WO2023040997A1

WO2023040997A1 - Single gene test method and application thereof

Info

Publication number: WO2023040997A1
Application number: PCT/CN2022/119180
Authority: WO
Inventors: 林坚; 陈航宇; 许诺; 陈龙
Original assignee: 北京大学
Priority date: 2021-09-17
Filing date: 2022-09-16
Publication date: 2023-03-23
Also published as: CN115851934A

Abstract

Provided are a single gene test method and an application thereof. Specifically, provided is a gene modification test method, comprising (S1) on the basis of the quantity and/or presence of hydroxymethylcytosine in a clinical examination positive sample and a clinical examination negative sample of a target gene, determining a region to be tested, and (S2) detecting the quantity and/or presence of hydroxymethylcytosine in said region of a sample to be tested.

Description

A single gene detection method and its application

technical field

This application relates to the field of biomedicine, in particular to a single gene detection method and its application.

Background technique

At present, there is no clinically effective method to screen tumor patients in advance who will benefit from targeted drug therapy, and there is no reliable method to early warning of tumor metastasis and organ damage during treatment. A commonly used method for screening the beneficiaries of targeted drug therapy is to use the tumor tissue samples of tumor patients punctured or operated on to perform immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) tests of relevant target genes, so as to determine whether the tumor patients are Suitable for targeted drug therapy. This detection method requires tumor tissue samples, and the waiting period for patients is long. At the same time, it is affected by tumor heterogeneity and metastasis, and the specificity of screening targeted drugs is poor. DNA hydroxymethylation is an important form of epigenetic modification. As a promising biomarker, it is closely related to the occurrence and development of various human diseases. However, research on DNA hydroxymethylation for specific population screening Not yet developed. Therefore, there is an urgent need to develop a convenient, fast and accurate detection method to screen patients who benefit from treatment in advance and to provide early warning of tumor metastasis and organ damage.

Contents of the invention

On the one hand, the present application provides an analysis method, comprising (S1) determining the area to be tested based on the quantity and/or presence of hydroxymethylcytosine in the clinical test-positive samples and the clinical test-negative samples of the target gene, (S2) Detecting the quantity and/or presence of said hydroxymethylcytosine in said test region of the test sample.

In another aspect, the present application provides a method for confirming the existence of a disease, assessing the formation or risk of developing the disease, assessing the progression and/or prognosis of the disease, and/or screening the population corresponding to the treatment, comprising (S1) based on the target gene The amount and/or presence of hydroxymethylcytosine in the clinical test positive sample and the clinical test negative sample, determine the area to be tested, (S2) detect the hydroxymethylcytosine in the test area of the test sample quantity and/or presence.

In another aspect, the present application provides an analysis method, comprising detecting the quantity and/or presence of hydroxymethylcytosine in the region to be tested of the single target gene of the sample to be tested by digital PCR based on a single target gene .

In another aspect, the present application provides a method for confirming the presence of a disease, assessing the development or risk of developing a disease, assessing the progression and/or prognosis of a disease, and/or screening a population responding to treatment, comprising based on a single target gene, by The digital PCR method detects the quantity and/or presence of hydroxymethylcytosine in the test area of the test sample.

On the other hand, the present application provides a nucleic acid, which comprises a sequence capable of binding to the region to be tested determined by the method described in the present application, or its complementary region, or the above-mentioned fragments.

On the other hand, the present application provides a method for preparing a nucleic acid, comprising the sequence of the region to be tested, or its complementary region, or the above-mentioned fragment determined according to the method described in the application, designed to be able to bind to the region to be tested, or a complementary region thereof, or a nucleic acid of a fragment thereof.

In another aspect, the present application provides a kit comprising the nucleic acid described in the present application.

In another aspect, the present application provides the application of the nucleic acid described in the present application, and/or the kit described in the present application, in the preparation of disease detection products.

In another aspect, the present application provides the nucleic acid described in the present application, and/or the kit described in the present application, which can be used to confirm the existence of the disease, assess the formation or risk of the disease, assess the progress and/or prognosis of the disease and/or the nucleic acid described in the application. Or screen for applications in products that have appropriate populations for treatment.

On the other hand, the present application provides a database comprising the sequence of the region to be tested determined by the method described in the present application, or its complementary region, or the above-mentioned fragments.

On the other hand, the present application provides a storage medium, which records a program capable of running the method described in the present application.

In another aspect, the present application provides a device comprising the storage medium described in the present application.

In another aspect, the present application provides the device described in the present application, further comprising a processor coupled to the storage medium, and the processor is configured to execute based on a program stored in the storage medium to implement the present application the method described.

Those skilled in the art can easily perceive other aspects and advantages of the present application from the following detailed description. In the following detailed description, only exemplary embodiments of the present application are shown and described. As those skilled in the art will appreciate, the content of the present application enables those skilled in the art to make changes to the specific embodiments which are disclosed without departing from the spirit and scope of the invention to which this application relates. Correspondingly, the drawings and descriptions in the specification of the present application are only exemplary rather than restrictive.

Description of drawings

The particular features of the invention to which this application relates are set forth in the appended claims. The features and advantages of the invention to which this application relates can be better understood with reference to the exemplary embodiments described in detail hereinafter and the accompanying drawings. A brief description of the accompanying drawings is as follows:

Figure 1 shows the copy number (copies of ng) of the PD-L1 hydroxymethylation site (CD274) single gene detection in the plasma cell-free DNA 5hmC library of 49 melanoma patients; among them, the PD-L1 positive group (PD -L1+) was significantly different from the PD-L1 negative group (PD-L1-) (p<0.01).

Figure 2 shows the copy number (copies of ng) of EGFR hydroxymethylation site single gene detection in the plasma cell-free DNA 5hmC library of 56 patients with esophageal squamous cell carcinoma; among them, the EGFR positive group (EGFR+) and the EGFR negative group ( EGFR-) compared with significant difference (p<0.01).

Figure 3 shows the copy number (copies of ng) of the HER2 hydroxymethylation site (ERBB2) single gene detection in the plasma cell-free DNA 5hmC library of 36 breast cancer patients; among them, the HER2 positive group (HER2+) and the HER2 negative group group (HER2-) was significantly different (p<0.01).

Detailed ways

The implementation of the invention of the present application will be described in the following specific examples, and those skilled in the art can easily understand other advantages and effects of the invention of the present application from the content disclosed in this specification.

Definition of Terms

In this application, the term "sample" generally refers to a material or mixture of materials, usually in liquid or other form, which may contain one or more analytes of interest.

