WO2022098619A1 - Compositions and methods for improving cancer therapy - Google Patents

Abstract

The present disclosure relates to compositions and methods for cancer therapy. In particular, the present disclosure relates to compositions and methods for identifying subjects for treatment with cancer immunotherapy.

Description

COMPOSITIONS AND METHODS FOR IMPROVING CANCER THERAPY

CROSS-REFERENCE TO RELATED APPLICATION(S)

This application claims the benefit of U.S. Provisional Patent Application No. 63/110,752, filed on November 6, 2020, the entire contents of which are hereby incorporated by reference.

FIELD

The present disclosure relates to compositions and methods for cancer therapy. In particular, the present disclosure relates to compositions and methods for identifying subjects for treatment with cancer immunotherapy.

BACKGROUND

Breast cancer is the second most common form of cancer among women in the U.S., and the second leading cause of cancer deaths among women. While the 1980s saw a sharp rise in the number of new cases of breast cancer, that number now appears to have stabilized. The drop in the death rate from breast cancer is probably due to the fact that more women are having mammograms. When detected early, the chances for successful treatment of breast cancer are much improved.

Breast cancer, which is highly treatable by surgery, radiation therapy, chemotherapy, and hormonal therapy, is most often curable when detected in early stages. Mammography is the most important screening modality for the early detection of breast cancer. Breast cancer is classified into a variety of sub-types, but only a few of these affect prognosis or selection of therapy. Patient management following initial suspicion of breast cancer generally includes confirmation of the diagnosis, evaluation of stage of disease, and selection of therapy. Diagnosis may be confirmed by aspiration cytology, core needle biopsy with a stereotactic or ultrasound technique for nonpalpable lesions, or incisional or excisional biopsy. At the time the tumor tissue is surgically removed, part of it is routinely processed for determination of estrogen receptor (ER), progesterone receptor (PR) and human epidermal receptor 2 (HER-2) levels, and more recently for mutations in selected genes, most precisely PIK3CA.

Prognosis and selection of therapy are influenced by the age of the patient, menopausal status and general health, and stage of the disease, pathologic characteristics of the primary tumor including the presence of tumor grade, and ER, PgR, and HER2 levels in the tumor tissue and measures of proliferative capacity, such as Ki67.

The three major treatments for breast cancer are surgery, radiation, and drug therapy. No treatment fits every patient, and often two or more are required. The choice is determined by many factors, including the age of the patient and her menopausal status, the type of cancer (e.g., ductal vs. lobular), its stage including whether it is totally in situ or is invasive (infiltrative) into surrounding normal tissue and if so, whether it has spread to regional lymph nodes or if it has spread to other sites of the body, such as bone, liver, lung, etc, a condition known as metastatic breast cancer. The type of therapy given is chosen based on ER, PgR, HER2, and more recently on mutational status of certain genes, such as PIK3CA.

Breast cancer treatments are defined as local or systemic. Surgery and radiation are considered local therapies because they directly treat the tumor, breast, lymph nodes, or other specific regions. Drug treatment is called systemic therapy, because its effects are widespread. Drug therapies include classic chemotherapy drugs, and hormone blocking treatment if the cancer expresses ER and/or PgR(e.g., aromatase inhibitors, selective estrogen receptor modulators, and estrogen receptor downregulators), and anti-HER2 treatments if the cancer is positive for HER2. They may be used separately or, most often, in different combinations.

There is a need for additional treatments, particularly treatments customized to a patient’s tumor.

SUMMARY

The present disclosure relates to compositions and methods for cancer therapy. In particular, the present disclosure relates to compositions and methods for identifying subjects for treatment with cancer immunotherapy with immune checkpoint inhibitors, specifically those directed against the programmed cell death 1 (PD1) and its ligand 1 (PD-L1) system.

The disclosure relates to selecting and monitoring treatment with checkpoint inhibitors. In particular, the disclosure relates to using pre-treatment circulating tumor cell (CTC) and/or platelet levels to select patients likely to benefit from checkpoint therapy. It also relates to using serial CTC and/or platelet PD-L1 levels as pharmacodynamics monitoring biomarkers, using changes in CTC and/or platelet PD- LI levels to determine if a patient is likely to benefit after he/she has started therapy, and to use changes in CTC and/or platelet PD-L1 levels to determine if anti-PD LI therapy is no longer effective (to alter or end treatment).

For example, in some embodiments, provided herein is a method of treating cancer, comprising: a) measuring the level of PD-L1 expression on CTCs and/or platelets (e.g., CTCs and platelets); and b) administering immune checkpoint therapy when the level of PD-L1 on said CTCs and/or platelets is above a threshold level. In some embodiments, the measuring comprises contacting the CTCs and platelets with an antibody that specifically binds to PD-L1 (e.g., staining the CTCs and platelets with the antibody). In some embodiments, the measuring comprises fluorescence activated cell sorting, a multiplex PCR method, an immunomagnetic assay, or fluorescent staining of CTC and platelets captured on other solid phase platforms, such as glass slides or micro-filters. In some embodiments, the method is repeated one or more times and regular or irregular time intervals. In some embodiments, immune checkpoint therapy is altered (e.g., started or stopped) based on the results. In some embodiments, the method further comprises measuring the levels of PD-L1 on leucocytes.

Further embodiments provide a method for treating a subject for cancer, the method comprising the steps of: a) identifying the level of PD-L1 expression on CTCs and/or platelets (e.g., CTCs and platelets) by obtaining or having obtained a blood sample from the subject; and performing or having performed an assay on the blood to determine the presence or level of expression of PD-L1 on CTCs and platelets in the sample; and b) administering immune checkpoint therapy to the subject when the level of PD-L1 on the CTCs and/or platelets is above a threshold level.

Additional embodiments provide a method of treating a subject, comprising: administering immune checkpoint therapy to a subject when the level of PD-L1 on CTCs and/or platelets (e.g., CTCs and platelets) in a sample from the subject is above a threshold level.

Yet other embodiments provide a method for determining a treatment course of action, comprising a) measuring the level of PD-L1 expression on CTCs and/or platelets (e.g., CTCs and platelets); and b) determining a treatment course of action based on the level of PD-L1 on the CTCs and/or platelets.

The present disclosure is not limited to particular immune checkpoint therapies. For example, in some embodiments, the immune checkpoint therapy is anti- PD-L1 or anti-PD-L therapy. In some embodiments, the immune checkpoint therapy is one or more of a small molecule (e.g., CA-170), an antibody (e.g., atezolizumab, avelumab, durvalumab, pembrolizumab, nivolumab, cemiplimab, spartalizumab, camrelizumab, sintilimab, tislelizumab, toripalimab, dostarlimab, INCMGA00012, AMP-224, AMP-514, CK-301, or KN035), a peptide (e.g., AUNP12 or BMS- 986189), or a nucleic acid (e.g., a siRNA, an antisense, an shRNA, or a miRNA).

The present disclosure is not limited to particular threshold levels. In some embodiments, the threshold level is one or more CTCs in a sample that express PD- L1 on its surface at a level of l-3⁺ using a visual scale, and/or platelets positive for PD-L1 greater than 100 in a sample, using a visual scale. In some embodiments, the threshold level is determined using an automated system (e.g., comprising one or more of a camera, a computer processor, and a user interface).

The present disclosure is not limited to particular cancers. The compositions and methods described herein find use in any cancer treated with checkpoint immunotherapy. In some embodiments, immune checkpoint therapy is administered in combination with other cancer therapies (e.g., chemotherapy, additional immunotherapies, radiation, etc.).

In some embodiments, the measuring step is repeated one or more times. For example, in some embodiments, the measuring step is repeated after administration of immune checkpoint therapy. In some embodiments, treatments are altered based on the results of the measuring.

Additional embodiments are described herein.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 shows CTC Enumeration and CTC-PD-L1 Expression at timepoint-1 (near or prior to initiating a new systemic therapy for cancer). A. Distribution of CTC enumeration. Each bar represents the number of CTC in an individual patient sample. B. Distribution of CTC-PD-L1 staining. Colors represent the percent of CTC that expressed PD-L1, on a scale of 0-3+. 0 (■ blue), 1+ (■ red), and 2+ (■ green).

FIG. 2 shows CTC-PD-L1 expression at serial timepoints. A. Patients (N=5) that maintained CTC-PD-L1 positivity from timepoint-1 to subsequent timepoints. B. Patients (N=9) that converted CTC-PD-L1 negative to positive from timepoint-1 to subsequent timepoints. C. Patients (N=4) that converted CTC-PD-L1 positive to negative from timepoint-1 to subsequent timepoints. D. Patients (N=3) that had fluctuating CTC-PD-L1 expression among multiple timepoints.

FIG. 3 shows platelet-PD-Ll expression at serial timepoints. A. Patients (N=10) that maintained platelet-PD-Ll positive from timepoint- 1 to subsequent timepoints. B. Patients (N=2) that converted from having platelet-PD-Ll positive to platelet-PD-Ll negative at subsequent timepoints. C. Patient (N=l) that had platelet- PD-Ll expression fluctuating among multiple timepoints. D. Patients (N=15) that converted from platelet-PD-Ll negative at timepoint- 1 to platelet-PD-Ll positive at subsequent timepoints.

FIG. 4 shows a semi-quantitative scale of PD-L1 expression on cultured human breast cancer cells spiked in healthy blood and retrieved using the CellSearch® system.

FIG. 5 shows platelet-PD-Ll staining. A. CellSearch® thumbnail images from a patient with CTC-PD-L1 positive as well as platelet-PD-Ll positive. B. Contents from the CellSearch® cartridge from patient with CellSearch® platelet-PD-Ll positive illustrated in panel A. Yellow arrows point to PD-L1 positive platelets costained with additional antibodies for platelet specific markers CD-42b/CD-41 (APC/Cy7 conjugated). C. CellSearch® thumbnail images from a patient with platelet-PD-Ll negative and as well as CTC-PD-L1 negative. D. Contents from the CellSearch® cartridge of patient with CellSearch® platelet-PD-Ll negative illustrated in panel C. Yellow arrows point to PD-L1 negative platelets stained with additional antibodies for platelet specific markers CD-42b/CD-41 (APC/Cy7 conjugated).

FIG. 6 shows the effect of fixative in whole blood collection tubes on platelet- PD-Ll staining. A. Image illustrating CellSearch® platelet-PD-Ll positivity in patient sample for which whole blood was collected into CellSave tube containing fixative. B. Image illustrating CellSearch® Platelet-PD-Ll positivity in the same patient sample for which whole was collected into EDTA tube not containing fixative.

FIG. 7 shows PD-L1 expression on platelets. A. Fluorescent image of positive platelet-PD-Ll (PE conjugated) expression obtained from initial whole blood processed through CellSearch® using the classic method. B. Fluorescent images of PD-L1 (PE conjugated), cytokeratin (FITC-conjugated), CD-45 (APC conjugated), and DNA (DAPI) for platelet pellet from patient in panel A with positive platelet-PD- Ll processed through CellSearch®. C. Fluorescent images of PD-L1 (PE conjugated), cytokeratin (FITC-conjugated), CD-45 (APC conjugated), and DNA (DAPI) for platelet poor plasma from patient in panel A with positive platelet-PD-Ll processed through CellSearch®. D. Florescent image of negative platelet-PD-Ll (PE conjugated) expression obtained from initial whole blood processed through CellSearch® using the classic method. E. Florescent images of PD-L1 (PE conjugated), cytokeratin (FITC-conjugated), CD-45 (APC conjugated), and DNA (DAPI) for platelet pellet from patient in panel D with negative platelet-PD-Ll processed through CellSearch®. F. Florescent images of PD-L1 (PE conjugated), cytokeratin (FITC-conjugated), CD-45 (APC conjugated), and DNA (DAPI) for platelet poor plasma processed from patient in panel D with negative platelet-PD-Ll through CellSearch®.

FIG. 8 shows semi-quantitative scale of platelets-PD-Ll positivity per CellSearch® frame. A. CellSearch® thumbnail images, with each row representing a single cell and each column representing fluorescence of protein markers. B. A single frame within a CellSearch® cartridge. C. Examples of CellSearch® frames with platelet-PD-Ll staining count of >1,000, 100-1,000, <100, and 0.

FIG. 9 shows PD-L1 sensitivity and specificity of antibody clone 29E.2A3 for PD-L1. A. Western blot of cell lysates from cultured human breast cancer cell lines known to express (MDA-MB-231) or not to express PD-L1 (MCF-7) using E1L3N Rabbit mAb, confirming the PD-L1 status of these two cell lines. B. PD-L1 protein expression by Western blot of lysates of MDA-MB-231 cell line (PD-L1 positive) treated with siRNA against PD-L1. C. PD-L1 gene expression analysis of MDA-MB- 231 cell lines treated with siRNA against PD-L1. Clones of MDA-MB-231 cells treated with siRNA against PD-L1 as described in B above, confirming the success of the PD-L1 knock down process. D. CellSearch® Thumbnail gallery images of PD-L1 protein expression on siRNA (clone s26547) treated MDA-MB-231 cell line (see details in B above). E. PD-L1 protein expression when processed by CellSearch® on MDA-MB-231 cell lines (wild type and PD-L1 siRNA treated cell lines (see details in B above).

FIG. 10 shows PD-L1 expression on cultured breast cancer cell lines spiked into healthy donor whole blood and processed through CellSearch®. A. MDA-MB- 231: 97.5% of cells were strongly PD-L1 positive (2+), 2.5% of cells were PD-L1 negative (0). B. MDA-MB-468: 7.4% of cells were strongly PD-L1 positive (2+), 6.6% of cells were weakly PD-L1 positive (1+), and 86% of cells were PD-L1 negative (0). C. Sk-Br-3: 3% of cells were strongly PD-L1 positive (2+), 6% of cells were weakly PD-L1 positive (1+), and 91% of cells were PD-L1 negative (0). D. BT- 474: 0.01% of cells were weakly PD-L1 positive (1+), and 99.99% of cells were PD- L1 negative (0). E. MCF-7: 100% of cells were PD-L1 negative (0).

DEFINITIONS

To facilitate an understanding of the present disclosure, a number of terms and phrases are defined below:

As used herein, the terms “detect”, “detecting”, or “detection” may describe either the general act of discovering or discerning or the specific observation of a composition.

As used herein, the term “metastasis” is meant to refer to the process in which cancer cells originating in one organ or part of the body relocate to another part of the body and continue to replicate. Metastasized cells subsequently form tumors which may further metastasize. Metastasis thus refers to the spread of cancer from the part of the body where it originally occurs to other parts of the body.

The term “neoplasm” as used herein refers to any new and abnormal growth of tissue. Thus, a neoplasm can be a non-malignant neoplasm, a premalignant neoplasm or a malignant neoplasm. The term “neoplasm-specific marker” refers to any biological material that can be used to indicate the presence of a neoplasm. Examples of biological materials include, without limitation, nucleic acids, polypeptides, carbohydrates, fatty acids, cellular components (e.g., cell membranes and mitochondria), and whole cells.

As used herein, the term “non-human animals” refers to all non-human animals including, but not limited to, vertebrates such as rodents, non-human primates, ovines, bovines, ruminants, lagomorphs, porcines, caprines, equines, canines, felines, aves, etc.

"Amelioration" or "ameliorate" or "ameliorating" refers to a lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. The severity of indicators may be determined by subjective or objective measures.

As used herein, the term “co-administration” refers to the administration of at least two agent(s) (e.g., checkpoint inhibitor and an additional anti-cancer agent) or therapies to a subject. In some embodiments, the co-administration of two or more agents/therapies is concurrent. In other embodiments, a first agent/therapy is administered prior to a second agent/therapy. Those of skill in the art understand that the formulations and/or routes of administration of the various agents/therapies used may vary. The appropriate dosage for co-administration can be readily determined by one skilled in the art. In some embodiments, when agents/therapies are coadministered, the respective agents/therapies are administered at lower dosages than appropriate for their administration alone. Thus, co-administration is especially desirable in embodiments where the co-administration of the agents/therapies lowers the requisite dosage of a known potentially harmful (e.g, toxic) agent(s).

As used herein, the term "sample" is used in its broadest sense. In one sense, it is meant to include a specimen or culture obtained from any source, as well as biological and environmental samples. Biological samples may be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include blood products (e.g., plasma, serum), tissue, urine, saliva, stool, and the like. Environmental samples include environmental material such as surface matter, soil, water, crystals and industrial samples. Such examples are not however to be construed as limiting the sample types applicable to the present disclosure.

DETAILED DESCRIPTION

The present disclosure relates to compositions and methods for cancer therapy. In particular, the present disclosure relates to compositions and methods for identifying subjects for treatment with cancer immunotherapy.

Immune checkpoint inhibition (ICPi) with antibodies to programmed cell death 1 (PD1) and its ligand (PD-L1) is effective in several malignancies (1, 2). PD- L1 expression on tumor or infiltrating immune cells in malignant tissue predicts benefit from anti-PD-Ll/PDl therapies (3). Other predictors of response to ICPi include presence of tumor infiltrating lymphocytes, human leukocyte antigen (HLA) status, high tumor mutation burden or surrogates of it, antigen presenting cells, and the host microbiome (4-6).

PD-L1 expression is dynamic. However, tissues tested for PD-L1 are often collected at time periods long before the patient is treated with ICPi therapy and almost never serially during treatment (3). Evaluation of circulating tumor biomarkers in blood may provide real-time estimates of tumor status (7). Elevated circulating tumor cell (CTC) enumeration is prognostic in several metastatic epithelial cancers (8-11). In experiments conducted during development of the present disclosure, PD- L1 staining of platelets was observed. Further experiments confirmed PD-L1 expression on CTC at timepoint-1 in 17% of patients with MBC. Forty two percent of these patients had ≥5 CTC/7.5ml WB (9, 24, 25). Of these, 40% were CTC-PD-L1 positive.

In multi-variable analyses, CTC-PD-L1 expression was less likely to be observed in patients with bone metastases compared to those without bone metastases. By univariable analyses, CTC-PD-L1 expression was more likely observed in patients currently receiving or had recently progressed on ET, especially when given in combination with a CDK4/6 inhibitor, at the time of 1st blood draw. Enigmatically, in multi- but not uni-variable analysis, CTC-PD-L1 was more likely to be observed in ER+ and HER2+ MBC. The paradoxical finding of CTC-PD-L1 association with ER negativity in uni-variable but with positivity in multi-variable analyses is unexplained, but may indicate that positivity is associated with some other feature, such as multiple prior lines of therapy and/or the cancer’s becoming refractory to ET.

Platelet-PD-Ll expression was observed in 28% of the patients with MBC. Platelet-PD-Ll staining was associated with elevated CTC levels, but was independent of CTC-PD-L1 expression. Expression of platelet-PD-Ll was highly heterogeneous among different MBC patients, and unlike CTC-PD-L1 positivity, it was not associated with many distinct clinical or pathologic features, including tumor hormone receptor or HER2 status, apparent burden or site of disease, progressive or stable disease, or, importantly, recent surgery or other procedures within the preceding two months, presence of an intravascular indwelling device (port-a-cath), thrombocytopenia, or treatment. Platelet-PD-Ll positivity was lower in patients who were current smokers and in those with increased red blood cell counts. For patients with serial blood draws, platelet-PD-Ll expression remained stable in 73% of patients. Of the 16 patients that did have a change in platelet-PD-Ll, 15 (94%) changed from negative to positive over time.

Platelet-PD-Ll expression has been previously described by Flow Cytometry (20, 28). These reports have mostly, if not entirely, been within the context of comprehensive analysis of PD-L1 expression on all hematopoietic and immune- effector cells. Furthermore, the prior reports of CTC-PD-L1 expression in patients with MBC have not included observations of platelet expression of PD-L1 (17, 26). Platelets prevent hemorrhage, but have many other activities in normal hemostasis, wound healing, and immune function (29, 30). It is contemplated that platelet-PD-Ll expression may serve in the normal situation to protect epithelial cells from being innocent bystanders in the early immune response to infection. Further, as epithelial cells progress along the malignant continuum (31), some, but not all, may be associated with platelets expressing PD-L1 and commensurate immune suppression. Thus, platelet-PD-Ll expression may be a mechanism of tumor escape from immune elimination (5, 32, 33).

Accordingly, in some embodiments, the present disclosure provides compositions and methods for recommending or determining a treatment course of action and/or treating cancer based on the presence or level of expression of PD-L1 on CTCs and/or platelets and optionally leucocytes.

The present disclosure is not limited to particular methods for identifying the present and/or level of expression of PD-L1 on CTCs and platelets. In some embodiments, Immunomagnetic separation (IMS) is used. IMS is a method that deals with the isolation of cells, proteins, and nucleic acids within a cell culture or body fluid through the specific capture of biomolecules through the attachment of small- magnetized particles, beads, containing antibodies and lectins. These beads are coated to bind to targeted biomolecules, gently separated and goes through multiple cycles of washing to obtain targeted molecules bound to these super paramagnetic beads, which can differentiate based on strength of magnetic field and targeted molecules, are then eluted to collect supernatant and then are able to determine the concentration of specifically targeted biomolecules.

In some embodiments, a mixture of cell population is put into a magnetic field where cells then are attached to super paramagnetic beads, specific example are Dynabeads (4.5-pm), will remain once excess substrate is removed binding to targeted antigen. Dynabeads comprise iron-containing cores, which are covered by a thin layer of a polymer shell allowing the absorption of biomolecules. The beads are coated with primary antibodies, specific-specific antibodies, lectins, enzymes, or streptavidin; the linkage between magnetized beads coated materials are cleavable DNA linkers, allowing cell separation from the beads when the culturing of cells is more desirable.

Many of these beads have the same principles of separation; however, the presence and different strengths of magnetic fields requires certain sizes of beads, based on the ramifications of the separation of the cell population. The larger sized beads (>2pm) are the most commonly used range that are produced by Dynal (Dynal [UK] Ltd., Wirral, Mersyside, UK; Dynal, Inc., Lake Success, NY).

In some embodiments, commercially available IMS systems are utilized. In some embodiments, methods of the present disclosure utilize the CellSearch® system, (Menarini Silicon Biosystems Inc, Huntington Valley, PA) (Allard et al., Clin Cancer Res 2004;10(20):6897-904; Cristofanilli et al., N Engl J Med 2004;351(8):781-91; each of which is herein incorporated by reference in its entirety). The CELL SEARCH system identifies “events” that are then characterized as epithelial in origin by immunofluorescent staining with anti-cytokeratin antibodies and determined to be cellular by virtue of staining with DAPI. Contaminating leucocytes are identified with immunofluorescent staining with a monoclonal antibody against CD45, and the results are displayed pictorially in a digital format.

In some embodiments, flow cytometry is used to detect CTCs and platelets that express PD-L1. Flow cytometry (FCM) is a technique used to detect and measure physical and chemical characteristics of a population of cells or particles. In this process, a sample containing cells or particles is suspended in a fluid and injected into the flow cytometer instrument. The sample is focused to ideally flow one cell at a time through a laser beam, where the light scattered is characteristic to the cells and their components. Cells are often labeled with fluorescent markers so that light is absorbed and then emitted in a band of wavelengths. Tens of thousands of cells can be quickly examined, and the data gathered are processed by a computer.

In some embodiments, whole blood, or the huffy coat containing nucleated cells, is smeared onto glass slides or filtered through membranes to capture cells, and then these cells are characterized for epithelial markers and markers of malignancies.

In some embodiments, expression levels of PD-L1 are determined as mRNA using a variety of nucleic acid techniques, including but not limited to: nucleic acid sequencing; nucleic acid hybridization; and, nucleic acid amplification.

In some embodiments, RNA is detection by Northern blot analysis. Northern blot analysis involves the separation of RNA and hybridization of a complementary labeled probe.

In some embodiments, RNA (or corresponding cDNA) is detected by hybridization to an oligonucleotide probe). A variety of hybridization assays using a variety of technologies for hybridization and detection are available. For example, in some embodiments, TaqMan assay (PE Biosystems, Foster City, CA; See e.g., U.S. Patent Nos. 5,962,233 and 5,538,848, each of which is herein incorporated by reference) is utilized. The assay is performed during a PCR reaction. The TaqMan assay exploits the 5'-3' exonuclease activity of the AMPLITAQ GOLD DNA polymerase. A probe comprising an oligonucleotide with a 5'-reporter dye (e.g, a fluorescent dye) and a 3'-quencher dye is included in the PCR reaction. During PCR, if the probe is bound to its target, the 5'-3' nucleolytic activity of the AMPLITAQ GOLD polymerase cleaves the probe between the reporter and the quencher dye. The separation of the reporter dye from the quencher dye results in an increase of fluorescence. The signal accumulates with each cycle of PCR and can be monitored with a fluorimeter.

In some embodiments, microarrays including, but not limited to: DNA microarrays (e.g, cDNA microarrays and oligonucleotide microarrays); protein microarrays; tissue microarrays; transfection or cell microarrays; chemical compound microarrays; and, antibody microarrays are utilized for measuring cancer marker mRNA levels. A DNA microarray, commonly known as gene chip, DNA chip, or biochip, is a collection of microscopic DNA spots attached to a solid surface (e.g, glass, plastic or silicon chip) forming an array for the purpose of expression profiling or monitoring expression levels for thousands of genes simultaneously. The affixed DNA segments are known as probes, thousands of which can be used in a single DNA microarray. Microarrays can be used to identify disease genes by comparing gene expression in disease and normal cells. Microarrays can be fabricated using a variety of technologies, including but not limited to: printing with fine-pointed pins onto glass slides; photolithography using pre-made masks; photolithography using dynamic micromirror devices; ink-jet printing; or, electrochemistry on microelectrode arrays.

In yet other embodiments, reverse-transcriptase PCR (RT-PCR) is used to detect the expression of RNA. In RT-PCR, RNA is enzymatically converted to complementary DNA or "cDNA" using a reverse transcriptase enzyme. The cDNA is then used as a template for a PCR reaction. PCR products can be detected by any suitable method, including but not limited to, gel electrophoresis and staining with a DNA specific stain or hybridization to a labeled probe. In some embodiments, the quantitative reverse transcriptase PCR with standardized mixtures of competitive templates method described in U.S. Patents 5,639,606, 5,643,765, and 5,876,978 (each of which is herein incorporated by reference) is utilized. In some embodiments, PD-L1 is detected by hybridization with a detectably labeled probe and measurement of the resulting hybrids. Illustrative non-limiting examples of detection methods are described below.

One illustrative detection method, the Hybridization Protection Assay (HP A) involves hybridizing a chemiluminescent oligonucleotide probe (e.g., an acridinium ester-labeled (AE) probe) to the target sequence, selectively hydrolyzing the chemiluminescent label present on unhybridized probe, and measuring the chemiluminescence produced from the remaining probe in a luminometer. See, e.g., U.S. Pat. No. 5,283,174; Nelson et al., Nonisotopic Probing, Blotting, and Sequencing, ch. 17 (Larry J. Kricka ed., 2d ed. 1995, each of which is herein incorporated by reference in its entirety).

The interaction between two molecules can also be detected, e.g, using fluorescence energy transfer (FRET) (see, for example, Lakowicz et al., U.S. Pat. No. 5,631,169; Stavrianopoulos et al., U.S. Pat. No. 4,968,103; each of which is herein incorporated by reference). A fluorophore label is selected such that a first donor molecule's emitted fluorescent energy will be absorbed by a fluorescent label on a second, 'acceptor' molecule, which in turn is able to fluoresce due to the absorbed energy.

Alternately, the 'donor' protein molecule may simply utilize the natural fluorescent energy of tryptophan residues. Labels are chosen that emit different wavelengths of light, such that the 'acceptor' molecule label may be differentiated from that of the 'donor'. Since the efficiency of energy transfer between the labels is related to the distance separating the molecules, the spatial relationship between the molecules can be assessed. In a situation in which binding occurs between the molecules, the fluorescent emission of the 'acceptor' molecule label should be maximal. A FRET binding event can be conveniently measured through fluorometric detection means.

Another example of a detection probe having self-complementarity is a “molecular beacon.” Molecular beacons include nucleic acid molecules having a target complementary sequence, an affinity pair (or nucleic acid arms) holding the probe in a closed conformation in the absence of a target sequence present in an amplification reaction, and a label pair that interacts when the probe is in a closed conformation. Hybridization of the target sequence and the target complementary sequence separates the members of the affinity pair, thereby shifting the probe to an open conformation. The shift to the open conformation is detectable due to reduced interaction of the label pair, which may be, for example, a fluorophore and a quencher (e.g., DABCYL and EDANS). Molecular beacons are disclosed, for example, in U.S. Pat. Nos. 5,925,517 and 6,150,097, herein incorporated by reference in its entirety.

By way of non-limiting example, probe binding pairs having interacting labels, such as those disclosed in U.S. Pat. No. 5,928,862 (herein incorporated by reference in its entirety) might be adapted for use in method of embodiments of the present disclosure. Probe systems used to detect single nucleotide polymorphisms (SNPs) might also be utilized. Additional detection systems include “molecular switches,” as disclosed in U.S. Publ. No. 20050042638, herein incorporated by reference in its entirety. Other probes, such as those comprising intercalating dyes and/or fluorochromes, are also useful for detection of amplification products methods of embodiments of the present disclosure. See, e.g., U.S. Pat. No. 5,814,447 (herein incorporated by reference in its entirety).

In some embodiments, nucleic acid sequencing methods are utilized for detection. In some embodiments, the sequencing is Second Generation (a.k.a. Next Generation or Next-Gen), Third Generation (a.k.a. Next-Next-Gen), or Fourth Generation (a.k.a. N3-Gen) sequencing technology including, but not limited to, pyrosequencing, sequencing-by-ligation, single molecule sequencing, sequence-by- synthesis (SBS), semiconductor sequencing, massive parallel clonal, massive parallel single molecule SBS, massive parallel single molecule real-time, massive parallel single molecule real-time nanopore technology, etc. Morozova and Marra provide a review of some such technologies in Genomics, 92: 255 (2008), herein incorporated by reference in its entirety. Those of ordinary skill in the art will recognize that because RNA is less stable in the cell and more prone to nuclease attack experimentally RNA is usually reverse transcribed to DNA before sequencing. DNA sequencing techniques include fluorescence-based sequencing methodologies (See, e.g., Birren et al., Genome Analysis: Analyzing DNA, 1, Cold Spring Harbor, N.Y.; herein incorporated by reference in its entirety). In some embodiments, the sequencing is automated sequencing. In some embodiments, the sequencing is parallel sequencing of partitioned amplicons (PCT Publication No: W02006084132 to Kevin McKeman et al., herein incorporated by reference in its entirety). In some embodiments, the sequencing is DNA sequencing by parallel oligonucleotide extension (See, e.g., U.S. Pat. No. 5,750,341 to Macevicz et al., and U.S. Pat. No. 6,306,597 to Macevicz et al., both of which are herein incorporated by reference in their entireties). Additional examples of sequencing techniques include the Church polony technology (Mitra et al., 2003, Analytical Biochemistry 320, 55-65; Shendure et al., 2005 Science 309, 1728-1732; U.S. Pat. No. 6,432,360, U.S. Pat. No.

6,485,944, U.S. Pat. No. 6,511,803; herein incorporated by reference in their entireties), the 454 picotiter pyrosequencing technology (Margulies et al., 2005 Nature 437, 376-380; US 20050130173; herein incorporated by reference in their entireties), the Solexa single base addition technology (Bennett et al., 2005, Pharmacogenomics, 6, 373-382; U.S. Pat. No. 6,787,308; U.S. Pat. No. 6,833,246; herein incorporated by reference in their entireties), the Lynx massively parallel signature sequencing technology (Brenner et al. (2000). Nat. Biotechnol. 18:630-634; U.S. Pat. No. 5,695,934; U.S. Pat. No. 5,714,330; herein incorporated by reference in their entireties), and the Adessi PCR colony technology (Adessi et al. (2000). Nucleic Acid Res. 28, E87; WO 00018957; herein incorporated by reference in its entirety). A variety of nucleic acid sequencing methods are contemplated for use in the methods of the present disclosure including, for example, chain terminator (Sanger) sequencing, dye terminator sequencing, and high-throughput sequencing methods. See, e.g., Sanger et al., Proc. Natl. Acad. Sci. USA 74:5463-5467 (1997); Maxam et al., Proc. Natl. Acad. Sci. USA 74:560-564 (1977); Drmanac, et al., Nat. Biotechnol. 16:54-58 (1998); Kato, Int. J. Clin. Exp. Med. 2:193-202 (2009); Ronaghi et al., Anal. Biochem. 242:84-89 (1996); Margulies et al., Nature 437:376-380 (2005); Ruparel et al., Proc. Natl. Acad. Sci. USA 102:5932-5937 (2005), and Harris et al., Science 320:106-109 (2008); Levene et al., Science 299:682-686 (2003); Korlach et al., Proc. Natl. Acad. Sci. USA 105:1176-1181 (2008); Branton et al., Nat. Biotechnol.

26(10): 1146-53 (2008); Eid et al., Science 323:133-138 (2009); each of which is herein incorporated by reference in its entirety.

Next-generation sequencing (NGS) methods share the common feature of massively parallel, high-throughput strategies, with the goal of lower costs in comparison to older sequencing methods (see, e.g., Levy and Meyers, Annual Review of Genomics and Human Genetics Volume 17, 2016 pp 95-115; herein incorporated by reference in its entirety) A number of commercial platforms for NGS are available (See e.g., Levy and Meyers, supra). In some embodiments, the presence and/or level of PD-L1 on platelets and CTCs is determined by visual inspection of antibody staining (e.g., as described in Example 1 below).

In some embodiments, an automated system is used to detect and report the presence and/or level of PD-L1 on platelets and CTC. For example, in some embodiments, software is integrated into a system for immunomagnetic or other detection system that measures the level of intensity of staining or a label. In some embodiments, the system reports this information (e.g., on a screen of the system or other electronic device) to a user.

In some embodiments, a computer-based analysis program is used to translate the raw data generated by the detection assay (e.g., the presence, absence, or amount of PD-L1 expression on platelets and/or CTCs) into data of predictive value for a clinician (e.g., choice of cancer therapy). The clinician can access the predictive data using any suitable means. Thus, in some preferred embodiments, the present disclosure provides the further benefit that the clinician, who is not likely to be trained in genetics or molecular biology, need not understand the raw data. The data is presented directly to the clinician in its most useful form. The clinician is then able to immediately utilize the information in order to optimize the care of the subject.

The present disclosure contemplates any method capable of receiving, processing, and transmitting the information to and from laboratories conducting the assays, information provides, medical personal, and subjects. For example, in some embodiments, a sample (e.g, a biopsy or a blood or serum sample) is obtained from a subject and submitted to a profiling service (e.g, clinical lab at a medical facility, genomic profiling business, etc.), located in any part of the world (e.g, in a country different than the country where the subject resides or where the information is ultimately used) to generate raw data. Where the sample comprises a tissue or other biological sample, the subject may visit a medical center to have the sample obtained and sent to the profiling center, or subjects may collect the sample themselves (e.g, a urine sample) and directly send it to a profiling center. Where the sample comprises previously determined biological information, the information may be directly sent to the profiling service by the subject (e.g, an information card containing the information may be scanned by a computer and the data transmitted to a computer of the profiling center using an electronic communication systems). Once received by the profiling service, the sample is processed and a profile is produced (i.e., expression data), specific for the diagnostic or prognostic information desired for the subject.

The profile data is then prepared in a format suitable for interpretation by a treating clinician. For example, rather than providing raw data, the prepared format may represent a diagnosis or risk assessment (e.g, likelihood of cancer treatment being successful) for the subject, along with recommendations for particular treatment options. The data may be displayed to the clinician by any suitable method. For example, in some embodiments, the profiling service generates a report that can be printed for the clinician (e.g, at the point of care) or displayed to the clinician on a computer monitor.

In some embodiments, the information is first analyzed at the point of care or at a regional facility. The raw data is then sent to a central processing facility for further analysis and/or to convert the raw data to information useful for a clinician or patient. The central processing facility provides the advantage of privacy (all data is stored in a central facility with uniform security protocols), speed, and uniformity of data analysis. The central processing facility can then control the fate of the data following treatment of the subject. For example, using an electronic communication system, the central facility can provide data to the clinician, the subject, or researchers.

In some embodiments, the subject is able to directly access the data using the electronic communication system. The subject may choose further intervention or counseling based on the results. In some embodiments, the data is used for research use. For example, the data may be used to further optimize the inclusion or elimination of markers as useful indicators of a particular condition or stage of disease.

Compositions for use in the methods of the present disclosure include, but are not limited to, probes, amplification oligonucleotides, microparticles, and antibodies. Particularly preferred compositions detect, directly or indirectly, the presence of level of expression of PD-L1 on platelets and CTCs.

Any of these compositions, alone or in combination with other compositions of the present disclosure, may be provided in the form of a kit. For example, the single labeled probe and pair of amplification oligonucleotides may be provided in a kit for the amplification and detection of tumor markers. Kits may further comprise appropriate controls and/or detection reagents. The probe and antibody compositions of the present disclosure may also be provided in the form of an array or panel assay.

Embodiments of the present disclosure provide methods of determining a treatment for cancer, recommending a treatment for cancer, and/or treating cancer. In some embodiments, subjects identified as having PD-L1 expression on CTCs and platelets are treated with an immune checkpoint inhibitor.

In some embodiments, provided herein are methods for monitoring cancer therapy. For example, in some embodiments, the level or presence of PD-L1 expression on CTCs and/or platelets is repeated one or more times and regular or irregular time intervals. In some embodiments, immune checkpoint therapy is altered (e.g., started or stopped) based on the results. For example, in some embodiments, if the presence or level of PD-L1 on CTCs and/or platelets is increased, immune checkpoint therapy is started. If the level decreases or is absent, in some embodiments, immune checkpoint therapy is stopped and the subject is administered an alternative treatment.

In some embodiments, the threshold level is determined by examination of imaging (e.g., immunomagnetic imaging) data. For example, in some embodiments that utilize CellSearch©, the threshold level is one or more CTCs in a sample that express PD-L1 on its surface at a level of l-3⁺ using a visual scale and/or greater than 100 platelets positive for PD-L1 in a sample. For any particular analysis method, the threshold level may be determined experimentally (e.g., by comparison to a reference sample or samples).

The present disclosure is not limited to particular immune checkpoint inhibitors. In some embodiments, the immune checkpoint inhibitor targets PD-L1 or PD1. Non-limiting examples are described below.

In some embodiments, the immune checkpoint inhibitor is nivolumab (Bristol- Myers Squibb, New York, NY), pembrolizumab (Merck, Kenilworth, NJ), atezolizumab (Roche, Basel, Switzerland), avelumab (Merck, Kenilworth, NJ), durvalumab (AstraZeneca, Cambridge, United Kingdom) or cemiplimab (Regeneron, Tarrytown, NY).

Additional immune checkpoint inhibitors include but are not limited to, spartalizumab, camrelizumab, sintilimab, tislelizumab, toripalimab, dostarlimab, INCMGA00012, AMP-224, AMP-514, CK-301, KN035, AUNP12, BMS-986189, and CA-170. The present disclosure is not limited to treatment for a particular cancer. While the present disclosure is exemplified with breast cancer, the technology finds use with any number of cancers (e.g., any cancer treatable with immune checkpoint therapy). Examples include but are not limited to, bladder, breast, cervical, esophageal, gastric, colon, rectal, head and neck, Hodgkin lymphoma, liver, melanoma, merkel cell, nonsmall cell lung, renal cell, and other solid submits that are not able to repair errors in DNA that occur when DNA is copied.

In some embodiments, one or more additional cancer treatments are administered in combination with immune checkpoint therapy. In some embodiments, the additional treatment is radiation, chemotherapy, anti-androgen or estrogen therapy, or additional immunotherapies (e.g., immunotherapy against CTLA4 (e.g., ipilumumab) or CAR-T cells).

Further embodiments provide the use of the afore described analysis methods to provide a diagnosis, prognosis, or recommend a treatment course of action to a subject suspected of having or diagnosed with cancer.

EXPERIMENTAL

The following examples are provided to demonstrate and further illustrate certain embodiments of the present disclosure and are not to be construed as limiting the scope thereof.

Example 1

METHODS

Patient Accrual and Characteristics

Patients with MBC were enrolled into this prospective single-institution pilot study. Control blood was collected from healthy donors. Clinical characteristics were obtained by chart review and abstraction. Table 9 describes the patient demographics.

Blood Collection, Processing, CTC Enumeration, and Phenotyping

Whole blood (WB) was collected into 10ml CellSave tubes (MSB, Huntingdon Valley, PA) and processed through the CellSearch® (CXC kit) system (MSB, Huntingdon Valley, PA) as previously described (13, 21). PD-L1 staining was performed using a phycoerythrin-labeled anti-human PD-L1 monoclonal antibody (Biolegend clone 29E.2A3; Biolegend, San Diego, CA) at 3.5 ug/ml, using methods similar to those previously described for other phenotypic markers[13, 14, 21, 22],

Quantifying Platelets from CellSearch® Enriched Product

The contents from CellSearch® cartridges were extracted using gel loading tips coated in 2% BSA/PBS and placed into Eppendorf tubes. The number of platelets/ul was determined using the Hemavet® hv950 (Drew Scientific, Miami Lakes, FL).

Cell Culture for in vitro Experiments

Human breast cancer cell lines were cultured in a sterile incubator at 37°C with 5% CO₂. Characteristics for each cell line are described in Table 6.

Platelet Characterization of CellSearch® Enriched Product

Contents from CellSearch® cartridges were extracted, incubated for 30 minutes on ice with APC/Cy7 anti -human CD-42b and CD-41 monoclonal antibodies directed against platelets (clone HIP1 and HIP8, respectively; Biolegend, San Diego, CA), centrifuged at 800g for 20 minutes, washed twice with 1% BSA/PBS, centrifuged for 8 minutes at 94g onto poly -lysine coated slides, then examined by flourescense microscopy at 40x for platelet and PD-L1 expression.

Platelet Isolation from Whole Blood

Platelet rich plasma (PRP) was isolated from 7.5ml WB collected in CellSave tubes by 200g centrifugation for 10 minutes at RT. Platelets were isolated by a second spin of 2,000g at RT and the platelet poor plasma (PPP) was centrifuged 2 additional times at 2,000g to remove residual platelets. The PPP and platelet pellet were each resuspended with dilution buffer to a total volume of 14ml. The sample tubes were taped to the 4ml mark to simulate the red blood cell layer, enabling the automated CellSearch® to process the sample. Because these samples lacked whole cells necessary to focus the CellTracks Analyzer camera, DAPI coated magnetic beads provided were added to each cartridge to permit scanning. PD-L1 Knockdown in Cultured Human Breast Cancer Cells

Silencer® select pre-designed siRNA (s26547, s26548, s26549; Life Technologies, Carlsbad, CA) was used to knockdown PD-L1 expression in MDA- MB-231 cells. Two nonsense controls were used separately, one from Dharmacon and one from Silencer® select. The cells were transfected using Lipofectamine RNAiMax reagent (Invitrogen, Carlsbad, CA) in Opti-MEM medium with a final concentration of 25 pmol siRNA per well following manufacturer’s instructions.

Western Blot Analyses

PD-L1 protein expression in cultured human breast cancer cells was confirmed using Western blot analyses. For each sample, 35 ug of protein lysate was loaded onto 4-12% acrylamide gels. PVDF membrane was blocked with 5% milk/TBS-T and incubated with anti-PD-Ll rabbit primary monoclonal antibody (E1L3N Rabbit mAb; Cat# 13684, RRID:AB_2687655, Cell Signaling Technologies, Danvers, MA) and subsequently with horseradish peroxidase-linked anti-rabbit IgG secondary mAb (Cat# 7074, RRID:AB_2099233, Cell Signaling Technologies, Danvers, MA). Horseradish peroxidase linked [3-actin was used as a loading control (8H10D10, Cat# 3700, RRID:AB_2242334, Cell Signaling Technologies, Danvers, MA).

PD-L1 Gene Expression

Cell lysates were prepared using trizol and homogenized using a 23 guage sterile syringe. RNA was extracted using the Qiagen mini-RNA extraction kit (Qiagen, Hilden, Germany) following manufacturer’s instructions and included an Ambion DNA clean up kit (Invitrogen, Carlsbad, CA). Purified RNA was interrogated with the Promega Reverse Transcription Kit for RT-PCR (Promega, Madison, WI). Template cDNA was further amplified using sybergreen PCR with primer pairs designed for human PD-L1 (Integrated DNA Technologies, Coralville, IA). Samples were analyzed in triplicate using a CFX96 Real-Time PCR detection system (BioRad, Hercules, CA). All samples were normalized to GAPDH as previously described [23] and measured as fold change of PD-L1 expression from untreated MDA-MB-231 cells. All primers were diluted to a working concentration of 250nM. PD-L1 primer pair sequences are as follows: primer pair 1 5’CTTCCGTTTAAGAAAAGGGAGAA3’(SEQ ID NO:1)/ 5’TTACGTCTCCTCCAAATGTGT3’(SEQ ID NO:2); primer pair 2 (SEQ ID NO:1) 5’CTGACATTCATCTTCCGTTTAAG3’(SEQ ID NO: 3) /5’CGTCTCCTCCAAATGTGTATCA3’(SEQ ID NO:4); primer pair 3 5’GACATTCATCTTCCGTTTAAGAAA3’(SEQ ID NO:5) /5’CGTCTCCTCCAAATGTGTATCA3’(SEQ ID NO:6).

Statistical Analysis

The distribution of CTC-PD-L1 and platelet-PD-Ll expression in all blood samples was summarized using descriptive statistics. A marginal model with a logit link using generalized estimating equations (GEE) was fit to explore whether platelet- PD-Ll positivity varied across the timepoints. To evaluate the association between timepoint-1 PD-L1 expression with timepoint- 1 CTC and platelets, a Pearson’s chi- squared test and Fisher’s exact test were performed, respectively, each with significance level p=0.05. Marginal models estimated using GEE assuming an independent working correlation structure were used to explore the clinical/pathological features associated with CTC and platelet-PD-Ll expression. For CTC-PD-L1 expression, the outcome consisted of the count of PD-L1 positive CTC using samples with >0 CTC/7.5ml WB. Platelet-PD-Ll expression was dichotomized between negative or positive (≥100 PD-L1 positive platelets per frame) expression. Associations between features of interest with PD-L1 expression were assessed singly. The false discovery rate approach was used to adjust the type I error to claim statistical significance with p-value<0.001.

Data management and analysis were conducted using Statistical Analysis System (SAS) statistical software, version 9.4 (SAS Institute Inc., Cary, NC, USA).

RESULTS

Definition of CTC-PD-L1 Staining Scale

After processing circulating tumor cells (CTC) through CellSearch®, and staining for programed death ligand 1 (PD-L1), CTC were visually determined to have relative PD-L1 staining according to a scale similar to what we have previously published for other markers, ranging from 0-3+ (Paoletti C, Muniz MC, Thomas DG, et al. Clin Cancer Res 2015;21(ll):2487-98; Paoletti C, Larios JM, Muniz MC, et al. Mol Oncol 2016; 10(7): 1078-85). No cultured breast cancer cells or patient circulating tumor cells that stained 3+ for PD-L1 were observed. Therefore, CTC-PD-L1 staining of 1+ or 2+ was considered as positive. This scale depends on both the relative intensity of the CTC staining and the relative clarity of the background, ranging from dark black to gray/white. The latter occurs when the laser scanner used to identify events amplifies the signal to determine whether the event is or is not fluorescing. Thus, an event (CTC) that is very bright will have a very dark background, and is designated 3+, whereas an event that is dim with a gray/white background is 0. Figure 4 provides images from specimens that contain variable CTC-PD-L1 staining as an illustration CTC-PD-L1 that stained 0, 1+, and 2+.

Co-Staining of Platelets and PD-L1

In order to determine that the objects staining for PD-L1 were platelets, CellSearch® enriched contents from whole blood (WB), which had been stained with DAPI and anti-CD45, CK and CTC-PD-L1 was removed from the CellSearch® cartridge and spun onto poly -lysine coated slides. Both platelet-PD-Ll positive and negative staining specimens were analyzed. These were then stained for plateletspecific markers, CD-41 and CD-42b, in addition to the PD-L1 staining already assessed in CellSearch®.

Specimens from patients in which platelet-PD-Ll positivity in the CellSearch® system did, indeed, have co-staining of anti-platelet antibodies and anti- PD-L1 on the glass slides (Figure 5 A-B). In contrast, platelets were detected in specimens from patients who did not have platelet-PD-Ll staining in CellSearch®, but as expected no PD-L1 staining was observed (Figure 5 C-D).

Fixed vs. Nonfixed Blood

To determine if the preservative fixative in CellSave tubes impacted the presence of PD-L1 positive platelets in patient samples, WB was drawn in both CellSave and ethylenediaminetetraacetic acid (EDTA) non-fixative containing tubes from 13 patients, processed in parallel using the CellSearch® assay, and stained for PD-L1 (Figure 6). The presence or absence of PD-L1 positive platelets was concordant (+/+ = 9; -I- = 3; +/- = 0; -/+ = 1) in 12/13 patient samples (Table 6). One patient stained positive for platelet-PD-Ll expression in WB drawn into EDTA tubes, but did not have platelet-PD-Ll positive in WB drawn into CellSave tubes (Table 6).

PD-L1 expression on platelets For patient samples in which platelet-PD-Ll staining was observed using the classic CellSearch® method (Figure 7A), PD-L1 staining was maintained in the aliquot containing only the platelet pellet (Figure 7B). Staining for CD-45 (APC) and CK (FITC) in this aliquot was negative, demonstrating that the sample was clear of white blood cell (WBC) and CTC carryover (Figure 7B). Platelet poor plasma (PPP) did not have PD-L1 staining, confirming that the PD-L1 staining was on platelets (Figure 7C). In both platelet pellet and PPP samples, the DAPI fluorescence was seen only on DAPI coated magnetic beads (Figure 7B-E) added to permit scanning of the samples. For patient samples that did not have platelet-PD-Ll staining present in the classic CellSearch® method, neither the platelet pellet nor PPP displayed PD-L1 staining (Figure 7D-E). Taken together, these data confirmed that the non-CTC PD- L1 staining is on platelets.

Platelet-PD-Ll expression according to platelet count in CellSearch® cartridges

Routine clinical complete blood count (CBC) platelet levels determined on the same day as research blood collection ranged from 159,000 to 425,000/ul (Table 7). Platelet counts carried over into the CellSearch® cartridge for these patients ranged from 1,000-3,000 platelets/ul of enriched CellSearch® product, and were not related to the CBC-platelet count (Table 7). Four of these seven patients had <100, two had 100-1,000 and one had >1,000 PD-L1 positive platelet staining, determined from CellSearch® PD-L1 analysis, which, again, were independent of CBC-platelet or CellSearch®-cartridge carry-over platelet levels. These results confirmed that the number of PD-L1 positive platelets per CellSearch® frame were independent of the number of platelets assessed in CBC as well as the number of platelets carried over during the CellSearch® enrichment process.

Quantifying PD-L1 Positive Platelets in CellSearch®

Each CellSearch® cartridge was scanned using the CellTracks analyzer. Single cells are presented individually in thumbnail galleries (Figure 8A). Alternatively, images from the cartridge can be viewed by frames. Each CellSearch® cartridge is divided into 175 frames (Figure 8B). Each frame can be assessed for each fluorochrome (DAPI, FITC, APC, or PE) individually. Platelets were evenly distributed between frames; therefore, three frames were randomly selected from the 175 total frames to assess for the number of platelet-PD-Ll positivity (Figure 8B). An average platelet count per three CellSearch® frames was calculated for each specimen. A semi-quantitative scale of 0, <100, 100-1000, and >1,000 PD-L1 positive platelet count per three CellSearch® frames of the CellSearch® cartridge was generated. Platelet-PD-Ll 0-99/frame was considered negative and ≥100/frame as positive (Figure 8C).

PD-L1 Antibody Specificity

The Biolegend PE-conjugated PD-L1 antibody, clone 29E.293, which has been used in the CellSearch® system for CTC-PD-L1 expression analysis, has an affinity for PD-L1 only in the native conformation. Due to this limitation, the specificity of this antibody for PD-L1 was indirectly confirmed by siRNA knockdown of PD-L1 in MDA-MB-231 cells. Initially, both MDA-MB-231 and MCF-7 cell lines were tested for PD-L1 expression by Western blot using a separate antibody from 29E.293, designated as clone E1L3N (Cell Signaling Technologies, Danvers, MA). Clone E1L3N retains binding to PD-L1 after denaturation. For each sample, 35 ug of protein lysate was loaded onto 4-12% acrylamide gels. PVDF membrane was blocked with 5% milk/TBS-T and incubated with anti-PD-Ll rabbit primary monoclonal antibody (E1L3N Rabbit mAb; Cell Signaling Technologies, Danvers, MA) and subsequently with horseradish peroxidase-linked anti-rabbit IgG secondary mAb (Cell Signaling Technologies, Danvers, MA). Horseradish peroxidase linked -actin was used as a loading control (8H10D10, Cell Signaling Technologies, Danvers, MA). As expected, MDA-MB-231 cells had high expression of PD-L1 and were subsequently selected for siRNA knockdown experiments (Figure 9A).

Each of the three siRNA’s selected bind to a different region along the PD-L1 transcript. Five separate conditions of MDA-MB-231 cells were cultured in parallel: untreated, mock transfected, siRNA s26547, siRNA s26548, and siRNA s26549. The untreated and the nonsense control cell lines maintained high levels of PD-L1 expression by Western blot (Figure 9B). However, all three PD-L1 knockdown cell lines were negative for PD-L1 expression by Western blot analysis (Figure 9B).

To further analyze the efficacy of the knockdown of PD-L1 in MDA-MB-231 cells, PD-L1 message expression was analyzed. Cells transfected with the nonsense control did not exhibit a reduction in PD-L1 expression (Figure 9C). Compared to untreated cells, s26547 had a 75% reduction in PD-L1 (Figure 9C). Similarly, s26548 had an 80% reduction in PD-L1 expression compared to untreated cells. The s26549 transfected cells had a 40% reduction in PD-L1 expression (Figure 9C). These results confirmed siRNA knockdown of PD-L1 expression in transfected cell lines.

Having proven that the respective cell lines were positive (MDA-MB-231) or negative (MCF-7, SK-Br-3, BT-474), and that MDA-MB-231 siRNA knockdown cells no longer expressed PD-L1, it was investigated whether the PD-L1 antibody clone 29E.293 behaved as expected in the CellSearch® system. Wild type and transfected cells were harvested and spiked into 7.5ml of healthy donor blood. Spiked WB was processed using the CellSearch® platform staining for CK, DAPI, CD-45, and PD-L1. After processing through CellSearch®, “spiked CTC” were enumerated and CTC-PD-L1 expression was assessed (Figure 9D). Expression of PD-L1 on tumor cells was classified as 0 (no PD-L1 expression), 1+ (low PD-L1 expression), and 2+ (representing high PD-L1 expression), in a manner similar to the CTC-protein expression scale we have previously reported for ER, BCL2, HER2, Ki67, and M30, as illustrated in Figure 4 (Paoletti C, Muniz MC, Thomas DG, et al. Clin Cancer Res 2015;21(ll):2487-98; Paoletti C, Larios JM, Muniz MC, et al. Mol Oncol 2016;10(7):1078-85).

MDA-MB-231 PD-L1 knockdown cells, as well as those treated with the nonsense control, were interrogated for staining with PD-L1 antibody clone 29E.293. In this case, 46% and 36.5% of the s26547 knockdown cells were completely negative or 1+ (weakly positive), respectively. Only 17.5% of s26547 knockdown cells were 2+ (strongly positive). In contrast, 90.5% of the nonsense-transfected control cells stained 2+ (strongly positive), whereas only 8% were 1+ (weakly positive) (Figure 10E). Similar results were found for both s26548 and s26549 (Figure 9E). Taken together, these data confirmed that monoclonal antibody clone 29E.293 is specific for PD-L1 expression, and therefore appropriate for use in the CellSearch® system. To further determine the sensitivity and specificity of PD-L1 staining with antibody clone 29E.293, a series of different cultured human breast cancer cell lines with known PD-L1 expression were stained (Mittendorf EA, Philips AV, Meric-Bemstam F, et al. Cancer Immunol Res 2014;2(4):361-70). As expected, wild-type MD-MB- 231 had the highest PD-L1 expression with 97.5% of cells 2+ (Figure 10A), whereas the remaining 2.5% of cells were completely negative (0) for PD-L1 expression. Of the wild-type MDA-MB-468 cells (Figure 10B), 7.4% stained as 2+, 6.6% stained as 1+, and 86% of cells were 0. Sk-Br-3 cells, 3% stained as 2+, 6% stained as 1+, and 91% of cells were 0 for PD-L1 expression (Figure 10C), and both BT-474 and MCF-7 cells were completely negative (Figure 10D-E).

Association of CTC-PD-L1 and Platelet-PD-Ll Expression with Clinical and Pathological Factors

Each patient’s medical chart was reviewed with a prospective list of possible factors that might affect PD-L1 expression. Table 8 provides the relative status of these factors. Tables 9 and 10 provide uni- and multi-variable associations, respectively, of each factor with CTC-PD-L1 and Tables 11 and 12 provide uni- and multi-variable associations, respectively, with platelet-PD-Ll expression. CTC-PD- L1 expression was determined visually as described above and considered positive, if it was 1+ or 2+. Platelet-PD-Ll expression was determined as described above and ≥100/frame was considered positive. Associations were considered significant if the p-value describing the relative Rate Ratio for CTC-PD-L1 and Odds Ratio for Platelet-PD-Ll was <0.001 for univariable analyses and <0.05 for multivariable analyses.

CTC-PD-L1 Expression in Patients with MBC at Timepoint-1

Blood samples from 124 patients with MBC were assessed for CTC-PD-L1 expression at timepoint-1 and subsequent timepoints in selected cases (Figure 4). Timepoint-1 was at or close to any time that a patient was found to have progressive disease. Of the 124 samples at timepoint- 1, 52 (42%) had elevated CTC (≥5/7.5ml WB) (Table 1). Twenty-one (40%) of these 52 specimens had ≥1% CTC-PD-L1 expression of 1-2+ [median 15.2% (range 1-100%); Figure 1; Table 1], within a semi- quantitative grading system (Figure 5). At least one PD-L1 positive CTC was also observed in 9/30 (30%) patients with 1-4 CTC/7.5ml WB (Table 1).

Platelet-PD-Ll Expression in Patients with MBC

In the classic CellSearch® system, leukocytes are identified by staining with fluoresceinated anti-CD45, and platelets are not visualized. During CTC-PD-L1 expression analysis using CellSearch®, PD-L1 staining was observed on what visually appeared to be platelets. In extensive prior evaluations of WB using CellSearch® standard antibodies, as well as investigational studies using labeled antibodies against a number of other biomarkers, platelet staining was not observed. Plate! et-PD-Ll was not observed in over 70 WB samples collected longitudinally from 12 healthy donors spiked with MDA-MB-231 cells and processed through CellSearch® and stained with the 29E.2A3 PD-L1 antibody. Therefore, this finding was investigated further.

In the CellSearch® system, a platelet specific marker cannot be used simultaneously with anti-PD-Ll, since only one additional florescence channel is available for phenotyping. Therefore, using cytospins, it was demonstrated that the PD-L1 positive, non-nucleated objects observed in CellSearch® co-stained with antiplatelet antibodies, confirming that they were indeed, platelets Figure 5). Platelet-PD- L1 staining was not an artifact of the CellSave tube fixative (Figure 6 and Table 7), and the PD-L1 stained objects were confirmed to be platelets by isolating platelet pellets and PPP fractions from WB collected from a subset of patients and processed in parallel through CellSearch® (Figure 8). Platel et-PD-Ll staining was independent of number of platelets within the CellSearch® cartridge as well as routine clinical complete blood count determined on the same day as the research blood collection (Table 8).

Inter-patient platelet-PD-Ll expression was heterogeneous. Using a semi- quantitative scale (Figure 9), 41 (33%), 48 (39%), 24 (19%), and 11 (9%) of 124 samples at timepoint-1, had 0, <100, 100-1,000, and >1,000 PD-L1 positive platelets/frame of the CellSearch® cartridge, respectively (Table 2). Using an arbitrarily designated cutoff of ≥100 PD-L1 positive platelets/frame as positive, 35 (28%) samples were positive for platelet-PD-Ll expression at timepoint- 1. At timepoint-1, platelet-PD-Ll expression was associated with elevated CTC levels, but not with CTC-PD-L1 expression. Twenty -four of the 52 (46%) samples with ≥5CTC/7.5ml WB, but only 11/72 (15%) samples with <5CTC/7.5ml WB had PD-L1 positive platelets (p=0.0002) (Table 3). Platelet-PD-Ll expression was independent of CTC-PD-L1 expression for both samples with ≥5CTC/7.5ml WB (p=0.34) and <5CTC/7.5ml WB (p=0.99) (Table 3).

Association of CTC-PD-L1 and Platelet-PD-Ll Expression with Clinical/Pathological Features

Associations of CTC-PD-L1 and platelet-PD-Ll expression with clinical and pathological features were assessed (Tables 9-13). Only patients (n=82) with ≥lCTC/7.5ml WB were included in the analysis of association of CTC-PD-L1 and clinical/pathological features. By univariable analysis, CTC-PD-L1 positivity was less likely in patients with ER+ compared to triple negative MBC at either the time of 1st clinical metastasis biopsy (RR=0.33, p<0.001) and at a subsequent, later biopsy (RR=0.31, p<0.001). Similarly, CTC-PD-L1 was less likely in patients with HER2+ vs. triple negative MBC at the time of either biopsy (RR=0.22, p<0.001 for both) (Table 10). CTC-PD-L1 was also less likely in patients with bone only disease compared to patients without bone disease (RR=0.14, p<0.001). CTC-PD-L1 was significantly increased in patients currently receiving or who had just progressed on either endocrine therapy (ET) (RR=3.19, p<0.001) or CDK4/6 inhibitors (RR=4.11, p<0.001) (Table 10). CTC-PD-L1 was not associated with anticoagulant drugs, although only 13 patients were on a dedicated anticoagulant medication (rivaroxaban, enoxaparin, apixaban, clopidogrel) (Table 10).

In multivariable analysis, in contrast to the univariable analysis, CTC-PD-L1 was significantly higher in patients with ER+ vs. triple negative disease (RR=2.56, p=0.007) and HER2+ (RR=3.14, p=0.04). In concert with the univariate analysis, it was associated with prior treatment or progression on CDK4/6 inhibitors (RR=3.6, p=0.008) (Table 4). Likewise, CTC-PD-L1 was significantly lower in patients with bone only disease (RR=0.09, p<0.001) or with bone and other sites of disease (RR=0.19, p<0.001) (Table 4).

Platelet-PD-Ll positivity was higher in patients who had increased numbers of CTC (OR=1.03 for each 100 CTC/7.5ml increase, p<0.001) and in patients with ≥5 vs. <5 CTC (OR=1.45, p<0.001), but as noted above was independent of CTC-PD-L1 status. It was significantly lower in patients with increased number of red blood cell counts (univariable OR=0.72 for each M/ul increase, p<0.001; multivariable OR= 0.73, p<0.001) (Table 12, Table 5). Platelet-PD-Ll was also statistically lower in patients who were current vs. passive/never smokers (OR=0.76, p<0.001). Anticoagulant drugs did not appear to affect platelet-PD-Ll expression. However, since only a single patient was on clopidogrel and NSAID or aspirin use was taken on an as needed basis and often not recorded, no association with specific plateletaffecting agents could be drawn. Platelet-PD-Ll expression was not associated with any other identifiable pathological or clinical features (Tables 12 and 13). Serial Specimen CTC-PD-L1 and Platelet-PD-Ll Expression

Of the 124 patients enrolled, 59 had specimens assessed for CTC-PD-L1 and platelet-PD-Ll at multiple subsequent timepoints, ranging from 1.5 weeks to 27 months after timepoint-1. Of these 59, 35 (59%) had ≥lCTC/7.5ml in two or more subsequent specimens and 14/35 (40%) were CTC-PD-L1 negative at all timepoints. Five (14%) patients maintained CTC-PD-L1 positivity (Figure 2A), 9 (26%) patients converted CTC-PD-L1 status from negative to positive (Figure 2B), 4 (11%) patients converted from positive to negative (Figure 2C), and 3 (9%) patients had CTC-PD-L1 expression fluctuating from negative to positive to negative again at subsequent timepoints (Figure 2D).

Platelet-PD-Ll positivity varied significantly over time in some but not all patients (p=0.005). Of the 13 patients who had platelet-PD-Ll positive at timepoint-1, 10 (77%) maintained positivity at a subsequent blood draw (Figure 3A). In contrast, 2 (15%) patients converted from platelet-PD-Ll positive to negative (Figure 3B) and 1 (7%) patient had platelet-PD-Ll status fluctuating from positive to negative to positive again among subsequent timepoints (Figure 3C). Of the 46 patients who had platelet-PD-Ll negative at timepoint- 1, 32 (70%) maintained platelet-PD-Ll negativity at subsequent blood draw (data not shown), whereas 15 (33%) patients converted from having platelet-PD-Ll negative to positive at a later timepoint (Figure 3D).

Table 1. CTC-PD-L1 expression at timepoint-1.

Table 2. Platelet-PD-Ll distribution in all samples

Table 3. Association of platelet-PD-Ll score and CTC enumeration and PD-L1 expression at timepoint- 1

Table 4. Multivariable results of factors of interest with CTC-PD-L1 positive rate

Table 5. Multivariable results of factors of interest with Platelet-PD-Ll positivity

Table 6. PD-L1 expression as determined by CellSearch® in cultured cell lines. The characteristics for ER. PgR, HER2 expressiona as well as cell culture media information are provided.

Table 7. Platelet-PD-Ll expression in Fixed versus Non-Fixed Whole Blood

Table 8. Platelet-PD-Ll expression according to platelet count in CellSearch® cartridges

Table 9. Patient demographic characteristics.

Table 10. Univariable association of factors of interest with CTC-PD-L1 positive rate

Table 11. Multivariable results of factors of interest with CTC-PD-L1 positivity rate

Table 12. Univariable association of factors of interest with Platelet-PD-Ll positivity

Table 13. Multivariable results of factors of interest with Platelet-PD-Ll positivity

REFERENCES

1. Constantinidou A, Alifieris C, Trafalis DT. Targeting Programmed Cell Death -1 (PD-1) and Ligand (PD-L1): A new era in cancer active immunotherapy. Pharmacol Ther 2018; 10.1016/j.pharmthera.2018.09.008.

2. Schmid P, Adams S, Rugo HS, et al. Atezolizumab and Nab-Paclitaxel in Advanced Triple-Negative Breast Cancer. N Engl J Med 2018;379(22):2108-2121.

3. Davis AA, Patel VG. The role of PD-L1 expression as a predictive biomarker: an analysis of all US Food and Drug Administration (FDA) approvals of immune checkpoint inhibitors. J Immunother Cancer 2019;7(1 ):278.

4. Emens LA, Ascierto PA, Darcy PK, et al. Cancer immunotherapy: Opportunities and challenges in the rapidly evolving clinical landscape. Eur J Cancer 2017; 81 : 116- 129. 5. Lambert AW, Patabiraman DR, Weinberg RA. Emerging Biological Principles of Metastasis. Cell 2017;168(4):670-691.

6. Carretero R, Romero JM, Ruiz-Cabello F, et al. Analysis ofHLA class I expression in progressing and regressing metastatic melanoma lesions after immunotherapy.

Immunogenetics 2008;60(8):439-47.

7. Pantel K, Alix-Panabieres C. Circulating tumour cells in cancer patients: challenges and perspectives. Trends Mol Med 2010;16(9):398-406.

8. Scher HI, Heller G, Molina A, et al. Circulating tumor cell biomarker panel as an individual-level surrogate for survival in metastatic castration-resistant prostate cancer. J Clin Oncol 2015;33(12): 1348-55.

9. Smerage JB, Barlow WE, Hortobagyi GN, et al. Circulating tumor cells and response to chemotherapy in metastatic breast cancer: SWOG S0500. J Clin Oncol 2014;32(31):3483-9.

10. Cohen SJ, Punt CJ, lannotti N, et al. Relationship of circulating tumor cells to tumor response, progression-free survival, and overall survival in patients with metastatic colorectal cancer. J Clin Oncol 2008;26(19):3213-21.

11. Krebs MG, Sloane R, Priest L, et al. Evaluation and prognostic significance of circulating tumor cells in patients with non-small-cell lung cancer. J Clin Oncol 2011;29(12):1556-63.

12. Paoletti C, Cani AK, Larios JM, et al. Comprehensive Mutation and Copy Number Profiling in Archived Circulating Breast Cancer Tumor Cells Documents Heterogeneous Resistance Mechanisms. Cancer Res 2018;78(4):1110-1122.

13. Paoletti C, Muniz MC, Thomas DG, et al. Development of circulating tumor cell- endocrine therapy index in patients with hormone receptor-positive breast cancer.

Clin Cancer Res 2015;21(ll):2487-98.

14. Paoletti C, Li Y, Muniz MC, et al. Significance of Circulating Tumor Cells in Metastatic Triple-Negative Breast Cancer Patients within a Randomized, Phase II Trial: TBCRC 019. Clin Cancer Res 2015;21(12):2771-9.

15. Boffa DJ, Graf RP, Salazar MC, et al. Cellular Expression of PD-L1 in the Peripheral Blood of Lung Cancer Patients is Associated with Worse Survival. Cancer Epidemiol Biomarkers Prev 2017;26(7): 1139-1145.

16. Anantharaman A, Friedlander T, Lu D, et al. Programmed death-ligand 1 (PD-L1) characterization of circulating tumor cells (CTCs) in muscle invasive and metastatic bladder cancer patients. BMC Cancer 2016;16(l):744. 17. Mazel M, Jacot W, Pantel K, et al. Frequent expression of PD-L1 on circulating breast cancer cells. Mol Oncol 2015;9(9): 1773-82.

18. Janning M, Kobus F, Babayan A, et al. Determination of PD-L1 Expression in Circulating Tumor Cells of NSCLC Patients and Correlation with Response to PD- 1/PD-L1 Inhibitors. Cancers (Basel) 2019;ll(6). Darga et al

19. Khattak MA, Reid A, Freeman J, et al. PD-L1 Expression on Circulating Tumor Cells May Be Predictive of Response to Pembrolizumab in Advanced Melanoma: Results from a Pilot Study. Oncologist 2020;25(3):e520-e527.

20. Prestipino A, Emhardt AJ, Aumann K, et al. Oncogenic JAK2(V617F) causes PD- L1 expression, mediating immune escape in myeloproliferative neoplasms. Sci Transl Med 2018;10(429).

21. Paoletti C, Larios JM, Muniz MC, et al. Heterogeneous estrogen receptor expression in circulating tumor cells suggests diverse mechanisms of fulvestrant resistance. Mol Oncol 2016;10(7): 1078-85.

22. Paoletti C, Schiavon G, Dolce EM, et al. Circulating biomarkers and resistance to endocrine therapy in metastatic breast cancers: correlative results from AZD9496 oral SERD Phase I trial. Clin Cancer Res 2018; 10.1158/1078-0432.CCR-18-1569.

23. Gonzalez TL, Hancock M, Sun S, et al. Targeted degradation of activating estrogen receptor alpha ligand-binding domain mutations in human breast cancer. Breast Cancer Res Treat 2020; 180(3): 611-622.

24. Cristofanilli M, Budd GT, Ellis MJ, et al. Circulating tumor cells, disease progression, and survival in metastatic breast cancer. N Engl J Med 2004;351(8):781- 91.

25. Bidard FC, Peeters DJ, Fehm T, etal. Clinical validity of circulating tumour cells in patients with metastatic breast cancer: a pooled analysis of individual patient data. Lancet Oncol 2014;15(4):406-14.

26. Jacot W, Mazel M, Mollevi C, et al. Clinical Correlations of Programmed Cell Death Ligand 1 Status in Liquid and Standard Biopsies in Breast Cancer. Clin Chem 2020;66(8): 1093-1101.

27. Schott DS, Pizon M, Pachmann U, et al. Sensitive detection of PD-L1 expression on circulating epithelial tumor cells (CETCs) could be a potential biomarker to select patients for treatment with PD-1/PD-L1 inhibitors in early and metastatic solid tumors. Oncotarget 2017;8(42):72755-72772. 28. Rolfes V, Idel C, Pnes R et al. PD-L1 is expressed on human platelets and is affected by immune checkpoint therapy. Oncotarget 2018;9(44):27460-27470.

29. Jenne CN. Platelets: crossroads of immunity and hemostasis. Blood 2014;124(5):671-2.

30. Nami N, Feci L, Napoliello L, etal. Crosstalk between platelets and PBMC: New evidence in wound healing. Platelets 2016;27(2): 143-8.

31. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell 2011;144(5):646-74.

32. Haemmerle M, Stone RL, Menter DG, et al. The Platelet Lifeline to Cancer: Challenges and Opportunities. Cancer Cell 2018;33(6):965-983.

33. Szczerba BM, Castro-Giner F, Vetter M, et al. Neutrophils escort circulating tumour cells to enable cell cycle progression. Nature 2019;566(7745):553-557.

34. Wei XL, Wu QN, Chen DL, et al. The Clinical and Biomarker Association of Programmed Death Ligand 1 and its Spatial Heterogeneous Expression in Colorectal Cancer. J Cancer 2018;9(23):4325-4333.

35. Adams S, Gatti-Mays ME, Kalinsky K, et al. Current Landscape of Immunotherapy in Breast Cancer: A Review. JAMA Oncol 2019;

10.1001/jamaoncol.2018.7147.

36. Zhang J, Bu X, Wang H, et al. Cyclin D-CDK4 kinase destabilizes PD-L1 via cullin 3-SPOP to control cancer immune surveillance. Nature 2018;553(7686):91-95.

All publications, patents, patent applications and accession numbers mentioned in the above specification are herein incorporated by reference in their entirety. Although the invention has been described in connection with specific embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications and variations of the described compositions and methods of the invention will be apparent to those of ordinary skill in the art and are intended to be within the scope of the following claims.

Claims

CLAIMS We claim:

1. A method of treating cancer, comprising: a) measuring the level of PD-L1 expression on CTCs and platelets in a sample from a subject; and b) administering immune checkpoint therapy to said subject when the level of PD-L1 on said CTCs and/or platelets is above a threshold level.

2. A method for treating a subject for cancer, the method comprising the steps of: a) measuring the level of PD-L1 expression on CTCs and/or platelets by: obtaining or having obtained a blood sample from said subject; and performing or having performed an assay on the blood to determine the presence or level of expression of PD-L1 on CTCs and platelets in the sample; and b) administering immune checkpoint therapy to said subject when the level of PD-L1 on said CTCs and/or platelets is above a threshold level.

3. A method of treating a subject, comprising: administering immune checkpoint therapy to said subject when the level of PD-L1 on CTCs and platelets in a sample from said subject is above a threshold level.

4. The method of any of the preceding claims, wherein said immune checkpoint therapy is anti-PD-Ll or anti-PD-L therapy.

5. The method of claim 4, wherein said immune checkpoint therapy is selected from the group consisting of a small molecule, an antibody, a peptide, and a nucleic acid.

6. The method of claim 5, wherein said antibody is selected from the group consisting of atezolizumab, avelumab, durvalumab, pembrolizumab, nivolumab, cemiplimab, spartalizumab, camrelizumab, sintilimab, tislelizumab, tonpahmab, dostarlimab, INCMGA00012, AMP-224, AMP-514, CK-301, and KN035.

7. The method of claim 5, wherein said peptide is selected from the group consisting of AUNP12 and BMS-986189.

8. The method of claim 5, wherein said small molecule is CA-170.

9. The method of claim 5, wherein said nucleic acid is selected from the group consisting of a siRNA, an antisense, and a miRNA.

10. The method of any of the preceding claims, wherein said sample is a blood or blood product.

11. The method of any of the preceding claims, wherein said measuring comprises contacting said CTCs and platelets with an antibody that specifically binds to PF-D1.

12. The method of any of the preceding claims, wherein said measuring comprises fluorescence activated cell sorting.

13. The method of any of the preceding claims, wherein said measuring comprises a multiplex PCR method.

14. The method of any of the preceding claims, wherein said measuring comprises an immunomagnetic assay.

15. The method of any of the preceding claims, wherein said cancer is breast cancer.

16. The method of claim 15, wherein said breast cancer is metastatic.

17. The method of claim 15, wherein said breast cancer is estrogen receptor positive or negative.

18. The method of any of the preceding claims, wherein said threshold level is one or more CTCs in a sample that express PD-L1 on its surface at a level of 1-3⁺ and/or greater than 100 platelets positive for PD-L1 in a sample.

19. The claim 18, wherein said threshold level is determined using a visual scale or by automated detection.

20. The method of any of the preceding claims, wherein said measuring step is repeated one or more times.

21. The method of claim 20, wherein said measuring step is repeated after administration of said immune checkpoint therapy.

22. A method for determining a treatment course of action, comprising a) measuring the level of PD-L1 expression on CTCs and platelets; and b) determining a treatment course of action based on said level of PD-L1 on said CTCs and platelets.

23. The method of claim 22, wherein said treatment course of action comprises immune checkpoint therapy.