WO2023031856A1 - Compositions and methods for rna affinity purification - Google Patents

Compositions and methods for rna affinity purification Download PDF

Info

Publication number
WO2023031856A1
WO2023031856A1 PCT/IB2022/058234 IB2022058234W WO2023031856A1 WO 2023031856 A1 WO2023031856 A1 WO 2023031856A1 IB 2022058234 W IB2022058234 W IB 2022058234W WO 2023031856 A1 WO2023031856 A1 WO 2023031856A1
Authority
WO
WIPO (PCT)
Prior art keywords
mrna
rna
aptamer
utr
sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/IB2022/058234
Other languages
English (en)
French (fr)
Inventor
Jianping CUI
Tong-Ming Fu
Allison Jessica MATTHEWS
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sanofi SA
Original Assignee
Sanofi SA
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sanofi SA filed Critical Sanofi SA
Priority to AU2022336615A priority Critical patent/AU2022336615A1/en
Priority to EP22773306.0A priority patent/EP4396363A1/en
Priority to JP2024513920A priority patent/JP2024534216A/ja
Priority to CN202280059315.6A priority patent/CN117916387A/zh
Publication of WO2023031856A1 publication Critical patent/WO2023031856A1/en
Priority to US18/586,102 priority patent/US20240327847A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/115Aptamers, i.e. nucleic acids binding a target molecule specifically and with high affinity without hybridising therewith ; Nucleic acids binding to non-nucleic acids, e.g. aptamers
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K48/00Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
    • A61K48/005Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'active' part of the composition delivered, i.e. the nucleic acid delivered
    • A61K48/0066Manipulation of the nucleic acid to modify its expression pattern, e.g. enhance its duration of expression, achieved by the presence of particular introns in the delivered nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1003Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor
    • C12N15/1006Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers
    • C12N15/101Extracting or separating nucleic acids from biological samples, e.g. pure separation or isolation methods; Conditions, buffers or apparatuses therefor by means of a solid support carrier, e.g. particles, polymers by chromatography, e.g. electrophoresis, ion-exchange, reverse phase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P19/00Preparation of compounds containing saccharide radicals
    • C12P19/26Preparation of nitrogen-containing carbohydrates
    • C12P19/28N-glycosides
    • C12P19/30Nucleotides
    • C12P19/34Polynucleotides, e.g. nucleic acids, oligoribonucleotides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/16Aptamers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3519Fusion with another nucleic acid
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2830/00Vector systems having a special element relevant for transcription
    • C12N2830/50Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal

Definitions

  • mRNA messenger RNA
  • mRNA therapeutics are becoming an increasingly important approach for the treatment of a variety of diseases and is an emerging alternative to protein replacement therapies, antibody therapies, conventional vaccine therapies, and/or gene therapies.
  • the mRNA encoding the protein or peptide of interest is delivered to the patient or the target cell of the patient.
  • the patient's translational machinery Upon entry of the mRNA into the patient's target cell, the patient's translational machinery produces and subsequently express the protein or peptide of interest.
  • mRNA for therapeutics are often synthesized using in vitro transcription systems with enzymes such as RNA polymerases transcribing mRNA from template plasmid DNA, along with or followed by addition of a 5'- cap and 3 -polyadenylation.
  • enzymes such as RNA polymerases transcribing mRNA from template plasmid DNA, along with or followed by addition of a 5'- cap and 3 -polyadenylation.
  • the result of such reactionsi is a composition which includes full-length mRNA and various undesirable contaminants, e.g., proteins, non-RNA nucleic acids, undesired RNA species, spermidine, DNA, pyrophosphates, endotoxins, detergents, and organic solvents. These contaminants must be purified to provide a clean and homogeneous mRNA that is suitable for therapeutic use.
  • the disclosure provides a messenger RNA (mRNA) comprising at least one 5' untranslated region ( 5' UTR), at least one open reading frame (ORF), at least one 3' untranslated region (3' UTR), and at least one polyadenylation (polyA) sequence, wherein the mRNA comprises at least one RNA aptamer.
  • mRNA messenger RNA
  • ORF open reading frame
  • polyA polyadenylation
  • the RNA aptamer is embedded in an RNA scaffold.
  • the RNA scaffold comprises at least one secondary structure motif.
  • the secondary structure motif is a tetraloop, a pseudoknot, or a stem-loop.
  • the RNA scaffold comprises at least one tertiary structure.
  • the secondary structure motif and/or tertiary structure are nuclease resistant.
  • the RNA scaffold is a transfer RNA (tRNA), a ribosomal RNA (rRNA), or a ribozyme.
  • the ribozyme is catalytically inactive.
  • the RNA scaffold comprises a transfer RNA (tRNA).
  • the RNA aptamer is embedded in a tRNA hairpin loop of the tRNA.
  • the RNA aptamer is embedded in a tRNA anticodon loop of the tRNA.
  • the RNA aptamer is embedded in a tRNA D loop of the tRNA.
  • the RNA aptamer is embedded in a tRNA T loop of the tRNA.
  • the RNA aptamer is positioned in the 5' UTR. In some embodiments, the RNA aptamer is positioned between the 3' end of the ORF and the 5' end of the 3' UTR. In some embodiments, the RNA aptamer is positioned in the 3' UTR. In some embodiments, the RNA aptamer is positioned between the 3' end of the 3'UTR and the 5' end of the polyA sequence. In some embodiments, wherein the RNA aptamer is positioned at the 3' end of the polyA sequence.
  • the mRNA comprises or consists of one RNA aptamer. In some embodiments, the mRNA comprises between one and four RNA aptamers. In some embodiments, the RNA aptamers are identical. In some embodiments, the RNA aptamers are distinct.
  • the RNA aptamer is synthetically derived. In some embodiments, the RNA aptamer is a split aptamer or an X-aptamer. In some embodiments, the RNA aptamer is naturally-derived. In some embodiments, the RNA aptamer is derived from a hairpin RNA, a tRNA, or a riboswitch.
  • the RNA aptamer embedded in a bioorthogonal scaffold is embedded in a bioorthogonal scaffold.
  • the bioorthogonal scaffold is V5, F29, F30, or a variant thereof.
  • the bioorthogonal scaffold comprises a 5’ nucleotide sequence of SEQ ID NO: 34 and a 3' nucleotide sequence of SEQ ID NO: 35, wherein an aptamer sequence is positioned between SEQ ID NO: 34 and SEQ ID NO: 35.
  • the bioorthogonal scaffold comprises a 5' nucleotide sequence of SEQ ID NO: 39, an internal nucleotide sequence of SEQ ID NO: 40, and a 3' nucleotide sequence of SEQ ID NO: 41, wherein a first aptamer sequence is positioned between SEQ ID NO: 39 and SEQ ID NO: 40 and a second aptamer sequence is positioned between SEQ ID NO: 40 and SEQ ID NO: 41, optionally wherein the first and second aptamer are the same or different.
  • the RNA aptamer embedded bioorthogonal scaffold comprises the nucleotide sequence of SEQ ID NO: 29 or SEQ ID NO: 31.
  • the RNA aptamer binds to an affinity ligand.
  • the affinity ligand comprises protein A, protein G, streptavidin, glutathione, dextran, or a fluorescent molecule.
  • the affinity ligand comprises streptavidin.
  • the affinity ligand is immobilized on a chromatography resin.
  • the RNA aptamer is S1 m or Sm. In some embodiments, the mRNA comprises between one and four S1m or sm RNA aptamers. In some embodiments, the S1 m or sm RNA aptamer is positioned: 1) between the 3' end of the ORF and the 5' end of the 3' UTR; 2) in the 3' UTR; 3) between the 3' end of the 3'UTR and the 5’ end of the polyA sequence; and/or; 4) at the 3' end of the polyA sequence. In some embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 2 or 6. In some embodiments, the RNA aptamer embedded tRNA comprises the nucleotide sequence of SEQ ID NO: 7.
  • the mRNA encodes at least one polypeptide.
  • the polypeptide is a biologically active polypeptide, a therapeutic polypeptide, or an antigenic polypeptide.
  • the antigenic polypeptide comprises an antibody or fragment thereof, enzyme replacement polypeptide, or genome-editing polypeptide.
  • the therapeutic polypeptide comprises an antibody heavy chain, an antibody light chain, an enzyme, or a cytokine.
  • the biologically active polypeptide comprises a genome-editing polypeptide.
  • the mRNA contains a chimeric 5' or 3' UTR.
  • the mRNA comprises at least one chemical modification.
  • the chemical modification is pseudouridine, N1 -methylpseudouridine, 2-thlouridine, 4- thiouridine, 5- methylcytosine, 2-thio-l-methyl-1-deaza-pseudouridine, 2-thio-l-methyl-pseudouridine, 2-thio-5-aza-uridlne, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4- methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-l-methyl-pseudouridine, 4-thio- pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5- methoxyuridine, or 2'-O-methyl uridine.
  • the chemical modification is pseudouridine, N1 -methylpseudouridine, 5-methylcytosine, 5- methoxyuridine, or a combination thereof. In some embodiments, the chemical modification is N1 -methylpseudouridine.
  • the polyA sequence is at least 10 consecutive adenosine residues. In some embodiments, the polyA sequence is between 10 and 500 consecutive adenosine residues. In some embodiments, the mRNA comprises two polyA sequences, each polyA sequence comprising between 10 and 500 consecutive adenosine residues, wherein at least one RNA aptamer or RNA aptamer embedded tRNA is positioned between the two polyA sequences.
  • the mRNA comprises a 5' cap.
  • the translation efficiency of the mRNA is substantially the same compared to an mRNA that does not comprise an RNA aptamer.
  • the mRNA is synthesized using in vitro transcription (IVT).
  • the mRNA is expressed in vivo or ex vivo.
  • the disclosure provides a vector encoding the mRNA described above.
  • the vector comprises at least elements a-e, from 5' to 3': a) an RNA polymerase promoter; b) a polynucleotide sequence encoding a 5' UTR; c) a polynucleotide sequence encoding an ORF; d) a polynucleotide sequence encoding a 3' UTR; and e) a polynucleotide sequence encoding at least one RNA aptamer.
  • the vector further comprises a polynucleotide sequence encoding a polyA sequence and/or a polyadenylation signal.
  • the disclosure provides a host cell comprising the vector described above.
  • the disclosure provides a pharmaceutical composition comprising the mRNA described above.
  • the pharmaceutical composition is administered to a subject In need thereof in a method of treating or preventing a disease or disorder.
  • a method for purifying an mRNA comprising the steps of: (a) contacting a sample comprising the mRNA with an affinity ligand that is immobilized on a chromatography resin, wherein the RNA aptamer comprises binding affinity for the affinity ligand; (b) eluting the mRNA from the chromatography resin; and (c) purifying the mRNA from the sample.
  • the method comprises one or more washing steps between the contacting step (a) and the eluting step (b).
  • RNA comprises at least one open reading frame (ORF) and at least one RNA aptamer, wherein the RNA aptamer comprises binding affinity for the affinity ligand.
  • ORF open reading frame
  • the RNA further comprises at least one 5' untranslated region (5' UTR), at least one 3' untranslated region (3' UTR), and at least one polyadenylation (polyA) sequence.
  • 5' UTR 5' untranslated region
  • 3' UTR 3' untranslated region
  • polyA polyadenylation
  • the RNA is at least about 500 nucleotides in length, at least about 750 nucleotides in length, at least about 1 ,000 nucleotides in length, at least about 1 ,500 nucleotides in length, at least about 2,000 nucleotides in length, at least about 2,500 nucleotides in length, at least about 3,000 nucleotides in length, at least about 3,500 nucleotides in length, at least about 4,000 nucleotides in length, at least about 4,500 nucleotides in length, or at least about 5,000 nucleotides in length.
  • the RNA comprises a 5' cap. In some embodiments, the RNA is an mRNA.
  • the mRNA is greater than or equal to 90% pure.
  • a method for purifying an mRNA comprising the steps of (a) contacting a sample comprising the mRNA with an affinity ligand that is immobilized on a chromatography resin; (b) eluting the mRNA from the chromatography resin; and (c) isolating the mRNA from the sample, wherein the mRNA comprises at least one 5' untranslated region (5' UTR), at least one open reading frame (ORF), at least one 3' untranslated region (3' UTR), at least one polyadenylation (polyA) sequence, and at least one RNA aptamer, wherein the RNA aptamer comprises binding affinity for the affinity ligand.
  • the mRNA is greater than or equal to 90% pure.
  • a pharmaceutical composition comprising a plurality of mRNA molecules, wherein at least about 90% of an mRNA comprise at least one 5' untranslated region ( 5' UTR), at least one open reading frame (ORF), at least one 3' untranslated region (3' UTR), at least one polyadenylation (polyA) sequence, and at least one RNA aptamer.
  • 5' UTR 5' untranslated region
  • ORF open reading frame
  • polyA polyadenylation
  • mRNA messenger RNA
  • ORF open reading frame
  • polyA polyadenylation
  • mRNA messenger RNA
  • ORF open reading frame
  • polyA polyadenylation
  • mRNA messenger RNA
  • ORF open reading frame
  • polyA polyadenylation
  • FIG. 1 schematizes the steps in the aptamer tagged mRNA affinity purification process.
  • FIG. 2 shows the RNA concentration (ng) as measured on a Nanodrop prior to incubation with streptavidin sepharose beads (input) or following streptavidin affinity binding purification and elution steps with either a random aptamer or the S1 m aptamer (unbound versus eluted). Percent RNA recovered after affinity purification is relative to the input sample that did not undergo affinity purification.
  • FIG. 3 depicts the plasmid maps of pAM14 (2,496 bp) carrying an ARE element tagged with the 4xS1m aptamer or the pAM15 plasmid (2,168 bp) carrying the untagged ARE element.
  • FIG. 4 shows the RNA concentration (ng) as measured on a Nanodrop prior to incubation with streptavidin sepharose beads (input) or following streptavidin affinity binding purification and elution steps with either a TN Fa- 53 tagged 4xS1m aptamer mRNA or a TNFa-53 mRNA negative control (unbound versus eluted). Percent RNA purified is relative to input sample that did not undergo affinity purification.
  • FIG. 5 depicts the following plasmid maps containing the following constructs: (1 ) pAM22, a control plasmid of 2,173 bp, carrying a M. thermautotrophicust tRNA GLN2 scaffold (pAM22 (tRNA); plasmid map annotates the position of the anticodon arms with respect to the Gln2 anticodon loop) (2) pAM20, a control plasmid of 2,134 bp, carrying a Sm aptamer (pAM20 (Sm)), (3) pAM21, an experimental plasmid of 2,206 bp, carrying the Sm aptamer sequence embedded in a portion of the anticodon loop tRNA GLN2 sequence which is flanked on both sides by the tRNA anticodon arm sequence (pAM21 (tRNA Sm) , and (4) pAM23, an experimental plasmid of 2,306 bp, carrying tandem two-repeat configuration of the Sm-tRNA
  • FIG. 6 shows the RNA concentration (ng) as measured on a Nanodrop prior to incubation with streptavidin sepharose beads (input) or following streptavidin affinity binding purification wash steps (wash 1-3) and elution step (eluted) with either mRNA containing the Sm, tRNA, tRNA-Sm, and 2x tRNA Sm aptamer tags. Percent RNA recovery after affinity purification is relative to the input sample that did not undergo affinity purification.
  • FIG. 7 Illustrates the aptamer tagging strategies for optimized binding affinity and translation of mRNA based on aptamer-transcript localization, aptamer copy number, an aptamer embedded in a tRNA scaffold, and tandem repeat copies of an aptamer embedded in a tRNA scaffold.
  • FIG. 8 depicts plasmid maps pAM11 (3,541 bp) carrying humanized ehnanced green fluorescent protein (hEGFP) and pAM8 plasmid (3,213 bp) carrying hEGFP tagged with a 4xS1m aptamer.
  • FIG. 9 is an image of an agarose gel containing mRNA generated from an IVT reaction of PCR product template for hEGFP (lane 1, derived from pAM11) and hEGFP tagged with 4xS1m aptamer (lane 2, derived from pAMB).
  • FIG. 10 shows the RNA concentration (ng) as measured on a Nanodrop prior to incubation with streptavidin sepharose beads (input) or following streptavidin affinity binding purification and elution step (eluted) with either mRNA containing the hEGFP or hEGFP tagged with a 4xS1m aptamer. Percent RNA purified is relative to input sample that did not undergo affinity purification.
  • FIG. 11 are representative fluorescent microscopy images taken of HEK293FT cells transfected with hEGFP or hEGFP-4xS1m mRNA after 24 hours.
  • FIG. 12 displays a panel of representative fluorescent microscopy images taken of HEK293FT cells transfected with hEGFP (left column, top panel), hEGFP-4xS1m (left column, bottom panel), hEGFP with longer polyA tail (right column, top panel), or hEGFP-4xS1m with longer polyA tail (right column, bottom panel) mRNA after 24 hours.
  • FIG. 13A - FIG. 13B tests whether the topological order of the S1m aptamer impacts downstream mRNA affinity purification.
  • FIG. 13A is a schematic of the experimental constructs designed to test the S1m aptamer position in the mRNA transcript. The S1m aptamer was either placed (1) directly upstream of the 5' UTR; (2) directly upstream of the 3'UTR; (3) in the 3' UTR; (4) directly downstream the 3' UTR; or (5) in the 3' end of the polyA sequence.
  • FIG. 13B shows the percent of RNA recovered after affinity purification relative to the input sample that did not undergo affinity purification following streptavidin binding and elution steps (unbound versus eluted).
  • FIG. 14 tests whether the aptamer copy number (valency) in the transcript impacts downstream mRNA affinity purification.
  • FIG. 14 shows the percent of RNA recovered after affinity purification relative to the input sample that did not undergo affinity purification following streptavidin binding and elution steps (unbound versus eluted) with mRNA constructs that contained between one and six copies of S1 m aptamer.
  • FIG. 15 shows the percent of RNA recovered after mRNA affinity purification relative to the input sample that did not undergo affinity purification following streptavidin binding and elution steps (unbound versus eluted) with 2xS1m, 4xS1m, or the tRNA S1m aptamer tagged mRNA containing a different protein-coding sequence (Singapore '16 hemagglutinin) and distinct UTRs.
  • FIG. 16A • FIG. 16C tests whether the aptamer placement in the mRNA transcript impacts translation kinetics in HSKMc cells.
  • FIG. 16A is a schematic of the experimental constructs designed to test the impact of the S1 m aptamer position relative to the other topologically ordered components of the mRNA.
  • FIG. 16B is a bar graph of the total number of GFP positive cells (expressed as percent) as calculated by flow cytometry analysis for HSKMc cells transfected with either the untagged control mRNA or one of the five aptamer tagged mRNAs shown in FIG. 16A.
  • FIG. 16C is a bar graph displaying the number of GFP positive high cells (expressed as percent) in FIG. 16B.
  • FIG. 17A - FIG. 17C tests whether the aptamer placement in the mRNA transcript impacts translation kinetics in Hela cells.
  • FIG. 17A is a schematic of the experimental constructs designed to test the impact of the S1 m aptamer position relative to the other topologically ordered components of the mRNA.
  • FIG. 17B is a bar graph of the total number of GFP positive cells (expressed as percent) as calculated by flow cytometry analysis for Hela cells transfected with either the untagged control mRNA or one of the five aptamer tagged mRNAs shown in FIG. 17A.
  • FIG. 17C is a bar graph displaying only the number of GFP positive high cells (expressed as percent) in FIG. 17B.
  • FIG. 18 depicts a bar graph of the total number of GFP positive cells (expressed as percent) as calculated by flow cytometry analysis for Hela cells transfected with either the controls or with an aptamer tagged mRNA which had increased polyA tail length (labeled, ‘Aptamer, poly(A) 2x60_6 +A’s").
  • FIG. 19A - FIG. 19B examines whether the stabilization of an S1m aptamer with a tRNA scaffold impacts mRNA affinity purification and the subsequent mRNA translational efficiency.
  • FIG. 19A - FIG. 19B examines whether the stabilization of an S1m aptamer with a tRNA scaffold impacts mRNA affinity purification and the subsequent mRNA translational efficiency.
  • FIG. 19A is a bar graph which shows the percent of RNA recovered after mRNA affinity purification relative to the input sample following streptavidin binding and elution steps (unbound versus eluted) with the untagged mRNA control, the 2xS1m aptamer, the 4xS1m aptamer transcript, or tRNA S1m aptamer tagged mRNA.
  • FIG. 19B is a bar graph of the total number of GFP positive Mela cells (expressed as percent) as calculated by flow cytometry analysis after transfection with the untagged mRNA control or the tRNA S1m aptamer tagged mRNA (labeled, ‘tRNA stabilized aptamer”).
  • FIG. 20A is the secondary RNA structure formed by the F30-aptamer.
  • FIG. 20B is a bar graph which shows the percent of RNA recovered after mRNA affinity purification relative to the input sample following streptavidin binding and elution steps (unbound versus eluted) with the untagged mRNA control, the 4xS1m aptamer, the 1xS1m aptamer stabilized in a F30 scaffold (F30 ⁇ 1xS1m), or the 2xS1 m aptamer stabilized in a F30 scaffold (F30-2xS1 m) tagged mRNA.
  • RNA concentration ng
  • streptavidin sepharose beads input
  • streptavidin affinity binding purification and elution step eluted with either the untagged mRNA control, the 4xS1 m aptamer, the F30-2xS 1m aptamer, or the F30-1xS1m tagged mRNA.
  • the present disclosure is directed to, inter alia, novel mRNA compositions and methods for RNA affinity purification.
  • the disclosure relates to mRNA compositions comprising at least one RNA aptamer.
  • the RNA aptamers associated with the disclosed mRNA compositions enable the use of effective affinity purification methods yet have minimal impact on translation efficiency and immunogenicity. Also disclosed herein are methods of making these mRNA-tagged aptamer compositions.
  • a or “an” entity refers to one or more of that entity; for example, “a nucleotide sequence,” is understood to represent one or more nucleotide sequences.
  • the terms “a” (or “an”), “one or more,” and “at least one” can be used interchangeably herein.
  • the term indicates deviation from the indicated numerical value by ⁇ 10%, ⁇ 5%, ⁇ 4%, ⁇ 3%, ⁇ 2%, ⁇ 1%, ⁇ 0.9%, ⁇ 0.8%, ⁇ 0.7%, ⁇ 0.6%, ⁇ 0.5%, ⁇ 0.4%, ⁇ 0.3%, ⁇ 0.2%, ⁇ 0.1%, ⁇ 0.05%, or ⁇ 0.01%.
  • "about” indicates deviation from the indicated numerical value by ⁇ 10%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 5%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 4%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 3%.
  • “about” indicates deviation from the indicated numerical value by ⁇ 2%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 1%. In some embodiments, “about” indicates deviation from the Indicated numerical value by ⁇ 0.9%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.8%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.7%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.6%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.5%. In some embodiments, “about” indicates deviation from the Indicated numerical value by ⁇ 0.4%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.3%.
  • “about” indicates deviation from the indicated numerical value by ⁇ 0.1%. In some embodiments, “about” indicates deviation from the indicated numerical value by ⁇ 0.05%. In some embodiments, “about” indicates deviation from the Indicated numerical value by ⁇ 0.01%.
  • a polynucleotide may encompass a singular nucleic add as well as plural nucleic acids.
  • a polynucleotide is an isolated nucleic acid molecule or construct, e.g., messenger RNA (mRNA) or plasmid DNA (pDNA).
  • mRNA messenger RNA
  • pDNA plasmid DNA
  • a polynucleotide comprises a conventional phosphodiester bond.
  • a polynucleotide comprises a non-conventional bond (e.g., an amide bond, such as found in peptide nucleic acids (PNA)).
  • PNA peptide nucleic acids
  • nucleic acid may refer to any one or more nucleic add segments, e.g., DNA or RNA fragments, present in a polynucleotide.
  • isolated nudeic acid or polynudeotide is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment.
  • a recombinant polynudeotide encoding a Factor VIII polypeptide contained in a vector is considered isolated for the purposes of the present disclosure.
  • Further examples of an isolated polynudeotide include recombinant polynucleotides maintained in heterologous host cells or purified (partially or substantially) from other polynucleotides in a solution.
  • Isolated RNA molecules indude in vivo or in vitro RNA transcripts of polynucleotides of the present disclosure.
  • Isolated polynudeotides or nucleic acids according to the present disclosure further include such molecules produced synthetically.
  • a polynucleotide or a nucleic add can include regulatory elements such as promoters, enhancers, ribosome binding sites, or transcription termination signals.
  • polypeptide is intended to encompass a singular "polypeptide” as well as plural “polypeptides,” and refers to a molecule composed of monomers (amino adds) linearly linked by amide bonds (also known as peptide bonds).
  • polypeptide refers to any chain or chains of two or more amino acids, and does not refer to a specific length of the product.
  • polypeptides dipeptides, tripeptides, oligopeptides, "protein,” “amino add chain,” or any other term used to refer to a chain or chains of two or more amino acids, are induded within the definition of "polypeptide,” and the term “polypeptide” can be used instead of, or interchangeably with any of these terms.
  • polypeptide is also intended to refer to the products of post-expression modifications of the polypeptide, including without limitation glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, or modification by non-naturally occurring amino adds.
  • a polypeptide can be derived from a natural biological source or produced recombinant technology, but is not necessarily translated from a designated nucleic add sequence. It can be generated in any manner, Induding by chemical synthesis.
  • an "isolated" polypeptide or a fragment, variant, or derivative thereof refers to a polypeptide that is not in its natural milieu. No particular level of purification is required. For example, an isolated polypeptide can simply be removed from its native or natural environment. Recombinantly produced polypeptides and proteins expressed in host cells are considered isolated for the purpose of the disclosure, as are native or reoombinant polypeptides which have been separated, fractionated, or partially or substantially purified by any suitable technique.
  • administering refers to delivering to a subject a composition described herein, e.g., a chimeric protein.
  • the composition e.g., the chimeric protein
  • the composition can be administered Intravenously, subcutaneously, intramuscularly, intradermally, or via any mucosal surface, e.g., orally, sublingually, buccally, nasally, rectally, vaginally or via pulmonary route.
  • the administration is intravenous.
  • the administration is subcutaneous.
  • the administration is self-administration.
  • a parent administers the chimeric protein to a child.
  • the chimeric protein is administered to a subject by a healthcare practitioner such as a medical doctor, a medic, or a nurse.
  • mRNA messenger RNA
  • mRNA compositions comprising RNA aptamers.
  • mRNA is typically thought of as the type of RNA that carries information from DNA to the ribosome.
  • the existence of mRNA is typically very brief and includes processing and translation, followed by degradation.
  • mRNA processing comprises the addition of a "cap” on the N- terminal (5') end, and a "tail” on the C-terminal (3') end.
  • a typical cap is a 7-methylguanosine cap, which is a guanosine that is linked through a 5'- 5 -triphosphate bond to the first transcribed nucleotide.
  • the presence of the cap is important in providing resistance to nucleases found in most eukaryotic cells.
  • a 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5' nucleotide, leaving two terminal phosphates; guanosine triphosphate (GTP) is then added to the terminal phosphates via a guanylyl transferase, producing a 5 '5 '5 triphosphate linkage; and the 7- nitrogen of guanine is then methylated by a methyltransferase.
  • GTP guanosine triphosphate
  • mRNAs include a 5' and/or 3' untranslated region (UTR).
  • mRNA disclosed herein comprise a 5' UTR that includes one or more elements that affect an mRNA's stability or translation.
  • a 5' UTR may be between about 50 and 500 nucleotides in length.
  • mRNA disclosed herein comprise a 3' UTR comprising one or more of a polyadenylation signal, a binding site for proteins that affect an mRNA's stability of location in a cell, or one or more binding sites for miRNAs.
  • a 3' UTR may be between 50 and 500 nucleotides in length or longer.
  • the mRNAs disclosed herein comprise a 5' or 3' UTR that is derived from a gene distinct from the one encoded by the mRNA transcript.
  • the mRNAs disclosed herein comprise a 5' or 3' UTR that is chimeric.
  • mRNAs disclosed herein may be synthesized according to any of a variety of known methods.
  • mRNAs according to the present invention may be synthesized via in vitro transcription (IVT).
  • IVT in vitro transcription
  • Methods for in vitro transcription are known in the art. See, e.g., Geall et al. (2013) Semin. Immunol. 25(2): 152-159; Brunelle et al. (2013) Methods Enzymol. 530:101-14.
  • IVT is typically performed with a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, and an appropriate RNA polymerase (e.g., T3, T7 or SP6 RNA polymerase), DNAse I, pyrophosphatase, and/or RNAse inhibitor.
  • RNA polymerase e.g., T3, T7 or SP6 RNA polymerase
  • DNAse I e.g., pyrophosphatase
  • RNAse inhibitor e.g., RNA polymerase
  • the exact conditions will vary according to the specific application.
  • the presence of these reagents is undesirable in a final mRNA product and are considered impurities or contaminants which must be purified to provide a clean and homogeneous mRNA that is suitable for therapeutic use.
  • mRNA provided from in vitro transcription reactions may be desirable in some embodiments, other sources of mRNA
  • the methods disclosed herein may be used to purify mRNA of a variety of nucleotide lengths. In some embodiments, the disclosed methods may be used to purify mRNA of greater than about 1 kb, 1.5 kb, 2 kb, 2.5 kb, 3 kb, 3.5 kb, 4 kb. 4.5 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, 10 kb, 11 kb, 12 kb, 13 kb, 14 kb, or 15 kb in length.
  • the mRNA disclosed herein may be modified or unmodified. In some embodiments, the mRNA disclosed herein contain one or more modifications that typically enhance RNA stability.
  • the disclosed mRNAs may be synthesized from naturally occurring nucleotides and/or nucleotide analogues (modified nucleotides) including, but not limited to, purines (adenine (A), guanine (G)) or pyrimidines (thymine (T), cytosine (C), uracil (U)), and as modified nucleotides analogues or derivatives of purines and pyrimidines, such ase.g.
  • the disclosed mRNAs comprise at least one chemical modification including but not limited to, consisting of pseudouridine, N1 -methylpseudouridine, 2-thiouridine, 4'- thiouridine, 5- methylcytosine, 2-thio-kmethyl-1-deaza-pseudouridine, 2-thio-kmethykpseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4- methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-l-methykpseudouridine, 4-thio- pseudouridlne, 5-aza-urldine, dihydropseudouridine, 5-methyluridine, 5-methyluridine, 5- methoxyuridine, and 2*-O-methyl uridine.
  • pseudouridine N1 -methylp
  • the modified nucleotides comprise N1 -methylpseudouridine.
  • the preparation of such analogues is known to a person skilled In the art e.g. from the U.S. Pat No. 4,373,071, U.S. Pat. No. 4,401,796, U.S. Pat No. 4,415,732, U.S. Pat. No. 4,458,066, U.S. Pat. No. 4,500,707, U.S. Pat. No. 4,668,777, U.S. Pat. No. 4,973,679, U.S. Pat No. 5,047,524, U.S. Pat. No. 5,132,418, U.S. Pat. No. 5,153,319, U.S. Pat. No. 5,262,530, and U.S. Pat. No. 5,700,642.
  • the mRNAs disclosed herein contains mRNA derived from a single gene or a single synthesis or expression construct.
  • the mRNA compositions disclosed herein comprise multiple mRNA transcripts and each can or collectively code for one or more proteins.
  • the mRNA comprising the RNA aptamer as disclosed herein encodes a therapeutic polypeptide
  • the therapeutic polypeptide comprises an antibody heavy chain, an antibody light chain, an enzyme, or a cytokine.
  • the mRNA encodes a cytokine.
  • cytokines include IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31, IL-32, IL-33, INF -a, INF-y.
  • the mRNA comprising the RNA aptamer encodes a genome-editing polypeptide.
  • the genome-editing polypeptide is a CRISPR protein, a restriction nuclease, a meganuclease, a transcription activator-like effector protein (TALE, including a TALE nuclease, TALEN), or a zinc finger protein (ZF, including a ZF nuclease, ZFN). See, e.g., Int’l Pub. No. W02020139783.
  • the mRNA encodes an enzyme that is utilized in an enzyme replacement therapy.
  • enzyme replacement therapy include lysosomal diseases, such as Gaucher disease, Fabry disease, MPS I, MPS II (Hunter syndrome), MPS VI and Glycogen storage disease type II.
  • the mRNA comprising the RNA aptamer encodes an antigen of interest.
  • the antigen may be a polypeptide derived from a virus, for example, influenza virus, coronavirus (e.g., SARS-CoV-1, SARS-CoV-2, or MERS-related virus), Ebola virus, Dengue virus, human immunodeficiency virus (HIV), hepatitis A virus (HAV), hepatitis B virus (HBV), hepatitis C virus (HCV), herpes simplex virus (HSV), respiratory syncytial virus (RSV), rhinovirus, cytomegalovirus (CMV), zika virus, human papillomavirus (HPV), human metapneumovirus (hMPV), human parainfluenza virus type 3 (PIV3), Epstein-Barr virus (EBV), or chikungunya virus.
  • a virus for example, influenza virus, coronavirus (e.g., SARS-CoV-1,
  • the antigen may be derived from a bacterium, for example, Staphylococcus aureus, Moraxella (e.g., Moraxella catarrhalis; causing otitis, respiratory infections, and/or sinusitis), Chlamydia trachomatis (causing chlamydia), borrelia (e.g., Borrelia burgdorferi causing Lyme Disease), Bacillus anthrads (causing anthrax), Salmonella typhi (causing typhoid fever), Mycobacterium tuberculosis (causing tuberculosis), Propionibacterium acnes (causing acne), or non- typeabie Haemophilus influenzae.
  • Moraxella e.g., Moraxella catarrhalis; causing otitis, respiratory infections, and/or sinusitis
  • Chlamydia trachomatis causing chlamydia
  • borrelia e.g., Borrelia
  • the mRNA comprising the RNA aptamer may encode for more than one antigen.
  • the mRNAs disclosed herein encode for two, three, four, five, six, seven, eight, nine, ten, or more antigens. These antigens can be from the same or different pathogens.
  • a potydstronic mRNA that can be translated into more than one antigen (e.g., each antigen-coding sequence is separated by a nucleotide linker encoding a self-cleaving peptide such as a 2A peptide) and can be further fused to the aptamer.
  • the mRNA compositions disclosed herein are used In a vacdne.
  • mRNA vacdnes provide a promising alternative to traditional subunit vaccines, which contain antigenic proteins derived from a pathogen.
  • Vaccines based on mRNA allow de novo expression of complex antigens in the vaccinated subject, which in turn allows proper post-translational modification and presentation of the antigens in its natural conformation.
  • the manufacturing process for mRNA vaccines can be used for a variety of antigens, enabling rapid development and deployment of mRNA vaccines.
  • a detailed discussion of mRNA vaccines can be found in Pardi, et al. (2016) Nat Rev Drug Discov 17, 261-279.
  • RNA to be purified naturally contains a sequence with strong affinity for a target that can be immobilized on the stationary phase (i.e., a chromatography resin), the RNA may require tagging with a specific sequence to do so, analogous to the polyhistidine tag used in protein science.
  • mRNA compositions which comprise at least one aptamer.
  • the aptamers associated with these mRNA compositions enable the use of affinity purification with minimal impact on translation efficiency and immunogenicity.
  • methods of making such mRNA-tagged aptamer compositions are also disclosed herein.
  • aptamer refers to any nucleic acid sequence that has a non- covalent binding site for a specific target.
  • exemplary aptamer targets include nucleic acid sequence, protein, peptide, antibody, small molecule, mineral, antibiotic, and others.
  • the aptamer binding site may result from secondary, tertiary, or quaternary conformational structure of the aptamer.
  • RNA aptamer refers to an aptamer comprised of RNA.
  • the RNA aptamer is included in the nucleotide sequence of the mRNA transcript. In other embodiments, the RNA aptamer is separate from the nucleotide sequence of the mRNA transcript.
  • Aptamers are typically capable of binding to specific targets with high affinity and specificity. Aptamers have several advantages over other binding proteins (e.g. antibodies). For example, aptamers can be engineered completely in vitro (e.g., via a SELEX aptamer selection method), can be produced by chemical synthesis, possess desirable storage properties, and elicit little or no immunogenicity in therapeutic applications. See, generally, Proske ef al., (2005) Appl. Microbiol. Biotechnol 69:367-374. [0095] Aptamers have historically been used to modulate gene expression by directly binding to ligands. These aptamers act similarly to regulatory proteins, forming highly specific binding pockets for the target, followed by conformational changes.
  • the RNA aptamer is synthetically derived. In some embodiments, the RNA aptamer is naturally derived from prokaryotes and/or eukaryotes. In some embodiments, the RNA aptamer is derived from a hairpin RNA, a tRNA, or a riboswitch.
  • the RNA aptamer is derived from a riboswitch.
  • Riboswitches are regulatory RNA elements that act as small molecule sensors to control gene transcription and translation.
  • riboswitch classes are known in the art. Exemplary riboswitches include B12 riboswitch, TPP riboswitch, SAM riboswitch, guanine riboswitch, FMN riboswitch, lysine riboswitch, and the PreQ1 riboswitch.
  • the RNA aptamer is a split aptamer.
  • Split aptamers are analogs to split-protein systems (e.g. beta-galactosidase) and rely on two or more short nucleic acid strands that assemble into a higher order structure upon the presence of a specific target.
  • Debais et al. 2020
  • Nucleic Adds Res 48(7): 3400-3422 An exemplary split aptamer is the ATP-aptamer. Sassanfar & Szostak (1993) Nature 364(6437)-550-553.
  • the ATP aptamer is an RNA aptamer that was divided into two RNA fragments by removing the loop that closes the stem and by extending each fragment with additional nucleotides to compensate for the loss of stability. Neither of the two RNA fragments bind ATP alone but in the presence of ATP the binding ability is reactivated. Debiais et al. (2020) Nucleic Adds Res 48(7): 3400-3422.
  • the RNA aptamer is an X-aptamer.
  • X-aptamers are engineered with a combination of natural and chemically-modified nucleotides to improve binding affinity, specificity, and versatility.
  • An exemplary embodiment of a X-aptamer is the PS2-aptamer.
  • the PS2-aptamer is an RNA aptamer that contains a phosphorodithioate (i.e., PS2) substitution at a single nucleotide of RNA aptamer which increases the aptamer's binding affinity from a nanomolar to a picomolar range.
  • PS2 phosphorodithioate
  • the RNA aptamer binds to a ligand.
  • the ligand is utilized in an affinity purification system.
  • the affinity ligand comprises protein A, protein G, streptavidin, glutathione (GSH), dextran (sephadex), cellulose (e.g., diethylaminoethyl cellulose) or a fluorescent molecule.
  • the affinity ligand is Immobilized on a chromatography resin.
  • the affinity ligand comprises protein A. DNA aptamers have been shown previously to target protein A. See, e.g., Stoltenburg et al. (2016) Sci Rep. 6:33812.
  • RNA aptamers bind streptavidin.
  • Streptavidin-binding aptamers are described in, e.g., Srisawat & Engelke (2001) RNA 7(4): 632-641.
  • RNA aptamers that bind to sephadex.
  • Sephadex-binding aptamers are described in, e.g., Srisawat et al. (2001 ) Nucleic Acid Res 29(2): e4.
  • RNA aptamers that bind to glutathione (GSH). Glutathione-binding aptamers are described in, e.g., Bala, et al. (2011). RNA Biology 8(1): 101-111. In some embodiments, the RNA aptamer is GSHapt 8.17 or GSHapt 5.39.
  • RNA aptamers that bind to a fluorescent molecule. Examples of such aptamers are described in, e.g., Paige et al. (2011 ) Science 333(6042): 642-646.
  • the RNA aptamer comprises a S1m aptamer
  • the S1m aptamer used according to the instant disclosure is the aptamer described in Bachler et al. (1999) RNA 5(11):1509-1516, Srisawat & Engelke (2001) RNA 7(4): 632-641, or Li & Altman. (2002) Nuc. Acids Res. 30(17): 3706-3711.
  • the RNA adapter comprises the nucleotide sequence of SEQ ID NO: 2.
  • the RNA aptamer comprises a Sm aptamer.
  • the RNA adapter comprises the nucleotide sequence of SEQ ID NO: 6.
  • aptamers into mRNA has been reported to impact translation.
  • the location of the aptamer on the mRNA may partially determine the magnitude of impact on translation. For example, it is generally believed that when inserting structured RNA into a 5 -UTR of a transcript protein translation levels may be reduced. Babendure et al, (2006). RNA 12:851-861; Hotter et al. (2009) Nuc Acids Res 37(18):e120.
  • Insertion of an aptamer into the 5' UTR an mRNA molecule can form a hairpin loop, which alters the structure of the mRNA and blocks access to the ribosome, thereby preventing translation. See, e.g., United States Patent Application Publication No. 2007/0136827.
  • RNA aptamers which include aptamers at various locations with respect to the ORF of the mRNA Selection of location of the RNA aptamer on the mRNA can be evaluated with respect to both the magnitude of regulation of translation and basal expression level.
  • reporter constructs may be built which contain an aptamer at various locations within the 5 -UTR, between 0 to 100 bases from the cap or start codon.
  • the downstream region after the aptamer can be retained in order to preserve the peptide leader sequence, thereby limiting alteration to the upstream sequence relative to the aptamer.
  • the RNA aptamer is positioned in the 5' UTR. In some embodiments, the RNA aptamer is positioned following the 5'UTR and immediately before the protein-coding ORF. In some embodiments, the RNA aptamer is positioned following the protein-coding open reading frame (ORF) and immediately before the 3' UTR. In some embodiments, the RNA aptamer is positioned between the 3' end of the ORF and the 5' end of the 3' UTR. In some embodiments, the RNA aptamer is positioned in the 3'UTR. In some embodiments, the RNA aptamer is positioned downstream of the 3'UTR and immediately before the polyA tail.
  • ORF protein-coding open reading frame
  • the RNA aptamer is positioned between the 3' end of the 3'UTR and the 5' end of the polyA sequence. In some embodiments, the RNA aptamer is positioned immediately after the polyA tail (i.e., at the end of the transcript). In some embodiments, the RNA aptamer is positioned at the 3' end of the polyA sequence. [0111] In some embodiments, the RNA aptamer does not have to be bound directly to the mRNA. In some embodiments, the RNA aptamer is attached to a linker. See, e.g., Elenko et al. (2009) J Am Chem Soc. 131(29): 9866-9867.
  • the RNA aptamer can be removed from the mRNA after affinity purification. This may be achieved, for example, using DNA oligonucleotides which hybridize to the RNA aptamer or RNA scaffold. The resulting duplex can then be cleaved with an enzyme such as RNase H. See, e.g., Batey RT. (2014). Curr Opin Struct Biol. 26:1-8.
  • An increase in aptamer copy number may allow aptamers to create a larger three- dimensional structure (i.e., enhancing the number of affinity ligand binding sites available or creating a unique ligand binding site).
  • a strategic arrangement of aptamer copies may allow for increased avidity with the cognate affinity ligand.
  • the mRNA used In the disclosed methods and compositions comprises multiple copies of an aptamer.
  • Previous reports have shown that using a single small- molecule binding aptamer in the 5 -UTR enables 8-fold repression of translation upon ligand addition, but using three aptamers causes a 37-fold repression.
  • the copy number of aptamers introduced into the mRNA is one, two, three, four, five, six, seven, eight, nine, ten, or more.
  • the RNA aptamer comprises multiple copies of an aptamer sequence. In some embodiments, the RNA aptamer comprises the nucleotide sequence of SEQ ID NO: 5.
  • copies of the aptamer are in repeat tandem configuration.
  • the 4XS1 m aptamer disclosed herein is an example of a multiple copy aptamer in a repeat tandem configuration.
  • the mRNA compositions disclosed herein comprise an RNA aptamer that is embedded In an RNA scaffold.
  • RNA scaffold refers to a noncoding RNA molecule that can assemble to have a predefined structure which creates spatial architecture to organize, protect, or enhance the properties of a functional module of interest
  • Exemplary functional modules can be nucleic acids (e.g., aptamers) or protein.
  • the RNA scaffolds suitable for use according to the instant disclosure can be associated with an RNA without disrupting the RNA structure.
  • suitable RNA scaffolds allow for an RNA aptamer to be embedded without disrupting the RNA structure.
  • the RNA scaffolds used according to the instent disclosure can be any RNA scaffolds which do not have a significant negative impact on RNA expression or translation.
  • RNA scaffold's predefined structure contains RNA-spedfic sequence motifs for self- assembly such as base-pairing between hairpin stems (kissing loops) and/or chemical modifications, Myhrvold & Silver (2015) Nat Struct Mol Bio 22(1):8-10.
  • RNA-specific sequence motifs can form secondary (i.e., two-dimensional) and/or tertiary (I.e., three-dimensional) structures.
  • the RNA scaffold comprises at least one secondary structure motif.
  • the RNA scaffold comprises at least one tertiary structure motif.
  • RNA structural motifs include open and stacked three-way junctions, four-way junctions, four-way junctions similar to Holliday's structures, stem-loops (i.e., hairpin loops), interior loops (i.e., internal loops), bulges, tetraloops, multibranch loops, pseudoknots and knots, 90° kinks, and pseudo-torsional angles.
  • stem-loops i.e., hairpin loops
  • interior loops i.e., internal loops
  • bulges i.e., internal loops
  • tetraloops i.e., multibranch loops
  • pseudoknots and knots i.e., 90° kinks, and pseudo-torsional angles.
  • RNA scaffolds can either be derived from nature (e.g., attenuators, tRNA, riboswitches, terminators) or artificially engineered to form secondary or tertiary RNA structure. Delebecque et al. (2012) Nat Protoc 7(10): 1797-1807. Typically, in order to retain the RNA scaffold predefined structure, the RNA scaffold's RNA loop(s) (e.g., a hairpin loop) are the target regions for embedding the functional module of interest. See, e.g., US 20050282190 A1.
  • the RNA scaffold's predefined structure can be modified, however, to have additional desirable properties. For example, the predefined RNA scaffold structure may be modified to become resistant to one or both of exonuclease digestion and endonuclease digestion.
  • the mRNA compositions disclosed herein comprise an RNA aptamer that is embedded in a transfer RNA (tRNA).
  • Transfer RNA (tRNA) scaffolds are an attractive tagging candidate in affinity purification systems, as tRNAs fold into canonical, stable clover-leaf structures that are resistant to unfolding and can protect RNA fusions from nuclease degradation. It has been demonstrated that embedding an aptamer in the anticodon loop of a tRNA scaffold promotes proper folding. See generally, Ponchon and Dardel (2007) Nat. Methods 4(7):571-576; Ponchon et al. (2013) Nucleic Adds Res. 41:e150.
  • RNA aptamer embedded in a tRNA scaffold has been demonstrated to successfully pull-down transcript-specific RNA-binding proteins from cell lysates, lioka H et al. (2011) Nuc. Acids Res. 39(8):e53.
  • the mRNA compositions disclosed herein comprise an RNA aptamer that is embedded in a tRNA which comprises the nucleotide sequence of SEQ ID NO: 7.
  • the RNA aptamer is embedded in a tRNA hairpin loop of the tRNA. In some embodiments, the RNA aptamer is embedded in a tRNA anticodon loop. In some embodiments, the RNA aptamer is embedded in a tRNA D loop. In some embodiments, the RNA aptamer is embedded in a tRNA T loop.
  • the mRNA compositions disclosed herein comprise an RNA aptamer embedded in a bioorthogonal scaffold.
  • a bioorthogonal scaffold The hallmark feature of a bioorthogonal scaffold is that it is not recognized by intracellular nucleases and targeted for degradation. Filonov et al. (2015) Chem Biol. 22(5): 649-660.
  • bioorthogonal scaffolds include, V5, F29, F30, or variants thereof. Id. F29 and F30 share the same three-way junction motif that is seen in naturally occurring riboswitches and viral RNAs. Shu et al. (2014) Nucleic Adds Res. 42, e10.
  • F30 is an engineered version of F29 which was mutated to remove an internal terminator sequence.
  • the mRNA compositions disclosed herein comprise an RNA aptamer embedded in a bioorthogonal scaffold.
  • the bioorthogonal scaffold is V5, F29, F30, or a variant thereof.
  • the bioorthogonal scaffold comprises a 5' nucleotide sequence of SEQ ID NO: 34 and a 3' nucleotide sequence of SEQ ID NO: 35, wherein an aptamer sequence is positioned between SEQ ID NO: 34 and SEQ ID NO: 35.
  • the bioorthogonal scaffold comprises a 5' nucleotide sequence of SEQ ID NO: 39, an internal nucleotide sequence of SEQ ID NO: 40, and a 3' nucleotide sequence of SEQ ID NO: 41, wherein a first aptamer sequence is positioned between SEQ ID NO: 39 and SEQ ID NO: 40 and a second aptamer sequence is positioned between SEQ ID NO: 40 and SEQ ID NO: 41, optionally wherein the first and second aptamer are the same or different.
  • the RNA aptamer embedded bioorthogonal scaffold comprises the nucleotide sequence of SEQ ID NO: 29 or SEQ ID NO: 31.
  • RNA scaffolds include ribosomal RNA (rRNA) and ribozymes.
  • the RNA aptamer is embedded in a ribosomal RNA.
  • the ribosomal RNA is a 5S rRNA or a derivative thereof. Exemplary 5S rRNA scaffolds and derivatives thereof are described in further detail in Stepanov et al. (Methods Mol Biol. 2323: 75-97. 2021), the contents of which are incorporated herein by reference.
  • the RNA aptamer is embedded in a ribozyme.
  • the ribozyme is catalytically inactive.
  • the RNA aptamer is embedded in a T-cassette.
  • the T-cassette RNA scaffold comprises the sequence GAACGAAACUCUGGGAGCUGCGAUUGGCAGAAUUCCGUUAGCAAGGCCGCAGGACUUGCA UGCUUAUCCUGCGGCGCGGGCGCGUUUCCCGGGUUACGCGCCCGCCUUAAGUGUUUCUCG AGUUGGCACUUAAGCUUGCUAACGGAAUUCCCCCAUAUCCAACUUCCAAUUUAAUCUUUCU UUUUUAAUUUUCACUUAUUUGCG (SEQ ID NO: 43, wherein the bold, underlined text correspond to aptamer insertion sites.
  • An aptamer may be inserted at 1 , 2, or all 3 aptamer insertion sites.
  • the T-cassette RNA scaffold is embedded with 1 , 2, or 3 aptamers.
  • the aptamers are the same.
  • the aptamers are different.
  • 2 of 3 aptamers are different.
  • 2 or 3 aptamers are the same.
  • the T-cassette RNA scaffold is encoded by the polynucleotide sequence of GAACGAAACTCTGGGAGCTGCGATTGGCAGAATTCCGTTAGCAAGGCCGCAGGACTTGCATG CTTATCCTGCGGCGCGGGCGCGTTTCCCGGGTTACGCGCCCGCCTTAAGTGTTTCTCGAGTT GGCACTTAAGCTTGCTAACGGAATTCCCCCATATCCAACTTCCAATTTAATCTTTCTTTTTTAATT TTCACTTATTTGCG (SEQ ID NO: 44).
  • T-cassette scaffold is described in further detail in Wurster et al. (Nucleic Acids Research. 37(18): 6214-6224. 2009), the contents of which are incorporated herein by reference.
  • mRNA purified according to the disclosed methods is substantially free of impurities from mRNA synthesis.
  • impurities include, for example, prematurely aborted RNA sequences, DNA templates, and/or enzyme reagents used in in vitro synthesis.
  • the disclosed method for purifying a mRNA comprises the steps of: (a) contacting a sample comprising a mRNA comprising at least one aptamer with an affinity ligand that is immobilized on a chromatography resin, wherein the RNA aptamer comprises binding affinity for the affinity ligand; (b) eluting the mRNA from the chromatography resin; and (c) purifying the mRNA from the sample.
  • Affinity chromatography is one purification method that can be used with the mRNA compositions and methods disclosed herein.
  • the RNA aptamers disclosed herein comprise binding affinity for the selected affinity ligand.
  • the selected affinity ligand is is immobilized (e.g. crosslinked) on a chromatography resin.
  • the mRNA comprising the RNA aptamer therefore binds with the resin containing the affinity ligand.
  • the chromatography resin material is preferably present in a column, wherein the sample containing RNA is loaded on the top of the column and the eluent is collected at the bottom of the column. See, e.g., FIG. 1 for a general illustration of the affinity purification methods disclosed herein.
  • the chromatography resin can be any material that is known to be used as a stationary phase in chromatography methods.
  • the type of molecules used as affinity ligands, which interact with the RNA aptamers disclosed herein, can be a variety of types.
  • Non-exhaustive examples of affinity ligands are antibodies, proteins, oligonucleotides, dyes, boronate groups, or chelated metal ions.
  • the stationary phase may be composed of organic and/or inorganic material.
  • the most widely used stationary phase materials are hydrophilic carbohydrates such as cross-linked agarose and synthetic copolymer materials. These materials may comprise derivatives of cellulose, polystyrene, synthetic poly amino acids, synthetic polyacrylamide gels, or a glass surface. Further examples of materials that can be used as chromatography resins are polystyrenedlvlnylbenzenes, silica gel, silica gel modified with non-polar residues, or other materials suitable for gel chromatography or other chromatographic methods, such as dextran, sephadex, agarose, dextran/agarose mixtures, and others known in the art
  • the chromatography resin can be functionalized with affinity ligands for which the RNA aptamer has binding affinity.
  • the resin may be an agarose media or a membrane functionalized with phenyl groups (e.g. , Phenyl SepharoseTM from GE Healthcare or a Phenyl Membrane from Sartorius), Tosoh Hexyl, CaptoPhenyl, Phenyl SepharoseTM 6 Fast Flow with low or high substitution, Phenyl SepharoseTM High Performance, Octyl SepharoseTM High Performance (GE Healthcare); FractogelTM EMD Propyl or FractogelTM EMD Phenyl (E.
  • ToyoScreen PPG, ToyoScreen Phenyl, ToyoScreen Butyl, and ToyoScreen Hexyl are based on rigid methacrylic polymer beads.
  • GE HiScreen Butyl FF and HiScreen Octyl FF are based on high flow agarose based beads.
  • Toyopearl Ether-650M Preferred are Toyopearl Ether-650M, Toyopearl Phenyl-650M, Toyopearl Butyl-650M, Toyopearl Hexyl-650C (TosoHaas, PA), POROS-OH (ThermoFisher) or methacrylate based monolithic columns such as CIM-OH, CIM-SO3, CIM-C4 A and CIM C4 HDL which comprise OH, sulfate or butyl ligands, respectively (BIA Separations).
  • the chromatography resin comprises protein A as an affinity ligand.
  • Exemplary protein A resins include Byzen Pro Protein A resin (MilliporeSigma; 18887), Dynabeads Protein A Magnetic Beads (ThermoFisher: 10001D), Pierce Protein A Agarose (ThermoFisher; 20334), Pierce Protein A/G Plus Agarose (ThermoFisher; 20423), Pierce Protein A Plus UltraLink (ThermoFisher; 53142), Pierce Recombinant Protein A Agarose (ThermoFisher), POROS MabCapture A Select (ThermoFisher).
  • the chromatography resin comprises streptavidin as an affinity ligand.
  • streptavidin resins include Streptavidin-Agarose from Streptomyces avidinii (MilliporeSigma; S1638), Pierce Streptavidin Plus UltaLink Resin (ThermoFisher; 53117), Pierce High Capacity Steptavisin Agarose (ThermoFisher; 20357), Streptavidin 6HC Agarose Resin (ABT; STV6HC-5), Streptavidin Resin - Amintra (Abeam; ab270530).
  • the chromatography resin comprises glutathione (GSH) as an affinity ligand.
  • GSH resins include Glutathione Resin (GenScript; L00206), Pierce Glutathione Agarose (ThermoFisher; 16102BID), Glutathione Sepharose 4B GST-tagged Protein Resin 9Cytiva; 17075605); Glutathione Affinity Resin - Amintra (Abeam; ab270237).
  • the purification process disclosed herein may be carried out during or subsequent to mRNA synthesis.
  • mRNA may be purified as described herein before a cap and/or tail are added to the mRNA.
  • the mRNA is purified after a cap and/or tail are added to the mRNA.
  • the mRNA is purified after a cap is added.
  • the mRNA is purified both before and after a cap and/or tail are added to the mRNA.
  • a purification step as described herein may be performed after each step of mRNA synthesis, optionally along with other purification processes, such as dialysis and/or filtration.
  • mRNA may undergo dialysis to remove shortmers after initial synthesis (e.g., with or without a tail) and then be subjected to purification as described herein.
  • the purification methods disclosed herein may be applied multiple times to a mRNA sample.
  • vectors comprising the mRNA compositions disclosed herein.
  • the nucleic acid sequences encoding a protein of interest e.g., mRNA encoding a therapeutic polypeptide
  • a protein of interest e.g., mRNA encoding a therapeutic polypeptide
  • the nucleic acids can be cloned into a vector including, but not limited to a plasmid, a phagemid, a phage derivative, an animal virus, and a cosmid.
  • Vectors of particular interest include expression vectors, replication vectors, probe generation vectors, sequencing vectors and vectors optimized for in vitro transcription.
  • the vector is used to express mRNA in a host cell.
  • the vector is used as a template for IVT.
  • the construction of optimally translated IVT mRNA suitable for therapeutic use is disclosed In detail in Sahin, et al. (2014). Nat. Rev. Drug Discov. 13, 759-780; Weissman (2015). Expert Rev. Vaccines 14, 265-281.
  • the vectors disclosed herein comprise at least the following, from 5' to 3': an RNA polymerase promoter; a polynucleotide sequence encoding a 5’ UTR; a polynucleotide sequence encoding an ORF; a polynucleotide sequence encoding a 3' UTR; and a polynucleotide sequence encoding at least one RNA aptamer.
  • the vectors disclosed herein also comprise a polynucleotide sequence encoding a polyA sequence and/or a polyadenylation signal.
  • RNA polymerase promoters are known in the art.
  • the promoter is a T7 RNA polymerase promoter.
  • Other useful promoters include, but are not limited to, T3 and SP6 RNA polymerase promoters. Consensus nucleotide sequences for T7, T3 and SP6 promoters are known in the art.
  • host cells e.g., mammalian cells, e.g., human cells
  • vectors or RNA compositions disclosed herein comprising the vectors or RNA compositions disclosed herein.
  • Polynucleotides can be introduced into target cells using any of a number of different methods, for instance, commercially available methods which include, but are not limited to, electroporation (Amaxa Nudeofector-ll (Amaxa Biosystems, Cologne, Germany)), (ECM 830 (BTX) (Harvard Instruments, Boston, Mass.) or the Gene Pulser II (BioRad, Denver, Colo.), Multiporator (Eppendort, Hamburg Germany), cationic liposome mediated transfection using lipofection, polymer encapsulation, peptide mediated transfection, biolistic particle delivery systems such as "gene guns” (see, for example, Nishikawa, et al. (2001). Hum Gene Ther. 12(8):861-70, or the TransIT-RNA transfection Kit (Mirus, Madison Wl).
  • electroporation Amaxa Nudeofector-ll (Amaxa Biosystems, Cologne, Germany)
  • ECM 830 BTX
  • Chemical means for introducing a polynucleotide into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • colloidal dispersion systems such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • An exemplary colloidal system for use as a delivery vehicle In vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).
  • RNA purified according to this invention is useful as a component in pharmaceutical compositions, for example for use as a vaccine.
  • These compositions will typically include RNA and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition of the invention can also Include one or more additional components such as small molecule immunopotentiators (e.g. TLR agonists).
  • a pharmaceutical composition of the invention can also include a delivery system for the RNA, such as a liposome, an oil-in-water emulsion, or a microparticle.
  • the pharmaceutical composition comprises a lipid nanoparticle (LNP).
  • the composition comprises an antigen-encoding nucleic acid molecule encapsulated within a LNP.
  • the LNP comprises at least one cationic lipid. In some embodiments, the LNP comprises a cationic lipid, a polyethylene glycol (PEG) conjugated (PEGylated) lipid, a cholesterol-based lipid, and a helper lipid.
  • PEG polyethylene glycol
  • RNA aptamer sequences were chemically synthesized.
  • the first RNA aptamer nucleotide sequence was a random sequence aptamer to serve as a negative control (SEQ ID NO:1 ).
  • the second sequence is the S1m aptamer (SEQ ID NO: 2), which was previously reported to bind to streptavidin. Bachler et al., (1999), RNA 5(11):1509-1516; Srisawat, C. and Engelke, D.R., (2001) RNA 7(4): 632-641; Li, Y. and Altman, S., Nucleic Acids Res. (2002), 30(17): 3706-3711.
  • the nucleotide sequence for the random aptamer (SEQ ID NO: 1 ) and the S1 m aptamer (SEQ ID NO: 2) are shown below.
  • Binding of the aptamers was analyzed using a sepharose bead affinity purification strategy followed by quantification of the yield of RNA recovery.
  • Methods for preparing the RNA aptamers and streptavidin beads for binding involved the following steps: (1) Preparation of the streptavidin sepharose beads. To remove bead storage solution, 20 ⁇ L of streptavidin sepharose beads (per sample) were spun at 600xg for 1 minute at 4°C and washed twice in binding buffer (500 ⁇ L/per sample). Subsequently, the beads were resuspended in 20 ⁇ L of binding buffer with RNasin Ribonuclease Inhibitor (3 ⁇ L/100 units) and then incubated on ice for 15 minutes. (2) Preparation of RNA aptamers.
  • RNA aptamers 2.5 ⁇ g of the RNA aptamers were resuspended in 10 ⁇ L binding buffer. Refolding of the RNA aptamers was performed by heating at 56’C for 5 min, 37°C for 10 min, followed by a room temperature incubation for 5 minutes to refold aptamer structure. At the end of the RNA aptamer preparation procedure, 2 ⁇ L of the random aptamer and the S1 m aptamer in a 1 :2 mix with binding buffer were collected as a control for total RNA aptamer yield (input control). (3) incubation conditions.
  • RNA aptamers 10 ⁇ L of refolded aptamer containing mRNA (2.5 ⁇ g) aptamers were added to the beads and incubated at 4°C for 2 hours on a rotator. Subsequently, beads were washed 3 times with 100 ⁇ L of binding buffer and kept on ice for the remainder of the procedure to maintain aptamer secondary structure. (4) Elution of RNA aptamers from beads. Elution was performed with 250 ⁇ L phenol-based reagent in the following steps. 50 ⁇ L cold chloroform were added to the beads and shaken vigorously for 10 seconds followed by a spin at 12,000xg for 15 minutes (at 4°C).
  • RNA was eluted from each Monarch column in 50 ⁇ L DEPC- treated water. RNA concentration following streptavidin affinity purification was quantified on a Nanodrop using parameters set by the manufacturer's specifications.
  • the aptamers prepared in Example 1 were affinity purified with streptavidin sepharose beads, eluted, and the amount of RNA recovery in the eluate was quantified using the methods described above. Random aptamer sequence samples did not yield any RNA recovery (Nanodrop lower detection limit 2.5 ng/ ⁇ L). In contrast, the S1m aptamer samples had approximately 13% RNA recovery (1,250 ng/ ⁇ L) relative to S1m aptamer RNA samples collected prior to incubation with streptavidin beads (approximately 9,600 ng/ ⁇ L) (FIG. 2). This result shows that the S1 m aptamers designed in Example 1 can be affinity purified with streptavidin and thus can be suitable as a functional tag in a streptavidin affinity based purification system.
  • DNA plasmids pAM14 and pAM15 were modified to include a 53 bp nucleotide sequence encoding an AU-rich element (ARE) RNA from the 3'UTR of mouse TNFa driven by a T7 promoter as previously described.
  • ARE AU-rich element
  • pAM14 (2,496 bp) is derived from the same vector backbone as pAM15 (2,168 bp) but contains a 4xS1m aptamer flanked by a 30-mer polyA tail in a 5" to 3' orientation.
  • the TNF ⁇ -53-4xS1m nucleotide sequence was amplified with an AM5/6 primer pair from the pAM14 plasmid.
  • the negative control cDNA template was amplified using the same AM5/6 primer pair from plasmid pAM15, producing sequences containing 5' UTR and 3' UTR flanks (SEQ ID NOs: 3 and 4, respectively).
  • the positions of the AM5/6 primer binding sites are annotated in the pAM14 and pAM15 plasmid maps as shown in FIG. 3.
  • the IVT reactions for experiment group, TNFa-53-4xS1 m mRNA, and control group was carried out using RNA reagents and procedure commercially available. (HiScribe T7 ARCA mRNA synthesis Kit with tailing, NEB). After cap and tail reactions the filtered mRNA was stored at - 20°C until use.
  • the aptamer mRNA was affinity purified with streptavidin sepharose beads, eluted, and the amount of RNA recovery in the eluate was quantified using the methods described above.
  • the binding affinity of streptavidin sepharose beads to a TNFa-53 tagged 4xS1m mRNA or a TNFa-53 mRNA negative control sample was evaluated and compared.
  • the Sm aptamer was selected for analysis.
  • the nucleotide sequence for the Sm aptamer (SEQ ID NO: 6) and the tRNA-Sm aptamer (SEQ ID NO: 7) are shown below.
  • Maps of the plasmids of interest are depicted in FIG. 5. Briefly, these were: (1) pAM22, a control construct, carrying a Methanothermobacter thermautotrophicust tRNA GLN2 scaffold (pAM22 (tRNA); plasmid map annotates the position of the anticodon arms with respect to the Gln2 anticodon loop) (2) pAM20, a control construct, carrying a Sm aptamer (pAM20 (Sm)), (3) pAM21, an experimental construct, carrying the Sm aptamer sequence embedded in a portion of the anticodon loop tRNA GLN2 sequence which is flanked on both sides by the tRNA anticodon arm sequence (pAM21 (tRNA Sm), and (4) pAM23, an experimental construct, carrying tandem two-repeat configuration of the Sm-tRNA GLN2 construct (2x tRNA Sm). Each tag was driven by a T7 promoter.
  • the aptamer tag nucleotide sequences were amplified with flanking primers, as described in Example 3.
  • the IVT reactions for experiment group, tRNA Sm and the 2x tRNA Sm mRNA and control group was carried out using RNA reagents and procedure commercially available. (HiScribe T7 ARCA mRNA Kit with tailing, NEB). After cap and tail reactions the filtered mRNA was stored at -20°C until use.
  • Affinity binding of the Sm, tRNA, tRNA-Sm, and 2x tRNA Sm aptamer tags were analyzed. The same binding and elution methods from Example 2 were applied.
  • RNA scaffold structure such as a tRNA, can improve the binding efficiency of an aptamer tag.
  • Example 5 Synthesis and affinity purification of mRNA encoding hEGFP tagged with multiple COPY aptamer (eHGFP-4xS1m)
  • RNA aptamer tags studies the effect of including RNA aptamer tags on expression of mRNA and protein translation. Since aptamers are designed to be part of the mRNA, there is a possibility that an aptamer tag could negatively impact translation.
  • plasmids were constructed which included the ORF for humanized enhanced green fluorescent protein (hEGFP; SEQ ID NO: 8 as shown below) flanked by 5' and 3' UTR sequences, driven by a T7 promoter, and ending in a 30-mer polyA tail in a 5’ to 3' orientation (pAM11).
  • Experimental plasmid pAM8 was created by introducing the 4xS1 m aptamer sequence (SEQ ID NO: 5) downstream of the 3' UTR and immediately before the polyA tail.
  • FIG. 8 depicts the plasmid maps of pAM11 and pAM8.
  • the hEGFP or the hEGFP-4xS1m aptamer tagged nucleotide sequence was amplified with an AM5/6 primer pair. Design and orientation of the primer pair is similar to the strategy as disclosed in Example 3.
  • the IVT reaction was performed with HiScribeTM T7 ARCA mRNA Kit according to manufacturer's instructions. To avoid an additional polyadenylation step, a stretch of 30-mer adenosine tail was created with the template DNA for IVT.
  • the resulting mRNA are of good quality with expected size (lane 1 hEGFP and lane 2 hEGFP-4xS1m).
  • Example 6 Analysis of protein translation and function of mRNA tagged with multiple COPY aptamer (eHGFP-4xS1m)
  • RNA aptamer tags were assessed by direct visualization of GFP expression in cells.
  • hEGFP mRNA produced from pAM8 and pAM11 was isolated after affinity purification and transfected into HEK293FT cells.
  • 0.5 ⁇ g RNA was transfected with Mirus TransIT Transfection reagent Into HEK293FT cells in 24-well plates according to manufacturer’s instructions. After 24 hours, the cells were examined using fluorescent microscopy.
  • the mRNA containing the 4xS1 m aptamer produces a lower intensity signal (right panel) relative to mRNA without aptamer (left panel).
  • Example 7 Analysis of protein translation and function of mRNA tagged with multiple copy aptamer and including elongated polyA tail
  • the short polyA tail (30-mer adenosine) may be Impacting translation efficiency due to the aptamer sequence.
  • hEGFP-4xS1m aptamer tagged mRNA was subjected to an additional polyadenylation reaction using Poly(A) polymerase (NEB, M0276S).
  • Example 8 Analysis of aptamer position on RNA recovery
  • aptamer sequences are designed to be part of mRNAs, and there is a possibility that the potential aptamer structures or configuration of the same could negatively affect expression.
  • aptamer tagged mRNA constructs were designed to test: (1) aptamer position relative to the other topologically ordered mRNA components, (2) aptamer copy number (i.e., aptamer valency), (3) surrounding scaffolding (i.e., a stabilizing tRNA-scaffold), or a combination of configurations as diagrammed in FIG. 7.
  • this example interrogates whether varying the location of the 4xS1m aptamer sequence with respect to the other topologically ordered pieces in the mRNA impact RNA recovery after mRNA affinity purification.
  • the panel of mRNA constructs designed are shown in FIG. 13A.
  • the 4xS1 m aptamer was localized either (1 ) directly upstream of the 5' UTR, (2) directly upstream of the 3'UTR, (3) in the 3' UTR, (4) directly downstream the 3' UTR, or (5) embedded in the 3' end of the polyA sequence.
  • cDNA templates were generated and IVT used to produce mRNA with the specific aptamer configuration.
  • mRNA was affinity purified using streptavidin sepharose beads and quantified as described in Example 2.
  • aptamer valency i.e., aptamer copy number
  • aptamer copy number is another variable that could impact RNA recovery.
  • a panel of aptamer tagged mRNA constructs were designed to contain between one to six tandem repeat copies (labeled as 1xS1 m through 6xS1m) of the 81 m aptamer.
  • the aptamer tag was placed after the 3' UTR.
  • cDNA templates were generated and IVT used to produce mRNAs with specific aptamer valency.
  • mRNA was affinity purified using streptavidin sepharose beads and quantified as described in Example 2.
  • Example 10 Analysis of aptamer binding in alternative mRNA context on RNA recovery
  • RNA yield following the streptavidin affinity binding purification process for each construct tested is shown in FIG. 15.
  • the average and standard deviation values for each sample (unbound and elute) are shown below in Table 3.
  • Table 3 Percent unbound mRNA and percent eluted mRNA for the data of FIG. 15
  • the aptamers provide specific binding to streptavidin sepharose beads despite the varied neighboring sequence. This result demonstrates that the streptavidin aptamer mRNA designs disclosed herein are robust in alternative RNA contexts.
  • Example 11 Analysis of aptamer position on protein translation
  • mRNA encoding a humanized EGFP was produced through in vitro transcription (IVT) and subsequently mixed with a transfection reagent. The mix was then applied to either Hela or human skeletal muscle (HSKMc) cells. After 24 hours of incubation, transfected cells were quantified for GFP fluorescence via flow cytometric analysis. The cellular GFP fluorescence intensity being directly proportional to translational efficiency of the mRNA transcript encoding hEGFP.
  • Hela or HSKMc cell lines were seeded in complete growth media in 12- well plates and grown to an 80-90% confluency.
  • Hela 229 cell media conditions were DMEM and 10% FBS and HSK Me cells media conditions were 199 Media, 20% FBS, and 1% PenStrep.
  • Compensation beads were made by preparing live/dead reactive ArC compensation beads or using GFP BrightComp eBeads according to manufacturer's instructions.
  • the mRNA translation efficiency for aptamer tagged mRNA where the aptamer varied in placement within the mRNA was assessed in either HskMc and Hela cell lines, respectively. Expression was quantified as the total number of cells with GFP signal above background (% GFP+ Cells), as well as the number of cells above a certain signal intensity threshold (% high GFP+ cells).
  • Example 12 Analysis of elongated polyA tail length on translation efficiency
  • Example 7 demonstrated that a longer polyA tall length increased translation efficiency of the aptamer tagged mRNA.
  • elongated polyA tails were added to S1m aptamer tagged mRNA and tested in the mRNA translation efficiency assay described in Example 11.
  • the vectors used for IVT included an encoded polyA tail, specifically a segmented polyA tail with 60 A's, a Nsil restriction enzyme cut site, then another 60 A's.
  • mRNA produced from the vectors described above contained the segmented polyA tail and were ARCA capped.
  • Example 13 Analysis of mRNA tagged with an aptamer embedded in RNA scaffold on RNA recovery and translation efficiency
  • Example 5 To confirm and expand on the findings of Example 5, the S1m aptamer embedded in the tRNA scaffold tag (see Example 5) was compared to the 2xS1m and the 4xS1m aptamer tagged mRNA with respect to RNA recovery after streptavidin affinity purification and mRNA translation efficiency.
  • RNA purification yields that were equal to the binding efficiency of the 4xS1m aptamer tagged mRNA, demonstrating that an RNA scaffold significantly increases affinity purification yield.
  • Stabilization of the S1 m aptamer with a tRNA scaffold had no impact on mRNA translation efficiency as shown in FIG. 19B. The results are summarized In Table 4 below.
  • Example 14 Synthesis and affinity purification of mRNA tagged with aptamer stabilized in a bioorthogonal RNA scaffold
  • tRNA scaffolded aptamers often have reduced RNA stability due to endonucleolytic cleavage in bacterial and mammalian cells. Filonov et al. (2015) Chem Biol. 22(5): 649-660.
  • An alternative to tRNA scaffolds are bioorthogonal scaffolds. Bioorthogonal scaffolds are not readily recognized by intracellular nucleases and targeted for degradation, such as, the V5, the F29, or the F30 scaffold. Id.
  • aptamers of Interest may be readily inserted into the F30 scaffold.
  • a left F30 sequence and a "1x right" F30 sequence flank the one aptamer.
  • a left F30 sequence and middle F30 sequence flank the first aptamer, and the middle F30 sequence and a "2x right” F30 sequence flank the second aptamer.
  • a F30-1x aptamer and F30-2x aptamer sequence are provided below.
  • TTGCCATGTGTATGTGGG (left F30 sequence, SEQ ID NO: 32) - APTAMER SEQUENCE - CCCACATACTCTGATGATCCTTCGGGATCATTCATGGCAA (“1x right” F30 sequence, SEQ ID NO: 33)
  • TTGCCATGTGTATGTGGG left F30 sequence, SEQ ID NO: 36
  • APTAMER SEQUENCE - CCCACATACTCTGATGATCC (middle F30 sequence, SEQ ID NO: 37)
  • APTAMER SEQUENCE - GGATCATTCATGGCAA ("2x right" F30 sequence, SEQ ID NO: 38)
  • UUGCCAUGUGUAUGUGGG (left F30 sequence, SEQ ID NO: 39) - APTAMER SEQUENCE - CCCACAUACUCUGAUGAUCC (middle F30 sequence, SEQ ID NO: 40) - APTAMER SEQUENCE - GGAUCAUUCAUGGCAA (“2x right" F30 sequence, SEQ ID NO: 41 )
  • the aptamer mRNA was affinity purified with streptavidin sepharose beads, eluted, and the amount of RNA recovery in the eluate was quantified using the methods described above.
  • the binding affinity of streptavidin sepharose beads to either untagged mRNA (no aptamer control), the 4xS1m aptamer, the F30-1xS1m aptamer, or the F30-2xS1m aptamer tagged mRNA was evaluated and compared.
  • RNA recovery from the eluted F30-2xS1 m and the F30-1xS1 m tagged mRNA was approximately 900 ng/ ⁇ L and 800 ng/ ⁇ L, respectively (FIG. 20C).
  • the affinity purified eluted negative control yielded only 200 ng/ ⁇ L of RNA recovery yield.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicinal Preparation (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/IB2022/058234 2021-09-02 2022-09-01 Compositions and methods for rna affinity purification Ceased WO2023031856A1 (en)

Priority Applications (5)

Application Number Priority Date Filing Date Title
AU2022336615A AU2022336615A1 (en) 2021-09-02 2022-09-01 Compositions and methods for rna affinity purification
EP22773306.0A EP4396363A1 (en) 2021-09-02 2022-09-01 Compositions and methods for rna affinity purification
JP2024513920A JP2024534216A (ja) 2021-09-02 2022-09-01 Rnaアフィニティー精製のための組成物および方法
CN202280059315.6A CN117916387A (zh) 2021-09-02 2022-09-01 用于rna亲和纯化的组合物和方法
US18/586,102 US20240327847A1 (en) 2021-09-02 2024-02-23 Compositions and methods for rna affinity

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US202163240027P 2021-09-02 2021-09-02
US63/240,027 2021-09-02
EP22315159 2022-07-20
EP22315159.8 2022-07-20

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US18/586,102 Continuation US20240327847A1 (en) 2021-09-02 2024-02-23 Compositions and methods for rna affinity

Publications (1)

Publication Number Publication Date
WO2023031856A1 true WO2023031856A1 (en) 2023-03-09

Family

ID=83362521

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2022/058234 Ceased WO2023031856A1 (en) 2021-09-02 2022-09-01 Compositions and methods for rna affinity purification

Country Status (5)

Country Link
US (1) US20240327847A1 (https=)
EP (1) EP4396363A1 (https=)
JP (1) JP2024534216A (https=)
AU (1) AU2022336615A1 (https=)
WO (1) WO2023031856A1 (https=)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023242425A1 (en) 2022-06-17 2023-12-21 Sanofi Compositions and methods for circular rna affinity purification
WO2025035120A1 (en) * 2023-08-10 2025-02-13 Board Of Regents, The University Of Texas System Aptamer-based purification of circular rnas

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2022099003A1 (en) 2020-11-06 2022-05-12 Sanofi Lipid nanoparticles for delivering mrna vaccines

Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4373071A (en) 1981-04-30 1983-02-08 City Of Hope Research Institute Solid-phase synthesis of polynucleotides
US4401796A (en) 1981-04-30 1983-08-30 City Of Hope Research Institute Solid-phase synthesis of polynucleotides
US4415732A (en) 1981-03-27 1983-11-15 University Patents, Inc. Phosphoramidite compounds and processes
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4500707A (en) 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US4668777A (en) 1981-03-27 1987-05-26 University Patents, Inc. Phosphoramidite nucleoside compounds
US4973679A (en) 1981-03-27 1990-11-27 University Patents, Inc. Process for oligonucleo tide synthesis using phosphormidite intermediates
US5047524A (en) 1988-12-21 1991-09-10 Applied Biosystems, Inc. Automated system for polynucleotide synthesis and purification
US5132418A (en) 1980-02-29 1992-07-21 University Patents, Inc. Process for preparing polynucleotides
US5153319A (en) 1986-03-31 1992-10-06 University Patents, Inc. Process for preparing polynucleotides
US5262530A (en) 1988-12-21 1993-11-16 Applied Biosystems, Inc. Automated system for polynucleotide synthesis and purification
US5700642A (en) 1995-05-22 1997-12-23 Sri International Oligonucleotide sizing using immobilized cleavable primers
US20050282190A1 (en) 2004-04-09 2005-12-22 Hua Shi Modular design and construction of nucleic acid molecules, aptamer-derived nucleic acid constructs, RNA scaffolds, their expression, and methods of use
US20070136827A1 (en) 2002-11-15 2007-06-14 Trustees Of Boston University Cis/trans riboregulators
WO2014186334A1 (en) * 2013-05-15 2014-11-20 Robert Kruse Intracellular translation of circular rna
WO2018161053A1 (en) * 2017-03-02 2018-09-07 MEIRAGTX, UK II Limited Regulation of gene expression by aptamer-modulated rnase p cleavage
WO2020139783A2 (en) 2018-12-27 2020-07-02 Lifeedit, Inc. Polypeptides useful for gene editing and methods of use
US20210214729A1 (en) * 2018-05-15 2021-07-15 Messenger Biopharma Substitution of the messenger rna cap with two rna sequences introduced at the 5-prime end thereof

Patent Citations (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5132418A (en) 1980-02-29 1992-07-21 University Patents, Inc. Process for preparing polynucleotides
US4458066A (en) 1980-02-29 1984-07-03 University Patents, Inc. Process for preparing polynucleotides
US4500707A (en) 1980-02-29 1985-02-19 University Patents, Inc. Nucleosides useful in the preparation of polynucleotides
US4415732A (en) 1981-03-27 1983-11-15 University Patents, Inc. Phosphoramidite compounds and processes
US4668777A (en) 1981-03-27 1987-05-26 University Patents, Inc. Phosphoramidite nucleoside compounds
US4973679A (en) 1981-03-27 1990-11-27 University Patents, Inc. Process for oligonucleo tide synthesis using phosphormidite intermediates
US4373071A (en) 1981-04-30 1983-02-08 City Of Hope Research Institute Solid-phase synthesis of polynucleotides
US4401796A (en) 1981-04-30 1983-08-30 City Of Hope Research Institute Solid-phase synthesis of polynucleotides
US5153319A (en) 1986-03-31 1992-10-06 University Patents, Inc. Process for preparing polynucleotides
US5262530A (en) 1988-12-21 1993-11-16 Applied Biosystems, Inc. Automated system for polynucleotide synthesis and purification
US5047524A (en) 1988-12-21 1991-09-10 Applied Biosystems, Inc. Automated system for polynucleotide synthesis and purification
US5700642A (en) 1995-05-22 1997-12-23 Sri International Oligonucleotide sizing using immobilized cleavable primers
US20070136827A1 (en) 2002-11-15 2007-06-14 Trustees Of Boston University Cis/trans riboregulators
US20050282190A1 (en) 2004-04-09 2005-12-22 Hua Shi Modular design and construction of nucleic acid molecules, aptamer-derived nucleic acid constructs, RNA scaffolds, their expression, and methods of use
WO2014186334A1 (en) * 2013-05-15 2014-11-20 Robert Kruse Intracellular translation of circular rna
WO2018161053A1 (en) * 2017-03-02 2018-09-07 MEIRAGTX, UK II Limited Regulation of gene expression by aptamer-modulated rnase p cleavage
US20210214729A1 (en) * 2018-05-15 2021-07-15 Messenger Biopharma Substitution of the messenger rna cap with two rna sequences introduced at the 5-prime end thereof
WO2020139783A2 (en) 2018-12-27 2020-07-02 Lifeedit, Inc. Polypeptides useful for gene editing and methods of use

Non-Patent Citations (38)

* Cited by examiner, † Cited by third party
Title
"Oxford Dictionary Of Biochemistry And Molecular Biology", 2000, OXFORD UNIVERSITY PRESS
ABEYDEERA ET AL., NUCLEIC ACIDS RES, vol. 44, no. 17, 2016, pages 8052 - 8064
BABENDURE ET AL., RNA, vol. 12, 2006, pages 851 - 861
BACHLER ET AL., RNA, vol. 5, no. 11, 1999, pages 1509 - 1516
BALA ET AL., RNA BIOLOGY, vol. 8, no. 1, 2011, pages 101 - 111
BATEY RT, CURR OPIN STRUCT BIOI, vol. 26, 2014, pages 1 - 8
BRUNETTE, METHODS, vol. 530, 2013, pages 101 - 14
DEBIAIS ET AL., NUCLEIC ACIDS RES, vol. 48, no. 7, 2020, pages 3400 - 3422
DELEBECQUE, NAT PROTOC, vol. 7, no. 10, 2012, pages 1797 - 1807
ELENKO ET AL., J AM CHEM SOC., vol. 131, no. 29, 2009, pages 9866 - 9867
FILONOV ET AL., CHEM BIOI., vol. 22, no. 5, 2015, pages 649 - 660
FILONOV ET AL., CHEM BIOL., vol. 22, no. 5, 2015, pages 649 - 660
FILONOV, CHEM BIOL, vol. 22, no. 5, 2015, pages 649 - 660
GEALL, SEMIN. IMMUNOL., vol. 25, no. 2, 2013, pages 152 - 159
H. IIOKA ET AL: "Efficient detection of RNA-protein interactions using tethered RNAs", NUCLEIC ACIDS RESEARCH, vol. 39, no. 8, 1 April 2011 (2011-04-01), pages e53 - e53, XP055166296, ISSN: 0305-1048, DOI: 10.1093/nar/gkq1316 *
KATHRIN LEPPEK ET AL: "An optimized streptavidin-binding RNA aptamer for purification of ribonucleoprotein complexes identifies novel ARE-binding proteins", NUCLEIC ACIDS RESEARCH, vol. 42, no. 2, 1 January 2014 (2014-01-01), GB, pages e13 - e13, XP055500642, ISSN: 0305-1048, DOI: 10.1093/nar/gkt956 *
KOTTER, NUC ACIDS RES, vol. 37, no. 18, 2009, pages e120
KOTTER, NUCLEIC ACIDS RES, vol. 37, no. 18, 2009, pages e120
LI, Y.ALTMAN, S., NUCLEIC ACIDS RES., vol. 30, no. 17, 2002, pages 3706 - 3711
LIALTMAN, NUC. ACIDS RES., vol. 30, no. 17, 2002, pages 3706 - 3711
LIOKA H ET AL., NUC. ACIDS RES., vol. 39, no. 8, 2011, pages e53
MYHRVOLDSILVER, NAT STRUCT MOL BIO, vol. 22, no. 1, 2015, pages 8 - 10
NISHIKAWA ET AL., HUM GENE THER, vol. 12, no. 8, 2001, pages 861 - 70
PAIGE ET AL., SCIENCE, vol. 333, no. 6042, 2011, pages 642 - 646
PARDI ET AL., NAT REV DRUG DISCOV, vol. 17, 2018, pages 261 - 279
PONCHON, NUCLEIC ACIDS RES, vol. 41, 2013, pages e150
PONCHONDARDEL, NAT. METHODS, vol. 4, no. 7, 2007, pages 571 - 576
PROSKE, APPL. MICROBIOL. BIOTECHNOI, vol. 69, 2005, pages 367 - 374
SAHIN ET AL., NAT. REV. DRUG DISCOV., vol. 13, 2014, pages 759 - 780
SHU ET AL., NUCLEIC ACIDS RES, vol. 42, 2014, pages e10
SRISAWAT, C.ENGELKE, D.R., RNA, vol. 7, no. 4, 2001, pages 632 - 641
SRISAWAT, NUCLEIC ACID RES, vol. 29, no. 2, 2001, pages e4
STEPANOV, METHODS MOL BIOI, vol. 2323, 2021, pages 75 - 97
STOLTENBURG ET AL., SCI REP, vol. 6, 2016, pages 33812
SZOSTAK, NATURE, vol. 364, no. 6437, 1993, pages 550 - 553
TUSUP MARINA ET AL: "Design of in vitroTranscribed mRNA Vectors for Research and Therapy", MEDLINE, US NATIONAL LIBRARY OF MEDICINE (NLM), BETHESDA, MD, US, 29 May 2019 (2019-05-29), XP002802284 *
WEISSMAN, EXPERT REV. VACCINES, vol. 14, 2015, pages 265 - 281
WURSTER, ACIDS RESEARCH, vol. 37, no. 18, 2009, pages 6214 - 6224

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2023242425A1 (en) 2022-06-17 2023-12-21 Sanofi Compositions and methods for circular rna affinity purification
WO2025035120A1 (en) * 2023-08-10 2025-02-13 Board Of Regents, The University Of Texas System Aptamer-based purification of circular rnas

Also Published As

Publication number Publication date
JP2024534216A (ja) 2024-09-18
US20240327847A1 (en) 2024-10-03
EP4396363A1 (en) 2024-07-10
AU2022336615A1 (en) 2024-04-11

Similar Documents

Publication Publication Date Title
US20240327847A1 (en) Compositions and methods for rna affinity
TW202305140A (zh) 多價rna組合物中rna種類之鑑定及比率測定方法
AU2026201251A1 (en) Compositions comprising circular polyribonucleotides and uses thereof
Aditham et al. Chemically modified mocRNAs for highly efficient protein expression in mammalian cells
US20250223592A1 (en) Compositions and methods for circular rna affinity purification
US20230104113A1 (en) Delivery of compositions comprising circular polyribonucleotides
JP2021500072A (ja) 血友病aに対する遺伝子編集用組成物及び方法
EP4219723A1 (en) Circular rna platforms, uses thereof, and their manufacturing processes from engineered dna
CN101939428A (zh) 涉及mRNA翻译增强因子的组合物和方法
CA3226213A1 (en) Rna adsorbed onto lipid nano-emulsion particles and its formulations.
JP7592581B2 (ja) ナノ粒子に自己組織化するポリペプチド
WO2024006988A2 (en) Engineered delivery vesicles and uses thereof
EP4638755A1 (en) Method of preparing self-circularized rna
CN117916387A (zh) 用于rna亲和纯化的组合物和方法
AU2022417517A1 (en) Compositions and methods for purifying polyribonucleotides
KR20240126857A (ko) 폴리리보뉴클레오티드를 정제하기 위한 조성물 및 방법
CN118510896A (zh) 用于在变性条件下富集环状rna的方法
Martins Biorecognition by amino acid-based affinity chromatography for RNA purification
WO2025247180A1 (zh) 用于制备含较少非目的序列的环状rna的载体和方法
WO2025097022A1 (en) Multicomponent systems for site-specific genome modifications
CN120513299A (zh) 用于纯化多核糖核苷酸的组合物和方法
EA051673B1 (ru) Рнк, адсорбированная на частицах наноэмульсии липидов, и ее композиции

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 22773306

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 202280059315.6

Country of ref document: CN

WWE Wipo information: entry into national phase

Ref document number: 2024513920

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: AU2022336615

Country of ref document: AU

Ref document number: 2022336615

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2022773306

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2022336615

Country of ref document: AU

Date of ref document: 20220901

Kind code of ref document: A

ENP Entry into the national phase

Ref document number: 2022773306

Country of ref document: EP

Effective date: 20240402