In this application, the terms "determine", "measure", "evaluate", "evaluate", "determine" and "analyze" are used interchangeably herein and generally refer to any form of measurement, including determining the presence or absence of an element. These terms can include both quantitative and/or qualitative aspects. Evaluations can be relative or absolute. "Assessing the presence of" can include determining the amount of something present, as well as determining its presence or absence.

In this application, the terms "clinical test sample", "clinical test positive sample" and "clinical test negative sample" generally refer to samples whose positive or negative status is determined by clinical test methods. For example, the sample can be tested and confirmed by the detection method of the recognized clinical guidelines, and a conclusion can be drawn that the sample is clinically positive or clinically negative. For example, clinical testing methods commonly used in this field may include, but are not limited to, clinical immunohistochemical testing, clinical FISH testing, gene mutation testing, gene expression testing, genes predicting the occurrence of diseases and related symptoms, blood testing of tumor markers, etc.

For example, the simple steps of clinical immunohistochemical detection may include freezing or paraffin sections of clinical tissues, incubating and staining with antibodies after blocking, taking pictures and grading according to the intensity of the signal. Test-positive samples; and samples with weaker signals and lower grades are clinical test-negative samples.

For example, the simple steps of clinical FISH detection may include FISH sample preparation, probe preparation, probe labeling, hybridization, chromosome banding, fluorescence microscope detection, and result analysis. Slice the clinical tissue, then use the probe to mark and hybridize, detect the fluorescent signal and grade it according to the signal intensity, among which the signal is stronger and the grade is higher as the positive sample of the clinical test; while the signal is weaker and the grade is lower. The low one is the negative sample of clinical test.

For example, the simple steps of gene mutation detection may include taking patient tumor tissue samples, extracting DNA, and testing with kits and other methods to determine whether the patient has a mutation; those with mutations are regarded as positive samples in clinical tests; those without mutations are used as clinical tests. Negative samples.

For example, methods for genetic detection may include: polymerase chain reaction-restriction fragment length polymorphism analysis technology, pyrosequencing method, single-strand conformational polymorphism analysis technology, probe amplification block mutation system, high-performance liquid Phase chromatography, micro-digital polymerase chain reaction, and high-resolution melting curve analysis techniques, etc.

For example, the detection of gene expression can include selecting kits and other methods for detection according to the conditions of genes and tumors to determine whether the patient has gene expression variation; those with gene expression variation are regarded as positive samples in clinical tests; those without gene expression variation as clinically negative samples.

For example, the genes for predicting the occurrence of diseases and related symptoms can include the genes related to diseases and related symptoms obtained through the existing sequencing data, or sequencing of clinical patient samples (including DNA, RNA and other sequencing methods), and data analysis. Genes, and genes that can predict the occurrence of diseases and their related symptoms through their expression levels in the absence of occurrence. Samples that are predicted to be highly correlated with diseases and their related symptoms can be regarded as positive samples of clinical tests, and samples that are predicted to be highly correlated with diseases and their related symptoms can be regarded as negative samples of clinical tests.

For example, the blood test for tumor markers may include blood collection to check the levels of tumor markers in the blood. Alternatively, the pleural effusion or ascites can be drained and sent for examination of tumor markers. The changes in the content of tumor markers in the pleural effusion and ascites can be compared with the changes in the tumor markers in the blood of the patient, thereby strengthening the monitoring and control of the disease. diagnosis. Samples that are predicted to be highly correlated with diseases and their related symptoms can be regarded as positive samples of clinical tests, and samples that are predicted to be highly correlated with diseases and their related symptoms can be regarded as negative samples of clinical tests.

In this application, the term "sequencing" generally refers to a method by which the identity of at least 10 contiguous nucleotides (e.g., at least 20, at least 50, at least 100, or at least 200 nucleotides) of a polynucleotide can be obtained. identities of one or more consecutive nucleotides).

In this application, the term "UDP glucose modified with chemoselective groups" generally refers to UDP glucose that has been functionalized, possibly at the 6-hydroxyl position, to include the ability to participate in 1,3- Groups for cycloaddition (or "click") reactions. Such groups may include azido and alkynyl (eg cyclooctyne). For example, UDP-6-N3-Glu can be UDP glucose modified with chemoselective groups.

In this application, the term "biotin moiety" generally refers to biotin or moieties such as desthiobiotin, oxidized biotin, 2-iminobiotin, diaminobiotin, biotin sulfoxide, biotin Affinity tags for biotin analogs such as Cytin. The biotin moiety can bind streptavidin.

In this application, the terms "cycloaddition reaction" and "click reaction" are generally interchangeably described terms, generally referring to the 1,3-cycloaddition between an azide and an alkynyl to form a five-membered heterocycle. In some embodiments, the alkynyl group can be strained (eg, in a ring such as cyclooctyne), and the cycloaddition reaction can be performed under copper-free conditions. Dibenzocyclooctyne (DBCO) and difluorooctyne (DIFO) may be examples of alkynes capable of participating in copper-free cycloaddition reactions.

In this application, the term "biotin-bound carrier" generally refers to a carrier (eg a bead, which may be magnetic) attached to streptavidin or avidin or a functional equivalent thereof.

In this application, the term "amplification" generally refers to the use of a target nucleic acid as a template to produce one or more copies of the target nucleic acid.

In this application, the term "copy of a fragment" generally refers to an amplified product, wherein the copy of a fragment may be the reverse complement of the strand of the fragment, or may have the same sequence as the strand of the fragment.

In this application, the term "enrichment" generally refers to the separation of analytes with a certain characteristic (such as nucleic acids containing hydroxymethylcytosine) from analytes without that characteristic (such as nucleic acids containing hydroxymethylcytosine). partially purified. For example, enrichment typically increases the concentration of an analyte having the characteristic (eg, a nucleic acid comprising hydroxymethylcytosine) by at least 2-fold, at least 5-fold, or at least 10-fold relative to an analyte without the characteristic. Following enrichment, at least 10%, at least 20%, at least 50%, at least 80%, or at least 90% of the analytes in the sample may have the characteristic used for the enrichment. For example, at least 10%, at least 20%, at least 50%, at least 80%, or at least 90% of the nucleic acid molecules in the enriched composition may comprise chain of methylcytosine.

Detailed description of the invention

On the one hand, the present application provides an analysis method, comprising (S1) determining the area to be tested based on the quantity and/or presence of hydroxymethylcytosine in the clinical test-positive samples and clinical test-negative samples of the target gene, and (S2) detecting The quantity and/or presence of the hydroxymethylcytosine in the region to be tested of the sample to be tested. For example, the region to be tested may comprise a subregion of the region where a single target gene is located.

In another aspect, the present application provides a method of confirming the presence of a disease, assessing the development or risk of developing the disease, assessing the progression and/or prognosis of the disease and/or screening a population responding to treatment, comprising (S1) target-based The number and/or presence of hydroxymethylcytosine in the clinical test positive sample and the clinical test negative sample of the gene, determine the area to be tested, (S2) detect the hydroxymethylcytosine in the test area of the test sample the number and/or existence of For example, the region to be tested may comprise a subregion of the region where a single target gene is located.

For example, the region to be tested can be determined based on the amount and/or presence of the hydroxymethylcytosine in the clinical test positive samples and the clinical test negative samples of a single target gene.

For example, the step (S1) of the method of the present application may comprise a step (S1-1): determining the positive sample of the clinical test and the negative sample of the clinical test of the target gene.

For example, the step (S1) of the method of the present application may include the step (S1-2): determining that the clinical test-positive sample and the clinical test-negative sample contain hydroxymethyl cells in the same region by a hydroxymethylation sequencing method. The number of nucleic acid fragments with pyrimidines.

For example, the step (S1) of the method of the present application may include a step (S1-3): determining the region containing differential hydroxymethylcytosine in the clinical test positive sample and the clinical test negative sample, as the area to be tested.

For example, the step (S2) of the method of the present application may include detecting the quantity and/or presence of the hydroxymethylcytosine in the region to be tested of the sample to be tested by sequencing.

For example, the present application provides an analytical method or a method for confirming the presence of a disease, assessing the formation or risk of developing a disease, assessing the progression and/or prognosis of a disease and/or screening a population corresponding to treatment, comprising steps (S1- 1): determining the clinically positive samples and the clinically negative samples of the target gene; step (S1-2): determining the clinically positive samples and the clinically negative samples by hydroxymethylation sequencing The number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the sample; step (S1-3): determining the region containing differential hydroxymethylcytosine in the clinical test positive sample and the clinical test negative sample, as The region to be tested; step (S2) may include detecting the quantity and/or presence of hydroxymethylcytosine in the region to be tested by sequencing.

For example, the present application provides an analytical method or a method for confirming the presence of a disease, assessing the formation or risk of developing a disease, assessing the progression and/or prognosis of a disease and/or screening a population corresponding to treatment, comprising steps (S1- 1): determining the clinically positive samples and the clinically negative samples of the target gene; step (S1-2): determining the clinically positive samples and the clinically negative samples by hydroxymethylation sequencing The number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the sample; step (S1-3): when the clinical test positive sample contains nucleic acid of hydroxymethylcytosine in the same region compared to the clinical test negative sample When the absolute value of the ratio log2 of the number of fragments after processing is 0.5 or more, it is determined that the region is the region to be tested; step (S2) may include detecting all parts of the region to be tested in the sample to be tested by sequencing. The amount and/or presence of the above-mentioned hydroxymethylcytosine.

For example, the present application provides an analytical method or a method for confirming the presence of a disease, assessing the formation or risk of developing a disease, assessing the progression and/or prognosis of a disease and/or screening a population corresponding to treatment, comprising steps (S1- 1): determining the clinically positive samples and the clinically negative samples of the target gene; step (S1-2): determining the clinically positive samples and the clinically negative samples by hydroxymethylation sequencing The number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the sample; step (S1-3): when the clinical test positive sample contains nucleic acid of hydroxymethylcytosine in the same region compared to the clinical test negative sample The absolute value of the ratio log2 of the number of fragments after processing is 0.5 or more, and when the difference between the clinical test positive sample and the clinical test negative sample in the same area is less than 0.05, it is determined that the area is The area to be tested; step (S2) may include detecting the quantity and/or presence of the hydroxymethylcytosine in the area to be tested in the sample to be tested by sequencing.

For example, the clinical test-positive samples and the clinical test-negative samples of the present application can be determined by the following clinical test methods: immunohistochemical detection, clinical FISH detection, gene mutation detection, gene expression detection, genes that predict the occurrence of diseases and related symptoms , and blood tests for tumor markers. For example, the clinical test-positive samples and the clinical test-negative samples of the present application can be determined by immunohistochemistry and/or fluorescence in situ hybridization. For example, methods for determining whether a clinical test sample is positive or negative can be based on diagnostic guidelines consensus in the art.

For example, a sample with an immunohistochemical staining score of 1 or higher is judged to be a clinically positive sample according to the antibody staining signal standard of the immunohistochemical method. For example, according to immunohistochemistry, it can be detected by Ventana SP142 IHC (immunohistochemistry), and the staining of SP142 can show brown dot or linear staining, distributed in the tumor or in the peritumoral stroma. For example, the judgment standard of immunohistochemical method can be as follows: adopt stepwise scoring method, divide into 4 grades according to the percentage of stained cells, namely: 0-<1%; 1%-<5%; 5%-<10%; ≥10%. Among them, ≥1% were positive.

For example, a sample with a fluorescence in situ hybridization ratio of 2.0 or higher is judged to be a clinically positive sample according to the fluorescent in situ hybridization fluorescent probe signal standard. For example, according to the fluorescence in situ hybridization method, in vitro fluorescently labeled DNA probes can be used, using the principle of complementary base pairing between the probe and the target gene to be detected. Fluorescent signals are used to obtain results, allowing the detection of chromosomal or genetic abnormalities in cells and tissues. For example, the judging criteria for fluorescence in situ hybridization can be: (1) red fluorescent signals are connected into clusters; (2) double microsome amplification occurs in red fluorescent signals; (3) red-green fluorescent signal ratio > 1.5.

For example, the hydroxymethylation sequencing method of the present application may include the following steps: (S1-2a) extracting nucleic acid fragments in the sample, (S1-2b) labeling nucleic acid fragments containing hydroxymethylcytosine in the nucleic acid fragments , (S1-2c) enriching the nucleic acid fragments containing hydroxymethylcytosine, (S1-2d) sequencing the enriched nucleic acid fragments containing hydroxymethylcytosine.

For example, the labeling described herein comprises contacting the nucleic acid fragment with DNA β-glucosyltransferase and UDP glucose modified with a chemoselective group. For example, the label of the present application may be that the chemoselective group is attached to a nucleic acid fragment containing hydroxymethylcytosine in the sample.

