WO2023034232A1 - Agent thérapeutique à petites molécules pour l'ataxie de friedreich et la tauopathie - Google Patents

Agent thérapeutique à petites molécules pour l'ataxie de friedreich et la tauopathie Download PDF

Info

Publication number
WO2023034232A1
WO2023034232A1 PCT/US2022/041930 US2022041930W WO2023034232A1 WO 2023034232 A1 WO2023034232 A1 WO 2023034232A1 US 2022041930 W US2022041930 W US 2022041930W WO 2023034232 A1 WO2023034232 A1 WO 2023034232A1
Authority
WO
WIPO (PCT)
Prior art keywords
mirol
dmic60
mitochondrial
flies
dmiro
Prior art date
Application number
PCT/US2022/041930
Other languages
English (en)
Inventor
Xinnan Wang
Li Li
Vinita BHARAT
Chung-Han Hsieh
Original Assignee
The Board Of Trustees Of The Leland Stanford Junior University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Board Of Trustees Of The Leland Stanford Junior University filed Critical The Board Of Trustees Of The Leland Stanford Junior University
Publication of WO2023034232A1 publication Critical patent/WO2023034232A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings

Definitions

  • Mitochondria are a vital organelle to support neuronal function and survival. Emerging evidence has revealed mitochondrial malfunction in a broad spectrum of neurological disorders.
  • One such neurological condition is tauopathy, which is shared by multiple neurodegenerative diseases such as Alzheimer’s disease (AD), progressive supranuclear palsy (PSP), frontal temporal lobar degeneration (FTLD), and parkinsonism, tauopathy is featured with intracellular neurofibrillary tangles.
  • the main constituent of those neurofilaments is tau protein, which is encoded by MAPT gene. Mutations in MAPT gene result in production of abnormal tau protein and promote tangle formation. Therefore, pathogenic MAPT mutations are detrimental to neuronal integrity and function.
  • Mitochondria are vital organelles to support cellular functions and survival, and their activities decline with age and in diseases. Mitochondrial biochemical reactions are compartmentalized by the extraordinarly organized double membranes.
  • the inner mitochondrial membranes (IMM) protrude into the matrix to form cristae, which house key protein complexes of the electron transport chain (ETC) for ATP synthesis.
  • ETC electron transport chain
  • a recently described mitochondrial contact site and cristae organizing system (MICOS) in the inner mitochondrial membrane is crucial for the formation and maintenance of cristae structure.
  • ROS reactive oxygen species
  • the ideal protein targets of intramitochondrial ROS modification for delivering redox signals to the cytosol are mitochondrial membrane proteins.
  • the two membranes of mitochondria are closely apposed and separated by the narrow intermembrane space (IMS).
  • IMS intermembrane space
  • OMM outer mitochondrial membranes
  • Methods and compositions are provided for treatment of Friedreich’s Ataxia (FA).
  • FA Friedreich’s Ataxia
  • a method is provided for treating FA by disrupting the MIC60-Miro interaction, or reducing undesirable levels of Miro or MICOS components, e.g. MIC60, in a cell having depolarized or otherwise damaged mitochondria.
  • the cell is in vivo, e.g. in an animal model for FA, in an individual diagnosed with FA, in a clinical trial for treatment of FA, and the like.
  • an effective dose of an agent herein termed a “Mirol reducer” is administered to an individual, or contacted with a cell population.
  • a Mirol reducer is determined to have activity in a Mirol assay as described herein.
  • methods and compositions are provided for monitoring, treatment, and drug screening for tauopathies, including without limitation tauopathy caused by a mutation in the MAPT gene. It is shown herein that that there are impairments in several mitochondrial behaviors in cells from MAPT patients. In particular the mitochondrial protein Mirol provides a disease marker and a target for pathogenic MAPT patients. Mutations in MAPT gene cause multiple neurological disorders, including frontal temporal lobar degeneration and parkinsonism. Using MAPT patients’ fibroblasts, it is shown that disease-causing MAPT mutations compromise early events of mitophagy.
  • a failure to relocate LRRK2 or Parkin to damaged mitochondria disrupts the following removal of Mirol or Mitofusin2.
  • Mirol ratio (mean Mirol intensity with depolarization divided by that with control) was significantly higher in MAPT patients than in healthy controls. The data indicate that mitochondrial depolarization causes the separation of mitochondria and ER contact, which is essential for the following mitophagy. Blocking their dissociation, as seen in MAPT fibroblasts can lead to mitophagy impairment.
  • a novel signal transduction pathway of intramitochondrial oxidation is disclosed herein.
  • the redox status of the matrix is transmitted through the oxidative structural change of a protein complex bridging the mitochondrial double membranes, which ultimately elicits adverse cellular responses.
  • Miro receives cellular instructions from the inside of the mitochondria rather than from the outside. This mechanism places mitochondrial membrane complexes at the central intersection to relay commands from both internal and external mitochondria to guide mitochondrial behaviors.
  • Redox-dependent regulation is shown for the protein MIC60, which interacts with MIRO.
  • MIC60 itself interacts with a myriad of proteins in the IMS and on the OMM, and associates in multiple complexes.
  • the present disclosure provides targets and approaches to antagonize the unfavorable effect by ROS on the MIC60-Miro complex during FA, without disrupting the favorable functions of ROS, by disrupting the MIC60- Miro interaction, or reducing undesirable levels of Miro or MICOS components, e.g. MIC60.
  • aspects of the methods of the disclosure may comprise administering an effective dose of an agent that reduces levels of Miro 1 , herein termed a Mirol reducer, to a subject having Friedreich’s Ataxia or tauopathy, e.g. associated with a MAPT mutation.
  • an agent that reduces levels of Miro 1 herein termed a Mirol reducer
  • a pharmaceutical composition comprising an effective dose of Mirol reducer is provided, which dose may be sufficient to achieve a therapeutic level of Mirol of at least 1 p.M, at least 5 p.M, at least 10
  • a unit dose may be, for example, at least 1 pig/kg, at least 10 pig/kg, at least 100 pig/kg, at least 500 pig/kg, up to 1 mg/ kg, up to 5 mg/kg, up to 10 mg/kg, up to 50 mg/kg, up to 100 mg/kg, or more.
  • the Mirol reducer is administered to the midbrain and/or putamen of the individual.
  • a Mirol reducer is a compound of structure I: a salt thereof, a prodrug thereof, or a derivative thereof, wherein:
  • A is an imidazole group or a dimethylamine group
  • R is H or methyl; n is 1 or 2; each X is independently selected from methyl, F, Cl, Br, and I; and
  • the Mirol reducer has the structure of MR3, MR4, or MR5:
  • the Mirol reducer is a compound of formula (I) or a salt thereof.
  • the Mirol reducer is a compound of formula (I) or a prodrug thereof.
  • the Mirol reducer is a compound of formula (II):
  • X is F, Cl, Br, or I.
  • a Mirol reducer is provided in a prodrug form.
  • “Prodrug” refers to a derivative of an active agent that requires a transformation within the body to release the active agent. In certain embodiments, the transformation is an enzymatic transformation. Prodrugs are frequently, although not necessarily, pharmacologically inactive until converted to the active agent. “Promoiety” refers to a form of protecting group that, when used to mask a functional group within an active agent, converts the active agent into a prodrug. In some cases, the promoiety will be attached to the drug via bond(s) that are cleaved by enzymatic or non- enzymatic means in vivo.
  • any convenient prodrug forms of the subject compounds can be prepared, e.g., according to the strategies and methods described by Rautio et al. (“Prodrugs: design and clinical applications”, Nature Reviews Drug Discovery 7, 255-270 (February 2008)).
  • the promoiety is attached to the carboxylic acid group of the subject compounds.
  • the promoiety is an acyl or substituted acyl group.
  • the promoiety is an alkyl or substituted alkyl group, e.g., that forms an ester when attached to the carboxylic acid group of the subject compounds.
  • a Mirol reducer, prodrugs, stereoisomers or salts thereof are provided in the form of a solvate (e.g., a hydrate).
  • solvate refers to a complex or aggregate formed by one or more molecules of a solute, e.g. a prodrug or a pharmaceutically-acceptable salt thereof, and one or more molecules of a solvent.
  • Such solvates are typically crystalline solids having a substantially fixed molar ratio of solute and solvent.
  • Representative solvents include by way of example, water, methanol, ethanol, isopropanol, acetic acid, and the like. When the solvent is water, the solvate formed is a hydrate.
  • aspects of the methods include administering a Mirol reducer to a subject having tauopathy. Also provided are companion diagnostic assays to determine if a subject is suitable for treatment with a Mirol reducer due to a Mirol phenotype associated with tauopathy.
  • a Mirol assay is performed by contacting a population of cells with an agent that damages mitochondria.
  • the agent is a mitochondria-specific uncoupler, e.g. a protonophore.
  • Agents suitable for this purpose include FCCP, CCCP, DNP, BAM15, etc., as known in the art. The cells are incubated for a period of time sufficient to depolarize mitochondria and initiate clearance, e.g.
  • the cells are lysed and assessed for levels of Mirol .
  • the cells are lysed and an affinity assay is performed on the lysate to detect levels of Mirol protein.
  • affinity agent specific for Mirol e.g. a Mirol specific antibody, is utilized as a capture agent or as a detection agent, or both.
  • Suitable formats include, without limitation, immunoassays such as ELISA, RIA, EIA, FRET, etc.
  • ELISA immunoassay
  • RIA RIA
  • EIA EIA
  • FRET FRET
  • the presence of Mirol protein following mitochondrial depolarization is indicative of a tauopathy phenotype, while control cells degrade Mirol under these conditions.
  • a Mirol assay as described above is utilized for the diagnosis and clinical monitoring of movement disorders, which diseases include, without limitation, tauopathy.
  • the methods of the invention are used in determining the efficacy of a therapy for treatment of a movement disorder, e.g. in vitro, such as drug screening assays and the like; at an individual level; in the analysis of a group of patients, e.g. in a clinical trial format; etc.
  • Clinical trial embodiments may involve the comparison of two or more time points for a patient or group of patients. The patient status is expected to differ between the two time points as the result of administration of a therapeutic agent, therapeutic regimen, or challenge with a diseaseinducing agent to a patient undergoing treatment.
  • the response of a patient with a movement disorder to therapy is assessed by detecting the ability of a cell sample from a patient, including without limitation a fibroblast sample, to degrade Mirol after mitochondria damage, e.g. mitochondrial depolarization.
  • Mirol degradation may be monitored in a variety of ways. Conveniently, the removal of Mirol is detected in a patient sample by an immunoassay, such as ELISA or other high throughput affinity assays.
  • FIGS. 1A-1 M dMIC60 Is Oxidized and Binds to Miro in a Redox-Dependent Manner, (a- f) Wild-type flies (w , , ,s ) (a-e), or flies with indicated genotypes (f), were treated with the reducing agent DTT, the non-reducing agent PEG-MAL (PEG) or AMS, or by the indirect thiol trapping assay, and blotted with anti-dMIC60. H 2 O 2 was fed at day 1 for 24 hrs.
  • the FRET images are color-coded colocalized FRET.
  • colocalized FRET index is calculated from 68 and 88 neurons from 17 and 22 brain regions from 5 and 6 brains for H 2 Oand H 2 O 2 , respectively. Mann-Whitney Test. * p ⁇ 0.05. Scale bars: 20
  • FIGS. 2A-2E Mitochondrial Changes with Age.
  • 3-actin on the same blot, n.s.: not significant. n 4.
  • Genotype: Elav-GS>UAS-DMiro RNAl uninduced (RU-). n 5 (young) and 7 (old) fly brains. Scale bar: 200
  • FIGS. 3A-3I Dissociating the DMiro-dMIC60 Interaction Benefits Fly Lifespan and Health-Span.
  • (e) Representative confocal images of TMRM staining (magenta) of fly brains expressing Mito-GFP (green) in DA neurons driven by TH-GAL4, with or without DMiro RNAi. The fluorescence intensity of TMRM is normalized to that of Mito- GFP within the same neuron cell body. n 20-38 neurons from 3-4 brains.
  • FIGS. 5A-5B DMiro RNAi Restores Cellular Respiration and Mitophagy.
  • (a) Seahorse analysis on ex vivo fly brains (Elav-GS>UAS-DMiro RNAl ) of different ages, with or without RU induction, as indicated. “RU-” flies were fed with the same volume of the vehicle, ethanol. n 7 brains.
  • Black arrows show the times of oligomycin and rotenone/antimycin injections, (b) Representative confocal single-section images, overlaying Mito-GFP (green), ubiquitin (red), and p62 (blue), of fly brains expressing Mito-GFP in DA neurons driven by TH-GAL4, with or without DMiro RNAi. Yellow arrow heads show Mito-GFP puncta that colocalize with p62, ubiquitin, or both. The colocalization coefficient is quantified for Mito-GFP versus ubiquitin, and Mito-GFP versus p62, respectively.
  • n 31 , 24, 19, 25 neurons for ubiquitin, and 32, 24, 19, 23 for p62 (from left to right) from 6 brains. Scale bar: 10 pm.
  • FIGS. 6A-6H a-Syn Expression or Frataxin Deficiency Impacts the DMiro-dMIC60 Complex
  • (a, g) Representative confocal stack images of MitoSox staining of fly brains as indicated.
  • n 4 independent experiments.
  • (e) The DA neuron number in the PPL1 clusters is quantified.
  • n 6 ( TH>dMIC60-WT), 8 (JH>dMIC60-CS), 10 (JH ⁇ SNCA A53T , dMIC60-WT), and 7 (TH>SNCA A53T , dMIC60-CS) brains,
  • Locomotor ability shown as Performance Index of 42-day- old flies. n 25 (TH>dMIC60-WT), 40 (TH>dMIC60-CS), 45 (JH ⁇ SNCA A53T , dMIC60-WT), and 33 (TH>SNCA A53T , dMIC60-CS).
  • the band intensity of dMIC60 in IP is normalized to that of DMiro.
  • n 4.
  • FIGS. 7A-7G MR3 and MR5 Benefit Normal Flies, and Fly Models of PD and FA.
  • DMSO solvent
  • Drug administration started from day 2.
  • Locomotor ability shown as Performance Index at indicated dates.
  • n 40, 42, 40, 46 flies (from left to right), 3 independent experiments,
  • n 43, 41 , 44, 44, 44, 42 flies (from left to right), 3 independent experiments. Data is compared at the same age.
  • n 126 (1 pM MR3), 131 (2.5 pM MR5), 132 (2.5 pM MR3), 157 (DMSO) flies,
  • g ATP levels of wild-type flies fed with either 2.5 or 10 pM MR5 from adulthood for 20 days.
  • FIGS. 8A-8C Schematic Representation of a Redox-Dependent Regulation of dMIC60-DMiro.
  • dMIC60 shows a weak interaction with DMiro.
  • ROS upregulation causes an increase in the amount of dMIC60 bound to DMiro, leading to stabilization of the complex, which may consequently exacerbate ROS accumulation by slowing mitophagy and disrupting cellular respiration
  • DMiro-dMIC60 complex extends lifespan and health-span, promotes mitophagy, restores cellular respiration, and rescues phenotypes of PD and FA models.
  • FIGS. 9A-9J Miro Binds to dMIC60 in a Redox-Dependent Manner, (a) Two-day-old flies expressing Myc-tagged UAS-dMIC60-WT or dMIC60-CS driven by Actin-GAL4 in dMIC60 null background, were lysed and immunoblotted. Both anti-dMIC60 and anti-Myc recognize transgenic dMIC60 protein in dMIC60 null background (no endogenous dMIC60).
  • Anti-dMIC60 recognizes endogenous dMIC60 in flies with Actin-GAL4 alone in wild-type background, (b) Whole-body lysates of wild-type flies (w ,, ,s ) were IPed with anti-DMiro or IgG, and immunoblotted (IB) as indicated, (c) Immunostaining of dMIC60 and ATP5
  • FIGS. 10A-10D DMiro Protein Levels in MICOS Mutants, (a) Lysates of 2 nd instar larvae (dMIC19 nul1 ), pupae (dMIC60 nul1 ), or 14-day-old adults (RNAi) were immunoblotted as indicated. The band intensity of each marker is normalized to that of ATP5
  • 3-actin from the same blot and graphed as relative change compared to control. Wild-type: w 1118 . n 3 (Top panel: anti-DMiro for WT and Middle panel) and 4 (the rest) independent experiments.
  • FIGS. 11A-11 F DMiro Protein Levels in Mitochondrial Mutants
  • FIGS. 12A-12H The Role of DMiro in Lifespan.
  • “RU-” flies were fed with the same volume of the vehicle, ethanol. All flies were female,
  • n 141 flies.
  • p 0.46 by Log-Rank Test
  • FIGS. 13A-13D dMIC60 or dMIC19 RNAi Does not Affect Mitochondrial Structure,
  • im of mitochondrial circumference. n 30 mitochondria from 3 male larvae,
  • (c) Quantification of the mitochondrial size. n 19 mitochondria from 3 male larvae,
  • d) Quantification of the aspect ratio. n 20 mitochondria from 3 male larvae.
  • CJ crista junction
  • n 142 (RU+) and 143 (RU-) flies.
  • p 0.99 by Log-Rank Test, (d)
  • Adult-onset downregulation of dMIC60 in intestine enterocytes induced in the presence of RU does not alter lifespan, compared to un-induced controls (RU-, black line).
  • n 140 (RU+) and 147 (RU-) flies.
  • FIGS. 15A-15H a-Syn Neurotoxicity in Flies
  • (a) Validation of an oc-syn fly model where wild-type human oc-syn transgene downstream of a modified UAS that significantly increases gene expression is expressed using the inducible pan-neuronal driver Elav-GS-GAL4 (“ Elav-GS>UAS- SNCA-WT, RU+”) through adulthood. Un-induced controls are “Elav-GS>UAS-SNCA-WT, RU-”. Head lysates of induced and uninduced flies were immunoblotted as indicated. The band intensity of a-syn is normalized to that of p-actin. n 3 independent experiments.
  • FIGS. 16A-16D Miro Reducers Benefit PD Models
  • FIGS 17A-17E Mitochondrial Protein Changes Following CCCP Treatment in Fibroblasts. Mitochondrial Protein Responses to CCCP in Fibroblasts.
  • A Schematic representation of our readouts.
  • B Examples of the readouts using Healthy-1 and MAPT-1.
  • C Demographic and genetic information of all cell lines used in this study.
  • D Heat maps show relative mitochondrial protein levels. The intensity of each band in the mitochondrial fraction is normalized to that of the mitochondrial loading control VDAC from the same blot and expressed as a fraction of the mean of Healthy-1 with DMSO treatment; this control was included in every experiment. Mean values are imported into heat maps.
  • FIGS. 18A-18I Ultrastructural Changes of Mitochondria in Fibroblasts.
  • A Representative TEM images of Healthy-6 (WT) and MAPT-1 (MAPT-N279K) with and without CCCP treatment. Scale bar: 500 nm.
  • B-l Quantifications from images as in (A).
  • B Quantification of mitochondrial size (minor x major diameter).
  • C Quantification of mitochondrial perimeter.
  • D Quantification of cristae junction number normalized to mitochondrial perimeter.
  • E Quantification of aspect ratio (minor/major diameter).
  • n 57 (WT, DMSO), 51 (WT, CCCP), 53 (MAPT-N279K, DMSO), and 64 (MAPT-N279K, CCCP) mitochondria from 15 different images from 3 independent cultures. Two-Way ANOVA Post Hoc Tukey Test.
  • FIGS 19A-19C Phenotypes of Cytoskeleton and Other Organelles in Fibroblasts.
  • A Representative TEM images of Healthy-6 (WT) and MAPT-1 (MAPT-N279K) with and without CCCP treatment, showing cytoskeleton tracks (Tracks) next to mitochondria.
  • C Representative TEM images of Healthy-6 (WT) and MAPT-1 (MAPT-N279K) with and without CCCP treatment, showing vacuole-like structures (Vac), structures similar to multi-vesicular bodies (MV), and structures similar to lamellar bodies (LB). Scale bars: 500 nm.
  • FIGS 20A-20F The Mitochondrial Network in Fibroblasts, Tau Interaction with Mirol , and Effect of Mirol Reducer.
  • B-C Co-IP with anti-GFP from HEK cells transfected as indicated.
  • D HEK cells transfected with different tau and Mirol constructs were lysed and blotted.
  • FIGS 21A-21C Control Experiments.
  • A Validation of our mitochondrial purification method. “Mito” and “Cyto” fractions from healthy fibroblasts were blotted as indicated. ATP5b is a mitochondrial marker. Calreticulin is an ER protein.
  • B Intra-plate variability of ELISA shown in Figure 1 F-G, 4E, measured by running the same fibroblast sample 4 times in the same plate.
  • C An IP similar to Figure 4C is shown. A negative control (empty vector) is included. All lanes are from the same blot.
  • Methods and compositions are provided for the assessment and treatment of Friedreich’s Ataxia in an individual. Aspects of the methods include administering a MIRO1 reducer to a subject having Friedreich’s Ataxia. Also provided are reagents and kits for practicing the subject methods.
  • Hereditary ataxias may be autosomal recessive or autosomal dominant.
  • Autosomal recessive ataxias include Friedreich ataxia (the most prevalent), ataxia-telangiectasia, abetalipoproteinemia, ataxia with isolated vitamin E deficiency, and cerebrotendinous xanthomatosis.
  • Friedreich ataxia results from a gene mutation causing abnormal repetition of the DNA sequence GAA in the FXN gene on the long arm of chromosome 9; the EXTV gene codes for the mitochondrial protein frataxin.
  • the GAA sequence is repeated 5 to 38 times within the FXN ene in people who do not have Friedreich ataxia; however, in people with Friedreich ataxia, the GAA sequence may be repeated 70 to > 1000 times. Inheritance is autosomal recessive.
  • an individual may be diagnosed with FA prior to treatment.
  • diagnosis of an individual comprise genotyping the frataxin gene, for example by PCR analysis of the 1 st intron. See, for example, Jama et al.
  • Alleles can be quantified as being between 5 and 200 GAA repeats, or expanded alleles beyond 200 repeats.
  • a PCR assay can correctly genotype and classify normal, mutable normal, borderline, and expanded alleles in both homozygous and heterozygous states.
  • the rate of progression varies from person to person. Generally, within 10 to 20 years after the appearance of the first symptoms the person is confined to a wheelchair. Individuals may become completely incapacitated in later stages of the disease. Friedreich ataxia can shorten life expectancy, and heart disease is the most common cause of death. However, some people with less severe features of FA live into their sixties or older.
  • Assessment of motor skills can be used in initial clinical evaluation, and to determine the efficacy of treatment. See, for example, Hohenfeld et al. (2019) Cerebellum 18(5):896-909, herein specifically incorporated by reference.
  • Assessment tests include, for example, quantitative motor assessments of the Q-Motor battery, including lift (manumotography), finger tapping (digitomotography) and pronate/supinate (dysdiadochomotography) tasks.
  • Indicia for ataxia may include, for example, International Cooperative Ataxia Rating Scale (ICARS): developed to determine the level of impairment from ataxia related to genetics; Scale for the Assessment and Rating of Ataxia (SARA): similar scale to the ICARS to assess ataxia but shorter to administer; Friedreich’s Ataxia Rating Scale (FARA): assessment for ataxia specific to FA.
  • ICARS International Cooperative Ataxia Rating Scale
  • SARA Scale for the Assessment and Rating of Ataxia
  • FARA Ataxia Rating Scale
  • Gait 6 Minute Walk Test: assesses aerobic capacity and gait
  • Timed Up and Go (TUG) assesses fall risk, balance and gait
  • Goal Attainment Scale individualized outcome measure to assess the extent the patient meets their various goals.
  • Additional indicia may include Functional Independence Measure: measure of physical, psychological and social function; Goal Attainment Scale: individualized outcome measure to assess the extent the patient meets their various goals; Child Occupational Self-Assessment (v 2.2): a self-report measure for how competent children and adolescents feel completing every day activities and how much value they place on these activities, ages 6-17; Depression Anxiety Stress Scale: can be used in later stages of the disease to assess potential symptoms of depression, anxiety and stress.
  • the methods disclosed herein can stabilize an individual’s assessed level of disability by one or more of the indicia indicated above for a period of time, e.g. during administration of an agent disclosed herein.
  • the methods disclosed herein can reduce an individual’s assessed level of disability following administration of an agent disclosed here, e.g. a reduction of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 40%, at least about 50% or more, as assessed by one or more of the indicia indicated above.
  • Tauopathies are a heterogeneous group of neurodegenerative disorders, pathologically characterized by neuronal and/or glial inclusions of the microtubule-binding protein, tau. Heterogeneity spans many domains from the clinical presentation, anatomical localization, genetic variations, and radiological and pathological signs.
  • tauopathies present as movement disorders, dementia, and motor neuron disease, either in isolation or in varied combinations, based on the vulnerable anatomical structures being affected by the pathological protein accumulation.
  • MAPT gene containing N terminal domain (N1 , N2) and microtubule binding domain (R1 , R2, R3, R4), on chromosome 17q21 encodes the protein tau. Due to alternative splicing of the MAPT gene, three repeat (2N3R, 1 N3R, 0N3R) or four repeat (2N4R, 1 N4R, 0N4R) tau isoforms are formed. Depending upon numerous single nucleotide polymorphisms (SNPs) and a 900kb inversion, H2 and H1 haplotypes of MAPT gene are formed and have impact on the phenotypic presentation.
  • SNPs single nucleotide polymorphisms
  • H2 and H1 haplotypes of MAPT gene are formed and have impact on the phenotypic presentation.
  • Tauopathies have been conventionally classified from a pathological perspective into two groups — (A) Primary tauopathies where tau is the predominant pathology including three repeat (3R-) and four repeat (4R-) tauopathies, (B) Secondary tauopathies where additional etiologies (e.g., amyloid, trauma, and autoimmune) are involved for tau deposition.
  • additional etiologies e.g., amyloid, trauma, and autoimmune
  • tauopathies are geographically isolated like Guadeloupean parkinsonism, Western pacific amyotrophic lateral sclerosis and parkinsonism-dementia complex (ALS/PDC), and Nodding syndrome of northern Kenya, where environmental impact may be relevant.
  • Cognitive syndromes include behavioral variant of frontotemporal dementia (bvFTD), nonfluent agrammatic variant of primary progressive aphasia (nfavPPA), semantic variant of primaryprogressive aphasia (svPPA), and amnestic syndrome of hippocampal type (AS).
  • bvFTD behavioral variant of frontotemporal dementia
  • nfavPPA nonfluent agrammatic variant of primary progressive aphasia
  • svPPA semantic variant of primaryprogressive aphasia
  • A amnestic syndrome of hippocampal type
  • Motor syndromes Richardson syndrome (RS), Parkinson syndrome (P), corticobasal syndrome (CBS), primary gait freezing (PGF), cerebellar syndrome (C), and primary lateral sclerosis (PLS).
  • RS Richardson syndrome
  • P Parkinson syndrome
  • CBS corticobasal syndrome
  • PPF primary gait freezing
  • C cerebellar syndrome
  • PLS primary lateral sclerosis
  • tauopathies can be classified based on the etiology like genetic (e.g., MAPT related), autoimmune (e.g., anti lgLON5 related), traumatic (e.g., chronic traumatic encephalopathy), etc.
  • MAPT related e.g., MAPT related
  • autoimmune e.g., anti lgLON5 related
  • traumatic e.g., chronic traumatic encephalopathy
  • frontal cortex e.g., behavioral variant frontotemporal dementia/bvFTD, progressive supranuclear palsy-frontal variant/PSP-F
  • parietal cortex e.g., corticobasal syndrome/CBS
  • peri-sylvian e.g., progressive nonfluent aphasia/PNFA
  • limbic e.g., argyrophilic grain disease/AGD
  • brainstem e.g., progressive supranuclear palsy-Richardson's type/PSP-RS, anti lgLON5 related
  • cerebellum e.g., PSP-C
  • Parkinsonism associated with familial FTD and MAPT mutation varies from mild to the aggressive form in severity and can occur early or late in this spectrum.
  • Chromosome 17 carries another gene named progranulin (PGRN), that is also linked with the spectrum of frontotemporal dementia-parkinsonism, but with TAR DNA binding protein 43 (TDP43) inclusions instead of tau.
  • PGRN progranulin
  • TDP43 TAR DNA binding protein 43
  • parkinsonism in familial FTD can also be liked with chromosome 9 open reading frame 72 (C9orf72) gene where overlap with motor neuron disease (FTD-MND) is commonly seen.
  • MAPT and PGRN both can present with akinetic-rigid variant of parkinsonism.
  • MAPT commonly presents with PSP like phenotype with symmetric motor involvement while PGRN presents with corticobasal syndrome (CBS) like phenotype with asymmetric involvement and parietal lobe signs like apraxia, dyscalculia, visuoperceptual, and visuospatial dysfunction.
  • CBS corticobasal syndrome
  • Penetrance is 100% in MAPT, while it is age dependent in PGRN and reaches about 90% at the age of 70. Progression of disease is relatively faster in PGRN and hallucinations are more common.
  • Specific mutations in the MAPT gene can present with subtle phenotypic differences.
  • the inner mitochondrial membrane has the highest density of protein in the cell and is differentiated into three distinct interconnected domains: the boundary region, which are flattened membranes that lie in close apposition to the outer membrane; cristae membranes, which are lamellar invaginations with highly curved edges; and cristae junctions, which are relatively narrow tubules that connect cristae to the boundary membrane and may act as a physical partitioning mechanism that prevents and/or regulates the intermixing of proteins between cristae and the boundary domains.
  • the boundary region which are flattened membranes that lie in close apposition to the outer membrane
  • cristae membranes which are lamellar invaginations with highly curved edges
  • cristae junctions which are relatively narrow tubules that connect cristae to the boundary membrane and may act as a physical partitioning mechanism that prevents and/or regulates the intermixing of proteins between cristae and the boundary domains.
  • Cristae membranes house assembled electron transport chain protein complexes and ATP synthase, which function together to synthesize ATP via oxidative phosphorylation. Specific combinations of electron transport chain complexes further assemble into large mega-Dalton supercomplexes in cristae in a manner dependent on the mitochondrial lipid cardiolipin and act to facilitate electron transport, and likely as diffusion traps to promote their sorting into cristae.
  • the MICOS complex has been proposed to act as a master regulator/integrator of mitochondrial inner membrane shape and organization. Consistently, MICOS interacts both physically and functionally with cardiolipin, import machinery, and respiratory complexes.
  • the MICOS complex is also embedded in the inner membrane with domains facing the intermembrane space that mediate the formation of heterologous structures localized to the inner boundary membrane. It is comprised of six core subunits in yeast: Mic60, Mic10, Mid 9, Mic27, Mic26, and Mid 2, that, with the exception of Mid 2, have mammalian homologs.
  • Single MICOS subunit deletion causes a characteristic mitochondrial inner membrane morphological defect in cells, consisting of extended, stacked, lamellar inner membranes and a reduction of the number of cristae junctions, with a consequent lamellar mitochondrial shape defect.
  • the common cellular phenotypes of single MICOS subunit deletions indicate that they perform a shared function.
  • expression analysis indicates that Mic60 and Mid 0 function uniquely as ‘core components’ that direct a hierarchal MICOS assembly as MIC60 deletion causes Mid 9 instability and MIC10 deletion causes Mic27 instability.
  • specific pairwise combinations of MICOS subunit deletions can produce either positive or negative genetic interactions, indicating that although MICOS subunits act cooperatively, they also perform non- redundant roles within mitochondria.
  • mitochondria transport protein refers to any protein that is involved in the transport of mitochondria in a cell, e.g., a neuron, fibroblast, etc.
  • Mitochondrial transport factors include, but are not limited to, Mitochondrial Rho (Miro) proteins, trafficking kinesin (TRAK) proteins, kinesin, dynein motors, and myosin motors.
  • Mitochondrial Rho refers to a member of the mitochondrial Rho protein family of Rho GTPases. Miro family members have tandem GTP-binding domains, two EF hand domains that bind calcium and are larger than classical small GTPases.
  • Miro family members include, but are not limited to, Mirol (also known as “Arhtl ” and “mitochondrial Rho GTPase 1 ”, “mitochondrial Rho 1 ”, “ras homolog family member T1 ”, and “Rhotl ”, the sequence for which can found at GenBank Accession Numbers NP_001028738.1 and NM_001033566.1 ) and Miro2 (also known as “Arht2”, “mitochondrial Rho GTPase 2”, “mitochondrial Rho 2” and “ras homolog family member T2”, and “Rhot2”, GenBank Accession Numbers NP 00620124.1 and NM_138769.2).
  • Mirol also known as “Arhtl ” and “mitochondrial Rho GTPase 1 ”, “mitochondrial Rho 1 ”, “ras homolog family member T1 ”, and “Rhotl ”
  • Miro2 also known as
  • sample refers to a sample from an animal, most preferably a human, seeking assessment or treatment of a disease, e.g. an movement disorder such as FA or tauopathy.
  • Samples of the present invention include, without limitation, samples comprising cells, conveniently blood, biopsy, tissue scraping, hair roots, and the like, such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof.
  • the term encompasses samples that have been manipulated in any way after their procurement, such as by treatment with reagents, cell cultures, or enrichment for certain components.
  • the term encompasses a clinical sample, and also includes cells in cell culture, cell supernatants, cell lysates, serum, plasma, biological fluids, and tissue samples. Samples containing fibroblasts are convenient for the assays described herein, and can be obtained by a superficial punch skin biopsy under a local anesthetic. Peripheral blood is another useful source of cells.
  • treatment generally mean obtaining a desired pharmacologic and/or physiologic effect.
  • the effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease.
  • Treatment may also refer to experimental procedures in which a cell or animal model is exposed to a regimen, e.g. a drug candidate.
  • T reatment includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; or (c) relieving the disease, i.e., causing regression of the disease.
  • the therapeutic agent may be administered before, during or after the onset of disease or injury.
  • the treatment of ongoing disease, where the treatment stabilizes or reduces the undesirable clinical symptoms of the patient, is of particular interest. Such treatment is desirably performed prior to complete loss of function in the affected tissues.
  • the subject therapy can be administered during early symptomatic stage of the disease, and in some cases during symptomatic stages of the disease.
  • the terms "individual,” “subject,” “host,” and “patient,” are used to refer any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans.
  • susceptibility means primarily increased susceptibility.
  • the evaluation of a sample from an individual that shows decreased degradation of Mirol on damaged or depolarized mitochondria is characteristic of increased susceptibility to development of Friedreich’s Ataxia, as characterized by a relative risk of greater than one.
  • the Mirol reducer is provided in a pharmaceutical composition, wherein the pharmaceutical composition comprises a therapeutically effective amount of a compound of Formula I or a pharmaceutically acceptable salt or derivative therefrom:
  • a Mirol reducer will inhibit the level or biological activity of Mirol by 10% or more, by 20% or more, for example, 30% or more, 40% or more, or 50% or more, sometimes 60% or more, 70% or more, or 80% or more, e.g. 90%, 95%, or 100%, relative to an untreated control not contacted with the reducer.
  • a reducer may be validated as such by any convenient method in the art for detecting the level and/or activity of Mirol in the presence versus absence of the Mirol reducer.
  • a reducer does not inhibit basal levels of Mirol , but reduces the level or activity of Mirol following damage to mitochondria, e.g. uncoupling, deprotonation, etc.
  • the reducer described herein may be administered alone or in combination with any pharmaceutically acceptable carrier or salt known in the art and as described below.
  • a pharmaceutical composition comprising an effective dose of Mirol reducer is provided, which dose may be sufficient to achieve a therapeutic level of Mirol of at least 1 p.M, at least 5 p.M, at least 10 p.M, at least 20 p.M, up to about 1 mM, up to about 500
  • a unit dose may be, for example, at least 1
  • a unit dose may be, for example, at least 1 pig/kg, at least 10 pig/kg, at least 100 pig/kg, at least 500 pig/kg , up to 1 mg/ kg, up to 5 mg/kg, up to 10 mg/kg, up to 50 mg/kg, up to 100 mg/kg, or more.
  • carrier or “vehicle” refers to a diluent, adjuvant, excipient, or vehicle with which the Mirol reducer is administered.
  • Such pharmaceutical carriers can be, for example, lipids, e.g. liposomes, e.g. liposome dendrimers; sterile liquids, such as saline solutions in water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
  • a saline solution is a preferred carrier when the pharmaceutical composition is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol and the like.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like.
  • the composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.
  • the reducer can be formulated as neutral or salt forms.
  • Pharmaceutically acceptable salts include those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
  • compositions will contain a therapeutically effective amount of the Mirol reducer, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient.
  • suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences” by E. W. Martin, hereby incorporated by reference herein in its entirety.
  • Such compositions will contain a therapeutically effective amount of the Mirol reducer, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient.
  • the formulation should suit the mode of administration.
  • the pharmaceutical composition can also include any of a variety of stabilizing agents, such as an antioxidant for example.
  • the pharmaceutical composition includes a polypeptide
  • the polypeptide can be complexed with various well-known compounds that enhance the in vivo stability of the polypeptide, or otherwise enhance its pharmacological properties (e.g., increase the half-life of the polypeptide, reduce its toxicity, enhance solubility or uptake). Examples of such modifications or complexing agents include sulfate, gluconate, citrate and phosphate.
  • the polypeptides of a composition can also be complexed with molecules that enhance their in vivo attributes. Such molecules include, for example, carbohydrates, polyamines, amino acids, other peptides, ions (e.g., sodium, potassium, calcium, magnesium, manganese), and lipids.
  • compositions intended for in vivo use are usually sterile. To the extent that a given compound must be synthesized prior to use, the resulting product is typically substantially free of any potentially toxic agents, particularly any endotoxins, which may be present during the synthesis or purification process.
  • potentially harmful contaminants e.g., at least National Food (NF) grade, generally at least analytical grade, and more typically at least pharmaceutical grade.
  • compositions intended for in vivo use are usually sterile.
  • the resulting product is typically substantially free of any potentially toxic agents, particularly any endotoxins, which may be present during the synthesis or purification process.
  • the subject pharmaceutical composition is typically sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 pm membranes). Therapeutic compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • the pharmaceutical composition may be stored in unit or multi-dose containers, for example, sealed ampules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution.
  • a lyophilized formulation 10-mL vials are filled with 5 ml of sterile- filtered 1% (w/v) aqueous solution of compound, and the resulting mixture is lyophilized.
  • the pharmaceutical composition comprising the lyophilized Mirol reducer is prepared by reconstituting the lyophilized compound, for example, by using bacteriostatic Water-for- Injection.
  • the pharmaceutical composition can be formulated for intravenous, oral, via implant, transmucosal, transdermal, intramuscular, intrathecal, or subcutaneous administration.
  • the pharmaceutical composition is formulated for intravenous administration.
  • the pharmaceutical composition is formulated for subcutaneous administration.
  • the following delivery systems, which employ a number of routinely used pharmaceutical carriers, are only representative of the many embodiments envisioned for administering the instant compositions.
  • Injectable drug delivery systems include solutions, suspensions, gels, microspheres and polymeric injectables, and can comprise excipients such as solubility-altering agents (e.g., ethanol, propylene glycol and sucrose) and polymers (e.g., polycaprylactones and PLGAs).
  • Implantable systems include rods and discs, and can contain excipients such as PLGA and polycaprylactone.
  • Oral delivery systems include tablets and capsules. These can contain excipients such as binders (e.g., hydroxypropylmethylcellulose, polyvinyl pyrilodone, other cellulosic materials and starch), diluents (e.g., lactose and other sugars, starch, dicalcium phosphate and cellulosic materials), disintegrating agents (e.g., starch polymers and cellulosic materials) and lubricating agents (e.g., stearates and talc).
  • excipients such as binders (e.g., hydroxypropylmethylcellulose, polyvinyl pyrilodone, other cellulosic materials and starch), diluents (e.g., lactose and other sugars, starch, dicalcium phosphate and cellulosic materials), disintegrating agents (e.g., starch polymers and cellulosic materials) and lubricating agents (e.
  • Transmucosal delivery systems include patches, tablets, suppositories, pessaries, gels and creams, and can contain excipients such as solubilizers and enhancers (e.g., propylene glycol, bile salts and amino acids), and other vehicles (e.g., polyethylene glycol, fatty acid esters and derivatives, and hydrophilic polymers such as hydroxypropylmethylcellulose and hyaluronic acid).
  • solubilizers and enhancers e.g., propylene glycol, bile salts and amino acids
  • other vehicles e.g., polyethylene glycol, fatty acid esters and derivatives, and hydrophilic polymers such as hydroxypropylmethylcellulose and hyaluronic acid.
  • Dermal delivery systems include, for example, aqueous and nonaqueous gels, creams, multiple emulsions, microemulsions, liposomes, ointments, aqueous and nonaqueous solutions, lotions, aerosols, hydrocarbon bases and powders, and can contain excipients such as solubilizers, permeation enhancers (e.g., fatty acids, fatty acid esters, fatty alcohols and amino acids), and hydrophilic polymers (e.g., polycarbophil and polyvinylpyrolidone).
  • the pharmaceutically acceptable carrier is a liposome or a transdermal enhancer.
  • the subject pharmaceutical composition is formulated to cross the blood brain barrier (BBB).
  • BBB blood brain barrier
  • One strategy for drug delivery through the blood brain barrier (BBB) entails disruption of the BBB, either by osmotic means such as mannitol or leukotrienes, or biochemically by the use of vasoactive substances such as bradykinin.
  • a BBB disrupting agent can be co-administered with the therapeutic compositions when the compositions are administered by intravascular injection.
  • ND pharmaceutical composition behind the BBB may be by local delivery, for example by intrathecal delivery, e.g., through an Ommaya reservoir (see, e.g., US Patent Nos.
  • compositions of the pharmaceutical composition can be supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ample of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
  • the pharmaceutical composition is supplied as a dry sterilized lyophilized powder that is capable of being reconstituted to the appropriate concentration for administration to a subject. In some embodiments, the pharmaceutical composition is supplied as a water free concentrate.
  • the pharmaceutical composition is supplied as a dry sterile lyophilized powder at a unit dosage of at least 0.5 mg, at least 1 mg, at least 2 mg, at least 3 mg, at least 5 mg, at least 1 0 mg, at least 15 mg, at least 25 mg, at least 30 mg, at least 35 mg, at least 45 mg, at least 50 mg, at least 60 mg, or at least 75 mg.
  • Solutions, suspensions and powders for reconstitutable delivery systems include vehicles such as suspending agents (e.g., gums, xanthans, cellulosics and sugars), humectants (e.g., sorbitol), solubilizers (e.g., ethanol, water, PEG and propylene glycol), surfactants (e.g., sodium lauryl sulfate, Spans, Tweens, and cetyl pyridine), preservatives and antioxidants (e.g., parabens, vitamins E and C, and ascorbic acid), anti-caking agents, coating agents, and chelating agents (e.g., EDTA).
  • suspending agents e.g., gums, xanthans, cellulosics and sugars
  • humectants e.g., sorbitol
  • solubilizers e.g., ethanol, water, PEG and propylene glycol
  • the pharmaceutical composition is formulated as a salt form.
  • Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
  • methods are provided for the treatment or amelioration of Friedreich’s Ataxia or tauopathy in a subject, the method comprising administering to the subject a therapeutically effective amount of Mirol reducer or pharmaceutical composition thereof as described herein.
  • cells of the subject e.g. neuronal cells
  • Cells in vivo may be contacted with Mirol reducer by any convenient method for the administration of polypeptides, and nucleic acids, or small molecules to a subject, e.g. as described herein or known in the art.
  • the subject is a mammal.
  • Mammalian species that may be treated with the present methods include canines; felines; equines; bovines; ovines; etc. and primates, particularly humans.
  • the method is for the treatment of a human.
  • Animal models, particularly small mammals, e.g., murine, lagomorpha, etc. may be used for experimental investigations
  • a “therapeutically effective amount” of the Mirol reducer it is meant an amount that is required to stabilize, or reduce the severity and/or the symptoms of the Friedreich’s Ataxia or tauopathy, e.g. as described herein or as known in the art.
  • the therapeutically effective amount may slow the rate of progression of the disease and the increase of severity of clinical symptoms, may halt the progression of the disease and the clinical symptoms, or may cause a regression of the disease and the clinical symptoms.
  • the method further comprises the step of measuring one or more of the clinical symptoms of the Friedreich’s Ataxia, e.g. motor symptoms, neuronal symptoms, etc., e.g. as described herein or known in the art before and/or after treatment with the Mirol reducer and determining that the one or more symptoms have been reduced.
  • the calculation of the effective amount or effective dose of the Mirol reducer or pharmaceutical composition to be administered is within the skill of one of ordinary skill in the art, and will be routine to those persons skilled in the art by using assays known in the art, e.g. as described herein.
  • the effective amount of Mirol reducer pharmaceutical composition to be given to a particular patient will depend on a variety of factors, several of which will differ from patient to patient.
  • a competent clinician will be able to determine an effective amount of a therapeutic agent to administer to a patient to halt or reverse the progression the disease condition as required.
  • the effective amount may be dependent upon the route of administration and the seriousness of the Friedreich’s Ataxia, and should be decided according to the judgment of the practitioner and each human patient's circumstances.
  • Determining a therapeutically effective amount of the Mirol reducer can be done based on animal data using routine computational methods. For example, effective amounts may be extrapolated from dose-response curves derived from preclinical protocols either in vitro (e.g., dopaminergic neuron cultures, such as the ones described below, treated with rotenone or MPP+ for 24h, or with Epoxymicin for 48h) or using any of the in vivo Friedreich’s Ataxia animal models known in the art. Utilizing LD50 animal data, and other information available for the agent, a clinician can determine the maximum safe dose for an individual, depending on the route of administration.
  • dose-response curves derived from preclinical protocols either in vitro (e.g., dopaminergic neuron cultures, such as the ones described below, treated with rotenone or MPP+ for 24h, or with Epoxymicin for 48h) or using any of the in vivo Friedreich’s Ataxia animal models known in the art. Utiliz
  • an intravenously administered dose may be more than an intrathecally administered dose, given the greater body of fluid into which the therapeutic composition is being administered.
  • compositions which are rapidly cleared from the body may be administered at higher doses, or in repeated doses, in order to maintain a therapeutic concentration.
  • the competent clinician will be able to optimize the dosage of a particular therapeutic in the course of routine clinical trials.
  • the effective amount of the pharmaceutical composition provided herein is between about 0.025 mg/kg and about 1000 mg/kg body weight of a human subject.
  • the pharmaceutical composition is administered to a human subject at an amount of about 1000 mg/kg body weight or less, about 950 mg/kg body weight or less, about 900 mg/kg body weight or less, about 850 mg/kg body weight or less, about 800 mg/kg body weight or less, about 750 mg/kg body weight or less, about 700 mg/kg body weight or less, about 650 mg/kg body weight or less, about 600 mg/kg body weight or less, about 550 mg/kg body weight or less, about 500 mg/kg body weight or less, about 450 mg/kg body weight or less, about 400 mg/kg body weight or less, about 350 mg/kg body weight or less, about 300 mg/kg body weight or less, about 250 mg/kg body weight or less, about 200 mg/kg body weight or less, about 150 mg/kg body weight or less, about 100 mg/kg body weight
  • the effective amount of the pharmaceutical composition provided herein is between about 0.025 mg/kg and about 60 mg/kg body weight of a human subject.
  • the effective amount of an antibody of the pharmaceutical composition provided herein is about 0.025 mg/kg or less, about 0.05 mg/kg or less, about 0.10 mg/kg or less, about 0.20 mglkg or less, about 0.40 mg/kg or less, about 0.80 mg/kg or less, about 1 .0 mg/kg or less, about 1 .5 mg/kg or less, about 3 mg/kg or less, about 5 mg/kg or less, about 1 0 mg/kg or less, about 15 mg/kg or less, about 20 mg/kg or less, about 25 mg/kg or less, about 30 mg/kg or less, about 35 mglkg or less, about 40 mg/kg or less, about 45 mg/kg or less, about 50 mg/kg or about 60 mg/kg or less.
  • the Mirol reducer can be administered for prophylactic and/or therapeutic treatments. Toxicity and therapeutic efficacy of the active ingredient can be determined according to standard pharmaceutical procedures in cell cultures and/or experimental animals, including, for example, determining the LD 5 o (the dose lethal to 50% of the population) and the ED 5 o (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 5 o/ED 5 o. Compounds that exhibit large therapeutic indices are preferred.
  • the data obtained from cell culture and/or animal studies can be used in formulating a range of dosages for humans.
  • the dosage of the active ingredient typically lines within a range of circulating concentrations that include the ED 5 o with low toxicity.
  • the dosage can vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the Mirol reducer can be administered daily, semi-weekly, weekly, semi-monthly, monthly, etc., at a dose of from about 0.01 mg, from about 0.1 mg, from about 1 mg, from about 5 mg, from about 10 mg, from about 100 mg or more per kilogram of body weight when administered systemically. Smaller doses may be utilized in localized administration, e.g., in direct administration to ocular nerves, etc.
  • Administration of the Mirol reducer can be achieved in various ways, including oral, buccal, rectal, parenteral, intraperitoneal, intradermal, transdermal, intracheal, intracranial, intraventricular, intracerebral, etc., administration.
  • the pharmaceutical composition comprising the Mirol reducer may be systemic after administration or may be localized by the use of regional administration, intramural administration, or use of an implant that acts to retain the active dose at the site of implantation.
  • the pharmaceutical composition comprising the Mirol reducer may be formulated for immediate activity or they may be formulated for sustained release.
  • the Mirol reducer or pharmaceutical composition thereof is administered in combination with a second therapeutic agent for the treatment or amelioration of the Friedreich’s Ataxia or tauopathy.
  • метод ⁇ н ⁇ е те ⁇ ированн ⁇ е те ⁇ унк ⁇ ионент ⁇ мо ⁇ ет ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇ ⁇
  • Test agents can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the 'one- bead one-compound' library method; and synthetic library methods using affinity chromatography selection.
  • a cell e.g. a viable cell or population of cells
  • the protein can be contacted directly with the agent to be tested.
  • the level (amount) of activity is assessed either directly or indirectly, and is compared with the level of activity in a control, e.g. in the absence of the agent to be tested. If the level of the activity in the presence of the agent differs, by an amount that is statistically significant, from the level of the activity in the absence of the agent, then the agent is an agent that alters the activity.
  • This invention further pertains to novel agents identified by the above-described screening assays. Accordingly, it is within the scope of this invention to further use an agent identified as described herein in the methods of treatment described herein. For example, an agent identified as described herein can be used to alter Mirol degradation with the agent identified as described herein.
  • cells expressing the mitochondrial transport protein of interest are contacted with a candidate agent of interest and the effect of the candidate agent on the expression or function of the mitochondrial transport protein is assessed by monitoring one or more mitochondria-associated parameters.
  • the activity of a candidate agent can be assessed by determining the level of Mirol following mitochondria depolarization.
  • Parameters are quantifiable components of cells, particularly components that can be accurately measured, desirably in a high throughput system.
  • a parameter can be any cell component or cell product including cell surface determinant, receptor, protein or conformational or posttranslational modification thereof, lipid, carbohydrate, organic or inorganic molecule, nucleic acid, e.g. mRNA, DNA, etc. or a portion derived from such a cell component or combinations thereof. While most parameters will provide a quantitative readout, in some instances a semi-quantitative or qualitative result will be acceptable. Readouts may include a single determined value, or may include mean, median value or the variance, etc.
  • one such method may comprise contacting a cell that expresses mitochondrial transport proteins with a candidate agent; and comparing the mitochondria-associated parameter to the mitochondria-associated parameter in a cell that expresses the mitochondrial transport proteins but was not contacted with the candidate agent, wherein a difference in the parameter in the cell contacted with the candidate agent indicates that the candidate agent will treat the tauopathy.
  • Another example of a parameter would be the state of ubiquitination of a Miro protein, a TRAK protein, or Khc, by, for example, immunoprecipitation with mitochondrial transport protein-specific antibodies followed by Western blotting with ubiquitin-specific antibodies, where an increase in ubiquitination following contact with the candidate agent indicates that the agent will treat tauopathy.
  • All cells comprise mitochondria, and thus, any cell may be used in the subject screening methods.
  • the cell is a cell type that is typically affected by tauopathy, e.g. a a neuron, e.g. a motor neuron.
  • the cell comprises a genetic mutation, i.e. a mutation in MAPT which is associated with tauopathy.
  • the cell may be acutely cultured from an individual that has tauopathy.
  • Candidate agents of interest are biologically active agents that encompass numerous chemical classes, primarily organic molecules, which may include organometallic molecules, inorganic molecules, genetic sequences, etc.
  • An important aspect of the invention is to evaluate candidate drugs, select therapeutic antibodies and protein-based therapeutics, with preferred biological response functions.
  • Candidate agents comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and typically include at least an amine, carbonyl, hydroxyl or carboxyl group, frequently at least two of the functional chemical groups.
  • the candidate agents often comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups.
  • Candidate agents are also found among biomolecules, including peptides, polynucleotides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.
  • pharmacologically active drugs include chemotherapeutic agents, anti-inflammatory agents, hormones or hormone antagonists, ion channel modifiers, and neuroactive agents.
  • chemotherapeutic agents include chemotherapeutic agents, anti-inflammatory agents, hormones or hormone antagonists, ion channel modifiers, and neuroactive agents.
  • exemplary of pharmaceutical agents suitable for this invention are those described in, "The Pharmacological Basis of Therapeutics," Goodman and Gilman, McGraw-Hill, New York, N.Y., (1996), Ninth edition, under the sections: Drugs Acting at Synaptic and Neuroeffector Junctional Sites; Drugs Acting on the Central Nervous System; Autacoids: Drug Therapy of Inflammation; Water, Salts and Ions; Drugs Affecting Renal Function and Electrolyte Metabolism; Cardiovascular Drugs; Drugs Affecting Gastrointestinal Function; Drugs Affecting Uterine Motility; Chemotherapy of Parasitic Infections; Chemotherapy of Microbial
  • Test compounds include all of the classes of molecules described above, and may further comprise samples of unknown content. Of interest are complex mixtures of naturally occurring compounds derived from natural sources such as plants. While many samples will comprise compounds in solution, solid samples that can be dissolved in a suitable solvent may also be assayed. Samples of interest include environmental samples, e.g. ground water, sea water, mining waste, etc.; biological samples, e.g. lysates prepared from crops, tissue samples, etc.; manufacturing samples, e.g. time course during preparation of pharmaceuticals; as well as libraries of compounds prepared for analysis; and the like. Samples of interest include compounds being assessed for potential therapeutic value, i.e. drug candidates.
  • sample also includes the fluids described above to which additional components have been added, for example components that affect the ionic strength, pH, total protein concentration, etc.
  • samples may be treated to achieve at least partial fractionation or concentration.
  • Biological samples may be stored if care is taken to reduce degradation of the compound, e.g. under nitrogen, frozen, or a combination thereof.
  • the volume of sample used is sufficient to allow for measurable detection, usually from about 0.1 :1 to 1 ml of a biological sample is sufficient.
  • Compounds, including candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds, including biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.
  • the term "genetic agent” refers to polynucleotides and analogs thereof, which agents are tested in the screening assays of the invention by addition of the genetic agent to a cell.
  • the introduction of the genetic agent results in an alteration of the total genetic composition of the cell.
  • Genetic agents such as DNA can result in an experimentally introduced change in the genome of a cell, generally through the integration of the sequence into a chromosome. Genetic changes can also be transient, where the exogenous sequence is not integrated but is maintained as an episomal agents.
  • Genetic agents, such as antisense oligonucleotides can also affect the expression of proteins without changing the cell's genotype, by interfering with the transcription or translation of mRNA. The effect of a genetic agent is to increase or decrease expression of one or more gene products in the cell.
  • Agents are screened for biological activity by adding the agent to at least one and usually a plurality of cell samples.
  • the change in parameter readout in response to the agent is measured, desirably normalized, and the resulting data may then be evaluated by comparison to reference datasets.
  • the reference datasets may include basal readouts in the presence and absence of a decoupling agent, etc.
  • Agents of interest for analysis include any biologically active molecule with the capability of modulating, directly or indirectly, the Mirol phenotype of interest of a cell of interest.
  • the agents are conveniently added in solution, or readily soluble form, to the medium of cells in culture.
  • the agents may be added in a flow-through system, as a stream, intermittent or continuous, or alternatively, adding a bolus of the compound, singly or incrementally, to an otherwise static solution.
  • a flow-through system two fluids are used, where one is a physiologically neutral solution, and the other is the same solution with the test compound added. The first fluid is passed over the cells, followed by the second.
  • a bolus of the test compound is added to the volume of medium surrounding the cells. The overall concentrations of the components of the culture medium should not change significantly with the addition of the bolus, or between the two solutions in a flow through method.
  • Agent formulations preferably essentially of a biologically active compound and a physiologically acceptable carrier, e.g. water, ethanol, DMSO, etc.
  • a physiologically acceptable carrier e.g. water, ethanol, DMSO, etc.
  • the formulation may consist essentially of the compound itself.
  • a plurality of assays may be run in parallel with different agent concentrations to obtain a differential response to the various concentrations.
  • determining the effective concentration of an agent typically uses a range of concentrations resulting from 1 :10, or other log scale, dilutions.
  • the concentrations may be further refined with a second series of dilutions, if necessary.
  • one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection of the agent or at or below the concentration of agent that does not give a detectable change in the phenotype.
  • Mitochondria are the main site for generating reactive oxygen species, which are key players in diverse biological processes.
  • the molecular pathways of redox signal transduction from the matrix to the cytosol are poorly defined.
  • Cysteine oxidation of MIC60 an inner mitochondrial membrane protein, triggers the formation of disulfide bonds and the physical association of MIC60 with Miro, an outer mitochondrial membrane protein.
  • the oxidative structural change of this membrane-crossing complex ultimately elicits cellular responses that delay mitophagy, impair cellular respiration, and cause oxidative stress.
  • Our discovery provides a molecular basis for common treatment strategies against oxidative stress.
  • MICOS mitochondrial contact site and cristae organizing system
  • MIC19/CHCHD3 cristae organizing system
  • Miro plays crucial roles in initiating mitophagy-a mitochondria-specific autophagy that involves recruitment of cytosolic autophagosomes and fusion with lysosomes, and likely in organizing mitochondria-ER contacts and balancing intracellular ion, metabolite, and nucleoid homeostasis.
  • a connection between the IMM protein MIC60 and the OMM protein Miro could allow signal transduction of the intramitochondrial oxidation status to the cytosol.
  • We tested this hypothesis by characterizing the nature and regulatory signals of the MIC60-Miro interaction.
  • MIC60 Protein Undergoes an Oxidative Conformational Change It is known that human MIC19 switches to an oxidative conformation by forming two disulfide bonds within the twin cysteine-x9-cysteine motifs in the CHCH domain. We hypothesized that cysteine oxidation might also cause conformational changes of MIC60 protein.
  • Fly MIC60 (dMIC60) has four cysteines, of which two (AAs 10 and 12) are located in the putative mitochondrial targeting signal sequence (MTS) sticking into the matrix and are likely cleaved during maturation, and two (AAs 302 and 550) are present in the part of dMIC60 that remains in the IMS (Fig. 1 a).
  • a disulfide bond between cysteines 302 and 550 could cause folding of dMIC60 protein.
  • DTT the reducing agent
  • PEG-MAL the non-reducing agent
  • dMIC60 protein migrated faster under the non-reducing condition (PEG- MAL) than the reducing condition (DTT) in SDS-PAGE (Fig. 1 a), indicating that dMIC60 contains oxidized cysteines and undergoes oxidative conformational changes.
  • anti-dMIC60 recognizes the regions close to both cysteines 302 and 550.
  • PEG-MAL a smaller thiol-reacting agent, AMS, which adds 0.5 kDa to each cysteine, in the indirect thiol trapping assay.
  • AMS thiol-reacting agent
  • dMIC60-WT wild-type dMIC60
  • dMIC60-CS mutant dMIC60 where both cysteines were converted to serines
  • Oxidized MIC60 Promotes Its Physical Coupling with Miro.
  • endogenous human Mirol binds to MIC60 in HEK293T cells.
  • endogenous Drosophila Miro DMiro
  • dMIC60 resided in the same complex in vivo by coimmunoprecipitation (co-IP) from 10-day-old flies (Fig. 1 g).
  • fly MIC19 dMIC19 was also in the same complex (Fig. 1g), but not fly Mitofusin (Mart), VDAC, or ATP5
  • dMIC60-CS lost the ability to bind to DMiro in young flies fed with H 2 O 2 (Fig. 1 k).
  • recombinant wild-type dMIC60 also associated with human GST-Miro1 , and dMIC60- CS consistently eliminated this interaction (FIG. 9e-g).
  • Adding a strong reducing agent (2 mM - mecaptoethanol) to the regular non-reducing buffer (Non) similarly abolished the binding between recombinant human Mirol and dMIC60 in vitro, but not between human Mirol and Parkin (FIG. 9h-i), a known Miro-interactor.
  • MICOS Functions Upstream of Miro to Stabilize Miro.
  • qPCR quantitative real-time PCR
  • the protein levels of dMIC60 and DMiro were also mildly upregulated in older flies, detected by both Western blotting (Fig. 2d; Input) and mass spectrometry (Fig. 2c), although the mRNA expression of DMiro did not change over age as detected by qPCR (FIG. 1 1 e); the protein levels of dMIC60 and DMiro were lowered by AD4 feeding (Fig. 2e; Input).
  • RNAi RNAi
  • RNAi fly lines of dMIC60 and dMIC19-vjh ch did not affect mitochondrial cristae confirmed by transmission electron microscopy (TEM) (FIG. 13), but reduced DMiro levels (FIG. 10b)-and the GS system to bypass the development.
  • TEM transmission electron microscopy
  • FIG. 10b reduced DMiro levels
  • adult-onset reduction of dMIC19 or dMIC60 in pan-neurons by Elav- GS-GAL4 but not in intestine enterocytes by 5966-GS-GAL4, significantly extended lifespan (Fig. 3c-d, FIG. 14a-d), like DMiro RNAi.
  • Targeting the MIC60-Miro Complex Improves Mitochondrial Function and Cellular Respiration. Having demonstrated the significance of this redox-dependent regulation to fly physiology at the organismal level, we next sought to identify the underlying cellular mechanisms. If elevation of mitochondrial ROS with age damages a specific downstream cellular function via the dMIC60-DMiro complex, targeting the complex should restore this function. To this end, we examined several parameters of cellular metabolism. We first measured ATP levels to determine the energy homeostasis. We found that flies with the reduced mutant, dMIC60-CS, had higher total ATP levels than those with dMIC60-WT (Fig. 4a).
  • DMiro RNAi in pan-neurons from adulthood significantly elevated both total and head ATP levels (Fig. 4b).
  • flies with dMIC60-CS had lower ROS levels than those with dMIC60-WT (Fig. 4c)
  • DMiro RNAi in pan-neurons greatly lowered ROS levels in older brains (Fig. 4d), showing that oxidative stress is alleviated.
  • mitochondrial membrane potential which is a driving force for mitochondrial ATP synthesis, in dopaminergic (DA) neurons of fly brains by TMRM staining.
  • TMRM The intensity of TMRM was normalized to that of Mito-GFP in the same DA neurons driven by TH-GAL4.
  • DMiro RNAi considerably improved it (Fig. 4e).
  • Fig. 4e We also evaluated whether cellular respiration was affected by aging and whether DMiro RNAi could normalize it.
  • Cells depend on a series of biochemical reactions both in the cytosol (glycolysis) and in the mitochondria (oxidative phosphorylation) to produce ATP.
  • a-Syn is the main constituent of Lewy bodies, a pathological feature of Parkinson’s disease (PD) which is characterized by a selective loss of DA neurons in the substantia nigra.
  • PD Parkinson’s disease
  • the a-syn protein pathology is a recurring theme in many other neurodegenerative diseases including Alzheimer’s disease, Lewy Body Dementia, and Multiple System Atrophy. It has been well-documented that a-syn accumulation enhances mitochondrial ROS production and impairs mitochondrial function. Indeed, we observed increased ROS levels detected by MitoSox staining in fly brains expressing human a-syn-A53T (Fig. 6a), consistent with a previous study.
  • the Membrane-Crossing Redox Sensor Acts in Flies with Frataxin Deficiency Acts in Flies with Frataxin Deficiency.
  • Flies with Frataxin Deficiency Now that we have demonstrated how the dMIC60-DMiro pathway is activated during both normal aging and a-syn toxicity in flies, we knew whether this mechanism also underlay childhood-onset mitochondrial diseases, many of which are characterized by oxidative stress due to mitochondrial dysfunction.
  • Friedreich’s Ataxia (FA) is an early-onset autosomal recessive genetic disease, caused by the extension of GAA repeats in the FTX gene, which encodes a mitochondria- localized protein called frataxin. Disease mutations reduce frataxin and disrupt mitochondrial function. High-energy-demanding neurons and heart cells are particularly affected.
  • oxidative stress is a compelling theory underpinning the disease pathology and anti-oxidation strategies have been successful in multiple FA models.
  • Flies deficient in the frataxin ortholog (Fh) have been established as useful models for understanding FA pathogenic mechanisms.
  • RNAi against Fh mitochondrial ROS levels in fly brains were elevated (Fig. 6g).
  • dMIC60 bound to DMiro and both proteins were mildly upregulated in whole-body lysates of these Fh RNAi flies (Fig. 6h).
  • MR5 treatment significantly rescued the age-dependent DA neuron loss and locomotor decline of oc-syn-A53T- expressing flies (Fig. 7b-c).
  • iPSCs induced pluripotent stem cells
  • SNCA encodes oc-syn
  • TH tyrosine hydroxylase
  • iPSC-derived DA neurons from PD patients are more vulnerable to stress than those from healthy controls.
  • MR5 treatment at 5 p.M for 30 hrs completely rescued the stress-induced degeneration of DA neurons derived from the PD patient (Fig. 7d, FIG. 16c), just like MR3.
  • cysteine oxidation switches protein structures to allow for stability of macromolecular complexes.
  • MIC19 another component of the MICOS complex, stabilizes the MICOS assembly via the oxidation of the cysteines in its CHCH domain. It will be of importance to determine whether MIC19 oxidation regulates the interaction between MIC60 and Miro.
  • MIC60 itself interacts with a myriad of proteins in the IMS and on the OMM, and associates in multiple complexes. These proteins include other MICOS components, PINK1 , the TOM complex, DISC1 , OPA1 , Sam50, Metaxin, and HSP70 etc. MIC60 cysteine oxidation may also affect those additional MIC60-associated protein complexes and consequently regulate their respective functions.
  • a systemic understanding of how MIC60 oxidation affects a network of mitochondrial proteins will reveal further mechanistic details and molecular pathways of MIC60 oxidation beyond Miro, and help us understand MIC60’s larger role in dictating multiple mitochondrial activities.
  • a previous paper using mutant EMS Fh alleles shows that ROS are not elevated in third instar larval ventral nerve cords (VNC).
  • VNC larval ventral nerve cords
  • Fig. 6g mitochondrial ventral nerve cords
  • the discrepancy might be caused by the different developmental stages examined. ROS elevation may be more evident in adult brains as compared to larval VNC.
  • mitochondrial membrane proteins are crucial for tailoring mitochondrial behaviors. Their unique membrane-bridging location makes these proteins a core unit to tunnel information in and out of the mitochondria, and to allow cells to swiftly respond to stressors and stimuli in their environments.
  • a better understanding of the regulations underlying mitochondrial membrane complexes on a precise temporal and spatial scale will help us direct strategies to intervene in pathological processes and prolong health-span and lifespan.
  • fly stocks The following fly stocks were used: w 1118 , Actin-GAL4 (Bloomington Drosophila Stock Center-BDSC), Elav-GAL4 (BDSC), TH-GAL4 (BDSC), UAS-mito-GFP (BDSC), UAS- GeneSwitch-GAL4, DMiro RNAl (#106683, Vienna Drosophila Resource Center-VDRC), DMiro RNAl (RNAi 2; #330334, VDRC), dMIC60 RNAi (#47615, VDRC), dMIC19 RNAl (#52251 , VDRC), Sam50 RNAi (#33642, VDRC), dMIC26 RNAl (#31098, VDRC), white RNAl (#30033, VDRC), and UAS-T7-DMiro.
  • UAS-dMIC60 WT -Myc and UAS-dMIC60 cs -Myc were generated using PhiC31 integrase-mediated transgenesis, with an insertion at an estimated position of 25C6 at the attP40 site (BestGene, Inc.)-
  • UAS-SNCA flies were generated by injecting pJFRC8-40xllAS-SNCA into 25C6 at the attP40 site at the Fly Facility at Department of Genetics of University of Cambridge.
  • pJFRC8-40x UAS-SNCA was generated by PCR amplifying the human SNCA cDNA from the pCMV6-XL5 vector (#SC119919, OriGene), engineered with the unique Xhol/Xbal restriction sites at either side, and cloning it into a pJFRC8-40xUAS-IVS-mCD8::GFP plasmid (a gift from Gerald Rubin, #26221 , Addgene).
  • PCR primers were: Forward- “GCGCCTCGAGATGGATGTATTCA”; Reverse-“GCGCTCTAGATTAGGCTTCAGGT”.
  • pcDNA3.1 -dMIC60-Flag was purchased from Genescript (OFa05646), and pcDNA3.1 -dMIC60- Flag with the C302S and C550S mutations was custom-made by Genescript.
  • pUASTAttB- dMIC60-CS C302S, C550S
  • pET101 -TGPG-dMIC60-CS AAs 92-739; C302S, C550S)-His-V5
  • pA1 -T7-DMiroA11 were custom-made by Synbio.
  • RNA Total RNA (5 pg) was then subjected to DNA digestion using DNase I (Ambion), immediately followed by reverse transcription using the iScript Reverse Transcription Supermix (1708841 , BIO-RAD). qPCR was performed using the StepOnePlusTM instrument (Thermo Fisher Scientific) and SYBR® Green Supermix (172-5270, BIO-RAD) by following the manufacturer’s instructions. qPCR was analyzed by the Step OneTM Software (Version 2.2.2), and relative expression level was presented by the ratio of target gene to the internal standard gene, RP49. Each sample was analyzed in duplicate. Four independent biological repeats were obtained. The following primers were used:
  • DMiro reverse 5’-GCCTCAGGTGAGGAAACGC -3’ dMIC19 forward: 5’-CGACGATGTGGTCAAGCGACT -3’ dMIC19 reverse: 5’-ACTTTCGGAGCAGGAGAAGC -3’ dMIC26 forward: 5’-CAGCTCCTGACCACTTCGAG -3’ dMIC26 reverse: 5’-TGGCTTGGGTTCTGTCTTGC -3’ Sam50 forward: 5’-GGTTGGAGTGGATTTGACGC -3’ Sam50 reverse: 5’-CAAAGAGGCCAATTTGGGGC -3’ RP49 forward: 5’-GCTAAGCTGTCGCACAAA -3’ RP49 reverse: 5’-TCCGGTGGGCAGCATGTG -3’
  • nitrocellulose membranes (16201 15, Bio-Rad) were used in semi-dry transfer with Bjerrum Schafer-Nielsen buffer (48 mM Tris, 39 mM glycine, 20% Methanol (v/v), pH 9.2).
  • Transferred membranes were first blocked in TBST (TBS with 0.05% Tween-20) with 5% milk for 1 hr at room temperature, and then immunoblotted with the following primary antibodies in TBST with 5% milk at 4°C overnight: guinea pig anti-DMiro (GP5) at 1 :20,000, rabbit anti-dMIC60 at 1 :3,000, rabbit anti-dMIC19 at 1 :3,000, mouse anti-ATP5p (ab14730, Abeam) at 1 :5,000, mouse anti-oc-tubulin (T6199, T5168, Sigma; 62204, Invitrogen) at 1 :3,000, mouse anti-p-actin (ab8224, Abeam) at 1 :5,000, mouse anti-VDAC (ab14734, Abeam) at 1 :3,000, rabbit anti-marf at 1 :1 ,000, mouse anti-oc-synuclein (ab27766, Abeam) at 1 :3,000, mouse anti-Mi
  • IP and Cell Culture Ten whole flies were homogenized in 300 pl lysis buffer (50 mM Tris pH7.5, 1 % Triton, 300 mM NaCI, 5 mM EDTA, 1 :1000 Protease Inhibitor Cocktail III— #539134, Millipore), followed by centrifugation at 13,000 rpm for 10 min at 4°C. Supernatant (30 pl) was reserved as “Input”.
  • the remaining 270 pl was incubated with 2 pl anti-DMiro or normal guinea pig IgG (#5051291 , Thermo Fisher) for 2 hrs on a nutator at 4°C, and then combined with 60 pl washed protein A-Sepharose beads (Amersham) for 1 hr at 4°C. Or lysates were mixed with 18 pl glutathione beads (GE Healthcare) and 1 pg GST-Miro1 (H00055288-P01 , Abnova). Beads were then washed 5 times with lysis buffer. Residual buffer was removed from the last wash and the beads were mixed with 50 pl 2xlaemmli buffer and loaded into SDS-PAGE.
  • Mitochondrial Isolation Mitochondrial Isolation. Mitochondria fractions were isolated as described previously with minor modifications. Briefly, forty 20-day-old whole flies were mechanically homogenized with a glass Dounce homogenizer in 1000 pl cold mitochondrial isolation buffer (70 mM sucrose, 21 OmM Mannitol, 50mM Tris-HCI pH7.5, 10 mM EDTA/TRIS pH 7.4, 1 :1000 Protease Inhibitor Cocktail III). After first centrifugation at 600 g for 10 min at 4°C to remove debris, crude supernatant was spun at 7,000 g for 10 min at 4°C to pellet intact mitochondria. After this step, supernatant was referred to “cytosolic fraction (Cyto)”.
  • 1000 pl cold mitochondrial isolation buffer 70 mM sucrose, 21 OmM Mannitol, 50mM Tris-HCI pH7.5, 10 mM EDTA/TRIS pH 7.4, 1 :1000 Protease Inhibitor Cocktail III
  • ATP Assay [00161 ] ATP Assay. ATP concentrations were determined using the Roche ATP Bioluminescence Assay Kit HS II (#11699709001 , Sigma). Briefly, 1 whole fly or 8 fly heads were homogenized in 150 pl ice-cold lysis buffer using a Kontes pellet pestle. Lysate was then boiled for 5 min and centrifuged at 20,000 g at 4°C for 1 min. Cleared lysate was diluted 1 :200 in dilution buffer and loaded with 10 pl luciferase. Luminescence was immediately measured using a FlexStation 3 (Molecular Devices). Total protein amount was measured using the bicinchoninic acid protein (BCA) assay (Thermo Fisher). The ATP level in each sample was normalized to the total protein amount.
  • BCA bicinchoninic acid protein
  • Images were acquired using a Leica SPE laser scanning confocal microscope equipped with a 10x/N.A.0.40 objective or 20x/N.A.0.60 oil Plan-Apochromat objective as Z stacks, with identical imaging parameters among different genotypes in a blinded fashion.
  • the total intensity of each individual brain was measured with Imaged (Ver. 1.48, NIH), and normalized to the background intensity.
  • TMRM tetramethylrhodamine methylester
  • T668 Molecular Probes
  • TMRM was present in the imaging media (25 nM TMRM in HBSS) during the live-imaging experiment.
  • TMRM fluorescence was excited at 561 nm and Mito-GFP at 488 nm using a Leica SPE laser scanning confocal microscope. Confocal images were obtained with a 63x/N.A.1 .30 oil Plan-Apochromat objective. Images were collected from the same neuron cluster. The mean intensity of TMRM is normalized to that of matrix-localized Mito-GFP within the same neuron cell body.
  • iPSC-derived neurons For immunostaining on iPSC-derived neurons, neurons were fixed in 4% paraformaldehyde (Electron Microscopy Sciences, Hatfield, PA) for 15 min, then washed twice in PBS (5 min each), and rinsed in deionized water. Alexa Fluor 594 picolyl azide based TUNEL assays were performed according to the manufacturer's instruction (C10618, Invitrogen). Coverslips were incubated with TdT reaction buffer at 37°C for 10 min, followed by TdT reaction mixture at 37°C for 60 min in a humidified chamber.
  • Neurons were blocked in PBS with 3% BSA for 60 min, and then immunostained with rabbit anti- TH (AB-152, EMD Millipore) at 1 :500 at 4°C overnight, followed by Alexa Fluor 488 fluorochrome conjugated goat anti-rabbit IgG (A1 1008, Invitrogen) at room temperature for 1 hr.
  • rabbit anti- TH AB-152, EMD Millipore
  • Alexa Fluor 488 fluorochrome conjugated goat anti-rabbit IgG A1 1008, Invitrogen
  • Samples were imaged at room temperature with a 20x/N.A.0.60 oil Plan-Apochromat objective on a Leica SPE laser scanning confocal microscope, with identical imaging parameters among different genotypes in a blinded fashion. Images were processed with Imaged (Ver. 1 .48, NIH) using only linear adjustments of contrast and color.
  • iPSCs Neuronal Derivation from iPSCs.
  • the iPSC work was approved by Stanford Stem Cell Oversight Committee.
  • iPSCs were purchased under an MTA from the NINDS human and cell repository, which is in a partnership with multiple institutions that deposited iPSCs, approved study protocols, ensured consent from donors, and explained the conditions for donating materials for research. All iPSC lines in this study are summarized below and have been fully characterized by our previous study and the NINDS human and cell repository.
  • iPSCs were derived to midbrain dopaminergic neurons as previously described with minor modifications. Briefly, neurons were generated using an adaptation of the dual-smad inhibition method with the use of smad inhibitors dorsormorphin (P5499, Sigma-Aldrich) and SB431542 (1614, Tokris), and the addition of GSK3P inhibitor CHIR99021 (04-0004, Stemgent) and smoothened agonist SAG (566661 , CalBioChem).
  • rosette-forming neuroectodermal cells were manually lifted and detached en bloc, and then cultured in suspension in a low-attachment dish (430589, Corning Inc.) with N2 medium with 20 ng/ml BDNF (450-02, Peprotech), 200 pM Ascorbic Acid (A5960, Sigma-Aldrich), 500 nM SAG, and 100 ng/ml FGF8a (4745-F8-050, R&D systems).
  • neurons were transferred onto poly-ornithine and laminin-coated glass coverslips in a 24-well plate.
  • N2 medium supplemented with 20 ng/ml BDNF, 200 pM Ascorbic Acid, 20 ng/ml GDNF (450-10, Peprotech), 1 ng/ml TGFP3 (AF-100-36E, Peprotech), and 500 pM Dibutyryl-cAMP (D0627, Sigma-Aldrich) for maturation of dopaminergic neurons.
  • Neurons were used at day 21 -22 after neuronal induction, when about 80-90% of total cells expressed the neuronal marker TUJ-1 , and 17.08%-19.25% of total cells expressed TH and markers consistent with ventral midbrain neuronal subtypes.
  • Antimycin A (A8674, Sigma-Aldrich) was applied to neurons at 10 pM.
  • pET101 -TGPG-dMIC60 (WT or CS)-His-V5 was transformed in BL21 DE3 non- pathogenic E. Coli by standard transformation methods.
  • a 3 ml culture suspended in a culture tube was incubated overnight at 37 e C and shook at 250 rpm in a shaking incubator. The following day, the culture was added to 200 ml of growth media (YT media/1% glucose/Amp+), and then incubated at 37 e C, 250 rpm in a shaking incubator for at least 2 hrs or until it reached an O.D. of 0.6.
  • IPTG (67-93-1 , Millipore Sigma) was added at a concentration of 0.1 mM, and the culture was allowed to incubate for an additional 2.5-3 hrs at 25°C, 180 rpm for optimum expression. Bacteria were then pelleted by centrifugation at 5,000 rpm for 15 min. After discarding the supernatant and resuspending the pellet in IxPBS with Protease Inhibitor Cocktail 111 (1 :1000), bacteria were sonicated on ice with a sonicator at 50% power, 32% amplitude for 6-7 min or until the solution changed color (generally going from a darker consistency to a lighter one).
  • pellets were lysed by Bugbuster (70922-3, 10 ml per 200 ml culture, Sigma) and Lysozyme (L3790, 2.5 ku per 1 ml Bugbuster, Sigma) with Protease Inhibitor Cocktail III (1 :1000). Cellular debris was removed by centrifugation at 12,000 rpm for 20 min. All subsequent steps were performed at 4 e C or on ice. Ni-NTA beads were washed and resuspended 3-4 times in 1xPBS with Protease Inhibitor Cocktail III (1 :1000) to a final solution of 50% Ni-NTA beads. Generally, 500 pil of beads was used for every 200 ml of bacteria.
  • This step was repeated along an imidazole concentration gradient with wash buffers consisting of 100 mM imidazole, 200 mM imidazole, and finally with an elution buffer containing 300 mM imidazole. Elution buffer was run over beads at least twice until no more protein of interest was eluted. Protein was concentrated to 2-4x and exchanged into NETN buffer (0.2 mM PMSF, 150 mM NaCI, 20 mM Tris-HCI pH 8.0, 0.5% NP-40, Protease Inhibitor Cocktail III) using a 2-6 ml PierceTM protein concentrator with a molecular weight cutoff (MWCO) of 30 KDa.
  • NETN buffer 0.2 mM PMSF, 150 mM NaCI, 20 mM Tris-HCI pH 8.0, 0.5% NP-40, Protease Inhibitor Cocktail III
  • Or flies were lysed in lysis buffer containing 1 mg/ml methoxypolyethylene glycol maleimide 5000 (PEG-MAL; 63187, Sigma), followed by centrifugation, and Laemmeli buffer was added to supernatant at 37 e C for 30 min. Or flies were lysed in lysis buffer containing 10 mM tris(2-carboxyethyl)phosphine (TCEP; 51805-45-9, Sigma), followed by centrifugation.
  • PEG-MAL methoxypolyethylene glycol maleimide 5000
  • TCEP tris(2-carboxyethyl)phosphine
  • mitochondrial fraction was treated with 10 mM TCEP at 37 e C for 30 min, pelleted via centrifugation and resuspended again, then Laemmeli buffer and 15 mM AMS were added, and the sample was incubated at 37 e C for 10 min.
  • Supernatant was batch-bound to IgG sepharose (GE Healthcare, Chicago, IL, USA) and washed with lysis buffer and then with wash buffer (30 mM HEPES pH 7.4, 250 mM KAc, 2 mM MgAc, 3 mM CaCI 2 , 20 pM GTP, 5% glycerol). Protein was eluted from sepharose by cleavage with Tobacco Etch Virus (TEV) protease in elution buffer (30 mM HEPES pH 7.4, 150 mM KAc, 2 mM MgAc, 3 mM CaCI 2 , 20 pM GTP, 5% glycerol) at 16 e C for 2 hrs.
  • TSV Tobacco Etch Virus
  • the eluate was concentrated in 10 KDa-MWCO spin filters (Millipore, Burlington, MA, USA). TEV and residual affinity tag was removed by passage of the protein through a Superdex 200 Increase 10/300 GL (GE Healthcare) in SEC buffer (30 mM HEPES pH 7.4, 150 mM KAc, 2 mM MgAc, 3 mM CaCI 2 , 20 pM GTP).
  • Mirol protein (0.4 mg/ml starting concentration) was combined with Sypro Orange protein stain (Sigma, St. Louis, MO, USA) at a final concentration of 2x(manufacturer’s assignment) in PBS. Protein was diluted in a 2-fold series in a final volume of 10 pl.
  • MR3 was diluted to 150 pM in PBS and then diluted in a 2-fold series. Diluted MR3 was added to wells of a 384-well plate, followed by protein and dye in equal proportion to yield the peak well-concentration of MR3 at 100 pM. Plate was sealed with optical grade plastic, spun for 1 min at 500xg to mix, and incubated at room temperature for 10 min prior to initiation of the melt program. Dilution values were measured in quadruplicate with PBS as the control. A separate row of MR3 plus dye alone confirmed there was no fluorescence in the absence of Mirol protein. The plate was read in a QuantFlex RT-PCR and a thermal melt curve from 25-95°C was applied at 0.03°C/s. Dye fluorescence was read with QuantStudio and analyzed with Thermal Shift Analyzer software.
  • the collected mass spectra were analyzed using Proteome Discoverer 2.2 (Thermo Scientific) against the Uniprot Drosophila Melanogaster database. Data were searched using Byonic v3.7.13 (Protein Metrics) as the peptide identification node. The precursor ion tolerance was set to 12 ppm. The fragment ion tolerance was set to 0.4 Da and 12 ppm for MS2 and MS3 scans, respectively. Trypsin was set as the enzyme, and up to two missed cleavages were allowed. N-termini and lysine residues modified by TMTI Oplex and cysteine modified with propionamide were set as fixed modifications in the search. Oxidation on methionine and deamidation on asparagine and glutamine were set as variable modifications. Data were validated using the standard reverse-decoy technique at a 1% false discovery rate.
  • TEM Third instar male larvae were filleted in 1 xCa 2+ free saline (0.128 M NaCI, 2 mM KCI, 5 mM EGTA, 4 mM MgCl2, 5 mM HEPES, 0.0355 M sucrose) and fixed in Karnovsky’s fixative (0.1 M sodium cacodylate buffer pH 7.4, 2% glutaraldehyde, and 4% paraformaldehyde) at room temperature (22°C) for 30 min and then kept at 4°C overnight.
  • 1 xCa 2+ free saline 0.128 M NaCI, 2 mM KCI, 5 mM EGTA, 4 mM MgCl2, 5 mM HEPES, 0.0355 M sucrose
  • Karnovsky’s fixative 0.1 M sodium cacodylate buffer pH 7.4, 2% glutaraldehyde, and 4% paraformaldehyde
  • Specimens were postfixed in cold/aqueous 1% osmium tetroxide for 1 hr, warmed to room temperature for 2 hrs, and then rinsed 3 times in ultra-filtered H 2 O. Specimens were subsequently stained en bloc with 1% uranyl acetate at room temperature for 2 hrs, dehydrated in a graded ethanol series, immersed in propylene oxide (PO) for 15 min, infiltrated with a graded series of PO and EMbed-812 resin, and then embedded in EMbed-812 resin at 65°C overnight. Sections were cut to a thickness of 75-90 nm and laid on formvar/carbon-coated slot Cu grids.
  • PO propylene oxide
  • Sections were stained for 40 sec with 3.5% uranyl acetate in 50% acetone followed by Sato’s Lead Citrate for 2 min. Sections were observed using a JEM-1400 120kV (Joel, Japan) and images were taken using an Orius 832 4k X 2.6k digital camera with 9
  • Black arrows in the Figure represent the times of oligomycin and rotenone/antimycin injections.
  • a total of at least three OCR and pH measurements were taken after each compound was administered.
  • Basal respiration was calculated as follows: (average(initial three measurements))-(average(last three measurements)) from the O 2 pmol/min readings.
  • ECAR was calculated as the average of the initial three measurements from the mpH/min readings.
  • Fibroblasts were obtained under an MTA from the National Institute of Neurological Disorders and Stroke (NINDS) human and cell repository or the Parkinson’s Progression Markers Initiative (PPMI), which is in a partnership with multiple institutions that approved study protocols, ensured consent from donors, and deposited fibroblasts. All available lines were acquired from NINDS at the time of purchase. Fibroblast and HEK cell culture, immunoprecipitation (IP), and mitochondrial purification were described in (Hsieh et al., 2016).
  • NINDS National Institute of Neurological Disorders and Stroke
  • PPMI Parkinson’s Progression Markers Initiative
  • CCCP in DMSO or the same volume of DMSO treated fibroblasts were lifted by a cell scraper, and mechanically homogenized with a Dounce homogenizer in 750 pl isolation buffer (200 mM sucrose, 10 mM TRIS/MOPS, pH 7.4). After centrifugation at 500 g for 10 min, crude supernatant was spun at 10,000 g for 10 min to pellet intact mitochondria. Mitochondrial pellet was washed twice with isolation buffer.
  • cytosolic fraction (Cyto)
  • pellet was resuspended in 50 pl lysis buffer (50 mM Tris pH 8.0, 150 mM NaCI, and 1% Triton X-100-T8787, Sigma-Aldrich) with 0.25 mM phenylmethanesulfonylfluoride (P7626, Sigma-Aldrich) and protease inhibitors (Roche) named “mitochondrial fraction (Mito).”
  • pRK5-EGFP-tau (#46904, addgene), pRK5-EGFP-tau-P301 L, pRK5-EGFP-tau-N279K, and pRK5-EGFP-tau-R406W (the latter three were custom-made by Synbio Technology) were used for transfection by the calcium phosphate transfection protocol (Wang and Schwarz, 2009).
  • Transferred membranes were first blocked overnight in phosphate-buffered saline (PBS) containing 5% fat-free milk and 0.1% tween-20 at 4°C, and then incubated with the following primary antibodies: mouse anti-Miro1 (WH0055288M1 , Sigma-Aldrich) at 1 :1 ,000, rabbit anti-Miro1 (HPA010687, Sigma-Aldrich) at 1 :1 ,000, rabbit anti-VDAC (4661 S, Cell Signaling Technology) at 1 :1 ,000, mouse anti-Mitofusin2 (H00009927-M01 , Abnova) at 1 :1 ,000, mouse anti-Parkin (sc32282, Santa Cruz Biotechnology) at 1 :500, rabbit anti-LRRK2 (NB300-268, Novus Biologicals) at 1 :500, rabbit anti-GAPDH (5174S, Cell Signaling Technology) at 1 :3,000, rabbit anti- -actin (4967S
  • Enzyme-Linked Immunosorbent Assay (ELISA). All experiments were performed as blinded tests. 40 pM CCCP in DMSO or the same volume of DMSO alone was applied to fibroblasts for 6 hrs, and then cells were lysed in lysis buffer (100 mM Tris, 150 mM NaCI, 1 mM EGTA, 1 mM EDTA, 1 % Triton X-100, 0.5% Sodium deoxycholate) with protease inhibitor cocktail (539134, Calbiochem). Cell debris was removed by centrifugation at 17,000 g for 10 min at 4°C.
  • lysis buffer 100 mM Tris, 150 mM NaCI, 1 mM EGTA, 1 mM EDTA, 1 % Triton X-100, 0.5% Sodium deoxycholate
  • TEM Transmission Electron Microscopy
  • wash buffer 0.05% Tween 20 in PBS, pH 7.3
  • FIG. 17F-G, 4E, Fig. 5B details are similar as in (Nguyen et aL, 2021 ).
  • the Rhotl ELISA kit (EKL54911 , Biomatik) was used according to the manufacturer’s instructions. The specificity and stability were validated by Biomatik. The dynamic detection range, sensitivity (lower limit of detection), and precision (inter- and intra-assay) were determined by both Biomatik and us. Briefly, 50 pl of cell lysate prepared from above, or serial dilutions of the standard (0-40 ng/ml) were added and incubated for 2 hrs at 37°C.
  • the LRRK2 and PINK1-Parkin Pathways are Affected in Pathogenic MAPT Fibroblasts.
  • the OMM protein Mitofusin2 is a target of the PINK1 -Parkin pathway, but not of LRRK2, for depolarization-triggered degradation.
  • At-risk subjects are younger asymptomatic family members of probands and carry the same genetic mutations.
  • 4 MAPT lines failed to significantly recruit LRRK2 to mitochondria, and 2 lines failed to recruit Parkin (FIG. 17A-C).
  • One line MAT-7, R406W
  • Basal levels of LRRK2 and Parkin were comparable among all lines (P>0.8).
  • FIG. 19A-B we saw mitochondria frequently juxtaposed with cytoskeleton (actin or microtubule) tracks in healthy control fibroblasts and this association was significantly reduced following CCCP treatment (FIG. 19A-B), showing that damaged mitochondria are sequestered from cytoskeleton networks.
  • MAPT fibroblasts failed to exhibit this response (FIG. 19A- B).
  • MAPT fibroblasts displayed the widespread presence of structures resembling lamellar bodies (LB) and multivesicular bodies (MV) under both basal and depolarized conditions (FIG. 19C), indicating possible imbalance in proteostasis and lipid homeostasis.
  • MAPT Mutations Disrupt Tau Interaction with Mirol Disrupt Tau Interaction with Mirol.
  • MAPT MAPT Mutations Disrupt Tau Interaction with Mirol.
  • Miro can localize to the ER-mitochondrial contact sites and anchors mitochondria to microtubule and actin tracks.
  • Miro is quickly removed from depolarized mitochondria, and our earlier results showed a unifying impairment in removing Mirol from damaged mitochondria in all 7 MAPT lines (FIG. 17), suggesting that Mirol and tau may coordinate to ensure an efficient mitophagy process.
  • Mirol Reducer Rescues the Phenotype of Mirol Retention in Pathogenic MAPT Fibroblasts.
  • the failure to remove Mirol from damaged mitochondria in fibroblasts of MAPT patients (FIG. 17) is reminiscent of that observed in fibroblasts of PD patients.
  • MR3 small molecule
  • Mirol Reducer could also promote Mirol degradation in /WAFT fibroblasts.
  • tau may conduct this role via Miro.
  • wild-type tau physically interacts with Mirol and mutant tau disrupts this interaction.
  • Both tau and Miro can reside at the ER-mitochondrial contact sites.
  • Miro is quickly detached from the OMM of depolarized mitochondria to facilitate the following mitophagy. Because the classical role of Miro is to anchor mitochondria to microtubule motors to mediate mitochondrial transport, eliminating Miro stops damaged mitochondrial motility and limits the spread of damage.
  • Nix is critical to two distinct phases of mitophagy, reactive oxygen species-mediated autophagy induction and Parkin-ubiquitin-p62-mediated mitochondrial priming.
  • Disrupted-in-schizophrenia 1 plays essential roles in mitochondria in collaboration with Mitofilin. Proceedings of the National Academy of Sciences of the United States of America 107, 17785-17790, doi:10.1073/pnas.1004361107 (2010).

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

L'invention concerne des méthodes et des compositions pour le traitement de l'ataxie de Friedreich.
PCT/US2022/041930 2021-08-31 2022-08-29 Agent thérapeutique à petites molécules pour l'ataxie de friedreich et la tauopathie WO2023034232A1 (fr)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202163238980P 2021-08-31 2021-08-31
US63/238,980 2021-08-31
US202163255266P 2021-10-13 2021-10-13
US63/255,266 2021-10-13

Publications (1)

Publication Number Publication Date
WO2023034232A1 true WO2023034232A1 (fr) 2023-03-09

Family

ID=85413003

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2022/041930 WO2023034232A1 (fr) 2021-08-31 2022-08-29 Agent thérapeutique à petites molécules pour l'ataxie de friedreich et la tauopathie

Country Status (1)

Country Link
WO (1) WO2023034232A1 (fr)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140256786A1 (en) * 2013-02-26 2014-09-11 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for treatment of mitochondrial diseases
WO2021046322A1 (fr) * 2019-09-05 2021-03-11 The Board Of Trustees Of The Leland Stanford Junior University Agent thérapeutique à petites molécules pour la maladie de parkinson associé à un biomarqueur d'activité thérapeutique
WO2022056111A1 (fr) * 2020-09-10 2022-03-17 Duke University Compositions et méthodes de traitement de troubles neurologiques

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140256786A1 (en) * 2013-02-26 2014-09-11 The Board Of Trustees Of The Leland Stanford Junior University Compositions and methods for treatment of mitochondrial diseases
WO2021046322A1 (fr) * 2019-09-05 2021-03-11 The Board Of Trustees Of The Leland Stanford Junior University Agent thérapeutique à petites molécules pour la maladie de parkinson associé à un biomarqueur d'activité thérapeutique
WO2022056111A1 (fr) * 2020-09-10 2022-03-17 Duke University Compositions et méthodes de traitement de troubles neurologiques

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
KAY LAURA; PIENAAR ILSE S.; COORAY RUWINI; BLACK GARY; SOUNDARARAJAN MEERA: "Understanding Miro GTPases: Implications in the Treatment of Neurodegenerative Disorders", MOLECULAR NEUROBIOLOGY, SPRINGER US, NEW YORK, vol. 55, no. 9, 6 February 2018 (2018-02-06), New York, pages 7352 - 7365, XP036561057, ISSN: 0893-7648, DOI: 10.1007/s12035-018-0927-x *

Similar Documents

Publication Publication Date Title
Ottolini et al. Alpha-synuclein at the intracellular and the extracellular side: functional and dysfunctional implications
Dagda et al. Beyond the mitochondrion: cytosolic PINK 1 remodels dendrites through Protein Kinase A
Parthsarathy et al. A novel retro-inverso peptide inhibitor reduces amyloid deposition, oxidation and inflammation and stimulates neurogenesis in the APPswe/PS1ΔE9 mouse model of Alzheimer’s disease
Velasco‐Estevez et al. Inhibition of Piezo1 attenuates demyelination in the central nervous system
Li et al. A mitochondrial membrane-bridging machinery mediates signal transduction of intramitochondrial oxidation
Tofaris Initiation and progression of α-synuclein pathology in Parkinson’s disease
Daniels et al. Cyclized NDGA modifies dynamic α-synuclein monomers preventing aggregation and toxicity
KR20120024529A (ko) 신경섬유 매듭 및 아밀로이드 베타의 축적으로부터 기인하는 진행성 인지 기능 장애의 치료용 렙틴 조성물 및 치료 방법
Chocron et al. Genetic and pharmacologic proteasome augmentation ameliorates Alzheimer’s-like pathology in mouse and fly APP overexpression models
Jeong et al. Broad activation of the Parkin pathway induces synaptic mitochondrial deficits in early tauopathy
Tawara et al. Muscle-dominant wild-type TDP-43 expression induces myopathological changes featuring tubular aggregates and TDP-43-positive inclusions
Brembati et al. Alpha synuclein post translational modifications: potential targets for Parkinson’s disease therapy?
Qi et al. Molecular hydrogen attenuates sepsis-induced cognitive dysfunction through regulation of tau phosphorylation
US20220288071A1 (en) A small molecule therapeutic for parkinson's disease paired with a biomarker of therapeutic activity
WO2023034232A1 (fr) Agent thérapeutique à petites molécules pour l'ataxie de friedreich et la tauopathie
Ben-Zichri et al. Bcl-2-Homology-Only Proapoptotic Peptides Modulate β-Amyloid Aggregation and Toxicity
Lima et al. The dopamine receptor agonist apomorphine stabilizes neurotoxic α‐synuclein oligomers
Scarcella et al. Metabolic rewiring and autophagy inhibition correct lysosomal storage disease in mucopolysaccharidosis IIIB
Kearney et al. Rit2 silencing in dopamine neurons drives a Parkinsonian phenotype
JP4857071B2 (ja) 筋萎縮性側策硬化症（ａｌｓ）の検出方法
Xue et al. Enhanced TARP-γ8-PSD-95 coupling in excitatory neurons contributes to the rapid antidepressant-like action of ketamine in male mice
US20210113552A1 (en) Methods for enhancing cellular clearance of pathological molecules via activation of the cellular protein ykt6
EP3727588B1 (fr) Peptides activateurs de l'enzyme adam 10 et leurs utilisations dans le traitement de la maladie d'alzheimer
Simmons 5-Ht1f receptor agonism for the treatment of spinal cord injury
van Veen Deficient lysosomal polyamine export is at the heart of ATP13A2-associated neurodegeneration

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22865390

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE