the nucleic acid may preferably be a vector, e.g. an AAV vector, capable of expressing both the modular polypeptide component, e.g. including an artificial nickase of the invention, and the targeting nucleic acid.
- More than one targeting nucleic acid may be provided to a host cell to target more than one site.
- a pair of nucleoprotein complexes of the invention including an artificial nickase may be provided by vector delivery to a cell, possibly by means of a single vector, together with a sequence template for homologous recombination.
- nucleoprotein complex or complexes of the invention extend to the full panoply of applications for DNA modification for which a CRISPR-Cas/sgRNA may be employed.
- a method for modifying one or more target nucleic acid sequences employing one or more nucleoprotein complexes of the invention or one or more nucleic acids for provision thereof in a host cell with the proviso that such methods as claimed do not extend to methods of modifying the germ line identity of a human being or methods of medical treatment practised on a human or animal body as such.
- a single modular polypeptide component for provision of the one or more nucleoprotein complexes may be provided in cells by expression from a vector.
- the same vector may preferably also express the required one or more targeting nucleic acids.
- a combination of (i) at least one modular polypeptide component for a genome modification tool of the invention, or a polynucleotide encoding the same and (ii) one or more targeting nucleic acids which can link with said polypeptide component (s), or one or more polynucleotides encoding the same, for use in a method of the invention as discussed above or for use in therapeutic treatment.
- both the polypeptide component and the one or more targeting nucleic acids may preferably be expressed from a single vector.
- an artificial nuclease for use in an ApGet nucleoprotein complex discussed herein represents another aspect of the invention.
- Use of self-assembling peptide clusters incorporating catalytic residues have been previously used to generate artificial enzymes acting as esterases or providing a number of other enzymatic reactions.
- the inventors in this instance have for the first time attained an artificial nuclease which can provide nickase function in a dsDNA using linked, self-assembling short peptides with an approach designed to achieve the required function while minimising size and thereby providing an artificial enzyme well-suited for providing the effector module in a genome editing tool.
- Linking individual peptide units in this way also helps to control the extent of self- assembly.
- FIG. 1 Schematic diagram of a genome editing tool of the invention consisting of a nucleic acid component (NAC) and modular polypeptide component.
- the NAC is a targeting RNA in which TE is the targeting element providing a sequence complementary to a strand region of the target.
- RS is an RNA scaffold part of the NAC which binds to an RNA scaffold binding domain (RSBD) whereby the NAC interacts with the modular polypeptide component.
- RSBD RNA scaffold binding domain
- the TE and RS form a single nucleic acid with a connecting sequence joining the two functional binding sequences such that the required binding can occur.
- DBD is the DNA binding domain of the modular polypeptide component which recognises a predetermined sequence (PDS) of the target DNA
- L1 is a linker linking the DBD to the effector protein for genome modification, e.g. a nuclease (an endonuclease for double-strand breaks or a nickase for single-strand breaks), a transcription activator or repressor or a methylase
- L2 is a linker linking the DBD and RSBD.
- the target sequences can either be immediately adjacent to the PDS, or spaced from the PDS
- FIG. 2 Schematic diagram more specifically of the ApGet system where the modular polypeptide component includes a fused artificial nuclease.
- TE is the targeting element of the targeting RNA which hybridises to a sequence at the target DNA region for nickase action.
- the recognition element of the targeting RNA is joined to the TE by a connecting sequence and provides an RNA scaffold (RS) which binds to an RNA scaffold binding domain (RSBD).
- RS RNA scaffold
- DBD is the DNA binding domain which binds to the predetermined sequence (PDS) on one strand of the target dsDNA.
- L1 and L2 are peptide linkers. Binding of the DBD to the PDS facilitates hybridization of the TE to its complementary sequence.
- Figures 3a-c Evidence of the specific binding and unwinding of dsDNA targets by selected phage clones presenting 12 mer polypeptides.
- the dsDNA targets presented two PDS sequences: 5’-GAGGTC-3’ (PDS1) and 5’- ACGGGT -3’ (PDS2).
- the selected phage clones were incubated with dsDNA containing either PDS1 (reactions 3, 4, 5, 10, 11 and 12) or PDS2 (reactions 1 , 2, 8 and 9) sequences and with either T7E1 nuclease (reactions 1-5) or Surveyor nuclease (reactions 8-12).
- Mock reactions are the incubations of the dsDNA without presence of the selected phage clones, with either T7E1 (reactions 6 and 7) or Surveyor (reactions 13 and 14).
- T7E1 reactions 6 and 7
- Surveyor reactions 13 and 14
- Quantification of the T7E1 and Surveyor mediated cleavage was performed by densitometry analysis using Imaged software. The results are shown in Figures 3b and 3c respectively.
- FIG. 4 Cleavage assay results using T7E1 enzyme for binding of the chemically synthesized peptides 1 , 2, 3 and 4 (Table 2 in Example 1) to the two 6 nt sequences as above designated PDS1 and PDS2 in a dsDNA target and unwinding of the dsDNA target.
- the arrow shows the band which intensifies upon T7E1 endonucleolytic cleavage of the dsDNA target.
- FIG. 5 Schematic diagram illustrating a FRET experiment to assess specific binding and unwinding of a dsDNA target by peptide binding to a PDS with RNA hybridization. Results are also shown for binding of Peptide 1 (SEQ. ID. No. 37 as shown in Table 2) to PDS1 having the 5' to 3' sequence GAGGTC. The FRET signal was determined upon incubation of the PDS1 containing dsDNA targets with 5' FAM-RNA with (2, 4) or without peptide (1, 3). Binding of Peptide 1 is shown to facilitate hybridization of the RNA to sequences adjacent to PDS1 as evident from the increase of FRET signal.
- Peptide 1 SEQ. ID. No. 37 as shown in Table 2
- the FRET signal was determined upon incubation of the PDS1 containing dsDNA targets with 5' FAM-RNA with (2, 4) or without peptide (1, 3). Binding of Peptide 1 is shown to facilitate hybridization of the RNA to sequences adjacent to PDS
- FIG. 6 Schematic diagram of a genome-editing tool of the invention showing possible alternative strand hybridization of a targeting element (TE) of a targeting RNA.
- RS is the RNA scaffold for tethering the targeting RNA to the modular polypeptide component via the RNA scaffold binding domain (RSBD).
- DBD is the DNA-binding domain which binds a short predetermined sequence (PDS) to facilitate heteroduplex formation.
- the DBD is linked via linker to a C-terminal effector protein for nucleic acid modification.
- Figure 7 Emission signal of Thioflavin T (Tht) in the presence of the 7 amino acid peptide LELDLHL (bD peptide; SEQ. ID. no. 8) indicative of production of amyloid ⁇ -sheet structure.
- Figure 8 Designs for an artificial nuclease (a) employing a pentamer or (b) a decamer of linked identical beta-sheet forming peptides with flanking peptide units with increased positive charge through substitution of a hydrophobic residue by a positively charged residue such as lysine or arginine.
- H hydrophobic reside.
- C catalytic amino acid.
- N negative design peptide unit (which limits or avoids inter-molecule polymerization), in this case C- terminal and N- terminal peptide units with increased positive charge.
- K lysine residue substituted for a hydrophobic residue of the beta-sheet forming peptide.
- the C-terminal flanking peptide may also have a final flexible soluble tail, e.g. the 4mer NQRS.
- Each of the preceding peptide units is linked by a linker, e.g. of 4 amino acid residues providing a beta turn.
- Figure 9 “Non-inverted and inverted” artificial nuclease designs. “Non-inverted” means that the individual beta strand units of the nuclease share the same primary sequence in the N- to C-terminal direction whereas in the “inverted” design the primary sequence of consecutive beta stand units is reversed. Boxes 1-7 signify the amino acid sequence of the beta peptide in the N-C terminal direction.
- FIG 10 Diagram illustrating the assembly of pentamer and decamer beta protein nucleases in a complete modular polypeptide component of an ApGet.
- the beta peptide units black are assembled using either five or ten beta peptide units. The units are connected using a series of beta turns like connecting loops.
- Each design contains additional flanking beta peptide units that incorporate a charged residue (lysine, K) to limit inter-molecule polymerization, i.e. negative design (flanking arrows).
- the orientation of beta peptide sequence is modified to mimic either inverted or non-inverted in an attempt to mimic either a parallel or antiparallel beta sheet fold (see again boxes 1-7 in Figure 9 signifying the amino acid sequence of the beta peptide in the N-C terminal direction).
- each artificial beta protein nuclease design is fused with linker 1 as in the ApGet-1.0 protein onto the C-terminal end of the ApGet-i protein providing the remainder of the required modules for a complete synthetic genome editing system.
- the ApGet-i can contain several purification/solubility tags to enhance protein expression and solubility. Shown is such a tag providing a maltose-binding protein fused to a 6x His tag at both the N-terminus and C- terminus.
- the C-terminal His tag is separated from the N-terminal of the ApGet by a spacer unit and TEV cleavage site whereby the whole multi-element tag can be removed.
- FIG. 11 Gel analysis of plasmid DNA cleavage by in vitro transcription and translation (IVTT)-expressed ApGet1.0 protein with 10mer of the IbD peptide.
- ApGet-i (expressed with additional inclusion of the DBD-enzyme linker of ApGetl .0 at the C-terminus) and a no protein control were carried out for each buffer condition to control for activity enabled by the buffer composition or by the contaminating protein components of the IVTT mix.
- Plasmid DNA was mixed with identical quantities of total IVTT protein mix (as per Abs 280nm) for ApGetl .0 10mer non-inverted, inverted, ApGeti and a water control in reaction buffer containing either no metal or 5mM Mn 2+ or Mg 2+ A secondary reaction comparing the cleavage of the IVTT proteins in the presence of Mn 2+ and nuclease inhibitor protein was also carried out.
- Figure 12 Diagrams of the plasmids used in testing recruitment of an ApGet-i by a targeting nucleic acid to PDS-target sequence sites in E. coli cells.
- Figure 13 Results of testing ApGet-i for reducing transcriptional activity on (a) detector for eYFP expression and (b) detector for LacZa expression in EPI300 E.coli cells. Tables 5 and 6 in the exemplification summarise the construct testing. The values presented are average values of the eYFP/OD600 or LacZa/OD600 of the experiments done in triplicate with the standard deviation indicated.
- Figure 14 Diagram of the 'Editor' plasmid and 'Detector' plasmid used in testing a complete ApGet system in E. coli cells.
- the ApGet modular polypeptide component was the amino acid sequence of SEQ. ID. No.1 but with a Fok1 nuclease domain instead of the artificial nuclease.
- Figure 15 Results of ApGet-Fokl editing obtained using 'Editor' and 'Detector' plasmids as illustrated in Figure 14. Editing by the ApGet- Fok1 nuclease construct is evident from the loss of the target-containing detector plasmid resulting in reduced bacterial growth on the selective media (see bars 1-3). The results shown are from co-transformation of EPI300 E. coli cells with an ApGet-Fokl expressing editor plasmid with detector plasmids containing “PDSin” configurations of the targets and different length spacers between the target sequences. Detection of the editing activity was by measuring GD600 a day after induction of ApGet with Anhydrotetracycline (ATC).
- ATC Anhydrotetracycline
- Figure 16 Schematic representation of 'Editor' plasmids used in testing the ApGet system with artificial nuclease in bacterial cells.
- FIG 17 Schematic representation of 'Detector' plasmids used in testing ApGet systems possessing an artificial nuclease in bacterial cells. Detectors were designed with either 'PDS-out' configuration (construct f) or 'PDS- in' configuration (construct g) for the pair of PDS-target sequence elements. Target and PDS sequences of PDSin and PDSout detectors are located exactly between the homology arms, as in Figure 14, and are identical to those in Figure 14. Successful targeting is shown by observation of nanoluciferase activity in the presence of a suitable HDR template. The Homology-directed repair (HDR) template for the nanoluciferase was constructed on the same plasmids that express ApGet as a separate unit.
- HDR Homology-directed repair
- FIGs 18 and 19 are schematic diagrams showing possible alternative heteroduplex interactions when a pair of genome editing tools of the invention are employed to modify, e.g. cut, both strands of a target genomic DNA at chosen sites.
- each polypeptide component is shown as including a Fok1 nuclease domain.
- Two such nuclease domains are shown as being caused to dimerise to provide a functional endonuclease by use of two targeting RNAs which target different sequences on opposite strands of the target DNA.
- the two DNA-binding domains are shown as each binding to a PDS in a fully complementary region of the target DNA in which the Fok1 endonuclease cuts.
- the PDS sequences are both internal to the pair of target sequences.
- each polypeptide component is shown as including a fused enzyme which may be for example a fused artificial nickase as herein described.
- each DBD is shown as binding to a PDS outside a single heteroduplex region formed by the targeting sequences of two different targeting RNAs hybridising with a different target strand.
- Each of the pair of enzyme domains acts on a different strand within the heteroduplex region. Since the pair of PDS sequences are outside the pair of target sequences, this scheme is referred to as employing PDS-out positions.
- Figures 20a and b Results of tests of ApGet editing to restore functional nanoluciferase by triggering homology directed repair of a disrupted nanoluciferase open reading frame.
- Various Editor plasmids including an expression cassette for various configurations of ApGet1.0 ( Figure 16) and with an expression cassette for nanoluciferase HDR template were co-transformed with the detector plasmids expressing disrupted open reading frame of the nanoluciferase with the targets in “PDSin” and “PDSout” configurations ( Figure 17).
- Colonies of co-transformants of ApGetl .0 with detectors were grown in liquid medium with IPTG or with and without IPTG for same construct and corresponding antibiotics and Nanoluc/GD600 signal was analysed next day. Error bars are standard deviation of three experiments.
- Figures 21 and 22 illustrate the ApGet-i expressing Editor plasmid and Detector plasmids respectively used in evaluating the flexibility of the DBD of SEQ. ID. No. 4 for binding to variants of PDS1 (5'-GAGGTC-3').
- Figures 23a and b show the control plasmid used with the detector plasmids of Figure 22 and the results for the binding ability of the tested DBD for various 6mer PDSs.
- Figure 24 Schematic representation of the ApGet expressing plasmid construct designed for transient expression of ApGet variants in mammalian cell lines.
- FIG 25 Schematic representations of the variant ApGet expression units incorporated into the plasmid construct as shown in Figure 24 together with a high copy number bacterial origin of replication and antibiotic resistance gene.
- Figure 26 Layout of the ApGet targeting region in exon 4 of the PD-L1 gene. TE binding regions designated as PD-L1 target sites are flanked by PDS sites. The direction of the TE binding region shows forward and reverse complementary strand binding sites for the ApGet.
- Figure 27 Reduction of PD-L1 expression in cell cultures transfected with ApGet. Quantitation of the PD-L1 expression in cell samples from each image (Imaged). Error bar is standard deviation of signal strength of individual cells in the sample.
- Figure 28 provides (a) a representation of the genome target region and donor template structure as discussed in Example 6(ii) to investigate ApGet-mediated repair of a target region in the PD-L1 gene and (b) a table setting out the editing components employed and sample results for PCR confirmation of an HDR event.
- Figure 29 shows the genomic reference sequence with the layout of primers that was used to evaluate targeting of the TSKU gene in HEK293 cells with ApGet expressing constructs as reported in Example 6(iii).
- Figure 30 TIDER analysis from the studies reported in Example 6(iii) using Sangar sequencing which compared the levels of substitution from the wild-type sequence between the untreated samples and ApGet transfected samples.
- Figure 31 Configurations of recombinant ApGet proteins purified from an E. coli expression system. The configurations detail the various purification, solubility and cleavage tags as discussed in Example 7.
- Figure 32 Illustration of the expression cassettes employed for expressing an ApGeti-VP64 construct as discussed in Example 8 for transcriptional activation of the ASCL-1 gene in HEK293T cells.
- Figure 33 Results of transcriptional activation of the ASCL-1 gene in HEK293T cells using ApGeti-VP64 constructs expressed in conjunction with 4 NACs targeting different promoter locations and comparison with a dCas9-VP64 fusion construct.
- a targeting nucleic acid for provision of a genome editing tool of the invention will generally be an RNA.
- the targeting element (TE) is complementary to a sequence on the target DNA.
- TE hybridises to the target sequence to fulfil its targeting purpose; generally it will be fully complementary to the target sequence.
- the TE will be 15-25 nucleotides, for example, 15-20 or 21 nucleotides, preferably 18-20 or 21 nucleotides. Longer or shorter TEs may however be feasible in some circumstances, e.g. a TE of about 10 to 35 nucleotides.
- a TE of about 10 to 35 nucleotides.
- PDS proximal short predetermined dsDNA sequence
- RNA sequence there will thereby be formation of an R loop - a region of otherwise double-stranded DNA where a sequence of single-stranded DNA is displaced while its complement forms an RNA/DNA hybrid helix with an invading RNA strand.
- a DNA-binding domain of this type is considered an essential element of a genome- editing tool of the invention which aids in optimising efficiency of the required genome modification. Provision of such a DBD to a predetermined sequence can be achieved by various methods. Such methods may comprise use of computational methods for ligand design. However, a preferred method as exemplified herein is use of a phage display peptide library to select displayed peptides with binding affinity for the chosen target dsDNA sequence.
- a DBD may for example be a polypeptide sequence of no more than 70-75 amino acid residues, e.g. no more than a 30 mer, no more than a 25 mer, no more than a 20mer, preferably no more than a 15mer.
- provision of a DBD of no more than 15 amino acids, e.g. about 12-15 amino acids is however favoured (including possibly a GGS element at the C-terminus).
- the DBD may not necessarily require recognition of 6bp. It could be less than 6bp. For example, 5’NNGG3’ or 5’GG3’.
- the chosen DBD may have binding affinity for more than one predetermined sequence, e.g. more than one 6 mer dsDNA sequence. This may be favoured to provide flexibility of use at different DNA sites.
- the exemplified DBD of SEQ. ID no. 4 has been shown to be effective with the same targeting nucleic acid when presented with a number of 6mer dsDNA sequences other than 5'GAGGTC3' as a PDS; see Example 5 and Figure 23b. It may be particularly favoured to also pair, for example, with a PDS of sequence 5 'TTGGTA3', 5'AAAAAA3' or 5'AAAGTC3'.
- the DBD may for example be chosen to target parts of the genome that a CRISPR-Cas system, e.g. a Cas9 CRISPR system cannot access due to PAM restriction. It may for example be specifically designed to bind to AT rich regions of the genome rather than regions providing a Cas9 PAM, i.e.5'-NGG-3', e.g. in a CGG region.
- the targeting nucleic acid component must be bound by a module of the modular polypeptide component. Preferably this will be an end module.
- This interaction may be by various means known for linking a nucleic acid with a recognition domain in a polypeptide structure.
- the targeting nucleic acid component may present as its recognition element for interaction with the modular polypeptide component a non-nucleic acid label which is a member of a specific binding pair. This will bind with its binding partner presented by the modular polypeptide component.
- the specific binding pair may be biotin-streptavidin or the nucleic acid may be coupled to an antigenic epitope in which case the recognition domain of the modular polypeptide may comprise a ScFV for binding the epitope.
- the provided recognition element will be an RNA motif (alternatively referred to as an RNA scaffold) which binds a module of the polypeptide component referred to herein as an RNA scaffold binding domain (RSBD).
- RNA scaffold binding domain RSBD
- Many such naturally occurring RNA scaffold-RSBD interactions are known, often referred to in the literature as RNA aptamer- binding domain interactions, for tethering an RNA sequence to a protein domain. Examples of such binding complexes include (i) the 19 nt Box B RNA motif and its cognate 22 amino acid RNA-binding domain of the lambda phage anti-terminator N protein (the lambda N22 peptide; see SEQ. ID. No.
- RNA scaffold- RSBD pairs may be substituted by a variant in which either or both members of the pair is a mutant sequence provided the required binding affinity is maintained.
- a phage display peptide library may again be employed to attain a peptide-RNA scaffold binding pair or alternative panning of a peptide library for identification of appropriate peptide binding activity for an RNA scaffold, e.g. an RNA structure comprising one or more than one hairpins.
- the length of the RNA scaffold should preferably be between about 15 and 25 nucleotides, e.g. 19-20 nucleotides as exemplified by the lambda Box B sequence.
- the RNA scaffold-RSBD pair will have multiple contact points to provide high affinity interaction and with a view to reducing off-target non-specific interaction of the scaffold sequence with any host genomic sequences.
- a targeting nucleic acid or an RNA scaffold element thereof and /or connector sequence may incorporate one or more modified nucleotides and/or one or more modified internucleotide linkages.
- Modified nucleotides for this purpose may include, for example, 2'-O-methyl analogs, 2'-fluoro analogs or 2' deoxy analogs.
- LNA locked nucleic acid
- the use of locked nucleic acid (LNA) monomers may be contemplated in which the 2' hydroxyl group is linked to the 4' carbon atom of the sugar ring forming a 2'C, 4'-C-oxymethylene linkage and thereby providing a bicyclic sugar moiety .
- Modified bases such as 2-aminopurine, 5- bromouridine, 5-methylcytidine and 5-methoxyuridine may be employed.
- One or more inter- nucleotide linkages may for example be a phosphorothioate linkage.
- Such methods for modifying RNA oligonucleotides to aid stability and required activity in a cellular environment are well-known and any such methods may find use in designing a targeting nucleic acid for use in accordance with the invention. It will be appreciated that such RNA oligonucleotide modification may be contemplated where chemical synthesis of the targeting nucleic acid can be carried out for RNP delivery of a nucleoprotein complex.
- modified wild-type phage aptamers which retain binding affinity for their cognate binding protein and may be employed in a targeting nucleic acid of the invention
- RNA scaffolds on a targeting RNA may be desired to provide two or more RNA scaffolds on a targeting RNA (either the same or different) to enhance the efficiency of the system or to facilitate the interaction with more than one protein via a RSBD, e.g. two different RNA scaffolds in tandem separated by a connector sequence.
- a single targeting RNA may interact with more than one modular polypeptide component for a nucleoprotein complex of the invention, which may be the same or different.
- Such a targeting RNA with more the one RNA scaffold may also be used to recruit another effector component, e.g. a base editor, joined to an appropriate RSBD.
- RNA scaffold with the modular polypeptide component providing its cognate binding peptide, Lambda N22 (MDAQTRRRERRAEKQAQWKAAN SEQ. ID. No:2).
- MDAQTRRRERRAEKQAQWKAAN SEQ. ID. No:2 The modular polypeptide component providing its cognate binding peptide, Lambda N22 (MDAQTRRRERRAEKQAQWKAAN SEQ. ID. No:2).
- a short connector sequence e.g.
- RNA scaffold can be positioned in the 5’ or 3’ end of the nucleic acid component.
- an RNA nucleic acid component was fused to the 5' terminal of the following sequence in which the short connector AATTT is fused to the BoxB RNA scaffold sequence shown in bold :
- the connector in this sequence may be substituted by an alternative sequence provided it permits correct functioning of both the joined targeting element (TE) and RNA scaffold (RS). Also either the TE or RS may be the 5'-terminal sequence.
- the TE in a targeting nucleic acid for a gene-editing tool of the invention may be designed to bind to either strand of a dsDNA. See Figure 6.
- a linker may be provided between the selected DBD and one or both of the effector component and recognition domain for tethering the targeting nucleic acid - one or both of the distinct linker peptides shown as linkers 1 and 2 in any of Figures 1 , 2 and 6.
- Suitable linkers for this purpose are well-known which do not provide secondary structure or unwanted domain interaction; see for example Chen et al. (2013) Adv. Drug Deliv. Rev. 65, 1357-1369, 'Fusion Protein Linkers: Property, Design and Functionality'.
- Suitable linkers may be 2 to 15 or more amino acids in length, e.g. (Gly)n or (GGGGS)n. See also linker 1a as employed in the studies of Example 8. In some instances, a flexible linker far longer than 15 amino acids may be preferred, e.g. up to 35 amino acids as exemplified by the linker in the ApGet of SEQ. ID.
- any such linker may preferably be minimised with a view to the desire for the complete length of the modular polypeptide component to be as low as possible, e.g. preferably no more than 220-250 amino acids, for example when including an artificial nuclease as described herein.
- longer modular polypeptide components may be required in some instances, e.g. 300 amino acids in length or longer, for example, if using a different effector component.
- the effector component as hereinbefore indicated may be any of a diverse range of moieties for use in modifying DNA (either modifying structure or regulation) including (i) an endonuclease for producing double-stranded breaks, e.g. a Fok 1 nuclease domain (ii) a nickase (iii) a transcription activator such as VP64 (iv) a transcriptional repressor (v) an epigenetic modulator enzyme (vii) a recombinase (viii) a transposase (ix) an integrase and (x) a nucleobase modifying enzyme construct, including for example a nickase such as an artificial nickase as herein described with a base editor.
- an endonuclease for producing double-stranded breaks e.g. a Fok 1 nuclease domain
- ii) a nickase iii) a transcription activator
- the effector component has no DNA binding ability, it is not excluded that the effector component has some DNA binding ability provided this does not prevent site-specific modification directed by the targeting element and DBD.
- DBD DNA binding ability
- a transposase or integrase may be similarly employed as the effector component in a modular polypeptide component for genome editing as now described with site-specific insertion of a co-supplied exogeneous nucleic acid being directed by hybridisation of the targeting element to its complementary sequence facilitated by the binding of the DBD.
- the effector component may be a fusion construct for example in which a nickase, including possibly an artificial nuclease as herein described, is provided together with a base editor or reverse transcriptase.
- an artificial nuclease comprising a multimer of linked, self-assembling peptides forming a beta sheet structure wherein:
- the self-assembling peptides of said multimer each present an alternating pattern of hydrophobic and hydrophilic residues with all or at least a proportion, of the hydrophilic residues of each such peptide representing a catalytic triad of amino acids or more than three catalytic amino acids whereby said multimer is capable of cleaving a dsDNA either on both strands or on a single-strand, i.e. exhibits nickase activity;
- the self-assembling peptides are joined by linkers to limit the multimer number, e.g. to no more than 20, e.g. 4-15 or 16, preferably to no more than 10, more preferably 5-10 and
- N-terminal and C-terminal flanking sequences are provided linked to the multimer to prevent or limit aggregation between multimers of the nuclease protein with increased positive charge compared to the peptide units of the multimer due to inclusion of one or more positively charged residues, e.g. by inclusion of one or more lysine or arginine residues.
- Other means of capping the multimer at the N- and /or C-terminal may be employed to aid performance, e.g. by aiding solubility and /or stability.
- beta sheet structure will be understood as desirably an amyloid-like beta sheet structure.
- the self-assembling peptides may, for example, be chosen and linked with a view to attaining an anti-parallel beta sheet.
- the linkers between each such peptides can have the same or different lengths.
- the linker length may be 2 to 25 amino acids, e.g. a 4, 5, 6, 7, 8, 9, 10, 11 or 12 mer linker may be chosen.
- Short linkers suitable for providing beta turns or beta turn-like loops e.g. 4 mers, may be designed based on knowledge of the amino acid composition of such turns in native proteins as further discussed and exemplified below.
- thioflavin T (Tht) binding. Fluorescence emission assay of Thioflavin T binding is commonly employed to detect amyloid fibrils. Upon binding to amyloid fibrils, ThT gives a strong fluorescence signal at approximately 482-485 nm when excited at 450 nm (Xue et al. (2017) Royal . Soc. Open Sci. 4: 160696, 'Thioflavin T as an amyloid dye: fibril quantification, optimal concentration and effect on aggregation).
- the C-terminal flanking sequence may preferably also provide a flexible, tail sequence at its C-terminus to aid solubility, e.g. the 4 mer NQGS [SEQ. ID. No. 10] or a longer sequence.
- such a polypeptide comprising an artificial nuclease may also desirably be produced with an N- terminal tag to aid purification and /or solubility, e.g. a His tag, e.g. a hexa-His tag, to aid purification or a tag comprising one or more His tags and/ or a sequence to aid solubility such as maltose binding protein (MBP).
- a His tag e.g. a hexa-His tag
- MBP maltose binding protein
- a tag will be a cleavable tag, for example, chosen from SUMO or TEV tags.
- a suitable tag may comprise 6x His linked to MBP with a further C-terminal 6x His tag separated by a short spacer from a TEV protease cleavage site; see Figure 10.
- an artificial nickase as disclosed herein is preferred. It will be appreciated that the invention extends however more generally to polypeptides comprising or consisting of an artificial nuclease as now taught.
- the self-assembling peptides of said multimer may be identical as in the artificial nuclease of SEQ. ID. No.6 as discussed above, although it may be chosen to use two or more non-identical peptides of the same length, e.g. 7 mers.
- the alternating hydrophobic residues of the self-assembling peptides may be leucine and /or isoleucine, most preferably isoleucine, starting with the N-terminal residue.
- the hydrophobic amino acid residues may, however, also be selected from any hydrophobic amino acid residues including for example valine.
- the length may be, for example, a 6 mer to 15 mer, preferably a 7 mer to 11 mer, e.g. a 7 mer or 9 mer, although a 7 mer is preferred, preferably a 7mer with alternating isoleucine residues starting with the N-terminal residue.
- peptides of the multimer may be continuously linked in the N- terminal to C-terminal direction or alternate peptides may be reversed throughout or in part and for convenience will preferably be identical.
- a multimer formed of 7mer self- assembling peptides may be represented as:
- X represents an amino acid linker which may be varied, e.g. any of a 4, 5, 6, 7, 8, 9, 10, 11 or 12 mer, preferably a 4 mer, designed with the aim of providing a beta turn or beta turn like loop, e.g. NDGG, DSSG, SSGS, NNGN, GSDG, GNSG, DNGG, DSDG, SSSG, GSEG, GDSG (SEQ. ID. Nos. 11-21) and other linkers consisting of a combination of amino acids selected from glycine (G), the polar amino acids serine (S), asparagine (N), glutamine (Q) and threonine (T) and the charged amino acids glutamic acid (E) and aspartic acid (D).
- G glycine
- S polar amino acids serine
- N asparagine
- T glutamine
- D charged amino acids glutamic acid
- D aspartic acid
- linkers may be employed with any suitable self-assembling peptides to control the multimer size and with a view to aiding stabilization and solubility of the desired beta structure design. Possible options will be readily discernible by those skilled in the field of protein structure analysis and design having regard to the exemplification provided.
- all the self-assembling peptides will be linked in the N- to C-terminal direction. In this way an assembly of consecutive monomer units may be provided in an anti-parallel beta sheet structure as further discussed below. See Figures 8 and 9.
- C 1 , C2, and Cs may correspond to a trio of different amino acids of a naturally-occurring nuclease known to be capable of nicking a single-strand of a dsDNA, e.g.
- the chosen catalytic amino acids may correspond to the catalytic amino acids of a RuvC nuclease domain as present in an endonuclease, for example, a Cas9 nuclease, i.e. glutamate (E), aspartate (D) and histidine (H).
- a Cas9 nuclease i.e. glutamate (E), aspartate (D) and histidine (H).
- a RuvC nuclease domain as present in a Cas9 nuclease has been reported to have 4 catalytic amino acids - His983, Asp986, Asp10 and Glu762. Mutation of any of these catalytic amino acids has been shown to result in loss of function (Nishimasu et al. (2014) Cell 156, 935-949).
- a preferred 7 amino acid peptide for linkage as above is IEIDIHI.
- This peptide could also be made of different length of amino acids, anywhere between 5 to 11.
- such a peptide may be optionally fused in the multimer structure to a linker sequence providing an aspartate (D residue) as indicated above. D residues may be incorporated into the beta turn designs with a view to potentially increasing the solubility of the complete nuclease.
- a multimer of identical self-assembling peptides will be flanked by N- terminal and C-terminal sequences with increased positive charge to reduce propensity for aggregation.
- This may be by substitution of at least one hydrophobic residue in peptides otherwise identical to the self-assembling peptide for the multimer by a positively charged residue, e.g. preferably substitution of a hydrophobic residue by a lysine.
- the multimer is formed of 7 mer units of alternating hydrophobic and catalytic residues starting with leucine or isoleucine
- IEIDIHI 7 mer units such a C- terminal and N-terminal unit may have an identical sequence except for a positively charged amino acid substitution for the isoleucine at position 3 and/or 5 from the N-terminus, e.g. a lysine (K) residue.
- the N-terminal flanking sequence may be IEKDIHI (SEQ. ID. No. 22) or IEIDKHI (SEQ. ID. No. 23) fused to a 4 mer linking sequence for linkage to the first 7 mer peptide unit of the multimer of identical peptide units.
- the C-terminal flanking sequence may be selected from the same sequences with an additional C-terminal tail sequence.
- the N-terminal flanking sequence may be IEKDIHI and the C-terminal flanking sequence may be IEIDKHI or vice versa.
- One or both lysine residues may be an alternative positively charged residue e.g. arginine. In this way there will be repulsion of nuclease assemblies when for example such flanking units are linked to a multimer of 10 identical peptides.
- the C-terminal tail sequence may be chosen to aid solubility, e.g. NQGS.
- one or more of the beta turns may be varied and /or the C-terminal NQGS sequence with maintenance of the desired nuclease activity. Substitution of the artificial nuclease ofSEQ. ID. No. 1
- the artificial nuclease as provided in SEQ. ID. No.1 may be substituted by any alternative effector component desired for modification of a target dsDNA site, either with maintenance or change of the linker to the DBD.
- a functional synthetic genome editing tool as now taught has the artificial nuclease of SEQ. ID. No.1 substituted by a Fok 1 nuclease domain (referred to herein as an ApGet-Fok1 construct).
- any ApGet-i comprising a nucleic acid recognition module linked to a DBD may be additionally linked to a Fok1 nuclease domain.
- Such a modular polypeptide construct may for example be used with a pair of targeting nucleic acids with differing TEs to provide a functional Fok1 nuclease capable of cutting dsDNA at a target site.
- One configuration for this is illustrated in Figure 18. See also the exemplification below employing the 'Editor' plasmid illustrated in Figure 14 for expression of an ApGet-Fok1 construct to produce a double strand break in a detector plasmid. It will be recognised that the DBDs and targeting elements may be varied to produce a double-strand break at different dsDNA target sites.
- the artificial nuclease as provided in SEQ. ID. No. 1 may be substituted by a transcription activator, e.g. VP 64, and the resulting modular polypeptide combined with one or more targeting nucleic acids designed to target a promoter location and thereby activate or enhance transcription of the one or more coding sequences in operational linkage with the promoter; see Example 8.
- a transcription activator e.g. VP 64
- Such effector component substitution may be accompanied by change of one or more of the RSBD, the DBD, the linker between the RSBD and DBD (Linker 2, L2,as shown in Figure 1) and the linker between the effector component and DBD (linker L1 , L1, as shown in Figure 1) provided required function of the RSBD, DBD and effector component is maintained.
- the artificial nuclease of SEQ. ID. NO. 1 may be substituted by the VP64 polypeptide with shortening of linker 2 (see linker 2b of SEQ. ID. No. 70) or change of linker 1 (see linker 1a of SEQ. ID. No. 69).
- an artificial nickase of the invention has use beyond inclusion in a complete synthetic gene-editing tool as discussed above. It may be employed as part of a fusion enzyme in fusion with another entity for DNA modification, e.g. a dCas9, possibly also linked to a further component for DNA modification such as a base editor or reverse transcriptase. It may be expressed from a polynucleotide, e. g. expression vector either as part of a fusion protein, e.g. a modular polypeptide component of a DNA modifying tool for use with a targeting nucleic acid, or as a separate protein.
- a polynucleotide e. g. expression vector either as part of a fusion protein, e.g. a modular polypeptide component of a DNA modifying tool for use with a targeting nucleic acid, or as a separate protein.
- Polynucleotides capable of expressing a polypeptide of the invention e.g. comprising or consisting of artificial nuclease or nickase of the invention and host cells transformed by such polynucleotides also constitute aspects of the present invention.
- a polynucleotide encoding an artificial nuclease or nickase protein of the invention with an N-terminal tag sequence to aid purification and solubility as discussed above, e.g. such a tag sequence which is a cleavable tag sequence providing both a His tag and tag to aid solubility, e.g. Maltose Binding Protein (MBP) sequence.
- MBP Maltose Binding Protein
- Such a polynucleotide may be an expression cassette for production of the nuclease or nickase protein in an in vitro transcription and translation system or an expression vector for expression of such a nuclease protein in a host cell, e.g. a bacterial cell such as an E.coli cell or yeast cell.
- a host cell thus transformed represents a further aspect of the invention.
- a method of producing a polypeptide comprising an artificial nuclease or nickase of the invention which comprises:
- an artificial nuclease of the invention preferably an artificial nickase of the invention
- the artificial nuclease or nickase will generally be joined to the DBD by a linker sequence such that the DBD can bind to the selected PDS and the nuclease is able to act at the required target site.
- an expression cassette e.g. vector, will be provided which encodes the whole modular polypeptide.
- An N-terminal tag may be provided in some instances, e.g. a cleavable His tag (see Figure 16).
- a modular polypeptide component or any modular polypeptide component for use in a nucleoprotein complex of the invention for target sequence modification, may be initially expressed, e.g. in a host cell such as E. coli, with a multiple component tag sequence to assist all, or any of, solubility, purification and detection including a protease cleavage site whereby prior to use unwanted tag sequence can be removed.
- Such a multiple component tag sequence may be linked to an NLS whereby upon protease cleavage an NLS is retained at the N- or C- terminus possibly together with additional sequence which does not interfere with required target modification, e.g. an end sequence including a detection sequence.
- Such a multiple component sequence tag may desirably provide all of (i) at least one his tag, e.g. at least one hexa-his tag, (ii) a polypeptide sequence to aid solubility, e.g. a M BP or small ubiquitin-like modifier (SUMO) (iii) a protease cleavage site and (iv) a detection sequence, e.g. an epitope tag.
- at least one his tag e.g. at least one hexa-his tag
- a polypeptide sequence to aid solubility e.g. a M BP or small ubiquitin-like modifier (SUMO)
- an ApGet or ApGet-i in E. coli with an N-terminal extension providing in the N- to C-terminal direction all of: (i) a hexa-his tag (ii) a solubility tag of either MBP or SUMO (iii) a linker providing a spacer (iv) a TEV protease cleavage site and (v) an epitope tag such as the FLAG® epitope joined to an NLS.
- an epitope tag such as the FLAG® epitope joined to an NLS.
- a 4mer N-terminus leader sequence such as GWGS (See Figure 31).
- the linker between the solubility tag and TEV protease cleavage site may desirably be an asparagine rich linker rather than a linker adding to requirement for glycine and serine.
- ApGet it has been found additionally beneficial to incorporate a Strep-tag® II at the C-terminus to aid separation from prematurely terminated product.
- a variety of other N- and or C-terminal tags may be employed in initially expressing a modular polypeptide component of the invention to aid solubility and/or purification and/or detection and/or membrane penetration.
- the modular polypeptide component may in some instances be expressed with inclusion of a cell penetrating peptide sequence.
- nucleoprotein complex of the invention may be delivered to host cells either as an active complex, e.g. by electroporation, or with one or both of the polypeptide component and targeting nucleic acid component expressed by a polynucleotide.
- RNA molecules can be delivered to cells by any of a variety of suitable methods without limitation. Many such methods are known. Thus, direct introduction of synthetic RNA molecules to the cell of interest may be by electroporation, nucleofection, transfection, via nanoparticles, via viral mediated RNA delivery, via non-viral mediated delivery, via extracellular vesicles (for example exosome and microvesicles), via eukaryotic cell transfer (for example by recombinant yeast ) and other methods that can package the nucleic acid molecules and provide delivery to the target viable cell. Other methods for the introduction of RNA molecules include non-integrative transient transfer of DNA polynucleotides whereby the relevant sequence is transcribed intracellularly.
- DNA-only vehicles for example, plasmids, MiniCircles, MiniVectors, MiniStrings, protelomerase generated DNA molecules (for example Doggybones), artificial chromosome (for example HAC), cosmids
- vehicles such as nanoparticles, extracellular vesicles (for example exosomes and microvesicles), via eukaryotic cell transfer (for example by recombinant yeast), transient viral transfer by AAV, non-integrating viral particles (for example lentivirus and retrovirus based systems), cell penetrating peptides and other technology that can mediate the introduction of DNA into a cell without direct integration into the genomic landscape.
- RNA components include the use of integrative gene transfer technology for stable introduction of the machinery for RNA transcription into the genome of the target cells. This can be controlled via constitutive or promoter inducible systems to attenuate RNA expression.
- integrative gene transfer technology includes, but not limited to, integrating viral particles (for example lentivirus, adenovirus and retrovirus based systems), transposase mediate transfer (for example Sleeping Beauty and Piggybac), and other technology that encourages integration of the target DNA into a cell of interest.
- Delivery of the protein or peptidergic components, such as the artificial nickase, of the system can be carried out by the same technology but in some situations, there are advantages to mediate the delivery via different methods. Such applicable methods, and not limited to, are listed below. Firstly, the direct introduction of protein molecules to the cell of interest by electroporation, nucleofection, transfection, via nanoparticles, via viral mediated packaged delivery, extracellular vesicles (for example exosome and microvesicles), via eukaryotic cell transfer (for example by recombinant yeast), and other methods that can package the macromolecules for delivery to the target viable cell without integration into genomic landscape.
- DNA-only vehicles for example, plasmids, MiniCircles, MiniVectors, MiniStrings, protelomerase generated DNA molecules (for example Doggybones), artificial chromosome (for example HAC), cosmids), or DNA- carrying vehicles such as nanoparticles, extracellular vesicles (for example exosome and microvesicles), via eukaryotic cell transfer (for example by recombinant yeast), transient viral transfer by AAV, non-integrating viral particles (for example lentivirus and retrovirus based systems), and other technology that can mediate the introduction of DNA into a cell without direct integration into the genomic landscape.
- DNA-only vehicles for example, plasmids, MiniCircles, MiniVectors, MiniStrings, protelomerase generated DNA molecules (for example Doggybones), artificial chromosome (for example HAC), cosmids
- DNA- carrying vehicles such as nanoparticles, extracellular vesicles (for example exosome and
- Another method for the introduction of the protein component(s) includes the use of integrative gene transfer technology for stable introduction of the machinery for transcription and translation into the genome of the target cells. Many such methods are well-known in the gene modification field. Control can again be via constitutive or inducible promoter systems. The design may be so that the system can be removed after the utility has been met (for example, introducing a Cre-Lox recombination system).
- Such technology for stable gene transfer includes, but not limited to, integrating viral particles (for example lentivirus, adenovirus and retrovirus based systems), transposase mediate transfer (for example Sleeping Beauty and Piggybac), and other technology that encourages integration of the target DNA into a cell of interest.
- any protein component and/or RNA component from an encoding polynucleotide. This can be performed in a variety of ways.
- one or more intermediate vectors may be employed for introduction into prokaryotic or eukaryotic cells and suitable for replication and/or transcription to express the required component(s).
- Expression vectors may be employed for administration to the chosen host cell, for example a plant cell, an animal cell, e.g. a bird, mammalian cell or a human cell, a fungal cell, a bacterial cell, or a protozoan cell.
- the present invention provides nucleic acids that encode any of the RNA components or proteins of the invention as mentioned above.
- the nucleic acids are isolated and/or purified.
- Examples of expression constructs of use in application of a nucleoprotein complex of the invention include a vector, such as a plasmid or viral vector, into which a nucleic acid sequence of the invention has been inserted, in a forward or reverse orientation.
- the construct further includes regulatory sequences, including a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and commercially available.
- expression vectors of use in application of nucleoprotein complexes of the invention include chromosomal, non-chromosomal and synthetic DNA sequences, bacterial plasmids, phage DNA, baculovirus, yeast plasmids, vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
- the vector may include appropriate sequences for amplifying expression.
- the expression vector preferably contains one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell cultures, or such as tetracycline or ampicillin resistance in E. coli.
- a vector or vectors for use in application of a nucleoprotein complex of the invention e.g. to express the modular polypeptide component(s) and/ or one or more targeting RNAs intracellularly or production of a protein component of the invention can be designed with appropriate control sequences for such expression or production in the chosen host cell.
- suitable expression hosts include bacterial cells (e.g., E. coli, Streptomyces, Salmonella typhimurium), fungal cells (yeast), insect cells (e.g., Drosophila and Spodoptera frugiperda (Sf9)), animal cells (e.g., CHO, COS, and HEK 293), adenoviruses, and plant cells.
- bacterial cells e.g., E. coli, Streptomyces, Salmonella typhimurium
- fungal cells yeast
- insect cells e.g., Drosophila and Spodoptera frugiperda (Sf9)
- animal cells e.g.,
- a nucleic acid or combination of nucleic acids for provision of one or more nucleoprotein complexes of the invention in a host cell.
- host cells may be prokaryotic or eukaryotic cells. They may for example be any of bacterial cells, yeast cells, insect cells, and fungal cells and eukaryotic cells including plant cells and human and non-human animal cells, such as, for example, hamster (e.g. CHO cells), monkey (e.g. vero cells), rat, mice, bird or chicken cells.
- Suitable host cells will be understood to include ex-vivo cells e.g. ex- vivo stem cells, induced pluripotent stem cells (iPSCs) and ex-vivo T cells including engineered CAR-T cells.
- the nucleic acid may preferably be a vector, e.g. a viral vector such as a recombinant adeno-associated viral (rAAV) vector, lentivirus , retrovirus .adenovirus or Sendai virus vector capable of expressing both at least one modular polypeptide component of the invention, e.g. including an artificial nickase of the invention, and at least one targeting nucleic acid component. More than one targeting nucleic acid component may be provided to a host cell to target more than one DNA site. In this case, each targeting nucleic acid component may interact with a single modular polypeptide component, i.e. more than one targeting nucleic acid, e.g.
- rAAV recombinant adeno-associated viral
- each targeting nucleic acid component of a pair may interact with a different modular polypeptide component each possessing a DBD which binds a different PDS.
- the DNA target sites for the targeting nucleic acid components may be external to the pair of PDS sites (referred to as the 'PDS-in' configuration) or the DNA target sites for the targeting nucleic acid components may be internal to the pair of PDS sites (referred to as the 'PDS-out' configuration').
- Such configurations are illustrated in Figures 18 and 19 with each targeting nucleic acid targeting a different DNA strand of a dsDNA.
- a pair of nucleoprotein complexes of the invention for use as above may include as the effector component a Fok1 nuclease domain joined to the DBD by a suitable linker sequence, i.e. will represent an ApGet-i construct joined by a linker to the catalytic domain of a Fok1 endonuclease (referred to herein as a ApGet-Fok1 modular polypeptide).
- a pair of complexes may operate in the PDS-in or PDS-out configuration to produce a double-stranded break in a dsDNA, e.g. a genomic DNA for gene knock out. See Figure 18 which illustrates a pair of ApGet-Fok1 modular polypeptides operating in the PDS-in configuration for this purpose.
- nucleoprotein complexes of the invention preferably a single vector, for vector delivery of a pair of nucleoprotein complexes of the invention providing an artificial nickase to a cell to cut both strands of a dsDNA.
- Such delivery may also be able to achieve gene knock out by non-homologous end joining.
- nucleoprotein complex delivery may be accompanied with provision of a sequence template for homologous recombination. This sequence template may be provided by an entirely separate expression construct or by expression from a separate expression cassette on the same vector.
- Figure 16 illustrates single vector constructs able to express all of a modular polypeptide including an artificial nuclease, a targeting nucleic acid component for interacting with the modular polypeptide and a sequence for homology repair of an enzyme-coding sequence upon cutting of a pair of target sites.
- a method for modifying one or more target nucleic acid sequences employing one or more nucleoprotein complexes of the invention or one or more nucleic acids for provision thereof in a host cell with the proviso that such methods as claimed do not extend to methods of modifying the germ line identity of a human being or methods of medical treatment practised on the human or animal body as such.
- a single polypeptide component for provision of the one or more nucleoprotein complexes may be provided in cells by expression from a vector.
- the same vector may preferably also express the required one or more targeting nucleic acids, preferably one or more targeting RNAs.
- a combination of (i) at least one polypeptide component for a genome modification tool of the invention, or a polynucleotide capable of expressing the same and (ii) one or more targeting nucleic acids which can interact or link with said polypeptide component(s), or one or more polynucleotides capable of expressing the same, for use in a method as above, or for use in therapeutic treatment.
- a combination may be provided in the form of a kit for one or more specific applications, e.g.
- a single polypeptide component or polynucleotide encoding the same may be provided with one or more targeting nucleic acids, or one or more polynucleotides designed to target one or more desired nucleic acid locations.
- both the polypeptide component and the one or more targeting nucleic acids, preferably targeting RNAs may preferably be expressed from a single vector.
- the invention can be utilised to edit cells utilised in bioproduction, vaccine production, research tools and reagents, production of genetically- modified animals and plants and cell therapy.
- Components of the invention can be utilised for gene therapy applications.
- Nucleoprotein complexes of the invention may, for example be utilized in the provision of cells for use in therapy.
- One such application is generating therapeutic cells such as T cells engineered to express a Chimeric Antigen Receptor (CAR-T) or T Cell Receptor (TCR).
- the CAR-T/TCR cells may be derived from primary T cells or differentiated from stem cells.
- Suitable stem cells include, but are not limited to, mammalian stem cells such as human stem cells, including, but not limited to, hematopoietic, neural, embryonic, induced pluripotent stem cells (iPSC), mesenchymal, mesodermal, liver, pancreatic, muscle, and retinal stem cells.
- Other stems cells include, but are not limited to, mammalian stem cells such as mouse stem cells, e.g., mouse embryonic stem cells.
- Nucleoprotein complexes of the invention may be used to knockout, modify or increase the expression of a single gene or multiple genes in various types of cells or cell lines, including but not limited to cells from mammals.
- Nucleoprotein complexes of the invention may be applicable to multiplex genetic modification, which, as in known in the art, involves genetically modifying multiple genes or multiple targets within the same gene.
- the technology may be used for many applications, including but not limited to knock out of genes to prevent graft versus host disease by making non-host cells non-immunogenic to the host or prevent host vs graft disease by making non-host cells resistant to attack by the host. These approaches are also relevant to generating allogenic (off-the-shelf) or autologous (patient specific) cell-based therapeutics.
- Target genes may include, but are not limited to, the T Cell Receptor, the major histocompatibility complex (MHC class I and class II) genes, including B2M, and genes involved in the innate immune response.
- DNA modification system as now taught may be delivered into cells in various ways well-known to those skilled in cell transformation including:
- Virus-like particles containing any as noted in 1 , 2 or 3 above
- Lipid nanoparticles containing as noted in 1 , 2 or 3 above.
- Viral vectors e.g. rAAV vectors, expressing a targeting RNA component and the modular polypeptide component.
- a synthetic genome-editing tool as now taught including an artificial nuclease formed from linked synthetic peptide units may advantageously permit genome-editing for gene knock-out, or gene modification by homologous recombination, employing just a single vector for delivery of the required expression cassettes, e.g. a vector capable of expressing all of an ApGet modular polypeptide and at least one targeting RNA and possibly additionally a template sequence for homologous recombination between a pair of cut sites.
- M13 phage display library As noted above, a commercially available M13 phage display library was employed (New England Biolabs, catalogue #E8111L) which contains around 1 x 10 9 12mer peptides fused to the N-terminus of the phage minor coat protein III. Two different 6 nt dsDNA baits were employed with a biotin tag immobilized on a streptavidin-coated 96 well plate as specified in Table 1 below:
- ELISA assays were used to assess binding of peptides of the phage display library to the PDS1 and PDS2 dsDNA baits using an anti-M13 phage antibody labelled with horseradish peroxidase (HRP). After three rounds of bio-panning and sequence analysis of the bound peptides in the library, two 12 mer peptide sequences were selected, chemically synthesised, and modified as set out in Table 2 below.
- Blocking step of the streptavidin coated 96 well plate (Fisher Scientific, UK) with the Blocking Buffer (0.1 M NaHCC 3 (pH 8.6), 5 mg/ml BSA, filter sterilised and stored at 4° C).
- Precomplexing step (this step can be done at the same time as the blocking step, mentioned above), where the amplified phage library was incubated with each of the dsDNA baits in separate reactions.
- Each bait includes annealed double stranded DNA oligos (dsDNA), containing one of the PDS sites.
- dsDNA double stranded DNA oligos
- the forward strand in each of the dsDNA oligos, mentioned above was 3’ end labelled with TEG-biotin (Sigma/Merck).
- TEG-biotin Sigma/Merck
- the length of PDS should be kept as short as possible (so as to allow reliable oligonucleotide synthesis and stable base-pairing to form dsDNA).
- Conditions of the pre- complexing step 5micL phage library (10 11 pfu) incubated with 50nM dsDNA bait (final concentration) in 200pl TBST (total volume of the binding reaction).
- Amplification and titering steps were performed before each selection (panning) round, according to the manufacturer’s instructions (NEB). In total, 2-3 rounds were done.
- Peptide 2 in the phage library had high binding ability for the PDS1 dsDNA bait.
- Peptide 4 was selected on the basis of binding to the PDS2 dsDNA bait.
- Table 2 List of the chemically synthesized peptides used in the test for peptide binding and unwinding of dsDNA targets. The peptides were synthesized with the indicated modifications.
- the modified peptides as set out in Table 2 were used to test the sequences for use as DNA-binding domains without M13 phage connection.
- the modifications included amidation and acetylation at the N- and C termini respectively to reflect natural peptide modifications to improve peptide stability and prevent degradation.
- an additional C-terminal linker (GGS) was provided as noted above. This also permitted assessment of the binding characteristic to the cognate PDS with presence of a linker permitting linkage to a different non-phage protein.
- a FRET experiment was carried out to assess the binding and unwinding activity of Peptide 1 with ability to facilitate RNA hybridization when presented with PDS1 in an extended dsDNA target as shown schematically in Figure 5. It was hypothesized that, upon binding, Peptide 1 will cause some transient unwinding of the dsDNA which will facilitate binding of a targeting RNA.
- the fluorescent donor, 6-carboxyfluorescein (FAM) was used to tag an appropriate targeting RNA with a 15bp complementary sequence. Target DNA was tagged with the fluorescent acceptor Cy5 at a 3' end or Texas Red at a 5'-end.
- RNA-DNA hybridisation was shown to be facilitated by binding of Peptide 1 to its cognate PDS1 sequence as reflected by the FRET signal - a Cy5 or Texas red fluorescence signal upon FAM excitation (see Figure 5).
- the results from the cleavage and FRET experiments are consistent with the binding of Peptide 1 to its respective PDS in dsDNA causing partial and transient unwinding of the dsDNA and facilitating hybridisation of a complementary RNA.
- the Peptide 1 amino acid sequence (SEQ. ID. No. 4) incorporating a C-terminal GGS linker is one example of a favoured polypeptide sequence for use as the DNA-binding domain in a genome editing tool of the invention, e.g. ApGet system. It will be recognized that by similar studies short polypeptide sequences may be found for binding to other desired predetermined dsDNA target sequences of 6 or less than 6 nucleotides. Site-directed mutagenesis may be utilized to further improve binding capability for any desired PDS.
- Peptide 1 will commonly be provided with at least a second linker for incorporation into a complete required modular polypeptide component including additionally the targeting nucleic acid recognition domain and the effector component. Moreover, it may be desired to extend the incorporated GGS linker. However, this can be achieved with maintenance of the desired binding characteristic for the PDS and confirmed by appropriate further testing.
- Peptide 1 as the DBD may be linked to an effector component, e.g. an artificial nuclease, by extension of the C-terminal by a further sequence of G and S residues, e.g. the linker of SEQ. ID. No. 5 [GGGGSGGGGSGGGGGS] as employed in the ApGet of SEQ. ID. No.1.
- the first step in the design of an artificial nickase was selection of an ordered polypeptide capable of forming a supra-molecular self-assembled nanostructure.
- beta sheet forming peptides were chosen of length 7 or 9 amino acids with an alternating pattern of hydrophobic leucine and hydrophilic lysine residues. Such a pattern is known to form a self-assembled nanostructure with propensity for amyloidal structural formation.
- This pattern was further modified by the substitution of amino acids at hydrophilic positions based on the known catalytic amino acids of naturally occurring nucleases, e.g. an RuvC1 nuclease domain as present in Cas9.
- each of the peptide units may be identical in which case each C may be a different amino acid of a catalytic trio - either a recognised catalytic triad or a trio of different amino acid types providing catalytic function in a known naturally-occurring nuclease such as a RuvC1 nuclease domain. Alternate linked peptide units may be linked N- terminal to C- terminal or with reversion.
- Table 4 sets out the precise peptide sequences of 7 or 9 amino acids which were used in first developing an efficient artificial nickase.
- the starting sequence (bA) as indicated above was an inactive 7mer of alternating leucine residues and lysine residues.
- the naturally-occurring nuclease domain for provision at hydrophilic positions of amino acids of a catalytic trio are listed.
- all of peptides bB, bD, i BD, bE, bF had all lysines substituted by the three amino acids corresponding with the catalytic amino acids of a RuvC1 nuclease domain [Glutamic acid (E) Aspartic acid (D) and Histidine (H)] separated by hydrophobic residues.
- leucine was also substituted by isoleucine.
- bD is a 7mer starting with a leucine and having leucine residues alternating with E, D and H in that order.
- IbD has the same amino acid pattern except for substitution of leucine by isoleucine (I) as the hydrophobic residues. It is possible that isoleucine residues could aid the formation of ⁇ -sheet structure more efficiently than leucine residues as the former are more hydrophobic than the later.
- Peptide IbD and Peptide bD are previously represented above as SEQ. ID. No. 7 and SEQ. ID. No. 8 respectively.
- the remaining peptides are SEQ. ID. Nos. 47-59.
- Such peptides were tested for ability to self-assemble to provide a ⁇ -sheet supramolecular structure and nickase activity.
- Ability to provide a ⁇ - sheet supramolecular structure was determined by thioflavin T fluorescence binding (Xue et al. (2017) Royal Soc. Open Sci. 4: 160696).
- nickase activity was investigated by means of a molecular beacon assay combined with a gel plasmid cleavage assay.
- Thioflavin T was mixed with the peptides in reaction buffer solution.
- Peptides were diluted to 200pM (from a stock solution of 4.4mM in DMSO) using a reaction buffer solution (the same buffer as used for the initial molecular beacon assays as set out below).
- ThT was added to the peptide in the reaction buffer solution at 25pM with pulse vortexing and centrifugation. Plates containing 200pl per cell of the peptide/Tht solution were incubated at 37°C.
- the emission signal at 485nm was measured every 5 minutes using an excitation wavelength of 450 nm. An increase of emission signal was taken to be indicative of ThT binding to amyloid-like fibrils.
- peptide bD a high emission signal was measured instantly indicating ready self-assembly of peptides to form such fibrils (see Figure 7).
- a molecular beacon assay was firstly used to screen each of the peptides for DNA binding and cleavage.
- the following DNA oligonucleotide containing 33 nucleotides was employed where the first six nucleotides at each terminus complement one another forming a 6bp double stranded DNA stem. This results in a 23-nucleotide single stranded DNA loop region.
- the hairpin structure formed contains a fluorescein molecule as a 5' modification (6-FAM) and a fluorescent quencher (BHQ1) as a 3' modification. In the hairpin conformation the fluorescent signal of the molecular beacon is reduced. If a peptide binds or causes cleavage, the hairpin structure will disassemble releasing the fluorophore from the quencher.
- reaction conditions were chosen to reflect conditions that might be expected to strengthen the probability of DNA cleavage by each peptide.
- the peptide designs were inspired by the catalytic active sites of known nucleases. Often the divalent metal of choice for such sites is Mg 2+ .
- Mg 2+ ions require stringent coordination geometry and charge requirements and can be substrate specific and highly selective.
- Mn 2+ ions require less coordination sites to facilitate catalysis.
- Mn 2+ ions have been used to screen mutated nucleases in vitro as such ions tend to exhibit relaxed substrate specificity and can rescue defective enzymes compared to Mg 2+ ions. Hence, Mn 2+ ions were used for the initial activity screen of peptides in this instance.
- Each reaction was carried out in a reaction buffer of 25mM Tris-HCI (pH 7.5), 130mM NaCI, 27pM KCI and 5mM MnCl 2 .
- the molecular beacon was provided at a concentration of 400nM.
- the emission signal of the fluorophore after a 15-minute incubation was measured for each peptide mixed with the molecular beacon at a 500:1 concentration ratio.
- Peptides bL and bN gave a relatively high emission signal with such conditions. These peptides were therefore used to further assess variance of the assay conditions as regards Mn 2+ concentration, metal ion dependency and peptide concentration.
- the concentration of manganese chloride used in the initial screen was in excess. This was to enhance the probability of forming a reaction intermediate to push the reaction to completion. An excess of metal ions is often employed in in vitro reactions. However too much metal can produce an inhibitory effect on the reaction.
- the optimal manganese chloride concentration for bN peptide was found to be 0.25mM.
- the reaction with different metal ions showed differences in the signal emitted by the molecular beacon with either bL or bN peptides.
- the disassembly of the molecular beacon was more extensive in the presence of zinc chloride ions compared to manganese, calcium and magnesium chloride for bL peptide.
- the bN peptide showed a high increase in the signal regardless of the metal in the reaction.
- a high signal was also observed without any metal ions.
- the signal was greater with Mn 2+ ions. This suggests that by using different peptide designs that contain different active site regions a potentially different mechanism of DNA cleavage could be generated.
- the molecular beacon at 400nM was added to increasing concentrations of bN peptide from 0-800pM in the presence of either Mn 2+ or Zn 2+ ions.
- the bN peptide elicited a signal change with Mn 2+ and Zn 2+ ions.
- the signal from the bN peptide with Mn 2+ ions was greater than the bN peptide with Mg 2+ ions.
- a general increase in the signal measured for the disassembly of the molecular beacon was observed with increasing peptide bN concentration.
- the signal of the bN peptide in the presence of Mn 2+ ions does saturate after 400
- the signal emitted from the molecular beacon could result from cleavage of the DNA by the peptide, resulting in the dissociation of the double-stranded region of the hairpin structure due to a low T m range (melting temperature) for the resulting oligos generated.
- the signal could also be produced by the peptide binding to the DNA and distorting the shape of the hairpin structure. This could change the proximity of the fluorophore and the quencher which could also produce a signal release. Therefore, the molecular beacon assay cannot differentiate between binding and cleavage.
- a further gel plasmid cleavage assay was employed to look for cleavage.
- Such a gel cleavage assay can differentiate between plasmid that is intact (no cleavage), nicked (ssDNA cleavage) and linearised (dsDNA cleavage) as the three plasmid species will migrate differently on an agarose gel.
- Intact plasmids have a supercoiled structure and therefore can migrate easily through an agarose gel whereas a ssDNA cleavage on the plasmid will relax this supercoiled structure. This produces a relaxed circle/nicked structure that migrates more slowly through the pores.
- the dsDNA cleavage of a plasmid produces a linearised plasmid. The linear structure migrates faster than a relaxed circular structure although not as fast as the supercoiled structure.
- plasmid DNA (pBR322) was mixed with increasing concentrations of the peptide bL or bN, in the presence of Zn 2+ ions. This was found to result in an increase in the percentage of nicked plasmid after 12 hours. The percentage of nicked species increases with greater peptide concentration for both bL and bN. The percentage of nicked plasmid decreases for the bN peptide with a peptide concentration greater than 600pM whereas the increase in the amount of nicked plasmid continues to increase at such higher peptide concentrations for the bL peptide. An increasing proportion of the plasmid DNA is also observed in the wells of the gel. This DNA can be binding to the peptide causing a complex that is unable to migrate into the gel.
- the peptides bL, bN and bD all demonstrated some cleavage. However, the peptide bD was chosen for further study because of its higher propensity to produce a highly stable amyloid beta sheet structure as assessed by ThT assay. Protein design
- a beta strand mimicking peptide of length 7 or 9 amino acids (hereinafter referred to as a beta peptide) with an alternating pattern of hydrophobic and hydrophilic residues to be used.
- the hydrophobic leucine residue is interchangeable with isoleucine.
- flanking units with negative design, i.e. to discourage intermolecular binding and aggregation between each beta sheet protein molecule.
- the leucine residues of peptide bD were replaced with isoleucine to give the 7mer peptide ibD since i bD was found to produce no observable aggregates even at the highest tested concentration. It is possible that isoleucine could aid the formation of ⁇ -sheet structure more efficiently than leucine, as the former is more hydrophobic than the later.
- the bD peptide did not exhibit the greatest signal from the peptide functionality studies in vitro. However, the peptide showed the least propensity to aggregate and to precipitate, therefore it was expected that the bD peptide would be a more stable peptide as the monomer unit of a larger multimer construct such as the decamer designed.
- beta turns that can connect the beta peptide units together
- the appropriate length of and the amino acid composition of each beta turn needs to be designed. Consideration is given to both the design of beta turns in native proteins and the type of amino acid side chains that are required to orientate the beta strand sequences (the beta peptide units) to hydrogen bond and produce a beta sheet structure. Studies show that the optimal beta turn length in native proteins is often 2, 4 or 5 residues in length. In native proteins a beta turn that consists of either 2 or 5 amino acids often folds in favor of a specific chirality whereas beta turns with a length of 4 amino acids do not fold in favor of any specific chirality. Hence, for the proof of concept, an amino acid length of 4 was chosen for provision of the linkers between the selected self-assembling peptides.
- the role of the beta turns is to encourage this self-assembly by bringing the peptide units close to each other. Therefore, it is not necessary to design a rigid beta turn with amino acids residues that might force a specific-turn conformation and restrict the potential structural fold of the beta peptides. Instead, the design of the beta turns is more flexible. In native proteins polar amino acid residues (serine, asparagine, glutamine and threonine) are often present in beta turns. The hydrophilic side chains of these amino acids can readily hydrogen bond, stabilizing the potential beta turn conformation. In addition, the side chains of these amino acids have no charge so are less likely to contribute to structural rearrangement or interact with the active site residues.
- charged amino acids glutamic acid and aspartic acid
- beta turn designs potentially increasing the solubility of the complete protein.
- the selection of the fourth amino acid is more restricted, preferentially to glycine.
- the small and flexible side chain of this amino acid prevents steric repulsion, allowing for the ⁇ -p connection.
- the beta peptide’s ability to readily self-assemble into a beta-sheet structure is advantageous for producing a beta sheet protein structure but the self-assembly of the beta peptides is uncontrollable, producing potentially large fibrillar structures.
- the introduction of the beta turns can control the number of beta peptides per molecule. However, this does not prevent intermolecular assembly of these beta sheet protein molecules.
- “negative design” is incorporated into the beta sheet protein design as seen in natural ⁇ - sheet proteins (see Richardson and Richardson (2002 PNAS 99, 2754-2759). For this a single amino acid with a charged side chain, a lysine amino acid residue, was introduced into each flanking beta peptide unit thereby providing charged residues at the intermolecular interface and inhibiting the aggregation of the beta sheet protein molecules.
- each peptide unit was connected in the N- to C-terminal direction using a beta turn. This leads to the catalytic residue in position 2 of the first peptide unit potentially hydrogen bonding to the catalytic residue in position 6 of the second peptide unit ( Figure 9).
- consecutive ibD peptides may be linked by a N4 linker providing a beta turn as follows:
- beta peptides were assembled initially into a pentamer, consisting of 5 beta peptides, and decamer consisting of 10 beta peptides.
- the pentamers and decamers ( Figure 8) were flanked on their N- and C- terminus by a beta peptide unit that incorporates negative design to reduce aggregation as explained above.
- inverted and non-inverted designs were produced (See Figure 9).
- Each peptide unit represents a potential beta strand and is separated by a beta turn of four amino acids.
- the N-terminal was fused directly onto the C-terminus of the DBD as shown by SEQ. ID. No. 1 through a linker (Linker 1).
- a flexible, soluble region was provided at the terminus of the C-terminal flanking region comprising of asparagine, glutamine, glycine and serine.
- each protein construct was fused onto the C- terminal region of the construct ApGet-i (SEQ. ID. No. 1 minus the final linker and nickase) by provision of a linker sequence.
- the linker chosen was
- This final construct is referred to as an ApGet1.0 nuclease protein.
- Such modular polypeptides were expressed using two different systems to use various mechanism of action or in vitro characterisation studies: (i) in vitro transcription translation (IVTT) and 2) bacterial recombinant protein production (E. coli protein production).
- IVTT in vitro transcription translation
- E. coli protein production bacterial recombinant protein production
- a series of protein tags were attached onto the ApGet1.0 sequence (see Figure 10).
- the first protein design contained an N-terminal hexa-histidine tag (6His-tag) preceding a protease specific cleavage site (TEV cleavage site). The cleavage site can be cleaved by the TEV protease allowing the removal of the 6His-tag after purification of the ApGetl .0 protein.
- the second protein design was conceived to potentially enhance the solubility of the ApGetl .0 construct by fusing a maltose binding protein (MBP) to the N-terminus of ApGet1.0.
- MBP maltose binding protein
- the MBP tag was provided with an N-terminal 6His-tag.
- the C terminus was fused to a second 6His Tag followed by a spacer region consisting of glycine and serine followed by a TEV protease cleavage site.
- the spacer reduces steric interference of the MBP on the folding of the ApGetl .0 and allows adequate access to the TEV protease for successful cleavage of the His-MBP-His tag from ApGet1.0.
- An IVTT expression system was used to initially screen the ApGet 1.0 proteins for cleavage activity with enhancement of expression as discussed above.
- a cell free in vitro transcription and translation system translates a protein without the constraints of a cellular environment.
- Such a system is often used to express insoluble and toxic proteins that are not stable in the cell and would otherwise aggregate or cause cell death reducing protein yield.
- the PURExpress® IVTT system (New England BioLabs) was used which can express the proteins free from proteases, RNases and DNases. This was desirable as the presence of proteases can reduce the overall protein yield and RNases/DNases can interfere with in vitro cleavage assays.
- the MBP-fused ApGet1.0 was cleaved prior to any cleavage assays to remove the large MBP protein as it might sterically interfere with the action of the ApGetl .0 proteins.
- the cleaved protein was semi-purified before cleavage assays by carrying out a crude (batch) purification of the protein mix with Ni-NTA resin.
- the resin captures the 6His tag extracting the His-MBP-His fusion tag and His-TEV protease from the protein solution.
- buffers containing either no metal, Mn 2+ or Mg 2+ were tested. Mn 2+ and Mg 2+ were used at 5mM. The remaining buffer components reflected physiological conditions: 25mM Tris-HCI pH8.0, 150mM NaCI.
- the ApGetl .0 protein of SEQ. ID. No. 1 was found to nick plasmid DNA (representing ssDNA cleavage) in the presence of Mg 2+ or Mn 2+ ions.
- this is the ApGET employing the artificial nuclease of SEQ. ID. no. 6:
- an ApGetl .0 10mer protein using the IVTT system is useful to be able to screen for initial cleavage activity.
- an increase in protein yield, purity, and the ability to quantify the proteins can assist in revealing the efficiency of the enzymes and understanding their mechanism of action.
- E. coli recombinant technology can produce a greater yield of protein and purification can be assisted using a series of columns for chromatography.
- a DNA sequence encoding the ApGetl .0 protein with an MBP tag as discussed above was placed within a high-copy plasmid, pET24a which ensures that upon transformation each cell contains many copies of the ApGetl .0 protein thereby increasing protein yield. This was enhanced further by using the T7 promoter.
- the plasmid was used to transform DE3 lysogenic bacterial cells that contain the T7 RNA polymerase gene and expression of the RNA polymerase was induced by IPTG.
- the host cells chosen were BL21 (DE3) RIPL codon plus E. coli cells (Agilent Technologies).
- the MBP-fused ApGet1.0 protein was over expressed with an induction temperature of 18°C for 12-18 hours.
- the ApGet-i protein (again including a C-terminal linker) was similarly expressed at 37°C for 4 hours.
- cell lysate containing the overexpressed ApGetl .0 protein was passed through a Ni-NTA affinity-based chromatography column, using the 6His-tag to purify the MBP fused ApGet1.0 protein from the lysate.
- a second cation exchange column was used to further purify the MBP-ApGet1.0 protein, followed by cleavage reaction with the TEV protease. This cleaves the target protein from the whole His-MBP-His protein tag.
- Final separation of the His-MBP-His tag and the TEV protease from the target protein was carried out by batch purification using Ni-NTA resin. The target protein remains in solution while the tag and protease bind to the resin.
- Example 4 Proof of concept testing in bacterial cells
- E.coli were co-transformed with a first plasmid, termed the "Editor” encoding an ApGet configuration to be tested, and a second plasmid, the "Detector” encoding factors that generate a differential signal upon gene-editing mediated by the ApGet system.
- the two plasmids have distinct and compatible origins of replication and contain different antibiotic resistance genes allowing co-transformation and stable maintenance of both plasmids in the E.coli population.
- the Editor plasmid is a multi-copy plasmid, which encodes the ApGet polypeptide under the control of a native SpCas9 promoter and the nucleic acid component (NAC) under the control of the J23119 promoter.
- This is a commonly used strong synthetic promoter to drive gRNA expression in E. coli (see, for example, in Qi et al. Repurposing CRISPR as an RNA- guided platform for sequence specific control of gene expression. Cell (2013) 152, 1173— 1183).
- the Detector plasmid comprises a Lac promoter driven eYFP or LacZa protein coding sequence with its 5’ upstream region containing four identical targets complementary to the target element deployed in the ApGet system. See Figure 12.
- the target element sequence (TE) in the Editor plasmid is:
- the targeting element in the NAC was fused using the connector AATTT to a BoxB RNA scaffold sequence which binds the RSBD of the ApGet polypeptide.
- the targets in the two Detector plasmids are as follows (SEQ. ID. No. 62):
- Target sequence in PC1 and PC2 in 5’-3’ direction are PDS and sequences in white boxes are targets, separated by other sequences in between.
- Construct 1 plasmid for expression of ApGet-i.
- Construct 2 the eYFP detector plasmid.
- Construct 3 the LacZa detector plasmid.
- Construct 4 plasmid having similar backbone to construct 1 but without an ApGet-i expression cassette.
- the testing of the ApGet concept was then extended by fusing the catalytic unit of the Fokl nuclease through a linker (the linker of SEQ. ID. No 5 as shown above in SEQ. ID.no.1) to the DBD domain of the ApGet-i so as to create a fully functional RNA-directed genome editing enzyme.
- the nuclease linker was chosen in part to optimize the nucleotide sequence for synthesis of synthetic DNA fragments.
- the Editor plasmid for the ApGet-Fokl system consisted of the nucleic acid component (NAC), expressed under the control of the constitutive J23119 promoter and the ApGet-Fokl protein under the control of an inducible Tet-On promoter (the Tet repressor (TetR) regulates expression of the Tet promoter (TetP) by binding to the Tet Operator (TetO) sequence).
- the backbone of the Editor plasmid is derived from pET28a and includes the ColE1 origin of replication and kanamycin resistance expression unit (see Figure 14).
- the Detector plasmid contained a target cassette comprising two identical target sequences on opposite DNA strands (recognized by a single ApGet NAC component expressed from the Editor plasmid used in the experiment), for example with PDS sequences located internal to their respective target sequences (we term this the “inward”, or “PDS-in” configuration).
- Target Element sequence CACACAGGAAACAGTATTCAT (SEQ. ID. NO. 63)
- the detector plasmid also contained elements derived from pCC1 which contain the ori2 and oriV origins of replication and an antibiotic resistance gene, distinct from that on the Editor plasmid, in this specific example the chloramphenicol resistance gene (see again Figure 14).
- an ApGet system was delivered to E. coli bacterial cells with the aim of correcting a disrupted gene.
- the cells were co-transformed with a detector plasmid carrying a disrupted nanoluciferase gene and an editor plasmid expressing the ApGet system where the polypeptide component of the system (e.g. a modular polypeptide having the amino acid sequence of SEQ. ID. No. 1) is under the control of a T7 promoter and Lac operator and the RNA component of the system is expressed under the control of a synthetic promoter (J23119)
- a repair template is also embedded with approx. 200bp right and left homology arms in the editor plasmid.
- sequence of the donor or repair template element in the 5’-3’ direction was as follows: (sequence of the left homology arm is underlined and sequence of the right homology arm highlighted in grey):
- the detector plasmid provided a “gain of function” detection system, where generation of nicks in the double-stranded DNA sequence of the detector element can facilitate Homology Directed Repair (HDR), to restore detector activity in the presence of the donor template.
- HDR Homology Directed Repair
- the detector was designed in the form of a nanoluciferase gene, expressed under the control of a T7 promoter and disrupted by the target cassette, which is recognized by ApGet1.0.
- the target cassette is composed of two identical target sequences in tandem, in either “PDS-out” or “PDS-in” configurations. (See constructs f and g respectively in Figure 17).
- the PDSin and PDSout detectors employed the same target sequences as employed previously and noted above and were located exactly between the homology arms.
- the target cassette consisting of two target sequences located in close proximity to each other, may increase the clustered nicking activity of the AN of ApGet1.0 thus increasing the chance for the double-stranded break, which in turn may trigger more efficient HDR which will result in the expression of the functional nanoluciferase.
- the Homology-directed repair (HDR) template for the nanoluciferase was constructed on the same plasmids that express ApGet as a separate unit.
- Figures 18 and 19 further illustrate the use of PDS-in and PDS-out configurations of pairs of PDS-target sequences as targeted by a synthetic genome editing system of the invention.
- Control plasmids used were either “h” (devoid of any functionally relevant elements for the current experiments) or “i” (plasmid with HDR unit only).
- Nanoluc ORF Nanoluciferase open reading frame
- DBD of sequence SLETWLKHREKDGGS was selected on the basis of binding affinity for the dsDNA sequence represented by the 5' to 3' sequence 5'GAGGTC3' (the initially chosen predetermined sequence (PDS) for use in targeting).
- PDS predetermined sequence
- An ApGet-i expressing plasmid (the Editor plasmid) was provided as shown in Figure 21.
- a nanoluciferase expression cassette was cloned in a second plasmid vector (the Detector plasmid) with the PDS as originally used for DBD selection and variants of that PDS in the target region as shown in Figure 22.
- Bacterial cells were transformed with the Editor plasmid in which ApGet-i expression was under the control of a TetR promoter.
- the NAC was also expressed by the same plasmid under the control of a constitutive J23119 promoter.
- the Detector and Editor plasmids were provided with different resistance genes and compatible origins of replication.
- the ApGet-i expression plasmid has a ColE1 high copy origin of replication.
- the Detector plasmids have Ori2 and OriV origins of replication. Transformation of the Detector and Editor plasmids was carried out in EPI300 cells (Lucigen), which allow for the copy control of the Detector plasmids.
- the transformed cultures were induced the next day with Anhydrotetracycline (ATC) to induce the expression of ApGet-i and the nanoluciferase expression was induced with IPTG (Isopropyl ⁇ -D-1 -thiogalactopyranoside).
- ATC Anhydrotetracycline
- IPTG Isopropyl ⁇ -D-1 -thiogalactopyranoside
- the signal of the nanoluciferase was monitored on the microplate reader and normalized to take account of the degree of bacterial growth in the culture.
- the DBD directed to different PDSs of the DNA is effective in inhibiting expression of the luciferase.
- This confirms that the DBD of the invention is flexible in terms of its ability to bind to the DNA.
- the DBD of SEQ. ID. No. 4 can be expected to be effective in targeting not only 5'GAGGTC3' sequences in a dsDNA but also, for example, 5'TTGGGTC3' and 5'AAAAAA3' with good if not better affinity.
- ApGet in mammalian cells was tested in HEK293T and HAP1 cells.
- optimized configurations of ApGet in plasmid or RNP forms were created.
- ApGet and NAC expression units were constructed in a circular vector of minimal necessary length, only containing a high copy origin of replication and an antibiotic resistance gene to allow for the efficient production of this vector (Figure 24).
- ApGet and NAC units were expressed under their respective RNA pol II and RNA pol III promoters: CMV, Cbh/CAG or Ef1A promoters for expression of ApGet and a U6 promoter for expression of each of two NAC units were used.
- the variants of the ApGet expression cassettes employed are illustrated more fully in Figure 25.
- a nuclear localization signal was provided preceded at the N-terminus by a FLAG® epitope tag.
- the target region of the ApGet was chosen to affect the expression of all known alternative splicing transcripts with open reading frames of the PD-L1 gene (also known as CD274) (Q9NZQ7-1 , Q9NZQ7-2, Q9NZQ7-3, Uniprot).
- PD-L1 gene also known as CD274
- Q9NZQ7-1 , Q9NZQ7-2, Q9NZQ7-3, Uniprot Layout of the ApGet targeting region in exon 4 of the PD-L1 gene target, including binding sites of ApGet target elements and PDS sites is shown in Figure 26.
- ApGet RNP was delivered to haploid HAP1 cells by electroporation (NEON, Thermofisher). Haploid cells were selected so that there could be anticipated a direct phenotypic consequence of any reading frame changing or significant deletion mutation as the cells only contain a single copy of the target gene.
- NEON Thermofisher
- Haploid cells were selected so that there could be anticipated a direct phenotypic consequence of any reading frame changing or significant deletion mutation as the cells only contain a single copy of the target gene.
- interferon gamma was added to the transfected cell cultures to induce PD-L1 expression. 24 hours after transfection, the cells were fixed, and PD-L1 was detected using immunofluorescence labeled antibodies Quantification of the PD-L1 expressing cells was done by ImageJ and values were plotted for a graph using MS Excel; See Figure 27.
- HAP1 cells were co-transfected with a vector expressing ApGet (Fig. 25, Construct I), NAC for two adjacent regions of the target region in the PD-L1 gene in the form of RNA oligos and donor template in the form of single stranded DNA oligo (ssODN, Alt-R, IDT).
- the donor template was designed to have a HA tag sequence with the stop codons at the 3’ end, flanked by 50bp homology arms from both sides.
- the homology arms of the donor template were designed to bind to sequences 30bp upstream and downstream of the target region so as to minimize the effect of potential ApGet activity on and close to the target region on already integrated HDR template (Fig. 28a).
- the experiment provides evidence that ApGet-mediated editing triggered the integration of the HA tag into chromosomal DNA via an HDR mechanism.
- HEK293T cells were transfected with ApGet expressing constructs (j and k as shown in Figure 25), with targeting to the TSKU gene, that includes juxtaposed PDS sequences on either side of the target site; See Figure 29 .
- Geneomic DNA was collected 48 hours after transfection and amplified by PCR using primers flanking the target site. DNA sequence traces from Sanger sequencing with fluorescent chain terminating residues were obtained from the PCR products. These were analyzed using the cloud-based software package, TIDER, which calculates the degree of gene editing by assessing the fraction of wild-type sequence at each position. A non-transfected sample was used as a control (Brinkman et al, Nucleic Acids Res. (2016)).
- Results shown in Figure 30 indicate high rates of substitution from the wild-type sequence at sequence positions 5' to base pair 150 in the test samples compared to the control sample. This provides strong support for the contention that the ApGet system is editing chromosomal DNA at the target site in the human HEK-293 cells.
- the starting configurations which were employed for these fusion proteins are detailed in Figure 31 and consisted of the following: His-tag (6x histidine) for Immobilized metal affinity chromatography (IMAC)-based purification, a solubility tag of either maltose binding protein (MBP) or small ubiquitin-like modifier (SUMO), spacer followed by a TEV protease cleavage site, a FLAG® epitope tag, a nuclear localization sequence (NLS), the POI sequence and finally a Strep-tag®l I sequence at the C-terminal end.
- This tag may be used for both ApGeti and ApGet production.
- ApGeti can be purified without the Strep II tag and thus may be expressed simply with inclusion of Linker 1 (Seq. ID. No. 5) at the C-terminus.
- TEV protease-mediated cleavage in these constructs generated an NH2-terminal leader consisting of amino acids Gly-Trp-Gly-Ser (GWGS), thus introducing an additional aromatic amino acid residue to improve the sensitivity of absorbance measurements at 280 nm for protein quantification.
- GWGS Gly-Trp-Gly-Ser
- Strep II tag when incorporated as a COOH-terminal tag enables use of affinity chromatography on a specifically engineered version of streptavidin to select full-length proteins. This allowed the removal of prematurely terminated translation products from the final protein preparations. Through this method production of full length ApGet protein was successfully achieved with purification, detection and solubility tags.
- Example 8 Transcriptional activation using an ApGeti linked to VP64
- the ASCL-1 gene was selected as a known target gene for such a CRISPR/ Cas based transcriptional activator with low background transcription level.
- Four locations in the gene promoter region were chosen to be targeted using 4 different NACs.
- Each NAC consisted of a targeting element joined via a short connector to the same RNA scaffold (the Box B lambda phage sequence).
- three different modular ApGet polypeptides were employed with the same VP64 effector and the same RSBD (the lambda N22 peptide). Either linker 1 between the VP64 component and the DBD or linker 2 between the RSBD and DBD was varied as shown in table 8 below.
- Each ApGeti-VP64 variant was expressed together with four separate NAC transcriptional units from the same plasmid.
- the plasmid constructs all had a general structure comprising a minimalistic vector backbone (containing a ColE1 origin of replication and a bacterial resistance gene) and an insert, comprising 5 separate transcription units: two U6 promoter driven NAC units followed by and in reverse direction of transcription to an Ef1-a promoter driven ApGeti-VP64 expression unit, followed by another two separate U6 promoter driven NAC units, as shown in Figure 32.
- the sequences of the different NAC expression units as well as ApGeti-VP64 variant expression units are set out in following table 10. Table 11 summarises the expression units of each plasmid construct.
- NAC numbering (1 to 4) Is according to the position of the NAC in the construct (from 5' to 3').
- NAC1 and NAC2 sequences are given on reverse complementary strand, as they are in reverse transcription orientation to ApGeti-VP64 and NAC3 and NAC4.
- Each NAC expression unit comprises a U6 promoter followed by RS (bold letters), TE (underlined sequence) and terminator sequence comprising of 7x t.
- Each ApGeti-VP64 expression sequence comprises an Ef1-a promoter and 5' untranslated region, followed by ApGeti-VP64 encoding sequence (underlined), comprising the RSBD (capital Italic letters), followed by Linker2 (bold letters), DBD (bold, capital letters), Linked (capital letters) and VP64 module (italic letters).
- NAC1 (Seq. ID. No. 72 ): 5’- NAC2 (Seq. ID. No. 73):
- NAC3 (Seq. ID. No. 74):
- NAC4 (Seq. ID. No.75 ):
- Linker 1 DNA sequence (Seq. ID No. 78):
- Modified linker 1 (L1a) DNA sequence (Seq. ID No. 79 ):
- Linker 2 (L2) DNA sequence (Seq. ID. No. 80): 5’-
- HEK293T cells were transfected with a plasmid expressing an ApGet-i protein fused to VP64 plus the 4 NACs using Lipofectamine 3000 reagent in accordance with the manufacturer’s instructions.
- 2.5. mg of the ApGeti-VP64 expressing plasmid was employed to 0.7-1 x 10 6 HEK293T cells in wells in a 6- well plate format (ThermoFisher Scientific)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Crystallography & Structural Chemistry (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicinal Preparation (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Enzymes And Modification Thereof (AREA)
Priority Applications (10)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2024521748A JP2024537279A (ja) | 2021-10-08 | 2022-10-07 | 合成ゲノム編集システム |
| AU2022360286A AU2022360286A1 (en) | 2021-10-08 | 2022-10-07 | Synthetic genome editing system |
| IL311961A IL311961A (en) | 2021-10-08 | 2022-10-07 | A synthetic genome editing system |
| ES22793205T ES3041112T3 (en) | 2021-10-08 | 2022-10-07 | Synthetic genome editing system |
| KR1020247015096A KR20240082405A (ko) | 2021-10-08 | 2022-10-07 | 합성 게놈 편집 시스템 |
| CA3234338A CA3234338A1 (en) | 2021-10-08 | 2022-10-07 | Synthetic genome editing system |
| EP25195247.9A EP4636084A3 (en) | 2021-10-08 | 2022-10-07 | Synthetic genome editing system |
| US18/698,875 US20260009008A1 (en) | 2021-10-08 | 2022-10-07 | Synthetic genome editing system |
| CN202280078480.6A CN118318044A (zh) | 2021-10-08 | 2022-10-07 | 合成的基因组编辑系统 |
| EP22793205.0A EP4413140B1 (en) | 2021-10-08 | 2022-10-07 | Synthetic genome editing system |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB2114453.0A GB202114453D0 (en) | 2021-10-08 | 2021-10-08 | Synthetic genome editing system |
| GB2114453.0 | 2021-10-08 | ||
| GB2209735.6 | 2022-07-01 | ||
| GBGB2209735.6A GB202209735D0 (en) | 2022-07-01 | 2022-07-01 | Synthetic genome editing system |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2023057777A1 true WO2023057777A1 (en) | 2023-04-13 |
Family
ID=83902914
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2022/052555 Ceased WO2023057777A1 (en) | 2021-10-08 | 2022-10-07 | Synthetic genome editing system |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US20260009008A1 (https=) |
| EP (2) | EP4636084A3 (https=) |
| JP (1) | JP2024537279A (https=) |
| KR (1) | KR20240082405A (https=) |
| AU (1) | AU2022360286A1 (https=) |
| CA (1) | CA3234338A1 (https=) |
| ES (1) | ES3041112T3 (https=) |
| IL (1) | IL311961A (https=) |
| WO (1) | WO2023057777A1 (https=) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013088446A1 (en) | 2011-12-16 | 2013-06-20 | Targetgene Biotechnologies Ltd | Compositions and methods for modifying a predetermined target nucleic acid sequence |
| WO2020142676A1 (en) * | 2019-01-04 | 2020-07-09 | The University Of Chicago | Systems and methods for modulating rna |
| WO2021084533A1 (en) * | 2019-10-28 | 2021-05-06 | Targetgene Biotechnologies Ltd | Pam-reduced and pam-abolished cas derivatives compositions and uses thereof in genetic modulation |
| WO2022011232A1 (en) | 2020-07-10 | 2022-01-13 | Horizon Discovery Limited | Rna scaffolds |
-
2022
- 2022-10-07 KR KR1020247015096A patent/KR20240082405A/ko active Pending
- 2022-10-07 CA CA3234338A patent/CA3234338A1/en active Pending
- 2022-10-07 IL IL311961A patent/IL311961A/en unknown
- 2022-10-07 JP JP2024521748A patent/JP2024537279A/ja active Pending
- 2022-10-07 AU AU2022360286A patent/AU2022360286A1/en active Pending
- 2022-10-07 WO PCT/GB2022/052555 patent/WO2023057777A1/en not_active Ceased
- 2022-10-07 US US18/698,875 patent/US20260009008A1/en active Pending
- 2022-10-07 EP EP25195247.9A patent/EP4636084A3/en active Pending
- 2022-10-07 ES ES22793205T patent/ES3041112T3/es active Active
- 2022-10-07 EP EP22793205.0A patent/EP4413140B1/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013088446A1 (en) | 2011-12-16 | 2013-06-20 | Targetgene Biotechnologies Ltd | Compositions and methods for modifying a predetermined target nucleic acid sequence |
| WO2020142676A1 (en) * | 2019-01-04 | 2020-07-09 | The University Of Chicago | Systems and methods for modulating rna |
| WO2021084533A1 (en) * | 2019-10-28 | 2021-05-06 | Targetgene Biotechnologies Ltd | Pam-reduced and pam-abolished cas derivatives compositions and uses thereof in genetic modulation |
| WO2022011232A1 (en) | 2020-07-10 | 2022-01-13 | Horizon Discovery Limited | Rna scaffolds |
Non-Patent Citations (19)
| Title |
|---|
| AGUILERA ET AL., INTEGR. BIOL. (CAMB, vol. 1, 2009, pages 371 - 381 |
| BARON- BENHAMOU ET AL., METHODS MOL. BIOL., vol. 257, 2004, pages 135 - 154 |
| BOLUKBASI MEHMET FATIH ET AL: "DNA-binding-domain fusions enhance the targeting range and precision of Cas9", NATURE METHODS, vol. 12, no. 12, 19 October 2015 (2015-10-19), New York, pages 1150 - 1156, XP093012024, ISSN: 1548-7091, Retrieved from the Internet <URL:http://www.nature.com/articles/nmeth.3624> DOI: 10.1038/nmeth.3624 * |
| BRINKMAN ET AL., NUCLEIC ACIDS RES., 2018 |
| CHEN ET AL., ADV. DRUG DELIV. REV., vol. 65, 2013, pages 1357 - 1369 |
| COFSKY JOSHUA C ET AL: "CRISPR-Cas12a exploits R-loop asymmetry to form double-strand breaks", ELIFE, vol. 9, 10 June 2020 (2020-06-10), XP093011978, Retrieved from the Internet <URL:https://cdn.elifesciences.org/articles/55143/elife-55143-v2.xml> DOI: 10.7554/eLife.55143 * |
| KOMOR ET AL.: "Programmable Editing of a Target Base in Genomic DNA without Double-Stranded DNA Cleavage", NATURE, vol. 533, no. 7603, pages 420 - 424, XP055968803, DOI: 10.1038/nature17946 |
| NISHIMASU ET AL., CELL, vol. 156, 2014, pages 935 - 949 |
| NOGUCHI ET AL., DIABETES, vol. 52, 2003, pages 1732 - 1737 |
| QI ET AL.: "Repurposing CRISPR as an RNA-guided platform for sequence specific control of gene expression", CELL, vol. 152, 2013, pages 1173 - 1183, XP055346792, DOI: 10.1016/j.cell.2013.02.022 |
| RAUCH SIMONE ET AL: "Programmable RNA-Guided RNA Effector Proteins Built from Human Parts", CELL, vol. 178, no. 1, 27 June 2019 (2019-06-27), pages 122, XP085721270, ISSN: 0092-8674, DOI: 10.1016/J.CELL.2019.05.049 * |
| RICHARDSONRICHARDSON, PNAS, vol. 99, 2002, pages 2754 - 2759 |
| RUFO ET AL.: "Short peptides self-assemble to produce catalytic amyloids", NATURE CHEM., vol. 6, 2014, pages 303 - 309 |
| TREHIN ET AL., PHARMA. RES., vol. 21, 2004, pages 1248 - 1256 |
| WENDER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 13003 - 13008 |
| WÖLCKE JULIAN ET AL: "A DNA-BINDING PEPTIDE FROM A PHAGE DISPLAY LIBRARY", NUCLEOSIDES, NUCLEOTIDES & NUCLEIC ACIDS, vol. 20, no. 4-7, 31 March 2001 (2001-03-31), US, pages 1239 - 1241, XP093012180, ISSN: 1525-7770, DOI: 10.1081/NCN-100002526 * |
| XUE ET AL., ROYAL SOC. OPEN SCI., vol. 4, 2017, pages 160696 |
| XUE ET AL., ROYAL. SOC. OPEN SCI., vol. 4, 2017, pages 160696 |
| ZENDER ET AL., CANCER GENE THER., vol. 9, 2002, pages 486 - 96 |
Also Published As
| Publication number | Publication date |
|---|---|
| EP4413140A1 (en) | 2024-08-14 |
| ES3041112T3 (en) | 2025-11-07 |
| EP4636084A3 (en) | 2025-12-24 |
| CA3234338A1 (en) | 2023-04-13 |
| EP4413140B1 (en) | 2025-08-13 |
| JP2024537279A (ja) | 2024-10-10 |
| EP4636084A2 (en) | 2025-10-22 |
| US20260009008A1 (en) | 2026-01-08 |
| EP4413140C0 (en) | 2025-08-13 |
| AU2022360286A1 (en) | 2024-05-02 |
| IL311961A (en) | 2024-06-01 |
| KR20240082405A (ko) | 2024-06-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP4025691B1 (en) | Novel, non-naturally occurring crispr-cas nucleases for genome editing | |
| AU2017364084B2 (en) | CRISPR/Cpf1 systems and methods | |
| KR102012382B1 (ko) | 조작된 crispr-cas9 조성물 및 사용 방법 | |
| US20200149024A1 (en) | Engineered CRISPR-Cas9 Nucleases | |
| US20180112234A9 (en) | Methods and compositions for gene editing | |
| US20190071657A1 (en) | Engineered CRISPR-Cas9 Nucleases | |
| JP2022122910A (ja) | 真核ゲノム修飾のための操作されたCas9システム | |
| US20160102322A1 (en) | Crispr oligonucleotides and gene editing | |
| CN110799205A (zh) | 利用CRISPR-Cpf1的可诱导、可调和多重的人类基因调节 | |
| KR20230002401A (ko) | C9orf72의 표적화를 위한 조성물 및 방법 | |
| AU2015355546A1 (en) | Guide RNA with chemical modifications | |
| WO2017107898A2 (en) | Compositions and methods for gene editing | |
| WO2020069029A1 (en) | Novel crispr nucleases | |
| EP4413140B1 (en) | Synthetic genome editing system | |
| JP2025510007A (ja) | カーゴヌクレオチド配列を転位するための系及び方法 | |
| CN118318044A (zh) | 合成的基因组编辑系统 | |
| JP2025508794A (ja) | 融合タンパク質 | |
| HK40078419A (en) | Novel, non-naturally occurring crispr-cas nucleases for genome editing | |
| HK40078419B (en) | Novel, non-naturally occurring crispr-cas nucleases for genome editing | |
| WO2023220654A2 (en) | Effector protein compositions and methods of use thereof | |
| BR122025004697B1 (pt) | Sistemas para modificar um genoma eucariótico, pluralidade de ácidos nucleicos, vetor, e proteína de fusão |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 22793205 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 3234338 Country of ref document: CA |
|
| ENP | Entry into the national phase |
Ref document number: 2024521748 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 311961 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: AU2022360286 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202417034718 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 2022360286 Country of ref document: AU Date of ref document: 20221007 Kind code of ref document: A |
|
| ENP | Entry into the national phase |
Ref document number: 20247015096 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2022793205 Country of ref document: EP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2022793205 Country of ref document: EP Effective date: 20240508 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 202280078480.6 Country of ref document: CN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11202402272W Country of ref document: SG |
|
| WWG | Wipo information: grant in national office |
Ref document number: 2022793205 Country of ref document: EP |