For example, a chemoselective group described herein may comprise an azido group. For example, the chemoselective groups of the present application may comprise any chemical click group.

For example, labeling as described herein may also comprise contacting said nucleic acid fragment bearing a chemoselective group with biotin comprising biotin capable of reacting with said chemoselective group. For example, the biotin capable of reacting with the chemoselective group may comprise biotin containing a dibenzocyclooctyne modification. For example, the label may be that a first label is linked to a nucleic acid fragment containing hydroxymethylcytosine in the sample, and may include linking the nucleic acid fragment to which the first label is linked with a second label, the The second label is selectively reactive with said first label.

For example, said enriching can comprise contacting said nucleic acid fragments bearing biotin with magnetic beads comprising streptavidin. For example, the labeled nucleic acid fragments containing hydroxymethylcytosine can be combined with magnetic beads containing streptavidin. For example, said enrichment may comprise separating magnetic beads bearing said hydroxymethylcytosine nucleic acid fragments by magnetic force.

For example, the step (S1) may include a step (S1-3): determining a region containing differential hydroxymethylcytosine in the clinical test positive sample and the clinical test negative sample as the region to be tested.

For example, the region of differentiated hydroxymethylcytosine may comprise, in the clinical test positive sample, compared to the clinical test negative sample, the number of nucleic acid fragments comprising hydroxymethylcytosine in the region is significantly increased and / or areas of significant reduction. For example, the area to be tested can be determined by determining the multiple of difference in the number of nucleic acid fragments containing hydroxymethylcytosine in the same area in the clinical test positive sample compared to the clinical test negative sample. For example, the multiple of difference may be related to the following statistical value: the difference in the number of nucleic acid fragments containing hydroxymethylcytosine in the same region in the clinical test positive sample compared to the clinical test negative sample, the clinical test The log2-processed ratio of the number of nucleic acid fragments containing hydroxymethylcytosine in the same region in the positive sample compared to the negative sample in the clinical test and/or in the positive sample compared to the negative sample in the clinical test Absolute value of the ratio of the number of nucleic acid fragments containing hydroxymethylcytosine in the same region after log2 treatment.

For example, when the ratio log2 of the number of nucleic acid fragments containing hydroxymethylcytosine in the same region in the clinical test positive sample compared to the clinical test negative sample has an absolute value of 0.5 or more after processing, it can be determined that The above-mentioned area is the area to be tested. For example, when the significance of the difference between the clinical test positive sample and the clinical test negative sample in the same area is less than 0.05, the area can be determined as the area to be tested. For example, when the ratio log2 of the number of nucleic acid fragments containing hydroxymethylcytosine in the same region in the clinical test positive sample compared to the clinical test negative sample has an absolute value of 0.5 or more after processing, and when the When the significance of the difference between the clinical test positive sample and the clinical test negative sample in the same area is less than 0.05, the area can be determined as the area to be tested.

For example, the step (S2) of the present application may include detecting the quantity and/or presence of the hydroxymethylcytosine in the region to be tested in the sample to be tested by sequencing. For example, the present application may sequence the sample to be tested by a method selected from the following group: digital PCR and high-throughput sequencing. For example, the sequencing method of the present application can be selected from any sequencing method known in the art.

On the other hand, the present application also provides a method for analyzing, confirming the existence of a disease, assessing the formation or risk of developing a disease, assessing the progress and/or prognosis of a disease and/or screening a population that is suitable for treatment, which may include For the target gene, the quantity and/or presence of hydroxymethylcytosine in the region to be tested of the single target gene in the sample to be tested is detected by digital PCR. For example, the present application provides an analysis method, comprising detecting the hydroxymethylcytosine in the region to be tested of the single target gene in the sample to be tested by digital PCR based on the region to be tested obtained through preliminary screening in the single target gene the number and/or existence of For example, the step of primary screening may be the step (S1) of any analysis method in the present application. For example, the region to be measured in the present application is determined by step (S1-1), step (S1-2), and step (S1-3) of any analysis method in the present application.

On the other hand, the present application also provides a method for determining a region to be detected, and the region to be detected is used in a detection method based on the quantity and/or presence of hydroxymethylcytosine. For example, the method for determining the area to be tested in the present application includes step (S1-1), step (S1-2), and step (S1-3) of any analysis method in the present application.

In another aspect, the present application also provides a database, which may contain the sequence of the region to be tested determined by the method described in the present application, or its complementary region, or the above-mentioned fragments. For example, the region to be tested determined by PD-L1 may be chr9:5449218-5450100. For example, the region to be tested determined by PD-L1 may be chr9:5460114-5460435. For example, the region to be tested determined by EGFR may be chr7:55127173-55127790. The region to be tested determined by HER2 may be chr17:37852095-37852700.

In one aspect, the present application provides a nucleic acid, and the nucleic acid may comprise a region to be tested that can be determined in combination with the method described in the present application, or a complementary region thereof, or a sequence of a fragment thereof. For example, the nucleic acid can be a probe. In another aspect, the present application provides a method for preparing a nucleic acid, which may include the sequence of the region to be tested determined according to the method described in the application, or its complementary region, or the above-mentioned fragments, designed to be able to bind to the region to be tested region, or a complementary region thereof, or a nucleic acid of a fragment thereof.

For example, the nucleic acid of the present application can be CTGTATTGCCACATAATGTCTATA as shown in SEQ ID NO:1. For example, the nucleic acid of the present application can be ATTGAGAAATTGGACTCTTCGTTG as shown in SEQ ID NO:2. For example, the nucleic acid of the present application can be TTGCATGAATGCAGGAAAAA as shown in SEQ ID NO:3. For example, the nucleic acid of the present application can be AGTTGGCACTGGGTCTCTGT as shown in SEQ ID NO:4. For example, the sequences shown in SEQ ID NO:1 and/or SEQ ID NO:2 can bind chr9:5449218-5450100. For example, the sequences shown in SEQ ID NO:3 and/or SEQ ID NO:4 can bind chr7:55127173-55127790. For example, the sequences shown in SEQ ID NO:5 and/or SEQ ID NO:6 can bind chr17:37852095-37852700.

In one aspect, the present application provides a kit that can comprise the nucleic acid described in the present application. For example, the kits of the present application may also contain other materials required for the kits.

In one aspect, the present application provides the application of the nucleic acid of the present application, and/or the kit of the present application, in the preparation of disease detection products. In one aspect, the present application provides the nucleic acid of the present application, and/or the kit of the present application, which can be used for disease detection. In one aspect, the present application provides a method for disease detection, which may include providing the nucleic acid of the present application, and/or the kit of the present application.

In one aspect, the application provides the nucleic acid of the application, and/or the kit of the application, which can be prepared to confirm the existence of the disease, assess the formation of the disease or the risk of formation, assess the progress and/or prognosis of the disease and/or screen for Therapy has an application in the product for the corresponding population. In one aspect, the present application provides the nucleic acid of the present application, and/or the kit of the present application, which can be used to confirm the existence of a disease, assess the formation of a disease or the risk of formation, assess the progression and/or prognosis of a disease and/or screen There is a corresponding population for treatment. In one aspect, the present application provides a method for confirming the presence of a disease, assessing the formation or risk of developing a disease, assessing the progression and/or prognosis of a disease and/or screening a population responding to treatment, which may comprise providing the nucleic acid of the present application, and /or the test kit of the present application. For example, a disease in this application may comprise a tumor. For example, diseases in this application may include solid tumors. For example, diseases in the present application may comprise melanoma, esophageal tumor, and/or breast tumor. For example, a disease in this application may comprise melanoma. For example, the diseases in the present application may include squamous cell carcinoma of the esophagus. For example, a disease in the present application may comprise breast cancer.

For example, any one or more of the methods of the present application may be for non-diagnostic purposes. For example, any one or more of the methods of the present application may be for diagnostic purposes.

In another aspect, the present application also provides a storage medium, which can record a program capable of running the method described in the present application.

In another aspect, the present application also provides a device comprising the storage medium described in the present application. For example, the non-transitory computer readable storage medium may include a floppy disk, a flexible disk, a hard disk, a solid state storage (SSS) (such as a solid state drive (SSD)), a solid state card (SSC), a solid state module (SSM)), an enterprise high-grade flash drives, tape, or any other non-transitory magnetic media, etc. Non-transitory computer readable storage media may also include punched cards, paper tape, cursor sheets (or any other physical media having a pattern of holes or other optically identifiable markings), compact disc read only memory (CD-ROM) , Rewritable Disc (CD-RW), Digital Versatile Disc (DVD), Blu-ray Disc (BD) and/or any other non-transitory optical media.

For example, the device as described in the present application further includes a processor coupled to the storage medium, and the processor is configured to execute based on the program stored in the storage medium to implement the method described in the present application. For example, the database system may implement various mechanisms to ensure that the methods described herein performed on the database system produce correct results. In this application, the database system may use disks as permanent data storage. In this application, the database system can provide database storage and processing services for multiple database clients. The database client may store database data across multiple shared storage devices, and/or may utilize one or more execution platforms with multiple execution nodes. The database system can be organized such that storage and computing resources can be effectively scaled indefinitely.

The method of the present application can accurately determine the hydroxymethylation site of the target gene, and realize the detection of a single gene site based on 5-hydroxymethylcytosine (5hmC), which can be used for disease detection, screening of people benefiting from standard disease treatment programs, Targeted drug benefit population screening. The detection method based on 5-hydroxymethylcytosine (5hmC) of the present application can be convenient, fast and accurate compared with existing target gene detection methods (such as IHC, FISH or multi-site detection).

Not intending to be limited by any theory, the following examples are only for explaining the methods and uses of the present application, and are not intended to limit the scope of the invention of the present application.

Example

Example 1 Single gene detection method based on 5-hydroxymethylcytosine (5hmC)

(1) 5-Hydroxymethylcytosine (5hmC) library establishment

plasma separation

1. Take whole blood (8mL) in 10mL Kangwei Company (CW2815M) cfDTM free nucleic acid blood collection tube, store at room temperature after taking blood;

2. For the first centrifugation, centrifuge at 1350g at 4°C for 12 minutes at low temperature, take out the light yellow supernatant and transfer it to a 2mL DNase free sterile centrifuge tube.

3. The second centrifugation, 13500g, 4 ℃ low temperature centrifugation for 5min, carefully remove the supernatant and transfer to 2-3 tubes of 2mL DNase free sterile centrifuge tubes, freeze in -80° refrigerator, you can get about 4-6mL clean plasma .

Plasma, urine and saliva cfDNA extraction

1. Use the Quick-cfDNA Serum&Plasma Kit (ZYMO, D4076), Quick-DNA Urine KIT (ZYMO, D3061), Quick-cfDNA Serum&Plasma Kit (ZYMO, D4076) kits to extract cfDNA from plasma, urine, and saliva samples , can extract about 8-10ng cfDNA from plasma, urine and saliva;

2. Use Qubit3.0 to measure the concentration of cfDNA.

End-fill cfDNA and ligate with sequencing adapters

According to the instructions of KAPA HyperPlus Library Preparation Kit (KK8514), the brief operation is as follows:

1. Prepare a reaction mixture containing 20 μL cfDNA, 2.8 μL End Repair&A-Tailing Buffer and 1.2 μL End Repair&A-Tailing Enzyme mix (total volume is 24 μL); incubate at 20°C for 30 minutes, then at 65°C for 30 minutes;

2. Configure the following ligation reaction mixture in a .5mL low-adsorption EP tube: 2 μL Nuclease free water (nuclease-free water), 12 μL Ligation Buffer and 4 μL DNA Ligase; add 2 μL sequencing KAPA index (PKR2015, PKR2016 and PKR2017), mixed, added to 24 μL reaction sample, heated at 20°C for 4 hours;

3. Use the DNA Clean&Concentrator 5 (ZYMO, D4014) purification kit to purify the reaction product, and use 20 μL of elution buffer to elute to obtain the final DNA ligation sample.

5hmC labeling

1. Prepare a labeling reaction mixture with a total volume of 4 μL: 1 μL 50uM UDP-N3-Glu (hmC labeling substrate), 2.5 μL βGT enzyme (NEB) and 2.5 μL HEPES buffer (pH 8.0, final concentration is 50 mM). Add 6 μL labeling mix to 20 μL DNA ligation sample. Place the mixture in a water bath at 37°C for 1 hour;

2. Take out the mixture and purify the reaction product with DNA Clean&Concentrator 5 (ZYMO, D4014) purification kit to obtain 30 μL of purified DNA;

3. Then add 1 μL 45uM DBCO-PEG4-Biotin (Click Chemistry Tools) to the above-mentioned purified 30 μL DNA, and bathe in water at 37°C for 1 hour;

4. Purify the reaction product with DNA Clean&Concentrator 5 (ZYMO, D4014) purification kit to obtain 30 μL of purified labeled product.

5hmC enrichment

1. Equilibrate the bound magnetic beads according to the following steps: take out 2.5 μL Dynabeads (Invitrogen, 65306) and add 100 μL washing buffer (5mM Tris (pH 7.5), 1M NaCl and 0.02% Tween20), blow and mix, place in 1.5mL magnetic On the rack, wash the bound magnetic beads with 100 μL washing buffer repeatedly for 3 times, finally add 100 uL washing buffer, mix the magnetic beads, and vortex for 30 min;

2. After 30min, wash the magnetic beads with 100uL washing buffer 3 times, and finally add 32μL binding buffer (10mM Tris (pH 7.5), 2M NaCl and 0.04% Tween20), and mix well;

3. Add the purified labeled product obtained in the above steps to the magnetic bead mixture, and mix in a rotary mixer for 30 minutes to fully combine;

4. Finally, wash the magnetic beads 5 times with 100 μL washing buffer, and add 23.8 μL RNase-Free water.

PCR amplification

1. Add 25 μL 2×PCR master mix and 1.25 μL PCR primers (total volume is 50 μL) to the final system of the above steps, and perform amplification according to the temperature and conditions of the PCR reaction cycle as described below:

2. The amplified product was purified with AmpureXP beads (KAPA, KK8001), and finally eluted with 20uL eluent to obtain the final 5hmC library. Library concentration determination can be performed with Qubit 3.0.

(2) Single point screening of the target gene

High-throughput sequencing after quality control of the 5hmC library

1. Perform quality control of the obtained 5hmC library on the Fragment AnalyzerTM automatic capillary electrophoresis system (kit: DNF-900; use software: Fragment Analyzer instrument control software, PROSize data analysis software) to determine the size of the DNA fragments in the library and whether it contains impurities (Library size is about 300bp);

2. Perform qPCR concentration determination (kit: KAPA SYBR FAST Universal qPCR Kit (KK4601)) to determine whether the sample library meets the sequencing standards on the machine;

Specific steps:

a. Preparation of samples: prepare five 1.5mL EP tubes, and mix every 4 samples to be sequenced into one EP tube. There are 20 samples in 5 tubes (index cannot be repeated); each 5hmC library sample absorbs 5ng, and each EP The total volume of the tube is 20uL, and the final concentration is 1ng/uL;

b. The sample reaction system (20uL) is as follows: draw 4uL of the library in each EP tube for qPCR quantification.

反应物Reactant	体积(uL)Volume (uL)
KAPA SYBR FAST qPCR Master Mix(2X)KAPA SYBR FAST qPCR Master Mix(2X)	1010
Library Quantification Primer Premix(10X)Library Quantification Primer Premix(10X)	1.61.6
ROX Reference Dye High(50X)ROX Reference Dye High(50X)	0.40.4
RNase-Free waterRNase-Free water	44
5hmC文库5hmC library	44

c.qPCR program settings:

d. Result analysis: analyze according to the qPCR operating software to determine whether the 5hmC library is degraded and whether it meets the sequencing requirements;

3. The library (16uL) that passed the quality inspection was sequenced with Illumina NextSeq500, the sequencing kit used was High Output Kit v2 (75cycles), the sequencing throughput of each sample was 1.5Gb, and the sequencing band size was 75bp.

Raw sequencing data comparison

1. Each original sequencing FASTQ data is first trimmed with low-quality data using Trimmomatic software, and then compared to the human genome hg19 using Bowtie2 software;

2. Use MACS software to identify the peak number of reads containing 5hmC, the parameters are: effective genome size = 2.72e+09; tag size = 38; band width = 100; model fold = 10; P value cutoff = 1.00e-05, And use this to call peaks and generate counts files;

3. Use the DEseq2 software to compare the counts files from different samples, find the 5hmC peak area with more than 50 reads, press |log2FoldChange|>=0.5, pvalue<0.05, and screen out the differential biomarkers of 5hmC up- and down-regulation respectively.

Hydroxymethylation Site Screening

1. Determine the clinical sample grouping: According to the results of clinical immunohistochemistry (IHC), fluorescence in situ hybridization (FISH) and other methods to detect drug treatment targets, clinical samples are divided into positive and negative groups;

2. Through the comparative analysis of the positive group and the negative group, filter the 5hmC differential markers according to the screening conditions of |log2FoldChange|>=0.5, pvalue<0.05, and find the corresponding hydroxymethylation sites of PD-L1, EGFR, HER2, etc.;

3. Synthesize primers for hydroxymethylation sites such as PD-L1, EGFR, HER2 (Qingke Biotechnology Co., Ltd.), for example, the corresponding site of the following PD-L1 primer can be chr9:5449218-5450100, for example, the following EGFR The site corresponding to the primer may be chr7:55127173-55127790, for example, the site corresponding to the following HER2 primer may be chr17:37852095-37852700.

(3) Gene detection based on cfDNA hydroxymethylation unit site

Sample system preparation (20uL)

1. The amount of 5hmC library added to the sample is 10ng, the standard primer concentration is 10uM, and the dye method master mix (Yongnuo, S0200020301);

反应物Reactant	体积(μL)Volume (μL)
样本sample	Xx

RNase-Free waterRNase-Free water	9.2减去X9.2 minus X
引物F1Primer F1	0.40.4
引物F2Primer F2	0.40.4
染料预混液dye master mix	1010

droplet generation

1. Use Yongnuo sample preparation general consumables (S0100010101) for chip preparation, add 50uL droplet generating oil to the first row of 8 holes of the chip, add 20uL sample system to the second row of 8 holes of the chip, and then add 5uL of sealant Added to the second row of sample wells;

反应物Reactant	体积(μL)Volume (μL)	芯片位置chip location
微滴生成油 droplet generating oil	5050	第一排first row
样本体系sample system	2020	第二排second row
密封剂Sealants	55	第二排second row

2. Use Yongnuo MicroDrop-100 digital PCR system for microdroplet generation;

Sealing film

1. Transfer the prepared microdroplet (50uL) to a 96-well PCR plate (S0100030101), and attach a membrane;

2. Use Yongnuo MicroDrop-100 digital PCR system to seal the film at 190°C high temperature;

PCR amplification

1. PCR amplification procedure:

2. Perform PCR amplification on the sample;

Digital PCR detection

1. Use Yongnuo MicroDrop-100 digital PCR system to detect and analyze PCR products.

Example 2 Melanoma clinical sample test results

1. Sample collection and 5hmC-Seal sequencing:

Blood samples were collected from 49 melanoma patients, including 14 PD-L1 positive patients and 35 negative patients. Take the peripheral blood samples (8-10mL) of the above 49 melanoma patients, and separate the plasma (4-5mL), extract cfDNA from the plasma for 5hmC-Seal high-throughput sequencing, and the sequencing throughput of each sample is 1.5Gb , the size of the sequencing band is 75bp;

2. Screening of hydroxymethylation differential markers:

According to the results of PD-L1 detection by clinical immunohistochemistry (IHC), the clinical samples were divided into two groups: PD-L1 positive and negative; through the comparative analysis between the positive group and the negative group, according to |log2FoldChange|>=0.5, pvalue< The 0.01 screening condition screens 5hmC differential markers to find the hydroxymethylation site (CD274) corresponding to the PD-L1 gene;

3. Synthesize CD274 (PD-L1) hydroxymethylation site primers (Qingke Biotechnology Co., Ltd.), for example, the site corresponding to the following PD-L1 primers can be chr9:5449218-5450100.

4. Digital PCR single gene detection based on CD274 hydroxymethylation site

The amount of 5hmC library input for each melanoma patient was 10ng, and four groups of experimental cohorts were designed: blank control group (Blank control), negative control group (Negative control), PD-L1 positive group (PD-L1+) and PD-L1 Negative group (PD-L1-); Among them, the blank control group is RNase-Free water, and the sample volume is 9.2uL. The negative control group was a melanoma cfDNA sample (without 5hmC enrichment), and the loading amount was 10 ng.

5. Results, Figure 1 shows the copy number (copies of ng) of PD-L1 hydroxymethylation site (CD274) single gene detection in the plasma cell-free DNA 5hmC library of 49 melanoma patients; among them, PD-L1 There was a significant difference (p<0.01) between the positive group (PD-L1+) and the PD-L1 negative group (PD-L1-).

Example 3 Esophageal squamous cell carcinoma clinical sample test results

1. Sample collection and 5hmC-Seal sequencing:

Blood samples were collected from 56 patients with esophageal squamous cell carcinoma, including 34 EGFR-positive patients and 22 EGFR-negative patients. Peripheral blood samples (8-10mL) were collected from the above 56 patients with esophageal squamous cell carcinoma, and plasma (4-5mL) was separated, and cfDNA was extracted from the plasma for 5hmC-Seal high-throughput sequencing. The sequencing throughput of each sample was 1.5 Gb, the size of the sequencing band is 75bp;

2. Screening of hydroxymethylation differential markers:

According to the results of clinical immunohistochemical (IHC) detection of EGFR, the clinical samples were divided into EGFR positive and negative groups; through the comparative analysis of the positive group and the negative group, filter according to |log2FoldChange|>=0.5, pvalue<0.01 5hmC differential markers, find the hydroxymethylation site corresponding to the EGFR gene;

3. Synthesize EGFR hydroxymethylation site primers (Qingke Biotechnology Co., Ltd.), for example, the site corresponding to the following EGFR primers can be chr7:55127173-55127790.

4. Digital PCR single gene detection based on EGFR hydroxymethylation site

The amount of 5hmC library input for each patient with esophageal squamous cell carcinoma was 10 ng, and four groups of experimental cohorts were designed: blank control group (Blank control), negative control group (Negative control), EGFR positive group (EGFR+) and EGFR negative group (EGFR- ); wherein, the blank control group was RNase-Free water, and the loading volume was 9.2uL. The negative control group was esophageal squamous cell carcinoma cfDNA samples (without 5hmC enrichment), and the loading amount was 10 ng.

5. Results, Figure 2 shows the copy number (copies of ng) of EGFR hydroxymethylation site single gene detection in the plasma cell-free DNA 5hmC library of 56 patients with esophageal squamous cell carcinoma; among them, the EGFR positive group (EGFR+) and Compared with EGFR-negative group (EGFR-), there was a significant difference (p<0.01).

Example 4 Breast cancer clinical sample test results

1. Sample collection and 5hmC-Seal sequencing:

Blood samples were collected from 36 breast cancer patients, including 16 HER2 (ERBB2) positive patients and 20 negative patients. Take the peripheral blood samples (8-10mL) of the above 36 breast cancer patients, and separate the plasma (4-5mL), extract cfDNA from the plasma for 5hmC-Seal high-throughput sequencing, and the sequencing throughput of each sample is 1.5Gb , using a paired-end 75bp sequencing strategy;

2. Screening of hydroxymethylation differential markers:

According to the results of HER2 detection by clinical immunohistochemistry (IHC), the clinical samples were divided into HER2 positive and negative groups; through the comparative analysis of the positive group and the negative group, filter according to |log2FoldChange|>=0.5, pvalue<0.01 5hmC differential markers, find the hydroxymethylation site corresponding to HER2 (ERBB2);

3. Synthesize ERBB2 hydroxymethylation site primers (Qingke Biotechnology Co., Ltd.), for example, the site corresponding to the following ERBB2 primers can be chr17:37852095-37852700.

4. Digital PCR single gene detection based on ERBB2 hydroxymethylation site

The 5hmC library input amount for each breast cancer patient was 10ng, and four experimental cohorts were designed: blank control group (Blank control), negative control group (Negative control), HER2 positive group (HER2+) and HER2 negative group (HER2-) ; Among them, the blank control group was RNase-Free water, and the loading volume was 9.2uL. The negative control group was breast cancer cfDNA samples (without 5hmC enrichment), and the loading amount was 10ng.

5. Results, Figure 3 shows the copy number (copies of ng) of the HER2 hydroxymethylation site (ERBB2) single gene detection in the plasma cell-free DNA 5hmC library of 36 breast cancer patients; among them, the HER2 positive group (HER2+ ) compared with the HER2-negative group (HER2-) had a significant difference (p<0.01).

The foregoing detailed description has been offered by way of explanation and example, not to limit the scope of the appended claims. Variations on the presently enumerated embodiments of the present application will be apparent to those of ordinary skill in the art and remain within the scope of the appended claims and their equivalents

Claims

An analysis method, comprising (S1) determining the region to be tested based on the quantity and/or presence of hydroxymethylcytosine in a clinical test-positive sample and a clinical test-negative sample of a target gene, and (S2) detecting the said sample to be tested The amount and/or presence of said hydroxymethylcytosine in the region to be tested.
A method for confirming the presence of a disease, assessing the formation or risk of developing a disease, assessing the progression and/or prognosis of a disease, and/or screening a population responding to treatment, comprising (S1) a positive clinical test sample based on a target gene and a clinical test The quantity and/or presence of hydroxymethylcytosine in the negative sample, determining the region to be tested, (S2) detecting the quantity and/or presence of hydroxymethylcytosine in the region to be tested in the sample to be tested.
The method according to any one of claims 1-2, based on the quantity and/or presence of said hydroxymethylcytosine in said clinical test positive sample and said clinical test negative sample of a single target gene, determine the the area to be tested.
The method according to any one of claims 1-3, wherein the step (S1) comprises a step (S1-1): determining the clinical test-positive samples and the clinical test-negative samples of the target gene.
The method according to any one of claims 1-4, wherein the clinically positive samples and the clinically negative samples are determined by immunohistochemistry and/or fluorescence in situ hybridization.
The method according to claim 5, wherein said immunohistochemical staining score is judged according to the standard of antibody staining signal.
The method according to any one of claims 5-6, wherein the fluorescence in situ hybridization method ratio is calculated according to the standard of fluorescent probe signal.
The method according to any one of claims 1-7, wherein said step (S1) comprises a step (S1-2): determining said clinical test-positive sample and said clinical test-negative sample by a hydroxymethylation sequencing method The number of nucleic acid fragments containing hydroxymethylcytosine in the same region.
The method according to claim 8, wherein the hydroxymethylation sequencing method comprises the following steps: (S1-2a) extracting nucleic acid fragments in the sample, (S1-2b) marking the nucleic acid fragments containing hydroxymethylcytosine (S1-2c) enriching the nucleic acid fragments containing hydroxymethylcytosine, (S1-2d) sequencing the enriched nucleic acid fragments containing hydroxymethylcytosine.
The method of claim 9, said labeling comprising contacting said nucleic acid fragment with DNA β-glucosyltransferase and UDP glucose modified with a chemoselective group.
The method of claim 10, said chemoselective group comprising an azido group.
The method of any one of claims 10-11, said labeling further comprising contacting said nucleic acid fragment bearing a chemoselective group with biotin comprising biotin capable of reacting with said chemoselective group.
The method of claim 12, said biotin capable of reacting with said chemoselective group comprising dibenzocyclooctyne modified biotin.
The method of any one of claims 9-13, said enriching comprising contacting said nucleic acid fragments with biotin with magnetic beads comprising streptavidin.
The method according to any one of claims 9-14, wherein said enriching comprises magnetically separating magnetic beads bearing said hydroxymethylcytosine nucleic acid fragments.
The method according to any one of claims 1-15, wherein said step (S1) comprises a step (S1-3): determining that differential hydroxymethyl groups are contained in said clinical test positive sample and said clinical test negative sample The region of cytosine is used as the region to be detected.
The method of claim 16, wherein the region of differential hydroxymethylcytosine comprises, said clinical test positive sample, compared to said clinical test negative sample, said region comprises hydroxymethylcytosine Regions with significantly increased and/or significantly decreased numbers of nucleic acid fragments.
The method according to any one of claims 16-17, by determining the multiple of difference in the number of nucleic acid fragments comprising hydroxymethylcytosine in the same region in the clinical test positive sample compared to the clinical test negative sample, Determine the area to be tested.
The method according to claim 18, wherein the multiple of difference is related to the following statistical value: the difference in the number of nucleic acid fragments containing hydroxymethylcytosine in the same region in the positive sample of the clinical test compared to the negative sample of the clinical test value.
The method of any one of claims 18-19, wherein the fold difference is related to the statistic that the clinical test positive sample contains hydroxymethylcytosine in the same region compared to the clinical test negative sample The log2-processed ratio of the number of nucleic acid fragments.
The method of any one of claims 18-20, wherein the fold difference is related to the statistic that the clinical test positive sample contains hydroxymethylcytosine in the same region compared to the clinical test negative sample The absolute value of the ratio of the number of nucleic acid fragments after log2 processing.
The method according to any one of claims 16-21, when the ratio log2 of the number of nucleic acid fragments containing hydroxymethylcytosine in the same region of the clinical test-positive sample compared to the clinical test-negative sample is processed When the absolute value of is 0.5 or more, the region is determined to be the region to be tested.
The method according to any one of claims 16-22, when the difference between the clinical test positive sample and the clinical test negative sample in the same area is less than 0.05, it is determined that the area is the area to be tested .
The method according to claim 23, determining the significance of the difference by a significance test method of T test.
The method according to any one of claims 1-24, wherein said step (S2) comprises detecting the quantity of said hydroxymethylcytosine and/or exist.
The method according to claim 25, wherein the sample to be tested is sequenced by a method selected from the following group: digital PCR and high-throughput sequencing.
An analysis method, comprising based on a single target gene, detecting the quantity and/or presence of hydroxymethylcytosine in the region to be tested of the single target gene of the sample to be tested by means of digital PCR.
A method for confirming the presence of a disease, assessing the formation or risk of developing a disease, assessing the progression and/or prognosis of a disease and/or screening a population responding to treatment, comprising detecting a sample to be tested by means of digital PCR based on a single target gene The amount and/or presence of hydroxymethylcytosine in the region to be tested.
The method according to any one of claims 27-28, wherein the region to be tested is determined by the method according to any one of claims 1-26.
A nucleic acid comprising a sequence capable of binding to the region to be tested determined by the method of any one of claims 1-26, or a complementary region thereof, or a fragment thereof.
A method for preparing nucleic acid, comprising the region to be tested determined according to the method of any one of claims 1-26, or its complementary region, or the sequence of the above-mentioned fragment, designed to be able to bind to the region to be tested, or The nucleic acid of its complementary region, or the above-mentioned fragment.
A kit comprising the nucleic acid according to claim 30.
The use of the nucleic acid according to claim 30, and/or the kit according to claim 32, in the preparation of disease detection products.
Nucleic acid as claimed in claim 30, and/or test kit as claimed in claim 32, in the preparation confirming the existence of disease, assessing disease formation or forming risk, assessing the progression and/or prognosis of disease and/or screening for treatment There are applications in the products of the corresponding crowd.
A database comprising the sequence of the region to be tested determined by the method of any one of claims 1-26, or its complementary region, or the above-mentioned fragments.
A storage medium recording a program capable of executing the method according to any one of claims 1-29.
An apparatus comprising the storage medium of claim 36.
The device according to claim 37, further comprising a processor coupled to the storage medium, the processor configured to execute based on a program stored in the storage medium to implement any one of claims 1-29 method described in the item.