WO2023047123A1 - Procédé de détermination de l'adéquation d'un inhibiteur exo1 pour le traitement du cancer - Google Patents

Procédé de détermination de l'adéquation d'un inhibiteur exo1 pour le traitement du cancer Download PDF

Info

Publication number
WO2023047123A1
WO2023047123A1 PCT/GB2022/052410 GB2022052410W WO2023047123A1 WO 2023047123 A1 WO2023047123 A1 WO 2023047123A1 GB 2022052410 W GB2022052410 W GB 2022052410W WO 2023047123 A1 WO2023047123 A1 WO 2023047123A1
Authority
WO
WIPO (PCT)
Prior art keywords
exo1
attenuation
loss
sgrna
gene
Prior art date
Application number
PCT/GB2022/052410
Other languages
English (en)
Inventor
Marija MARIC
Simon Joseph BOULTON
Original Assignee
The Francis Crick Institute Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Francis Crick Institute Limited filed Critical The Francis Crick Institute Limited
Publication of WO2023047123A1 publication Critical patent/WO2023047123A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the invention relates to a method for determining the suitability of an EXO1 inhibitor for the treatment of cancer, and to the use of a kit for said method.
  • the invention also relates to a method for the treatment of cancer.
  • EXO1 Human exonuclease 1
  • DSBR double-strand break repair
  • checkpoint activation to restart stalled DNA forks.
  • EXO1 is often found to be overexpressed in cancers and this is associated with poor prognosis.
  • knockout of EXO1 gene is viable in different organisms, exemplified by the viable knockout mouse model of EXO1 , suggesting that loss of EXO1 is compensated by other DNA repair pathways.
  • identification of synthetic lethal interactions with loss of EXO1 may reveal therapeutic opportunities for targeting cancer harbouring specific DNA repair pathway alterations.
  • a method for determining the suitability of an EXO1 inhibitor for the treatment of cancer in a subject comprising detecting the presence of genetic loss or attenuation and/or loss or attenuation of expression of one or more genes selected from: a gene which encodes a Fanconi Anemia core complex protein, a gene which encodes a FANCM complex protein, a gene which encodes a BRCA1- A complex protein, ZRSR2, CDK11 B, LY6G6D, CYBA, EFNA5, or ZBTB7A, in a biological sample obtained from said subject.
  • a method for the treatment of cancer in a subject comprising determining the suitability of an EXO1 inhibitor for the treatment of cancer according to the methods as described herein; and administering an effective amount of an EXO1 inhibitor to the subject if genetic loss or attenuation and/or loss or attenuation of expression is detected.
  • kits in a method of predicting the suitability of an EXO1 inhibitor for the treatment of cancer in a subject
  • the kit comprises a biosensor configured to detect the presence of a genetic loss or attenuation and/or loss or attenuation of expression of one or more genes selected from: a gene which encodes a Fanconi Anemia core complex protein, a gene which encodes a FANCM complex protein, a gene which encodes a BRCA1-A complex protein, ZRSR2, CDK11 B, LY6G6D, CYBA, EFNA5, or ZBTB7A, in a biological sample obtained from said subject.
  • Figure 1 (A) Immunoblots for EXO1 and alpha-tubulin from whole cell extracts of eHAP iCas9 wild type and EXO1 KO clones 11 , 21 and 22.
  • FIG. 2 Sensitivity of eHAP iCas9 EXO1 KO clones to (A) methyl methanesulfonate MMS, (B) cisplatin, (C) formaldehyde, (D) potassium bromate (KBrO3), (E) an ATR inhibitor (ATRi), (F) Olaparib, and (G) hydroxyurea (HU).
  • FIG. 3 Cas9 cutting efficiency of eHAP iCas9 wild type (top) and EXO1 KO clone 11 (bottom) by the BFP/GFP assay measured by flow cytometry. Left panels show Cas9 cutting efficiency with the addition of doxycycline for 96h, while right panels show minimal activity of Cas9 in the absence of doxycycline in media.
  • Figure 4 Viability of EXO1 KO clones in eHAP iCas9 background. Three clones were analysed for viability using Cell Titer Gio assay (6 days after seeding) and obtained values were normalised against the wild type cell line (mean with SD).
  • Figure 5 (A) Representative images for three repeats (200 cells were seeded per well) and (B) quantification (mean with SD) of a clonogenic assay for eHAP iCas9 wild type cell line and EXO1 KO clone 11 cell line.
  • FIG. 6 Volcano plot (log fold change on X axis, -Iog10 of p-value on Y axis) of whole genome CRISPR dropout screen indicates synthetic lethality of EXO1 with (A) MRE11 and RAD50 in WT vs EXO1 KO comparison of ‘day 6’ timepoint, (B) FEN1 in WT vs EXO1 KO comparison of ‘day 6’ timepoint, (C) RMI2 and BLM in WT vs EXO1 KO comparison of ‘day 16’ timepoint and (D) ATM in WT vs EXO1 KO comparison of ‘day 16’ timepoint.
  • A MRE11 and RAD50 in WT vs EXO1 KO comparison of ‘day 6’ timepoint
  • B FEN1 in WT vs EXO1 KO comparison of ‘day 6’ timepoint
  • C RMI2 and BLM in WT vs EXO1 KO comparison of ‘day 16’ timepoint
  • Figure 8 (A) Representative images for three repeats (200 cells were seeded per well) and (B) quantification (mean with SD) of a clonogenic assay for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for RMI2, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for RMI2.
  • FIG. 9 Viability assay with Cell Titer Gio for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for RMI2, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for RMI2.
  • FIG. 11 Volcano plots (log fold change on X axis, -Iog10 of p-value on Y axis) of whole genome CRISPR dropout screen indicates synthetic lethality of EXO1 with Fanconi anemia genes in WT vs EXO1 KO comparison for ‘day 6’ and ‘day 16’ timepoints.
  • Figure 12 (A) Representative images for three repeats (200 cells were seeded per well) and (B) quantification (mean with SD) of a clonogenic assay for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for C19orf40/FAAP24, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for C19orf40/FAAP24.
  • NT non-targeting
  • NT non-targeting
  • EXO1 KO clone 11 with integrated sgRNA for C19orf40/FAAP24 EXO1 KO clone 11 with integrated sgRNA for C19orf40/FAAP24.
  • C Viability assay with Cell Titer Gio for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for C19orf40/FAAP24, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for C19orf40/FAAP24.
  • Figure 13 (A) Representative images for three repeats (200 cells were seeded per well) and (B) quantification (mean with SD) of a clonogenic assay for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for APITD1/MHF1 , EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for APITD1/MHF1 .
  • C Viability assay with Cell Titer Gio for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for APITD1/MHF1 , EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for APITD1/MHF1.
  • Figure 14 (A) Representative images for three repeats (200 cells were seeded per well) and (B) quantification (mean with SD) of a clonogenic assay for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for FANCG, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for FANCG.
  • NT non-targeting
  • C Viability assay with Cell Titer Gio for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for FANCG, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for FANCG.
  • D FANCG and vinculin (loading control) from whole cell extracts of eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for FANCG, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for FANCG
  • FIG. 15 Volcano plots (log fold change on X axis, -Iog10 of p-value on Y axis) of whole genome CRISPR dropout screen indicates synthetic lethality of EXO1 with BRCA1-A complex genes in WT vs EXO1 KO comparison for ‘day 6’ and ‘day 16’ timepoints (BABAM1/MERIT40 in ‘day 6’, and FAM175A/Abraxas1 and BRCC3/BRCC36 in ‘day 16’).
  • Figure 16 (A) Representative images for three repeats (200 cells were seeded per well) and (B) quantification (mean with SD) of a clonogenic assay for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for FAM175A/Abraxas1 , EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for FAM175A/Abraxas1.
  • C Viability assay with Cell Titer Gio for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for FAM175A/Abraxas1 , EXO1 KO clone 11 with integrated nontargeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for FAM175A/Abraxas1.
  • D FAM175A/Abraxas1 and vinculin (loading control) from whole cell extracts of eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for FAM175A/Abraxas1 , EX01 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for FAM175A/Abraxas1.
  • NT non-targeting
  • EX01 KO clone 11 with integrated non-targeting (NT) sgRNA EXO1 KO clone 11 with integrated sgRNA for FAM175A/Abraxas1.
  • Figure 17 (A) Representative images for three repeats (200 cells were seeded per well) and (B) quantification (mean with SD) of a clonogenic assay for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for BRCC3/BRCC36, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for BRCC3/BRCC36.
  • C Viability assay with Cell Titer Gio for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for BRCC3/BRCC36, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for BRCC3/BRCC36.
  • D BRCC3/BRCC36 and vinculin (loading control) from whole cell extracts of eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for BRCC3/BRCC36, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for BRCC3/BRCC36.
  • NT non-targeting
  • BRCC3/BRCC36 wild type with integrated non-targeting (NT) sgRNA
  • EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA wild type with integrated non-targeting (NT) sgRNA
  • EXO1 KO clone 11 with integrated sgRNA for BRCC3/BRCC36 EXO1 KO clone 11 with integrated sgRNA for BRCC3/BRCC36.
  • Figure 18 Analysis for FAM175A gene in cBioPortal, using a curated set of studies with 48870 patient samples (as of June 2021). Legend shown above the graph indicates the type of mutation observed, while on the X axis each study is labelled with the cancer type that was investigated.
  • Figure 19 Analysis for BRCC3 gene in cBioPortal, using a curated set of studies with 48870 patient samples (as of June 2021). Legend shown above the graph indicates the type of mutation observed, while on the X axis each study is labelled with the cancer type that was investigated.
  • Figure 20 Volcano plot (log fold change on X axis, -Iog10 of p-value on Y axis) of whole genome CRISPR dropout screen indicates synthetic lethality of EXO1 KO with spliceosome factor ZRSR2 loss in WT vs EXO1 KO comparison for ‘day 16’ timepoint.
  • Figure 21 (A) Representative images for three repeats (200 cells were seeded per well) and (B) quantification (mean with SD) of a clonogenic assay for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for ZRSR2, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for ZRSR2.
  • C Viability assay with Cell Titer Gio for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for ZRSR2, EX01 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for ZRSR2.
  • Figure 22 Analysis for ZRSR2 gene in cBioPortal, using a curated set of studies with 48870 patient samples (as of June 2021). Legend shown above the graph indicates the type of mutation observed, while on the X axis each study is labelled with the cancer type that was investigated.
  • FIG. 23 Volcano plot (log fold change on X axis, -Iog10 of p-value on Y axis) of whole genome CRISPR dropout screen indicates synthetic lethality of EXO1 KO with loss of genes CDK11 B, LY6G6D, CYBA, EFNA5 and ZBTB7A in WT vs EXO1 KO comparison for ‘day 16’ timepoint.
  • Figure 24 (A) Representative images for three repeats (200 cells were seeded per well) and (B) quantification (mean with SD) of a clonogenic assay for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for CDK11 B, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for CDK11 B.
  • NT non-targeting
  • CDK11 B EXO1 KO clone 11 with integrated non-targeting
  • EXO1 KO clone 11 with integrated sgRNA for CDK11 B EXO1 KO clone 11 with integrated sgRNA for CDK11 B.
  • C Viability assay with Cell Titer Gio for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for CDK11 B, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for CDK11 B.
  • Figure 25 Analysis for CDK11 B gene in cBioPortal, using a curated set of studies with 48870 patient samples (as of June 2021). Legend shown above the graph indicates the type of mutation observed, while on the X axis each study is labelled with the cancer type that was investigated.
  • Figure 26 (A) Representative images for three repeats (200 cells were seeded per well) and (B) quantification (mean with SD) of a clonogenic assay for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for LY6G6D, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for LY6G6D.
  • NT non-targeting
  • LY6G6D wild type with integrated sgRNA for LY6G6D
  • EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA wild type with integrated non-targeting (NT) sgRNA
  • EXO1 KO clone 11 with integrated sgRNA for LY6G6D EXO1 KO clone 11 with integrated sgRNA for
  • Figure 27 Analysis for LY6G6D gene in cBioPortal, using a curated set of studies with 48870 patient samples (as of June 2021). Legend shown above the graph indicates the type of mutation observed, while on the X axis each study is labelled with the cancer type that was investigated.
  • Figure 28 (A) Representative images for three repeats (200 cells were seeded per well) and (B) quantification (mean with SD) of a clonogenic assay for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for CYBA, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for CYBA.
  • NT non-targeting
  • C Viability assay with Cell Titer Gio for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for CYBA, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for CYBA.
  • Figure 29 Analysis for CYBA gene in cBioPortal, using a curated set of studies with 48870 patient samples (as of June 2021). Legend shown above the graph indicates the type of mutation observed, while on the X axis each study is labelled with the cancer type that was investigated.
  • Figure 30 (A) Representative images for three repeats (200 cells were seeded per well) and (B) quantification (mean with SD) of a clonogenic assay for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for EFNA5, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for EFNA5.
  • C Viability assay with Cell Titer Gio for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for EFNA5, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for EFNA5.
  • Figure 31 Analysis for EFNA5 gene in cBioPortal, using a curated set of studies with 48870 patient samples (as of June 2021). Legend shown above the graph indicates the type of mutation observed, while on the X axis each study is labelled with the cancer type that was investigated.
  • Figure 32 (A) Representative images for three repeats (200 cells were seeded per well) and (B) quantification (mean with SD) of a clonogenic assay for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for ZBTB7A, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for ZBTB7A.
  • NT non-targeting
  • ZBTB7A Quantification (mean with SD) of a clonogenic assay for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for ZBTB7A, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sg
  • C Viability assay with Cell Titer Gio for eHAP iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for ZBTB7A, EXO1 KO clone 11 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 11 with integrated sgRNA for ZBTB7A.
  • Figure 33 Analysis for ZBTB7A gene in cBioPortal, using a curated set of studies with 48870 patient samples (as of June 2021). Legend shown above the graph indicates the type of mutation observed, while on the X axis each study is labelled with the cancer type that was investigated.
  • Figure 34 Validation of EXO1 KO cell lines in HeLa Kyoto iCas9 background.
  • A immunoblots for EXO1 and alpha-tubulin (loading control) of wild type clone 13, EXO1 KO clone 1.2 and EXO1 KO clone 2.19
  • B sensitivity of HeLa Kyoto iCas9 EXO1 KO clones 1.2 and 2.19 to MMS
  • C sensitivity of HeLa Kyoto iCas9 EXO1 KO clones 1.2 and 2.19 to ATMi (KU55933)
  • D sensitivity of HeLa Kyoto iCas9 EXO1 KO clones 1.2 and 2.19 to Olaparib.
  • Figure 35 Synthetic lethality between EXO1 and FANCG in HeLa Kyoto iCas9 background.
  • A Representative images for three repeats (200 cells were seeded per well) and
  • B quantification (mean with SD) of a clonogenic assay for HeLa Kyoto iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for FANCG, EXO1 KO clone 2.19 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 2.19 with integrated sgRNA for FANCG.
  • NT non-targeting
  • Figure 36 Synthetic lethality between EXO1 and APITD1/MHF1 in HeLa Kyoto iCas9 background.
  • A Representative images for three repeats (200 cells were seeded per well) and
  • B quantification (mean with SD) of a clonogenic assay for HeLa Kyoto iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for APITD1/MHF1 , EXO1 KO clone 2.19 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 2.19 with integrated sgRNA for APITD1/MHF1.
  • Figure 37 Synthetic lethality between EXO1 and BRCC3/BRCC36 in HeLa Kyoto iCas9 background.
  • A Representative images for three repeats (200 cells were seeded per well) and
  • B quantification (mean with SD) of a clonogenic assay for HeLa Kyoto iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for BRCC3/BRCC36, EXO1 KO clone 2.19 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 2.19 with integrated sgRNA for BRCC3/BRCC36.
  • Figure 38 Synthetic lethality between EXO1 and ZRSR2 in HeLa Kyoto iCas9 background.
  • A Representative images for three repeats (200 cells were seeded per well) and
  • B quantification (mean with SD) of a clonogenic assay for HeLa Kyoto iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for ZRSR2, EXO1 KO clone 2.19 with integrated non-targeting (NT) sgRNA, and EXO1 KO clone 2.19 with integrated sgRNA for ZRSR2.
  • NT non-targeting
  • ZRSR2 Quantification (mean with SD) of a clonogenic assay for HeLa Kyoto iCas9 cells: wild type with integrated non-targeting (NT) sgRNA, wild type with integrated sgRNA for ZRSR2, EXO1 KO clone 2.19 with integrated non-targeting (NT)
  • Figure 39 Additional/synergistic sensitivity of EXO1 KO and FANCG KO double KO to cancer chemotherapeutics.
  • A Survival of inducible double KO cell line with EXO1 KO and FANCG sgRNA in the presence of camptothecin, comparison to the wild type cells with nontargeting sgRNA, EXO1 KO cells with non-targeting sgRNA, and wild type cells with FANCG sgRNA;
  • B survival in the presence of cisplatin;
  • C survival in the presence of Olaparib;
  • D survival in the presence of veliparib.
  • Each experiment was performed in three independent biological repeats, fitting with a logistic function.
  • Figure 40 Additional/synergistic sensitivity of EXO1 KO and APITD1/MHF1 KO double KO to cancer chemotherapeutics.
  • A Survival of inducible double KO cell line with EXO1 KO and APITD1 sgRNA in the presence of camptothecin, comparison to the wild type cells with non-targeting sgRNA, EXO1 KO cells with non-targeting sgRNA, and wild type cells with APITD1 sgRNA;
  • B survival in the presence of cisplatin;
  • C survival in the presence of Olaparib;
  • D survival in the presence of veliparib.
  • Each experiment was performed in three independent biological repeats, fitting with a logistic function.
  • Figure 41 Additional/synergistic sensitivity of EXO1 KO and BRCC3 KO double KO to cancer chemotherapeutics.
  • A Survival of inducible double KO cell line with EXO1 KO and BRCC3 sgRNA in the presence of camptothecin, comparison to the wild type cells with nontargeting sgRNA, EXO1 KO cells with non-targeting sgRNA, and wild type cells with BRCC3 sgRNA;
  • B survival in the presence of veliparib.
  • Each experiment was performed in three independent biological repeats, fitting with a logistic function.
  • Figure 42 Additional/synergistic sensitivity of EXO1 KO and ZRSR2 KO double KO to cancer chemotherapeutics;
  • A Survival of inducible double KO cell line with EXO1 KO and ZRSR2 sgRNA in the presence of camptothecin, comparison to the wild type cells with nontargeting sgRNA, EXO1 KO cells with non-targeting sgRNA, and wild type cells with ZRSR2 sgRNA;
  • B survival in the presence of cisplatin;
  • C survival in the presence of Olaparib;
  • D survival in the presence of veliparib.
  • Each experiment was performed in three independent biological repeats, fitting with a logistic function.
  • Figure 43 Additive/synergistic sensitivity to Olaparib in HeLa Kyoto iCas9 background: (A) for inducible double KO cell line of EXO1 KO and FANCG KO, (B) for inducible double KO cell line of EXO1 KO and APITD1/MHF1 KO, (C) for inducible double KO cell line of EXO1 KO and BRCC3/BRCC36 KO, (D) for inducible double KO cell line of EXO1 KO and ZRSR2 KO. Each experiment was performed in three independent biological repeats, fitting with a logistic function.
  • a method for determining the suitability of an EXO1 inhibitor for the treatment of cancer in a subject comprising detecting the presence of genetic loss or attenuation and/or loss or attenuation of expression of one or more genes selected from: a gene which encodes a Fanconi Anemia core complex protein, a gene which encodes a FANCM complex protein, a gene which encodes a BRCA1- A complex protein, ZRSR2, CDK11 B, LY6G6D, CYBA, EFNA5, or ZBTB7A, in a biological sample obtained from said subject.
  • the invention has the potential to provide an optimised cancer treatment with an EX01 inhibitor by targeting subjects with genetic loss or attenuation and/or loss or attenuation of expression within genes which are synthetic lethal with EXO1 .
  • references herein to “attenuation of expression” refer to a reduction in protein expression and consequently a reduction in protein function.
  • attenuation of expression is a reduction in protein expression. It will be appreciated that such a reduction in protein expression will be required to be one which is reliable, repeatable and ideally observable in a protein expression quantification technique, such as Western blotting.
  • the reduction in protein expression will be at least a 50% reduction in protein expression. Further examples of typical reductions in protein expression will be at least 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98 or 99%, or any ranges of any values therebetween.
  • Attenuation of expression is a reduction in protein function.
  • the reduction in protein expression results in a reduction in protein function.
  • a reduction in protein function will be at least a 50% reduction in protein function.
  • Further examples of typical reductions in protein function will be at least 55, 60, 65, 70, 75, 80, 85, 90, 95, 96, 97, 98 or 99%, or any ranges of any values therebetween.
  • the method described herein comprises detecting the presence of genetic loss or attenuation of one or more of said genes.
  • the genetic loss or attenuation is a genetic loss- or attenuation-of- function mutation or deletion i.e., a mutation or deletion that results in reduced or abolished protein function.
  • the method described herein comprises detecting the presence of loss or attenuation of expression of one or more of said genes.
  • Fanconi Anemia core complex protein refers to the Fanconi Anemia proteins (FANCA, -B, -C, -E, -F, -G, -L, and FAAP20) and any associated factors which form the Fanconi Anemia core complex required for mono-ubiquitination of FANCD2-FANCI dimer on DNA damage.
  • the gene which encodes a Fanconi Anemia core complex protein is selected from any one of FANCB, FANCC, FANCE, FANCF, FANCG, FANCL, or FAAP20 (C1orf86).
  • FANCB includes “FA complementation group B”.
  • the FANCB is human FANCB. Wild type human FANCB is identified by NCBI Gene ID: 2187.
  • FANCC includes “FA complementation group C”.
  • the FANCC is human FANCC. Wild type human FANCC is identified by NCBI Gene ID: 2176.
  • FANCE includes “FA complementation group E”.
  • the FANCE is human FANCE. Wild type human FANCE is identified by NCBI Gene ID: 2178.
  • FANCF includes “FA complementation group F”.
  • the FANCF is human FANCF. Wild type human FANCF is identified by NCBI Gene ID: 2188.
  • FANCG includes “FA complementation group G”.
  • the FANCG is human FANCG. Wild type human FANCG is identified by NCBI Gene ID: 2189.
  • FANCL includes “FA complementation group L”.
  • the FANCL is human FANCL. Wild type human FANCL is identified by NCBI Gene ID: 55120.
  • FAAP20 includes “FA core complex associated protein 20” and “C1orf86”.
  • the FAAP20 is human FAAP20. Wild type human FAAP20 is identified by NCBI Gene ID: 199990.
  • FANCM complex protein refers to FANCM and proteins which form a complex with FANCM, including but not limited to FAAP24, APITD1 , and STRA13.
  • the gene which encodes a FANCM complex protein is selected from any one of FAAP24 (C19orf40), APITD1 (MHF1), STRA13 (MHF2), or FANCM.
  • FANCM includes “FA complementation group M”.
  • the FANCM is human FANCM. Wild type human FANCM is identified by NCBI Gene ID: 57697. References herein to “FAAP24” includes “FA core complex associated protein 24” and “C19orf40”. In one embodiment, the FAAP24 is human FAAP24. Wild type human FAAP24 is identified by NCBI Gene ID: 91442.
  • APITD1 includes “MHF1”, “CENPS” and “centromere protein S”.
  • the APITD1 is human APITD1. Wild type human APITD1 is identified by NCBI Gene ID: 378708.
  • STRA13 includes “MHF2”, “CENPX” and “centromere protein X”.
  • the STRA13 is human STRA13. Wild type human STRA13 is identified by NCBI Gene ID: 201254.
  • BRCA1-A complex protein refers to the proteins of the BRCA1-A complex composed of ubiquitin interacting motif containing protein RAP80, adapter protein FAM175A (Abraxasl), BABAM1 (MERIT40), BRCC45, and deubiquitylating enzyme BRCC3 (BRCC36).
  • the gene which encodes a BRCA1-A complex protein is any one of BABAM1 (MERIT40), FAM175A (Abraxasl) or BRCC3 (BRCC36).
  • BABAM1 includes “BRISC and BRCA1 A complex member 1” and “MERIT40”.
  • the BABAM1 is human BABAM1. Wild type human BABAM1 is identified by NCBI Gene ID: 29086.
  • FAM175A includes “ABRAXAS1” and “BRCA1 A complex subunit”.
  • the FAM175A is human FAM175A. Wild type human FAM175A is identified by NCBI Gene ID: 84142.
  • BRCC3 includes “BRCA1/BRCA2-containing complex subunit 3” and “BRCC36”.
  • the BRCC3 is human BRCC3. Wild type human BRCC3 is identified by NCBI Gene ID: 79184.
  • the genetic loss or attenuation and/or loss or attenuation of expression is in at least one of FAAP24 (C19orf40), FANCG, APITD1 (MHF1), FAM175A (Abraxasl), BRCC3 (BRCC36), ZRSR2, CDK11 B, LY6G6D, CYBA, EFNA5 and ZBTB7A.
  • ZRSR2 includes “zinc finger CCCH-type, RNA binding motif and serine/arginine rich 2”.
  • the ZRSR2 is human ZRSR2.
  • Wild type human ZRSR2 is identified by NCBI Gene ID: 8233.
  • References herein to “CDK11 B” includes “cyclin dependent kinase 11 B”.
  • the CDK11 B is human CDK11 B. Wild type human CDK11 B is identified by NCBI Gene ID: 984.
  • LY6G6D includes “lymphocyte antigen 6 family member G6D”.
  • the LY6G6D is human LY6G6D. Wild type human LY6G6D is identified by NCBI Gene ID: 58530.
  • CYBA includes “cytochrome b-245 alpha chain”.
  • the CYBA is human CYBA. Wild type human CYBA is identified by NCBI Gene ID: 1535.
  • EFNA5 includes “ephrin A5”.
  • the EFNA5 is human EFNA5. Wild type human EFNA5 is identified by NCBI Gene ID: 1946.
  • ZBTB7A includes “zinc finger and BTB domain containing 7A”.
  • the ZBTB7A is human ZBTB7A. Wild type human ZBTB7A is identified by NCBI Gene ID: 51341.
  • detecting the presence of genetic loss or attenuation of one or more of said genes comprises detecting the presence of a variant nucleic acid sequence.
  • references herein to a “variant nucleic acid sequence” includes any variation in the native, non-mutant or wild type genetic code of the gene. Examples of such genetic variations include: mutations (e.g., point mutations), substitutions, deletions, single nucleotide polymorphisms (SNPs), haplotypes, chromosome abnormalities, Copy Number Variation (CNV), DNA inversions, or gene amplification. Genetic variations may be in a coding or non-coding region of the nucleic acid sequence. Mutations in the coding region of the gene encoding the component may prevent the translation of full-length active protein i.e.
  • Mutations in non-coding regions of the gene encoding the component, for example, in a regulatory element, may prevent transcription of the gene.
  • a nucleic acid comprising one or more sequence variations may encode a variant polypeptide which has reduced or abolished activity or may encode a wild-type polypeptide which has little or no expression within the cell, for example through the altered activity of a regulatory element.
  • a nucleic acid comprising one or more sequence variations may have one or more mutations or polymorphisms relative to the wild-type sequence.
  • Detection of the presence of a variant nucleic acid sequence may be achieved by various methods including DNA or RNA sequencing, sequencing by hybridisation, mutation scanning techniques, hybridisation-based techniques, extension-based techniques, incorporationbased techniques, restriction-enzyme based techniques and ligation-based techniques.
  • Mutation scanning techniques include but are not limited to, protein truncation test (PTT), single-strand conformation polymorphism analysis (SSCP), denaturing gradient gel electrophoresis (DGGE), temperature gradient gel electrophoresis (TGGE), cleavase, heteroduplex analysis, chemical mismatch cleavage (CMC) and enzymatic mismatch cleavage.
  • PTT protein truncation test
  • SSCP single-strand conformation polymorphism analysis
  • DGGE denaturing gradient gel electrophoresis
  • TGGE temperature gradient gel electrophoresis
  • CMC chemical mismatch cleavage
  • enzymatic mismatch cleavage enzymatic mismatch cleavage.
  • hybridisation-based techniques include but are not limited to, dot blots, reverse dot blots, multiple allele specific diagnostic assay (MASDA), oligonucleotide arrays, TaqmanTM, and molecular beacons.
  • MASDA multiple allele specific diagnostic assay
  • Extension-based techniques include but are not limited to, ARMSTM, ALEXTM and competitive oligonucleotide priming system (COPS).
  • ARMSTM ALEXTM
  • COPS competitive oligonucleotide priming system
  • incorporation-based techniques include, but are not limited to, minisequencing and arrayed primer extension (APEX).
  • restriction enzyme-based techniques include but are not limited to restriction fragment length polymorphism (RFLP), and restriction site generating polymerase chain reaction (PCR).
  • ligation-based techniques include but are not limited to oligonucleotide ligation assay (OLA). Epigenetic modifications
  • detecting the presence of loss or attenuation of expression of one or more of said genes comprises detection of epigenetic modifications, such as DNA methylation or histone modifications including histone acetylation, deacetylation, methylation, ubiquitylation, phosphorylation, or sumoylation.
  • epigenetic modifications such as DNA methylation or histone modifications including histone acetylation, deacetylation, methylation, ubiquitylation, phosphorylation, or sumoylation.
  • Detection of epigenetic modifications such as DNA methylation or histone modification may be achieved by various methods including, but not limited to, high-performance liquid chromatography (HPLC), bisulfite sequencing, CpG island microarrays, mass spectrometry, or chromatin immunoprecipitation (ChIP) followed by hybridization to microarrays (ChlP-chip) or by high-throughput sequencing (ChlP-seq).
  • HPLC high-performance liquid chromatography
  • bisulfite sequencing CpG island microarrays
  • mass spectrometry mass spectrometry
  • ChIP chromatin immunoprecipitation
  • ChIP chromatin immunoprecipitation
  • ChlP-chip hybridization to microarrays
  • ChlP-seq high-throughput sequencing
  • detecting the presence of loss or attenuation of expression of one or more of said genes comprises detecting and/or quantifying the presence of a polypeptide encoded by said one or more genes.
  • the polypeptide may be directly detected, e.g., by SELDI or MALDI-TOF.
  • the polypeptide may be detected directly or indirectly via interaction with a ligand or ligands such as an antibody or a biomarker-binding fragment thereof, or other peptide, or ligand, e.g., aptamer, or oligonucleotide, capable of specifically binding the polypeptide.
  • the ligand may possess a detectable label, such as a luminescent, fluorescent or radioactive label, and/or an affinity tag.
  • detecting and/or quantifying can be performed by one or more method(s) selected from the group consisting of: mass spectrometry (MS), SELDI (-TOF), MALDI (-TOF), 1-D gel-based analysis, 2-D gel-based analysis, NMR (nuclear magnetic resonance) spectroscopy and chromatography.
  • chromatography techniques include reverse phase, size permeation (gel filtration), thin-layer, ion exchange, affinity, high pressure liquid chromatography (HPLC), Ultra Performance Liquid Chromatography (UPLC) and other liquid chromatography (LC) or LC MS-based techniques.
  • Appropriate LC MS techniques include ICAT® (Applied Biosystems, CA, USA), or iTRAQ® (Applied Biosystems, CA, USA).
  • Detecting and/or quantifying the polypeptide may be performed using an immunological method, involving an antibody, or a fragment thereof capable of specific binding to the polypeptide.
  • Suitable immunological methods include sandwich immunoassays, such as sandwich ELISA, in which the detection of the polypeptide is performed using two antibodies which recognize different epitopes on a biomarker; radioimmunoassays (RIA), direct, indirect or competitive enzyme linked immunosorbent assays (ELISA), enzyme immunoassays (EIA), fluorescence immunoassays (FIA), protein immunoblotting (western blotting), immunoprecipitation and any particle-based immunoassay (e.g. using gold, silver, or latex particles, magnetic particles, or Q-dots).
  • Immunological methods may be performed, for example, in microtitre plate or strip format.
  • the genetic loss or attenuation may be a genetic loss- or attenuation-of-function mutation or deletion i.e., a mutation or deletion that results in reduced or abolished protein function. Detection of the genetic loss or attenuation in a gene may therefore also be achieved by measuring the function of the polypeptide which is encoded by said gene. It will be appreciated that measurement of protein function can be achieved by various methods depending on the function of the protein. Examples include assays which measure nuclease activity, ubiquitin ligase activity, or deubiquitylase activity.
  • biological sample includes cerebrospinal fluid (CSF), whole blood, blood serum, plasma, urine, saliva, or other bodily fluid (stool, tear fluid, synovial fluid, sputum), breath, e.g., as condensed breath, or an extract or purification therefrom, or dilution thereof.
  • CSF cerebrospinal fluid
  • Biological samples also include tissue homogenates, tissue sections and biopsy specimens from a live subject, or taken post-mortem. The samples can be prepared, for example where appropriate diluted or concentrated, and stored in the usual manner.
  • EXOT includes “Exonucleasel”. Wild type EXO1 is identified by NCBI Accession Number: AAN39382 and examples of X-ray crystallographic structures for EXO1 are defined with PDB Numbers: 3QE9, 3QEA and 3QEB. In one embodiment, the EXO1 is human EXOI .
  • EXO1 inhibitor examples include an agent capable of causing a reduction in functional activity of EXO1 , for example a decrease in enzymatic activity which may be partial or complete, when compared to a control, such as in the absence of said agent or an inactive agent.
  • suitable EXO1 inhibitors are described in WO 2017/051251.
  • cancers examples include: human cancers and carcinomas, sarcomas, adenocarcinomas, lymphomas, leukemias, such as solid and lymphoid cancers, kidney, breast, lung, bladder, colon, ovarian, prostate, pancreas, stomach, brain, head and neck, skin, uterine, testicular, glioma, esophagus, and liver cancer, including hepatocarcinoma, lymphoma, including B- acute lymphoblastic lymphoma, non-Hodgkin's lymphomas (e.g., Burkitt's, Small Cell, and Large Cell lymphomas), Hodgkin's lymphoma, leukemia (including AML, ALL, and CML), or multiple myeloma.
  • human cancers and carcinomas sarcomas
  • adenocarcinomas such as solid and lymphoid cancers
  • cancers examples include prostate cancer, colorectal cancer, pancreatic cancer, cervical cancer, gastric cancer, ovarian cancer, lung cancer, and cancer of the head.
  • the cancer is selected from: cancer of the thyroid, endocrine system, brain, breast, cervix, colon, head & neck, liver, kidney, lung, non-small cell lung, melanoma, mesothelioma, ovary, sarcoma, stomach, uterus, Medulloblastoma, colorectal cancer, and pancreatic cancer.
  • the cancer is selected from: Hodgkin's Disease, Non-Hodgkin's Lymphoma, multiple myeloma, neuroblastoma, glioma, glioblastoma multiforme, ovarian cancer, rhabdomyosarcoma, primary thrombocytosis, primary macroglobulinemia, primary brain tumors, cancer, malignant pancreatic insulanoma, malignant carcinoid, urinary bladder cancer, premalignant skin lesions, testicular cancer, lymphomas, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, endometrial cancer, adrenal cortical cancer, neoplasms of the endocrine or exocrine pancreas, medullary thyroid cancer, medullary thyroid carcinoma, melanoma, colorectal cancer, papillary thyroid cancer, hepatocellular carcinoma, and prostate cancer.
  • leukemia include progressive, malignant diseases of the blood- forming organs and is generally characterized by a distorted proliferation and development of leukocytes and their precursors in the blood and bone marrow.
  • Leukemia is generally clinically classified on the basis of (1) the duration and character of the disease-acute or chronic; (2) the type of cell involved; myeloid (myelogenous), lymphoid (lymphogenous), or monocytic; and (3) the increase or non-increase in the number abnormal cells in the blood- leukemic or aleukemic (subleukemic).
  • the leukemia is selected from: acute nonlymphocytic leukemia, chronic lymphocytic leukemia, acute granulocytic leukemia, chronic granulocytic leukemia, acute promyelocytic leukemia, adult T-cell leukemia, aleukemic leukemia, a leukocythemic leukemia, basophylic leukemia, blast cell leukemia, bovine leukemia, chronic myelocytic leukemia, leukemia cutis, embryonal leukemia, eosinophilic leukemia, Gross' leukemia, hairy-cell leukemia, hemoblastic leukemia, hemocytoblastic leukemia, histiocytic leukemia, stem cell leukemia, acute monocytic leukemia, leukopenic leukemia, lymphatic leukemia, lymphoblastic leukemia, lymphocytic leukemia, lymphogenous leukemia, lymphoid leukemia, lymphosarcoma
  • sarcoma include a tumor which is made up of a substance like the embryonic connective tissue and is generally composed of closely packed cells embedded in a fibrillar or homogeneous substance.
  • the sarcoma is selected from: chondrosarcoma, fibrosarcoma, lymphosarcoma, melanosarcoma, myxosarcoma, osteosarcoma, Abernethy's sarcoma, adipose sarcoma, liposarcoma, alveolar soft part sarcoma, ameloblastic sarcoma, botryoid sarcoma, chloroma sarcoma, chorio carcinoma, embryonal sarcoma, Wilms' tumor sarcoma, endometrial sarcoma, stromal sarcoma, Ewing's sarcoma, fascial sarcoma, fibroblastic sarcoma
  • melanoma include a tumor arising from the melanocytic system of the skin and other organs.
  • the melanoma is selected from: acral-lentiginous melanoma, amelanotic melanoma, benign juvenile melanoma, Cloudman's melanoma, S91 melanoma, Harding-Passey melanoma, juvenile melanoma, lentigo maligna melanoma, malignant melanoma, nodular melanoma, subungal melanoma, and superficial spreading melanoma.
  • carcinoma include a malignant new growth made up of epithelial cells tending to infiltrate the surrounding tissues and give rise to metastases.
  • the carcinoma is selected from: medullary thyroid carcinoma, familial medullary thyroid carcinoma, acinar carcinoma, acinous carcinoma, adenocystic carcinoma, adenoid cystic carcinoma, carcinoma adenomatosum, carcinoma of adrenal cortex, alveolar carcinoma, alveolar cell carcinoma, basal cell carcinoma, carcinoma basocellulare, basaloid carcinoma, basosquamous cell carcinoma, bronchioalveolar carcinoma, bronchiolar carcinoma, bronchogenic carcinoma, cerebriform carcinoma, cholangiocellular carcinoma, chorionic carcinoma, colloid carcinoma, comedo carcinoma, corpus carcinoma, cribriform carcinoma, carcinoma en cuirasse, carcinoma cutaneum, cylindrical carcinoma, cylindrical cell carcinoma, duct carcinoma, carcinoma durum, embryonal carcinoma, encephaloid carcinoma, epiermoid carcinoma, carcinoma epitheliale aden
  • the EXO1 inhibitor While it is possible for the EXO1 inhibitor to be administered alone, it is preferable to present it as a pharmaceutical composition (e.g., formulation). In one embodiment this is a sterile pharmaceutical composition.
  • the present invention further provides pharmaceutical compositions, as defined above, and methods of making a pharmaceutical composition comprising (e.g. admixing) at least one EXO1 inhibitor, together with one or more pharmaceutically acceptable excipients and optionally other therapeutic or prophylactic agents, as described herein.
  • the pharmaceutically acceptable excipient(s) can be selected from, for example, carriers (e.g. a solid, liquid or semi-solid carrier), adjuvants, diluents, fillers or bulking agents, granulating agents, coating agents, release-controlling agents, binding agents, disintegrants, lubricating agents, preservatives, antioxidants, buffering agents, suspending agents, thickening agents, flavouring agents, sweeteners, taste masking agents, stabilisers or any other excipients conventionally used in pharmaceutical compositions.
  • carriers e.g. a solid, liquid or semi-solid carrier
  • adjuvants e.g. a solid, liquid or semi-solid carrier
  • pharmaceutically acceptable refers to compounds, materials, compositions, and/or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of a subject (e.g., human) without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio.
  • a subject e.g., human
  • Each carrier, excipient, etc. must also be “acceptable” in the sense of being compatible with the other ingredients of the formulation.
  • compositions containing EXO1 inhibitors can be formulated in accordance with known techniques, see for example, Remington’s Pharmaceutical Sciences, Mack Publishing Company, Easton, PA, USA.
  • compositions can be in any form suitable for oral, parenteral, topical, intranasal, intrabronchial, sublingual, ophthalmic, otic, rectal, intra-vaginal, or transdermal administration.
  • compositions are intended for parenteral administration, they can be formulated for intravenous, intramuscular, intraperitoneal, subcutaneous administration or for direct delivery into a target organ or tissue by injection, infusion or other means of delivery.
  • the delivery can be by bolus injection, short term infusion or longer-term infusion and can be via passive delivery or through the utilisation of a suitable infusion pump or syringe driver.
  • EXO1 inhibitors will generally be presented in unit dosage form and, as such, will typically contain sufficient compound to provide a desired level of biological activity.
  • a formulation may contain from 1 nanogram to 2 grams of active ingredient, e.g., from 1 nanogram to 2 milligrams of active ingredient.
  • particular sub-ranges of compound are 0.1 milligrams to 2 grams of active ingredient (more usually from 10 milligrams to 1 gram, e.g., 50 milligrams to 500 milligrams), or 1 microgram to 20 milligrams (for example 1 microgram to 10 milligrams, e.g., 0.1 milligrams to 2 milligrams of active ingredient).
  • a unit dosage form may contain from 1 milligram to 2 grams, more typically 10 milligrams to 1 gram, for example 50 milligrams to 1 gram, e.g., 100 milligrams to 1 gram, of active compound.
  • the active compound will be administered to a patient in need thereof (for example a human or animal patient) in an amount sufficient to achieve the desired therapeutic effect.
  • a method for the treatment of cancer in a subject comprising determining the suitability of an EXO1 inhibitor for the treatment of cancer according to the method as described herein; and administering an effective amount of an EXO1 inhibitor to the subject if genetic loss or attenuation and/or loss or attenuation of expression is detected.
  • the EXO1 inhibitor is generally administered to a subject in need of such administration, for example a human or animal patient, particularly a human.
  • the EXO1 inhibitor will typically be administered in amounts that are therapeutically or prophylactically useful and which generally are non-toxic. However, in certain situations (for example in the case of life-threatening diseases), the benefits of administering the EXO1 inhibitor may outweigh the disadvantages of any toxic effects or side effects, in which case it may be considered desirable to administer compounds in amounts that are associated with a degree of toxicity.
  • the EXO1 inhibitors may be administered over a prolonged term to maintain beneficial therapeutic effects or may be administered for a short period only. Alternatively, they may be administered in a continuous manner or in a manner that provides intermittent dosing (e.g., a pulsatile manner).
  • a typical daily dose of the EXO1 inhibitor can be in the range from 100 picograms to 100 milligrams per kilogram of body weight, more typically 5 nanograms to 25 milligrams per kilogram of bodyweight, and more usually 10 nanograms to 15 milligrams per kilogram (e.g. 10 nanograms to 10 milligrams, and more typically 1 microgram per kilogram to 20 milligrams per kilogram, for example 1 microgram to 10 milligrams per kilogram) per kilogram of bodyweight although higher or lower doses may be administered where required.
  • the EXO1 inhibitor can be administered on a daily basis or on a repeat basis every 2, or 3, or 4, or 5, or 6, or 7, or 10 or 14, or 21 , or 28 days for example.
  • the EXO1 inhibitor may be administered orally in a range of doses, for example 1 to 1500 mg, 2 to 800 mg, or 5 to 500 mg, e.g., 2 to 200 mg or 10 to 1000 mg, particular examples of doses including 10, 20, 50 and 80 mg.
  • the EXO1 inhibitor may be administered once or more than once each day.
  • the EXO1 inhibitor can be administered continuously (i.e. , taken every day without a break for the duration of the treatment regimen).
  • the EXO1 inhibitor can be administered intermittently (i.e. , taken continuously for a given period such as a week, then discontinued for a period such as a week and then taken continuously for another period such as a week and so on throughout the duration of the treatment regimen).
  • treatment regimens involving intermittent administration include regimens wherein administration is in cycles of one week on, one week off; or two weeks on, one week off; or three weeks on, one week off; or two weeks on, two weeks off; or four weeks on two weeks off; or one week on three weeks off - for one or more cycles, e.g., 2, 3, 4, 5, 6, 7, 8, 9 or 10 or more cycles.
  • a patient will be given an infusion of the EXO1 inhibitor for periods of one hour daily for up to ten days in particular up to five days for one week, and the treatment repeated at a desired interval such as two to four weeks, in particular every three weeks.
  • a patient may be given an infusion of a compound of the formula (I) for periods of one hour daily for 5 days and the treatment repeated every three weeks.
  • a patient is given an infusion over 30 minutes to 1 hour followed by maintenance infusions of variable duration, for example 1 to 5 hours, e.g., 3 hours.
  • a patient is given a continuous infusion for a period of 12 hours to 5 days, an in particular a continuous infusion of 24 hours to 72 hours.
  • a patient is given the compound orally once a week.
  • a patient is given the compound orally once-daily for between 7 and 28 days such as 7, 14 or 28 days.
  • a patient is given the compound orally once-daily for 1 day, 2 days, 3 days, 5 days or 1 week followed by the required amount of days off to complete a one or two week cycle.
  • a patient is given the compound orally once-daily for 2 weeks followed by 2 weeks off.
  • a patient is given the compound orally once-daily for 2 weeks followed by 1 week off.
  • a patient is given the compound orally once-daily for 1 week followed by 1 week off.
  • the quantity of compound administered and the type of composition used will be commensurate with the nature of the disease or physiological condition being treated and will be at the discretion of the physician.
  • EXO1 inhibitors can be used as a single agent or in combination with other anticancer agents.
  • Combination experiments can be performed, for example, as described in Chou TC, Talalay P. Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors. Adv Enzyme Regulat 1984;22: 27-55.
  • the EXO1 inhibitors as defined herein can be administered as the sole therapeutic agent or they can be administered in combination therapy with one of more other compounds (or therapies) for treatment of a particular disease state, for example a neoplastic disease such as a cancer as hereinbefore defined.
  • the EXO1 inhibitors may be advantageously employed in combination with one or more other medicinal agents, more particularly, with other anti-cancer agents or adjuvants (supporting agents in the therapy) in cancer therapy.
  • Examples of other therapeutic agents or treatments that may be administered together (whether concurrently or at different time intervals) with the EXO1 inhibitors include but are not limited to:
  • the method of treatment as described herein additionally comprises administering an effective amount of a chemotherapeutic in combination with the EXO1 inhibitor.
  • chemotherapeutics or adjuvants include but are not limited to any of the agents selected from groups (i)-(xlvi) below:
  • Platinum compounds for example cisplatin (optionally combined with amifostine), carboplatin or oxaliplatin;
  • Taxane compounds for example paclitaxel, paclitaxel protein bound particles (AbraxaneTM), docetaxel, cabazitaxel or larotaxel;
  • Topoisomerase I inhibitors for example camptothecin compounds, for example camptothecin, irinotecan(CPT11), SN-38, or topotecan;
  • Topoisomerase II inhibitors for example anti-tumour epipodophyllotoxins or podophyllotoxin derivatives for example etoposide, or teniposide;
  • Vinca alkaloids for example vinblastine, vincristine, liposomal vincristine (Onco-TCS), vinorelbine, vindesine, vinflunine or vinvesir;
  • Nucleoside derivatives for example 5-fluorouracil (5-Fll, optionally in combination with leucovorin), gemcitabine, capecitabine, tegafur, UFT, S1 , cladribine, cytarabine (Ara-C, cytosine arabinoside), fludarabine, clofarabine, or nelarabine;
  • Antimetabolites for example clofarabine, aminopterin, or methotrexate, azacitidine, cytarabine, floxuridine, pentostatin, thioguanine, thiopurine, 6-mercaptopurine, or hydroxyurea (hydroxycarbamide);
  • Alkylating agents such as nitrogen mustards or nitrosourea, for example cyclophosphamide, chlorambucil, carmustine (BCNll), bendamustine, thiotepa, melphalan, treosulfan, lomustine (CCNll), altretamine, busulfan, dacarbazine, estramustine, fotemustine, ifosfamide (optionally in combination with mesna), pipobroman, procarbazine, streptozocin, temozolomide, uracil, mechlorethamine, methylcyclohexylchloroethylnitrosurea, or nimustine (ACNll); (ix) Anthracyclines, anthracenediones and related drugs, for example daunorubicin, doxorubicin (optionally in combination with dexrazoxane), liposomal formulations of doxorubicin (e
  • Epothilones for example ixabepilone, patupilone, BMS-310705, KOS-862 and ZK-EPO, epothilone A, epothilone B, desoxyepothilone B (also known as epothilone D or KOS- 862), aza-epothilone B (also known as BMS-247550), aulimalide, isolaulimalide, or luetherobin;
  • DNA methyl transferase inhibitors for example temozolomide, azacytidine or decitabine, or SGI-110;
  • Antifolates for example methotrexate, pemetrexed disodium, or raltitrexed
  • Cytotoxic antibiotics for example antinomycin D, bleomycin, mitomycin C, dactinomycin, carminomycin, daunomycin, levamisole, plicamycin, or mithramycin;
  • Tubulin-binding agents for example combrestatin, colchicines or nocodazole;
  • EGFR epidermal growth factor receptor
  • VEGFR vascular endothelial growth factor receptor
  • PDGFR platelet-derived growth factor receptor
  • MTKI multi target kinase inhibitors
  • Raf inhibitors mTOR inhibitors for example imatinib mesylate, erlotinib, gefitinib, dasatinib, lapatinib, dovotinib, axitinib, nilotinib, vandetanib, vatalinib, pazopanib, sorafenib, sunitinib, temsirolimus, everolimus (RAD 001), vemurafenib (PLX4032/RG7204), dabrafenib, encorafenib or an IKB kinase inhibitor such as SAR- 113945, bardox
  • Aurora kinase inhibitors for example AT9283, barasertib (AZD1152), TAK-901 , MK0457 (VX680), cenisertib (R-763), danusertib (PHA-739358), alisertib (M LN-8237), or MP- 470;
  • CDK inhibitors for example AT7519, roscovitine, seliciclib, alvocidib (flavopiridol), dinaciclib (SCH-727965), 7-hydroxy-staurosporine (UCN-01), JNJ-7706621 , BMS- 387032 (a.k.a. SNS-032), PHA533533, PD332991 , ZK-304709, or AZD-5438;
  • AKT inhibitors such as KRX-0401 (perifosine/ NSC 639966), ipatasertib (GDC-0068; RG-7440), afuresertib (GSK-2110183; 2110183), MK-2206, MK-8156, AT13148, AZD-5363, triciribine phosphate (VQD-002; triciribine phosphate monohydrate (API-2; TCN-P; TCN-PM; VD- 0002), RX-0201, NL-71-101 , SR-13668, PX-316, AT13148, AZ-5363, Semaphore, SF1126, or Enzastaurin HCI (LY317615) or MTOR inhibitors such as rapamycin analogues such as RAD 001 (everolimus), CCI 779 (temsirolemus), AP
  • CBP-501 forkhead translocation inhibitors
  • enzastaurin HCI LY317615
  • PI3K Inhibitors such as dactolisib (BEZ235), buparlisib (BKM-120; NVP- BKM-120), BYL719, copanlisib (BAY-80-6946), ZSTK-474, CUDC-907, apitolisib (GDC- 0980; RG-7422), pictilisib (pictrelisib, GDC-0941, RG-7321), GDC-0032, GDC-0068, GSK-2636771, idelalisib (formerly CAL-101, GS 1101 , GS-1101), MLN1117 (INK1117), MLN0128 (INK128), IPI-145 (INK1197), LY-3023414, ipatasertib, afuresertib, MK-2206,
  • Hsp90 inhibitors for example AT13387, herbimycin, geldanamycin (GA), 17-allylamino- 17-desmethoxygeldanamycin (17-AAG) e.g. NSC-330507, Kos-953 and CNF-1010, 17- dimethylaminoethylamino-17-demethoxygeldanamycin hydrochloride (17-DMAG) e.g. NSC-707545 and Kos-1022, NVP-AUY922 (VER-52296), NVP-BEP800, CNF-2024 (BIIB-021 an oral purine), ganetespib (STA-9090), SNX-5422 (SC-102112) or IPI-504;
  • Monoclonal Antibodies (unconjugated or conjugated to radioisotopes, toxins or other agents), antibody derivatives and related agents, such as anti-CD, anti-VEGFR, anti- HER2, anti-CTLA4, anti-PD-1 or anti-EGFR antibodies, for example rituximab (CD20), ofatumumab (CD20), ibritumomab tiuxetan (CD20), GA101 (CD20), tositumomab (CD20), epratuzumab (CD22), lintuzumab (CD33), gemtuzumab ozogamicin (CD33), alemtuzumab (CD52), galiximab (CD80), trastuzumab (HER2 antibody), pertuzumab (HER2), trastuzumab-DM1 (HER2), ertumaxomab (HER2 and CD3), cetuximab (EGFR), panitum,
  • Estrogen receptor antagonists or selective estrogen receptor modulators (SERMs) or inhibitors of estrogen synthesis for example tamoxifen, fulvestrant, toremifene, droloxifene, faslodex, or raloxifene;
  • Aromatase inhibitors and related drugs such as exemestane, anastrozole, letrazole, testolactone aminoglutethimide, mitotane or vorozole;
  • Antiandrogens i.e. androgen receptor antagonists
  • related agents for example bicalutamide, nilutamide, flutamide, cyproterone, or ketoconazole
  • Hormones and analogues thereof such as medroxyprogesterone, diethylstilbestrol (a.k.a. diethylstilboestrol) or octreotide
  • medroxyprogesterone a.k.a. diethylstilboestrol
  • octreotide octreotide
  • CYP17 Steroidal cytochrome P450 17alpha-hydroxylase-17,20-lyase inhibitor
  • GnRAs Gonadotropin releasing hormone agonists or antagonists
  • Glucocorticoids for example prednisone, prednisolone, dexamethasone;
  • Differentiating agents such as retinoids, rexinoids, vitamin D or retinoic acid and retinoic acid metabolism blocking agents (RAMBA) for example accutane, alitretinoin, bexarotene, or tretinoin;
  • RAMBA retinoic acid metabolism blocking agents
  • Chromatin targeted therapies such as histone deacetylase (HDAC) inhibitors for example panobinostat, resminostat, abexinostat, vorinostat, romidepsin, belinostat, entinostat, quisinostat, pracinostat, tefinostat, mocetinostat, givinostat, CUDC-907, CUDC-101 , ACY-1215, MGCD-290, EVP-0334, RG-2833, 4SC-202, romidepsin, AR-42 (Ohio State University), CG-200745, valproic acid, CKD-581 , sodium butyrate, suberoylanilide hydroxamide acid (SAHA), depsipeptide (FR 901228), dacinostat (NVP- LAQ824), R306465/ JNJ-16241199, JNJ-26481585, trichostatin A, chlamy
  • HDAC
  • Proteasome Inhibitors for example bortezomib, carfilzomib, delanzomib (CEP-18770), ixazomib (M LN-9708), oprozomib (ONX-0912) or marizomib;
  • Radiolabelled drugs for radioimmunotherapy for example with a beta particle-emitting isotope (e.g. , Iodine -131, Yittrium -90) or an alpha particle-emitting isotope (e.g., Bismuth-213 or Actinium-225) for example ibritumomab or Iodine tositumomab;
  • a beta particle-emitting isotope e.g. , Iodine -131, Yittrium -90
  • an alpha particle-emitting isotope e.g., Bismuth-213 or Actinium-225
  • interferons such as interferon-y and interferon a
  • interleukins e.g. interleukin 2
  • aldesleukin denileukin diftitox
  • interferon alfa 2a interferon alfa 2b
  • peginterferon alfa 2b peginterferon alfa 2b
  • Vaccines such as sipuleucel-T (Provenge) or OncoVex
  • Cytokine-activating agents include Picibanil, Romurtide, Sizofiran, Virulizin, or Thymosin
  • (xliv) Enzymes such as L-asparaginase, pegaspargase, rasburicase, or pegademase;
  • DNA repair inhibitors such as PARP inhibitors for example, olaparib, veliparib, iniparib, ING-1001 , AG-014699, or ONO-2231;
  • Agonists of Death receptor e.g. TNF-related apoptosis inducing ligand (TRAIL) receptor
  • TNF-related apoptosis inducing ligand (TRAIL) receptor such as mapatumumab (formerly HGS-ETR1), conatumumab (formerly AMG 655), PRO95780, lexatumumab, dulanermin, CS-1008 , apomab or recombinant TRAIL ligands such as recombinant Human TRAIL/Apo2 Ligand;
  • the chemotherapeutic is a PARP inhibitor.
  • suitable PARP inhibitors include olaparib, veliparib, iniparib, rucaparib (AG-014699 or PF-01367338), talazoparib and AG-014699.
  • the chemotherapeutic is selected from camptothecin, cisplatin, Olaparib, and veliparib.
  • the genetic loss or attenuation and/or loss or attenuation of expression is genetic loss or attenuation and/or loss or attenuation of expression in one or more genes selected from: a gene which encodes a Fanconi Anemia core complex protein, a gene which encodes a FANCM complex protein, a gene which encodes a BRCA1-A complex protein, ZRSR2, CDK11B, LY6G6D, CYBA, EFNA5, or ZBTB7A, in a biological sample obtained from said subject.
  • the genetic loss or attenuation and/or loss or attenuation of expression is genetic loss or attenuation and/or loss or attenuation of expression in one or more genes selected from: a gene which encodes a Fanconi Anemia core complex protein, a gene which encodes a FANCM complex protein, a gene which encodes a BRCA1-A complex protein, or ZRSR2, in a biological sample obtained from said subject.
  • the genetic loss or attenuation and/or loss or attenuation of expression is genetic loss or attenuation and/or loss or attenuation of expression in one or more genes selected from: FANCG, APITD1/MHF1, BRCC3/BRCC36, ZRSR2 and the chemotherapeutic is selected from camptothecin, cisplatin, Olaparib, and veliparib. Kits
  • kits in a method of predicting the suitability of an EXO1 inhibitor for the treatment of cancer in a subject
  • the kit comprises a biosensor configured to detect the presence of genetic loss or attenuation and/or loss or attenuation of expression of one or more genes selected from: a gene which encodes a Fanconi Anemia core complex protein, a gene which encodes a FANCM complex protein, a gene which encodes a BRCA1-A complex protein, ZRSR2, CDK11 B, LY6G6D, CYBA, EFNA5, or ZBTB7A, in a biological sample obtained from said subject.
  • kits for use in determining the presence or absence of genetic loss or attenuation and/or loss or attenuation of expression of one or more genes may include one or more articles and/or reagents for performance of the method, such as means for providing the test sample itself, e.g., a blood sample (such components generally being sterile). Such a kit may also include instructions for use.
  • biosensor examples include any agent capable of detecting the presence of the variant nucleic acid sequence, or detecting and/or quantifying the presence of the polypeptide which is encoded by the variant nucleic acid sequence.
  • a biosensor may comprise a peptide, an antibody or a fragment thereof, or a synthetic ligand such as a plastic antibody, or an aptamer or oligonucleotide.
  • the antibody can be a monoclonal antibody or a fragment thereof.
  • a ligand may be labelled with a detectable marker, such as a luminescent, fluorescent, enzyme or radioactive marker; alternatively or additionally a ligand according to the invention may be labelled with an affinity tag, e.g., a biotin, avidin, streptavidin or His (e.g., hexa-His) tag.
  • affinity tag e.g., a biotin, avidin, streptavidin or His (e.g., hexa-His) tag.
  • ligand binding may be determined using a label-free technology for example the Bio-Layer Interferometry (BLI)-based Octet® system and Surface Plasmon Resonance (SPR)-based Pioneer
  • a diploid eHAP cell line was used for the generation of EXO1 knockouts.
  • This cell line is a diploidized HAP1 cell line (haploid originally purchased from Horizon Discovery), derived from KBM-7 cell line (a male patient with a chronic myeloid leukemia). All eHAP cell lines were grown in IMDM media with 10% Tet-free FBS and 1% penicillin/streptomycin, at 37°C in 5% CO2 condition. This cell line was then modified by a lentiviral integration of inducible Cas9, with an Edit-R inducible lentiviral Cas9 vector (Horizon Discovery) (Hewitt et al., 2021).
  • Cell line eHAP iCas9 was derived as a single clone from the pool of transduced cells after selection, and was chosen based on the cutting efficiency of integrated inducible Cas9 using a BFP/GFP cutting efficiency reporter assay (Addgene #67980) (Hewitt et al., 2021).
  • Knockout of EXO1 was made by transfection of the eHAP iCas9 cell line with a lenti-sgRNA puro vector (Addgene #104990), that had an EXO1 guide targeting exon 5 cloned into the vector (targeting sequence: TCAGGGGGTAGATTGCCTCG (SEQ ID NO: 1)). Upon transfection cells were incubated with doxycycline to induce the Cas9 expression and after 24 hours treated with puromycin to select only for cells that have been transfected with the vector. After 48 hours of selection, cells were seeded in 96-well plates in order to derive single cell clones. In parallel, the selected pool was checked by immunoblotting for the efficiency of the knockout of EXO1.
  • Each of the knockout cell line was then assessed for sensitivity to puromycin to ensure that lenti-sgRNA plasmid with the EXO1 guide did not integrate.
  • Single cell clones were screened by immunoblotting for the levels of EXO1 protein in cells and following that, knockout clones were screened for Cas9 cutting efficiency (with a BFP/GFP cutting efficiency reporter assay that is assessed by flow cytometry) to ensure that EXO1 KO clones still possess the high efficiency of Cas9 activity.
  • EXO1 KO clones were examined for sensitivity to different genotoxic agents, based on published dataset of whole genome genotoxic screens (Durocher lab shiny app, based on Olivieri et al, 2020), using Cell Titer Gio assay (Promega).
  • HeLa Kyoto cell lines were grown in DM EM media with 10% Tet-free FBS and 1% penicillin/streptomycin, at 37°C in 5% CO2 condition.
  • eHAP iCas9 cell line inducible Cas9 modification to HeLa Kyoto cell line was introduced through the lentiviral integration of an Edit-R inducible lentiviral Cas9 vector (Horizon Discovery) (Bayley, Borel et al., 2022).
  • the cell line used was derived as a single clone from the pool of transduced cells after selection and was chosen based on the cutting efficiency of integrated inducible Cas9 using a BFP/GFP cutting efficiency reporter assay (Addgene #67980) (Hewitt et al., 2021 ; Bayley, Borel et al., 2022).
  • EXO1 KO cell lines in eHAP iCas9 cell line knockout of EXO1 was made by transfection of the HeLa Kyoto iCas9 cell line with a lenti-sgRNA puro vector (Addgene #104990), that had either an EXO1 guide targeting exon 5 cloned into the vector (targeting sequence: TCAGGGGGTAGATTGCCTCG (SEQ ID NO: 1)) or an EXO1 guide targeting exon 12 (targeting sequence: AGAGTGTAAGCACTCCACCT (SEQ ID NO: 2)).
  • each of the knockout cell line was assessed for sensitivity to puromycin to ensure that lenti-sgRNA plasmid with the EXO1 guide did not integrate. Selection and validation of single cell clones was performed as described for eHAP iCas9 EXO1 KO clones.
  • the lentiviral Brunello library which was a single vector-based library (sgRNA only vector) was obtained from Addgene (#73179-LV). Transduction of the cells was performed with 100 million cells to obtain MOI (multiplicity of infection) of 0.4 after selection for representation of the library in 40 million cells, which amounts to the coverage of 500 cells per sgRNA. Transduced cells were selected with puromycin (0.4 .g/ml) for 48 hours, after which doxycycline (1 .g/ml) was added to the cells to induce Cas9 expression.
  • MOI multiplicity of infection
  • Cells were treated with doxycycline for 6 days in total, with representation of 40 million cells maintained by passaging every 2 days. After 6 days of Cas9 induction, first samples for sequencing analysis were obtained by harvesting 60 million cells (‘day 6’). Cells were then passaged without doxycycline every 2 days by maintaining representation until day 10 when the final sample for sequencing was obtained (‘day 16’). Samples for sequencing were harvested by washing cells in PBS and freezing cell pellets and storing at -80°C.
  • Genomic DNA was isolated with PureLink Genomic DNA Mini Kit (Invitrogen). Quantity of genomic DNA was measured by Nanodrop and Qubit (Invitrogen). From each sample 200 g of genomic DNA was then used for amplification of integrated sgRNAs by using P5 mix of oligos and P7 barcoded oligos in a PCR reaction with Ex Taq polymerase (TaKaRa) according to the Broad Institute protocol (oligos in Table 1). PCR products were purified by agarose gel extraction method using QIAquick Gel Extraction Kit (QIAGEN) and additionally purified using MinElute PCR Purification Kit (QIAGEN).
  • top 150 genes in ‘day 16’ analyses were analysed in cBioPortal against a curated set of non-redundant studies with 48870 patient samples (as of June 2021). Genes that had a significant percentage of loss-of-function mutations and deep deletions in any cancer type were then selected for the validation.
  • each guide sequence was chosen from the Brunello library database based on predicted score (higher score signifying higher on-target efficiency and lower off-target effect) as well as raw numbers of reads from the screen bioinformatic analysis across two timepoints and three biological triplicates (target sequences are listed in Table 2).
  • Each guide was cloned by using GeCKO protocol from Zhang lab, into a lenti-sgRNA vector (with puromycin resistance gene).
  • Lentiviruses were produced with a three vector system in HEK293 FT cells (grown in IMDM media with 10% Tet-free FBS and 1 % penicillin/streptomycin, at 37°C in 5% CO2 condition), with pLP1 , pLP2 and VSV-G packaging vectors with each of the lentiGuide vectors.
  • Each of the viruses were produced in a 6 well with 600000 cells seeded the day before the transfection. Following day cells were transfected for virus production (with 353.75ng of pLP1 , 166.25ng of pLP2, 230ng of VSV-G and 625ng of lentiGuide vector and 5 pl of Lipofectamine 2000) and after 24 hours media was replaced on the cells.
  • Media with the lentiviruses was collected 72 hours after transfection, filtered through 0.45pm filter and added to the cells (either eHAP iCas9 wild type cells or eHAP iCas9 EXO1 KO cells) together with polybrene (0.8 pg/ml). Media on transduced cells was refreshed after 24h to allow for the recovery. Following a day of recovery, cells were selected for 48 hours with puromycin (0.4 pg/ml).
  • Protocol for the HeLa Kyoto iCas9 cell line construction for inducible KO cell lines was as described for eHAP iCas9 cell lines, with the difference in the puromycin selection of transduced cells (final concentration of puromycin was 0.5 .g/ml).
  • viability of cells was assessed using two independent methods: clonogenic viability assay and cell viability assay with Cell Titer Gio (Promega).
  • clonogenic viability assay was grown in the presence of doxycycline (1 .g/ml) for 96 hours to induce Cas9 expression in cells with integrated sgRNAs (non-targeting sgRNA or sgRNA for the identified hit from the screen). Cells were then counted and seeded for viability assays (described in details below). In addition, cells were harvested for immunoblotting analysis of each cell line to assess the loss of protein upon inducible knockout induction. Viability of each cell line was assessed in three independent biological experiments.
  • Each eHAP cell line was counted after 96 hours of Cas9 induction and seeded in 24 well plates for 400, 200 and 100 cells (in 4 technical repeats for each dilution). Colonies were grown for 6 days when they were fixed and stained with 0.5% crystal violet solution with 20% methanol. Plates were then scanned and analysed using GelCount (Oxford Optronics). Images and mean value for technical replicates of wells with 200 cells seeded were used for the subsequent analysis. Value for eHAP iCas9 wild type cell line with an integrated non-targeting sgRNA was used for the normalisation.
  • Immunoblotting analyses of whole cell lysates were performed using standard immunoblotting techniques with following commercially available primary antibodies: anti-EXO1 (Abeam, ab95068), anti-alpha tubulin (Sigma, T6199), anti-vinculin (Abeam, ab11194), anti-FAAP24 (gift from S. West lab, SW92, published in Ciccia et al, 2007), anti-Abraxas1 (Abeam, ab248872), anti-BRCC36 (Bethyl, A302-517A-M), anti-FANCG (Novus Biologicals, H00002189-M01). Chemiluminescence was acquired using GelDoc system (Bio-Rad) and Clarity and Clarity Max reagents (Bio-Rad).
  • EXO1 KO in eHAP iCas9 cell line were validated by immunoblotting (Figure 1), as well as by measuring sensitivities to different genotoxic agents previously described in the literature ( Figure 2A-E).
  • EXO1 KO in eHAP cell line were confirmed to be sensitive to alkylating agent MMS, cisplatin, formaldehyde, potassium bromate, as well as an ATR inhibitor.
  • EXO1 KO clones in eHAP background were sensitive to PARP inhibitor Olaparib, as well as hydroxyurea (Figure 2F-G).
  • EXO1 KO clones were investigated for viability with a Cell Titer Gio assay ( Figure 4), while clone 11 was further assessed for its colony formation ability and viability with a clonogenic assay ( Figure 5A and B). These experiments demonstrated that EXO1 KO clones in eHAP cell background proliferate at 75-80% efficiency of a wild type eHAP iCas9 cell, which allows for a whole genome CRISPR dropout screen in EX01 -deficient background.
  • a whole genome CRISPR Cas9 dropout screen in eHAP iCas9 and eHAP iCas9 EXO1 KO cell lines was performed to identify genes whose loss conferred synthetic lethality in the EXO1 KO lines, but not the isogenic wild type control. Gene hits from this screen were subsequently analysed to determine if they are frequently subject to loss-of-function mutations or locus deletions in cancer.
  • MRE1 1 and RAD50 genes encoding for two members of the MRN complex (MRE11-RAD50- NBS1), were identified to be synthetic lethal with EXO1 as shown in the volcano plot of ‘day 6’ timepoint of the CRISPR screen ( Figure 6A).
  • the MRN complex acts as a nuclease in the process of short-range resection in homologous recombination pathway or in resection of stalled replication forks. All three of the factors are essential; however, hypomorphic allele of the third member or this complex, NBS1 , was found to be synthetic sick with EXO1 knockout in a mouse model (Rein et al, 2015).
  • These genes were not identified in the later timepoint of the screen as synthetic lethal with EXO1 loss, presumably as both MRE11 and RAD50 are essential genes and eventually drop out in both cell lines.
  • Figure 6B shows observation of synthetic lethality between loss of EXO1 and FEN1 nuclease, which processes Okazaki fragments in DNA replication. This genetic interaction has been observed and validated between RAD27 (homolog of FEN1) and EXO1 loss in multiple screens in the budding yeast model organism. As this genetic interaction has not been observed in mammalian cells before, it was validated with a specific inhibitor of FEN1 nuclease (WO 2017/051251). As shown in Figure 7, eHAP iCas9 EXO1 KO cells were more sensitive to FEN1 inhibitor treatment than wild type cells, as assessed by a cell survival assay using Cell Titer Gio.
  • RMI2 was one of the top synthetic lethal hits in ‘day 16’ comparison, it was validated by assessing viability of EXO1 KO cells with an integrated inducible sgRNA for RMI2 (double KO) in comparison to either wild type (WT) or EXO1 KO cells with an integrated inducible non-targeting sgRNA (single KO for EXO1), or wild type cells with an integrated guide for RMI2 (single KO for RMI2).
  • WT wild type
  • EXO1 KO cells with an integrated inducible non-targeting sgRNA single KO for EXO1
  • wild type cells with an integrated guide for RMI2 single KO for RMI2
  • double KO cells showed a significant reduction in viability in comparison to WT against which it was normalised, as well as both of the single KOs in a clonogenic assay.
  • double KO of EXO1 and RMI2 showed a significant reduction in viability in comparison to the wild type in the
  • FAAP24 C19orf40
  • APITD1 MHF1
  • FANCG FANCG from the FA core complex.
  • Figure 12A-C double KO of FAAP24 and EXO1 showed a significant reduction of viability in comparison to the wild type and single KOs, in both clonogenic assay and Cell Titer Gio viability assay (immunoblotting validation for KO is shown in Figure 12D).
  • Figure 13A-C we demonstrate synthetic lethality of APITD1 (MHF1) and EXO1 loss, as observed by two independent viability assessment methods.
  • a number of additional genes were chosen for validation by manually analysing 150 top ranked hits from ‘day 16’, via literature search as well as by analysing cancer genomic datasets available via cBioPortal to identify those genes that have LOF mutations or are deleted in cancers.
  • ZRSR2 is a gene that is frequently mutated in hematopoietic cancers, as highlighted in the literature (Yoshida et al, 2011), as well as in other types of cancer such as gastric cancers ( Figure 22). ZRSR2 is believed to function in the assembly of the minor spliceosome, which processes a small class of introns called U12-type introns.
  • EFNA5 Ephrin A5; receptor protein-tyrosine kinase
  • Figure 31 EFNA5 (Ephrin A5; receptor protein-tyrosine kinase) is frequently deleted or mutated in cancers ( Figure 31), and in the EXO1 KO whole genome CRISPR dropout screen it scored as a synthetic lethal gene with EXO1 loss. This was validated using the clonogenic assay and Cell Titer Gio assay to assess viability of double KO against wild type ( Figure 23 and Figure 30A-C).
  • ZBTB7A encodes for a transcription factor, which is involved in HDAC1 recruitment. This gene is often mutated in cancers ( Figure 33).
  • EXO1 KO cell lines are sensitive to certain chemotherapeutics that are currently in clinical use or that are currently in clinical trials, we investigated if inducible knockout cell lines for targets that we identified as synthetic lethal with EXO1 loss share these sensitivities and if sensitivities of inducible double KO cell lines of EXO1 and these targets are additive/synergistic. If so, cancers that are deficient for the factors we identified as synthetic lethal with EXO1 loss could be targeted with an EXO1 inhibitor in combination with these chemotherapeutics.
  • each of the double KO cell lines was compared to the wild type cell line (with integrated nontargeting sgRNA for Cas9 activity control), to the cell line in which EXO1 has been constitutively knocked out (also containing integrated non-targeting sgRNA for Cas9 activity control), and to the respective inducible KO cell line for the factors listed above.
  • inducible KO of Fanconi Anemia core complex factor FANCG in eHAP iCas9 cell line background is sensitive to camptothecin, cisplatin, as well as to PARP inhibitors Olaparib and veliparib.
  • Double KO cell line of EXO1 and FANCG is showing significant additive sensitivity to camptothecin, cisplatin and PARP inhibitors Olaparib and veliparib ( Figure 40A-E).
  • Inducible KO of FANCM complexfactor APITD1/MHF1 in eHAP iCas9 cell line is also sensitive to camptothecin, cisplatin, as well as to PARP inhibitors Olaparib and veliparib ( Figure 40).
  • the double KO cell line of EXO1 and APITD1/MHF1 showed a significant additive sensitivity to camptothecin, cisplatin and PARP inhibitors Olaparib and veliparib ( Figure 40).
  • EXO1 KO cells in combination with the inducible KOs of FA factors, BRCA1-A complex factors and ZRSR2 show strong additive effect to the sensitivity of either EXO1 KO or inducible KOs of either of these factors to PARP inhibitors Olaparib and veliparib.
  • double KOs of EXO1 and FA factors FANCG or APITD1/MFH1 are additively sensitive to Olaparib treatment in HeLa Kyoto iCas9 background, similarly to what we observed in the double KO cell lines in eHAP iCas9 background ( Figure 43A-B).
  • Ciccia A Ling C, Coulthard R, Yan Z, Xue Y, Meetei AR, Laghmani el H, Joenje H, McDonald N, de Winter JP, Wang W, West SC. Identification of FAAP24, a Fanconi anemia core complex protein that interacts with FANCM. Mol Cell. 2007 Feb 9;25(3):331-43. doi: 10.1016/j.molcel.2007.01.003. PMID: 17289582.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention concerne un procédé pour déterminer la convenance d'un inhibiteur EXO1 pour le traitement du cancer, et l'utilisation d'un kit pour ledit procédé. L'invention concerne également un procédé de traitement du cancer.
PCT/GB2022/052410 2021-09-23 2022-09-23 Procédé de détermination de l'adéquation d'un inhibiteur exo1 pour le traitement du cancer WO2023047123A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB2113610.6A GB202113610D0 (en) 2021-09-23 2021-09-23 Novel method
GB2113610.6 2021-09-23

Publications (1)

Publication Number Publication Date
WO2023047123A1 true WO2023047123A1 (fr) 2023-03-30

Family

ID=78399808

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2022/052410 WO2023047123A1 (fr) 2021-09-23 2022-09-23 Procédé de détermination de l'adéquation d'un inhibiteur exo1 pour le traitement du cancer

Country Status (2)

Country Link
GB (1) GB202113610D0 (fr)
WO (1) WO2023047123A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016012630A1 (fr) * 2014-07-25 2016-01-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Procédés pour prédire la réponse à des inhibiteurs de la voie de réparation de l'adn dans un lymphome diffus à grandes cellules b
US20160152985A1 (en) * 2006-10-20 2016-06-02 Dana-Farber Cancer Institute, Inc. Compositions and methods for treating cancer
WO2017051251A1 (fr) 2015-09-25 2017-03-30 Ludwig Institute For Cancer Research Ltd Dérivés de 3-hydroxy-quinazoline-2,4-dione et leur utilisation comme modulateurs de nucléase
WO2019067442A1 (fr) * 2017-09-26 2019-04-04 Ideaya Biosciences, Inc. Composés de dihydrothiéno [3,2-b] pyridine

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20160152985A1 (en) * 2006-10-20 2016-06-02 Dana-Farber Cancer Institute, Inc. Compositions and methods for treating cancer
WO2016012630A1 (fr) * 2014-07-25 2016-01-28 INSERM (Institut National de la Santé et de la Recherche Médicale) Procédés pour prédire la réponse à des inhibiteurs de la voie de réparation de l'adn dans un lymphome diffus à grandes cellules b
WO2017051251A1 (fr) 2015-09-25 2017-03-30 Ludwig Institute For Cancer Research Ltd Dérivés de 3-hydroxy-quinazoline-2,4-dione et leur utilisation comme modulateurs de nucléase
WO2019067442A1 (fr) * 2017-09-26 2019-04-04 Ideaya Biosciences, Inc. Composés de dihydrothiéno [3,2-b] pyridine

Non-Patent Citations (12)

* Cited by examiner, † Cited by third party
Title
BAYLEY RBOREL VMOSS RJSWEATMAN ERUIS PORMROD AGOULA AMOTTRAM RMASTANAGE THEWITT G: "H3K4 methylation by SETD1A/BOD1L facilitates RIF1-dependent NHEJ", MOL CELL, vol. 82, no. 10, 19 May 2022 (2022-05-19), pages 1924 - 1939
CAI MYDUNN CECHEN WKOCHUPURAKKAL BSNGUYEN HMOREAU LASHAPIRO GIPARMAR KKOZONO DD'ANDREA AD: "Cooperation of the ATM and Fanconi Anemia/BRCA Pathways in Double-Strand Break End Resection", CELL REP., vol. 30, no. 7, 18 February 2020 (2020-02-18), pages 2402 - 2415
CHOU TCTALALAY P: "Quantitative analysis of dose-effect relationships: the combined effects of multiple drugs or enzyme inhibitors.", ADV ENZYME REGULAT, vol. 22, 1984, pages 27 - 55, XP023796270, DOI: 10.1016/0065-2571(84)90007-4
CICCIA ALING CCOULTHARD RYAN ZXUE YMEETEI ARLAGHMANI EL HJOENJE HMCDONALD NDE WINTER JP: "Identification of FAAP24, a Fanconi anemia core complex protein that interacts with FANCM", MOL CELL, vol. 25, no. 3, 9 February 2007 (2007-02-09), pages 331 - 43
DOENCH JGFUSI NSULLENDER MHEGDE MVAIMBERG EWDONOVAN KFSMITH ITOTHOVA ZWILEN CORCHARD R: "Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9.", NAT BIOTECHNOL., vol. 34, no. 2, February 2016 (2016-02-01), pages 184 - 191
HEWITT GBOREL VSEGURA-BAYONA STAKAKI TRUIS PBELLELLI RLEHMANN LCSOMMEROVA LVANCEVSKA ATOMAS-LOBA A: "Defective ALC1 nucleosome remodeling confers PARPi sensitization and synthetic lethality with HRD", MOL CELL, vol. 81, no. 4, 18 February 2021 (2021-02-18), pages 767 - 783
LIU WPALOVCAK ALI FZAFAR AYUAN FZHANG Y: "Fanconi anemia pathway as a prospective target for cancer intervention", CELL BIOSCI., 16 March 2020 (2020-03-16)
MADAN VKANOJIA DLI JOKAMOTO RSATO-OTSUBO AKOHLMANN ASANADA MGROSSMANN VSUNDARESAN JSHIRAISHI Y: "Aberrant splicing of U12-type introns is the hallmark of ZRSR2 mutant myelodysplastic syndrome", NAT COMMUN., vol. 6, 14 January 2015 (2015-01-14), pages 6042
OLIVIERI MCHO TALVAREZ-QUILON ALI KSCHELLENBERG MJZIMMERMANN MHUSTEDT NROSSI SEADAM SMELO H: "A Genetic Map of the Response to DNA Damage in Human Cells", CELL, vol. 182, no. 2, 23 July 2020 (2020-07-23), pages 481 - 496, XP086224640, DOI: 10.1016/j.cell.2020.05.040
REIN KYANEZ DATERRE BPALENZUELA LAIVIO SWEI KEDELMANN WSTARK JMSTRACKER TH: "EX01 is critical for embryogenesis and the DNA damage response in mice with a hypomorphic Nbs1 allele", NUCLEIC ACIDS RES., vol. 43, no. 15, 3 September 2015 (2015-09-03), pages 7371 - 87
TRAN P T ET AL: "EXO1-A multi-tasking eukaryotic nuclease", DNA REPAIR, ELSEVIER, AMSTERDAM, NL, vol. 3, no. 12, 2 December 2004 (2004-12-02), pages 1549 - 1559, XP027409860, ISSN: 1568-7864, [retrieved on 20041008] *
YOSHIDA KSANADA MSHIRAISHI YNOWAK DNAGATA YYAMAMOTO RSATO YSATO-OTSUBO AKON ANAGASAKI M: "Frequent pathway mutations of splicing machinery in myelodysplasia.", NATURE, vol. 478, no. 7367, 11 September 2011 (2011-09-11), pages 64 - 9, XP055142763, DOI: 10.1038/nature10496

Also Published As

Publication number Publication date
GB202113610D0 (en) 2021-11-10

Similar Documents

Publication Publication Date Title
US11135225B2 (en) Cancer treatments using combinations of CDK and ERK inhibitors
EP3082800B1 (fr) Traitement du cancer faisant appel à des associations d'inhibiteurs de l'erk et de la raf
ES2953311T3 (es) Tratamientos contra el cáncer que usan combinaciones de inhibidores de ERK y MEK de tipo 2
ES2918375T3 (es) Tratamientos contra el cáncer usando combinaciones de inhibidores de la ruta de PI3K/Akt y ERK
JP2022034068A (ja) 非ｅｒｋ ｍａｐｋ経路阻害剤耐性のがんを処置するための方法および組成物
WO2015095807A1 (fr) Traitements du cancer au moyen de combinaisons d'inhibiteurs de l'egfr et de l'erk
US20160310477A1 (en) Cancer treatments using combinations of mek type 1 and erk inhibitors
US20220387544A1 (en) Novel therapeutic use
WO2023047123A1 (fr) Procédé de détermination de l'adéquation d'un inhibiteur exo1 pour le traitement du cancer
US11180761B2 (en) PDGFR RNA aptamers
CA3131249A1 (fr) Procede de traitement d'un myelome multiple

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22785778

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE