WO2023038999A1 - Compositions and methods for treating ovarian aging, ovarian diseases and conditions, and symptoms thereof - Google Patents

Compositions and methods for treating ovarian aging, ovarian diseases and conditions, and symptoms thereof Download PDF

Info

Publication number
WO2023038999A1
WO2023038999A1 PCT/US2022/042799 US2022042799W WO2023038999A1 WO 2023038999 A1 WO2023038999 A1 WO 2023038999A1 US 2022042799 W US2022042799 W US 2022042799W WO 2023038999 A1 WO2023038999 A1 WO 2023038999A1
Authority
WO
WIPO (PCT)
Prior art keywords
extract
subject
compound
acid
pharmaceutically acceptable
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2022/042799
Other languages
English (en)
French (fr)
Inventor
Keshav K. Singh
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yuva Biosciences Inc
Original Assignee
Yuva Biosciences Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yuva Biosciences Inc filed Critical Yuva Biosciences Inc
Priority to EP22868016.1A priority Critical patent/EP4398921A4/en
Priority to US18/690,132 priority patent/US20250017992A1/en
Priority to JP2024515109A priority patent/JP2024534952A/ja
Publication of WO2023038999A1 publication Critical patent/WO2023038999A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/02Algae
    • A61K36/03Phaeophycota or phaeophyta (brown algae), e.g. Fucus
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • A61P15/08Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/352Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom condensed with carbocyclic rings, e.g. methantheline 
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365Lactones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365Lactones
    • A61K31/366Lactones having six-membered rings, e.g. delta-lactones
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/715Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/715Polysaccharides, i.e. having more than five saccharide radicals attached to each other by glycosidic linkages; Derivatives thereof, e.g. ethers, esters
    • A61K31/737Sulfated polysaccharides, e.g. chondroitin sulfate, dermatan sulfate
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • A61K36/18Magnoliophyta (angiosperms)
    • A61K36/185Magnoliopsida (dicotyledons)
    • A61K36/47Euphorbiaceae (Spurge family), e.g. Ricinus (castorbean)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K8/00Cosmetics or similar toiletry preparations
    • A61K8/18Cosmetics or similar toiletry preparations characterised by the composition
    • A61K8/96Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution
    • A61K8/97Cosmetics or similar toiletry preparations characterised by the composition containing materials, or derivatives thereof of undetermined constitution from algae, fungi, lichens or plants; from derivatives thereof
    • A61K8/9783Angiosperms [Magnoliophyta]
    • A61K8/9789Magnoliopsida [dicotyledons]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61QSPECIFIC USE OF COSMETICS OR SIMILAR TOILETRY PREPARATIONS
    • A61Q19/00Preparations for care of the skin
    • A61Q19/08Anti-ageing preparations

Definitions

  • aspects and embodiments disclosed herein relate to methods of treatment of diseases and conditions related to mitochondrial dysfunction. More specifically, aspects and embodiments disclosed herein relate to methods of treatment of diseases and conditions related to mitochondrial DNA depletion.
  • Mitochondrial dysfunction such as mitochondrial DNA (mtDNA) depletion
  • mitochondrial DNA (mtDNA) depletion is involved in many diseases and conditions, such as mtDNA depletion syndromes, mitochondrial diseases, viral infections, viral infection-induced symptoms, aging, aging-associated chronic diseases, reduced energy levels and vitality, and other human pathologies.
  • mtDNA depletion syndromes mitochondrial diseases, viral infections, viral infection-induced symptoms, aging, aging-associated chronic diseases, reduced energy levels and vitality, and other human pathologies.
  • mtDNA depletion syndromes mitochondrial diseases, viral infections, viral infection-induced symptoms, aging, aging-associated chronic diseases, reduced energy levels and vitality, and other human pathologies.
  • Fundamental questions about mitochondrial biology and mtDNA biology and their roles in such diseases and conditions remain mostly unsolved.
  • Animal models capable of inducing mitochondrial dysfunction and/or modulating mtDNA copy number and/or concentration have been developed and provide a system for investigating mitochondrial path
  • a method of enhancing or improving fertility in a subject may comprise administering to the subject a composition comprising an effective amount of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds constituent of one or more of an emblica extract and a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds having a similarity score of at least 95% with a compound constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof.
  • a method of extending reproductive longevity in a subject may comprise administering to the subject a composition comprising an effective amount of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds having a similarity score of at least 95% with a compound constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof.
  • a method of increasing oocyte mitochondrial mass or preventing a decrease of oocyte mitochondrial mass in a subject may comprise administering to the subject a composition comprising an effective amount of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds having a similarity score of at least 95% with a compound constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof.
  • a method of improving embryo development or improving embryo fertilization rate may comprise administering to a subject source of the embryo or to the embryo a composition comprising an effective amount of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds having a similarity score of at least 95% with a compound constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof.
  • a method of treating or preventing an ovarian disease or condition in a subject may comprise administering to the subject a composition comprising an effective amount of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds having a similarity score of at least 95% with a compound constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof.
  • a method of improving embryo development or improving embryo fertilization rate may comprise transferring ooplasm from a donor oocyte to a recipient oocyte to be fertilized to form the embryo.
  • the donor oocyte may have a mitochondrial DNA (mtDNA) content greater than the recipient oocyte.
  • At least one of the donor subject, a recipient subject, and the embryo may have been administered a composition comprising an effective amount of one or more of an emblica extract, a fucus extract, a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds having a similarity score of at least 95% with a compound constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof.
  • a method of reducing, preventing, or delaying perimenopause, menopause, or a symptom thereof in a subject may comprise administering to the subject a composition comprising an effective amount of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds having a similarity score of at least 95% with a compound constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof.
  • the method may comprise administering to the subject an effective amount of an emblica extract, one or more compound constituent of an emblica extract or having a similarity score of at least 95% with a compound constituent of an emblica extract, or a pharmaceutically acceptable form thereof.
  • the method may comprise administering to the subject an effective amount of a fucus extract, one or more compound constituent of an fucus extract or having a similarity score of at least 95% with a compound constituent of an fucus extract, or a pharmaceutically acceptable form thereof.
  • the method may comprise administering to the subject an effective amount of a chebula extract, one or more compound constituent of a chebula extract or having a similarity score of at least 95% with a compound constituent of a chebula extract, or a pharmaceutically acceptable form thereof.
  • the emblica extract is derived from Emblica officinalis.
  • the compound contained in the emblica extract is gallic acid, vanillic acid, chlorogenic acid, 5 caffeic acid, syringic acid, coumaric acid, quercetin, emblicanin A, emblicanin B, punigluconin, pedunculagin, punicafolin, phyllanemblin, kaempferol, ellagic acid, chebulinic acid, chebulagic acid, punicalagin, a metabolite of any of the foregoing, a compound having a similarity score of at least 95% with any of the foregoing, or a pharmaceutically acceptable form of any of the foregoing.
  • the fucus extract is derived from Fucus vesiculosus, Fucus serratus, Fucus, spiralis, or Fucus guiryi.
  • the compound constituent of the fucus extract is gallic acid, vanillic acid, chlorogenic acid, caffeic acid, syringic acid, coumaric acid, quercetin, fucoidan, punigluconin, pedunculagin, punicafolin, phyllanemblin, kaempferol, ellagic acid, chebulinic acid, chebulagic acid, punicalagin, a metabolite of any of the foregoing, a compound having a similarity score of at least 95% with any of the foregoing, or a pharmaceutically acceptable form of any of the foregoing.
  • the chebula extract is derived from Terminilia chebula, Terminalia arborea, or Lumnitzera racemose.
  • the compound constituent of the chebula extract is gallic acid, vanillic acid, chlorogenic acid, caffeic acid, syringic acid, coumaric acid, quercetin, fucoidan, punigluconin, and pedunculagin, punicafolin, phyllanemblin, kaempferol, ellagic acid, chebulinic acid, chebulagic acid, punicalagin, a metabolite of any of the foregoing, a compound having a similarity score of at least 95% with any of the foregoing, or a pharmaceutically acceptable form of any of the foregoing.
  • the composition comprises two or more of: an effective amount of an emblica extract, or a pharmaceutically acceptable form thereof, or a compound constituent of an emblica extract, or a pharmaceutically acceptable form thereof, or a compound having a similarity score of at least 95% with a compound constituent of an emblica extract, or a pharmaceutically acceptable form thereof; an effective amount of a fucus extract, or a pharmaceutically acceptable form thereof, or a compound constituent of a fucus extract, or a pharmaceutically acceptable form thereof, or a compound having a similarity score of at least 95% with a compound constituent of a fucus extract, or a pharmaceutically acceptable form thereof; and an effective amount of a chebula extract, or a pharmaceutically acceptable form thereof, or a compound constituent of a chebula extract, or a pharmaceutically acceptable form thereof, or a compound having a similarity score of at least 95% with a compound constituent of a chebula extract, or a pharmaceutically acceptable form thereof.
  • the composition is fortified with one or more compounds constituent of an emblica extract, or a pharmaceutically acceptable form thereof, or a compound having a similarity score of at least 95% with a compound constituent of an emblica extract, or a pharmaceutically acceptable form thereof.
  • the composition is fortified with one or more compounds constituent of a fucus extract, or a pharmaceutically acceptable form thereof, or a compound having a similarity score of at least 95% with a compound constituent of a fucus extract, or a pharmaceutically acceptable form thereof.
  • the composition is fortified with one or more compounds constituent of a chebula extract, or a pharmaceutically acceptable form thereof, or a compound having a similarity score of at least 95% with a compound constituent of a chebula extract, or a pharmaceutically acceptable form thereof.
  • the one or more compounds constituent of the emblica extract or having a similarity score of at least 95% with a compound constituent of the emblica extract is purified, e.g., at least 80% purified, at least 85% purified, at least 90% purified, at least 95% purified, at least 98% purified, at least 99% purified, at least 99.9% purified, at least 99.99% purified, or at least 99.999% purified.
  • the one or more compounds constituent of the fucus extract or having a similarity score of at least 95% with a compound constituent of the fucus extract is purified, e.g., at least 80% purified, at least 85% purified, at least 90% purified, at least 95% purified, at least 98% purified, at least 99% purified, at least 99.9% purified, at least 99.99% purified, or at least 99.999% purified.
  • the one or more compounds constituent of the chebula extract or having a similarity score of at least 95% with a compound constituent of the chebula extract is purified, e.g., at least 80% purified, at least 85% purified, at least 90% purified, at least 95% purified, at least 98% purified, at least 99% purified, at least 99.9% purified, at least 99.99% purified, or at least 99.999% purified.
  • the effective amount is a therapeutically effective amount.
  • administration induces mitochondrial biogenesis and/or improves mitochondrial function.
  • the effective amount or therapeutically effective amount is sufficient to induce mitochondrial biogenesis.
  • administration increases expression of at least one protein selected from PGC-la, TFAM, NRF-1, and COX II.
  • administration modulates menstrual cycles, e.g., normalizes menstrual cycles, increases ovulation events, and/or increases an anti-Mullerian hormone (AMH) level of the subject or recipient subject.
  • AMH anti-Mullerian hormone
  • administration decreases the probability of embryonic aneuploidy and/or Leigh’s syndrome.
  • administration reduces or lessens severity or frequency of at least one symptom of an ovarian diseases or conditions e.g., skin or vaginal dryness, pelvic pain or cramping, inflammation, prolonged or irregular menstrual cycles, and decreased ovulation events.
  • an ovarian diseases or conditions e.g., skin or vaginal dryness, pelvic pain or cramping, inflammation, prolonged or irregular menstrual cycles, and decreased ovulation events.
  • the composition is administered topically.
  • the composition is administered parenterally, e.g., intravenously, intraperitoneally, or intramuscularly.
  • the composition is administered enterally.
  • the composition is formulated as a topical solution, oil, cream, emulsion, or gel.
  • the composition is formulated as a shampoo, conditioner, spray, cream, gel, balm, body wash, soap, lotion, or make-up.
  • the composition is formulated as a parenteral liquid solution.
  • the composition is formulated as an enteral capsule or tablet, or dietary supplement or food, e.g., food, food supplement, medical food, food additive, nutraceutical, or drink.
  • the composition is administered locally.
  • the composition is administered systemically.
  • the composition is formulated for immediate release.
  • the composition is formulated for extended release, e.g., controlled or sustained release.
  • the composition may be administered in combination with a standard of care treatment for improving fertility.
  • the composition may be administered in combination with a standard of care treatment for treating an ovarian disease or condition or a symptom thereof.
  • composition may be administered in combination with one or more of clomiphene, tamoxifen, letrozole, metformin, gonadotrophins, gonadotrophin-releasing hormone, dopamine agonists, and other hormonal treatments.
  • composition may be administered in combination with a surgical procedure, e.g., fallopian tube surgery, laparoscopic surgery to remove or destroy cysts or submucosal fibroids, or laparoscopic ovarian drilling.
  • a surgical procedure e.g., fallopian tube surgery, laparoscopic surgery to remove or destroy cysts or submucosal fibroids, or laparoscopic ovarian drilling.
  • the composition may be administered in combination with a UV-blocking agent, moisturizer, sunscreen, wrinkle cream, retinoid, alpha-hydroxy acid, beta-hydroxy acid, squalene, antioxidant, tretinoin, glycosaminoglycan (GAG), lactic acid, malic acid, citric acid, tartaric acid, hydroquinone, kojic acid, L-ascorbic acid, licorice extract, N-acetylglucosamine, niacinamide, soy, dermal filler or injection, e.g. hyaluronic acid or calcium hydroxylapatite, botulinum toxin, laser resurfacing procedure, ultrasound therapy, chemical peel, e.g. glycolic acid peel, trichloroacetic acid or salicylic acid, or dermabrasion procedure.
  • a UV-blocking agent e.g. hyaluronic acid or calcium hydroxylapatite
  • botulinum toxin e.g. glycolic acid
  • the composition is administered in combination with a biomaterial, or encapsulated in a biomaterial, selected from an extracellular vesicle, collagen, hyaluronic acid, a synthetic biomaterial (e.g., polylactic acid (PLA), polyglycolic acid (PGA), polycaprolactone (PCL), polyethylene glycol (PEG)), fibrin, alginate, and a composite biomaterial.
  • a biomaterial selected from an extracellular vesicle, collagen, hyaluronic acid, a synthetic biomaterial (e.g., polylactic acid (PLA), polyglycolic acid (PGA), polycaprolactone (PCL), polyethylene glycol (PEG)), fibrin, alginate, and a composite biomaterial.
  • PVA polylactic acid
  • PGA polyglycolic acid
  • PCL polycaprolactone
  • PEG polyethylene glycol
  • the ovarian disease or condition is selected from perimenopause, menopause, endometriosis, ovarian cysts, pre-menopausal or post-menopausal ovarian cancer, e.g., ovarian epithelial cancer, ovarian tumors, e.g., ovarian germ cell tumor, ovarian low malignant potential tumors, and ovarian stromal tumors, polycystic ovary syndrome (PCOS), primary ovarian insufficiency (POI), and ovarian torsion.
  • PCOS polycystic ovary syndrome
  • POI primary ovarian insufficiency
  • composition may be administered in combination with one or more of hormone therapy, e.g., estrogen, progesterone, testosterone, or a synthetic form thereof, selective serotonin reuptake inhibitors (SSRIs), gabapentin, clonidine, hormonal contraceptives, gonadotropinreleasing hormone (GnRH) agonists or antagonists, heat therapy, pain relievers, nonsteroidal anti-inflammatory drugs (NSAID), such as ibuprofen or other analgesics, spironolactone, eflornithine, electrolysis, chemotherapy, radiation therapy, and surgery, e.g., hysterectomy, bilateral salpingo-oophorectomy, and debulking surgery, and lifestyle changes, such as weight loss, improved nutrition, and increased physical activity.
  • hormone therapy e.g., estrogen, progesterone, testosterone, or a synthetic form thereof
  • SSRIs selective serotonin reuptake inhibitors
  • gabapentin gabapentin
  • the embryo may be produced by in vitro fertilization.
  • the method may comprise measuring mitochondrial content of the embryo and selecting the embryo responsive to the measurement of mitochondrial content being within a predetermined range.
  • the donor oocyte may be autologous.
  • the donor oocyte may be allogeneic.
  • the donor oocyte may be xenogeneic.
  • the ooplasm transfer may be complete.
  • the ooplasm transfer may be partial, e.g., by electrofusion or direct ooplasmic injection.
  • the transfer may be performed by modified intracytoplasmic sperm injection (ICSI).
  • ICSI modified intracytoplasmic sperm injection
  • the transfer may be performed by autonomous germline mitochondrial energy transfer (AUGMENT) on the oocyte.
  • ALGMENT autonomous germline mitochondrial energy transfer
  • the method may comprise using CRISPR/Cas 9 gene editing technology on the mtDNA of the donor oocyte or the recipient oocyte.
  • the method may comprise using CRISPR/Cas 9 gene editing technology on mitochondrial DNA (mtDNA) of an oocyte of the subject to be fertilized to form the embryo.
  • mtDNA mitochondrial DNA
  • the method may further comprise introducing stem cell generated mitochondrial DNA (mtDNA) into an oocyte of the subject to be fertilized to form the embryo.
  • mtDNA stem cell generated mitochondrial DNA
  • the method may comprise introducing antioxidants to a culture media of the embryo during development.
  • the transfer may be performed by nuclear genome transfer, e.g., oocyte spindle transfer, germinal vesicle (GV) transfer, pronuclear transfer (PNT), or polar body nuclear transfer (PBNT).
  • nuclear genome transfer e.g., oocyte spindle transfer, germinal vesicle (GV) transfer, pronuclear transfer (PNT), or polar body nuclear transfer (PBNT).
  • GV germinal vesicle
  • PNT pronuclear transfer
  • PBNT polar body nuclear transfer
  • the subject or recipient subject may be characterized by age-related reduced fertility, infertility, and/or ovarian aging.
  • the subject or recipient subject may be 40 years or older.
  • the subject or recipient subject may be characterized by premature reproductive aging, e.g., primary ovarian insufficiency (POI), early onset prolonged or irregular menstrual cycles, early onset decreased ovulation events, premature menopause or perimenopause, and/or ovarian inflammation associated with premature reproductive aging.
  • POI primary ovarian insufficiency
  • early onset prolonged or irregular menstrual cycles early onset decreased ovulation events
  • premature menopause or perimenopause premature reproductive aging.
  • the subject or recipient subject may be younger than 40 years.
  • the subject may be pre-menopausal.
  • the subject may be perimenopausal.
  • the subject may be post-menopausal.
  • the subject or recipient subject may have a diminished ovarian reserve (DOR).
  • DOR diminished ovarian reserve
  • the subject or recipient subject may have a normal ovarian reserve (NOR).
  • NOR normal ovarian reserve
  • the subject or recipient subject may suffer from one or more of obesity, diabetes, chronic inflammation, high blood sugar, an autoimmune disease, and/or poor lifestyle factors, such as smoking, alcohol use, drug use, exposure to chemicals (e.g., bisphenol A, advanced glycation end products (AGE)) and/or radiation, poor nutrition, e.g., increased ingestion of charred foods, increased ingestion of saturated fats, and/or reduced ingestion of fruits and vegetables, and/or reduced exercise.
  • chemicals e.g., bisphenol A, advanced glycation end products (AGE)
  • AGE advanced glycation end products
  • the subject or recipient subject may be characterized by a reduced anti-Mullerian hormone (AMH) level, e.g., less than about 80 ng/mL, an increased follicle stimulating hormone (FHL) level, e.g., greater than about 10 IU/L, an increased estradiol level, and/or a reduced antral follicle count (AFC), e.g., less than about 5-7 total follicles.
  • AMH anti-Mullerian hormone
  • FHL follicle stimulating hormone
  • AFC reduced antral follicle count
  • the subject or recipient subject may be undergoing or have attempted in vitro fertilization (IVF).
  • IVF in vitro fertilization
  • the subject or recipient subject may be a poor responder to IVF.
  • the subject or recipient subject may be a normal responder to IVF.
  • the subject or recipient subject may suffer from reduced production of reproductive hormones, e.g., estrogen and/or progesterone, increased production of follicle-stimulating hormone (FSH), prolonged or irregular menstrual cycles, uterine or vaginal atrophy, e.g., decreased endometrial glands, diffuse glandular breakdown (apoptotic bodies) of the uterus, acute inflammation of the uterus, and/or decreased vaginal epithelial thickness, decreased ovulation events, ovarian inflammation, and/or infertility.
  • reproductive hormones e.g., estrogen and/or progesterone
  • FSH follicle-stimulating hormone
  • uterine or vaginal atrophy e.g., decreased endometrial glands, diffuse glandular breakdown (apoptotic bodies) of the uterus, acute inflammation of the uterus, and/or decreased vaginal epithelial thickness, decreased ovulation events, ovarian inflammation, and/or infertility.
  • the subject or recipient subject may be characterized by a mitofusin (Mfnl) gene abnormality, a dynamic related protein 1 (Drpl) gene abnormality, a caseinolytic peptidase P (Clpp) gene abnormality, a growth differentiation factor 9 (GDF9) gene abnormality, a fragile-X mental retardation 1 (FMRI) gene abnormality, a transcription factor A (TFAM) gene abnormality, a mitochondrial DNA polymerase gamma (PolgA) gene abnormality, a mitochondrial inner membrane peptidase (IMP) gene abnormality, and/or a mitochondrial ABC transporter (MDR-1) gene abnormality.
  • Mfnl mitofusin
  • Drpl dynamic related protein 1
  • Clpp caseinolytic peptidase P
  • GDF9 growth differentiation factor 9
  • FMRI fragile-X mental retardation 1
  • TFAM transcription factor A
  • IMP mitochondrial inner membrane peptidase
  • MDR-1 mitochondrial ABC transporter
  • the subject or recipient subject may be characterized by decreased gene expression of PPARy, PGC-la, PGC-lb, ERR, NRF-1, NRF-2, SIRT1, SIRT3, SIRT4, and/or SIRT5.
  • the subject or recipient subject may be characterized by decreased AMP-activated protein kinase (AMPK) and or PTEN-induced kinase 1 (PINK1) protein expression and/or increased mammalian target of rapamycin (mTOR) protein expression.
  • AMPK AMP-activated protein kinase
  • PINK1 PTEN-induced kinase 1
  • the subject or recipient subject may have a somatic mitochondrial DNA mutation in an oocyte to be fertilized to form the embryo or the recipient oocyte, e.g., a T414G transverse mutation.
  • the subject or recipient subject may have an inherited mitochondrial DNA (mtDNA) mutation in an oocyte to be fertilized to form the embryo or the recipient oocyte, e.g., a T414G transverse mutation.
  • mtDNA mitochondrial DNA
  • the subject or recipient subject may be characterized by decreased levels of mitochondrial DNA (mtDNA) in an oocyte to be fertilized to form the embryo or the recipient oocyte and/or reduced oocyte quality, e.g., chromosomal misalignment and/or spindle malformation.
  • mtDNA mitochondrial DNA
  • the subject or recipient subject may be characterized by decreased gene expression of superoxide dismutase (SOD) and/or increased levels of Aldh3A2 enzyme.
  • SOD superoxide dismutase
  • the subject or recipient subject may be characterized by decreased mRNA expression of Prdx3, Prdx4, and/or Txn2 enzyme.
  • the subject or recipient subject may suffer from Turner’s Syndrome, galactosemia, and/or Fragile X Syndrome.
  • the subject or recipient subject may be characterized by progressive external ophthalmoplegia (POE), spinocerebellar ataxia with epilepsy (SCAE), and/or mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS).
  • POE progressive external ophthalmoplegia
  • SCAE spinocerebellar ataxia with epilepsy
  • MELAS mitochondrial encephalomyopathy
  • lactic acidosis lactic acidosis
  • MELAS stroke-like episodes
  • the subject or recipient subject may be characterized by dysfunctional folliculogenesis, e.g., follicle depletion or follicle dysfunction.
  • dysfunctional folliculogenesis e.g., follicle depletion or follicle dysfunction.
  • the subject or recipient subject may have decreased tertiary follicle counts, e.g., early antral, antral, and/or pre-ovulatory, and/or decreased corpora lutea (CL) follicle counts.
  • tertiary follicle counts e.g., early antral, antral, and/or pre-ovulatory, and/or decreased corpora lutea (CL) follicle counts.
  • the subject or recipient subject may be characterized by down-regulation of estrogen receptors (ER) a and P in the ovary, reduced ESRI or ESR2 gene expression, increased miR- 206-3p RNA expression, reduced ovarian production of 17P-estradiol (E2), and/or increased lipid-laden ovarian stromal cells.
  • ER estrogen receptors
  • E2 17P-estradiol
  • the composition comprises a nanoparticle-based delivery carrier.
  • the composition comprises a skin penetration enhancer or is administered in combination with a skin penetration enhancer, e.g., a chemical skin penetration enhancer or a physical skin penetration enhancer.
  • the composition comprises a mitochondria-targeting agent or a delivery carrier functionalized with a mitochondria-targeting agent.
  • the compound constituent of an emblica extract was derived from, purified from, or isolated from the emblica extract.
  • the compound constituent of an emblica extract was derived from, purified from, or isolated from a source other than the emblica extract.
  • the compound constituent of an emblica extract was synthesized.
  • the compound constituent of a fucus extract was derived from, purified from, or isolated from the fucus extract.
  • the compound constituent of a fucus extract was derived from, purified from, or isolated from a source other than the fucus extract.
  • the compound constituent of a fucus extract was synthesized.
  • the compound constituent of a chebula extract was derived from, purified from, or isolated from the chebula extract.
  • the compound constituent of a chebula extract was derived from, purified from, or isolated from a source other than the chebula extract.
  • the compound constituent of a chebula extract was synthesized.
  • a kit comprising a preparation comprising an effective amount of donor mtDNA in a therapeutically acceptable carrier.
  • the kit may comprise a composition comprising an effective amount of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof, or one or more compounds having a similarity score of at least 95% with a compound constituent of one or more of an emblica extract, a fucus extract, and a chebula extract, or a pharmaceutically acceptable form thereof.
  • FIG. 1A shows quantification of immunofluorescence analysis of OXPHOS complex IV (COXII) in relative fluorescence units (RFUs) in paraffin dorsal skin sections control and mtDNA-depleter mice after dox induction and 16 weeks of topical emblica extract treatment or control treatment.
  • FIG. IB shows RT-PCR analysis of dorsal skin RNA for mtDNA encoded genes from control and mtDNA-depleter mice after dox induction and 16 weeks of topical emblica extract treatment or control treatment;
  • FIG. ID shows quantitative analysis of inflammatory cells in the skin sections from control and mtDNA-depleter mice after dox induction and 16 weeks of topical emblica extract treatment or control treatment (mean ⁇ SD; *P ⁇ 0.05 ; **P ⁇ 0.01 ; ***P ⁇ 0.001 Student’s t test);
  • FIG. 3 shows schematics of emblica extract preventive and therapeutic in vivo experiments
  • FIG. 4A is a graph showing induced expression of mitochondrial complex IV subunit 2 (COXII) by various compositions, according to one embodiment
  • FIG. 4B is a graph showing induced expression of mitochondrial transcription factor A (TFAM) by various compositions, according to one embodiment
  • FIG. 4C is a graph showing induced expression of peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-la) by various compositions, according to one embodiment
  • FIG. 5 is an image of an electrophoresis gel showing protein levels of the mitochondrial biogenesis markers COXII, TFAM, and PGC-la induced by various compositions, according to one embodiment
  • FIGS. 6A-6F are graphs showing COXII expression induced by administration of an emblica extract in vitro at 6 hours to 96 hours after administration;
  • FIGS. 7A-7F are graphs showing TFAM expression induced by administration of an emblica extract in vitro at 6 hours to 96 hours after administration;
  • FIGS. 8A-8F are graphs showing PCG-la expression induced by administration of an emblica extract in vitro at 6 hours to 96 hours after administration;
  • FIGS. 9A-9D are graphs showing COXII expression induced by administration of an emblica extract in vitro, optionally with a nanoparticle delivery carrier, at 6 hours and 24 hours after administration;
  • FIGS. 10A-10B include graphs showing expression of COXII and TFAM at 6 hours after in vitro administration of a constituent of emblica extract, according to one embodiment
  • FIGS. 11A-11D include graphs showing expression of COXII and TFAM at 12 hours and 24 hours after in vitro administration of a constituent of emblica extract, according to one embodiment
  • FIGS. 12A-12D include graphs showing expression of COXII and TFAM at 12 hours and 24 hours after in vitro administration of a constituent of emblica extract, according to one embodiment
  • FIGS. 13A-13D include graphs showing expression of COXII and TFAM at 12 hours and 24 hours after in vitro administration of a constituent of emblica extract, according to one embodiment
  • FIGS. 14A-14D include graphs showing expression of COXII and TFAM at 12 hours and 24 hours after in vitro administration of a constituent of emblica extract, according to one embodiment
  • FIGS. 15A-15D include graphs showing expression of COXII at 6, 12, 24, and 48 hours after in vitro administration of a constituent of emblica extract, according to one embodiment
  • FIGS. 16A-16D include graphs showing expression of TFAM at 6, 12, 24, and 48 hours after in vitro administration of a constituent of emblica extract, according to one embodiment
  • FIGS. 17A-17D include graphs showing expression of COXII at 6, 12, 24, and 48 hours after in vitro administration of a constituent of emblica extract, according to one embodiment
  • FIGS. 18A-18D include graphs showing expression of TFAM at 6, 12, 24, and 48 hours after in vitro administration of a constituent of emblica extract, according to one embodiment
  • FIGS. 19A-19D include graphs showing expression of COXII at 6, 12, 24, and 48 hours after in vitro administration of a constituent of emblica extract, according to one embodiment
  • FIGS. 20A-20D include graphs showing expression of TFAM at 6, 12, 24, and 48 hours after in vitro administration of a constituent of emblica extract, according to one embodiment
  • FIGS. 21A-21D include graphs showing expression of COXII at 6, 12, 24, and 48 hours after in vitro administration of a constituent of emblica extract, according to one embodiment
  • FIGS. 22A-22D include graphs showing expression of TFAM at 6, 12, 24, and 48 hours after in vitro administration of a constituent of emblica extract, according to one embodiment
  • FIGS. 23A-23D include graphs showing expression of COXII at 6, 12, 24, and 48 hours after in vitro administration of a chebulinic acid, optionally encapsulated in a nanoparticle carrier, according to one embodiment
  • FIGS. 24A-24D include graphs showing expression of TFAM at 6, 12, 24, and 48 hours after in vitro administration of chebulinic acid, optionally encapsulated in a nanoparticle carrier, according to one embodiment
  • FIGS. 25A-25B include graphs showing expression of COXII at 6 hours after in vitro administration of emblica extract encapsulated in a nanoparticle carrier, according to one embodiment
  • FIGS. 26A-26D include graphs showing expression of COXII at 6, 12, 24, and 48 hours after in vitro administration of emblica extract encapsulated in a nanoparticle carrier, according to one embodiment
  • FIGS. 27A-27D include graphs showing expression of TFAM at 6, 12, 24, and 48 hours after in vitro administration of emblica extract encapsulated in a nanoparticle carrier, according to one embodiment
  • FIGS. 28A-28D include graphs showing expression of COXII at 6, 12, 24, and 48 hours after in vitro administration of emblica extract encapsulated in a nanoparticle carrier, according to one embodiment
  • FIGS. 29A-29D include graphs showing expression of COXII at 6, 12, 24, and 48 hours after in vitro administration of emblica extract encapsulated in a nanoparticle carrier, according to one embodiment.
  • FIGS. 3OA-3OD include graphs showing expression of TFAM at 6, 12, 24, and 48 hours after in vitro administration of emblica extract encapsulated in a nanoparticle carrier, according to one embodiment.
  • Mitochondrial dysfunction is associated with many mitochondrial diseases, many of which are the result of dysfunctional mitochondrial oxidative phosphorylation (OXPHOS).
  • OXPHOS mitochondrial oxidative phosphorylation
  • Mitochondrial OXPHOS accounts for the generation of most of the cellular adenosine triphosphate (ATP) in a cell.
  • the OXPHOS function largely depends on the coordinated expression of proteins encoded by both nuclear and mitochondrial genomes.
  • the human mitochondrial genome encodes for 13 polypeptides of the OXPHOS system, and the nuclear genome encodes the remaining more than 85 polypeptides required for the assembly of OXPHOS system.
  • mtDNA depletion impairs OXPHOS and leads to mtDNA depletion syndromes (Alberio,et al., Mitochondrion 7, 6-12, 2007; Ryan, Met al., Anna. Rev. Biochem. 76, 701-722, 2007).
  • the mtDNA depletion syndromes are a heterogeneous group of disorders, characterized by low mtDNA levels in specific tissues. In different target organs, mtDNA depletion leads to specific pathological changes (Tuppen, et al., Biochim. Biophys. Acta 1797, 113-128, 201)).
  • mtDNA depletion syndromes result from the genetic defects in the nuclear- encoded genes that participate in mtDNA replication, and mitochondrial nucleotide metabolism and nucleotide salvage pathway (Alberio,et al., Mitochondrion 7, 6-12, 2007).
  • mtDNA depletion is also implicated in other human diseases and conditions, such as, but not limited to, mtDNA depletion syndromes, mitochondrial diseases, viral infections, viral infection-induced symptoms, aging, aging-associated chronic diseases or conditions, reduced energy levels and vitality, characteristics of hair aging including hair loss and graying, characteristics of skin aging including skin wrinkles and senile lentigines, skin diseases and conditions, and other human pathologies.
  • POI primary ovarian insufficiency
  • a mouse that carries a specific mtDNA mutation has been shown to present signs of premature aging (i.e., a mtDNA depleter mouse).
  • studies also suggest a decrease in mtDNA content and mitochondrial copy number with age.
  • Low mtDNA copy number is linked to frailty and, for a multiethnic population, is a predictor of allcause mortality.
  • carrier refers to a diluent or vehicle with which a compound is administered.
  • the carrier may be a pharmaceutically acceptable carrier.
  • the carrier may be a cosmetically acceptable carrier. Examples of suitable pharmaceutical carriers are described in “Remington's Pharmaceutical Sciences” by E. W. Martin.
  • corresponding aspartic acid means an aspartic acid (D) residue that is mutated to an alanine (A) residue in a POLG1 amino acid sequence that is the equivalent of the aspartic acid at position 1135 of the human POLG1 sequence.
  • the “corresponding aspartic acid” is flanked on the amino terminus side by an amino acid sequence of S/T EV H X, I S/T VV H X, or C/A I S/T VV H X, and/or on the carboxy terminus side by an amino acid sequence of X E V/I R, X E V/I R Y/F, or X E V/I R Y/F L, wherein “X” indicates the aspartic acid amino acid that is mutated or will be mutated to alanine.
  • the terms “depleted,” “depletion,” or “depleter” with respect to mtDNA refers to a decrease in mtDNA copy number and/or concentration in a human or in a non-human animal, tissue, or cell of the non-human animal. Such a determination may be made with regard to a human that has not been administered a compound or composition of the disclosure or to a control non-human animal tissue, or cell (for example, a non-human animal that has not expressed or does not express a mutant POLG1 polypeptide).
  • treatment refers to reducing or lessening the severity or frequency of at least one symptom of that disease or condition, compared to a similar but untreated patient. Treatment can also refer to halting, slowing, or reversing the progression of a disease or condition, compared to a similar but untreated patient. Treatment may comprise addressing the root cause of the disease and/or one or more symptoms.
  • the term “effective amount” refers to an amount of a compound or composition of the disclosure administered to a subject, which is effective to provide a desired response and/or effect in the subject.
  • the response and/or effect may be a cosmetic response and/or effect.
  • the response and/or effect may be a therapeutic response and/or effect.
  • the response and/or effect may be a prophylactic or preventative response and/or effect.
  • the term “therapeutically effective amount” refers to an amount of compound or composition of the disclosure administered to a subject, which is effective to treat a disease or condition described herein in a subject and/or to produce a desired physiological response and/or therapeutic effect in the subject.
  • a desired physiological response includes increasing mtDNA copy number and/or concentration.
  • the actual dose which comprises the “effective amount” or “therapeutically effective amount” may depend upon the route of administration, the size and health of the subject, the disorder being treated, and the like.
  • the “effective amount” or “therapeutically effective amount” in the context of the present disclosure may be sufficient to treat or prevent ovarian diseases or conditions and symptoms thereof.
  • the “effective amount” or “therapeutically effective amount” in the context of the present disclosure is sufficient to induce mitochondrial biogenesis.
  • the “effective amount” or “therapeutically effective amount” may be sufficient to induce mitochondrial biogenesis locally.
  • the “effective amount” or “therapeutically effective amount” may be sufficient to induce mitochondrial biogenesis systemically.
  • the “effective amount” or “therapeutically effective amount” in the context of the disclosure decreases an inflammatory phenotype, increases expression of mitochondrial oxidative phosphorylation complexes, increases stability of mitochondrial oxidative phosphorylation complexes, alters, e.g., decreases expression of at least one gene selected from the group consisting of: NF-KB, COX-2, INF-pi, CCL5, MMP1 , MMP2, MMP9, MMP13, IGF1 R, VEGF, and MRPS5, alters, e.g., increases expression of at least one gene selected from the group consisting of: TIMP1 KLOTHO, COL1A1, MTCO2, TFAM, and VDAC, prevents a deactivation of a gene associated with mitochondrial health and activity, selected from: FGF2, FGFR1, COX7A1, PDK4, FAM173A, MRPL12, and WNT11, decreases inflammatory infiltrate in the skin and/or hair
  • the “effective amount” or “therapeutically effective amount” in the context of the disclosure increases mtDNA copy number or concentration by at least 5%, for example, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or 100%.
  • a reduction or increase when a reduction or increase is specified, such reduction or increase may be determined with respect to a subject or non-human animal that has not been treated with a compound or composition of the disclosure and that is suffering from a disease or condition described herein.
  • the “effective amount” or “therapeutically effective amount” in the context of the disclosure prevents incidence of an inflammatory phenotype, prevents a decrease in expression of mitochondrial oxidative phosphorylation complexes, prevents a decrease in stability of mitochondrial oxidative phosphorylation complexes, prevents an increase in expression of at least one gene selected from the group consisting of: NF-KB, COX-2, INF-pi, CCL5, MMP1, MMP2, MMP9, MMP13, 1GF1R.
  • VEGF vascular endothelial growth factor
  • MRPS5 prevents a decrease in expression of at least one gene selected from the group consisting of: TIMP1 K LOT HO, COL1A1, MTCO2, TFAM, and VDAC, prevents a deactivation of a gene associated with mitochondrial health and activity, selected from: FGF2, FGFR1, COX7A1, PDK4, FAM173A, MRPL12, and WNT11, prevents an increase in inflammatory infiltrate in the skin and/or hair follicles, prevents a decrease in mtDNA copy number or concentration, and/or prevents a decrease in expression of at least one protein selected from PGC-la, TFAM, NRF-1, and COXII.
  • the term “excipient” means a substance formulated alongside the active ingredient of a composition included for purposes such as, but not limited to, long-term stabilization, bulking up solid formulations that contain potent active ingredients in small amounts (thus often referred to as bulking agents, fillers, or diluents), or to confer a therapeutic enhancement on the active ingredient in the final dosage form, such as facilitating drug absorption, reducing viscosity, or enhancing solubility. Excipients can also be useful in the manufacturing process, to aid in the handling of the active substance concerns such as by facilitating powder flowability or non-stick properties, in addition to aiding in vitro stability such as prevention of denaturation or aggregation over the expected shelf life.
  • the excipient may be a pharmaceutically acceptable excipient.
  • the excipient may be a cosmetically acceptable excipient. Examples of suitable excipients are described in “Remington's Pharmaceutical Sciences” by E. W. Martin.
  • the term “in need of’ (such as in the phrase “in need of treatment”) refers to a judgment made by a healthcare professional that a subject requires or will benefit from administration of a compound of the disclosure. This judgment is made based on a variety of factors that are in the realm of a healthcare professional's expertise, such as, but not limited to, the knowledge that the subject is ill, or will be ill, as the result of a disease or condition that is treatable by a method or drug composition of the disclosure.
  • mutant POLG1 refers to a POLG1 amino acid sequence from a particular species that contains at least one mutation as compared to the wild-type POLG1 sequence from that species.
  • a mutation need not cause a disease.
  • a single mutation or more than one mutation may be present.
  • a single dominant negative mutation may be present (such as, but not limited to, a DI 135A mutation), optionally with one or additional mutations.
  • the term “pharmaceutically acceptable” refers to a compound that is compatible with the other ingredients of a composition and not deleterious to the subject receiving the compound or composition.
  • the term “pharmaceutically acceptable” means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • cosmetically acceptable refers to a compound that is compatible with the other cosmetic ingredients of a composition and not deleterious to the subject receiving the compound or composition.
  • a cosmetically acceptable composition or compound may be pharmaceutically acceptable. However, a cosmetically acceptable composition or compound need not be pharmaceutically acceptable.
  • the term “pharmaceutically acceptable form” is meant to include known forms of a compound of the disclosure that may be administered to a subject, including, but not limited to, solvates, hydrates, prodrugs, isomorphs, polymorphs, pseudomorphs, neutral forms and salt forms of a compound of the disclosure.
  • pharmaceutically acceptable salt refers to physiologically and pharmaceutically acceptable salts of the compounds of the invention: i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects to the compounds disclosed.
  • exemplary pharmaceutically acceptable salts include but are not limited to (a) salts formed with cations such as sodium, potassium, ammonium, magnesium, calcium, polyamines such as spermine and spermidine and the like; (b) acid addition salts formed with inorganic acids, for example hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like; (c) salts formed with organic acids such as, for example, acetic acid, oxalic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tannic acid, palmitic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, methanesulfonic acid, p- toluenesulfonic acid, naphthalenedisulfonic acid, polygalacturonic acid,
  • the term “pharmaceutical composition” refers to a mixture of one or more of the compounds of the disclosure, with other components, such as, but not limited to, pharmaceutically acceptable carriers and/or excipients.
  • the purpose of a pharmaceutical composition is to facilitate administration of a compound of disclosure.
  • a “cosmetically acceptable” excipient refers to a cosmetically acceptable material, composition, or vehicle, such as a liquid or solid filler, diluent, solvent, or encapsulating material.
  • each excipient is cosmetically acceptable in the sense of being compatible with the other ingredients of a cosmetic formulation, and suitable for use in contact with the tissue or organ of humans and animals without excessive toxicity, irritation, allergic response, immunogenicity, or other problems or complications, commensurate with a reasonable benefit/risk ratio.
  • the terms “repleted,” “repletion,” or “repleter” with respect to mtDNA refers to an increase in mtDNA copy number and/or concentration in a human or a non-human animal, tissue, or cell. Such a determination may be made with regard to a human or to a control non-human animal tissue, or cell that has undergone mtDNA depletion (such as immediately before repletion is initiated. In certain aspects, mtDNA is repletion results in mtDNA copy number and/or concentration approximately equal to the mtDNA copy number and/or concentration observed in a control non-human animal, tissue, or cell (for example, a non-human animal that has not expressed or does not express a mutant POLG1 polypeptide).
  • solvate means a compound of the disclosure, or a pharmaceutically acceptable salt thereof, wherein one or more molecules of a suitable solvent are incorporated in the crystal lattice.
  • a suitable solvent is physiologically tolerable at the dosage administered. Examples of suitable solvents are ethanol, water and the like. When water is the solvent, the molecule may be referred to as a “hydrate.”
  • the terms “subject” or “patient” include all members of the animal kingdom including, but not limited to, vertebrates, mammals, animals (e.g., cats, dogs, horses, swine, rodents, etc.) and humans.
  • the subject is a human.
  • the subject is an animal, e.g., a research animal, e.g., a mouse, a rat.
  • similarity or “similarity score” when used with respect to a compound refers to a degree of similarity between two or more compounds in chemical structure, chemical function, and/or one or more chemical properties.
  • the similarity score may be quantified by augmenting data generated by a deep neural network trained to model a plurality of chemical reactions for any given compound.
  • the data may be augmented by a multidimensional vector defining a matrix of properties of the compound or a chemical reaction involving the compound to generate an embedding score for the compound.
  • the embedding score for two or more compounds may be compared to generate the similarity score between the two or more compounds.
  • Mitochondrial dysfunction is implicated in both intrinsic and extrinsic aging.
  • the presence of skin wrinkles, acanthosis, epidermal hyperplasia with hyperkeratosis, and marked inflammatory infiltrate in the skin has been observed in mtDNA-depleter mice and represent characteristics similar to the extrinsic aging of skin in humans.
  • the changes in expression of intrinsic aging-associated genetic markers support intrinsic mechanisms underlying the phenotypic changes observed in mtDNA-depleter mice.
  • MMP proteolytic matrix metalloprotease
  • TIMP1 tissue-specific inhibitor tissue inhibitor metalloproteinase-1
  • mtDNA stress triggers inflammatory response. Inflammation also underlies aging and age-related diseases. Increased levels of markers of inflammation in the mtDNA-depleter mice indicate an activated immune response in the skin of mtDNA-depleter mice. Increased expression of NF-KB, a master regulator of the inflammatory response upon mtDNA depletion and its reduced expression after the restoration of mtDNA content suggests that NF-KB signaling is a critical mechanism contributing to the skin and hair follicle pathologies observed in mtDNA- depleter mice.
  • mtDNA a unique feature of proteins encoded by mtDNA is A-formyl- methionine at the N terminus.
  • A-formylated peptides when present in the extracellular space are known to act as mitochondrial damage-associated molecular patterns and activate neutrophils or activate keratinocyte-intrinsic responses resulting in the recruitment of immune cells.
  • previous animal models have shown alternations in mtDNA homeostasis and/or mtDNA copy number or concentration using a localized approach (for example targeting only a specific cell type)
  • the disclosure utilizes an animal model that provides for the global and targeted disruption of mtDNA homeostasis and/or mtDNA copy number of concentration in a controlled manner.
  • the disclosure identified compounds that are effective in treating diseases and conditions relating to mitochondrial dysfunction in a background of significant mtDNA depletion.
  • the disclosure demonstrates that such compounds reverse the physiological and phenotypic effects mediated by mitochondrial dysfunction.
  • Exemplary physiological and phenotypic effects of intrinsic and extrinsic aging reversed include a decrease in skin wrinkles, a decrease in hair loss, an increase in hair follicles in growth phase, decreased inflammatory gene expression, decreased inflammatory infiltrate in the skin and hair follicles, and increased collagen content in the skin.
  • the foregoing limitations make identifying effective treatments for the skin diseases and conditions where mitochondrial dysfunction is at issue difficult.
  • the disclosure utilized an inducible non-human animal model expressing a mutated POLG1 polypeptide (such as, but not limited to, a POLG1 polypeptide expressing a dominant-negative (DN) mutation) that induces mitochondrial dysfunction (for example by depletion of mtDNA) in the whole animal or selected cells/tissues.
  • DN dominant-negative
  • the non-human animal model disclosed can be used to rapidly identify compounds effective in treating mtDNA-related diseases and conditions.
  • the animal model in the absence of the expression of mutated POLG1 expression maintained normal epidermal differentiation and hair follicle morphogenesis making this animal model system a valuable tool in identifying therapies for the treatment of a variety of diseases and conditions characterized by mitochondrial dysfunction.
  • the mutant POLG1 polypeptide When the mutant POLG1 polypeptide is expressed, the animal model demonstrates profound phenotypic age-related changes in the skin, including development of skin wrinkles and hair loss. The phenotypic changes are reversible when mitochondrial function is restored (such as through the administration of an extract or compound described herein).
  • the methods described herein utilize a genetically modified non-human animal that expresses a mutant POLG1 polypeptide in a controlled manner. Tissues, organs and cells from such animal model may also be used.
  • the mutant POLG1 polypeptide is expressed ubiquitously (in every cell of the non-human animal).
  • the mutant POLG1 polypeptide is expressed in a specific tissue or set of tissues or in a specific cell type.
  • Such non-human animal model is described in US Patent Publication No. 2020-0085021-Al, incorporated herein by reference in its entirety for all purposes.
  • the animal model exhibits at least one characteristic selected from the group consisting of: reduced mitochondrial (mt) DNA content, reduced mtDNA copy number, changes in mitochondrial protein expression, reduced expression of mitochondrial oxidative phosphorylation complexes, reduced stability of mitochondrial oxidative phosphorylation complexes, skin wrinkles, hair loss, increased epidermal thickness, epidermal hyperplasia, acanthosis, hyperkeratosis, altered, e.g., increased expression of at least one gene selected from the group consisting of: NF-KB, COX-2, INF-pi, CCL5, MMP1 , MMP2, MMP9, MMP13, IGF1 R, VEGF, and MRPS5, altered, e.g., decreased expression of at least one gene selected from the group consisting of: TIMP1 and KLOTHO, COL1A1, MTCO2, TFAM, and VDAC, increased skin inflammation, and aberrant hair follicles.
  • mt reduced mitochondrial
  • the disclosure provides an artificial neural network trained to model a plurality of chemical reactions for any given compound.
  • compounds and compositions having a similarity score with a known promoter or inhibitor of mitochondrial biogenesis may be reliably identified.
  • the similarity score may be quantified by augmenting data generated by the deep neural network in a multi-dimensional vector defining a matrix of properties of the compound or a chemical reaction involving the compound to generate an embedding score for the compound.
  • the embedding score for the compound may be compared to an embedding score for the known promotor or inhibitor of mitochondrial biogenesis to generate the similarity score. Therefore, the disclosure provides for methods of screening compounds and compositions having a sufficient similarity score with known compounds.
  • the identified compounds are predicted to be effective at promoting or inhibiting mitochondrial biogenesis.
  • the disclosure provides a non-human animal model comprising a mutant POLG1 polypeptide and that express the mutant POLG1 polypeptide in a controlled manner either throughout the animal or in specific tissues.
  • a non-human animal model comprising a mutant POLG1 polypeptide and that express the mutant POLG1 polypeptide in a controlled manner either throughout the animal or in specific tissues.
  • compounds and compositions effective in treating diseases and conditions related to mitochondrial dysfunction can be reliably identified.
  • Methods utilizing cells, and tissues from such a non-human animal are also provided. Therefore, the disclosure provides for methods of screening compounds and compositions effective to treat diseases and conditions related to mitochondrial dysfunction in a subject, including diseases and conditions related to mtDNA depletion.
  • the disclosure provides for identification of a compound for the treatment of a disease or condition due, at least in part, to mitochodrial dysfunction, including changes in mtDNA copy number and/or concentration, and/or dysfunctional mitochondrial OXPHOS.
  • diseases and conditions include, but are not limited to, mtDNA depletion syndromes, mitochondrial diseases, ovarian diseases or conditions and symptoms thereof, aging, aging-associated chronic diseases, reduced energy levels and vitality, and other human pathologies.
  • Exemplary mitochondrial diseases include cardiovascular disease, diabetes, cancer, neurological disorders, such as age-associated neurological disorders , skin diseases and conditions, e.g., skin wrinkles, changes in skin pigmentation, senile lentigines, characteristics of skin aging, hair or scalp diseases and conditions, e.g., hair loss, hair thinning, changes in hair pigmentation, e.g., hair graying.
  • skin diseases and conditions e.g., skin wrinkles, changes in skin pigmentation, senile lentigines, characteristics of skin aging, hair or scalp diseases and conditions, e.g., hair loss, hair thinning, changes in hair pigmentation, e.g., hair graying.
  • such a method of screening comprises the steps of: a) providing a deep neural network trained to model a plurality of chemical reactions for a known promoter or inhibitor of mitochondrial biogenesis; b) executing the deep neural network to identify one or more compounds having a threshold similarity score of at least 70% with the known promoter or inhibitor of mitochondrial biogenesis; c) selecting one or more identified compounds on the basis of at least one inclusion criteria; and d) evaluating the at least one selected compound in an assay to determine an effect on mitochondrial biogenesis by the selected compound, wherein the assay may include an in vitro assay, ex vivo assay, or in vivo assay.
  • the at least one inclusion criteria may include a structural, functional, physical, or chemical property of the identified compound.
  • Exemplary properties include size, charge, ionic strength, bond strength, valence, hybridization, micromolecular structure, macromolecular structure, and others.
  • the threshold similarity score may be at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, at least 99.5%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.995%, at least 99.999%, or greater.
  • the assay may include screening the at least one selected compound with a non-human animal capable of inducible expression of a mutant POLG1 polypeptide, as described herein. In some embodiments, the assay may include screening the at least one selected compound to measure an effect on protein or gene expression of a mitochondrial health biomarker, as identified herein. The method of screening may be repeated by executing the deep neural network to identify one or more compounds having a similarity score of at least 70% with at least one identified compound and/or at least one selected compound. In some embodiments, the deep neural network may be retrained with at least one identified compound and/or at least one selected compound.
  • such a method of screening comprises the steps of: a) providing a non-human animal capable of inducible expression of a mutant POLG1 polypeptide; b) stimulating the expression of the mutant POLG1 polypeptide, wherein stimulating expression of the mutant POLG1 polypeptide induces a physiological or phenotypic response; c) administering an agent to the non-human animal either before step b) or after step b); d) determining the effect of the agent on pathology; and e) comparing the effect of the agent to a control animal, wherein a reduction or an increase (as appropriate) in the physiological or phenotypic response in the non- human animal after administration of the agent indicates the agent is a therapeutic agent for the treatment of the physiological or phenotypic response.
  • the disclosure provides a method for identifying a therapeutic agent for the treatment of mitochondrial dysfunction.
  • the disclosure provides a method for identifying a therapeutic agent for the treatment of a disease or condition associated with mitochondrial dysfunction or a symptom thereof.
  • the disclosure provides a method for identifying a therapeutic agent for the treatment of an aging-associated chronic disease related to mitochondrial dysfunction or a symptom thereof.
  • the disclosure provides a method for identifying a therapeutic agent for improving or preventing a decrease or condition in energy level and/or vitality.
  • the disclosure provides a method for identifying a therapeutic agent for treating or preventing ovarian diseases or conditions and symptoms thereof.
  • agents can include, but are not limited to, chemical compounds, pharmaceutical compositions, cosmetic composition, extracts, plant extracts, seaweed extracts, microbial extracts, biological compounds and compositions (e.g., proteins, DNA, RNA, siRNAs, vaccines and the like), and microorganisms.
  • the agent may be selected from a library, including a library of agents approved by a regulatory authority such as the FDA.
  • any of the transgenic non-human animals of the disclosure may be used.
  • step b) may be accomplished by providing an inducer compound to the transgenic non-human animal or withholding the inducer compound from the transgenic non-human animal.
  • the agent is added before step b). In any of the described methods of screening, the agent is added after step b).
  • the animal model is an animal model described in the preceding section.
  • the mutant POLG1 polypeptide may be any mutant POLG1 polypeptide described herein.
  • the mutant POLG1 polypeptide comprises a dominant negative mutation.
  • the mutant POLG1 polypeptide comprises a D1135A mutation.
  • the disclosure provides a method for treating or preventing mitochondrial dysfunction in a subject, the method comprising administering to said subject an effective amount of a compound of the disclosure, or a pharmaceutically acceptable form thereof. In one embodiment, the disclosure provides a method for treating or preventing a disease or condition associated with mitochondrial dysfunction or a symptom thereof in a subject, the method comprising administering to said subject an effective amount of a compound of the disclosure, or a pharmaceutically acceptable form thereof.
  • the disclosure provides compounds and compositions effective to treat or prevent diseases and conditions related to mitochondrial dysfunction, including mtDNA depletion.
  • Diseases and conditions related to mitochondrial dysfunction include ovarian diseases or conditions and symptoms thereof.
  • Ovarian diseases or conditions that may be treated by the methods disclosed herein include, for example, perimenopause, menopause, endometriosis, ovarian cysts, pre-menopausal or post-menopausal ovarian cancer, e.g., ovarian epithelial cancer, ovarian tumors, e.g., ovarian germ cell tumor, ovarian low malignant potential tumors, and ovarian stromal tumors, polycystic ovary syndrome (PCOS), primary ovarian insufficiency (POI), and ovarian torsion.
  • PCOS polycystic ovary syndrome
  • POI primary ovarian insufficiency
  • the ovarian diseases or conditions may be associated with infertility, premature ovarian aging, and reduced oocyte mitochondrial mass.
  • Treatment may include reducing or lessening the severity or frequency of symptoms of ovarian diseases or conditions including, for example, skin or vaginal dryness, pelvic pain or cramping, inflammation, prolonged or irregular menstrual cycles, and decreased ovulation events.
  • the treatment or prevention may involve inducing mitochondrial biogenesis and/or improving mitochondrial function.
  • the disclosure provides compounds and compositions effective to treat or prevent, for example, reduce, inhibit, delay, and/or reverse, perimenopause, menopause, and/or symptoms thereof.
  • Perimenopause is the stage before menopause, or the final period.
  • Perimenopause may be characterized by altered levels of hormones, such as reduced estrogen and/or increased follicle stimulating hormone (FSH), reduced ovulation, and prolonged or irregular menstrual cycles.
  • FSH follicle stimulating hormone
  • perimenopause may be characterized by FSH levels of about 20 lU/mL - 30 lU/mL or greater in a blood sample and menopause may characterized by FSH levels of about 25 lU/mL - 135 lU/mL or greater in a blood sample.
  • FSH levels of about 20 lU/mL - 30 lU/mL or greater in a blood sample
  • menopause may be characterized by FSH levels of about 25 lU/mL - 135 lU/mL or greater in a blood sample.
  • any altered level of a hormone may be compared to a baseline level of the subject to determine whether the subject is experiencing perimenopause or post-menopause.
  • Symptoms of perimenopause and menopause include mood changes, changes in sexual desire, trouble concentrating, headaches, hot flashes, night sweats, vaginal dryness, trouble sleeping, joint or muscle aches, heavy sweating, frequent urination, and other pre-menstrual cycle (PMS)- like symptoms.
  • PMS pre-menstrual cycle
  • the ovarian diseases or conditions and symptoms thereof include those associated with mitochondrial dysfunction. While not being bound to any particular theory, the compounds disclosed herein may exert observed effects through inhibiting a decrease in mitochondrial DNA copy number or concentration, inhibiting depletion of mitochondrial DNA, inhibiting degradation of mitochondrial DNA, contributing to an increase in mitochondrial DNA copy number or concentration, repleting mitochondrial DNA, and/or promoting increased activity of mitochondrial DNA.
  • the methods disclosed herein relate to enhancing or improving fertility in a subject. Any reduced fertility of the subject may be age-related or premature.
  • the diseases, conditions, or symptoms disclosed herein may be associated with age-related ovarian aging or premature ovarian aging.
  • the methods disclosed herein relate to extending reproductive longevity of a subject.
  • the methods disclosed herein relate to increasing oocyte mitochondrial mass or preventing a decrease of oocyte mitochondrial mass of a subject.
  • extracts have been identified as comprising one or more compounds that promote and/or inhibit mtDNA.
  • Emblica extract, fucus extract, and chebula extract are described herein. It should be understood that similar extracts, in particular, extracts comprising one or more compounds disclosed herein, compounds that are constituents of an extract disclosed herein, and/or compounds having a similarity score of at least 95% with one or more compounds disclosed herein, are expected to provide similar mtDNA promotion and/or inhibition. Accordingly, other extracts, compounds derived from, constituents of, or purified from other extracts, and compounds having a similarity score of at least 95% with compounds derived from, constituents of, or purified from other extracts are within the scope of the disclosure.
  • Exemplary extracts include Polygonum aviculare extract, Physalis gngulata extract, Dunaliella salina extract, Camellia sinensis leaf extract, Tremella fuciformis sporocarp extract, Alteromonas ferment extract, Theobroma cacao (cocoa) seed extract, Vitis vinifera (grape) flower cell extract, Mirabilis jalapa callus extract, Alteromonas ferment extract, and Vibrio alginolyticus ferment filtrate.
  • the compounds described herein may be derived from, purified from, or isolated from the extract.
  • the compounds described herein may be derived from, purified from, or isolated from a source other than the extract.
  • a compound constituent of an extract may be derived from, purified from, or isolated from another natural or artificial source.
  • the compounds described herein may be synthetic.
  • the compounds of the disclosure may be synthesized in a laboratory, manufacturing, or other setting. The above applies to compounds contained in or constituents of an extract, as well as compounds having a high similarity score thereof.
  • the methods disclosed herein may comprise administering to said subject an effective amount of an emblica extract, or a pharmaceutically acceptable form thereof.
  • the methods disclosed herein may comprise administering to said subject an effective amount of a compound derived from, constituent of, or purified from an emblica extract, or a pharmaceutically acceptable form thereof, or a compound having a similarity score of at least 95% with the compound derived from, constituent of, or purified from an emblica extract, or a pharmaceutically acceptable form thereof.
  • the methods disclosed herein may comprise administering to said subject an effective amount of a fucus extract, or a pharmaceutically acceptable form thereof.
  • the methods disclosed herein may comprise administering to said subject an effective amount of a compound derived from, constituent of, or purified from a fucus extract, or a pharmaceutically acceptable form thereof, or a compound having a similarity score of at least 95% with the compound derived from, constituent of, or purified from a fucus extract, or a pharmaceutically acceptable form thereof.
  • the methods disclosed herein may comprise administering to said subject an effective amount of a chebula extract, or a pharmaceutically acceptable form thereof.
  • the methods disclosed herein may comprise administering to said subject an effective amount of a compound derived from, constituent of, or purified from a chebula extract, or a pharmaceutically acceptable form thereof, or a compound having a similarity score of at least 95% with the compound derived from, constituent of, or purified from a chebula extract, or a pharmaceutically acceptable form thereof.
  • the disclosure may generally be related to extracts and compounds derived from, constituents of, or purified from extracts. It should be understood that compounds having a similarity score of at least 95%, for example, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, at least 99.9%, at least 99.95%, at least 99.99%, at least 99.995%, or at least 99.999% with a compound derived from, constituents of, or purified from the extract may be utilized in any composition as described herein.
  • the administration of the compositions disclosed herein may involve inhibition of a decrease in mitochondrial DNA copy number or concentration, inhibition of a depletion of mitochondrial DNA, inhibition of a degradation of mitochondrial DNA, or a combination of the foregoing.
  • the administration of the compositions disclosed herein may involve inducing mitochondrial biogenesis and/or improving mitochondrial function.
  • administration of the compositions disclosed herein may involve an increase in expression of mitochondrial oxidative phosphorylation complexes, an increase in stability of mitochondrial oxidative phosphorylation complexes, and/or an increase in expression of at least one protein selected from PGC-la, TFAM, NRF-1, and COXII.
  • administration of the compositions disclosed herein may involve modulation of a menstrual cycle, for example, normalizing a menstrual cycle, for example, regulating an amount and/or frequency of menstrual cycles.
  • Administration of the compositions disclosed herein may involve an increase of ovulation events.
  • Administration of the compositions disclosed herein may involve an increase of an anti-Mullerian hormone (AMH) level of the subject.
  • administration of the compositions disclosed herein may decrease the probability of embryonic aneuploidy and/or Leigh’s Syndrome.
  • the emblica extract is derived from Emblica officinalis (also known as Phyllanthus emblica, Indian gooseberry, or by its Hindi name Amla).
  • Emblica officinalis also known as Phyllanthus emblica, Indian gooseberry, or by its Hindi name Amla.
  • Such an extract from Emblica officinalis may be deri ved from any portion of the plant as desired.
  • the extract may be derived from the stem portion, the fruit portion, or both the stem portion and the fruit portion of Emblica officinalis.
  • the Emblica. officinalis may be provided in a powdered from and extracted using chemical solvents known in the ait, such as, but not limited to, aqueous ethyl acetate ethanol, and methanol. Other solvents or excipients disclosed herein may be used.
  • the chemical solvent may be methanol.
  • the effective amount of an emblica extract or a compound derived from, constituent of, or purified from an emblica extract is from 1 to 100 mg, such as 1 mg, 5, mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg.
  • the compound derived from, constituent of, or purified from an emblica extract is a breakdown product of a tannin, wherein the emblica extract is optionally as described above.
  • the compound derived from, constituent of, or purified from an emblica extract is an ellagitannin.
  • the compound derived from, constituent of, or purified from an emblica extract is emblicanin A, emblicanin B, punigluconin pedunculagin, and/or chebulinic acid.
  • the compound is an ellagitannin or a compound having a similarity score of at least 95% with an ellagitannin.
  • Exemplary ellagitannins and compounds having a high similarity score with such ellagitannins are listed in Table 1. Other compounds having a high similarity score with ellagitannins are within the scope of the disclosure. Table 1: Ellagitannins and compounds having a high similarity score with ellagitannins
  • the compound is chebulinic acid or a compound having a similarity score of at least 95% with chebulinic acid (formula I below).
  • Exemplary compounds having a high similarity score with chebulinic acid are listed in Table 2.
  • Table 2 Compounds having a high similarity score with chebulinic acid.
  • the compound derived from, constituent of, or purified from an emblica extract is a benzoic acid substituted with 1 to 5 hydroxy groups and optionally 1 to 3 O- (C1-C5 alkyl) or O-(Ci-Cs alkenyl) groups.
  • the compound derived from, constituent of, or purified from an emblica extract is a benzoic acid substituted with 1 to 3 hydroxy groups and optionally 1 to 2 O-(Ci-Cs alkyl) or O-(Ci-Cs alkenyl) groups.
  • the compound derived from, contained in, or purified from an emblica extract is gallic acid, vanillic acid, chlorogenic acid, caffeic acid, syringic acid, coumaric aid, quercetin, emblicanin A, emblicanin B, punigluconin, and pedunculagin, punicafolin, phyllanemblin, kaempferol, ellagic acid, chebulinic acid, chebulagic acid, punicalagin, or a metabolite of any of the foregoing.
  • the compound derived from, constituent of, or purified from an emblica extract is ascorbic acid or citric acid.
  • the compound derived from, constituent of, or purified from an emblica extract is gallic acid, vanillic acid, chlorogenic acid, caffeic acid, syringic acid, coumaric aid, quercetin, vitamin C, or a metabolite of any of the foregoing.
  • the compound derived from, constituent of, or purified from an emblica extract is gallic acid or a compound having a similarity score of at least 95% with gallic acid.
  • the active agent in the composition is gallic acid.
  • the active agent may be or comprise an ellagitannin.
  • the active agent may be or comprise emblicanin A, emblicanin B, punigluconin, pedunculagin, and/or chebulinic acid.
  • the composition may comprise an emblica extract fortified with one or more compound that is a constituent of an emblica extract.
  • the compound constituent of the emblica extract or combination of compounds constituents of the emblica extract may be purified, e.g., at least 80% purified, at least 85% purified, at least 90% purified, at least 95% purified, at least 98% purified, at least 99% purified, at least 99.9% purified, at least 99.99% purified, or at least 99.999% purified.
  • the effective amount of a compound derived from, constituent of, or purified from an emblica extract is from 1 to 100 mg of the, such as 1 mg, 5 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg of the compound derived from, constituent of, or purified from an emblica extract.
  • the fucus extract is derived from Fucus vesiculosus, Fucus serratus, Fucus, spiralis, or Fucus guiryi.
  • the fucus extract is derived from Fucus vesiculosus.
  • Such an extract may be derived from any portion of the algae as desired, fa preparing such an extract, the Fucus vesiculosus, Fucus serratus, Fucus, spiralis, or Fucus guiryi may be provided in a powdered from and extracted using chemical solvents known in the art, such as, but not limited to, aqueous ethyl acetate ethanol, and methanol. Other solvents or excipients disclosed herein may be used.
  • the chemical solvent mav be methanol.
  • the effective amount of fucus extract is from 1 to 100 mg of extract, such as 1 mg, 5 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg of a fucus extract.
  • the compound derived from, constituent of, or purified from a fucus extract is a benzoic acid substituted with 1 to 5 hydroxy groups and optionally 1 to 3 O-(Ci-Cs alkyl) or O-(Ci-Cs alkenyl) groups.
  • the compound derived from, constituent of, or purified from a fucus extract is a benzoic acid substituted with 1 to 3 hydroxy groups and optionally 1 to 2 O-(Ci-Cs alkyl) or O-(Ci-Cs alkenyl) groups.
  • the compound derived from, constituent of, or purified from a fucus extract is gallic acid, vanillic acid, chlorogenic acid, caffeic acid, syringic acid, coumaric aid, or a metabolite of any of the foregoing.
  • the compound derived from, constituent of, or purified from a fucus extract is gallic acid.
  • the active agent in the composition is gallic acid or a compound having a similarity score of at least 95% with gallic acid.
  • the active agent in the composition is chebulinic acid or a compound having a similarity score of at least 95% with chebulinic acid (see, e.g., Table 2 above).
  • the active agent may be or comprise an ellagitannin or a compound having a similarity score of at least 95% with an ellagitannin (see, e.g., Table 1 above).
  • the active agent may be or comprise fucoidan or a compound having a similarity score of at least 95% with fucoidan.
  • the composition may comprise a fucus extract fortified with one or more compound that is a constituent of a fucus extract.
  • the compound constituent of a fucus extract or combination of compounds constituents of a fucus extract may be purified, e.g., at least 80% purified, at least 85% purified, at least 90% purified, at least 95% purified, at least 98% purified, at least 99% purified, at least 99.9% purified, at least 99.99% purified, or at least 99.999% purified.
  • the effective amount of a compound derived from, constituent of, or purified from a fucus extract is from 1 to 100 mg, such as 1 mg, 5 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg of the compound derived from, constituent of, or purified from a fucus extract.
  • the chebula extract is derived from Terminilia chebula, Terminalia arborea, or Lumnitzera racemose.
  • the chebula extract is derived from Termibnilia chebula.
  • Such an extract may be derived from any portion of the plant as desired.
  • the Terminilia chebula, Terminalia arborea, or Lumnitzera racemose may be provided in a powdered from and extracted using chemical solvents known in the art, such as, but not limited to, aqueous ethyl acetate ethanol, and methanol. Other solvents or excipients disclosed herein may be used.
  • the chemical solvent may be methanol.
  • the effective amount of chebula extract is from 1 to 100 mg of extract, such as 1 mg, 5 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg of a chebula extract.
  • the compound derived from, constituent of, or purified from a chebula extract is a breakdown product of a tannin. In certain aspects, the compound derived from, constituent of, or purified from a chebula extract is an ellagitannin. In certain aspects, the compound derived from, constituent of, or purified from a chebula extract is chebulinic acid.
  • the compound derived from, constituent of, or purified from a chebula extract is a breakdown product of a tannin.
  • the compound derived from, constituent of, or purified from a fucus extract is an ellagitannin.
  • the compound derived from, constituent of, or purified from a fucus extract is fucoidan.
  • the compound derived from, constituent of, or purified from a chebula extract is a benzoic acid substituted with 1 to 5 hydroxy groups and optionally 1 to 3 O-(Ci-Cs alkyl) or O-(Ci-Cs alkenyl) groups.
  • the compound derived from, contained in, or purified from a fucus extract is a benzoic acid substituted with 1 to 3 hydroxy groups and optionally 1 to 2 O-(Ci-Cs alkyl) or O-(Ci-Cs alkenyl) groups.
  • the compound derived from, constituent of, or purified from a chebula extract is gallic acid, vanillic acid, chlorogenic acid, caffeic acid, syringic acid, coumaric aid, or a metabolite of any of the foregoing.
  • the compound derived from, constituent of, or purified from a chebula extract is chebulinic acid.
  • the active agent in the composition is chebulinic acid or a compound having a similarity score of at least 95% with chebulinic acid (see, e.g., Table 2 above).
  • the active agent may be or comprise an ellagitannin or a compound having a similarity score of at least 95% with an ellagitannin (see, e.g., Table 1 above).
  • the composition may comprise a chebula extract fortified with one or more compound that is a constituent of a chebula extract.
  • the compound constituent of a chebula extract or combination of compounds constituents of a chebula extract may be purified, e.g., at least 80% purified, at least 85% purified, at least 90% purified, at least 95% purified, at least 98% purified, at least 99% purified, at least 99.9% purified, at least 99.99% purified, or at least 99.999% purified.
  • the effective amount of a compound derived from, constituent of, or purified from a chebula extract is from 1 to 100 mg, such as 1 mg, 5 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, or 100 mg of the compound derived from, constituent of, or purified from a chebula extract.
  • the methods, and any of aspects of the foregoing, may comprise administering a composition comprising an effective amount of two or more of an emblica extract or a compound constituent of an emblica extract, an effective amount of a fucus extract or a compound constituent of a fucus extract, and an effective amount of a chebula extract or a compound constituent of a chebula extract.
  • the two or more of the emblica extract or compound constituent of the emblica extract, the fucus extract or compound constituent of the fucus extract, and the chebula extract or compound constituent of the chebula extract may provide synergistic effects in the treatment of the disease or condition.
  • compositions disclosed herein may comprise or be fortified with one or more of: an emblica extract or compound constituent of an emblica extract, a fucus extract or compound constituent of a fucus extract, a chebula extract or compound constituent of the chebula extract, BAMLET 10, BAMLET 50, ferulic acid, quercetin, urolithin A, pterostilbene, acadesine, embelin, EGCG, eriocitrin, gallic acid, gomsin A, lutein, luteolin, NAD, rutin, zeaxanthin, and melatonin.
  • compositions disclosed herein may be administered in combination with and/or encapsulated in a biomaterial.
  • Biomaterials provide certain advantages for drug delivery, including promoting favorable cellular interaction, relatively high drug loading content, controllable drug release, excellent passive and active targeting, biocompatibility and low toxicity.
  • Biomaterials can be classified into three basic categories: 1) natural biomaterials (e.g., extracellular vesicles, collagen, hyaluronic acid, fibrin), 2) synthetic biomaterials (e.g., polylactic acid (PLA), polyglycolic acid (PGA), poly caprolactone (PCL), polyethylene glycol (PEG)), and 3) composite biomaterials (e.g., protein-polysaccharide composite biomaterials, nanocomposite biomaterials, sponges).
  • natural biomaterials e.g., extracellular vesicles, collagen, hyaluronic acid, fibrin
  • synthetic biomaterials e.g., polylactic acid (PLA), polyglycolic acid (PGA), poly caprolactone (PCL), polyethylene glycol (PEG)
  • composite biomaterials e.g., protein-polysaccharide composite biomaterials, nanocomposite biomaterials, sponges.
  • Biomaterials may be used to encapsulate and deliver the compounds disclosed herein, and optional combination therapies, for treatment of ovarian diseases and conditions.
  • the biomaterials described herein may be nontoxic, biocompatible, biodegradable, bioresorbable, and/or able to support cellular and tissue regeneration without a resultant inflammatory reaction.
  • Biomaterials may be used in connection with artificial ovary construction, follicle development, biomaterial encapsulation of cells and/or compositions, and the delivery of natural extracellular vesicles.
  • Exemplary biomaterials include extracellular vesicles, collagen, hyaluronic acid, synthetic biomaterials, fibrin, and alginate.
  • Extracellular vesicles are a heterogeneous group of cell-derived membranous structures comprising of exosomes (-50 - 150 nm) and microvesicles (-100 - 1000 nm), which carry bioactive material and protein in different body fluids and deliver their contents to recipient cells.
  • EVs may be employed as effective nanocarriers of the compositions disclosed herein for advanced drug delivery due to multiple advantages including good biocompatibility with the immune system and low toxicity.
  • Stem cell-derived EVs may be employed to transfer functional miRNAs and proteins to ovarian tissues. Additionally, EVs may be readily isolated from stem cells of various origins and carry biologically active molecules that can be transferred to target ovarian cells to exert their therapeutic effects.
  • Collagen is the most abundant extracellular matrix protein in the animal kingdom, and it transmits loads in tissues and provides a highly biocompatible environment for cells.
  • Collagen may be used as a scaffold for stem cell-based ovarian therapy.
  • Such scaffolds may be employed in connection with treatments for primary ovarian failure (POF) and increase the long-term retention of adipose-derived stem cells (ADSCs) and contribute to the restoration of ovarian function, including a regular estrus cycle, elevated E2 levels, improved fertility, and successful clinical pregnancy.
  • PEF primary ovarian failure
  • ADSCs adipose-derived stem cells
  • Collagen may be used to improve targeted delivery of the compositions disclosed herein to ovarian tissues.
  • Hyaluronic acid is present in all vertebrates, is an important component of the ECM in most mature tissues, and plays a significant role in establishing a microenvironment conducive to the development of follicles in ovaries.
  • HA has excellent physiochemical properties and may be used for drug delivery.
  • Self-linked HA is a good cell scaffold to improve the transplantation of stem cells in the treatment of ovarian therapy. Additionally, HA may be used to improve targeted delivery of the compositions disclosed herein to ovarian tissues.
  • Fibrin is a natural scaffold formed after tissue injury, and it has excellent biocompatibility, controllability, biodegradability, and the ability to transfer cells and biomolecules to a target site. Primate oocytes derived from primary follicles cultured in fibrinalginate 3D capsules may be employed to restart meiosis for fertilization. Fibrin scaffolds may be used for follicular transplantation by controlling the release of growth factors and creating a continuous path of cell infiltration. Fibrin may be used to improve targeted delivery of the compositions disclosed herein to ovarian tissues.
  • Synthetic biomaterials may be designed, selected, and/or tailored according to the physicochemical and mechanical properties of target biological tissues.
  • PEG is a commonly used biocompatible polymer, and PEG hydrogels have been shown to provide a good microenvironment for follicles.
  • Synthetic biomaterials may be designed to deliver the compositions disclosed herein to target ovarian tissues.
  • Alginate is a group of non-branched polysaccharides that is non-toxic, nutrient-rich, biocompatible and biodegradable in humans. Alginate is able to form a soft hydrogel under physiological conditions, with pores large enough to allow nutrients and growth factors to pass through freely, while trapping cells in the polymer network. Alginate may be used to improve targeted delivery of the compositions disclosed herein to ovarian tissues.
  • the methods, and any aspects of the foregoing, may further comprise one or more of the steps: (i) identifying a subject in need of treatment or administration; and (ii) providing a compound of the disclosure or a pharmaceutical composition comprising a compound of the disclosure.
  • the term “preventing” when the term “preventing” is used the term may refer to at least a partial inhibition, for example a 10% inhibition, a 20% inhibition, a 30% inhibition, a 40% inhibition, 50% inhibition, a 60% inhibition, a 70% inhibition, an 80% inhibition, a 90% inhibition, a 95% inhibition or greater than 95% inhibition.
  • the term “improving” when the term “improving” is used the term may refer to at least partial improvement, for example, a 10% improvement, a 20% improvement, a 30% improvement, a 40% improvement, 50% improvement, a 60% improvement, a 70% improvement, an 80% improvement, a 90% improvement, a 95% improvement or greater than 95% improvement.
  • the term “enhancing” when the term “enhancing” is used the term may refer to at least partial enhancement, for example, a 10% enhancement, a 20% enhancement, a 30% enhancement, a 40% enhancement, 50% enhancement, a 60% enhancement, a 70% enhancement, an 80% enhancement, a 90% enhancement, a 95% enhancement or greater than 95% enhancement.
  • the term “increasing” when the term “increasing” is used the term may refer to at least partial increase, for example, a 10% increase, a 20% increase, a 30% increase, a 40% increase, 50% increase, a 60% increase, a 70% increase, an 80% increase, a 90% increase, a 95% increase or greater than 95% increase.
  • the term may refer to a two-fold, three-fold, four-fold, five-fold, ten-fold, one hundred-fold increase, or more.
  • the compound, or pharmaceutically acceptable form thereof may be administered alone or as a part of a pharmaceutical composition.
  • the pharmaceutical composition may be formulated by combining a solution of the compound with a pharmaceutically suitable carrier.
  • the solution of the compound may comprise 1 to 1,000 mg of the compound, for example, 10 to 600 mg, 20 to 500 mg, 30 to 200 mg, 50 to 100 mg, or 1 mg, 5 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, or 1,000 mg of the compound.
  • the compound and the pharmaceutically suitable carrier may be combined in a ratio of 1:5 to 5:1.
  • the pharmaceutical composition may be formulated to have a concentration of 1 to 1,000 mg/ml of the compound, for example, 10 to 600 mg/ml, 20 to 500 mg/ml, 30 to 200 mg/ml, 50 to 100 mg/ml, or 1 mg/ml, 5 mg/ml, 10 mg/ml, 20 mg/ml, 30 mg/ml, 40 mg/ml, 50 mg/ml, 60 mg/ml, 70 mg/ml, 80 mg/ml, 90 mg/ml, 100 mg/ml, 200 mg/ml, 300 mg/ml, 400 mg/ml, 500 mg/ml, 600 mg/ml, 700 mg/ml, 800 mg/ml, 900 mg/ml, or 1,000 mg/ml of the compound.
  • the pharmaceutical composition may be formulated to have a concentration of 0.01% to 2% of the compound, for example, 0.01%, 0.02%, 0.05%, 0.1%, 0.2%, 0.5%, 1%, or 2% of the compound.
  • the pharmaceutical composition may be formulated to have a concentration of 2.5 to 50 pM of the compound, for example, 2.5 pM, 5 pM, 10 pM, 25 pM, or 50 pM of the compound.
  • the pharmaceutical composition may be formulated to have a concentration of 50 to 500 pM of the compound, for example, 50 pM, 100 pM 5 200 pM 5 300 pM, 400 pM 5 or 500 pM of the compound.
  • the pharmaceutical composition may be formulated to have a concentration of 2.5 to 50 pM of the compound, for example, 2.5 pg/L, 5 pg/L, 10 pg/L, 25 pg/L, or 50 pg/L of the compound.
  • the pharmaceutical composition may be formulated to have a concentration of 50 to 500 pg/L of the compound, for example, 50 pg/L, 100 pg/L ⁇ 200 pg/L ⁇ 300 pg/L, 400 pg/L ⁇ or 500 pg/L of the compound.
  • the compound, or pharmaceutically acceptable form thereof may be administered alone or as a part of a cosmetic composition.
  • the cosmetic composition may be formulated by combining a solution of the compound with a cosmetically suitable carrier.
  • the solution of the compound may comprise 1 to 1,000 mg of the compound, for example, 10 to 600 mg, 20 to 500 mg, 30 to 200 mg, 50 to 100 mg, or 1 mg, 5 mg, 10 mg, 20 mg, 30 mg, 40 mg, 50 mg, 60 mg, 70 mg, 80 mg, 90 mg, 100 mg, 200 mg, 300 mg, 400 mg, 500 mg, 600 mg, 700 mg, 800 mg, 900 mg, or 1,000 mg of the compound.
  • the compound and the cosmetically suitable carrier may be combined in a ratio of 1:5 to 5:1.
  • the cosmetic composition may be formulated to have a concentration of 1 to 1,000 mg/ml of the compound, for example, 10 to 600 mg/ml, 20 to 500 mg/ml, 30 to 200 mg/ml, 50 to 100 mg/ml, or 1 mg/ml, 5 mg/ml, 10 mg/ml, 20 mg/ml, 30 mg/ml, 40 mg/ml, 50 mg/ml, 60 mg/ml, 70 mg/ml, 80 mg/ml, 90 mg/ml, 100 mg/ml, 200 mg/ml, 300 mg/ml, 400 mg/ml, 500 mg/ml, 600 mg/ml, 700 mg/ml, 800 mg/ml, 900 mg/ml, or 1,000 mg/ml of the compound.
  • a compound described herein is in the form of a pharmaceutically acceptable salt, solvate, or hydrate.
  • a pharmaceutically acceptable salt e.g., acid addition salt, and complexes thereof.
  • the preparation of such salts can facilitate the pharmacological use by altering the physical characteristics of the agent without preventing its physiological effect. Examples of useful alterations in physical properties include, but are not limited to, increasing the solubility to facilitate administering higher concentrations of the compound.
  • a compound or an extract described herein is administered topically, intravenously, intraperitoneally, parenterally, intramuscularly, orally or via the respiratory tract.
  • the compound or the extract is administered topically.
  • the compound or the extract is administered parenterally, e.g., by injection.
  • the compound or an extract described herein may be administered locally, e.g., at a local site of the disease or condition.
  • the compound or an extract described herein may be formulated for local administration, e.g., to a target site of the disease or condition.
  • the compound or an extract described herein may be administered systemically.
  • Systemic administration may be, e.g., topical, intravenous, intraperitoneal, parenteral, intramuscular, oral, or via the respiratory tract.
  • the compound or an extract described herein may be formulated for systemic administration.
  • the subject animal is a vertebrate.
  • the subject is a mammal.
  • the subject is a human.
  • the subject is a non-human mammal, e.g., a rodent, e.g., a mouse.
  • the subject may be female. In some aspects, the subject may be male.
  • the subject may be characterized as one of the following ethnicity /race: Asian, Black or African American, Hispanic or Latino, white, or multi-racial.
  • the subject may be of an age less than 1, or between 1-5, 5-10, 10-20, 20-30, 30-40, 40-50, 50-60, or over 60 years.
  • the subject may suffer from or have been diagnosed with a condition that causes increased risk of severe illness due to a viral infection, or for which a standard of care treatment causes increased risk of severe illness due to a viral infection.
  • Such conditions include, for example, cancer, chronic kidney disease, chronic lung disease (such as chronic obstructive pulmonary disease (COPD), asthma, interstitial lung disease, cystic fibrosis, and pulmonary hypertension), dementia or other neurological condition, diabetes type 1 or type 2, down syndrome, heart conditions (such as heart failure, coronary artery disease, cardiomyopathies, or hypertension), immunocompromised state, liver disease, overweight (for example, having a body mass index of 25 or greater), obesity (for example, having a body mass index of 30 or greater), pregnancy, sickle cell disease or thalassemia, being a current or former smoker, having received a solid organ or blood stem cell transplant, stroke or cerebrovascular disease, substance use disorders, a concurrent viral infection, such as HIV infection, SARS-CoV-2 infection, influenza infection, or MERS infection, or any indication identified by the U.S. Center for Disease Control and Prevention (CDC) as increasing risk of severe illness or for which standard of care causes increased risk of severe illness due to viral infection.
  • COPD chronic obstruct
  • the compound or the extract is administered in an effective amount. Suitable effective amounts are described in more detail herein.
  • the compound or the extract is administered in a therapeutically effective amount.
  • the administering step may comprise administering a single dose of a compound or extract according to a course of treatment (where the dose may contain an effective amount).
  • the administering step may comprise administering more than one dose of a compound or extract according to a course of treatment (where one or more doses may contain an effective amount).
  • the amount of a compound or extract in each dose administered during a course of treatment is not required to be the same.
  • the administering step may comprise administering at least one loading dose and at least one maintenance dose during a course of treatment. Dosing is described in more details herein.
  • the compound may be administered as a prophylactic treatment.
  • the compound may be administered as a cosmetic or therapeutic treatment.
  • the compounds disclosed herein may be used in various applications, e.g., cosmetic and/or therapeutic applications.
  • the compounds may be administered in an effective amount for an intended use, e.g., a cosmetic or a therapeutic application.
  • a composition may comprise a concentration or amount, e.g., an effective amount, of the compound sufficient to have a desired cosmetic effect.
  • a composition may comprise a concentration or amount, e.g., an effective amount, of the compound sufficient to have a desired therapeutic effect.
  • An amount and/or frequency of administration may be sufficient to induce mitochondrial biogenesis.
  • An amount and/or a frequency of administration may be sufficient to treat, inhibit, or prevent the progression of at least one of mitochondrial dysfunction, a disease or condition associated with mitochondrial dysfunction or a symptom thereof, an aging-associated chronic condition associated with mitochondrial dysfunction or a symptom thereof, and/or a decrease in energy level or vitality.
  • An amount and/or frequency of administration may be sufficient to modify a score of a parameter on a qualitative scale, as graded by the subject or a clinical grader.
  • the qualitative scale may comprise the following categories: none (best possible condition), mild, moderate, severe (worst possible condition).
  • the qualitative scale may refer to perceived or actual energy levels and/or vitality.
  • administering an effective amount of the compound may limit or inhibit at least one of mitochondrial dysfunction, a disease or condition associated with mitochondrial dysfunction or a symptom thereof, an aging-associated chronic condition associated with mitochondrial dysfunction or a symptom thereof, and/or a decrease in energy level or vitality.
  • the effective amount of the compound may slow progression of the at least one of mitochondrial dysfunction, a disease or condition associated with mitochondrial dysfunction or a symptom thereof, an aging-associated chronic condition associated with mitochondrial dysfunction or a symptom thereof, and/or a decrease in energy level or vitality.
  • administering an effective amount of the compound may promote mitochondrial biogenesis, mitochondrial function, and/or an increase in energy level or vitality.
  • administering an effective amount of the compound may increase expression of at least one protein selected from PGC-la, TFAM, NRF-1, and COX II.
  • Administering an effective amount may decrease expression or inhibit an increase of expression of at least one protein selected from FGF-21 and IL-6, or any cytokine related to viral infection.
  • Administering an effective amount may increase or inhibit a decrease in at least one of ATP- linked respiration, maximal respiration and reserve capacity in subjects infected with SARS- CoV-2.
  • Administering an effective amount may modulate, e.g., increases or decreases, viral protein interaction with one or more host mitochondrial genes, e.g., MRPS2, MRPS5, MRPS25, MRPS27, NDUFAF1, NDUFB9, NDUFAF2, ATP1B 1, ATP6V1A, ACADM, AASS, PMPCB, PITRM1, COQ8B, PMPCA, and Tomm70.
  • Administering an effective amount may increase expression of ACE2.
  • the amount of the compound or composition may be effective in treating or preventing an ovarian disease or condition in the subject.
  • the amount of the composition may be effective in improving or enhancing fertility and/or extending reproductive longevity.
  • administering an effective amount e.g., administering a therapeutically or cosmetically effective amount, may induce mitochondrial biogenesis and/or improve mitochondrial function.
  • administering an effective amount may increase oocyte mitochondrial mass or prevent a decrease in oocyte mitochondrial mass.
  • the compound may be administered prior to onset of the disease or condition in the subject.
  • the compound may be administered during incidence of the disease or condition in the subject.
  • the compound may be administered subsequent to at least partial reduction of the disease or condition in the subject.
  • the compound may be administered in response to a trigger or warning sign of an ovarian disease or condition, e.g., prolonged or irregular menstrual cycles, decreased ovulation events, and/or menstrual cramps or pain.
  • a trigger or warning sign of an ovarian disease or condition e.g., prolonged or irregular menstrual cycles, decreased ovulation events, and/or menstrual cramps or pain.
  • the compound may be administered in response to a trigger or warning sign of a mitochondrial dysfunction or aging-associated condition, e.g., aging, premature aging, habitual sleep conditions, weight loss, ultraviolet (UV) light exposure, treatment with a chemical or therapeutic agent, e.g., chemotherapy and/or radiation therapy, smoking, dehydration, or immersion.
  • a mitochondrial dysfunction condition e.g., based on age, race, skin type, eye color, habit, or heredity.
  • a method may further comprise determining whether the subject is in need of treatment or administration.
  • composition comprising the compound may additionally comprise a moisturizing agent, deodorizing agent, scent, colorant, insect repellant, cleansing agent, or UV-blocking agent.
  • the composition may include microspheres or microcapsules.
  • the composition may be formulated for immediate release or extended release.
  • the composition may be formulated for controlled or sustained release.
  • the composition may be formulated for sustained release over a period of 6 hours, 12 hours, 18 hours, 24 hours, 36 hours, 48 hours, or more.
  • the subject may be characterized as having normal mitochondrial function.
  • the subject may be characterized as having reduced mitochondrial function.
  • the subject may be characterized as having an increased level of circulating mtDNA, e.g., plasma mtDNA and/or cytoplasmic mtDNA.
  • the subject may be characterized by age-related reduced fertility, infertility, and/or ovarian aging. For instance, in some embodiments, the subject or recipient subject is 40 years or older.
  • the subject may be characterized as experiencing premature aging or a symptom of premature aging.
  • the subject may be characterized as experience premature reproductive aging, which may include one or more of primary ovarian insufficiency (POI), early onset prolonged or irregular menstrual cycles, early onset decreased ovulation events, premature menopause or perimenopause, and/or ovarian inflammation associated with premature reproductive aging.
  • POI primary ovarian insufficiency
  • early onset prolonged or irregular menstrual cycles early onset decreased ovulation events
  • premature menopause or perimenopause premature menopause or perimenopause
  • ovarian inflammation associated with premature reproductive aging In such embodiments, the subject may be younger than 40 years.
  • the subject may have a diminished ovarian reserve (DOR). In other embodiments, the subject may have a normal ovarian reserve (NOR).
  • DOR diminished ovarian reserve
  • NOR normal ovarian reserve
  • the subject may be pre-menopausal, perimenopausal, or post-menopausal.
  • the subject may suffer from reduced production of reproductive hormones, e.g., estrogen and/or progesterone, increased production of follicle-stimulating hormone (FSH), prolonged or irregular menstrual cycles, uterine or vaginal atrophy, e.g., decreased endometrial glands, diffuse glandular breakdown (apoptotic bodies) of the uterus, acute inflammation of the uterus, and/or decreased vaginal epithelial thickness, decreased ovulation events, ovarian inflammation, and/or infertility.
  • reproductive hormones e.g., estrogen and/or progesterone
  • FSH follicle-stimulating hormone
  • uterine or vaginal atrophy e.g., decreased endometrial glands, diffuse glandular breakdown (apoptotic bodies) of the uterus, acute inflammation of the uterus, and/or decreased vaginal epithelial thickness, decreased ovulation events, ovarian inflammation, and/or infertility.
  • the subject may be characterized by dysfunctional folliculogenesis, e.g., follicle depletion or follicle dysfunction.
  • the subject may have decreased tertiary follicle counts, e.g., early antral, antral, and/or pre-ovulatory, and/or decreased corpora lutea (CL) follicle counts.
  • the subject may be characterized by down-regulation of estrogen receptors (ER) a and P in the ovary, reduced ESRI or ESR2 gene expression, increased miR-206-3p RNA expression, reduced ovarian production of 17P-estradiol (E2), and/or increased lipid-laden ovarian stromal cells.
  • ER estrogen receptors
  • E2 17P-estradiol
  • the subject may be characterized by a reduced anti-Mullerian hormone (AMH) level, e.g., less than about 80 ng/mL, an increased follicle stimulating hormone (FHL) level, e.g., greater than about 10 IU/L, an increased estradiol level, and/or a reduced antral follicle count (AFC), e.g., less than about 5-7 total follicles.
  • AMH anti-Mullerian hormone
  • FHL follicle stimulating hormone
  • AFC reduced antral follicle count
  • the subject may be characterized as suffering from one or more of obesity, diabetes, chronic inflammation, high blood sugar, an autoimmune disease, and/or poor lifestyle factors, such as smoking, alcohol use, drug use, exposure to chemicals (e.g., bisphenol A, advanced glycation end products (AGE)) and/or radiation, poor nutrition, e.g., increased ingestion of charred foods, increased ingestion of saturated fats, and/or reduced ingestion of fruits and vegetables, and/or reduced exercise.
  • chemicals e.g., bisphenol A, advanced glycation end products (AGE)
  • AGE advanced glycation end products
  • the subject may be undergoing in vitro fertilization (IVF).
  • IVF in vitro fertilization
  • the subject may have previously attempted IVF, successfully or unsuccessfully.
  • the subject may be a poor responder to IVF.
  • the subject may be a normal responder to IVF.
  • the subject may have a mitochondrial DNA mutation in an oocyte to be fertilized to form the embryo or the recipient oocyte.
  • the mutation may be somatic or inherited.
  • the mutation may be, e.g., a T414G transverse mutation.
  • the subject may be characterized by decreased levels of mitochondrial DNA (mtDNA) in an oocyte to be fertilized to form the embryo.
  • the subject may be characterized by reduced oocyte quality, e.g., chromosomal misalignment and/or spindle malformation.
  • the subject may be characterized by a mitofusin (Mfnl) gene abnormality, a dynamic related protein 1 (Drpl) gene abnormality, a caseinolytic peptidase P (Clpp) gene abnormality, a growth differentiation factor 9 (GDF9) gene abnormality, a fragile-X mental retardation 1 (FMRI) gene abnormality, a transcription factor A (TFAM) gene abnormality, a mitochondrial DNA polymerase gamma (PolgA) gene abnormality, a mitochondrial inner membrane peptidase (IMP) gene abnormality, and/or a mitochondrial ABC transporter (MDR-1) gene abnormality.
  • Mfnl mitofusin
  • Drpl dynamic related protein 1
  • Clpp caseinolytic peptidase P
  • GDF9 growth differentiation factor 9
  • FMRI fragile-X mental retardation 1
  • TFAM transcription factor A
  • TFAM mitochondrial DNA polymerase gamma
  • IMP mitochondrial inner membrane peptidase
  • the subject may be characterized by decreased gene expression of PPARy, PGC-la, PGC-lb, ERR, NRF-1, NRF-2, SIRT1, SIRT3, SIRT4, and/or SIRT5.
  • the subject may be characterized by decreased AMP-activated protein kinase (AMPK) and or PTEN-induced kinase 1 (PINK1) protein expression and/or increased mammalian target of rapamycin (mTOR) protein expression.
  • AMPK AMP-activated protein kinase
  • PINK1 PTEN-induced kinase 1
  • the subject may be characterized by decreased gene expression of superoxide dismutase (SOD) and/or increased levels of Aldh3A2 enzyme.
  • SOD superoxide dismutase
  • the subject may be characterized by decreased mRNA expression of Prdx3, Prdx4, and/or Txn2 enzyme.
  • the subject may be characterized by a neurologic condition.
  • the subject may suffer from Turner’s Syndrome, galactosemia, and/or Fragile X Syndrome.
  • the subject may be characterized by progressive external ophthalmoplegia (POE), spinocerebellar ataxia with epilepsy (SCAE), and/or mitochondrial encephalomyopathy, lactic acidosis, and stroke-like episodes (MELAS).
  • POE progressive external ophthalmoplegia
  • SCAE spinocerebellar ataxia with epilepsy
  • MELAS mitochondrial encephalomyopathy
  • lactic acidosis lactic acidosis
  • stroke-like episodes MELAS
  • the subject may be characterized by one or more of: an inflammatory phenotype in the skin, a change in mitochondrial protein expression, reduced expression of mitochondrial oxidative phosphorylation complexes, reduced stability of mitochondrial oxidative phosphorylation complexes, a decrease in collagen content of the skin, increased epidermal thickness, increased epidermal hyperplasia, acanthosis, hyperkeratosis, increased expression of at least one gene selected from the group consisting of: NF-KB, COX-2, INF-pl, CCL5, MMP1, MMP2, MMP9, MMP13, IGF1R, VEGF, and MRPS5, decreased expression of at least one of gene selected from the ground consisting of TIMP1, KLOTHO, COL1A1, MTCO2, TFAM, and VDAC, and increased inflammatory infiltrate in skin.
  • the subject may be characterized as having decreased expression of at least one protein selected from PGC-la, TFAM, NRF-1, and COXII.
  • a method may further comprise administering a second amount of the compound to the subject.
  • the second amount may be administered as a second dose of the same formulation.
  • the second amount may be administered in another formulation.
  • the second amount may be administered in another formulation by the same route of administration, e.g., a topical solution or oil with a shampoo, conditioner, spray, cream, gel, body wash, soap, or lotion.
  • the second amount may be administered by another route of administration, e.g., each amount may independently be administered topically, parenterally, or enterally.
  • a method may further comprise administering a second compound to the subject.
  • the second compound may be a compound that is a constituent of the same extract.
  • the second compound may be a compound that is a constituent of another extract.
  • the second compound may be a compound having a similarity score of at least 95% with the first compound.
  • the second compound may be administered in the same formulation.
  • the second compound may be administered in another formulation.
  • the compound may be administered as part of a combination therapy.
  • the method may further comprise administering a second treatment in combination with the compound.
  • the compound may be administered for a period of time prior to initiating the second treatment.
  • the compound may be administered concurrently with the second treatment.
  • the compound may be administered for a period of time subsequent to ceasing the second treatment.
  • the second treatment may be administered via an alternate mode of administration.
  • the second treatment may be a cosmetic and/or therapeutic treatment.
  • the compound may be administered in combination with a second agent, e.g., cosmetic or therapeutic agent, approved to treat or commonly used to treat the disease or condition or a symptom thereof.
  • a second agent e.g., cosmetic or therapeutic agent
  • the compound may be administered in combination with a standard of care treatment for improving fertility.
  • the compound may be administered in combination with one or more of clomiphene, tamoxifen, letrozole, metformin, gonadotrophins, gonadotrophin-releasing hormone, dopamine agonists, and other hormonal treatments.
  • the compound may be administered in combination with a standard of care treatment for treating an ovarian disease or condition.
  • the compound may be administered in combination with one or more of hormone therapy, e.g., estrogen, progesterone, testosterone, or a synthetic form thereof, selective serotonin reuptake inhibitors (SSRIs), gabapentin, clonidine, hormonal contraceptives, gonadotropin-releasing hormone (GnRH) agonists or antagonists, heat therapy, pain relievers, nonsteroidal anti-inflammatory drugs (NSAID), such as ibuprofen or other analgesics, spironolactone, eflornithine, electrolysis, chemotherapy, radiation therapy, surgery, e.g., hysterectomy, bilateral salpingo-oophorectomy, and debulking surgery, and lifestyle changes, such as weight loss, improved nutrition, and increased physical activity.
  • hormone therapy e.g., estrogen, progesterone, testosterone, or a synthetic form thereof
  • SSRIs selective
  • the compound may be administered in combination with caffeine, B vitamins (e.g., B l, B2, B3, B5, B6, B8, B9 and/or B 12), vitamin C, vitamin D, iron, magnesium, and/or zinc.
  • B vitamins e.g., B l, B2, B3, B5, B6, B8, B9 and/or B 12
  • vitamin C e.g., B l, B2, B3, B5, B6, B8, B9 and/or B 12
  • vitamin C e.g., B l, B2, B3, B5, B6, B8, B9 and/or B 12
  • vitamin D e.g., iron, magnesium, and/or zinc.
  • the compound may be administered in combination with UV-blocking agent, moisturizer, sunscreen, wrinkle cream, retinoid, alpha-hydroxy acid, beta-hydroxy acid, squalene, antioxidant, tretinoin, glycosaminoglycan (GAG), lactic acid, malic acid, citric acid, tartaric acid, hydroquinone, kojic acid, L-ascorbic acid, licorice extract, N-acetylglucosamine, niacinamide, soy, dermal filler or injection, e.g. hyaluronic acid or calcium hydroxylapatite, botulinum toxin, laser resurfacing procedure, ultrasound therapy, chemical peel, e.g. glycolic acid peel, trichloroacetic acid or salicylic acid, or dermabrasion procedure.
  • UV-blocking agent e.g. hyaluronic acid or calcium hydroxylapatite
  • botulinum toxin e.g. glycolic acid peel, t
  • the compound may be administered in combination with a surgical procedure, e.g., fallopian tube surgery, laparoscopic surgery to remove or destroy cysts or submucosal fibroids, or laparoscopic ovarian drilling.
  • a surgical procedure e.g., fallopian tube surgery, laparoscopic surgery to remove or destroy cysts or submucosal fibroids, or laparoscopic ovarian drilling.
  • the compound may be administered in combination with an antioxidant.
  • antioxidants include CoQlO, vitamin C, vitamin E, carotenoids, e.g., beta-carotene, minerals, e.g., selenium and manganese, glutathione, lipoic acid, flavonoids, betaflavinoids, phenols, polyphenols, phytoestrogens, mitoquinol mesylate, and ubiquinone.
  • the fucus compound may be administered in combination with an emblica extract or a compound constituent of an emblica extract.
  • the fucus compound may be administered in combination with a chebula extract or a compound constituent of a chebula extract.
  • the emblica compound may be administered with a fucus extract or a compound constituent of a fucus extract.
  • the emblica compound may be administered with a chebula extract or a compound constituent of a chebula extract.
  • the combination of two or more of an emblica compound, a fucus compound, and a chebula compound may provide synergistic effects in the treatment of the disease or condition.
  • an effective amount of the compound may be administered to a face of a subject.
  • the compound may be administered to the scalp of the subject.
  • the compound may be administered to the body of the subject.
  • the compound may be applied to one or more of the more of the forehead, eye region, neck, scalp, head, shoulder, arm, hands, leg, underarm, torso, chest, feet, knee, ankle, back, buttock, or genitals of the subject.
  • an effective amount of the compound may be administered enterally or parenterally.
  • the subject may be undergoing in vitro fertilization (IVF).
  • IVF in vitro fertilization
  • the subject may have previously attempted IVF, successfully or unsuccessfully.
  • the subject may be a poor responder to IVF.
  • the subject may be a normal responder to IVF.
  • oocytes are typically retrieved from the ovary of a subject and placed in vitro with active, motile sperm to produce one or more embryo.
  • Viable embryos may be selected for transfer into the uterus of the subject or a surrogate. Additional viable embryos may be preserved for future transfer.
  • the methods disclosed herein may involve improving embryo development or improving embryo fertilization rate.
  • the embryo may be produced by IVF.
  • the method may comprise measuring mitochondrial content of the embryo and selecting the embryo responsive to the measurement of mitochondrial content being within a predetermined range.
  • the predetermined range may correspond to a healthy range, for example, a range associated with a normal ovarian reserve (NOR) and fertility.
  • the methods may comprise administering the compositions disclosed herein to the subject or to the embryo.
  • the method may comprise treating the embryo by introducing the composition to a culture media of the embryo during development.
  • the composition may be introduced in an amount effective to improve embryo development or fertilization rate.
  • the method may comprise introducing antioxidants to the culture media in combination with the composition.
  • the methods may include transferring ooplasm from a donor oocyte to a recipient oocyte of the subject to be fertilized to form the embryo.
  • the donor oocyte may have a mitochondrial DNA (mtDNA) content greater than the recipient oocyte of the subject.
  • the donor oocyte may be autologous.
  • the donor oocyte may be allogeneic.
  • the donor oocyte may be xenogeneic.
  • the composition may have been administered to a donor subject, the recipient subject, and/or the embryo.
  • the subject may have a mitochondrial DNA mutation in the oocyte to be fertilized to form the embryo.
  • the mutation may be somatic or inherited.
  • the mutation may be, e.g., a T414G transverse mutation.
  • the subject may be characterized by decreased levels of mitochondrial DNA (mtDNA) in the oocyte to be fertilized to form the embryo.
  • the subject may be characterized by reduced oocyte quality, e.g., chromosomal misalignment and/or spindle malformation.
  • the ooplasm transfer may be a complete transfer. In other embodiments, the ooplasm transfer may be partial. The partial ooplasm transfer may be by electrofusion or direct ooplasmic injection.
  • the ooplasm transfer may be performed by one of several methods.
  • the ooplasm transfer may be performed by modified intracytoplasmic sperm injection (ICSI).
  • the ooplasm transfer may be performed by autonomous germline mitochondrial energy transfer (AUGMENT) on the oocyte.
  • the ooplasm transfer may be performed by nuclear genome transfer, e.g., oocyte spindle transfer, germinal vesicle (GV) transfer, pronuclear transfer (PNT), or polar body nuclear transfer (PBNT).
  • the method may comprise using CRISPR/Cas 9 gene editing technology on mitochondrial DNA (mtDNA) of an oocyte of the subject to be fertilized to form the embryo.
  • the methods may comprise using CRISPR/Cas 9 gene editing technology on the mtDNA of the donor oocyte or the recipient oocyte.
  • the method may comprise introducing stem cell generated mitochondrial DNA (mtDNA) into an oocyte of the subject to be fertilized to form the embryo.
  • mtDNA transfer may occur without a donor oocyte.
  • a preparation comprising mtDNA as a therapeutic agent.
  • the preparation may comprise an effective amount of donor mtDNA in a therapeutically acceptable carrier.
  • the mtDNA may be edited by CRISPR/Cas 9.
  • the mtDNA may be stem cell generated.
  • the mtDNA may be in the form of a complete ooplasm transfer or a partial ooplasm transfer.
  • Kits comprising the preparation comprising mtDNA are also disclosed.
  • the kits may additionally comprise a compound of the disclosure, or a pharmaceutically acceptable form thereof.
  • the compounds of the disclosure are administered to the subject (or are contacted with cells of the subject) in an effective amount.
  • therapeutically the effective amount of a compound of the disclosure ranges from about 0.05 mg/kg/day to about 50 mg/kg/day. In certain embodiments, the effective amount ranges from about 0.05 mg/kg/day to about 40 mg/kg/day. In certain embodiments, the effective amount ranges from about 0.05 mg/kg/day to about 30 mg/kg/day. In certain embodiments, the effective amount ranges from about 0.05 mg/kg/day to about 20 mg/kg/day. In certain embodiments, the effective amount ranges from about 0.05 mg/kg/day to about 10 mg/kg/day. In certain embodiments, the effective amount ranges from about 0.05 mg/kg/day to about 8 mg/kg/day.
  • the effective amount ranges from about 0.05 mg/kg/day to about 6 mg/kg/day. In certain embodiments, the effective amount ranges from about 0.05 mg/kg/day to about 4 mg/kg/day. In certain embodiments, the effective amount ranges from about 0.05 mg/kg/day to about 3 mg/kg/day. In certain embodiments, the effective amount ranges from about 0.05 mg/kg/day to about 2 mg/kg/day. In certain embodiments, the effective amount ranges from about 0.05 mg/kg/day to about 1 mg/kg/day. In certain embodiments, the effective amount ranges from about 0.05 mg/kg/day to about 0.8 mg/kg/day.
  • the effective amount ranges from about 0.05 mg/kg/day to about 0.6 mg/kg/day. In certain embodiments, the effective amount ranges from about 0.05 mg/kg/day to about 0.4 mg/kg/day.
  • the amounts per day described above are administered according to a course of treatment and may be administered in a single dose or in more than 1 dose per day. The amounts per day described above may be administered according to a course of treatment and administered in one dose (q.d.) or two doses each day (b.i.d.), wherein the amount of the compound of the disclosure in each dose need not be the same.
  • each dose is administered according to a course of treatment.
  • dose refers to an amount of a compound of the disclosure administered at a given time point according to a course of treatment. For example, if a course of treatment for a compound of the disclosure is b.i.d (2 times/administrations per day) for 7 days, the two administrations on each of days 1-7 would each comprise administering a dose of a compound of the disclosure (for 2 doses each day).
  • a dose is administered q.d. (1 time/administration per day) according to a course of treatment.
  • a dose is administered b.i.d. according to a course of treatment.
  • a dose is administered t.i.d. (three times/administrations per day) according to a course of treatment.
  • each dose administered according to the course of treatment may contain the same amount of a compound of the disclosure or one or more of doses administered according to the course of treatment may contain a greater or lesser amount of a compound of the disclosure as compared to another dose administered according to the course of treatment.
  • the first dose administered on day 1 may contain a first amount (i.e., 2 mg/kg) and the second dose administered on day 1 may contain a second amount (i.e., 0.5 mg/kg).
  • the first dose administered on day 1 may contain a first amount (i.e., 2 mg/kg)
  • the second dose administered on day 1 may contain a second amount (i.e., 0.5 mg/kg)
  • the two doses administered on each of days 2-4 may contain the second amount
  • the two doses administered on each of days 5-7 may contain a third amount (i.e., 1 mg/kg).
  • a dose may be further divided into a sub-dose. Any given dose may be delivered in a single unit dose form or more than one unit dose form.
  • a dose when given by IV administration may be provided as a single IV infusion (i.e., a single 5 mg/kg IV infusion) or as two or more IV infusions administered one after the other (i.e., two 2.5 mg/kg IV infusions).
  • a sub-dose might be, for example, a number of discrete loosely spaced administrations, such as multiple inhalations from an insufflator, by application of a plurality of drops into the eye, or multiple tablets for oral administration.
  • more than one dose of a compound of the disclosure is administered during a course of treatment.
  • the methods may comprise the administration of multiple doses during the course of treatment.
  • the course of treatment may range from months to years.
  • the course of treatment may range from 2 days to 1 month, from 2 days to 3 weeks, from 2 days to 2 weeks, or from 2 days to 1 week.
  • the course of treatment may range from 1 year to 20 years or longer.
  • a dose is delivered at least 1 time per day (i.e., 1 to 3 times) during the course of treatment.
  • a dose is not administered every day during the course of treatment (for example, a dose is be administered at least 1 timer per day every other day, every third day, every week, or every month during the course of treatment).
  • the amount of a compound of the disclosure in each dose need not be the same as discussed above.
  • one or more doses, or all of the doses contain an effective amount of a compound of the disclosure.
  • a course of treatment may comprise administering at least one dose as a loading dose and at least one dose as a maintenance dose, wherein the loading dose contains a greater amount of a compound of the disclosure as compared to the maintenance dose (such as, but not limited to, 2 to 10 times higher).
  • the loading dose is administered initially, either as a single administration or more than one administration, followed by administration of one or more maintenance doses through the remaining course of treatment.
  • a loading dose of 3 mg/kg may be administered as the first dose on week 1 of the course of treatment, followed by maintenance doses of 0.5 mg/kg every week for the remainder of the course of treatment.
  • a loading dose may be given as a dose that is not the first dose administered during a course of treatment.
  • a loading dose may be administered as the first dose on week and as a dose on one or more additional weeks (for example, weeks 10 and 20).
  • a course of treatment may comprise administering a first dose formulated in a first composition and administering at least one second or subsequent dose formulated in a second composition.
  • the first composition and the second composition may be the same formulation.
  • the first composition and the second composition may be different formulations.
  • compositions are provided that comprise an amount, e.g., an effective amount, of a compound of the disclosure.
  • such pharmaceutical compositions contain a therapeutically effective amount of a compound of the disclosure.
  • other active agents may be included in such pharmaceutical compositions. Additional active agents to be included may be selected based on the disease or condition to be treated.
  • compositions disclosed may comprise one or more compound of the disclosure, alone or in combination with additional active agents, in combination with a pharmaceutically acceptable carrier and/or excipient and/or in combination with a cosmetically acceptable carrier and/or excipient.
  • Such pharmaceutical compositions may be used in the manufacture of a medicament for use in the methods described herein.
  • the compounds of the disclosure are useful in both free form and in the pharmaceutically acceptable forms, such as pharmaceutically acceptable salts.
  • Suitable carriers and excipients include solvents such as water, alcohol, and propylene glycol, solid absorbants and diluents, surface active agents, suspending agent, tableting binders, lubricants, flavors, and coloring agents.
  • the pharmaceutically and/or cosmetically acceptable carriers can include polymers and polymer matrices.
  • acceptable carriers include carboxymethyl cellulose, crystalline cellulose, glycerin, gum arabic, lactose, magnesium stearate, methyl cellulose, powders, saline, sodium alginate, sucrose, starch, talc and water, among others.
  • the acceptable carrier is chemically inert to the active agents in the composition and has no detrimental side effects or toxicity under the conditions of use.
  • Surfactants such as, for example, detergents, are also suitable for use in the formulations.
  • Specific examples of surfactants include polyvinylpyrrolidone, polyvinyl alcohols, copolymers of vinyl acetate and of vinylpyrrolidone, polyethylene glycols, benzyl alcohol, mannitol, glycerol, sorbitol or polyoxyethylenated esters of sorbitan; lecithin or sodium carboxymethylcellulose; or acrylic derivatives, such as methacrylates and others, anionic surfactants, such as alkaline stearates, in particular sodium, potassium or ammonium stearate; calcium stearate or triethanolamine stearate; alkyl sulfates, in particular sodium lauryl sufate and sodium cetyl sulfate; sodium dodecylbenzenesulphonate or sodium dioctyl sulphosuccinate; or fatty acids, in particular those derived from coconut oil,
  • Exemplary pharmaceutically acceptable carriers and/or excipients and/or cosmetically acceptable carriers and/or excipients include water, silica, glycerin, dimethicone, butylene glycol, pentylene glycol, ethoxy diglycol, poly aery late- 13, pentapeptide-34 trifluoroacetate, polyisobutene, lysolecithin, sclerotium gum, pullulan, polysorbate 20, diethylhexyl syringylidenemalonate, caprylyl glycol, glyceryl stearate, PEG- 100 stearate, cetearyl alcohol, butyrospermum parkii (shea) butter, acetyl tetrapeptide-2, betaine, melanin, tocopheryl acetate, tocopherol, hydroxy acetophenone, caprylic/capric triglyceride, batyl alcohol, Cl 2- 15 alkyl benzoate,
  • the compounds of the disclosure and pharmaceutical compositions containing such compounds as described in the instant disclosure can be administered by any conventional method available for use in conjunction with pharmaceuticals, either as individual therapeutic agents or in combination with additional therapeutic agents.
  • the compounds of the disclosure are administered in an effective amount, whether alone or as a part of a pharmaceutical composition.
  • the effective amount and the dosage administered will, of course, vary depending upon known factors, such as the pharmacodynamic characteristics of the particular agent and its mode and route of administration, the age, health and weight of the recipient; the severity and stage of the disease state or condition; the kind of concurrent treatment; the frequency of treatment; and the effect desired.
  • the total amount of the compound administered will also be determined by the route, timing and frequency of administration as well as the existence, nature, and extent of any adverse side effects that might accompany the administration of the compound and the desired physiological effect. It will be appreciated by one skilled in the art that various conditions or disease states, in particular chronic conditions or disease states, may require prolonged treatment involving multiple administrations.
  • the compound(s) of the disclosure will ordinarily be present in an amount of about 0.5-95% weight based on the total weight of the composition, or about 0.1-99.9% weight based on the total weight of the composition.
  • Multiple dosage forms may be administered as part of a single treatment.
  • the active agent can be administered enterally in solid dosage forms, such as capsules, tablets, and powders, or in liquid dosage forms, such as milk, elixirs, syrups and suspensions. It can also be administered parenterally, in sterile liquid dosage forms.
  • the compound(s) of the disclosure can also be administered intranasally (nose drops) or by inhalation via the pulmonary system, such as by propellant based metered dose inhalers or dry powders inhalation devices.
  • Other dosage forms include topical administration, such as administration transdermally, via patch mechanism or ointment.
  • Formulations suitable for enteral or oral administration may be liquid solutions, such as an effective amount of the compound(s) dissolved in diluents, such as milk, water, saline, buffered solutions, infant formula, other suitable carriers, or combinations thereof.
  • diluents such as milk, water, saline, buffered solutions, infant formula, other suitable carriers, or combinations thereof.
  • Formulations suitable for enteral or oral administration of the compounds of the disclosure are known in the art as exemplified by: Shaji, et al., Indian J Pharm Sci. 2008 May-Jun; 70(3): 269-277; Bruno, et al., Ther Deliv. 2013 Nov; 4(11): 1443-1467; (2004), et al., DARU Journal of Pharmaceutical Sciences, 2020, 28, 403-416.
  • the compound(s) can then be mixed to the diluent just prior to administration.
  • formulations suitable for enteral or oral administration may be capsules, sachets, tablets, lozenges, and troches.
  • the formulation may contain a predetermined amount of the compound(s) of the disclosure, as solids or granules, powders, suspensions and suitable emulsions.
  • Liquid formulations may include diluents, such as water and alcohols, for example, ethanol, benzyl alcohol, propylene glycol, glycerin, and the polyethylene alcohols, either with or without the addition of an acceptable surfactant, suspending agent, or emulsifying agent.
  • Capsule forms can be of the ordinary hard- or soft-shelled gelatin type containing, for example, surfactants, lubricants, and inert fillers, such as lactose, sucrose, calcium phosphate, and com starch.
  • Tablet forms can include one or more of the following: lactose, sucrose, mannitol, corn starch, potato starch, alginic acid, microcrystalline cellulose, acacia, gelatin, guar gum, colloidal silicon dioxide, croscarmellose sodium, talc, magnesium stearate, calcium stearate, zinc stearate, stearic acid, and other excipients, colorants, diluents, buffering agents, disintegrating agents, moistening agents, preservatives, flavoring agents, and pharmacologically compatible carriers.
  • Lozenge forms can comprise the active ingredient in a flavor, usually sucrose and acacia or tragacanth, as well as pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin, or sucrose and acadia, emulsions, and gels containing, in addition to the active ingredient, such carriers as are known in the art.
  • a flavor usually sucrose and acacia or tragacanth
  • pastilles comprising the active ingredient in an inert base, such as gelatin and glycerin, or sucrose and acadia, emulsions, and gels containing, in addition to the active ingredient, such carriers as are known in the art.
  • Formulations suitable for parenteral administration include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain anti-oxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the patient, and aqueous and nonaqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives.
  • the compound(s) can be administered in a physiologically acceptable diluent in an acceptable carrier, such as a sterile liquid or mixture of liquids, including water, saline, aqueous dextrose and related sugar solutions, an alcohol, such as ethanol, isopropanol, or hexadecyl alcohol, glycols, such as propylene glycol or polyethylene glycol such as poly(ethyleneglycol) 400, glycerol ketals, such as 2,2-dimethyl-l,3-dioxolane-4-methanol, ethers, an oil, a fatty acid, a fatty acid ester or glyceride, or an acetylated fatty acid glyceride with or without the addition of an acceptable surfactant, such as a soap or a detergent, suspending agent, such as pectin, carbomers, methylcellulose, hydroxypropylmethylcellulose, or carboxymethylcellulose, or emulsifying agents and other pharmaceutical adju
  • Oils which can be used in parenteral formulations include petroleum, animal, vegetable, or synthetic oils. Specific examples of oils include peanut, soybean, sesame, cottonseed, corn, olive, petrolatum, and mineral. Suitable fatty acids for use in parenteral formulations include oleic acid, stearic acid, and isostearic acid. Ethyl oleate and isopropyl myristate are examples of suitable fatty acid esters.
  • Suitable soaps for use in parenteral formulations include fatty alkali metal, ammonium, and triethanolamine salts
  • suitable detergents include (a) cationic detergents such as, for example, dimethyldialkylammonium halides, and alkylpyridinium halides, (b) anionic detergents such as, for example, alkyl, aryl, and olefin sulfonates, alkyl, olefin, ether, and monoglyceride sulfates, and sulfosuccinates, (c) nonionic detergents such as, for example, fatty amine oxides, fatty acid alkanolamides, and polyoxyethylene polypropylene copolymers, (d) amphoteric detergents such as, for example, alkyl .beta.-aminopropionates, and 2-alkylimidazoline quaternary ammonium salts, and (e) mixtures thereof.
  • the parenteral formulations typically contain from about 0.5% to about 50% by weight of the compound(s) in solution. Suitable preservatives and buffers can be used in such formulations. In order to minimize or eliminate irritation at the site of injection, such compositions may contain one or more nonionic surfactants having a hydrophile-lipophile balance (HLB) of from about 12 to about 17. The quantity of surfactant in such formulations ranges from about 5% to about 15% by weight. Suitable surfactants include polyethylene sorbitan fatty acid esters, such as sorbitan monooleate and the high molecular weight adducts of ethylene oxide with a hydrophobic base, formed by the condensation of propylene oxide with propylene glycol.
  • HLB hydrophile-lipophile balance
  • the compound(s) of the disclosure can be formulated into aerosol formulations to be administered via nasal or pulmonary inhalation.
  • aerosol formulations can be placed into pressurized acceptable propellants, such as dichlorodifluoromethane, propane, and nitrogen.
  • Such aerosol formulations may be administered by metered dose inhalers. They also may be formulated as pharmaceuticals for non-pressured preparations, such as in a nebulizer or an atomizer.
  • the compound(s) of the disclosure may be administered in an aqueous solution as a nasal or pulmonary spray and may be dispensed in spray form by a variety of methods known to those skilled in the art.
  • Systems for dispensing liquids as a nasal spray are disclosed in U.S. Pat. No. 4,511,069.
  • the formulations may be presented in multi-dose containers, for example in the sealed dispensing system disclosed in U.S. Pat. No. 4,511,069.
  • Additional aerosol delivery forms may include, e.g., compressed air-, jet-, ultrasonic-, and piezoelectric nebulizers, which deliver the active agent dissolved or suspended in a pharmaceutical solvent, e.g., water, ethanol, or a mixture thereof.
  • a pharmaceutical solvent e.g., water, ethanol, or a mixture thereof.
  • Nasal and pulmonary solutions of the disclosure may typically comprise the drug or drug to be delivered, optionally formulated with a surface-active agent, such as a nonionic surfactant (e.g., polysorbate-80), and one or more buffers.
  • a surface-active agent such as a nonionic surfactant (e.g., polysorbate-80)
  • the nasal spray solution further comprises a propellant.
  • the pH of the nasal spray solution is optionally between about pH 3.0 and 6.0, or 4.5 +/- 0.5.
  • Suitable buffers for use within these compositions are as described above or as otherwise known in the art.
  • Other components may be added to enhance or maintain chemical stability, including preservatives, surfactants, dispersants, or gases.
  • Suitable preservatives include, but are not limited to, phenol, methyl paraben, paraben, m-cresol, thiomersal, chlorobutanol, benzylalkonimum chloride, and the like.
  • Suitable surfactants include, but are not limited to, oleic acid, sorbitan trioleate, polysorbates, lecithin, phosphatidyl cholines, and various long chain diglycerides and phospholipids.
  • Suitable dispersants include, but are not limited to, ethylenediaminetetraacetic acid, and the like.
  • gases include, but are not limited to, nitrogen, helium, chlorofluorocarbons (CFCs), hydrofluorocarbons (HFCs), carbon dioxide, air, and the like.
  • nasal and pulmonary formulations are administered as dry powder formulations comprising the active agent in a dry, usually lyophilized, form of an appropriate particle size, or within an appropriate particle size range, for intranasal delivery.
  • Minimum particle size appropriate for deposition within the nasal or pulmonary passages is often about 0.5 pm. mass median equivalent aerodynamic diameter (MMEAD), commonly about 1 pm MMEAD, and more typically about 2 pm MMEAD.
  • Maximum particle size appropriate for deposition within the nasal passages is often about 10 pm MMEAD, commonly about 8 pm MMEAD, and more typically about 4 pm MMEAD.
  • Intranasally and pulmonaryly respirable powders within these size ranges can be produced by a variety of conventional techniques, such as jet milling, spray drying, solvent precipitation, supercritical fluid condensation, and the like.
  • These dry powders of appropriate MMEAD can be administered to a patient via a conventional dry powder inhaler (DPI), which relies on the patient's breath, upon pulmonary or nasal inhalation, to disperse the power into an aerosolized amount.
  • the dry powder may be administered via air-assisted devices that use an external power source to disperse the powder into an aerosolized amount, e.g., a piston pump.
  • the active agent can be combined with various pharmaceutically and/or cosmetically acceptable additives, as well as a base or carrier for dispersion of the active agent(s).
  • Desired additives include, but are not limited to, pH control agents, such as arginine, sodium hydroxide, glycine, hydrochloric acid, citric acid, etc.
  • local anesthetics e.g., benzyl alcohol
  • isotonizing agents e.g., sodium chloride, mannitol, sorbitol
  • adsorption inhibitors e.g., Tween 80
  • solubility enhancing agents e.g., cyclodextrins and derivatives thereof
  • stabilizers e.g., serum albumin
  • reducing agents e.g., glutathione
  • the tonicity of the formulation is typically adjusted to a value at which no substantial, irreversible tissue damage will be induced in the nasal mucosa at the site of administration.
  • the tonicity of the solution is adjusted to a value of about 1/3 to 3, more typically 1/2 to 2, and most often 3/4 to 1.7.
  • the compound(s) of the disclosure may be dispersed in a base or vehicle, which may comprise a hydrophilic compound having a capacity to disperse the active agent and any desired additives.
  • the base may be selected from a wide range of suitable carriers, including but not limited to, copolymers of polycarboxylic acids or salts thereof, carboxylic anhydrides (e.g., maleic anhydride) with other monomers (e.g., methyl (meth)acrylate, acrylic acid, etc.), hydrophilic vinyl polymers such as polyvinyl acetate, polyvinyl alcohol, polyvinylpyrrolidone, cellulose derivatives such as hydroxymethylcellulose, hydroxypropylcellulose, etc., and natural polymers such as chitosan, collagen, sodium alginate, gelatin, hyaluronic acid, and nontoxic metal salts thereof.
  • suitable carriers including but not limited to, copolymers of polycarboxylic acids or salts thereof, carboxylic anhydrides (e.g
  • a biodegradable polymer is selected as a base or carrier, for example, polylactic acid, poly(lactic acid-glycolic acid) copolymer, polyhydroxybutyric acid, poly(hydroxybutyric acid-glycolic acid) copolymer and mixtures thereof.
  • synthetic fatty acid esters such as polyglycerin fatty acid esters, sucrose fatty acid esters, etc. can be employed as carriers.
  • Hydrophilic polymers and other carriers can be used alone or in combination, and enhanced structural integrity can be imparted to the carrier by partial crystallization, ionic bonding, crosslinking and the like.
  • the carrier can be provided in a variety of forms, including, fluid or viscous solutions, gels, pastes, powders, microspheres and films for direct application to the nasal mucosa.
  • the use of a selected carrier in this context may result in promotion of absorption of the active agent.
  • the compounds of the disclosure may be formulated as described in International Patent Application No. PCT/US2022/020983, filed March 18, 2022, titled “COMPOSITIONS AND METHODS FOR IMPROVING MITOCHONDRIAL FUNCTION,” the entire disclosure of which is herein incorporated by reference in its entirety for all purposes.
  • the compounds of the disclosure may be formulated in a nanoparticle-based delivery carrier.
  • the nanoparticle delivery systems disclosed herein may offer benefits in mitochondria- targeted delivery and improving the therapeutic ability of the compounds.
  • Nanoparticle formulations have been shown to effectively transport drug molecules in their original form, solubilize hydrophobic drug molecules, enhance half-life of molecules, and decrease side effects and immunogenicity attributable to the molecules.
  • the nanoparticle delivery carriers disclosed herein may be selected or designed to provide enhanced skin penetration, higher stability, site specific targeting, e.g., efficiently deliver cargo inside the mitochondrial matrix, high entrapment efficiency, and/or time-controlled, e.g., delayed or sustained, release of the compounds.
  • Nanoparticle delivery carrier that may be designed to effectively deliver compounds of the formulation to a target site of a subject include surface chemistry, coating, structure, size, ability to aggregate, and solubility.
  • Exemplary nanomaterials are described in “Nano therapeutic Approaches to Target Mitochondria in Cancer,” (Mani, 2021) and “Role of Nanotechnology in Cosmeceuticals: A Review of Recent Advances,” (Kaul, 2018), each of which is incorporated herein by reference in its entirety for all purposes.
  • the nanoparticle delivery carrier may comprise and/or be functionalized with carbonbased nanomaterials, liposomal delivery vehicles, polymeric nanocarriers, micelles, dendrimers, lipophilic cations, solid-lipid nanoparticles (SLN), peptide-based nanomaterials, nano structured lipid carriers (NLC), niosomes, nanoemulsions, metal nanoparticles, nanospheres, polymerosomes, cubosomes, and combinations thereof.
  • the delivery carrier may be designed to for mitochondrial targeting or specific cell type targeting.
  • Exemplary mitochondrial targeting agents include antibodies, polymeric functional moieties, such as PEG, lipophilic cations, such as triphenylphosphine (TPP), and peptides, such as mitochondrial penetrating peptides (MPP).
  • the delivery carrier may be formed of a targeting moiety, for example, encapsulating or conjugated with the compounds disclosed herein, and/or the delivery carrier may be functionalized with a surface targeting moiety.
  • the nanoparticle carrier may be dimensioned to have an average size of about 10 to 5000 nm, for example 10 to 50 nm, 10 to 100 nm, 50 to 500 nm, 50 to 100 nm, 100 to 500 nm, 500 to 1000 nm, or 1000 nm to 5000 nm, which can be selected based on the target tissue, compound to be delivered, and other properties of the nanomaterial.
  • Exemplary carbon-based nanomaterials include carbon dots (C-dots or CD), carbon nanotubes (CNT), graphene derivatives, nanodiamonds (ND), quantum dots (QD), and magnetic nanoparticles (MNP).
  • Carbon nanoparticles may be formed into different shapes including, for example, spherical, elliptical, tube, horn-shaped, and combinations thereof.
  • CNTs are graphene sheets formed into cylindrical tubes. CNTs have demonstrated low toxicity profile, good biocompatibility, and targeted accumulation.
  • CNTs of the disclosure may be single-walled carbon nanotubes (SWCNT) and/or multi-walled carbon nanotubes (MWCNT). SWCNTs have a smaller diameter, in the range of 1 to 10 nm. MWCNTs have a larger diameter, in the range of 2 to 50 nm.
  • CNTs may be functionalized with a targeting sequence. For instance, CNTs may be functionalized to target mitochondria and/or a specific cell type.
  • Graphene derivatives also include two-dimensional carbon allotropes.
  • Graphene derivatives may be designed to exhibit specific physicochemical properties, such as a high surface area and selected multifaceted surface properties. Graphene derivatives may be functionalized, e.g., surface functionalized, for targeted delivery to mitochondria and/or a specific cell type. CNTs have been used successfully in hair colorants and cosmetic hair care formulations.
  • Nanodiamonds have been shown to provide high affinity to biomolecules, biocompatibility, and non- or low-cytotoxicity. Nanodiamonds, quantum dots, and magnetic nanoparticles may be conjugated with the compounds disclosed herein for targeted delivery. Certain MNP may be designed to encapsulate the compounds disclosed herein.
  • QDs are generally formed of a semiconductive core layered by a shell designed to provide selected physical and chemical characteristics. MNPs are formed of a magnetic core, such as an iron oxide material core, and surface coating designed to improve stability and biocompatibility in physiological environments. Thus, MNPs and QDs are highly adaptable for their selected use.
  • Liposome based delivery vehicles are typically formed of enclosed spherical vesicles composed of a lipid bilayer with an internal bilayer and internal aqueous core region.
  • the liposome may have a unilamellar or multilamellar structure.
  • Liposomes may be designed to have a surface chemistry effective for targeted delivery and/or controlled release delivery. For instance, engineered liposomes have shown improved cellular update and accumulation of a delivery compound in the mitochondria.
  • Antioxidants such as carotenoids, CoQlO, lycopene and agents such as vitamin A, E, and K, may be incorporated into liposomes to amplify physical and chemical stability.
  • Liposomes may be formulated with phosphatidylcholine to provide moisturizing properties to skin and hair care products.
  • Vegetable phospholipids and soya phospholipids may be used with topical formulations for their high content of esterified essential fatty acids. For example, when applied with an active agent, the barrier function of the skin is increased and water loss is decreased. It has been shown that certain liposomes have an effect on wrinkle reduction, decreasing efflorescence in acne treatment, and increasing skin smoothness.
  • Niosomes are vesicles having a bilayer structure composed of self-assembled hydrated nonionic surfactants. Niosomes may have cholesterol incorporated into their lipids or may be free of cholesterol. Niosomes may be formulated as multilamellar or unilamellar structures encapsulating the compounds disclosed herein by a membrane formed when the surfactant macromolecules are organized as a bilayer. Exemplary nonionic surfactants include spans, tweens, brijs, alkyl amides, sorbitan ester, crown ester, polyoxyethylene alkyl ether, and steroid- linked surfactants. Niosomes may encapsulate the compounds disclosed herein, providing prolonged systemic circulation and enhanced penetration into target tissue.
  • Niosomes in cosmetic and skin care applications provide skin penetration, increased stability of entrapped ingredients, and improved bioavailability of typically poorly adsorbed compounds.
  • Niosomes may be designed for a target application by controlling the nature and structure of surfactants, membrane composition, and temperature of hydration, which influences size and shape of the particle.
  • Specialized niosomes called proniosomes may be used.
  • Proniosomes are nonionic based surfactant vesicles which are hydrated immediately before use to yield aqueous noisome dispersions.
  • niosomes and proniosomes may be combined in a formulation.
  • Polymeric nanocarriers are generally formed of biodegradable polymers.
  • the polymeric nanocarriers may be reservoir type (nanocapsules in which compounds are dissolved/distributed in the core of the polymer), matrix type (nanospheres, in which compounds are entrapped in the polymer matrix), and combinations thereof.
  • Polymeric nanocarriers may offer the benefits of low toxicity, easy modification (for example, for targeted delivery), high drug loading capacity, small size, good aqueous solubility, and biocompatibility.
  • Exemplary polymeric nanocarriers for mitochondrial targeting include hydrophilic block polymer, such as polyethylene glycol (PEG), poly E-caprolactone (PCL).
  • Nanoparticles disclosed herein may be modified for mitochondrial targeting, such as by including surface hydrophilic block polymers (e.g., PEGylation).
  • Polymerosomes are artificial vesicles formed of self-assembling block copolymer amphiphiles. Polymerosomes typically have a hydrophilic core and lipophilic bilayer. Polymerosomes are highly customizable. Drug encapsulation and release capabilities may be controlled by forming the poly mero some with block copolymers that are biodegradable and/or responsive to stimuli.
  • composition and molecular weight of the polymerosome may be selected to control properties, such as, response to stimuli, membrane thickness, permeability, flexibility, and size (polymerosomes may be designed to have a radius from 50 nm to 5000 nm or more). Polymerosomes provide benefits, such as, improved skin elasticity and skin cell activation energy enhancement.
  • Cubosomes are nano structured particles formed from self-assembled liquid crystalline particles of aqueous lipids and surfactants. Cubosomes are formed of a bicontinuous liquid phase, enclosing two separate vesicles of aqueous formulations divided by a surfactant- controlled bilayer in a strongly packed structure. Cubosomes may be designed as a honeycombed structure having more than two separate vesicles. Release of each vesicle may be separately controlled. Cubosomes may provide benefits, such as, providing controlled and/or targeted release of the compounds, possessing lipid biodegradability, and having a high internal surface area with different drug-loading modalities.
  • Micelles are colloidal aggregates that are generally amphiphilic in nature, having a hydrophilic head and hydrophobic tail.
  • the size and shape of micelle nanoparticles may be selected by varying the solution’s isotonic strength, pH, temperature, and the nature of the amphiphilic molecule.
  • Micelles may be utilized to improve uptake of the compounds disclosed herein in mitochondria.
  • micelle formulations have been found to improve bioavailability of low absorption compounds, prevent mitochondrial swelling (indicating less mitochondrial permeability transition pore (mPTP) opening and prevention of injury), and protect cells from nitrosative stress, “Curcumin Micelles Improve Mitochondrial Function in Neuronal PC12 Cells and Brains of NMRI Mice - Impact on Bioavailability” (Hagl, 2015) (incorporated herein by reference in its entirety for all purposes).
  • Micelles may be functionalized with a targeting group, such as mitochondrial targeting TPP, MPP, or PEGyltaion.
  • micelle nanoparticles may be polymeric micelles.
  • Dendrimers are hyperbranched macromolecules which may be formed of sugars, amino acids, and/or nucleotides. Dendrimers are generally formed of a central core, repeated branches, and diverse peripheral groups. The peripheral groups may be designed or functionalized for a target application, such as targeted delivery. Benefits of dendrimers include the ability to provide drug encapsulation, high aqueous solubility, high retention time, biodegradability, specificity, low toxicity, and surface modification capabilities that may provide properties such as monodispersity, polyvalence, and stability. Dendrimers may be functionalized with a targeting group, such as TPP, MPP, or PEGylation. Dendrimers may be formulated to encapsulate the compound or conjugate to the compound.
  • a targeting group such as TPP, MPP, or PEGylation. Dendrimers may be formulated to encapsulate the compound or conjugate to the compound.
  • Lipophilic cations are positively charged ions that can penetrate the plasma and mitochondrial membranes. The lipophilic cations tend to accumulate in the mitochondria. Thus, lipophilic cations, such as TPP, dequalinum, and rhodamine 123, may be utilized for mitochondrial-targeted therapeutic delivery.
  • Delocalized lipophilic cations (DLC) have a strong mitochondrial targeting ability to cross the membrane and drive specific aggregation of attached moieties within the mitochondria of the cells.
  • DLCs may be utilized as nanoparticle carriers and/or as surface modifications for targeted delivery.
  • the compositions disclosed herein may be conjugated to a DLC, such as TPP, or encapsulated in another carrier having a TPP surface functionalization for targeted delivery.
  • Solid-lipid nanoparticles are sub-micron colloidal carriers in the range of 50 to 1000 nm, for example 50 to 500 nm or 50 to 100 nm.
  • SLNs are generally formed of physiological lipid disseminated in water or a liquid surfactant solution having an oil-based or lipoidal core.
  • SLNs may be prepared from complex glyceride mixtures, purified triglycerides, and waxes having phospholipid hydrophobic chains in the fat matrix.
  • SLNs provide benefits such as small size, large surface area, high drug loading capacity, and the contact of phases at the interface.
  • SLNs may be designed to provide controlled or sustained release of the compound. In cosmetics and pharmaceuticals, SLNs may provide increased penetration of the compounds disclosed herein through the skin.
  • SLNs may have ultraviolet (UV) resistant properties, occlusive properties which can be used to increase skin hydration, and good stability coalescence due to their solid nature, which reduces mobility and leakage of the active molecules.
  • Nano structured lipid carriers are a form of lipid nanoparticle formed by blending solid lipids with spatially incompatible liquid lipid compositions, forming an amorphous solid. NLCs may be of the imperfect type, amorphous type, or multiple type. NLC particles typically range in size from 10 nm to 1000 nm. When formulated from biodegradable and physiological lipids, NLCs show very little toxicity. Thus, NLC formulations may provide the benefits of reduced systemic side effects and higher drug loading capacity.
  • NLCs may be designed to have a biphasic drug release pattern. For example, a first compound release profile may be immediate or controlled release, and a second compound release profile may be controlled or delayed release. Like SLNs, NLCs may also provide increased penetration of the compounds disclosed herein through the skin, ultraviolet (UV) resistant properties, occlusive properties which can be used to increase skin hydration, and good stability coalescence.
  • UV ultraviolet
  • Nanoemulsions are kinetically and thermodynamically stable dispersions of liquid formed from an oil phase and a water phase in combination with a surfactant.
  • the nanoemulsions disclosed herein may be oil in water, water in oil, or bicontinuous formulations. Properties of nanoemulsions may be designed by controlling method of preparation. Nanoemulsions are typically dispersed phase, comprising small particles or droplets having low oil or water interfacial tension. Nanoemulsions are tupically formed of a lipophilic core surrounded by a monomolecular layer of phospholipids. Nanoemulsions provide benefits, such as, low viscosity, high kinetic stability, high interfacial area, high solubilization capacity, and increased rate of absorption. In cosmetic and pharmaceuticals, nanoemulsions may provide rapid penetration and active transport of active ingredients and hydration to the skin. Nanoemulsions may be formulated into foams, creams, sprays, or liquids.
  • Certain nanoparticle formulations such as SLNs, nanoemulsions, liposomes, and niosomes, may be used in moisturizing formulations, providing humectants that retain moisture for a prolonged period of time.
  • Metal nanoparticles may be designed to have specific properties and may be shaped as nanospheres, nanoshells, nanoclusters, nanorods, nanostars, nanocubes, branched, and nanotriangles. Shape, size, and dielectric properties of metal nanoparticles may have an effect on resonance frequency. Metal nanoparticles may be designed to have high drug loading capacity and effectively penetrate the cell wall by controlling size, surface area, and crystallinity. Benefits of metal nanoparticles include acceleration of blood circulation, anti-inflammatory properties, antiseptic properties, improvising firmness and elasticity of skin, delaying aging, and vitalizing skin metabolism. Exemplary metal nanoparticles are gold, silver, and copper.
  • metal nanoparticles have been shown to provide strong antifungal and/or antimicrobial properties.
  • Another exemplary metal nanoparticle is titanium dioxide (TiCh), which has been shown to provide protection from ultraviolet (UV) radiation.
  • Metal nanoparticles may be designed to be inert in nature, highly stable, biocompatible, and noncytotoxic. More than one metal may be used to form metal nanocomposites with selected properties.
  • Nanospheres are spherical nanoparticles having a core-shell structure.
  • the compounds may be encapsulated, conjugated, dissolved, or otherwise entrapped in the nanoparticle.
  • the nanospheres may be crystalline or amorphous structures.
  • the nanospheres may be biodegradable or nonbiodegradable.
  • Exemplary biodegradable biospheres include gelatin, modified starch, and albumin nanospheres.
  • One exemplary nonbiodegradable nanosphere is polylactic acid.
  • nanospheres may be used to deliver the compounds disclosed herein into a deep layer of the skin more precisely and efficiently. Nanospheres have been shown to provide protection against actinic aging.
  • Peptide-based nanomaterials are biomolecules made up of several amino acids linked by peptide bond. Peptides may generally provide rapid clearance in the kidney due to enzymatic degradation. Peptide nanomaterials may provide several benefits including targeting and accumulating capacity, small size, ease of production and customizability, and biocompatibility. Certain peptide nanomaterials may be designed to self-assemble into distinct shapes and sizes in response to environmental factors, such as temperature, pH, ionic strength, or molecular interaction between the host and peptide. Peptide nanoparticles may also be functionalized for targeted delivery. Functionalized peptides have been found to exhibit improved targetability and enhanced efficacy.
  • MPPs mitochondrial penetrating peptides
  • MPPs are cell penetrating peptides which can efficiently penetrate mitochondrial double membranes. MPPs are generally designed or selected to be positively charged peptides. Due to the strongly negative charge of mitochondrial membranes, positively charged peptides are capable of penetrating mitochondria. MPPs are described in more detail in “Mitochondrial targeted strategies and their application for cancer and other diseases treatment,” (Li, 2020), incorporated herein by reference in its entirety for all purposes. Thus, MPPs may be utilized as nanoparticle carriers and/or as surface modifications for targeted delivery. For instance, the compositions disclosed herein may be conjugated to an MPP or encapsulated in another carrier having an MPP surface functionalization for targeted delivery.
  • the formulations disclosed herein may comprise one or more skin penetration enhancer.
  • skin penetration enhancers Generally, small and moderately lipophilic molecules are likely to penetrate the skin barrier. Other compounds may require a suitable skin penetration enhancer to penetrate the barrier by either diminishing the barrier properties of the skin or actively driving movement of compounds across the skin with the input of external energy. Skin penetration enhancers are described in “Penetration Enhancement of Topical Formulations,” (Ng, 2018) and “Transdermal Delivery Systems in Cosmetics,” (Kim, 2020), each of which is incorporated herein by reference in its entirety for all purposes.
  • the nanoparticle delivery carriers disclosed herein may provide skin penetration enhancement for the compounds.
  • the formulations disclosed herein may additionally or alternatively contain one or more chemical or physical skin penetration enhancers.
  • exemplary chemical skin penetration enhancers include alcohols, such as, ethanol and glycol, sulfoxides, such as, dimethyl sulfoxide, laurocapram, pyrrolidones, dimethyl isosorbide, isopropyl myristate, propylene glycol, oleic acid, eucalyptol, water/aqua (hydration), surfactants, urea, fatty acids, fatty alcohols, and terpenes and/or terpenoids.
  • alcohols such as, ethanol and glycol
  • sulfoxides such as, dimethyl sulfoxide, laurocapram, pyrrolidones, dimethyl isosorbide
  • isopropyl myristate propylene glycol
  • oleic acid eucalyptol
  • Exemplary physical skin penetration enhancers include rollers, scrapers, scrubbers, exfoliators, microdermabrasion needles, iontophoresis devices, electroporation devices, ultrasound devices, such as sonophoresis, thermal ablation, magnetophoresis, photomechanical waves, electron beam irradiation, and low light therapy devices, such as light emitting diode (LED) sources.
  • Two or more skin penetration enhancers may be used in the formulation synergistically.
  • Chemical skin penetration enhancers may be included in dermatological, transdermal, cosmetic, and pharmaceutical products to enhance the dermal absorption of drug compounds. Chemical enhancers may enable or improve solubility, penetration, and/or absorption of the compounds disclosed herein. Exemplary chemical enhancers are described below.
  • Water (aqua) generally increases fluidity of the composition, providing higher permeability. Additionally, water hydrates the skin barrier, altering skin lipids and/or proteins for improved permeation. Hydrating compounds, such as glycerol and urea, may promote transdermal permeation by facilitating hydration of the stratum corneum and forming hydrophilic diffusion channels within the barrier.
  • Alcohol solvents such as ethanol and propylene glycol, may provide penetration enhancement by increasing fluidity of the compound and also act as good solvents. Degree of permeation may be selected by controlling alkyl chain length of fatty alcohols.
  • surfactants generally solubilize lipophilic agents, including active ingredients of the formulation as well as lipids within the stratum corneum. Thus, surfactants may enhance skin permeability by partitioning into the epithelial cell membranes and disrupting the packing of membrane lipids, forming structural defects that reduce membrane integrity.
  • the effect of the surfactant on skin permeation may be designed by selecting concentration and type of surfactant.
  • the surfactant may be anionic, cationic, or nonionic.
  • Anionic surfactants may be selected for skin or hair applications because they interact with keratin and lipids.
  • Cationic surfactants may be selected for skin applications because they interact with skin proteins via poler interactions. Non-ionic surfactants are generally less irritating to the skin and have better tolerability.
  • Fatty acids may increase percutaneous drug absorption.
  • Long-chain fatty acids which are carboxylic acids with typically long, unbranched aliphatic tails, have been demonstrated to increase percutaneous drug absorption as an effect of alkyl chain length.
  • Low molecular weight alkanols may act as solubilizers to enhance the solubility of the compound in the fatty matric of the stratum corneum.
  • Polyunsaturated fatty acids such as linoleic, alpha- linoleic, and arachidonic acids, may enhance the skin permeation.
  • One exemplary fatty acid chemical penetration enhancer is oleic acid. Oleic acid provides increased fluidity and reduced resistance toward the permeation of molecules.
  • Terpenes are hydrocarbons commonly found in plant extracts. Terpenoids are terpenes containing additional functional groups. One group of terpenes that may provide penetration enhancement are oxygen-containing terpenes. Exemplary oxygen containing terpenes include menthol, thymol, carvacrol, menthone, and cineole. Such terpenes may enhance penetration in a similar mechanism as alcohols. However, terpenes may be considered natural products. Benefits of terpenes include high percutaneous ability with minimal irritancy and toxicity.
  • the compounds of the disclosure may be formulated with a mitochondria-targeting agent.
  • exemplary mitochondrial targeting agents include antibodies, polymeric functional moieties, such as PEG, lipophilic cations, such as triphenylphosphine (TPP), and peptides such as mitochondrial targeting peptides (MPP).
  • the compounds of the disclosure may alternatively contain as pharmaceutically and/or cosmetically acceptable carriers substances as required to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents and the like, for example, sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc.
  • pharmaceutically and/or cosmetically acceptable carriers can be used which include, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, magnesium carbonate, and the like.
  • compositions of the disclosure can also be formulated as a solution, microemulsion, or other ordered structure suitable for high concentration of active ingredients.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof.
  • Proper fluidity for solutions can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of a desired particle size in the case of dispersible formulations, and by the use of surfactants.
  • compound(s) and compositions of the disclosure are administered in a time-release formulation, for example in a composition which includes a slow release polymer.
  • a time-release formulation for example in a composition which includes a slow release polymer.
  • Such compositions can be prepared with carriers that will protect against rapid release, for example a controlled release vehicle such as a polymer, microencapsulated delivery system or bioadhesive gel. Prolonged delivery, in various compositions of the invention can be brought about by including in the composition agents that delay absorption, for example, aluminum monosterate hydrogels and gelatin.
  • controlled release binders suitable for use in accordance with the invention include any biocompatible controlled-release material which is inert to the active agent and which is capable of incorporating the biologically active agent. Numerous such materials are known in the art.
  • Formulations suitable for topical administration include solutions, oils, creams, emulsions, and gels containing, in addition to the active ingredient, such carriers as are known in the art.
  • Topical formulations may be pharmaceutical or cosmetic formulations.
  • the compound is formulated as a shampoo, conditioner, spray, cream, gel, balm, body wash, soap, lotion, or make-up.
  • the compounds of the disclosure and compositions of the disclosure can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials, and can be stored in a freeze-dried (lyophilized) condition requiring only the addition of the sterile liquid excipient, for example, water, for injections, immediately prior to use.
  • Suitable unit doses i.e., effective amounts, may be determined during clinical trials designed appropriately for each of the conditions for which administration of a chosen compound is indicated and will, of course, vary depending on the desired clinical endpoint.
  • Extemporaneous injection solutions and suspensions can be prepared from sterile powders, granules, and tablets.
  • the requirements for effective pharmaceutically acceptable carriers for injectable compositions are well known to those of ordinary skill in the art.
  • formulations suitable for rectal administration may be presented as suppositories by mixing with a variety of bases such as emulsifying bases or water-soluble bases.
  • Formulations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams, or spray formulas containing, in addition to the active ingredient, such carriers as are known in the art to be appropriate.
  • compositions disclosed herein may be associated with a variety of natural products, and examples of such products are set out below.
  • the compositions disclosed herein may be formulated as a natural product.
  • the compositions disclosed herein may be administered in combination with a natural product.
  • the compositions disclosed herein may be incorporated in a natural product. These natural products may be comprised of formulations or compositions disclosed throughout this disclosure.
  • Natural products may be or comprise products for commercial purposes, and may refer to dietary supplements, and foods, e.g., food, food supplements, medical food, food additive, nutraceutical, or drink, produced from natural sources. Natural products may have pharmacological or biological activity that may be of therapeutic benefit, e.g., in treating disease or conditions. Natural products may be included in traditional medicines, treatments for cosmetological purposes, cosmetics, and spa treatments.
  • a natural product referred to herein may comprise any one or more of the components described as a natural product to be incorporated into a composition or formulation comprising one or more other components, e.g., excipients.
  • the preparation or formulation referred to as a natural product may comprise a natural product defined herein and one or more additional components or ingredients. Any of the compositions, preparations, or formulations discussed throughout this disclosure may be or comprise one or more natural products.
  • Suitable methods of administering a compound of the disclosure to a patient are available, and, although more than one route can be used to administer a particular compound, a particular route can provide a more immediate and more effective reaction than another route.
  • an emblica extract was prepared and analyzed by HPLC.
  • caplets containing E.officinalis extract (Himalaya Drug Company, Sugar Land, TX Lot 112000924; each caplet contains 250 mg fruit extract (45% tannins) and 350 mg powder stem (2% tannins)) was stirred with 250 ml methanol for 6 hours at room temperature.
  • the resulting solution was filtered to remove insoluble material and the methanol layer was stripped using a Rotovap (fraction 1).
  • the solid material resulting from the filtration step was stirred with an additional 250 ml of methanol for 4 hours at room temperature, filtered through to remove insoluble material and a filter funnel and the methanol layer was stripped using a Rotovap (fraction 2).
  • Fractions 1 and 2 were combined to obtain 8.25 grams of a dark, hydroscopic solid.
  • Table 5 Emblica Extract Compound Identification Standards. Standards were prepared by dissolving 1 mg of the standard in 1 ml methanol, sonicating the solution, and adding the solution to a 2 ml vial. Samples were subject to analytical HPLC as described above and to validate purity. A combined standard solution was created by adding 100 ul of each standard to a separate 2 ml vial. The standards were used to identify components in the emblica extract.
  • Table 6 Compounds identified in emblica extract.
  • Example 2 Prophetic Example Showing in vivo Energy and Vitality Improving Effects of Application of Emblica Extract
  • the subjects will complete a baseline questionnaire of 10 closed questions with predefined options to be selected.
  • the questionnaire will request information relating to baseline energy levels and vitality.
  • Other baseline parameters will be measured for skin roughness (Ra, Rz) by DermaTOP (three-dimensional imaging of surface structure), skin hydration by Comeometer (Courage & Khazaka, Cologne, Germany) (electrical capacitance measurement), and skin elasticity by Cutometer (optical measurement of skin displacement during 300 mbar suction).
  • the subjects will apply emblica extract (2-5 drops of emblica extract oil) or placebo twice daily topically to one side of the face for approximately 12 weeks.
  • the study will be performed in a split-face design.
  • Anti-wrinkling properties will be measured periorbitally in the region of crowfeet. Skin moisturizing effects will be evaluated on the bones of the cheeks. Effect of the emblica extract will be compared to the reference product or placebo.
  • Subjects will complete a final questionnaire at completion of the study.
  • the final questionnaire will request information relating to baseline energy levels and vitality. Skin roughness (Ra, Rz), skin hydration, and skin elasticity will also be measured at the completion of the study. Baseline results will be compared to final results.
  • emblica extract will improve energy levels and vitality. It is also expected that administration of emblica extract will improve aging-associated parameters including skin roughness, skin hydration, skin elasticity, and additional qualitative parameters measured by the questionnaire.
  • Example 3 Restoration of mitochondrial DNA depletion and function and suppression of inflammation by emblica extract in vivo
  • the shaved dorsal skin of 8-9 weeks old female C57BL/6 control and mtDNA-depleter mice (expressing DI 135A-POLG1) were treated topically with 200 pl of 50 mg/ml emblica extract ointment (prepared as described in the Methods section) or a corresponding amount of the control ointment (lacking emblica extract) daily beginning 1 week prior to the start of dox administration (200 mg/kg diet only) and continuing daily applications for 16 weeks (112 days).
  • the skin of mtDNA depleter mice showed increase in dermal and peri-appendageal mixed inflammatory cells, including mast cells, neutrophils and lymphocytes.
  • MPO +ve cells MPO +ve cells
  • Example 4 Restoration of mitochondrial DNA depletion, as evidenced by reversal of wrinkled skin and loss of hair by fucus extract in vivo
  • Emblica extract, components thereof, fucus extract, and related compounds were tested in vitro for induced expression of mitochondrial biogenesis regulatory proteins including mitochondrial complex IV subunit 2 (COXII), mitochondrial transcript factor A (TFAM), and peroxisome proliferator- activated receptor gamma coactivator 1 -alpha (PGC-la) at timepoints of 6 hours, 24 hours, and 48 hours post-administration.
  • COXII mitochondrial complex IV subunit 2
  • TFAM mitochondrial transcript factor A
  • POC-la peroxisome proliferator- activated receptor gamma coactivator 1 -alpha
  • compositions showed increased expression of the proteins as compared to a DMSO reference. Expression generally increased with increasing time.
  • Emblica extract was tested in vitro for induced expression of mitochondrial biogenesis regulatory proteins including mitochondrial complex IV subunit 2 (COXII), mitochondrial transcript factor A (TFAM), and peroxisome proliferator- activated receptor gamma coactivator 1-alpha (PGC-la) at timepoints of 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, and 96 hours post-administration, generally as described in previous examples.
  • Formulations of 0.01%, 0.05%, 0.1% and 0.2% emblica extract were tested. The results are presented in the graphs of FIGS. 6A- 6F (COXII expression), 7A-7F (TFAM expression), and 8A-8F (PCG-la expression). The general trend is that certain formulations induced greater expression after 96 hours than at earlier timepoints.
  • FIGS. 9A- 9D show COXII expression at 6 hours after administration of a nonencapsulated composition.
  • FIG. 9B shows COXII expression at 6 hours after administration of a nanoencapsulated composition.
  • FIG. 9C shows COXII expression at 24 hours after administration of a non-encapsulated composition.
  • FIG. 9D shows COXII expression at 24 hours after administration of a nanoencapsulated composition.
  • emblica extract Selected constituents of emblica extract were tested in vitro for induced expression of mitochondrial biogenesis regulatory proteins including COXII and TFAM at timepoints of 6, 12, 24, and 48 hours post-administration, generally as described in previous examples. Formulations of varying concentrations were tested. The results are presented in the graphs of FIGS. 10A through 22D. Briefly, chebulagic acid, chebulinic acid, kaempferol, ellagic acid, ascorbic acid, citric acid, gallic acid, quercetin, punicalagin were tested at concentrations ranging from 2.5 pM to 100 p M for induced expression of the target proteins.
  • Emblica extract and chebulinic acid formulations and nanoencapsulated chebulinic acid formulations were tested in vitro for induced expression of mitochondrial biogenesis regulatory proteins COXII and TFAM at timepoints of 6, 12, 18, and 24 hours post-administration, generally as described in Example 4.
  • Formulations of varying concentrations were tested. The results are presented in the graphs of FIGS. 23A-23D (COXII) and 24A-24D (TFAM).
  • D1135A-POLG1 site-directed mutation was created in the full-length human POLG1 complementary DNA (cDNA) using the site-directed mutagenesis kit (Agilent, Santa Clara, CA, USA).
  • the primer sequences used for site-directed mutagenesis are as follows, with the mutated site in upper case: D1135A_F:5'-gcatcagcatccatgCGgaggttcgctacctgg-3' and D1135A_R:5'- ccaggtagcgaacctcCGcatggatgctgatgc-3'. Mutations were confirmed by sequencing.
  • D1135A- P0LG1 cDNA was subcloned into the dox-inducible mammalian expression vector, pTRE- Tight-BI-AcGFPl (Clontech, Palo Alto, CA, USA).
  • pTRE- Tight-BI-AcGFPl Clontech, Palo Alto, CA, USA.
  • Potential founders were identified by screening genomic DNA from tail biopsies for the presence of the human Polgl transgene using the PCR.
  • the heterozygous human POLG1 -positive (+/POLG1- DN + ) founder male mice were mated with CAG-rtTA3 (rtTA) C57BL/6 female mice (Jackson Laboratories, stock no. 016532) to obtain +/POLG1-DN + rtTA + heterozygous transgenic mice.
  • the +/POLG1-DN + rtTA + heterozygous mice were intercrossed to generate homozygous POLG1-DN + rtTA + /POLGl-DN + rtTA + mice (mtDNA-depleter mice).
  • mice were given dox in diet (200 mg/kg diet) and water (2 mg/ml dox in 5% sucrose water) ad libitum. All animal experiments were conducted by following guidelines established by the Institutional Animal Care and Use Committee.
  • Skin from the dorsal side as well as other tissues was fixed in buffered formalin, embedded in paraffin, sectioned (5 pM), and stained with hematoxylin and eosin. Skin sections were stained with Giemsa stain to detect mast cells, while MPO, CD3, CD163, and Pax-5 antibodies were used for detection of other types of inflammatory cells by immunohistochemical analyses (Carson, et al., Histotechnology: A Self-Instruction Text, 3 ed., American Society for Clinical Pathology Press, Hong Kong, 2009).
  • RNA from the skin samples was isolated using Trizol (Invitrogen, Carlsbad, CA, USA). Approximately, 1000- 2000 ng RNA was normalized across samples, and cDNA was generated using the Iscript cDNA synthesis kit (Bio-Rad Laboratories, Hercules, CA, USA). cDNA was then subjected to RT-PCR using Green Taq PCR mixture (Promega, Madison, WI, USA) and gene-specific primers as given in Table 1 below. PCR products were run on 1.5 to 2% agarose gel and photographed using gel documentation system. At least three biological replicates were used in each PCR. P2- Microglobulin or RNU6B was used as an internal control in each PCR.
  • mtDNA content analyses in the skin and other tissues were carried out as reported earlier (Singh et al., PloS One, 10, e0139846, 2015). Briefly, the mtDNA content was analyzed by realtime PCR by absolute quantification with the following primers: mMitoF: 5'- CTAGAAACCCCGAAACCAAA-3', mMitoR: 5'-CCAGCTATCACCAAGCTCGT-3', mB2MF: 5'-ATGGGAAGCCGAACATACTG-3', and mB2MR: 5'- CAGTCTCAGTGGGGGTGAAT -3'. Beta-2-Microglobulin (B2M) was used as an internal control.
  • mMitoF 5'- CTAGAAACCCCGAAACCAAA-3'
  • mMitoR 5'-CCAGCTATCACCAAGCTCGT-3'
  • mB2MF 5'-ATGGGAAGCCGAACATACTG-3'
  • mB2MR 5
  • RNA samples were extracted from POLG1 D1135A expressing MCF-7 cells after 5 days of dox induction and from the cells grown in the absence of dox for 5 days by Trizol extraction method (Invitrogen). Illumina human microarray gene expression analysis was performed with total RNA samples as described earlier.
  • Mitochondrial isolation was carried out as previously described (Johnstone et al., J Biol Chem, 277, 42197-42204, 2002).
  • Blue- Native polyacrylamide gel electrophoresis (BN-PAGE) was performed with mitochondrial fractions prepared from the skin samples as described previously (Schagger et al., Mehtods Enzymol, 260, 190-202, 1995). Protein expression of mitochondrial OXPHOS subunits in the skin samples was carried out following standard immunoblots.
  • VDAC Voltage-dependent anion channel
  • P-actin antibodies were used as loading controls.
  • Isolated mitochondria were used for the measurement of enzymatic activities of OXPHOS complexes as previously described (Owens et al., PloS One, 6, e23846, 2011).
  • Skin fibroblasts from wild-type C57BL/6 (control cells) and mtDNA-depleter mice containing the D1135A-POLG1 site-directed mutation (POLG1-DN cells) were generated and spontaneously immortalized as described (Todaro et al., J Cell Biol, 17, 299-313 (1963). These cells were maintained in DMEM/F12 (Cellgro, Herndon, VA) supplemented with 10% FBS (Atlanta Biologicals, Lawrenceville, GA). To induce POLG1-DN expression in skin fibroblasts, 1 pg/ml dox dissolved in water was added to the cells in culture and after 6 days of incubation, cells were washed with PBS and collected in Trizol for isolation of total RNA.
  • MTT assays were carried out as described previously (Ronghe et al., J Steroid Biochem Mol Biol, 144 PtB, 500-512, 2014). Both control and POLG1-DN cells were first treated with dox (1 pg/ml) for 3 days and then cells were plated at a density of 3000 cells/well in 96 well plate with or without dox (1 pg/ml) containing culture media. Readings were taken at every 24 hours.
  • Emblica officinalis was obtained from commercially available caplets (Himalaya Drug Company, Sugar Land, TX). Each caplet contains 600 mg (250 mg fruit extract (45% tannins), 350 mg powder stem (2% tannins). Caplets were ground and dissolved in sterile water to make 100 mg/ml solution and then filtered. The emblica solution was then mixed with an appropriate ointment base for topical application.
  • Suitable ointment bases include, but are not limited to, dermabase ointment (MARCELLE®; water, mineral oil, propylene glycol, stearyl alcohol, cetyl esters, cetyl alcohol, glyceryl stearate, sodium lauryl sulfate, lecithin, and methylparaben) and 1:1 w/v) and Geritrex hydrophilic ointment (NDC 54162-670-14).
  • the ointment base and emblica solution may be added at any convenient ratio, for example from 1:5 w/v emblica solution to ointment base to 5:1 w/v emblica solution to ointment base.
  • the ointment base and emblica solution may be added at a 1:1 w/v ratio emblica solution to ointment base.
  • Fucus vesiculosus also known as bladder wrack, black tang, rockweed, bladder fucus, sea oak, cut weed, dyers fucus, red fucus, and rock wrack
  • An aqueous solution (100 mg/ml) solution was prepared from the fucus powder and filtered. The fucus solution was then mixed with an appropriate ointment base for topical application.
  • Suitable ointment bases include, but are not limited to, dermabase ointment (MARCELLE®; water, mineral oil, propylene glycol, stearyl alcohol, cetyl esters, cetyl alcohol, glyceryl stearate, sodium lauryl sulfate, lecithin, and methylparaben) and 1:1 w/v) and Geritrex hydrophilic ointment (NDC 54162-670-14).
  • the ointment base and fucus solution may be added at any convenient ratio, for example from 1:5 w/v fucus solution to ointment base to 5:1 w/v fucus solution to ointment base.
  • the ointment base and fucus solution may be added at a 1:1 w/v ratio fucus solution to ointment base.
  • the dorsal skin of the mice was depilated (for example, shaved under low-dose isoflurane inhalation anesthesia) approximately 2 days before initiation of administration of a composition to the skin.
  • Various active compositions and control compositions were applied topically to the dorsal skin daily as described. The skin of the mice was depilated prior to collection and analysis.
  • Emblica extract ointment at a concentration of 100 mg/mL aqueous solution was applied topically each day to a defined shaved area of the dorsal skin of the mice.
  • Control compositions comprised the same amount of ointment base without addition of emblica extract.
  • Fucus extract ointment at a concentration of 100 mg/mL aqueous solution was applied topically each day to a defined shaved area of the dorsal skin of the mice.
  • Control compositions comprised the same amount of ointment base without addition of fucus extract.
  • mtDNA-depleter mice (containing the D1135A-POLG1 mutation) as well as wild-type C57BL/6 mice (control) were used in the prevention and therapeutic experiments.
  • mice were given dox in diet (200 mg/kg diet) and water (2 mg/ml dox in 5% sucrose water) ad libitum for Examples 1 to 13 and mice were given dox in diet (2 mg/kg diet) and water (2 mg/ml dox in 5% sucrose water) ad libitum for Examples 14 to 15.
  • dox in diet 200 mg/kg diet
  • water 2 mg/ml dox in 5% sucrose water
  • mice were given dox in diet (2 mg/kg diet) and water (2 mg/ml dox in 5% sucrose water) ad libitum for Examples 14 to 15.
  • FIG. 3 Schematics of both preventive and therapeutic in vivo experiments are shown in FIG. 3, noting that in certain experiments in Examples 3-5 the time course of emblica extract or fucus extract administration continued beyond the end of the time periods specified in FIG. 3 (i.e., up to 112 days).
  • the term “plurality” refers to two or more items or components.
  • the terms “comprising,” “including,” “carrying,” “having,” “containing,” and “involving,” whether in the written description or the claims and the like, are open-ended terms, i.e., to mean “including but not limited to.” Thus, the use of such terms is meant to encompass the items listed thereafter, and equivalents thereof, as well as additional items. Only the transitional phrases “consisting of’ and “consisting essentially of,” are closed or semi-closed transitional phrases, respectively, with respect to the claims.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Natural Medicines & Medicinal Plants (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • General Health & Medical Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Botany (AREA)
  • Medical Informatics (AREA)
  • Alternative & Traditional Medicine (AREA)
  • Molecular Biology (AREA)
  • Reproductive Health (AREA)
  • Dermatology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pregnancy & Childbirth (AREA)
  • Gerontology & Geriatric Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Endocrinology (AREA)
  • Birds (AREA)
  • Gynecology & Obstetrics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Medicines Containing Plant Substances (AREA)
  • Medicinal Preparation (AREA)
  • Cosmetics (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Coloring Foods And Improving Nutritive Qualities (AREA)
PCT/US2022/042799 2021-09-07 2022-09-07 Compositions and methods for treating ovarian aging, ovarian diseases and conditions, and symptoms thereof Ceased WO2023038999A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP22868016.1A EP4398921A4 (en) 2021-09-07 2022-09-07 COMPOSITIONS AND METHODS FOR THE TREATMENT OF OVARIAN AGING, OVARIAN DISEASES AND CONDITIONS, AND THEIR SYMPTOMS
US18/690,132 US20250017992A1 (en) 2021-09-07 2022-09-07 Compositions and methods for treating ovarian aging, ovarian diseases and conditions, and symptoms thereof
JP2024515109A JP2024534952A (ja) 2021-09-07 2022-09-07 卵巣老化、卵巣疾患および状態、ならびにその症状を処置するための組成物および方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US202163241429P 2021-09-07 2021-09-07
US63/241,429 2021-09-07

Publications (1)

Publication Number Publication Date
WO2023038999A1 true WO2023038999A1 (en) 2023-03-16

Family

ID=85506938

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/042799 Ceased WO2023038999A1 (en) 2021-09-07 2022-09-07 Compositions and methods for treating ovarian aging, ovarian diseases and conditions, and symptoms thereof

Country Status (4)

Country Link
US (1) US20250017992A1 (https=)
EP (1) EP4398921A4 (https=)
JP (1) JP2024534952A (https=)
WO (1) WO2023038999A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116798634A (zh) * 2023-08-25 2023-09-22 北京大学深圳医院 一种fsh启动剂量预测系统、电子设备及存储介质
CN119112879A (zh) * 2024-09-26 2024-12-13 郑州大学第一附属医院 尿石素a在制备延缓卵巢衰老药物或保健食品中的应用

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2010059186A (ja) * 2007-11-21 2010-03-18 Kracie Seiyaku Kk アロマターゼ阻害剤
US20120316130A1 (en) * 2005-07-29 2012-12-13 Concourse Health Sciences Llc Compositions and methods for treating estrogen-dependent diseases and conditions
US20150132853A1 (en) * 1999-06-30 2015-05-14 Advanced Cell Technology, Inc. Cytoplasmic transfer to de-differentiate recipient cells
US20180008657A1 (en) * 2015-11-30 2018-01-11 Taiwan Mitochondrion Applied Technology Co.,Ltd. Use of emblica extract in preparing pharmaceutical composition for protecting mitochondria in retina
TW201834678A (zh) * 2017-03-24 2018-10-01 台灣粒線體應用技術股份有限公司 餘甘子萃取物用於製備增加血液中的gdf11之醫藥組合物的用途
US20200054682A1 (en) * 2018-08-14 2020-02-20 Imel Biotherapeutics, Inc. Methods and compositions for treating mitochondrial disease or disorders and heteroplasmy

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7776915B2 (en) * 2005-03-24 2010-08-17 Tracie Martyn International, Llc Topical formulations and methods of use
US20070065396A1 (en) * 2005-09-21 2007-03-22 Tracie Martyn International, Llc Topical macqui berry formulation
US8212076B2 (en) * 2006-08-04 2012-07-03 Covalence, Inc. Prevention of cellular senescence in mammals by natural peptide complexes

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150132853A1 (en) * 1999-06-30 2015-05-14 Advanced Cell Technology, Inc. Cytoplasmic transfer to de-differentiate recipient cells
US20120316130A1 (en) * 2005-07-29 2012-12-13 Concourse Health Sciences Llc Compositions and methods for treating estrogen-dependent diseases and conditions
JP2010059186A (ja) * 2007-11-21 2010-03-18 Kracie Seiyaku Kk アロマターゼ阻害剤
US20180008657A1 (en) * 2015-11-30 2018-01-11 Taiwan Mitochondrion Applied Technology Co.,Ltd. Use of emblica extract in preparing pharmaceutical composition for protecting mitochondria in retina
TW201834678A (zh) * 2017-03-24 2018-10-01 台灣粒線體應用技術股份有限公司 餘甘子萃取物用於製備增加血液中的gdf11之醫藥組合物的用途
US20200054682A1 (en) * 2018-08-14 2020-02-20 Imel Biotherapeutics, Inc. Methods and compositions for treating mitochondrial disease or disorders and heteroplasmy

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ANONYMOUS: "Mitochondrial DNA", WIKIPEDIA, 24 June 2021 (2021-06-24), XP093047426, Retrieved from the Internet <URL:https://en.wikipedia.org/w/index.php?title=Mitochondrial_DNA&oldid=1030181313> [retrieved on 20230516] *
See also references of EP4398921A4 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116798634A (zh) * 2023-08-25 2023-09-22 北京大学深圳医院 一种fsh启动剂量预测系统、电子设备及存储介质
CN116798634B (zh) * 2023-08-25 2023-11-21 北京大学深圳医院 一种fsh启动剂量预测系统、电子设备及存储介质
CN119112879A (zh) * 2024-09-26 2024-12-13 郑州大学第一附属医院 尿石素a在制备延缓卵巢衰老药物或保健食品中的应用

Also Published As

Publication number Publication date
JP2024534952A (ja) 2024-09-26
US20250017992A1 (en) 2025-01-16
EP4398921A4 (en) 2025-08-27
EP4398921A1 (en) 2024-07-17

Similar Documents

Publication Publication Date Title
US20240189218A1 (en) Compositions and methods for improving mitochondrial function
Wolf et al. Influences of opioids and nanoparticles on in vitro wound healing models
US20230149493A1 (en) Compositions and methods for treating covid-19 and symptoms thereof
RU2491917C2 (ru) Наноэмульсия
CN104755075B (zh) 非那雄胺和米诺地尔聚合物纳米粒子、其制备方法、药物组合物及其用途
TWI257303B (en) A method for enhancing protective cellular responses to genotoxic stress in skin
US20250017992A1 (en) Compositions and methods for treating ovarian aging, ovarian diseases and conditions, and symptoms thereof
TW201532621A (zh) 抗氧化劑組成物及其使用方法
JP6058263B2 (ja) 癌細胞においてアポトーシスを誘導する方法および使用
JP2009543799A (ja) 6,9−二置換プリン誘導体および皮膚を処置するためのその使用
WO2021164210A1 (zh) 没食子酸衍生物防治动脉粥样硬化疾病的应用
CN105168008A (zh) 抗皱用组合物和皮肤外用组合物
JP5685315B2 (ja) ニコチン酸アデニンディヌクレオチドリン酸又はその誘導体を含む薬学又は化粧料組成物
KR20200136928A (ko) 테트라셀미스 추출물
KR20250170060A (ko) 가압 나노에멀젼
KR101461625B1 (ko) 16-히드록시헥사데카노익 피토스핑고신을 유효성분으로 포함하는 피부장벽 손상의 개선 또는 치료, 또는 피부장벽 기능의 개선 또는 강화용 조성물
CN115400129A (zh) 细胞衰老表型改变用或皮肤老化防止用组合物
US20240225985A1 (en) Brightening compositions and methods of use
HK40102196A (zh) 用於改善线粒体功能的组合物和方法
WO2025064867A1 (en) Delivery system for mitochondrial health enhancers
WO2026072898A1 (en) Compositions and methods for wound and scar healing
WO2025064872A1 (en) Conjugate compounds for enhancement of mitochondrial health
EP3677256A1 (en) Method for treating a neurodegenerative disorder with a substituted phenyl-propenal moitey
CN107614060A (zh) 皮肤状况的治疗
JPWO2010137335A1 (ja) α−リポ酸ナノ粒子を含有する、ターンオーバー促進用組成物

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22868016

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2024515109

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2022868016

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022868016

Country of ref document: EP

Effective date: 20240408